WorldWideScience

Sample records for oligonucleotide phosphate acceptor

  1. Thermolytic 4-methylthio-1-butyl group for phosphate/thiophosphate protection in solid-phase synthesis of DNA oligonucleotides.

    Science.gov (United States)

    Cieślak, Jacek; Grajkowski, Andrzej; Livengood, Victor; Beaucage, Serge L

    2004-04-02

    The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a-d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 degrees C in an aqueous buffer under neutral conditions or within 2 h at 55 degrees C in concentrated NH(4)OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating those of large-scale (>50 mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.

  2. The Preparation of New Phosphorus-Centered Functional Groups for Modified Oligonucleotides and Other Natural Phosphates

    Directory of Open Access Journals (Sweden)

    S. Piettre

    2005-09-01

    Full Text Available Efforts to develop synthetic methodologies allowing the preparation of α,α– difluorophosphonothioates, α,α–difluorophosphonodithioates, α,α–difluorophosphono- trithioates, and α,α–difluorophosphinates are reviewed in the light of applications in the field of modified oligonucleotides and cyclitol phosphates. Two successful approaches have been developed, based either on the addition of phosphorus-centered radicals onto gem–difluoroalkenes or on a process involving the addition of lithiodifluorophosphono- thioates 91 onto a ketone and the subsequent deoxygenation reaction of the adduct. The radical route successfully developed a practical route to α,α–difluoro–H–phosphinates which proved to be useful intermediates to a variety of phosphate isosters. The ionic route led to the first preparation of phosphonodifluoromethyl analogues of nucleoside– 3’–phosphates.

  3. Allyl group as a protecting group for internucleotide phosphate and thiophosphate linkages in oligonucleotide synthesis: facile oxidation and deprotection conditions.

    Science.gov (United States)

    Manoharan, M; Lu, Y; Casper, M D; Just, G

    2000-02-10

    [reaction: see text] The allyl group, which serves as a protecting group for an internucleotide bond for both phosphates and phosphorothioates, can be easily removed by good nucleophiles under weakly basic or neutral conditions. For a practical synthesis on solid support, camphorsulfonyloxaziridine was used as the oxidizing agent for synthesizing DNA, while the Beaucage reagent was used for preparing phosphorothioate oligomers. Both types of oligonucleotides were easily deprotected by concentrated ammonium hydroxide containing 2% mercaptoethanol.

  4. Changes in phosphorylation of adenosine phosphate and redox state of nicotinamide-adenine dinucleotide (phosphate) in Geobacter sulfurreducens in response to electron acceptor and anode potential variation.

    Science.gov (United States)

    Rose, Nicholas D; Regan, John M

    2015-12-01

    Geobacter sulfurreducens is one of the dominant bacterial species found in biofilms growing on anodes in bioelectrochemical systems. The intracellular concentrations of reduced and oxidized forms of nicotinamide-adenine dinucleotide (NADH and NAD(+), respectively) and nicotinamide-adenine dinucleotide phosphate (NADPH and NADP(+), respectively) as well as adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP) were measured in G. sulfurreducens using fumarate, Fe(III)-citrate, or anodes poised at different potentials (110, 10, -90, and -190 mV (vs. SHE)) as the electron acceptor. The ratios of CNADH/CNAD+ (0.088±0.022) and CNADPH/CNADP+ (0.268±0.098) were similar under all anode potentials tested and with Fe(III)-citrate (reduced extracellularly). Both ratios significantly increased with fumarate as the electron acceptor (0.331±0.094 for NAD and 1.96±0.37 for NADP). The adenylate energy charge (the fraction of phosphorylation in intracellular adenosine phosphates) was maintained near 0.47 under almost all conditions. Anode-growing biofilms demonstrated a significantly higher molar ratio of ATP/ADP relative to suspended cultures grown on fumarate or Fe(III)-citrate. These results provide evidence that the cellular location of reduction and not the redox potential of the electron acceptor controls the intracellular redox potential in G. sulfurreducens and that biofilm growth alters adenylate phosphorylation.

  5. Changes in phosphorylation of adenosine phosphate and redox state of nicotinamide-adenine dinucleotide (phosphate) in Geobacter sulfurreducens in response to electron acceptor and anode potential variation

    KAUST Repository

    Rose, Nicholas D.

    2015-12-01

    © 2015 Elsevier B.V. Geobacter sulfurreducens is one of the dominant bacterial species found in biofilms growing on anodes in bioelectrochemical systems. The intracellular concentrations of reduced and oxidized forms of nicotinamide-adenine dinucleotide (NADH and NAD+, respectively) and nicotinamide-adenine dinucleotide phosphate (NADPH and NADP+, respectively) as well as adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP) were measured in G. sulfurreducens using fumarate, Fe(III)-citrate, or anodes poised at different potentials (110, 10, -90, and -190mV (vs. SHE)) as the electron acceptor. The ratios of CNADH/CNAD+ (0.088±0.022) and CNADPH/CNADP+ (0.268±0.098) were similar under all anode potentials tested and with Fe(III)-citrate (reduced extracellularly). Both ratios significantly increased with fumarate as the electron acceptor (0.331±0.094 for NAD and 1.96±0.37 for NADP). The adenylate energy charge (the fraction of phosphorylation in intracellular adenosine phosphates) was maintained near 0.47 under almost all conditions. Anode-growing biofilms demonstrated a significantly higher molar ratio of ATP/ADP relative to suspended cultures grown on fumarate or Fe(III)-citrate. These results provide evidence that the cellular location of reduction and not the redox potential of the electron acceptor controls the intracellular redox potential in G. sulfurreducens and that biofilm growth alters adenylate phosphorylation.

  6. Chimeric RNA Oligonucleotides with Triazole and Phosphate Linkages: Synthesis and RNA Interference.

    Science.gov (United States)

    Fujino, Tomoko; Kogashi, Kanako; Okada, Koudai; Mattarella, Martin; Suzuki, Takeru; Yasumoto, Kenichi; Sogawa, Kazuhiro; Isobe, Hiroyuki

    2015-12-01

    Chimeric RNA oligonucleotides with an artificial triazole linker were synthesized using solution-phase click chemistry and solid-phase automated synthesis. Scalable synthesis methods for jointing units for the chimeric structure have been developed, and after click-coupling of the jointing units with triazole linkers, a series of chimeric oligonucleotides was prepared by utilizing the well-established phosphoramidite method for the elongation. The series of chimeric 21-mer oligonucleotides that possessed the triazole linker at different strands and positions allowed for a screening study of the RNA interference to clarify the preference of the triazole modifications in small-interfering RNA molecules.

  7. Chloroplast ribonucleoproteins (RNPs) as phosphate acceptors for casein kinase II: purification by ssDNA-cellulose column chromatography.

    Science.gov (United States)

    Kanekatsu, M; Ezumi, A; Nakamura, T; Ohtsuki, K

    1995-12-01

    Using ssDNA-cellulose column chromatography, a 34 kDa ribonucleoprotein (p34) has been purified from a 0.4 M KCl crude extract of spinach chloroplasts as an effective phosphate acceptor for casein kinase II (CK-II) in vitro. Monomeric and oligomeric CK-IIs were copurified with p34 by the column chromatography and the kinases were separated from p34 by means of Mono Q column chromatography. It was found that (i) the purified p34 (pI 4.9) was phosphorylated specifically by CK-II in vitro; and (ii) similar polypeptides, such as p35 (pI 4.7) and p39 (pI 4.9) in maize and p33 (pI 4.7) in liverwort, were detected as ssDNA-binding chloroplast proteins phosphorylated by CK-II in vitro. The findings suggest that (i) RNPs that function as phosphate acceptors for CK-II exist commonly in chloroplasts among plant cells; and (ii) the physiological activity of RNPs is regulated by their specific phosphorylation by CK-II in chloroplasts.

  8. [Synthesis of 11-[(2-pyridyl)amino]- and 11-[(9-anthracenylcarbonyl)amino]undecyl phosphate and investigation of their acceptor properties in the enzymic reaction catalyzed by galactosylphosphotransferases from Salmonella].

    Science.gov (United States)

    Danilov, L L; Balagurova, N M; Vinnikova, A N; Utkina, N S; Torgov, V I; Kalinchuk, N A; Druzhinina, T N; Veselovsky, V V

    2014-01-01

    11-[(2-Pyridyl)amino]undecyl phosphate and 11-[(9-anthracenylcarbonyl)amino]undecyl phosphate were chemically synthesized. The abiliy of these new fluorescent derivatives of undecyl phosphate to serve as acceptor substrate of galactosyl phosphate residue in the enzymic reaction catalyzed by galactosylphosphotransferase from Salmonella anatum or Salmonella newport membrane preparation was demonstrated.

  9. Synthesis and properties of carbohydrate-phosphate backbone-modified oligonucleotide analogues and nucleic acid mimetics

    Energy Technology Data Exchange (ETDEWEB)

    Abramova, Tatyana V; Silnikov, Vladimir N [Institute of Chemical Biology and Fundamental Medicine, Siberian Branch of the Russian Academy of Sciences (Russian Federation)

    2011-05-31

    Advances in the synthesis of oligo(deoxy)ribonucleotide analogues and nucleic acid mimetics made in the last decade are summarized. Attention is focused on new methods for the synthesis of derivatives with a modified ribose-phosphate backbone (phosphorothioate, boranophosphate, and nucleoside phosphonate derivatives) and derivatives devoid of the phosphate group. Among nucleic acid mimetics, conformationally restricted modified peptide nucleic acids, including those bearing a negative or positive charge, and morpholino oligomers are considered. Advantages and drawbacks of the main types of analogues as regards the complexity of the synthesis and the possibility of their application as antisense agents or reagents for hybridization analysis are compared.

  10. Synthesis and properties of carbohydrate-phosphate backbone-modified oligonucleotide analogues and nucleic acid mimetics

    Science.gov (United States)

    Abramova, Tatyana V.; Silnikov, Vladimir N.

    2011-05-01

    Advances in the synthesis of oligo(deoxy)ribonucleotide analogues and nucleic acid mimetics made in the last decade are summarized. Attention is focused on new methods for the synthesis of derivatives with a modified ribose-phosphate backbone (phosphorothioate, boranophosphate, and nucleoside phosphonate derivatives) and derivatives devoid of the phosphate group. Among nucleic acid mimetics, conformationally restricted modified peptide nucleic acids, including those bearing a negative or positive charge, and morpholino oligomers are considered. Advantages and drawbacks of the main types of analogues as regards the complexity of the synthesis and the possibility of their application as antisense agents or reagents for hybridization analysis are compared.

  11. Fluorescent mannosides serve as acceptor substrates for glycosyltransferase and sugar-1-phosphate transferase activities in Euglena gracilis membranes.

    Science.gov (United States)

    Ivanova, Irina M; Nepogodiev, Sergey A; Saalbach, Gerhard; O'Neill, Ellis C; Urbaniak, Michael D; Ferguson, Michael A J; Gurcha, Sudagar S; Besra, Gurdyal S; Field, Robert A

    2017-01-13

    Synthetic hexynyl α-D-mannopyranoside and its α-1,6-linked disaccharide counterpart were fluorescently labelled through CuAAC click chemistry with 3-azido-7-hydroxycoumarin. The resulting triazolyl-coumarin adducts, which were amenable to analysis by TLC, HPLC and mass spectrometry, proved to be acceptor substrates for α-1,6-ManT activities in mycobacterial membranes, as well as α- and β-GalT activities in trypanosomal membranes, benchmarking the potential of the fluorescent acceptor approach against earlier radiochemical assays. Following on to explore the glycobiology of the benign protozoan alga Euglena gracilis, α-1,3- and α-1,2-ManT activities were detected in membrane preparations, along with GlcT, Glc-P-T and GlcNAc-P-T activities. These studies serve to demonstrate the potential of readily accessible fluorescent glycans as substrates for exploring carbohydrate active enzymes.

  12. Effect of phosphate activating group on oligonucleotide formation on montmorillonite: the regioselective formation of 3',5'-linked oligoadenylates

    Science.gov (United States)

    Prabahar, K. J.; Cole, T. D.; Ferris, J. P.

    1994-01-01

    The effects of amine structure on the montmorillonite-catalyzed oligomerization of the 5'-phosphoramidates of adenosine are investigated. 4-Aminopyridine derivatives yielded oligoadenylates as long as dodecamers with a regioselectivity for 3',5'-phosphodiester bond formation averaging 88%. Linear and cyclic oligomers are obtained and no A5'ppA-containing products are detected. Oligomers as long as the hexanucleotide are obtained using 2-aminobenzimidazole as the activating group. A predominance of pA2'pA is detected in the dimer fraction along with cyclic 3',5'-trimer; no A5'ppA-containing oligomers were detected. Little or no oligomer formation was observed when morpholine, piperidine, pyrazole, 1,2,4-triazole, and 2-pyridone are used as phosphate-activating groups. The effects of the structure of the phosphate activating group on the oligomer structure and chain lengths are discussed.

  13. [Synthesis and acceptor properties of 11-[(9'-anthracenyl)methoxy]undecyl phosphate and P1-{11-[(9'-anthracenyl)methoxy]undecyl}-P2-(alpha-D-galactopyranosyl) diphosphate in the enzymic reactions catalyzed by galactosylphosphotransferase and mannosyltransferase from Salmonella newport].

    Science.gov (United States)

    Vinnikova, A N; Utkina, N S; Danilov, L L; Torgov, V I; Druzhinina, T N; Veselovskiĭ, V V

    2013-01-01

    Fluorescent 11-[(9'-anthracenyl)methoxy]undecyl phosphate and P1-{11-[(9'-anthracenyl)methoxy]undecyl}-P2-(alpha-D-galactopyranosyl) diphosphate were chemically synthesized for the first time. The ability of the first compound to serve as substrate-acceptor ofgalactosyl phosphate residue and the second compound of mannosyl residue in enzymic reactions catalyzed by galactosylphosphotransferase and mannosyltransferase from Salmonella newport membrane preparation was demonstrated.

  14. Chemical phosphorylation of deoxyribonucleosides and thermolytic DNA oligonucleotides.

    Science.gov (United States)

    Ausín, Cristina; Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L

    2006-10-01

    The phosphorylating reagent bis[S-(4,4'-dimethoxytrityl)-2-mercaptoethyl]-N,N-diisopropylphosphoramidite is prepared in three steps from commercial methyl thioglycolate and diisopropylphosphoramidous dichloride. The phosphorylating reagent has been used successfully in the solid-phase synthesis of deoxyribonucleoside 5'-/3'-phosphate or -thiophosphate monoesters and oligonucleotide 5'-phosphate/-thiophosphate monoesters. Bis[S-(4,4'-dimethoxytrityl)-2-mercaptoethyl]-N,N-diisopropylphosphoramidite has also been employed in the construction of a thermolytic dinucleotide prodrug model to evaluate the ability of the reagent to produce thermosentive oligonucleotide prodrugs under mild temperature conditions ( approximately 25 degrees C) for potential therapeutic applications.

  15. The delivery of therapeutic oligonucleotides.

    Science.gov (United States)

    Juliano, Rudolph L

    2016-08-19

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. © The Author 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Antisense oligonucleotides in cancer.

    Science.gov (United States)

    Castanotto, Daniela; Stein, Cy A

    2014-11-01

    Over the past several dozen years, regardless of the substantial effort directed toward developing rational oligonucleotide strategies to silence gene expression, antisense oligonucleotide-based cancer therapy has not been successful. This review focuses on the most likely reasons for this lack of success, and on the barriers that still need to be overcome to make a clinical cancer treatment reality out of the promise of antisense therapy. Considerable progress has been made in the design and delivery of nucleic acid fragments. Chemical modifications have considerably improved oligonucleotide absorption, distribution and metabolism while at the same time reducing toxicity. Nevertheless, the delivery and the cellular uptake of these molecules are still not adequate to provide the desired therapeutic outcome. Recent therapeutic interventional phase III trials of antisense oligodeoxyribonucleotides for a cancer indication will be discussed, in addition to those studies that markedly improve the scientific understanding of the properties of these molecules. We still do not have a marketed antisense oligonucleotide for a cancer indication. This is because critical aspects of the cellular, tumor pharmacology and delivery properties of these agents are still not well understood.

  17. The Use of Gel Electrophoresis to Study the Reactions of Activated Amino Acids with Oligonucleotides

    Science.gov (United States)

    Zieboll, Gerhard; Orgel, Leslie E.

    1994-01-01

    We have used gel electrophoresis to study the primary covalent addition of amino acids to oligonu-cleotides or their analogs and the subsequent addition of further molecules of the amino acids to generate peptides covalently linked to the oligonucleotides. We have surveyed the reactions of a variety of amino acids with the phosphoramidates derived from oligonucleotide 5 inches phosphates and ethylenediamine. We find that arginine and amino acids can interact with oligonucleotidesl through stacking interactions react most efficiently. D- and L-amino acids give indistinguishable families of products.

  18. Template switching between PNA and RNA oligonucleotides

    Science.gov (United States)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  19. The 1974 National Acceptors Survey.

    Science.gov (United States)

    Laing, J; Phillips, J; Zablan, Z; Llorente, R; Cabigon, J

    1976-01-01

    The 1974 National Acceptors Survey in the Philippines studied 4 methods of contraception: pill, IUD, rhythm, and condom. After 1 year, 72% of IUD acceptors had an IUD in place but only 29% of condom acceptors were still using condoms. Pills and rhythm were equally effective in terms of continuation and pregnancy rates. Continuation rates were higher among acceptors at postpartum clinics than at other clnics, higher among urban respondents than rural, and higher among older respondents. Those with more children had higher continuation rates, whereas those who wanted more children had lower continuation rates. Continuation rates also increased 1) as the duration of marriage lengthened; 2) with a later age at marriage; 3) with higher educational attainment; 4) among income-contributing respondents with higher incomes; 5) among previous contraceptive users; and 6) when physicians provided the services rather than nonmedical personnel, including medical screenings. Clinic attendance, husband's occupation, whether or not there was payment, and husband's support are other factors that seemed to affect continuation rates. Contraceptive effectiveness values were higher among pill and IUD acceptors. The percentage of reduction in fertility following acceptance of a method was 74% for IUDs and 27% for condoms. Fertility reduction was great among acceptors at postpartum clinics, acceptors in central visayas, and the highly educated. Future births averted ranged, for every 100 acceptors, 208 with the IUD, 32 with the condom, and 1 each pill and rhythm. Factors affecting method selection were administrative, beliefs, and preferences. The most common complaint about provision of clinical services was that the staff should spend more time in home visits (86%).

  20. Radiolabeled oligonucleotides for antisense imaging

    Science.gov (United States)

    Iyer, Arun K; He, Jiang

    2011-01-01

    Oligonucleotides radiolabeled with isotopes emitting γ-rays (for SPECT imaging) or positrons (for PET imaging) can be useful for targeting messenger RNA (mRNA) thereby serving as non-invasive imaging tools for detection of gene expression in vivo (antisense imaging). Radiolabeled oligonucleotides may also be used for monitoring their in vivo fate, thereby helping us better understand the barriers to its delivery for antisense targeting. These developments have led to a new area of molecular imaging and targeting, utilizing radiolabeled antisense oligonucleotides. However, the success of antisense imaging relies heavily on overcoming the barriers for its targeted delivery in vivo. Furthermore, the low ability of the radiolabeled antisense oligonucleotide to subsequently internalize into the cell and hybridize with its target mRNA poses additional challenges in realizing its potentials. This review covers the advances in the antisense imaging probe development for PET and SPECT, with an emphasis on radiolabeling strategies, stability, delivery and in vivo targeting. PMID:21822406

  1. Peptide-LNA oligonucleotide conjugates

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Hansen, Lykke Haastrup; Vester, Birte

    2013-01-01

    properties, peptides were introduced into oligonucleotides via a 2'-alkyne-2'-amino-LNA scaffold. Derivatives of methionine- and leucine-enkephalins were chosen as model peptides of mixed amino acid content, which were singly and doubly incorporated into LNA/DNA strands using highly efficient copper......Although peptide-oligonucleotide conjugates (POCs) are well-known for nucleic acids delivery and therapy, reports on internal attachment of peptides to oligonucleotides are limited in number. To develop a convenient route for preparation of internally labeled POCs with improved biomedical......(i)-catalyzed azide-alkyne cycloaddition (CuAAC) "click" chemistry. DNA/RNA target binding affinity and selectivity of the resulting POCs were improved in comparison to LNA/DNA mixmers and unmodified DNA controls. This clearly demonstrates that internal attachment of peptides to oligonucleotides can significantly...

  2. Conceptual "Heat-Driven" approach to the synthesis of DNA oligonucleotides on microarrays.

    Science.gov (United States)

    Grajkowski, A; Cieślak, J; Chmielewski, M K; Marchán, V; Phillips, L R; Wilk, A; Beaucage, S L

    2003-12-01

    The discovery of deoxyribonucleoside cyclic N-acylphosphoramidites, a novel class of phosphoramidite monomers for solid-phase oligonucleotide synthesis, has led to the development of a number of phosphate protecting groups that can be cleaved from DNA oligonucleotides under thermolytic neutral conditions. These include the 2-(N-formyl-N-methyl)aminoethyl, 4-oxopentyl, 3-(N-tert-butyl)carboxamido-1-propyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, and 4-methythiobutyl groups. When used for 5'-hydroxyl protection of nucleosides, the analogous 1-phenyl-2-[N-methyl-N-(2-pyridyl)]aminoethyloxycarbonyl group exhibited excellent thermolytic properties, which may permit an iterative "heat-driven" synthesis of DNA oligonucleotides on microarrays. In this regard, progress has been made toward the use of deoxyribonucleoside cyclic N-acylphosphoramidites in solid-phase oligonucleotide syntheses without nucleobase protection. Given that deoxyribonucleoside cyclic N-acylphosphoramidites produce oligonucleotides with heat-sensitive phosphate protecting groups, blocking the 5'-hydroxyl of these monomers with, for example, the thermolabile 1-phenyl-2-[N-methyl-N-(2-pyridyl)]aminoethyloxycarbonyl group may provide a convenient thermo-controlled method for the synthesis of oligonucleotides on microarrays.

  3. Construction and Evaluation of Desulfovibrio vulgaris Whole-Genome Oligonucleotide Microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Z. He; Q. He; L. Wu; M.E. Clark; J.D. Wall; Jizhong Zhou; Matthew W. Fields

    2004-03-17

    Desulfovibrio vulgaris Hildenborough has been the focus of biochemical and physiological studies in the laboratory, and the metabolic versatility of this organism has been largely recognized, particularly the reduction of sulfate, fumarate, iron, uranium and chromium. In addition, a Desulfovibrio sp. has been shown to utilize uranium as the sole electron acceptor. D. vulgaris is a d-Proteobacterium with a genome size of 3.6 Mb and 3584 ORFs. The whole-genome microarrays of D. vulgaris have been constructed using 70mer oligonucleotides. All ORFs in the genome were represented with 3471 (97.1%) unique probes and 103 (2.9%) non-specific probes that may have cross-hybridization with other ORFs. In preparation for use of the experimental microarrays, artificial probes and targets were designed to assess specificity and sensitivity and identify optimal hybridization conditions for oligonucleotide microarrays. The results indicated that for 50mer and 70mer oligonucleotide arrays, hybridization at 45 C to 50 C, washing at 37 C and a wash time of 2.5 to 5 minutes obtained specific and strong hybridization signals. In order to evaluate the performance of the experimental microarrays, growth conditions were selected that were expected to give significant hybridization differences for different sets of genes. The initial evaluations were performed using D. vulgaris cells grown at logarithmic and stationary phases. Transcriptional analysis of D. vulgaris cells sampled during logarithmic phase growth indicated that 25% of annotated ORFs were up-regulated and 3% of annotated ORFs were downregulated compared to stationary phase cells. The up-regulated genes included ORFs predicted to be involved with acyl chain biosynthesis, amino acid ABC transporter, translational initiation factors, and ribosomal proteins. In the stationary phase growth cells, the two most up-regulated ORFs (70-fold) were annotated as a carboxynorspermidine decarboxylase and a 2C-methyl-D-erythritol-2

  4. Electrochemical uranyl cation biosensor with DNA oligonucleotides as receptor layer.

    Science.gov (United States)

    Jarczewska, Marta; Ziółkowski, Robert; Górski, Łukasz; Malinowska, Elżbieta

    2014-04-01

    The present study aims at the further development of the uranyl oligonucleotide-based voltammetric biosensor, which takes advantage of strong interaction between UO2(2+) and phosphate DNA backbone. Herein we report the optimization of working parameters of previously elaborated electrochemical DNA biosensor. It is shown that the sensor sensitivity is highly dependent on the oligonucleotide probe length and the incubation time of sensor in a sample solution. Consequently, the highest sensitivity was obtained for 10-nucleotide sequence and 60 min incubation time. The lower detection limit towards uranyl cation for developed biosensor was 30 nM. The influence of mixed monolayers and the possibility of developing a non-calibration device were also investigated. The selectivity of the proposed biosensor was significantly improved via elimination of adenine nucleobases from the DNA probe. Moreover, the regeneration procedure was elaborated and tested to prolong the use of the same biosensor for 4 subsequent determinations of UO2(2+).

  5. Acceptors in ZnO

    Energy Technology Data Exchange (ETDEWEB)

    Mccluskey, Matthew D.; Corolewski, Caleb; Lv, Jinpeng; Tarun, Marianne C.; Teklemichael, Samuel T.; Walter, Eric D.; Norton, M. G.; Harrison, Kale W.; Ha, Su Y.

    2015-03-21

    Zinc oxide (ZnO) has potential for a range of applications in the area of optoelectronics. The quest for p-type ZnO has focused much attention on acceptors. In this paper, Cu, N, and Li acceptor impurities are discussed. Experimental evidence shows that these point defects have acceptor levels 3.2, 1.5, and 0.8 eV above the valence-band maximum, respectively. The levels are deep because the ZnO valence band is quite low compared to conventional, non-oxide semiconductors. Using MoO2 contacts, the electrical resistivity of ZnO:Li was measured and showed behavior consistent with bulk hole conduction for temperatures above 400 K. A photoluminescence peak in ZnO nanocrystals has been attributed to an acceptor, which may involve a zinc vacancy. High field (W-band) electron paramagnetic resonance measurements on the nanocrystals revealed an axial center with g = 2.0033 and g = 2.0075, along with an isotropic center at g = 2.0053.

  6. Acceptors in ZnO

    Energy Technology Data Exchange (ETDEWEB)

    McCluskey, Matthew D., E-mail: mattmcc@wsu.edu; Corolewski, Caleb D.; Lv, Jinpeng; Tarun, Marianne C.; Teklemichael, Samuel T. [Department of Physics and Astronomy, Washington State University, Pullman, Washington 99164-2814 (United States); Walter, Eric D. [Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States); Norton, M. Grant; Harrison, Kale W. [School of Mechanical and Materials Engineering, Washington State University, Pullman, Washington 99164-2920 (United States); Ha, Su [Voiland School of Chemical Engineering and Bioengineering, Washington State University, Pullman, Washington 99164-6515 (United States)

    2015-03-21

    Zinc oxide (ZnO) has potential for a range of applications in the area of optoelectronics. The quest for p-type ZnO has focused much attention on acceptors. In this paper, Cu, N, and Li acceptor impurities are discussed. Experimental evidence indicates these point defects have acceptor levels 3.2, 1.4, and 0.8 eV above the valence-band maximum, respectively. The levels are deep because the ZnO valence band is quite low compared to conventional, non-oxide semiconductors. Using MoO{sub 2} contacts, the electrical resistivity of ZnO:Li was measured and showed behavior consistent with bulk hole conduction for temperatures above 400 K. A photoluminescence peak in ZnO nanocrystals is attributed to an acceptor, which may involve a Zn vacancy. High field (W-band) electron paramagnetic resonance measurements on the nanocrystals revealed an axial center with g{sub ⊥} = 2.0015 and g{sub //} = 2.0056, along with an isotropic center at g = 2.0035.

  7. Molecular Mechanisms of Antisense Oligonucleotides.

    Science.gov (United States)

    Crooke, Stanley T

    2017-04-01

    In 1987, when I became interested in the notion of antisense technology, I returned to my roots in RNA biochemistry and began work to understand how oligonucleotides behave in biological systems. Since 1989, my research has focused primarily on this topic, although I have been involved in most areas of research in antisense technology. I believe that the art of excellent science is to frame large important questions that are perhaps not immediately answerable with existing knowledge and methods, and then conceive a long-term (multiyear) research strategy that begins by answering the most pressing answerable questions on the path to the long-term goals. Then, a step-by-step research pathway that will address the strategic questions posed must be implemented, adjusting the plan as new things are learned. This is the approach we have taken at Ionis. Obviously, to create antisense technology, we have had to address a wide array of strategic questions, for example, the medicinal chemistry of oligonucleotides, manufacturing and analytical methods, pharmacokinetics and toxicology, as well as questions about the molecular pharmacology of antisense oligonucleotides (ASOs). Each of these endeavors has consumed nearly three decades of scientific effort, is still very much a work-in-progress, and has resulted in hundreds of publications. As a recipient of the Lifetime Achievement Award 2016 granted by the Oligonucleotide Therapeutic Society, in this note, my goal is to summarize the contributions of my group to the efforts to understand the molecular mechanisms of ASOs.

  8. Thermodynamics of Oligonucleotide Duplex Melting

    Science.gov (United States)

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-01-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  9. Sodium Phosphate

    Science.gov (United States)

    Sodium phosphate is used in adults 18 years of age or older to empty the colon (large intestine, bowel) ... view of the walls of the colon. Sodium phosphate is in a class of medications called saline ...

  10. Phosphate salts

    Science.gov (United States)

    ... levels that are too high, and for preventing kidney stones. They are also taken for treating osteomalacia (often ... But intravenous phosphate salts should not be used. Kidney stones (nephrolithiasis). Taking potassium phosphate by mouth might help ...

  11. Binding of Dumbbell Oligonucleotides to MoMuLV Reverse Transcriptase: Inhibitory Properties of RNase H Activity

    Directory of Open Access Journals (Sweden)

    Ajay Kumar

    2010-01-01

    Full Text Available Dumbbell oligonucleotides with loops of various chemistry were synthesized. Incubation of dumbbell oligonucleotides containing phosphorothioate bonds or trimethylene phosphate linkages in loops with S1 nuclease did not result in significant cleavage under conditions which led to the degradation of dumbbell oligonucleotide containing phophodiester bonds in the loops. The binding of reverse transcriptase of Moloney Murine Leukemia Virus (MoMuLV was evaluated with all the five oligonucleotides. The protein binds to all the dumbbell oligonucleotides with similar affinity. The dissociation constants evaluated using PAGE band mobility shift assays were of the order of 10-7. The inhibitory properties of the retroviral RNase H activity was evaluated using 3H –UTP-labeled RNA:RNA-DNA hybrid. It was found that the best dumbbell oligonucleotide, inhibitor contained phosphorothioate residues in both the loops. Our value studies demonstrated that this particularly designed oligonucleotide displays an IC50 of 18 nM in its inhibition on the reverse transcriptase RNase H activity, a magnitude lower than that of first nucleotide reverse transcriptase of HIV-1, tenofovir, introduced by Gilead Science in the market.

  12. Anaerobic electron acceptor chemotaxis in Shewanella putrefaciens

    Science.gov (United States)

    Nealson, K. H.; Moser, D. P.; Saffarini, D. A.

    1995-01-01

    Shewanella putrefaciens MR-1 can grow either aerobically or anaerobically at the expense of many different electron acceptors and is often found in abundance at redox interfaces in nature. Such redox interfaces are often characterized by very strong gradients of electron acceptors resulting from rapid microbial metabolism. The coincidence of S. putrefaciens abundance with environmental gradients prompted an examination of the ability of MR-1 to sense and respond to electron acceptor gradients in the laboratory. In these experiments, taxis to the majority of the electron acceptors that S. putrefaciens utilizes for anaerobic growth was seen. All anaerobic electron acceptor taxis was eliminated by the presence of oxygen, nitrate, nitrite, elemental sulfur, or dimethyl sulfoxide, even though taxis to the latter was very weak and nitrate and nitrite respiration was normal in the presence of dimethyl sulfoxide. Studies with respiratory mutants of MR-1 revealed that several electron acceptors that could not be used for anaerobic growth nevertheless elicited normal anaerobic taxis. Mutant M56, which was unable to respire nitrite, showed normal taxis to nitrite, as well as the inhibition of taxis to other electron acceptors by nitrite. These results indicate that electron acceptor taxis in S. putrefaciens does not conform to the paradigm established for Escherichia coli and several other bacteria. Carbon chemo-taxis was also unusual in this organism: of all carbon compounds tested, the only positive response observed was to formate under anaerobic conditions.

  13. An efficient reagent for the phosphorylation of deoxyribonucleosides, DNA oligonucleotides, and their thermolytic analogues.

    Science.gov (United States)

    Ausín, Cristina; Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L

    2005-09-15

    [reaction: see text] The phosphoramidite 11 was prepared in three steps from methyl 2-mercaptoacetate and demonstrated efficiency in the synthesis of conventional 5'-/3'-phosphate/thiophosphate monoester derivatives of 2'-deoxyribonucleosides and DNA oligonucleotides. Moreover, the use of 11 has enabled the preparation of the dinucleoside phosphorothioate analogue 26 in high yields (>95%) with minimal cleavage (<2%) of the thermolytic thiophosphate protecting group.

  14. Adaptive resolution simulation of oligonucleotides

    Science.gov (United States)

    Netz, Paulo A.; Potestio, Raffaello; Kremer, Kurt

    2016-12-01

    Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

  15. The Chemistry and Biology of Oligonucleotide Conjugates

    Science.gov (United States)

    Juliano, R.L.; Ming, Xin; Nakagawa, Osamu

    2012-01-01

    CONSPECTUS Short DNA or RNA oligonucleotides have tremendous potential as therapeutic agents. Because of their ability to engage in Watson-Crick base pairing they can interact with messenger mRNA or pre-mRNA targets with high selectivity and thus offer the possibility of precise manipulation of gene expression. This possibility has engendered extensive efforts to develop oligonucleotides as drugs, with many candidates already in clinical trials. However, a major impediment to the maturation of oligonucleotide-based therapeutics is the fact that these relatively large and usually highly charged molecules have great difficulty crossing cellular membranes and thus in penetrating to their sites of action in the cytosol or nucleus. In this Account we first summarize some basic aspects of the biology of antisense and siRNA oligonucleotides and then discuss chemical conjugation as an approach to improving the intracellular delivery and therapeutic potential of these agents. Our emphasis will be on the pharmacological ramifications of oligonucleotide conjugates rather than the details of conjugation chemistry. One important approach has been conjugation with ligands designed to bind to particular receptors and thus provide specificity to the interaction of cells with oligonucleotides. Another approach has been to couple antisense or siRNA with agents such as cell penetrating peptides that are designed to provoke escape of the conjugate from intracellular vesicular compartments. Both of these approaches have enjoyed some success. However, there remains much to be learned before oligonucleotide conjugates can find an important place in human therapeutics. PMID:22353142

  16. Injection site reactions after subcutaneous oligonucleotide therapy

    NARCIS (Netherlands)

    van Meer, L. (Leonie); M. Moerland (Matthijs); Gallagher, J. (Jolie); M.B.A. van Doorn (Martijn); E.P. Prens (Errol); A.F. Cohen; Rissmann, R. (Robert); J. Burggraaf (Jacobus)

    2016-01-01

    textabstractOligonucleotides (ONs) are short fragments of nucleic acids, currently being investigated as therapeutic agents. When administered subcutaneously (sc), ONs cause a specific local reaction originating around the injection site, such as erythema, itching, discomfort and pain, including

  17. A novel route for immobilization of oligonucleotides onto modified silica nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Rao, Kota Sreenivasa [Institute of Scientific and Industrial Research, Sanken, Osaka University, Osaka (Japan)]. E-mail: kotas_1999@yahoo.com; Rani, Sikhakolli Usha [Institute of Scientific and Industrial Research, Sanken, Osaka University, Osaka (Japan); Charyulu, Devarayapalli Kamakshaiah [Institute of Advanced Energy, Kyoto University, Gokasho, Uji (Japan); Kumar, Kamisetty Nagendra [Institute of Advanced Energy, Kyoto University, Gokasho, Uji (Japan); Lee, Bong-Kuk [Institute of Scientific and Industrial Research, Sanken, Osaka University, Osaka (Japan); Lee, Hea-Yeon [Institute of Scientific and Industrial Research, Sanken, Osaka University, Osaka (Japan); Kawai, Tomoji [Institute of Scientific and Industrial Research, Sanken, Osaka University, Osaka (Japan)

    2006-08-25

    A novel approach for immobilization of probe oligonucleotides that uses zirconium phosphate modified silica nanoparticles is proposed. The surface modification of nanoparticles was carried out in two stages. Initially binding of Zr{sup 4+} to the surface of silica nanoparticles and later treated with phosphoric acid for terminal phosphate groups. Oligonucleotide probes modified with amine group at 5'-end were strongly binds to the phosphate terminated silica nanoparticles with imidazole in presence of 0.1 mol L{sup -1} EDC [N-ethyl-N'-(3-dimethylaminopropyl) carbodiimide], as phosphate groups are more reactive towards amine group. Various studies, i.e., synthesis of silica nanoparticles, their surface modification, probe immobilization, measurement of hybridization and effect of bovine serum albumin (BSA) were carried out during optimization of reaction conditions. The significant reduction in the background signal was observed by treating the probe modified silica nanoparticles with bovine serum albumin prior to hybridization. The probe modified silica nanoparticles were retained their properties and the hybridization was induced by exposure of single-stranded DNA (ssDNA) containing silica nanoparticles to the complementary DNA in solution. The decrease in the fluorescence signal for one mismatch and three mismatch was observed upon hybridization of probe with target DNAs, while there was no response for the random target ssDNA under the same experimental conditions. The intensity of fluorescence signal was linear to the concentration of target DNA ranging from 3.9 x 10{sup -9} to 3.0 x 10{sup -6} mol L{sup -1}. A detection limit of 1.22 x 10{sup -9} mol L{sup -1} of oligonucleotides can be estimated. The proposed hybridization assay is simple and possesses good analytical characteristics and it can provide an effective and efficient route in the development of DNA biosensors and biochips.

  18. An oligonucleotide hybridization approach to DNA sequencing.

    Science.gov (United States)

    Khrapko, K R; Lysov YuP; Khorlyn, A A; Shick, V V; Florentiev, V L; Mirzabekov, A D

    1989-10-09

    We have proposed a DNA sequencing method based on hybridization of a DNA fragment to be sequenced with the complete set of fixed-length oligonucleotides (e.g., 4(8) = 65,536 possible 8-mers) immobilized individually as dots of a 2-D matrix [(1989) Dokl. Akad. Nauk SSSR 303, 1508-1511]. It was shown that the list of hybridizing octanucleotides is sufficient for the computer-assisted reconstruction of the structures for 80% of random-sequence fragments up to 200 bases long, based on the analysis of the octanucleotide overlapping. Here a refinement of the method and some experimental data are presented. We have performed hybridizations with oligonucleotides immobilized on a glass plate, and obtained their dissociation curves down to heptanucleotides. Other approaches, e.g., an additional hybridization of short oligonucleotides which continuously extend duplexes formed between the fragment and immobilized oligonucleotides, should considerably increase either the probability of unambiguous reconstruction, or the length of reconstructed sequences, or decrease the size of immobilized oligonucleotides.

  19. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field.

    Science.gov (United States)

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah

    2016-01-01

    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.

  20. Antisense Oligonucleotide Mediated Splice Correction of a Deep Intronic Mutation in OPA1

    Directory of Open Access Journals (Sweden)

    Tobias Bonifert

    2016-01-01

    Full Text Available Inherited optic neuropathies (ION present an important cause of blindness in the European working-age population. Recently we reported the discovery of four independent families with deep intronic mutations in the main inherited optic neuropathies gene OPA1. These deep intronic mutations cause mis-splicing of the OPA1 pre-messenger-RNA transcripts by creating cryptic acceptor splice sites. As a rescue strategy we sought to prevent mis-splicing of the mutant pre-messenger-RNA by applying 2′O-methyl-antisense oligonucleotides (AONs with a full-length phosphorothioate backbone that target the cryptic acceptor splice sites and the predicted novel branch point created by the deep intronic mutations, respectively. Transfection of patient-derived primary fibroblasts with these AONs induced correct splicing of the mutant pre-messenger-RNA in a time and concentration dependent mode of action, as detected by pyrosequencing of informative heterozygous variants. The treatment showed strong rescue effects (≃55% using the cryptic acceptor splice sites targeting AON and moderate rescue (≃16% using the branch point targeting AON. The highest efficacy of Splice correction could be observed 4 days after treatment however, significant effects were still seen 14 days post-transfection. Western blot analysis revealed increased amounts of OPA1 protein with maximum amounts at ≃3 days post-treatment. In summary, we provide the first mutation-specific in vitro rescue strategy for OPA1 deficiency using synthetic AONs.

  1. Intrinsically Labeled Fluorescent Oligonucleotide Probes on Quantum Dots for Transduction of Nucleic Acid Hybridization.

    Science.gov (United States)

    Shahmuradyan, Anna; Krull, Ulrich J

    2016-03-15

    Quantum dots (QDs) have been widely used in chemical and biosensing due to their unique photoelectrical properties and are well suited as donors in fluorescence resonance energy transfer (FRET). Selective hybridization interactions of oligonucleotides on QDs have been determined by FRET. Typically, the QD-FRET constructs have made use of labeled targets or have implemented labeled sandwich format assays to introduce dyes in proximity to the QDs for the FRET process. The intention of this new work is to explore a method to incorporate the acceptor dye into the probe molecule. Thiazole orange (TO) derivatives are fluorescent intercalating dyes that have been used for detection of double-stranded nucleic acids. One such dye system has been reported in which single-stranded oligonucleotide probes were doubly labeled with adjacent thiazole orange derivatives. In the absence of the fully complementary (FC) oligonucleotide target, the dyes form an H-aggregate, which results in quenching of fluorescence emission due to excitonic interactions between the dyes. The hybridization of the FC target to the probe provides for dissociation of the aggregate as the dyes intercalate into the double stranded duplex, resulting in increased fluorescence. This work reports investigation of the dependence of the ratiometric signal on the type of linkage used to conjugate the dyes to the probe, the location of the dye along the length of the probe, and the distance between adjacent dye molecules. The limit of detection for 34mer and 90mer targets was found to be identical and was 10 nM (2 pmol), similar to analogous QD-FRET using labeled oligonucleotide target. The detection system could discriminate a one base pair mismatch (1BPM) target and was functional without substantial compromise of the signal in 75% serum. The 1BPM was found to reduce background signal, indicating that the structure of the mismatch affected the environment of the intercalating dyes.

  2. The 4-methylthio-1-butyl group for phosphate/thiophosphate protection in oligodeoxyribonucleotide synthesis.

    Science.gov (United States)

    Cieślak, Jacek; Grajkowski, Andrzej; Livengood, Victor; Beaucage, Serge L

    2004-12-01

    The detailed preparation of deoxyribonucleoside phosphoramidites functionalized with a 4-methylthio-1-butyl group for P(III) protection is described, along with the incorporation of these phosphoramidites into DNA oligonucleotides via solid-phase techniques. The versatility of the thermolabile 4-methylthio-1-butyl phosphate/thiophosphate-protecting group is exemplified through its facile removal from oligonucleotides under neutral conditions or under standard basic conditions. The sulfonium salt that is produced during the thermolytic deprotection of oligonucleotides did not alter DNA nucleobases or desulfurize phosphorothioate diesters to a significant extent.

  3. Syntheses of donor-acceptor-functionalized dihydroazulenes

    DEFF Research Database (Denmark)

    Broman, Søren Lindbæk; Jevric, Martyn; Bond, Andrew

    2014-01-01

    The dihydroazulene (DHA)/vinylheptafulvene (VHF) photo/thermoswitch has been of interest for use in molecular electronics and advanced materials. The switching between the two isomers has previously been found to depend strongly on the presence of donor and acceptor groups. The fine-tuning of opt...

  4. Double Acceptor Interaction in Semimagnetic Quantum Dot

    Directory of Open Access Journals (Sweden)

    A. Merwyn Jasper D. Reuben

    2011-01-01

    Full Text Available The effect of geometry of the semimagnetic Quantum Dot on the Interaction energy of a double acceptor is computed in the effective mass approximation using the variational principle. A peak is observed at the lower dot sizes as a magnetic field is increased which is attributed to the reduction in confinement.

  5. Electron Donor Acceptor Interactions. Final Progress Report

    Energy Technology Data Exchange (ETDEWEB)

    None

    2002-08-16

    The Gordon Research Conference (GRC) on Electron Donor Acceptor Interactions was held at Salve Regina University, Newport, Rhode Island, 8/11-16/02. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  6. Positive role of nitrite as electron acceptor on anoxic denitrifying phosphorus removal process

    Institute of Scientific and Technical Information of China (English)

    HUANG RongXin; LI Dong; LI XiangKun; BAO LinLin; JIANG AnXi; ZHANG Jie

    2007-01-01

    Literatures revealed that the electron acceptor-nitrite could be inhibitory or toxic in the denitrifying phosphorus removal process.Batch test experiments were used to investigate the inhibitory effect during the anoxic condition.The inoculated activated sludge was taken from a continuous double- sludge denitrifying phosphorus and nitrogen removal system.Nitrite was added at the anoxic stage.One time injection and sequencing batch injection were carried on in the denitrifying dephosphorus procedure.The results indicated that the nitrite concentration higher than 30 mg/L would inhibit the anoxic phosphate uptake severely, and the threshold inhibitory concentration was dependent on the characteristics of the activated sludge and the operating conditions; instead, lower than the inhibitory concentration would not be detrimental to anoxic phosphorus uptake, and it could act as good electron acceptor for the anoxic phosphate accumulated.Positive effects performed during the denitrifying biological dephosphorus all the time.The utility of nitrite as good electron acceptor would provide a new feasible way in the denitrifying phosphorus process.

  7. DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY - HIGH RESOLUTION MASS SPECTROMETRY.

    Science.gov (United States)

    Nikcevic, Irena; Wyrzykiewicz, Tadeusz K; Limbach, Patrick A

    2011-07-01

    An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described.Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3'-terminal phosphate monoester and 3'-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N(3) (2-cyanoethyl) adducts of the full

  8. Methidium intercalator inserted into synthetic oligonucleotides.

    Energy Technology Data Exchange (ETDEWEB)

    Timofeev, E. N.; Smirnov, I. P.; Haff, L. A.; Tishchenko, E. I.; Mirzabekov, A. D.; Florentiev, V. L.; Center for Mechanistic Biology and Biotechnology; Engelhardt Inst. of Molecular Biology; PerSeptive BioSystems Inc.

    1996-01-01

    A new methidium intercalator phosphoramidite has been synthesized. Methidium incorporation into an oligonucleotide during the synthesis was confirmed by UV and MALDI TOF MS data. UV melting experiments showed enhanced stability of a duplex, containing internal methidium. Methidium phosphoramidite has been synthesized and used for insertion of intercalator into the deoxyoligonucleotides.

  9. Chemosensitization by antisense oligonucleotides targeting MDM2.

    Science.gov (United States)

    Bianco, Roberto; Ciardiello, Fortunato; Tortora, Giampaolo

    2005-02-01

    The MDM2 oncogene is overexpressed in many human cancers, including sarcomas, certain hematologic malignancies, and breast, colon and prostate cancers. The p53-MDM2 interaction pathway has been suggested as a novel target for cancer therapy. To that end, several strategies have been explored, including the use of small polypeptides targeted to the MDM2-p53 binding domain, anti-MDM2 antisense oligonucleotides, and natural agents. Different generations of anti-human-MDM2 oligonucleotides have been tested in in vitro and in vivo human cancer models, revealing specific inhibition of MDM2 expression and significant antitumor activity. Use of antisense oligos potentiated the effects of growth inhibition, p53 activation and p21 induction by several chemotherapeutic agents. Increased therapeutic effectiveness of chemotherapeutic drugs in human cancer cell lines carrying p53 mutations or deletions have shown the ability of MDM2 inhibitors to act as chemosensitizers in various types of tumors through both p53-dependent and p53-independent mechanisms. Inhibiting MDM2 appears to also have a role in radiation therapy for human cancer, regardless of p53 status, providing a rationale for the development of a new class of radiosensitizers. Moreover, MDM2 antisense oligonucleotides potentiate the effect of epidermal growth factor receptor (EGFR) inhibitors by affecting in vitro and in vivo proliferation, apoptosis and protein expression in hormone-refractory and hormone-dependent human prostate cancer cells. These data support the development, among other MDM2 inhibitors, of anti-MDM2 antisense oligonucleotides as a novel class of anticancer agents, and suggest a potentially relevant role for the oligonucleotides when integrated with conventional treatments and/or other signaling inhibitors in novel therapeutic strategies.

  10. Alteration of the Donor/Acceptor Spectrum of the (S-Amine Transaminase from Vibrio fluvialis

    Directory of Open Access Journals (Sweden)

    Maika Genz

    2015-11-01

    Full Text Available To alter the amine donor/acceptor spectrum of an (S-selective amine transaminase (ATA, a library based on the Vibrio fluvialis ATA targeting four residues close to the active site (L56, W57, R415 and L417 was created. A 3DM-derived alignment comprising fold class I pyridoxal-5′-phosphate (PLP-dependent enzymes allowed identification of positions, which were assumed to determine substrate specificity. These positions were targeted for mutagenesis with a focused alphabet of hydrophobic amino acids to convert an amine:α-keto acid transferase into an amine:aldehyde transferase. Screening of 1200 variants revealed three hits, which showed a shifted amine donor/acceptor spectrum towards aliphatic aldehydes (mainly pentanal, as well as an altered pH profile. Interestingly, all three hits, although found independently, contained the same mutation R415L and additional W57F and L417V substitutions.

  11. Design Considerations for Array CGH to OligonucleotideArrays

    Energy Technology Data Exchange (ETDEWEB)

    Baldocchi, R.A.; Glynne, R.J.; Chin, K.; Kowbel, D.; Collins, C.; Mack, D.H.; Gray, J.W.

    2005-03-04

    Background: Representational oligonucleotide microarray analysis has been developed for detection of single nucleotide polymorphisms and/or for genome copy number changes. In this process, the intensity of hybridization to oligonucleotides arrays is increased by hybridizing a polymerase chain reaction (PCR)-amplified representation of reduced genomic complexity. However, hybridization to some oligonucleotides is not sufficiently high to allow precise analysis of that portion of the genome. Methods: In an effort to identify aspects of oligonucleotide hybridization affecting signal intensity, we explored the importance of the PCR product strand to which each oligonucleotide is homologous and the sequence of the array oligonucleotides. We accomplished this by hybridizing multiple PCR-amplified products to oligonucleotide arrays carrying two sense and two antisense 50-mer oligonucleotides for each PCR amplicon. Results: In some cases, hybridization intensity depended more strongly on the PCR amplicon strand (i.e., sense vs. antisense) than on the detection oligonucleotide sequence. In other cases, the oligonucleotide sequence seemed to dominate. Conclusion: Oligonucleotide arrays for analysis of DNA copy number or for single nucleotide polymorphism content should be designed to carry probes to sense and antisense strands of each PCR amplicon to ensure sufficient hybridization and signal intensity.

  12. Mechanism of antisense oligonucleotide interaction with natural RNAs.

    Science.gov (United States)

    Serikov, R; Petyuk, V; Vorobijev, Y; Koval, V; Fedorova, O; Vlassov, V; Zenkova, M

    2011-08-01

    Oligonucleotides find several numbers of applications: as diagnostic probes, RT and PCR primers and antisense agents due to their ability of forming specific interactions with complementary nucleotide sequences within nucleic acids. These interactions are strongly affected by accessibility of the target sequence in the RNA structure. In the present work the mechanism of invasion of RNA structure by oligonucleotide was investigated using a model system: yeast tRNA(Phe) and oligonucleotides complementary to the 3'-part of this molecule. Kinetics of interaction of oligonucleotides with in vitro transcript of yeast tRNAPhe was studied using stopped-flow technique with fluorescence quenching detection, 5'-DABCYL labeled oligonucleotide was hybridized with 3'-fluorescein labeled tRNA(Phe). The results evidence for a four-step invasion process of the oligonucleotide-RNA complex formation. The process is initiated by formation of transition complexes with nucleotides in the T-loop and ACCA sequence. This complex formation is followed by RNA unfolding and formation of an extended heteroduplex with the oligonucleotide via strand displacement process. Computer modeling of oligonucleotide-tRNA(Phe) interaction revealed potential factors that could favor transition complexes formation and confirmed the proposed mechanism, showing the oligonucleotide to be a molecular "wedge". Our data evidence that oligonucleotide invasion into structured RNA is initiated by loop-single strand interactions, similar to the initial step of the antisense RNA-RNA interactions. The obtained results can be used for choosing efficient oligonucleotide probes.

  13. Antisense oligonucleotides in therapy for neurodegenerative disorders.

    Science.gov (United States)

    Evers, Melvin M; Toonen, Lodewijk J A; van Roon-Mom, Willeke M C

    2015-06-29

    Antisense oligonucleotides are synthetic single stranded strings of nucleic acids that bind to RNA and thereby alter or reduce expression of the target RNA. They can not only reduce expression of mutant proteins by breakdown of the targeted transcript, but also restore protein expression or modify proteins through interference with pre-mRNA splicing. There has been a recent revival of interest in the use of antisense oligonucleotides to treat several neurodegenerative disorders using different approaches to prevent disease onset or halt disease progression and the first clinical trials for spinal muscular atrophy and amyotrophic lateral sclerosis showing promising results. For these trials, intrathecal delivery is being used but direct infusion into the brain ventricles and several methods of passing the blood brain barrier after peripheral administration are also under investigation. Copyright © 2015. Published by Elsevier B.V.

  14. Electrochemical study of hepta–oligonucleotides

    Directory of Open Access Journals (Sweden)

    Zdenka Balcarova

    2010-12-01

    Full Text Available The study deals with the description and characterization of twohepta–oligonucleotides (DNA and RNA forming special structures.We studied their electrochemical behaviour by means of cyclicvoltammetry (CV and elimination voltammetry with linear scan(EVLS in combination with adsorptive stripping (AdS technique.Differences in electrochemical behaviour of hepta–deoxyribonucleotide and its RNA analog were discussed with regardto their different structures in solutions and their melting points.

  15. Abundant oligonucleotides common to most bacteria.

    Directory of Open Access Journals (Sweden)

    Colin F Davenport

    Full Text Available BACKGROUND: Bacteria show a bias in their genomic oligonucleotide composition far beyond that dictated by G+C content. Patterns of over- and underrepresented oligonucleotides carry a phylogenetic signal and are thus diagnostic for individual species. Patterns of short oligomers have been investigated by multiple groups in large numbers of bacteria genomes. However, global distributions of the most highly overrepresented mid-sized oligomers have not been assessed across all prokaryotes to date. We surveyed overrepresented mid-length oligomers across all prokaryotes and normalised for base composition and embedded oligomers using zero and second order Markov models. PRINCIPAL FINDINGS: Here we report a presumably ancient set of oligomers conserved and overrepresented in nearly all branches of prokaryotic life, including Archaea. These oligomers are either adenine rich homopurines with one to three guanine nucleosides, or homopyridimines with one to four cytosine nucleosides. They do not show a consistent preference for coding or non-coding regions or aggregate in any coding frame, implying a role in DNA structure and as polypeptide binding sites. Structural parameters indicate these oligonucleotides to be an extreme and rigid form of B-DNA prone to forming triple stranded helices under common physiological conditions. Moreover, the narrow minor grooves of these structures are recognised by DNA binding and nucleoid associated proteins such as HU. CONCLUSION: Homopurine and homopyrimidine oligomers exhibit distinct and unusual structural features and are present at high copy number in nearly all prokaryotic lineages. This fact suggests a non-neutral role of these oligonucleotides for bacterial genome organization that has been maintained throughout evolution.

  16. Synthesis and hybridization properties of inverse oligonucleotides.

    OpenAIRE

    Marangoni, M.; Van Aerschot, Arthur; Augustijns, Patrick; Rozenski, Jef; Herdewijn , Piet

    1997-01-01

    The synthesis of adenine and thymine cyclopentylethyl nucleosides is presented. This novel constrained monomeric building block is very difficult to incorporate into oligonucleotides. It was introduced in 13mer oligodeoxynucleotide sequences at a single position using H-phosphonate chemistry. Phosphoramidite chemistry completely failed in this particular case. The H-phosphonate building blocks were obtained starting from the corresponding phosphoramidites. Stability of duplexes with RNA and D...

  17. Conjugated donor-acceptor-acceptor (D-A-A) molecule for organic nonvolatile resistor memory.

    Science.gov (United States)

    Dong, Lei; Li, Guangwu; Yu, An-Dih; Bo, Zhishan; Liu, Cheng-Liang; Chen, Wen-Chang

    2014-12-01

    A new donor-acceptor-acceptor (D-A-A) type of conjugated molecule, N-(4-(N',N'-diphenyl)phenylamine)-4-(4'-(2,2-dicyanovinyl)phenyl) naphthalene-1,8-dicarboxylic monoimide (TPA-NI-DCN), consisting of triphenylamine (TPA) donors and naphthalimide (NI)/dicyanovinylene (DCN) acceptors was synthesized and characterized. In conjunction with previously reported D-A based materials, the additional DCN moiety attached as end group in the D-A-A configuration can result in a stable charge transfer (CT) and charge-separated state to maintain the ON state current. The vacuum-deposited TPA-NI-DCN device fabricated as an active memory layer was demonstrated to exhibit write-once-read-many (WORM) switching characteristics of organic nonvolatile memory due to the strong polarity of the TPA-NI-DCN moiety. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Binomial distribution-based quantitative measurement of multiple-acceptors fluorescence resonance energy transfer by partially photobleaching acceptor

    Science.gov (United States)

    Zhang, Lili; Yu, Huaina; Zhang, Jianwei; Chen, Tongsheng

    2014-06-01

    We report that binomial distribution depending on acceptor photobleaching degree can be used to characterize the proportions of various kinds of FRET (Fluorescence Resonance Energy Transfer) constructs resulted from partial acceptor photobleaching of multiple-acceptors FRET system. On this basis, we set up a rigorous quantitation theory for multiple-acceptors FRET construct named as Mb-PbFRET which is not affected by the imaging conditions and fluorophore properties. We experimentally validate Mb-PbFRET with FRET constructs consisted of one donor and two or three acceptors inside living cells on confocal and wide-field microscopes.

  19. A paper-based resonance energy transfer nucleic acid hybridization assay using upconversion nanoparticles as donors and quantum dots as acceptors

    Energy Technology Data Exchange (ETDEWEB)

    Doughan, Samer; Uddayasankar, Uvaraj; Krull, Ulrich J., E-mail: ulrich.krull@utoronto.ca

    2015-06-09

    Highlights: • Covalent immobilization of upconversion nanoparticles on paper. • LRET-based label free DNA detection using quantum dots as acceptors. • Use of polyethylene glycol to eliminate non-specific adsorption of quantum dots. • Improved analytical performance compared to analogous assays. - Abstract: Monodisperse aqueous upconverting nanoparticles (UCNPs) were covalently immobilized on aldehyde modified cellulose paper via reduction amination to develop a luminescence resonance energy transfer (LRET)-based nucleic acid hybridization assay. This first account of covalent immobilization of UCNPs on paper for a bioassay reports an optically responsive method that is sensitive, reproducible and robust. The immobilized UCNPs were decorated with oligonucleotide probes to capture HPRT1 housekeeping gene fragments, which in turn brought reporter conjugated quantum dots (QDs) in close proximity to the UCNPs for LRET. This sandwich assay could detect unlabeled oligonucleotide target, and had a limit of detection of 13 fmol and a dynamic range spanning nearly 3 orders of magnitude. The use of QDs, which are excellent LRET acceptors, demonstrated improved sensitivity, limit of detection, dynamic range and selectivity compared to similar assays that have used molecular fluorophores as acceptors. The selectivity of the assay was attributed to the decoration of the QDs with polyethylene glycol to eliminate non-specific adsorption. The kinetics of hybridization were determined to be diffusion limited and full signal development occurred within 3 min.

  20. A Tandem Oligonucleotide Approach for SNP-Selective RNA Degradation Using Modified Antisense Oligonucleotides.

    Science.gov (United States)

    Magner, Dorota; Biala, Ewa; Lisowiec-Wachnicka, Jolanta; Kierzek, Elzbieta; Kierzek, Ryszard

    2015-01-01

    Antisense oligonucleotides have been studied for many years as a tool for gene silencing. One of the most difficult cases of selective RNA silencing involves the alleles of single nucleotide polymorphisms, in which the allele sequence is differentiated by a single nucleotide. A new approach to improve the performance of allele selectivity for antisense oligonucleotides is proposed. It is based on the simultaneous application of two oligonucleotides. One is complementary to the mutated form of the targeted RNA and is able to activate RNase H to cleave the RNA. The other oligonucleotide, which is complementary to the wild type allele of the targeted RNA, is able to inhibit RNase H cleavage. Five types of SNPs, C/G, G/C, G/A, A/G, and C/U, were analyzed within the sequence context of genes associated with neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease, ALS (Amyotrophic Lateral Sclerosis), and Machado-Joseph disease. For most analyzed cases, the application of the tandem approach increased allele-selective RNA degradation 1.5-15 fold relative to the use of a single antisense oligonucleotide. The presented study proves that differentiation between single substitution is highly dependent on the nature of the SNP and surrounding nucleotides. These variables are crucial for determining the proper length of the inhibitor antisense oligonucleotide. In the tandem approach, the comparison of thermodynamic stability of the favorable duplexes WT RNA-inhibitor and Mut RNA-gapmer with the other possible duplexes allows for the evaluation of chances for the allele-selective degradation of RNA. A larger difference in thermodynamic stability between favorable duplexes and those that could possibly form, usually results in the better allele selectivity of RNA degradation.

  1. Template-Directed Ligation of Peptides to Oligonucleotides

    Science.gov (United States)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

    1996-01-01

    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  2. Anomalous surplus energy transfer observed with multiple FRET acceptors.

    Directory of Open Access Journals (Sweden)

    Srinagesh V Koushik

    Full Text Available BACKGROUND: Förster resonance energy transfer (FRET is a mechanism where energy is transferred from an excited donor fluorophore to adjacent chromophores via non-radiative dipole-dipole interactions. FRET theory primarily considers the interactions of a single donor-acceptor pair. Unfortunately, it is rarely known if only a single acceptor is present in a molecular complex. Thus, the use of FRET as a tool for measuring protein-protein interactions inside living cells requires an understanding of how FRET changes with multiple acceptors. When multiple FRET acceptors are present it is assumed that a quantum of energy is either released from the donor, or transferred in toto to only one of the acceptors present. The rate of energy transfer between the donor and a specific acceptor (k(D-->A can be measured in the absence of other acceptors, and these individual FRET transfer rates can be used to predict the ensemble FRET efficiency using a simple kinetic model where the sum of all FRET transfer rates is divided by the sum of all radiative and non-radiative transfer rates. METHODOLOGY/PRINCIPAL FINDINGS: The generality of this approach was tested by measuring the ensemble FRET efficiency in two constructs, each containing a single fluorescent-protein donor (Cerulean and either two or three FRET acceptors (Venus. FRET transfer rates between individual donor-acceptor pairs within these constructs were calculated from FRET efficiencies measured after systematically introducing point mutations to eliminate all other acceptors. We find that the amount of energy transfer observed in constructs having multiple acceptors is significantly greater than the FRET efficiency predicted from the sum of the individual donor to acceptor transfer rates. CONCLUSIONS/SIGNIFICANCE: We conclude that either an additional energy transfer pathway exists when multiple acceptors are present, or that a theoretical assumption on which the kinetic model prediction is based is

  3. Chemically Modified Oligonucleotides Modulate an Epigenetically Varied and Transient Form of Transcription Silencing of HIV-1 in Human Cells

    Directory of Open Access Journals (Sweden)

    Stuart Knowling

    2012-01-01

    Full Text Available Small noncoding RNAs (ncRNAs have been shown to guide epigenetic silencing complexes to target loci in human cells. When targeted to gene promoters, these small RNAs can lead to long-term stable epigenetic silencing of gene transcription. To date, small RNAs have been shown to modulate transcriptional gene silencing (TGS of human immunodeficiency virus type 1 (HIV-1 as well as several other disease-related genes, but it has remained unknown as to what extent particular chemistries can be used to generate single-stranded backbone-modified oligonucleotides that are amenable to this form of gene targeting and regulation. Here, we present data indicating that specific combinations of backbone modifications can be used to generate single-stranded antisense oligonucleotides that can functionally direct TGS of HIV-1 in a manner that is however, independent of epigenetic changes at the target loci. Furthermore, this functionality appears contingent on the absence of a 5′ phosphate in the oligonucleotide. These data suggest that chemically modified oligonucleotide based approaches could be implemented as a means to regulate gene transcription in an epigenetically independent manner.

  4. Guanine-tethered antisense oligonucleotides as synthetic riboregulators.

    Science.gov (United States)

    Hagihara, Masaki

    2014-01-01

    Regulation of gene expression by short oligonucleotides (antisense oligonucleotides), which can modulate RNA structures and inhibit subsequent associations with the translation machinery, is a potential approach for gene therapy. This chapter describes an alternative antisense strategy using guanine-tethered antisense oligonucleotides (G-ASs) to introduce a DNA-RNA heteroquadruplex structure at a designated sequence on RNA targets. The feasibility of using G-ASs to modulate RNA conformation may allow control of RNA function by inducing biologically important quadruplex structures. This approach to manipulate quadruplex structures using G-ASs may expand the strategies for regulating RNA structures and the functions of short oligonucleotide riboregulators.

  5. The reaction of choline dehydrogenase with some electron acceptors.

    Science.gov (United States)

    Barrett, M C; Dawson, A P

    1975-12-01

    1. The choline dehydrogenase (EC 1.1.99.1) WAS SOLUBILIZED FROM ACETONE-DRIED POWDERS OF RAT LIVER MITOCHONDRIA BY TREATMENT WITH Naja naja venom. 2. The kinetics of the reaction of enzyme with phenazine methosulphate and ubiquinone-2 as electron acceptors were investigated. 3. With both electron acceptors the reaction mechanism appears to involve a free, modified-enzyme intermediate. 4. With some electron acceptors the maximum velocity of the reaction is independent of the nature of the acceptor. With phenazine methosulphate and ubiquinone-2 as acceptors the Km value for choline is also independent of the nature of the acceptor molecule. 5. The mechanism of the Triton X-100-solubilized enzyme is apparently the smae as that for the snake venom solubilized enzyme.

  6. Lipid Oligonucleotide Conjugates as Responsive Material

    Science.gov (United States)

    2012-09-28

    U.S. Army Research Office P.O. Box 12211 Research Triangle Park, NC 27709-2211 15. SUBJECT TERMS Amphiphiles, oligonucleotides, lipids...peer-reviewed journals: (c) Presentations 1. Philippe Barthélémy, « Hybrid Lipids for Biomedical Applications », Targeting and Triggering Basic Research ...Steadel C. ; Pierre, N. ; Barthélémy, P. : Oligonucléotides amphiphile : Journée Scientifique de l’IFR 66, Talence, le 2 décembre 2008, France 29. Taib

  7. Antisense Oligonucleotide Therapy in Diabetic Retinopathy

    Science.gov (United States)

    Hnik, Peter; Boyer, David S.; Grillone, Lisa R.; Clement, John G.; Henry, Scott P.; Green, Ellen A.

    2009-01-01

    Diabetic retinopathy is one of the leading causes of blindness in the United States and other parts of the world. Historically, laser photocoagulation and vitrectomy surgery have been used for the treatment of diabetic retinopathy, including diabetic macular edema. Both procedures have proven to be useful under certain conditions but have their limitations. New pathways and processes that promote diabetic retinopathy have been identified, and several new therapeutic approaches are under investigation. These new therapies may be beneficial in the treatment of diabetic retinopathy and include antivascular endothelial growth factor agents, corticosteroids, and therapies that may potentially target a number of additional diabetic retinopathy-related factors and processes, including antisense oligonucleotides. Second-generation antisense oligonucleotides, such as iCo-007, may offer a significant advantage in the treatment of diabetic retinopathy by downregulating the signal pathways of multiple growth factors that seem to play a critical role in the process of ocular angiogenesis and vascular leakage. Benefits of such molecules are expected to include the specificity of the kinase target and an extended half-life, resulting in less frequent intravitreal drug administration, resistance to molecule degradation, and a good safety profile. PMID:20144342

  8. An imputation approach for oligonucleotide microarrays.

    Directory of Open Access Journals (Sweden)

    Ming Li

    Full Text Available Oligonucleotide microarrays are commonly adopted for detecting and qualifying the abundance of molecules in biological samples. Analysis of microarray data starts with recording and interpreting hybridization signals from CEL images. However, many CEL images may be blemished by noises from various sources, observed as "bright spots", "dark clouds", and "shadowy circles", etc. It is crucial that these image defects are correctly identified and properly processed. Existing approaches mainly focus on detecting defect areas and removing affected intensities. In this article, we propose to use a mixed effect model for imputing the affected intensities. The proposed imputation procedure is a single-array-based approach which does not require any biological replicate or between-array normalization. We further examine its performance by using Affymetrix high-density SNP arrays. The results show that this imputation procedure significantly reduces genotyping error rates. We also discuss the necessary adjustments for its potential extension to other oligonucleotide microarrays, such as gene expression profiling. The R source code for the implementation of approach is freely available upon request.

  9. Quantum computing with acceptor spins in silicon.

    Science.gov (United States)

    Salfi, Joe; Tong, Mengyang; Rogge, Sven; Culcer, Dimitrie

    2016-06-17

    The states of a boron acceptor near a Si/SiO2 interface, which bind two low-energy Kramers pairs, have exceptional properties for encoding quantum information and, with the aid of strain, both heavy hole and light hole-based spin qubits can be designed. Whereas a light-hole spin qubit was introduced recently (arXiv:1508.04259), here we present analytical and numerical results proving that a heavy-hole spin qubit can be reliably initialised, rotated and entangled by electrical means alone. This is due to strong Rashba-like spin-orbit interaction terms enabled by the interface inversion asymmetry. Single qubit rotations rely on electric-dipole spin resonance (EDSR), which is strongly enhanced by interface-induced spin-orbit terms. Entanglement can be accomplished by Coulomb exchange, coupling to a resonator, or spin-orbit induced dipole-dipole interactions. By analysing the qubit sensitivity to charge noise, we demonstrate that interface-induced spin-orbit terms are responsible for sweet spots in the dephasing time [Formula: see text] as a function of the top gate electric field, which are close to maxima in the EDSR strength, where the EDSR gate has high fidelity. We show that both qubits can be described using the same starting Hamiltonian, and by comparing their properties we show that the complex interplay of bulk and interface-induced spin-orbit terms allows a high degree of electrical control and makes acceptors potential candidates for scalable quantum computation in Si.

  10. Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays

    DEFF Research Database (Denmark)

    Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen

    2003-01-01

    Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer with an ......Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer...

  11. Oligonucleotides Containing Aminated 2′-Amino-LNA Nucleotides

    DEFF Research Database (Denmark)

    Lou, Chenguang; Samuelsen, Simone V.; Christensen, Niels Johan

    2017-01-01

    Mono- and diaminated 2′-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested...... that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2′-amino-LNA monomers and the host oligonucleotide backbone....

  12. Voltage-gated calcium channel and antisense oligonucleotides thereto

    Science.gov (United States)

    Hruska, Keith A. (Inventor); Friedman, Peter A. (Inventor); Barry, Elizabeth L. R. (Inventor); Duncan, Randall L. (Inventor)

    1998-01-01

    An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

  13. Pharmacokinetics, biodistribution and cell uptake of antisense oligonucleotides.

    Science.gov (United States)

    Geary, Richard S; Norris, Daniel; Yu, Rosie; Bennett, C Frank

    2015-06-29

    Pharmacokinetic properties of oligonucleotides are largely driven by chemistry of the backbone and thus are sequence independent within a chemical class. Tissue bioavailability (% of administered dose) is assisted by plasma protein binding that limits glomerular filtration and ultimate urinary excretion of oligonucleotides. The substitution of one non-bridging oxygen with the more hydrophobic sulfur atom (phosphorothioate) increases both plasma stability and plasma protein binding and thus, ultimately, tissue bioavailability. Additional modifications of the sugar at the 2' position, increase RNA binding affinity and significantly increase potency, tissue half-life and prolong RNA inhibitory activity. Oligonucleotides modified in this manner consistently exhibit the highest tissue bioavailability (>90%). Systemic biodistribution is broad, and organs typically with highest concentrations are liver and kidney followed by bone marrow, adipocytes, and lymph nodes. Cell uptake is predominantly mediated by endocytosis. Both size and charge for most oligonucleotides prevents distribution across the blood brain barrier. However, modified single-strand oligonucleotides administered by intrathecal injection into the CSF distribute broadly in the CNS. The majority of intracellular oligonucleotide distribution following systemic or local administration occurs rapidly in just a few hours following administration and is facilitated by rapid endocytotic uptake mechanisms. Further understanding of the intracellular trafficking of oligonucleotides may provide further enhancements in design and ultimate potency of antisense oligonucleotides in the future. Copyright © 2015. Published by Elsevier B.V.

  14. Enhanced fluorescence of silver nanoclusters stabilized with branched oligonucleotides.

    Science.gov (United States)

    Latorre, Alfonso; Lorca, Romina; Zamora, Félix; Somoza, Álvaro

    2013-05-28

    DNA stabilized silver nanoclusters (AgNCs) are promising optical materials, whose fluorescence properties can be tuned by the selection of the DNA sequence employed. In this work we have used modified oligonucleotides in the preparation of AgNCs. The fluorescent intensity obtained was 60 times higher than that achieved with standard oligonucleotides.

  15. Thermolytic properties of 3-(2-pyridyl)-1-propyl and 2-[N-methyl-N-(2-pyridyl)]aminoethyl phosphate/thiophosphate protecting groups in solid-phase synthesis of oligodeoxyribonucleotides.

    Science.gov (United States)

    Cieślak, Jacek; Beaucage, Serge L

    2003-12-26

    Thermolytic groups may serve as alternatives to the conventional 2-cyanoethyl group for phosphate/thiophosphate protection in solid-phase oligonucleotide synthesis to prevent DNA alkylation by acrylonitrile generated under the basic conditions used for oligonucleotide deprotection. Additionally, thermolytic groups are attractive in the context of engineering a "heat-driven" process for the synthesis of oligonucleotides on diagnostic microarrays. In these regards, the potential application of pyridine derivatives as thermolytic phosphate/thiophosphate protecting groups has been investigated. Specifically, 2-pyridinepropanol and 2-[N-methyl-N-(2-pyridyl)]aminoethanol were incorporated into deoxyribonucleoside phosphoramidites 7a-d and 9, which were found as efficient as 2-cyanoethyl deoxyribonucleoside phosphoramidites in solid-phase oligonucleotide synthesis. Whereas the removal of 3-(2-pyridyl)-1-propyl phosphate/thiophosphate protecting groups from oligonucleotides is effected within 30 min upon heating at 55 degrees C in concentrated NH4OH or in an aqueous buffer at pH 7.0, cleavage of 2-[N-methyl-N-(2-pyridyl)]aminoethyl groups occurs spontaneously when their phosphate or phosphorothioate esters are formed during oligonucleotide synthesis. The deprotection of these groups follows a cyclodeesterification process generating the bicyclic salts 13 and 14 as side products. These salts do not alkylate or otherwise modify any DNA nucleobases and do not desulfurize a phosphorothioate diester model under conditions mimicking large-scale oligonucleotide deprotection.

  16. Electron attachment to hydrated oligonucleotide dimers: guanylyl-3',5'-cytidine and cytidylyl-3',5'-guanosine.

    Science.gov (United States)

    Gu, Jiande; Xie, Yaoming; Schaefer, Henry F

    2010-05-03

    The dinucleoside phosphate deoxycytidylyl-3',5'-deoxyguanosine (dCpdG) and deoxyguanylyl-3',5'-deoxycytidine (dGpdC) systems are among the largest to be studied by reliable theoretical methods. Exploring electron attachment to these subunits of DNA single strands provides significant progress toward definitive predictions of the electron affinities of DNA single strands. The adiabatic electron affinities of the oligonucleotides are found to be sequence dependent. Deoxycytidine (dC) on the 5' end, dCpdG, has larger adiabatic electron affinity (AEA, 0.90 eV) than dC on the 3' end of the oligomer (dGpdC, 0.66 eV). The geometric features, molecular orbital analyses, and charge distribution studies for the radical anions of the cytidine-containing oligonucleotides demonstrate that the excess electron in these anionic systems is dominantly located on the cytosine nucleobase moiety. The pi-stacking interaction between nucleobases G and C seems unlikely to improve the electron-capturing ability of the oligonucleotide dimers. The influence of the neighboring base on the electron-capturing ability of cytosine should be attributed to the intensified proton accepting-donating interaction between the bases. The present investigation demonstrates that the vertical detachment energies (VDEs) of the radical anions of the oligonucleotides dGpdC and dCpdG are significantly larger than those of the corresponding nucleotides. Consequently, reactions with low activation barriers, such as those for O-C sigma bond and N-glycosidic bond breakage, might be expected for the radical anions of the guanosine-cytosine mixed oligonucleotides.

  17. Noncoding oligonucleotides: the belle of the ball in gene therapy.

    Science.gov (United States)

    Shum, Ka-To; Rossi, John J

    2015-01-01

    Gene therapy carries the promise of cures for many diseases based on manipulating the expression of a person's genes toward the therapeutic goal. The relevance of noncoding oligonucleotides to human disease is attracting widespread attention. Noncoding oligonucleotides are not only involved in gene regulation, but can also be modified into therapeutic tools. There are many strategies that leverage noncoding oligonucleotides for gene therapy, including small interfering RNAs, antisense oligonucleotides, aptamers, ribozymes, decoys, and bacteriophage phi 29 RNAs. In this chapter, we will provide a broad, comprehensive overview of gene therapies that use noncoding oligonucleotides for disease treatment. The mechanism and development of each therapeutic will be described, with a particular focus on its clinical development. Finally, we will discuss the challenges associated with developing nucleic acid therapeutics and the prospects for future success.

  18. Predicting oligonucleotide-directed mutagenesis failures in protein engineering.

    Science.gov (United States)

    Wassman, Christopher D; Tam, Phillip Y; Lathrop, Richard H; Weiss, Gregory A

    2004-01-01

    Protein engineering uses oligonucleotide-directed mutagenesis to modify DNA sequences through a two-step process of hybridization and enzymatic synthesis. Inefficient reactions confound attempts to introduce mutations, especially for the construction of vast combinatorial protein libraries. This paper applied computational approaches to the problem of inefficient mutagenesis. Several results implicated oligonucleotide annealing to non-target sites, termed 'cross-hybridization', as a significant contributor to mutagenesis reaction failures. Test oligonucleotides demonstrated control over reaction outcomes. A novel cross-hybridization score, quickly computable for any plasmid and oligonucleotide mixture, directly correlated with yields of deleterious mutagenesis side products. Cross-hybridization was confirmed conclusively by partial incorporation of an oligonucleotide at a predicted cross-hybridization site, and by modification of putative template secondary structure to control cross-hybridization. Even in low concentrations, cross-hybridizing species in mixtures poisoned reactions. These results provide a basis for improved mutagenesis efficiencies and increased diversities of cognate protein libraries.

  19. Evaluation of a new biocompatible poly(N-(morpholino ethyl methacrylate)-based copolymer for the delivery of ruthenium oligonucleotides, targeting HPV16 E6 oncogene.

    Science.gov (United States)

    Reschner, Anca; Shim, Yong Ho; Dubois, Philippe; Delvenne, Philippe; Evrard, Brigitte; Marcélis, Lionel; Moucheron, Cécile; Kirsch-De Mesmaeker, Andrée; Defrancq, Eric; Raes, Martine; Piette, Jacques; Collard, Laurence; Piel, Géraldine

    2013-08-01

    This study investigates the use of a new biocompatible block copolymer poly(2-(dimethylamino)ethyl methacrylate-N-(morpholino)ethyl methacrylate (PDMAEMA-b-PMEMA) for the delivery of a particular antisense oligonucleotide targeting E6 gene from human papilloma virus. This antisense oligonucleotide was derivatized with a polyazaaromatic Ru(II) complex which, under visible illumination, is able to produce an irreversible crosslink with the complementary targeted sequence. The purpose of this study is to determine whether by the use of a suitable transfection agent, it is possible to increase the efficiency of the antisense oligonucleotide targeting E6 gene, named Ru-P-4. In a recent study, we showed that Oligofectamine transfected Ru-P-4 antisense oligonucleotide failed to inhibit efficiently the growth of cervical cancer cell line SiHa, contrarily to the Ru-P-6 antisense oligonucleotide, another sequence also targeting the E6 gene. The ability of PDMAEMA-b-PMEMA to form polyplexes with optimal physicochemical characteristics was investigated first. Then the ability of the PDMAEMA-b-PMEMA/Ru-P-4 antisense oligonucleotide polyplexes to transfect two keratinocyte cell lines (SiHa and HaCat) and the capacity of polyplexes to inhibit HPV16+ cervical cancer cell growth was evaluated. PDMAEMA-b-PMEMA base polyplexes at the optimal molar ratio of polymer nitrogen atoms to DNA phosphates (N/P), were able to deliver Ru-P-4 antisense oligonucleotide and to induce a higher growth inhibition in human cervical cancer SiHa cells, compared to other formulations based on Oligofectamine.

  20. Photoinduced Intramolecular Charge Transfer in Donor-acceptor Dyad and Donor-bridge-acceptor Triad

    Institute of Scientific and Technical Information of China (English)

    Yong Ding; Yuan-zuo Li; Feng-cai Ma

    2008-01-01

    The ground and excited state properties of the [60]fullerene,diphenylbenzothiadiazole-triphenylamine (PBTDP-TPA) dyad and fullerene-diphenylbenzothiadiazole-triphenylamine (fullerene-PBTDP-TPA) triad were investigated theoretically using density functional theory with B3LYP functional and 3-21G basis set and time-dependent density functional theory with B3LYP functional and STO-3G basis set as well as 2D and 3D real space analysis methods.The 2D site representation reveals the electron-hole coherence on exci- tation.The 3D transition density shows the orientation and strength of the transition dipole moment,and the 3D charge difference density gives the orientation and result of the intramolecular charge transfer.Also, photoinduced intermolecular charge transfer (ICT) in PBTDP-TPA-fullerene triad are identified with 2D and 3D representations,which reveals the mechanisms of ICT in donor-bridge-acceptor triad on excitation. Besides that we also found that the direct superexchange ICT from donor to acceptor (tunneling through the bridge) strongly promotes the ICT in the donor-bridge-acceptor triad.

  1. Alkyl Radicals as Hydrogen Bond Acceptors: Computational Evidence

    DEFF Research Database (Denmark)

    Hammerum, Steen

    2009-01-01

    , and gives rise to pronounced shifts of IR stretching frequencies and to increased absorption intensities. The hydrogen bond acceptor properties of alkyl radicals equal those of many conventional acceptors, e.g., the bond length changes and IR red-shifts suggest that tert-butyl radicals are slightly better...

  2. An overview of electron acceptors in microbial fuel cells

    DEFF Research Database (Denmark)

    Ucar, Deniz; Zhang, Yifeng; Angelidaki, Irini

    2017-01-01

    as an electron acceptor due to its high oxidation potential and ready availability. Recent studies, however, have begun to assess the use of different electron acceptors because of the (1) diversity of redox potential, (2) needs of alternative and more efficient cathode reaction, and (3) expanding of MFC based...

  3. The role of deep acceptor centers in the oxidation of acceptor-doped wide-band-gap perovskites ABO3

    Science.gov (United States)

    Putilov, L. P.; Tsidilkovski, V. I.

    2017-03-01

    The impact of deep acceptor centers on defect thermodynamics and oxidation of wide-band-gap acceptor-doped perovskites without mixed-valence cations is studied. These deep centers are formed by the acceptor-bound small hole polarons whose stabilization energy can be high enough (significantly higher than the hole-acceptor Coulomb interaction energy). It is shown that the oxidation enthalpy ΔHox of oxide is determined by the energy εA of acceptor-bound states along with the formation energy EV of oxygen vacancies. The oxidation reaction is demonstrated to be either endothermic or exothermic, and the regions of εA and EV values corresponding to the positive or negative ΔHox are determined. The contribution of acceptor-bound holes to the defect thermodynamics strongly depends on the acceptor states depth εA: it becomes negligible at εA less than a certain value (at which the acceptor levels are still deep). With increasing εA, the concentration of acceptor-bound small hole polarons can reach the values comparable to the dopant content. The results are illustrated with the acceptor-doped BaZrO3 as an example. It is shown that the experimental data on the bulk hole conductivity of barium zirconate can be described both in the band transport model and in the model of hopping small polarons localized on oxygen ions away from the acceptor centers. Depending on the εA magnitude, the oxidation reaction can be either endothermic or exothermic for both mobility mechanisms.

  4. Acceptor impurity activation in III-nitride light emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Römer, Friedhard, E-mail: froemer@uni-kassel.de; Witzigmann, Bernd, E-mail: bernd.witzigmann@uni-kassel.de [Department of Electrical Engineering, University of Kassel, 34121 Kassel (Germany)

    2015-01-12

    In this work, the role of the acceptor doping and the acceptor activation and its impact on the internal quantum efficiency (IQE) of a Gallium Nitride (GaN) based multi-quantum well light emitting diode is studied by microscopic simulation. Acceptor impurities in GaN are subject to a high activation energy which depends on the presence of proximate dopant atoms and the electric field. A combined model for the dopant ionization and activation barrier reduction has been developed and implemented in a semiconductor carrier transport simulator. By model calculations, we demonstrate the impact of the acceptor activation mechanisms on the decay of the IQE at high current densities, which is known as the efficiency droop. A major contributor to the droop is the electron leakage which is largely affected by the acceptor doping.

  5. Cellular uptake and trafficking of antisense oligonucleotides.

    Science.gov (United States)

    Crooke, Stanley T; Wang, Shiyu; Vickers, Timothy A; Shen, Wen; Liang, Xue-Hai

    2017-03-01

    Antisense oligonucleotides (ASOs) modified with phosphorothioate (PS) linkages and different 2' modifications can be used either as drugs (e.g., to treat homozygous familial hypercholesterolemia and spinal muscular atrophy) or as research tools to alter gene expression. PS-ASOs can enter cells without additional modification or formulation and can be designed to mediate sequence-specific cleavage of different types of RNA (including mRNA and non-coding RNA) targeted by endogenous RNase H1. Although PS-ASOs function in both the cytoplasm and nucleus, localization to different subcellular regions can affect their therapeutic potency. Cellular uptake and intracellular distribution of PS ASOs are mediated by protein interactions. The main proteins involved in these processes have been identified, and intracellular sites in which PS ASOs are active, or inactive, cataloged.

  6. Conjugation of fluorescent proteins with DNA oligonucleotides.

    Science.gov (United States)

    Lapiene, Vidmantas; Kukolka, Florian; Kiko, Kathrin; Arndt, Andreas; Niemeyer, Christof M

    2010-05-19

    This work describes the synthesis of covalent ssDNA conjugates of six fluorescent proteins, ECFP, EGFP, E(2)GFP, mDsRed, Dronpa, and mCherry, which were cloned with an accessible C-terminal cystein residue to enable site-selective coupling using a heterobispecific cross-linker. The resulting conjugates revealed similar fluorescence emission intensity to the unconjugated proteins, and the functionality of the tethered oligonucleotide was proven by specific Watson-Crick base pairing to cDNA-modified gold nanoparticles. Fluorescence spectroscopy analysis indicated that the fluorescence of the FP is quenched by the gold particle, and the extent of quenching varied with the intrinsic spectroscopic properties of FP as well as with the configuration of surface attachment. Since this study demonstrates that biological fluorophores can be selectively incorporated into and optically coupled with nanoparticle-based devices, applications in DNA-based nanofabrication can be foreseen.

  7. Direct oligonucleotide-photosensitizer conjugates for photochemical delivery of antisense oligonucleotides.

    Science.gov (United States)

    Yuan, Ahu; Laing, Brian; Hu, Yiqiao; Ming, Xin

    2015-04-18

    Activation of photosensitizers in endosomes enables release of therapeutic macromolecules into the cytosol of the target cells for pharmacological actions. In this study, we demonstrate that direct conjugation of photosensitizers to oligonucleotides (ONs) allows spatial and temporal co-localization of the two modalities in the target cells, and thus leads to superior functional delivery of ONs. Further, light-activated delivery of an anticancer ON caused cancer cell killing via modulation of an oncogene and photodynamic therapy.

  8. Preparation and application of triple helix forming oligonucleotides and single strand oligonucleotide donors for gene correction.

    Science.gov (United States)

    Alam, Rowshon; Thazhathveetil, Arun Kalliat; Li, Hong; Seidman, Michael M

    2014-01-01

    Strategies for site-specific modulation of genomic sequences in mammalian cells require two components. One must be capable of recognizing and activating a specific target sequence in vivo, driving that site into an exploitable repair pathway. Information is transferred to the site via participation in the pathway by the second component, a donor nucleic acid, resulting in a permanent change in the target sequence. We have developed biologically active triple helix forming oligonucleotides (TFOs) as site-specific gene targeting reagents. These TFOs, linked to DNA reactive compounds (such as a cross-linking agent), activate pathways that can engage informational donors. We have used the combination of a psoralen-TFO and single strand oligonucleotide donors to generate novel cell lines with directed sequence changes at the target site. Here we describe the synthesis and purification of bioactive psoralen-linked TFOs, their co-introduction into mammalian cells with donor nucleic acids, and the identification of cells with sequence conversion of the target site. We have emphasized details in the synthesis and purification of the oligonucleotides that are essential for preparation of reagents with optimal activity.

  9. Design and analysis of mismatch probes for long oligonucleotide microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  10. Antisense Oligonucleotide-Based Therapy for Neuromuscular Disease.

    Science.gov (United States)

    Sardone, Valentina; Zhou, Haiyan; Muntoni, Francesco; Ferlini, Alessandra; Falzarano, Maria Sofia

    2017-04-05

    Neuromuscular disorders such as Duchenne Muscular Dystrophy and Spinal Muscular Atrophy are neurodegenerative genetic diseases characterized primarily by muscle weakness and wasting. Until recently there were no effective therapies for these conditions, but antisense oligonucleotides, a new class of synthetic single stranded molecules of nucleic acids, have demonstrated promising experimental results and are at different stages of regulatory approval. The antisense oligonucleotides can modulate the protein expression via targeting hnRNAs or mRNAs and inducing interference with splicing, mRNA degradation, or arrest of translation, finally, resulting in rescue or reduction of the target protein expression. Different classes of antisense oligonucleotides are being tested in several clinical trials, and limitations of their clinical efficacy and toxicity have been reported for some of these compounds, while more encouraging results have supported the development of others. New generation antisense oligonucleotides are also being tested in preclinical models together with specific delivery systems that could allow some of the limitations of current antisense oligonucleotides to be overcome, to improve the cell penetration, to achieve more robust target engagement, and hopefully also be associated with acceptable toxicity. This review article describes the chemical properties and molecular mechanisms of action of the antisense oligonucleotides and the therapeutic implications these compounds have in neuromuscular diseases. Current strategies and carrier systems available for the oligonucleotides delivery will be also described to provide an overview on the past, present and future of these appealing molecules.

  11. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    Science.gov (United States)

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  12. Design and analysis of mismatch probes for long oligonucleotide microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  13. Antisense oligonucleotide induction of progerin in human myogenic cells.

    Directory of Open Access Journals (Sweden)

    Yue-Bei Luo

    Full Text Available We sought to use splice-switching antisense oligonucleotides to produce a model of accelerated ageing by enhancing expression of progerin, translated from a mis-spliced lamin A gene (LMNA transcript in human myogenic cells. The progerin transcript (LMNA Δ150 lacks the last 150 bases of exon 11, and is translated into a truncated protein associated with the severe premature ageing disease, Hutchinson-Gilford progeria syndrome (HGPS. HGPS arises from de novo mutations that activate a cryptic splice site in exon 11 of LMNA and result in progerin accumulation in tissues of mesodermal origin. Progerin has also been proposed to play a role in the 'natural' ageing process in tissues. We sought to test this hypothesis by producing a model of accelerated muscle ageing in human myogenic cells. A panel of splice-switching antisense oligonucleotides were designed to anneal across exon 11 of the LMNA pre-mRNA, and these compounds were transfected into primary human myogenic cells. RT-PCR showed that the majority of oligonucleotides were able to modify LMNA transcript processing. Oligonucleotides that annealed within the 150 base region of exon 11 that is missing in the progerin transcript, as well as those that targeted the normal exon 11 donor site induced the LMNA Δ150 transcript, but most oligonucleotides also generated variable levels of LMNA transcript missing the entire exon 11. Upon evaluation of different oligomer chemistries, the morpholino phosphorodiamidate oligonucleotides were found to be more efficient than the equivalent sequences prepared as oligonucleotides with 2'-O-methyl modified bases on a phosphorothioate backbone. The morpholino oligonucleotides induced nuclear localised progerin, demonstrated by immunostaining, and morphological nuclear changes typical of HGPS cells. We show that it is possible to induce progerin expression in myogenic cells using splice-switching oligonucleotides to redirect splicing of LMNA. This may offer a model

  14. Optical Characterization of Oligonucleotide DNA Influenced by Magnetic Fields

    Directory of Open Access Journals (Sweden)

    Seyedeh Maryam Banihashemian

    2013-09-01

    Full Text Available UV-VIS spectroscopic analysis of oligonucleotide DNA exposed to different magnetic fields was performed in order to investigate the relationship between DNA extinction coefficients and optical parameters according to magnetic-field strength. The results with the oligonucleotides adenine-thymine 100 mer (AT-100 DNA and cytosine-guanine 100 mer (CG-100 DNA indicate that the magnetic field influences DNA molar extinction coefficients and refractive indexes. The imaginary parts of the refractive index and molar extinction coefficients of the AT-100 and CG-100 DNA decreased after exposure to a magnetic field of 750 mT due to cleavage of the DNA oligonucleotides into smaller segments.

  15. Oligonucleotide-Mediated Genome Editing Provides Precision and Function to Engineered Nucleases and Antibiotics in Plants.

    Science.gov (United States)

    Sauer, Noel J; Narváez-Vásquez, Javier; Mozoruk, Jerry; Miller, Ryan B; Warburg, Zachary J; Woodward, Melody J; Mihiret, Yohannes A; Lincoln, Tracey A; Segami, Rosa E; Sanders, Steven L; Walker, Keith A; Beetham, Peter R; Schöpke, Christian R; Gocal, Greg F W

    2016-04-01

    Here, we report a form of oligonucleotide-directed mutagenesis for precision genome editing in plants that uses single-stranded oligonucleotides (ssODNs) to precisely and efficiently generate genome edits at DNA strand lesions made by DNA double strand break reagents. Employing a transgene model in Arabidopsis (Arabidopsis thaliana), we obtained a high frequency of precise targeted genome edits when ssODNs were introduced into protoplasts that were pretreated with the glycopeptide antibiotic phleomycin, a nonspecific DNA double strand breaker. Simultaneous delivery of ssODN and a site-specific DNA double strand breaker, either transcription activator-like effector nucleases (TALENs) or clustered, regularly interspaced, short palindromic repeats (CRISPR/Cas9), resulted in a much greater targeted genome-editing frequency compared with treatment with DNA double strand-breaking reagents alone. Using this site-specific approach, we applied the combination of ssODN and CRISPR/Cas9 to develop an herbicide tolerance trait in flax (Linum usitatissimum) by precisely editing the 5'-ENOLPYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE (EPSPS) genes. EPSPS edits occurred at sufficient frequency that we could regenerate whole plants from edited protoplasts without employing selection. These plants were subsequently determined to be tolerant to the herbicide glyphosate in greenhouse spray tests. Progeny (C1) of these plants showed the expected Mendelian segregation of EPSPS edits. Our findings show the enormous potential of using a genome-editing platform for precise, reliable trait development in crop plants.

  16. Fluoroscence in situ hybridization of chicken intestinal samples with bacterial rRNA targeted oligonucleotide probes

    DEFF Research Database (Denmark)

    Olsen, Katja Nyholm; Francesch, M.; Christensen, Henrik

    2006-01-01

    The objective was to develop a fast and accurate molecular method for the quantification of the intestinal flora in chickens by rRNA fluorescence in situ hybridization (FISH). Seven weeks old conventionally reared Lohmann hens were used to set up the method. To sample ileal intestinal content......, the distal part from Meckels diverticulum to the ileo-caecal junction was removed. Fixation was performed in ethanol and phosphate buffered saline. After washing by centrifugation, the sample was resuspended in pre-heated hybridization buffer with oligonucleotide probe labelled with Cy3 (10ng/µl). The cells...... were hybridized for 24-72h, centrifuged, washed with pre-heated hybridization buffer, centrifuged and resuspended in Millipore quality water before filtration onto a 0.22 µm black polycarbonate filter. The probes used in this study were, LGC354A, LGC354B, LGC354C, Strc493, Bacto1080, Sal3, Chis150, EUB...

  17. Phosphate homeostasis and disorders.

    Science.gov (United States)

    Manghat, P; Sodi, R; Swaminathan, R

    2014-11-01

    Recent studies of inherited disorders of phosphate metabolism have shed new light on the understanding of phosphate metabolism. Phosphate has important functions in the body and several mechanisms have evolved to regulate phosphate balance including vitamin D, parathyroid hormone and phosphatonins such as fibroblast growth factor-23 (FGF23). Disorders of phosphate homeostasis leading to hypo- and hyperphosphataemia are common and have clinical and biochemical consequences. Notably, recent studies have linked hyperphosphataemia with an increased risk of cardiovascular disease. This review outlines the recent advances in the understanding of phosphate homeostasis and describes the causes, investigation and management of hypo- and hyperphosphataemia.

  18. Alteration of cartilage glycosaminoglycan protein acceptor by somatomedin and cortisol.

    Science.gov (United States)

    Kilgore, B S; McNatt, M L; Meador, S; Lee, J A; Hughes, E R; Elders, M J

    1979-02-01

    The effect of somatomedin and cortisol on embryonic chick cartilage in vitro indicates that somatomedin stimulates 35SO4 uptake while cortisol decreases it with no effect on glycosaminoglycan turnover. Xylosyltransferase activity is increased in crude fractions of somatomedin-treated cartilage but decreased in cortisol-treated cartilage. By using a Smith-degraded proteoglycan as an exogenous acceptor, xylosyltransferase activities from both treatments were equivalent, suggesting that the enzyme was not rate limiting. The results of xylosyltransferase assays conducted by mixing enzyme and endogenous acceptor from control, cortisol-treated and somatomedin-treated cartilage, suggest both effects to be at the level of the acceptor protein.

  19. Donor–Acceptor Oligorotaxanes Made to Order

    Energy Technology Data Exchange (ETDEWEB)

    Basu, Subhadeep [Northwestern Univ., Evanston, IL (United States); Coskun, Ali [Northwestern Univ., Evanston, IL (United States); Friedman, Douglas C. [Northwestern Univ., Evanston, IL (United States); Olson, Mark A. [Northwestern Univ., Evanston, IL (United States); Benitez, Diego [California Institute of Technology (Caltech), Pasadena, CA (United States); Tkatchouk, Ekaterina [California Institute of Technology (Caltech), Pasadena, CA (United States); Barin, Gokhan [Northwestern Univ., Evanston, IL (United States); Yang, Jeffrey [Northwestern Univ., Evanston, IL (United States); Fahrenbach, Albert C. [Northwestern Univ., Evanston, IL (United States); Goddard, William A. [California Institute of Technology (Caltech), Pasadena, CA (United States); Stoddart, J. Fraser [Northwestern Univ., Evanston, IL (United States)

    2011-01-01

    Five donor–acceptor oligorotaxanes made up of dumbbells composed of tetraethylene glycol chains, interspersed with three and five 1,5-dioxynaphthalene units, and terminated by 2,6-diisopropylphenoxy stoppers, have been prepared by the threading of discrete numbers of cyclobis(paraquat-p-phenylene) rings, followed by a kinetically controlled stoppering protocol that relies on click chemistry. The well-known copper(I)-catalyzed alkyne–azide cycloaddition between azide functions placed at the ends of the polyether chains and alkyne-bearing stopper precursors was employed during the final kinetically controlled template-directed synthesis of the five oligorotaxanes, which were characterized subsequently by ¹H NMR spectroscopy at low temperature (233 K) in deuterated acetonitrile. The secondary structures, as well as the conformations, of the five oligorotaxanes were unraveled by spectroscopic comparison with the dumbbell and ring components. By focusing attention on the changes in chemical shifts of some key probe protons, obtained from a wide range of low-temperature spectra, a picture emerges of a high degree of folding within the thread protons of the dumbbells of four of the five oligorotaxanes—the fifth oligorotaxane represents a control compound in effect—brought about by a combination of C[BOND]H···O and π–π stacking interactions between the π-electron-deficient bipyridinium units in the rings and the π-electron-rich 1,5-dioxynaphthalene units and polyether chains in the dumbbells. The secondary structures of a foldamer-like nature have received further support from a solid-state superstructure of a related [3]pseudorotaxane and density functional calculations performed thereon.

  20. Chloroquine Phosphate Oral

    Science.gov (United States)

    Chloroquine phosphate is in a class of drugs called antimalarials and amebicides. It is used to prevent and treat ... Chloroquine phosphate comes as a tablet to take by mouth. For prevention of malaria in adults, one dose is ...

  1. Glucose-6-phosphate dehydrogenase

    Science.gov (United States)

    ... medlineplus.gov/ency/article/003671.htm Glucose-6-phosphate dehydrogenase test To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) is a protein that helps red ...

  2. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  3. Oligonucleotide and Long Polymeric DNA Encoding

    Energy Technology Data Exchange (ETDEWEB)

    Miller, E; Mariella Jr., R P; Christian, A T; Gardner, S N; Williams, J M

    2003-11-24

    This report summarizes the work done at Lawrence Livermore National Laboratory for the Oligonucleotide and Long Polymeric DNA Encoding project, part of the Microelectronic Bioprocesses Program at DARPA. The goal of the project was to develop a process by which long (circa 10,000 base-pair) synthetic DNA molecules could be synthesized in a timely and economic manner. During construction of the long molecule, errors in DNA sequence occur during hybridization and/or the subsequent enzymatic process. The work done on this project has resulted in a novel synthesis scheme that we call the parallel pyramid synthesis protocol, the development of a suit of computational tools to minimize and quantify errors in the synthesized DNA sequence, and experimental proof of this technique. The modeling consists of three interrelated modules: the bioinformatics code which determines the specifics of parallel pyramid synthesis for a given chain of long DNA, the thermodynamics code which tracks the products of DNA hybridization and polymerase extension during the later steps in the process, and the kinetics model which examines the temporal and spatial processes during one thermocycle. Most importantly, we conducted the first successful syntheses of a gene using small starting oligomers (tetramers). The synthesized sequence, 813 base pairs long, contained a 725 base pair gene, modified green fluorescent protein (mGFP), which has been shown to be a functional gene by cloning into cells and observing its green fluorescent product.

  4. Silver and Cyanine Staining of Oligonucleotides in Polyacrylamide Gel.

    Directory of Open Access Journals (Sweden)

    Weizhong Tang

    Full Text Available To explore why some oligonucleotides in denaturing polyacrylamide gel could not be silver-stained, 134 different oligonucleotides were analyzed using denaturing polyacrylamide gel electrophoresis stained with silver and asymmetric cyanine. As a result, we found that the sensitivity of oligos (dA, (dC, (dG and (dT to silver staining could be ranged as (dA > (dG > (dC > (dT from high to low. It was unexpected that oligo (dT was hard to be silver-stained. Moreover, the silver staining of an oligonucleotide containing base T could be partially or completely inhibited by base T. The inhibition of silver staining by base T was a competitive inhibition which could be affected by the amounts of the argyrophil nucleobase and base T, the cis-distance between the argyrophil nucleobase and base T, and the gel concentration. The changes of the intensity of an oligonucleotide band caused by the changes of DNA base composition were diverse and interesting. The intensity of some oligonucleotide bands would significantly change when the changes of DNA base composition accumulated to a certain extent (usually ≥ 4 nt. The sensitivity of cyanine staining of ≤ 11-nt long oligonucleotides could be enhanced about 250-fold by fixing the gels with methanol fixing solution.

  5. An Overview of Electron Acceptors in Microbial Fuel Cells.

    Science.gov (United States)

    Ucar, Deniz; Zhang, Yifeng; Angelidaki, Irini

    2017-01-01

    Microbial fuel cells (MFC) have recently received increasing attention due to their promising potential in sustainable wastewater treatment and contaminant removal. In general, contaminants can be removed either as an electron donor via microbial catalyzed oxidization at the anode or removed at the cathode as electron acceptors through reduction. Some contaminants can also function as electron mediators at the anode or cathode. While previous studies have done a thorough assessment of electron donors, cathodic electron acceptors and mediators have not been as well described. Oxygen is widely used as an electron acceptor due to its high oxidation potential and ready availability. Recent studies, however, have begun to assess the use of different electron acceptors because of the (1) diversity of redox potential, (2) needs of alternative and more efficient cathode reaction, and (3) expanding of MFC based technologies in different areas. The aim of this review was to evaluate the performance and applicability of various electron acceptors and mediators used in MFCs. This review also evaluated the corresponding performance, advantages and disadvantages, and future potential applications of select electron acceptors (e.g., nitrate, iron, copper, perchlorate) and mediators.

  6. Development of Polymer Acceptors for Organic Photovoltaic Cells

    Directory of Open Access Journals (Sweden)

    Yujeong Kim

    2014-02-01

    Full Text Available This review provides a current status report of the various n-type polymer acceptors for use as active materials in organic photovoltaic cells (OPVs. The polymer acceptors are divided into four categories. The first section of this review focuses on rylene diimide-based polymers, including perylene diimide, naphthalene diimide, and dithienocoronene diimide-based polymers. The high electron mobility and good stability of rylene diimides make them suitable for use as polymer acceptors in OPVs. The second section deals with fluorene and benzothiadiazole-based polymers such as poly(9,9’-dioctylfluorene-co-benzothiadiazole, and the ensuing section focuses on the cyano-substituted polymer acceptors. Cyano-poly(phenylenevinylene and poly(3-cyano-4-hexylthiophene have been used as acceptors in OPVs and exhibit high electron affinity arising from the electron-withdrawing cyano groups in the vinylene group of poly(phenylenevinylene or the thiophene ring of polythiophene. Lastly, a number of other electron-deficient groups such as thiazole, diketopyrrolopyrrole, and oxadiazole have also been introduced onto polymer backbones to induce n-type characteristics in the polymer. Since the first report on all-polymer solar cells in 1995, the best power conversion efficiency obtained with these devices to date has been 3.45%. The overall trend in the development of n-type polymer acceptors is presented in this review.

  7. Fullerene-bisadduct acceptors for polymer solar cells.

    Science.gov (United States)

    Li, Yongfang

    2013-10-01

    Polymer solar cells (PSCs) have drawn great attention in recent years for their simple device structure, light weight, and low-cost fabrication in comparison with inorganic semiconductor solar cells. However, the power-conversion efficiency (PCE) of PSCs needs to be increased for their future application. The key issue for improving the PCE of PSCs is the design and synthesis of high-efficiency conjugated polymer donors and fullerene acceptors for the photovoltaic materials. For the acceptor materials, several fullerene-bisadduct acceptors with high LUMO energy levels have demonstrated excellent photovoltaic performance in PSCs with P3HT as a donor. In this Focus Review, recent progress in high-efficiency fullerene-bisadduct acceptors is discussed, including the bisadduct of PCBM, indene-C60 bisadduct (ICBA), indene-C70 bisadduct (IC70BA), DMPCBA, NCBA, and bisTOQC. The LUMO levels and photovoltaic performance of these bisadduct acceptors with P3HT as a donor are summarized and compared. In addition, the applications of an ICBA acceptor in new device structures and with other conjugated polymer donors than P3HT are also introduced and discussed. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Delivery of antisense oligonucleotide to the cornea by iontophoresis.

    Science.gov (United States)

    Berdugo, M; Valamanesh, F; Andrieu, C; Klein, C; Benezra, D; Courtois, Y; Behar-Cohen, F

    2003-04-01

    We wished to evaluate the potential of iontophoresis to promote the delivery of antisense oligonucleotides (ODN) directed at the vascular endothelial growth factor (VEGF)-R2 receptor (KDR/Flk) to the cornea of the rat eye. Fluorescence (CY5)-labeled ODNs in phosphate-buffered saline (PBS) (20 microM) were locally administered to rat eyes, and their fate within the anterior segment was studied. Thirty-four male, 5-week-old Wistar rats were used for all experiments. The rats were divided in four groups. In group I (12 rats, 12 eyes), the ODNs (20 microM) were delivered by iontophoresis (300 microA for 5 minutes) using a specially designed corneal applicator. In group II (12 rats, 12 eyes), the ODNs (20 microM) were delivered using the same applicator, but no electrical current was applied. In group III (6 rats, 6 eyes), a corneal neovascular reaction was induced prior to the application of ODNs (20 microM), and iontophoresis electrical current was delivered as for group I rats. Group IV (4 rats, 4 eyes) received ODN (60 microM) iontophoresis application (300 microA for 5 minutes) and were used for ODN integrity studies. The animals were killed 5 minutes, 90 minutes, and 24 hours after a single ODN application and studied. Topically applied ODNs using the same iontophoresis applicator but without current do not penetrate the cornea and remain confined to the superficial epithelial layer. ODNs delivered with transcorneoscleral iontophoresis penetrate into all corneal layers and are also detected in the iris. In corneas with neovascularization, ODNs were particularly localized within the vascular endothelial cells of the stroma. ODNs extracted from eye tissues 24 hours after iontophoresis remained unaltered. The iontophoresis current did not cause any detectable ocular damage under these conditions. Iontophoresis promotes the delivery of ODNs to the anterior segment of the eye, including all corneal layers. Iontophoresis of ODNs directed at VEGF-R2 may be used for the

  9. Targeting of single stranded oligonucleotides through metal-induced cyclization of short complementary strands : Targeting of single stranded oligonucleotides

    OpenAIRE

    Freville, Fabrice; Richard, Tristan; Bathany, Katell; Moreau, Serge

    2006-01-01

    International audience; A new strategy to cyclize a short synthetic oligonucleotide on a DNA or a RNA target strand is described. This one relies on a metal-mediated cyclization of short synthetic oligonucleotides conjugated with two chelating 2,2':6',2”-terpyridine moieties at their 3' and 5' ends. Cyclization following metal addition (Zn2+, Fe2+) was demonstrated using UV monitored thermal denaturation experiments, mass spectrometry analysis and gel shift assays. NMR experiments were used t...

  10. Reversing Antisense Oligonucleotide Activity with a Sense Oligonucleotide Antidote: Proof of Concept Targeting Prothrombin.

    Science.gov (United States)

    Crosby, Jeff R; Zhao, Chenguang; Zhang, Hong; MacLeod, A Robert; Guo, Shuling; Monia, Brett P

    2015-12-01

    The tissue half-life of second-generation antisense oligonucleotide drugs (ASOs) is generally longer than traditional small molecule therapeutics. Thus, a strategy to reverse the activity of antisense drugs is warranted in certain settings. In this study, we describe a strategy employing the administration of a complementary sense oligonucleotide antidote (SOA). As a model system we have chosen to target the coagulation factor and antithrombotic drug target, prothrombin, to assess the feasibility of this approach. ASO targeting mouse prothrombin specifically suppressed >90% hepatic prothrombin mRNA levels and circulating prothrombin protein in mice. These effects were dose- and time-dependent, and as expected produced predictable increases in anticoagulation activity [prothrombin time/activated partial thromboplastin time (PT/aPTT)]. Treatment with prothrombin SOAs resulted in a dose-dependent reversal of ASO activity, as measured by a return in prothrombin mRNA levels and thrombin activity, and normalization of aPTT and PT. The antithrombotic activity of prothrombin ASOs was demonstrated in a FeCl3-induced thrombosis mouse model, and as predicted for this target, the doses required for antithrombotic activity were also associated with increased bleeding. Treatment with SOA was able to prevent prothrombin ASO-induced bleeding in a dose-dependent manner. These studies demonstrate for the first time the utility of SOAs to selectively and specifically reverse the intracellular effects of an antisense therapy.

  11. Near infrared organic light-emitting diodes based on acceptor-donor-acceptor (ADA) using novel conjugated isatin Schiff bases

    Energy Technology Data Exchange (ETDEWEB)

    Taghi Sharbati, Mohammad, E-mail: m.t.sharbati@sutech.ac.i [Department of Electrical and Electronics Engineering, Shiraz University of Technology, Shiraz (Iran, Islamic Republic of); Soltani Rad, Mohammad Navid, E-mail: soltani@sutech.ac.i [Department of Chemistry, Shiraz University of Technology, Shiraz 71555-313 (Iran, Islamic Republic of); Behrouz, Somayeh [Department of Chemistry, Shiraz University of Technology, Shiraz 71555-313 (Iran, Islamic Republic of); Gharavi, Alireza [Photonics Lab, Department of Electrical and Computer Engineering, Shiraz University, Shiraz (Iran, Islamic Republic of); Emami, Farzin [Department of Electrical and Electronics Engineering, Shiraz University of Technology, Shiraz (Iran, Islamic Republic of)

    2011-04-15

    Fabrications of a single layer organic light emitting diodes (OLEDs) based on two conjugated acceptor-donor-acceptor (ADA) isatin Schiff bases are described. The electroluminescent spectra of these materials range from 630 to 700 nm and their band gaps were measured between 1.97 and 1.77 eV. The measured maximum external quantum efficiencies (EQE) for fabricated OLEDs are 0.0515% and 0.054% for two acceptor-donor-acceptor chromophores. The Commission International De L'Eclairage (CIE) (1931) coordinates of these two compounds were attained and found to be (0.4077, 0.4128) and (0.4411, 0.4126) for two used acceptor-donor-acceptor chromophores. The measured I-V curves demonstrated the apparent diode behavior of two ADA chromophores. The turn-on voltages in these OLEDs are directly dependent on the thickness. These results have demonstrated that ADA isatin Schiff bases could be considered as promising electroluminescence-emitting materials for fabrication of OLEDs.

  12. Why nature chose phosphates.

    Science.gov (United States)

    Westheimer, F H

    1987-03-06

    Phosphate esters and anhydrides dominate the living world but are seldom used as intermediates by organic chemists. Phosphoric acid is specially adapted for its role in nucleic acids because it can link two nucleotides and still ionize; the resulting negative charge serves both to stabilize the diesters against hydrolysis and to retain the molecules within a lipid membrane. A similar explanation for stability and retention also holds for phosphates that are intermediary metabolites and for phosphates that serve as energy sources. Phosphates with multiple negative charges can react by way of the monomeric metaphosphate ion PO3- as an intermediate. No other residue appears to fulfill the multiple roles of phosphate in biochemistry. Stable, negatively charged phosphates react under catalysis by enzymes; organic chemists, who can only rarely use enzymatic catalysis for their reactions, need more highly reactive intermediates than phosphates.

  13. Antisense oligonucleotides for the treatment of dyslipidaemia.

    Science.gov (United States)

    Visser, Maartje E; Witztum, Joseph L; Stroes, Erik S G; Kastelein, John J P

    2012-06-01

    Antisense oligonucleotides (ASOs) are short synthetic analogues of natural nucleic acids designed to specifically bind to a target messenger RNA (mRNA) by Watson-Crick hybridization, inducing selective degradation of the mRNA or prohibiting translation of the selected mRNA into protein. Antisense technology has the ability to inhibit unique targets with high specificity and can be used to inhibit synthesis of a wide range of proteins that could influence lipoprotein levels and other targets. A number of different classes of antisense agents are under development. To date, mipomersen, a 2'-O-methoxyethyl phosphorothioate 20-mer ASO, is the most advanced ASO in clinical development. It is a second-generation ASO developed to inhibit the synthesis of apolipoprotein B (apoB)-100 in the liver. In Phase 3 clinical trials, mipomersen has been shown to significantly reduce plasma low-density lipoprotein cholesterol (LDL-c) as well as other atherogenic apoB containing lipoproteins such as lipoprotein (a) [Lp(a)] and small-dense LDL particles. Although concerns have been raised because of an increase in intrahepatic triglyceride content, preliminary data from long-term studies suggest that with continued treatment, liver fat levels tend to stabilize or decline. Further studies are needed to evaluate potential clinical relevance of these changes. Proprotein convertase subtilisin/kexin-9 (PCSK9) is another promising novel target for lowering LDL-c by ASOs. Both second-generation ASOs and ASOs using locked nucleic acid technology have been developed to inhibit PCSK9 and are under clinical development. Other targets currently being addressed include apoC-III and apo(a) or Lp(a). By directly inhibiting the synthesis of specific proteins, ASO technology offers a promising new approach to influence the metabolism of lipids and to control lipoprotein levels. Its application to a wide variety of potential targets can be expected if these agents prove to be clinically safe and

  14. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    Science.gov (United States)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

  15. Novel complex MAD phasing and RNase H structural insights using selenium oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Abdur, Rob; Gerlits, Oksana O.; Gan, Jianhua; Jiang, Jiansheng; Salon, Jozef; Kovalevsky, Andrey Y.; Chumanevich, Alexander A.; Weber, Irene T.; Huang, Zhen, E-mail: huang@gsu.edu [Georgia State University, Atlanta, GA 30303 (United States)

    2014-02-01

    Selenium-derivatized oligonucleotides may facilitate phase determination and high-resolution structure determination for protein–nucleic acid crystallography. The Se atom-specific mutagenesis (SAM) strategy may also enhance the study of nuclease catalysis. The crystal structures of protein–nucleic acid complexes are commonly determined using selenium-derivatized proteins via MAD or SAD phasing. Here, the first protein–nucleic acid complex structure determined using selenium-derivatized nucleic acids is reported. The RNase H–RNA/DNA complex is used as an example to demonstrate the proof of principle. The high-resolution crystal structure indicates that this selenium replacement results in a local subtle unwinding of the RNA/DNA substrate duplex, thereby shifting the RNA scissile phosphate closer to the transition state of the enzyme-catalyzed reaction. It was also observed that the scissile phosphate forms a hydrogen bond to the water nucleophile and helps to position the water molecule in the structure. Consistently, it was discovered that the substitution of a single O atom by a Se atom in a guide DNA sequence can largely accelerate RNase H catalysis. These structural and catalytic studies shed new light on the guide-dependent RNA cleavage.

  16. Characteristic archaebacterial 16S rRNA oligonucleotides

    Science.gov (United States)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  17. Designer Metallic Acceptor-Containing Halogen Bonding: General Strategies.

    Science.gov (United States)

    Zhang, Xinxing; Bowen, Kit H

    2017-03-13

    Being electrostatic interactions in nature, hydrogen bonding (HB) and halogen bonding (XB) are considered to be two parallel worlds. In principle, all the applications that HB has could also be applied to XB. However, there has been no report on a metallic XB acceptor but metal anions have been observed to be good HB acceptors. This missing mosaic piece of XB is because common metal anions are reactive for XB donors. In view of this, we propose two strategies for designing metallic acceptor-containing XB using ab initio calculations. The first one is to utilize a metal cluster anion with a high electron detachment energy, such as the superatom, Al13- as the XB acceptor. The second strategy is to design a ligand passivated/protected metal core while it still can maintain the negative charge; several exotic clusters, such as PtH5-, PtZnH5- and PtMgH5-, are utilized as examples. Based on these two strategies, we anticipate that more metallic acceptor-containing XB will be discovered.

  18. Improving Photoconductance of Fluorinated Donors with Fluorinated Acceptors

    Energy Technology Data Exchange (ETDEWEB)

    Garner, Logan E.; Larson, Bryon; Oosterhout, Stefan; Owczarczyk, Zbyslaw; Olson, Dana C.; Kopidakis, Nikos; Boltalina, Olga V.; Strauss, Steven H.; Braunecker, Wade A.

    2016-11-21

    This work investigates the influence of fluorination of both donor and acceptor materials on the generation of free charge carriers in small molecule donor/fullerene acceptor BHJ OPV active layers. A fluorinated and non-fluorinated small molecule analogue were synthesized and their optoelectronic properties characterized. The intrinsic photoconductance of blends of these small molecule donors was investigated using time-resolved microwave conductivity. Blends of the two donor molecules with a traditional non-fluorinated fullerene (PC70BM) as well as a fluorinated fullerene (C60(CF3)2-1) were investigated using 5% and 50% fullerene loading. We demonstrate for the first time that photoconductance in a 50:50 donor:acceptor BHJ blend using a fluorinated fullerene can actually be improved relative to a traditional non-fluorinated fullerene by fluorinating the donor molecule as well.

  19. Hyperpolarizability studies of some nonconjugated twin donor–acceptor molecules

    Indian Academy of Sciences (India)

    Elizabeth Chirackal Varkey; Krishnapillai Sreekumar

    2011-07-01

    Extensive theoretical calculation on the effects of spacer length enhancement on the second-order NLO properties of twin donor acceptor molecules having two amide units bridged by the CH2 spacers was performed. The role of such aliphatic bridges on the Donor–Acceptor groups was computed by ZINDO/CV quantum chemical formalism. The odd-even effects were observed in twin donor acceptor systems (with two aliphatic units) linked by an alkyl spacer of varying length from = 1 to = 12. The system considered for the present study was ,'-alkane-(1, ) diyl bis-4-hydroxy hexanamides. For an odd number of CH2 spacers, the value was an order of magnitude higher than that for the even number of CH2 spacers. The origin for such oscillation is attributed to the similar oscillations in the dipole moment difference between the ground state and the dipole allowed state and to some extent on the variation in the oscillator strength.

  20. An overview of molecular acceptors for organic solar cells

    Directory of Open Access Journals (Sweden)

    Hudhomme Piétrick

    2013-07-01

    Full Text Available Organic solar cells (OSCs have gained serious attention during the last decade and are now considered as one of the future photovoltaic technologies for low-cost power production. The first dream of attaining 10% of power coefficient efficiency has now become a reality thanks to the development of new materials and an impressive work achieved to understand, control and optimize structure and morphology of the device. But most of the effort devoted to the development of new materials concerned the optimization of the donor material, with less attention for acceptors which to date remain dominated by fullerenes and their derivatives. This short review presents the progress in the use of non-fullerene small molecules and fullerene-based acceptors with the aim of evaluating the challenge for the next generation of acceptors in organic photovoltaics.

  1. Investigations of oligonucleotide usage variance within and between prokaryotes

    DEFF Research Database (Denmark)

    Bohlin, J.; Skjerve, E.; Ussery, David

    2008-01-01

    Oligonucleotide usage in archaeal and bacterial genomes can be linked to a number of properties, including codon usage (trinucleotides), DNA base-stacking energy (dinucleotides), and DNA structural conformation (di-to tetranucleotides). We wanted to assess the statistical information potential...... was that prokaryotic chromosomes can be described by hexanucleotide frequencies, suggesting that prokaryotic DNA is predominantly short range correlated, i. e., information in prokaryotic genomes is encoded in short oligonucleotides. Oligonucleotide usage varied more within AT-rich and host-associated genomes than...... in GC-rich and free-living genomes, and this variation was mainly located in non-coding regions. Bias (selectional pressure) in tetranucleotide usage correlated with GC content, and coding regions were more biased than non-coding regions. Non-coding regions were also found to be approximately 5.5% more...

  2. Delivery of RNAi-Based Oligonucleotides by Electropermeabilization

    Directory of Open Access Journals (Sweden)

    Muriel Golzio

    2013-04-01

    Full Text Available For more than a decade, understanding of RNA interference (RNAi has been a growing field of interest. The potent gene silencing ability that small oligonucleotides have offers new perspectives for cancer therapeutics. One of the present limits is that many biological barriers exist for their efficient delivery into target cells or tissues. Electropermeabilization (EP is one of the physical methods successfully used to transfer small oligonucleotides into cells or tissues. EP consists in the direct application of calibrated electric pulses to cells or tissues that transiently permeabilize the plasma membranes, allowing efficient in vitro and in vivo. cytoplasmic delivery of exogenous molecules. The present review reports on the type of therapeutic RNAi-based oligonucleotides that can be electrotransferred, the mechanism(s of their electrotransfer and the technical settings for pre-clinical purposes.

  3. Retro-1 Analogues Differentially Affect Oligonucleotide Delivery and Toxin Trafficking.

    Science.gov (United States)

    Yang, Bing; Ming, Xin; Abdelkafi, Hajer; Pons, Valerie; Michau, Aurelien; Gillet, Daniel; Cintrat, Jean-Christophe; Barbier, Julien; Juliano, Rudy

    2016-11-21

    Retro-1 is a small molecule that displays two important biological activities: First, it blocks the actions of certain toxins by altering their intracellular trafficking. Second, it enhances the activity of oligonucleotides by releasing them from entrapment in endosomes. This raises the question of whether the two actions involve the same cellular target. Herein we report the effects of several Retro-1 analogues on both toxins and oligonucleotides. We found analogues that affect toxins but not oligonucleotides and vice-versa, while Retro-1 is the only compound that affects both. This indicates that the molecular target(s) involved in the two processes are distinct. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

    Science.gov (United States)

    Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

    2016-01-01

    Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

  5. Comparable Stability of Hoogsteen and Watson–Crick Base Pairs in Ionic Liquid Choline Dihydrogen Phosphate

    OpenAIRE

    Hisae Tateishi-Karimata; Miki Nakano; Naoki Sugimoto

    2014-01-01

    The instability of Hoogsteen base pairs relative to Watson–Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson–Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stabi...

  6. Discussion about magnesium phosphating

    Directory of Open Access Journals (Sweden)

    P. Pokorny

    2016-07-01

    Full Text Available The paper describes results from recently published research focused on production of non-conventional magnesium phosphate Mg3(PO42・4H2O – bobierrite, or MgHPO4・3H2O – newberyite coating for both magnesium alloys and/or mild steel. This new kind of coating is categorized in the context of current state of phosphating technology and its potential advantages and crystal structure is discussed. At the same time, the suitable comparison techniques for magnesium phosphate coating and conventional zinc phosphate coating are discussed.

  7. Oligonucleotide Therapy for Obstructive and Restrictive Respiratory Diseases

    Directory of Open Access Journals (Sweden)

    Wupeng Liao

    2017-01-01

    Full Text Available Inhaled oligonucleotide is an emerging therapeutic modality for various common respiratory diseases, including obstructive airway diseases like asthma and chronic obstructive pulmonary disease (COPD and restrictive airway diseases like idiopathic pulmonary fibrosis (IPF. The advantage of direct accessibility for oligonucleotide molecules to the lung target sites, bypassing systemic administration, makes this therapeutic approach promising with minimized potential systemic side effects. Asthma, COPD, and IPF are common chronic respiratory diseases, characterized by persistent airway inflammation and dysregulated tissue repair and remodeling, although each individual disease has its unique etiology. Corticosteroids have been widely prescribed for the treatment of asthma, COPD, and IPF. However, the effectiveness of corticosteroids as an anti-inflammatory drug is limited by steroid resistance in severe asthma, the majority of COPD cases, and pulmonary fibrosis. There is an urgent medical need to develop target-specific drugs for the treatment of these respiratory conditions. Oligonucleotide therapies, including antisense oligonucleotide (ASO, small interfering RNA (siRNA, and microRNA (miRNA are now being evaluated both pre-clinically and clinically as potential therapeutics. The mechanisms of action of ASO and siRNA are highly target mRNA specific, ultimately leading to target protein knockdown. miRNA has both biomarker and therapeutic values, and its knockdown by a miRNA antagonist (antagomir has a broader but potentially more non-specific biological outcome. This review will compile the current findings of oligonucleotide therapeutic targets, verified in various respiratory disease models and in clinical trials, and evaluate different chemical modification approaches to improve the stability and potency of oligonucleotides for the treatment of respiratory diseases.

  8. Oligonucleotide Therapy for Obstructive and Restrictive Respiratory Diseases.

    Science.gov (United States)

    Liao, Wupeng; Dong, Jinrui; Peh, Hong Yong; Tan, Lay Hong; Lim, Kah Suan; Li, Li; Wong, Wai-Shiu Fred

    2017-01-17

    Inhaled oligonucleotide is an emerging therapeutic modality for various common respiratory diseases, including obstructive airway diseases like asthma and chronic obstructive pulmonary disease (COPD) and restrictive airway diseases like idiopathic pulmonary fibrosis (IPF). The advantage of direct accessibility for oligonucleotide molecules to the lung target sites, bypassing systemic administration, makes this therapeutic approach promising with minimized potential systemic side effects. Asthma, COPD, and IPF are common chronic respiratory diseases, characterized by persistent airway inflammation and dysregulated tissue repair and remodeling, although each individual disease has its unique etiology. Corticosteroids have been widely prescribed for the treatment of asthma, COPD, and IPF. However, the effectiveness of corticosteroids as an anti-inflammatory drug is limited by steroid resistance in severe asthma, the majority of COPD cases, and pulmonary fibrosis. There is an urgent medical need to develop target-specific drugs for the treatment of these respiratory conditions. Oligonucleotide therapies, including antisense oligonucleotide (ASO), small interfering RNA (siRNA), and microRNA (miRNA) are now being evaluated both pre-clinically and clinically as potential therapeutics. The mechanisms of action of ASO and siRNA are highly target mRNA specific, ultimately leading to target protein knockdown. miRNA has both biomarker and therapeutic values, and its knockdown by a miRNA antagonist (antagomir) has a broader but potentially more non-specific biological outcome. This review will compile the current findings of oligonucleotide therapeutic targets, verified in various respiratory disease models and in clinical trials, and evaluate different chemical modification approaches to improve the stability and potency of oligonucleotides for the treatment of respiratory diseases.

  9. A novel catechol-based universal support for oligonucleotide synthesis.

    Science.gov (United States)

    Anderson, Keith M; Jaquinod, Laurent; Jensen, Michael A; Ngo, Nam; Davis, Ronald W

    2007-12-21

    A novel universal support for deoxyribo- and ribonucleic acid synthesis has been developed. The support, constructed from 1,4-dimethoxycatechol, represents an improvement over existing universal supports because of its ability to cleave and deprotect under mild conditions in standard reagents. Because no nonvolatile additives are required for cleavage and deprotection, the synthesized oligonucleotides do not require purification prior to use in biochemical assays. Using reverse phase HPLC and electrospray mass spectroscopy, it was determined that oligonucleotides synthesized on the universal support (UL1) 3'-dephosphorylate quickly (9 h in 28-30% ammonium hydroxide (NH4OH) at 55 degrees C, 2 h in 28-30% NH4OH at 80 degrees C, or <1 h in ammonium hydroxide/methylamine (1:1) (AMA) at 80 degrees C). Oligonucleotides used as primers for the polymerase chain reaction (PCR) assay were found to perform identically to control primers, demonstrating full biological compatibility. In addition, a method was developed for sintering the universal support directly into a filter plug which can be pressure fit into the synthesis column of a commercial synthesizer. The universal support plugs allow the synthesis of high-quality oligonucleotides at least 120 nucleotides in length, with purity comparable to non-universal commercial supports and approximately 50% lower reagent consumption. The universal support plugs are routinely used to synthesize deoxyribo-, ribo-, 3'-modified, 5'-modified, and thioated oligonucleotides. The flexibility of the universal support and the efficiency of 3'-dephosphorylation are expected to increase the use of universal supports in oligonucleotide synthesis.

  10. Survival of the fittest before the beginning of life: selection of the first oligonucleotide-like polymers by UV light

    Directory of Open Access Journals (Sweden)

    Cherepanov Dmitry A

    2003-05-01

    Full Text Available Abstract Background A key event in the origin of life on this planet has been formation of self-replicating RNA-type molecules, which were complex enough to undergo a Darwinian-type evolution (origin of the "RNA world". However, so far there has been no explanation of how the first RNA-like biopolymers could originate and survive on the primordial Earth. Results As condensation of sugar phosphates and nitrogenous bases is thermodynamically unfavorable, these compounds, if ever formed, should have undergone rapid hydrolysis. Thus, formation of oligonucleotide-like structures could have happened only if and when these structures had some selective advantage over simpler compounds. It is well known that nitrogenous bases are powerful quenchers of UV quanta and effectively protect the pentose-phosphate backbones of RNA and DNA from UV cleavage. To check if such a protection could play a role in abiogenic evolution on the primordial Earth (in the absence of the UV-protecting ozone layer, we simulated, by using Monte Carlo approach, the formation of the first oligonucleotides under continuous UV illumination. The simulations confirmed that UV irradiation could have worked as a selective factor leading to a relative enrichment of the system in longer sugar-phosphate polymers carrying nitrogenous bases as UV-protectors. Partial funneling of the UV energy into the condensation reactions could provide a further boost for the oligomerization. Conclusion These results suggest that accumulation of the first polynucleotides could be explained by their abiogenic selection as the most UV-resistant biopolymers.

  11. PHOTOINDUCED CHARGE TRANSFER POLYMERIZATION OF STYRENE INITIATED BY ELECTRON ACCEPTOR

    Institute of Scientific and Technical Information of China (English)

    CAO Weixiao; ZHANG Peng; FENG Xinde

    1995-01-01

    Photoinduced charge transfer polymerization of styrene(St) with electron acceptor as initiator was investigated. In case of fumaronitrile (FN) or maleic anhydride (MA) as initiator the polymerization takes place regularly, whereas the tetrachloro-1, 4-benzenequinone (TCQ), 2, 3-dichloro-5, 6-dicyano-1, 4-benzenequinone (DDQ) . or tetracyano ethylene (TCNE) as initiator the polymerization proceeds reluctantly only after the photoaddition reaction. A mechanism was proposed that free radicals would be formed following the charge and proton transfer in the exciplex formed between St and electron acceptors.

  12. Lipid-modified G4-decoy oligonucleotide anchored to nanoparticles

    DEFF Research Database (Denmark)

    Cogoi, S; Jakobsen, U; Pedersen, E B

    2016-01-01

    KRAS is mutated in >90% of pancreatic ductal adenocarcinomas. As its inactivation leads to tumour regression, mutant KRAS is considered an attractive target for anticancer drugs. In this study we report a new delivery strategy for a G4-decoy oligonucleotide that sequesters MAZ, a transcription...... factor essential for KRAS transcription. It is based on the use of palmitoyl-oleyl-phosphatidylcholine (POPC) liposomes functionalized with lipid-modified G4-decoy oligonucleotides and a lipid-modified cell penetrating TAT peptide. The potency of the strategy in pancreatic cancer cells is demonstrated...

  13. Inhibition of microRNA with antisense oligonucleotides.

    Science.gov (United States)

    Esau, Christine C

    2008-01-01

    Antisense inhibition of microRNA (miRNA) function has been an important tool for uncovering miRNA biology. Chemical modification of anti-miRNA oligonucleotides (AMOs) is necessary to improve affinity for target miRNA, stabilize the AMO to nuclease degradation, and to promote tissue uptake for in vivo delivery. Here I summarize the work done to evaluate the effectiveness of various chemically modified AMOs for use in cultured cells and rodent models, and outline important issues to consider when inhibiting miRNAs with antisense oligonucleotides.

  14. Synthesis of Peptide-Oligonucleotide Conjugates Using a Heterobifunctional Crosslinker

    Science.gov (United States)

    Williams, Berea A.R.; Chaput, John C.

    2010-01-01

    Peptide-oligonucleotide conjugates (POCs) are molecular chimeras composed of a nucleic acid moiety covalently attached to a polypeptide moiety. POCs have been used in numerous applications from therapeutics to nanotechnology, and most recently as combinatorial agents in the assembly of bivalent protein affinity reagents. This unit describes the synthesis and purification of POC molecules using the heterobifunctional crosslinking reagent succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), which enables amine-modified oligonucleotides to become covalently linked to cysteine-modified polypeptides. This solution-based protocol consists of a two-step synthesis followed by a single purification step. PMID:20827717

  15. Versatile functionalization of nanoelectrodes by oligonucleotides via pyrrole electrochemistry.

    Science.gov (United States)

    Descamps, Emeline; Nguyen, Khoa; Bouchain-Gautier, Christelle; Filoramo, Arianna; Goux-Capes, Laurence; Goffman, Marcello; Bourgoin, Jean-Philippe; Mailley, Pascal; Livache, Thierry

    2010-11-15

    Surface modification at the nanometer scale is a challenge for the future of molecular electronics. In particular, the precise anchoring and electrical addressing of biological scaffolds such as complex DNA nanonetworks is of importance for generating bio-directed assemblies of nano-objects for nanocircuit purposes. Herein, we consider the individual modification of nanoelectrodes with different oligonucleotide sequences by an electrochemically driven co-polymerization process of pyrrole and modified oligonucleotide sequences bearing pyrrole monomers. We demonstrate that this one-step technique presents the advantages of simplicity, localization of surface modification, mechanical, biological and chemical stability of the coatings, and high lateral resolution.

  16. Anti sense and sensibility : renal and skin effects of (antisense) oligonucleotides

    NARCIS (Netherlands)

    Meer, van L.

    2017-01-01

    This thesis describes the clinical investigation of a novel treatment strategy for type 2 diabetes mellitus (t2dm) using an antisense oligonucleotide(aon)to inhibit the sglt2 receptor. Furthermore it describes skin effects of oligonucleotides

  17. Delivery of antisense oligonucleotides using cholesterol-modified sense dendrimers and cationic lipids

    NARCIS (Netherlands)

    Chaltin, Patrick; Margineanu, Anca; Marchand, Damien; Aerschot, Arthur Van; Rozenski, Jef; Schryver, Frans De; Herrmann, Andreas; Müllen, Klaus; Juliano, Rudolph; Fisher, Michael H.; Kang, Hyunmin; Feyter, Steven De; Herdewijn, Piet

    2005-01-01

    Cholesterol modified mono-, di-, and tetrameric oligonucleotides were synthesized and hybridized with antisense oligonucleotides to study their incorporation in cationic liposomes together with the influence of this dendrimeric delivery system on biological activity. Electrostatic interactions seem

  18. Acceptors in II-IV Semiconductors - Incorporation and Complex Formation

    CERN Multimedia

    2002-01-01

    A strong effort is currently devoted to the investigation of defects and the electrical activation of dopant atoms in II-VI semiconductors. In particular, the knowledge about the behaviour of acceptors, prerequisite for the fabrication of p-type semiconductors, is rather limited. The perturbed $\\,{\\gamma\\gamma}$ -angular correlation technique (PAC) and the photoluminescence spectroscopy (PL) using the radioactive isotopes $^{77}\\!$Br and $^{111}\\!$Ag will be applied for investigating the behaviour of acceptor dopant atoms and their interactions with defects in II-VI semiconductors. The main topic will be the identification of the technical conditions for the incorporation of electrically active acceptors in the II-VI semiconductors ~ZnS, ZnSe, ZnTe, CdS, CdSe, and CdTe with particular emphasis on the compounds~ CdTe, ZnSe, and ZnTe. The investigations will be supplemented by first exploratory PL experiments with the group V acceptors $^{71}\\!$As and $^{121}\\!$Sb. With help of the probe $^{111}\\!$Ag, the pos...

  19. Fluorescence Resonance Energy Transfer Using Spiropyran and Diarylethene Photochromic Acceptors

    Directory of Open Access Journals (Sweden)

    E. A. Jares-Erijman

    2000-03-01

    Full Text Available We describe the preparation and photophysical characterization of two model compounds designed to test a new approach for the quantitative determination of Fluorescence Resonance Energy Transfer (FRET in biological systems. The method enables modulation of FRET by exploiting the unique reversible spectral properties of photochromic diarylethenes and spiropyrans to create switchable energy acceptors.

  20. Excitation energy transfer in donor-bridge-acceptor systems.

    Science.gov (United States)

    Albinsson, Bo; Mårtensson, Jerker

    2010-07-21

    This perspective will focus on the mechanistic aspects of singlet and triplet excitation energy transfer. Well defined donor-bridge-acceptor systems specifically designed for investigating the distance and energy gap dependencies of the energy transfer reactions are discussed along with some recent developments in computational modeling of the electronic coupling.

  1. Role of bicarbonate at the acceptor side of photosystem II

    NARCIS (Netherlands)

    Rensen, van J.J.S.

    2002-01-01

    Besides being the substrate for the carboxylation reaction of photosynthesis, CO2 (bicarbonate) is required for the activity of Photosystem II (water plastoquinone oxido-reductase). It plays a role on the electron donor side as well as the electron acceptor side. In this contribution, attention will

  2. Covalent non-fused tetrathiafulvalene-acceptor systems.

    Science.gov (United States)

    Pop, Flavia; Avarvari, Narcis

    2016-06-28

    Covalent donor-acceptor (D-A) systems have significantly contributed to the development of many organic materials and to molecular electronics. Tetrathiafulvalene (TTF) represents one of the most widely studied donor precursors and has been incorporated into the structure of many D-A derivatives with the objective of obtaining redox control and modulation of the intramolecular charge transfer (ICT), in order to address switchable emissive systems and to take advantage of its propensity to form regular stacks in the solid state. In this review, we focus on the main families of non-fused TTF-acceptors, which are classified according to the nature of the acceptor: nitrogen-containing heterocycles, BODIPY, perylenes and electron poor unsaturated hydrocarbons, as well as radical acceptors. We describe herein the most representative members of each family with a brief mention of their synthesis and a special focus on their D-A characteristics. Special attention is given to ICT and its modulation, fluorescence quenching and switching, photoconductivity, bistability and spin distribution by discussing and comparing spectroscopic and electrochemical features, photophysical properties, solid-state properties and theoretical calculations.

  3. Poly(trifluoromethyl)azulenes: structures and acceptor properties.

    Science.gov (United States)

    Clikeman, Tyler T; Bukovsky, Eric V; Kuvychko, Igor V; San, Long K; Deng, Shihu H M; Wang, Xue-Bin; Chen, Yu-Sheng; Strauss, Steven H; Boltalina, Olga V

    2014-06-14

    Six new poly(trifluoromethyl)azulenes prepared in a single high-temperature reaction exhibit strong electron accepting properties in the gas phase and in solution and demonstrate the propensity to form regular π-stacked columns in donor-acceptor crystals when mixed with pyrene as a donor.

  4. Development of imide- and imidazole-containing electron acceptors for use in donor-acceptor conjugated compounds and polymers

    Science.gov (United States)

    Li, Duo

    Conjugated organic compounds and polymers have attracted significant attention due to their potential application in electronic devices as semiconducting materials, such as organic solar cells (OSCs). In order to tune band gaps, donor-acceptor (D-A) structure is widely used, which has been proved to be one of the most effective strategies. This thesis consists of three parts: 1) design, syntheses and characterization of new weak acceptors based on imides and the systematic study of the structure-property relationship; (2) introduction of weak and strong acceptors in one polymer to achieve a broad coverage of light absorption and improve the power conversion efficiency (PCE); (3) modification of benzothiadiazole (BT) acceptor in order to increase the electron withdrawing ability. Imide-based electron acceptors, 4-(5-bromothiophen-2-y1)-2-(2-ethylhexyl)-9- phenyl- 1H-benzo[f]isoindole-1,3(2H)-dione (BIDO-1) and 4,9-bis(5-bromothiophen-2-yl)-2-(2-ethylhexyl)-benzo[f]isoindole-1,3-dione (BIDO-2), were designed and synthesized. In this design, naphthalene is selected as its main core to maintain a planar structure, and thienyl groups are able to facilitate the bromination reaction and lower the band gap. BIDO-1 and BIDO-2 were successfully coupled with different donors by both Suzuki cross-coupling and Stille cross-coupling reactions. Based on the energy levels and band gaps of the BIDO-containing compounds and polymers, BIDO-1 and BIDO-2 are proved to be weak electron acceptors. Pyromellitic diimide (PMDI) was also studied and found to be a stronger electron acceptor than BIDO . In order to obtain broad absorption coverage, both weak acceptor ( BIDO-2) and strong acceptor diketopyrrolopyrrole (DPP) were introduced in the same polymer. The resulting polymers show two absorption bands at 400 and 600 nm and two emission peaks at 500 and 680 nm. The band gaps of the polymers are around 1.6 eV, which is ideal for OSC application. The PCE of 1.17% was achieved. Finally

  5. Anaerobic methanotrophy in tidal wetland: Effects of electron acceptors

    Science.gov (United States)

    Lin, Li-Hung; Yu, Zih-Huei; Wang, Pei-Ling

    2016-04-01

    Wetlands have been considered to represent the largest natural source of methane emission, contributing substantially to intensify greenhouse effect. Despite in situ methanogenesis fueled by organic degradation, methanotrophy also plays a vital role in controlling the exact quantity of methane release across the air-sediment interface. As wetlands constantly experience various disturbances of anthropogenic activities, biological burrowing, tidal inundation, and plant development, rapid elemental turnover would enable various electron acceptors available for anaerobic methanotrophy. The effects of electron acceptors on stimulating anaerobic methanotrophy and the population compositions involved in carbon transformation in wetland sediments are poorly explored. In this study, sediments recovered from tidally influenced, mangrove covered wetland in northern Taiwan were incubated under the static conditions to investigate whether anaerobic methanotrophy could be stimulated by the presence of individual electron acceptors. Our results demonstrated that anaerobic methanotrophy was clearly stimulated in incubations amended with no electron acceptor, sulfate, or Fe-oxyhydroxide. No apparent methane consumption was observed in incubations with nitrate, citrate, fumarate or Mn-oxides. Anaerobic methanotrophy in incubations with no exogenous electron acceptor appears to proceed at the greatest rates, being sequentially followed by incubations with sulfate and Fe-oxyhydroxide. The presence of basal salt solution stimulated methane oxidation by a factor of 2 to 3. In addition to the direct impact of electron acceptor and basal salts, incubations with sediments retrieved from low tide period yielded a lower rate of methane oxidation than from high tide period. Overall, this study demonstrates that anaerobic methanotrophy in wetland sediments could proceed under various treatments of electron acceptors. Low sulfate content is not a critical factor in inhibiting methane

  6. Effects of fluid flow on the oligonucleotide folding in single-walled carbon nanotubes.

    Science.gov (United States)

    Lim, M C G; Zhong, Z W

    2009-10-01

    This paper presents molecular-dynamics (MD) simulations of DNA oligonucleotide and water molecules translocating through carbon nanotube (CNT) channels. An induced pressure difference is applied to the system by pushing a layer of water molecules toward the flow direction to drive the oligonucleotide and other molecules. This MD simulation investigates the changes that occur in the conformation of the oligonucleotide due to water molecules in nanochannels while controlling the temperature and volume of the system in a canonical ensemble. The results show that the oligonucleotide in the (8,8)-(12,12) CNT channel forms a folded state at a lower pressure, whereas the oligonucleotide in the (10,10)-(14,14) CNT channel forms a folded state at a higher pressure instead. The van der Waals forces between the water molecules and the oligonucleotide suggest that the attraction between these two types of molecules results in the linear arrangements of the bases of the oligonucleotide. For a larger nanotube channel, the folding of the oligonucleotide is mainly dependent on the solvent (water molecules), whereas pressure, the size of the nanotube junction, and water molecules are the considering factors of the folding of the oligonucleotide at a smaller nanotube channel. For a folded oligonucleotide, the water distribution around the oligonucleotide is concentrated at a smaller range than that for the distribution around an unfolded oligonucleotide.

  7. Folding Topology of a Short Coiled-Coil Peptide Structure Templated by an Oligonucleotide Triplex

    DEFF Research Database (Denmark)

    Lou, Chenguang; Christensen, Niels Johan; Martos Maldonado, Manuel Cristo

    2017-01-01

    by oligonucleotide duplex and triplex formation. POC synthesis was achieved by copper-free alkyne-azide cycloaddition between three oligonucleotides and a 23-mer peptide, which by itself exhibited multiple oligomeric states in solution. The oligonucleotide domain was designed to furnish a stable parallel triplex...

  8. Oligonucleotide-directed mutagenesis for precision gene editing.

    Science.gov (United States)

    Sauer, Noel J; Mozoruk, Jerry; Miller, Ryan B; Warburg, Zachary J; Walker, Keith A; Beetham, Peter R; Schöpke, Christian R; Gocal, Greg F W

    2016-02-01

    Differences in gene sequences, many of which are single nucleotide polymorphisms, underlie some of the most important traits in plants. With humanity facing significant challenges to increase global agricultural productivity, there is an urgent need to accelerate the development of these traits in plants. oligonucleotide-directed mutagenesis (ODM), one of the many tools of Cibus' Rapid Trait Development System (RTDS(™) ) technology, offers a rapid, precise and non-transgenic breeding alternative for trait improvement in agriculture to address this urgent need. This review explores the application of ODM as a precision genome editing technology, with emphasis on using oligonucleotides to make targeted edits in plasmid, episomal and chromosomal DNA of bacterial, fungal, mammalian and plant systems. The process of employing ODM by way of RTDS technology has been improved in many ways by utilizing a fluorescence conversion system wherein a blue fluorescent protein (BFP) can be changed to a green fluorescent protein (GFP) by editing a single nucleotide of the BFP gene (CAC→TAC; H66 to Y66). For example, dependent on oligonucleotide length, applying oligonucleotide-mediated technology to target the BFP transgene in Arabidopsis thaliana protoplasts resulted in up to 0.05% precisely edited GFP loci. Here, the development of traits in commercially relevant plant varieties to improve crop performance by genome editing technologies such as ODM, and by extension RTDS, is reviewed.

  9. Differential oligonucleotide activity in cell culture versus mouse models.

    Science.gov (United States)

    Wickstrom, E; Tyson, F L

    1997-01-01

    The usual course of drug discovery begins with the demonstration of compound activity in cells and, usually, a lower level of activity in animals. Successive rounds of drug design may result in a compound with sufficient activity in animals to justify clinical trials. The basic endpoints of therapeutic oligonucleotide experiments include target antigen reduction, target messenger reduction and inhibition of transformed cell proliferation or viral replication. However, one should expect oligonucleotides to exhibit pleiotropic behaviour, as do all other drugs. In an animal oligonucleotides will necessarily bind to and dissociate from all macromolecules encountered in the blood, in tissues, on cell surfaces and within cellular compartments. Contrary to expectations, oligonucleotides designed to be complementary to certain transcripts have sometimes been found moderately effective in cell-free extracts, more effective in cell culture and most effective in animal models. If greater potency against standard endpoints is reported in mouse models than was observed in cell culture, critical examination must consider alternate modes of action in animals that may not apply in cell culture. This counterintuitive paradox will be examined, based on studies of Ha-ras expression in bladder cancer, Ki-ras expression in pancreatic cancer, erbB2 expression in ovarian cancer and c-myc expression in B cell lymphoma.

  10. Chromosome-specific painting in Cucumis species using bulked oligonucleotides

    Science.gov (United States)

    Chromosome-specific painting is a powerful technique in molecular cytogenetic and genome research. We developed an oligonucleotide (oligo)-based chromosome painting technique in cucumber (Cucumis sativus) that will be applicable in any plant species with a sequenced genome. Oligos specific to a sing...

  11. Splice-switching antisense oligonucleotides as therapeutic drugs

    National Research Council Canada - National Science Library

    Havens, Mallory A; Hastings, Michelle L

    2016-01-01

    Splice-switching oligonucleotides (SSOs) are short, synthetic, antisense, modified nucleic acids that base-pair with a pre-mRNA and disrupt the normal splicing repertoire of the transcript by blocking the RNA-RNA base-pairing or protein-RNA...

  12. Antithrombotic effect of antisense factor XI oligonucleotide treatment in primates.

    Science.gov (United States)

    Crosby, Jeffrey R; Marzec, Ulla; Revenko, Alexey S; Zhao, Chenguang; Gao, Dacao; Matafonov, Anton; Gailani, David; MacLeod, A Robert; Tucker, Erik I; Gruber, Andras; Hanson, Stephen R; Monia, Brett P

    2013-07-01

    During coagulation, factor IX (FIX) is activated by 2 distinct mechanisms mediated by the active proteases of either FVIIa or FXIa. Both coagulation factors may contribute to thrombosis; FXI, however, plays only a limited role in the arrest of bleeding. Therefore, therapeutic targeting of FXI may produce an antithrombotic effect with relatively low hemostatic risk. We have reported that reducing FXI levels with FXI antisense oligonucleotides produces antithrombotic activity in mice, and that administration of FXI antisense oligonucleotides to primates decreases circulating FXI levels and activity in a dose-dependent and time-dependent manner. Here, we evaluated the relationship between FXI plasma levels and thrombogenicity in an established baboon model of thrombosis and hemostasis. In previous studies with this model, antibody-induced inhibition of FXI produced potent antithrombotic effects. In the present article, antisense oligonucleotides-mediated reduction of FXI plasma levels by ≥ 50% resulted in a demonstrable and sustained antithrombotic effect without an increased risk of bleeding. These results indicate that reducing FXI levels using antisense oligonucleotides is a promising alternative to direct FXI inhibition, and that targeting FXI may be potentially safer than conventional antithrombotic therapies that can markedly impair primary hemostasis.

  13. Systematic design of mouse Vh gene family-specific oligonucleotides

    NARCIS (Netherlands)

    Seijen, AM; Seijen, HG; Bos, NA

    2001-01-01

    Kabat's database has often been used to design mouse Vh gene-specific 5 ' primers. The emphasis was mostly on constructing a universal (degenerate) 5 ' primer or 5 ' primer set, which would be able to match every mouse Vh gene. We were interested in finding oligonucleotides that could be used as pri

  14. Regioselective immobilization of short oligonucleotides to acrylic copolymer gels.

    Science.gov (United States)

    Timofeev, E; Kochetkova, S V; Mirzabekov, A D; Florentiev, V L

    1996-01-01

    Four types of polyacrylamide or polydimethyl-acrylamide gels for regioselective (by immobilization at the 3' end) of short oligonucleotides have been designed for use in manufacturing oligonucleotide microchips. Two of these supports contain amino or aldehyde groups in the gel, allowing coupling with oligonucleotides bearing aldehyde or amino groups, respectively, in the presence of a reducing agent. The aldehyde gel support showed a higher immobilization efficiency relative to the amino gel. Of all reducing agents tested, the best results were obtained with a pyridine-borane complex. The other supports are based on an acrylamide gel activated with glutaraldehyde or a hydroxyalkyl-functionalized gel treated with mesyl chloride. The use of dimethylacrylamide instead of acrylamide allows subsequent gel modifications in organic solvents. All the immobilization methods are easy and simple to perform, give high and reproducible yields, allow long durations of storage of the activated support, and provide high stability of attachment and low non-specific binding. Although these gel supports have been developed for preparing oligonucleotide microchips, they may be used for other purposes as well. PMID:8774893

  15. LNA 5'-phosphoramidites for 5'→3'-oligonucleotide synthesis

    DEFF Research Database (Denmark)

    Madsen, Andreas Stahl; Kumar, Santhosh T.; Wengel, Jesper

    2010-01-01

    Hereby we report an efficient synthesis of LNA thymine and LNA 5-methylcytosine 5′-phosphoramidites, allowing incorporation of LNA thymine and LNA 5-methylcytosine into oligonucleotides synthesized in the 5′→3′ direction. Key steps include regioselective enzymatic benzoylation of the 5′-hydroxy...

  16. Systematic design of mouse Vh gene family-specific oligonucleotides

    NARCIS (Netherlands)

    Seijen, AM; Seijen, HG; Bos, NA

    2001-01-01

    Kabat's database has often been used to design mouse Vh gene-specific 5 ' primers. The emphasis was mostly on constructing a universal (degenerate) 5 ' primer or 5 ' primer set, which would be able to match every mouse Vh gene. We were interested in finding oligonucleotides that could be used as pri

  17. Radioactivity of phosphate mineral products

    OpenAIRE

    Mitrović Branislava; Vitorović Gordana; Stojanović Mirjana; Vitorović Duško

    2011-01-01

    The phosphate industry is one of the biggest polluters of the environment with uranium. Different products are derived after processing phosphoric ore, such as mineral and phosphate fertilizers and phosphate mineral supplements (dicalcium-and monocalcium phosphate) for animal feeding. Phosphate mineral additives used in animal food may contain a high activity of uranium. Research in this study should provide an answer to the extent in which phosphate minera...

  18. Glycoclusters on oligonucleotide and PNA scaffolds: synthesis and applications.

    Science.gov (United States)

    Spinelli, Nicolas; Defrancq, Eric; Morvan, François

    2013-06-07

    Conjugation of oligonucleotides (ONs) to a variety of reporter groups has been the subject of intensive research during the last decade. Conjugation is indeed of great interest because it can be used not only to improve the existing ONs properties but also to impart new ones. In this context tremendous efforts have been made to conjugate carbohydrate moieties to ONs. Indeed carbohydrates play an important role in biological processes such as signal transduction and cell adhesion through the recognition with sugar-binding proteins (i.e. lectins) located on the surface of cells. For this reason, carbohydrate-oligonucleotide conjugates (COCs) have been first developed for improving the poor cellular uptake or tissue specific delivery of ONs through receptor-mediated endocytosis. Besides the targeted ONs delivery, carbohydrate-oligonucleotide conjugates (COCs) are also evaluated in the context of carbohydrate biochips in which surface coating with carbohydrates is achieved by using the DNA-directed immobilization strategy (DDI). Peptide nucleic acids (PNAs) have also been extensively investigated as a surrogate of DNA for diverse applications. Therefore attachment of carbohydrate moieties to this class of molecules has been studied. The aforementioned applications of COCs require mimicking of the natural processes, in which the weak individual protein-carbohydrate binding is overcome by using multivalent interactions. This tutorial review focuses on the recent advances in carbohydrate-oligonucleotide conjugates and describes the major synthetic approaches available. In addition, an overview of applications that have been developed using various scaffolds allowing multivalent interactions is provided. Finally recent results on the use of peptide nucleic acids as oligonucleotides surrogate are described.

  19. Synthesis and X-ray crystal structure of the first tetrathiafulvalene-based acceptor-donor-acceptor sandwich

    DEFF Research Database (Denmark)

    Simonsen, Klaus B.; Thorup, Niels; Cava, Michael P.

    1998-01-01

    The synthesis and characterization of a bis-macrocyclic A-D-A sandwich produced in a simple one-pot reaction is reported. Only one acceptor unit participates in charge-transfer interactions with the TTF unit in the solid state....

  20. Preparation of liposome-coated oligonucleotide labeled with 99mTc and its uptake in vascular smooth muscle cells

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    To explore the preparation method of liposome-coated 99mTc-labeled antisense oligonucleotide (ASON),targeteing the proliferating cell nuclear antigen (PCNA), and to explore the biological characteristics and the uptake kinetics of a radiolabeled probe in vascular smooth muscle cells, an 18-base single-stranded antisense oligonucleotide targeting PCNA mRNA and the complementary strand (sense oligonucleotide, SON) were synthesized. The ASON (SON) was labeled with 99mTc, by conjugating the bifunctional chelator (hydrazino nicotinamide, HYNIC), and purified through a gel filtration column of Sephadex G-25. The product was then encapsulated in cationic liposome (oligofectamineTM). The radiolabeling efficiency, radiochemical purity, stability of the liposome-coated 99mTc-HYNIC-ASON in a phosphate buffered solution (PBS), and fresh human serum and its uptake rate were studied. There was no significant difference between the 99mTc radiolabeling efficiencies of HYNIC-ASON and HYNIC-SON, which were 60.04% ± 1.92% and 59.60% ± 2.53%, respectively (P > 0.05, n = 5). The radiochemical purity of the liposome-coated 99mTc-HYNIC-ASON was 94.70% ± 1.90% (n = 5). And after incubation with PBS and fresh human seAt 90 min after transfection, the uptake rate of the liposome-coated 99mTc-HYNIC-ASON reached its peak of 83.8% ±5.92% in vascular smooth muscle cells (VSMCs) and was much higher than that of the nonliposome-coated 99mTc-HYNIC-ASON, which was 11.16% ± 0.54% (P < 0.01, n = 4). The labeling method of PCNA ASON (SON) conjugated by HYNIC has been proved successful. The liposome was able to enhance the ASON (SON) uptake in VSMCs,and could be widely used as a safe, convenient, effective gene transfer carrier.

  1. 3-(N-tert-butylcarboxamido)-1-propyl and 4-oxopentyl groups for phosphate/thiophosphate protection in oligodeoxyribonucleotide synthesis.

    Science.gov (United States)

    Wilk, Andrzej; Chmielewski, Marcin K; Grajkowski, Andrzej; Beaucage, Serge L; Phillips, Lawrence R

    2003-02-01

    This unit provides procedures for the preparation of deoxyribonucleoside phosphoramidites and appropriate phosphordiamidite precursors with P(III) protecting groups different than the standard 2-cyanoethyl group. Specifically, these phosphoramidites are functionalized with the 3-(N-tert-butylcarboxamido)-1-propyl or 4-oxopentyl groups. The usefulness of these novel deoxyribonucleoside phosphoramidites in the solid-phase synthesis of a 20-mer DNA oligonucleotide and its phosphorothioated analog is demonstrated. It is also shown that removal of the 3-(N-tert-butylcarboxamido)-1-propyl phosphate/thiophosphate-protecting group from these oligonucleotides is rapidly effected under thermolytic conditions at neutral pH, whereas the 4-oxopentyl group is preferably removed by treatment with pressurized ammonia gas or concentrated ammonium hydroxide at ambient temperature. These detailed methods constitute an economical and alkylation-free approach to large-scale preparations of therapeutic oligonucleotides.

  2. Specific discrimination of three pathogenic Salmonella enterica subsp. enterica serotypes by carB-based oligonucleotide microarray.

    Science.gov (United States)

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun; Cha, Hyung Joon

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes.

  3. Hepatotoxic Potential of Therapeutic Oligonucleotides Can Be Predicted from Their Sequence and Modification Pattern

    Science.gov (United States)

    Hagedorn, Peter H.; Yakimov, Victor; Ottosen, Søren; Kammler, Susanne; Nielsen, Niels F.; Høg, Anja M.; Hedtjärn, Maj; Meldgaard, Michael; Møller, Marianne R.; Ørum, Henrik; Koch, Troels

    2013-01-01

    Antisense oligonucleotides that recruit RNase H and thereby cleave complementary messenger RNAs are being developed as therapeutics. Dose-dependent hepatic changes associated with hepatocyte necrosis and increases in serum alanine-aminotransferase levels have been observed after treatment with certain oligonucleotides. Although general mechanisms for drug-induced hepatic injury are known, the characteristics of oligonucleotides that determine their hepatotoxic potential are not well understood. Here, we present a comprehensive analysis of the hepatotoxic potential of locked nucleic acid-modified oligonucleotides in mice. We developed a random forests classifier, in which oligonucleotides are regarded as being composed of dinucleotide units, which distinguished between 206 oligonucleotides with high and low hepatotoxic potential with 80% accuracy as estimated by out-of-bag validation. In a validation set, 17 out of 23 oligonucleotides were correctly predicted (74% accuracy). In isolation, some dinucleotide units increase, and others decrease, the hepatotoxic potential of the oligonucleotides within which they are found. However, a complex interplay between all parts of an oligonucleotide can influence the hepatotoxic potential. Using the classifier, we demonstrate how an oligonucleotide with otherwise high hepatotoxic potential can be efficiently redesigned to abate hepatotoxic potential. These insights establish analysis of sequence and modification patterns as a powerful tool in the preclinical discovery process for oligonucleotide-based medicines. PMID:23952551

  4. High-throughput screening identifies small molecules that enhance the pharmacological effects of oligonucleotides

    Science.gov (United States)

    Yang, B.; Ming, X.; Cao, C.; Laing, B.; Yuan, A.; Porter, M. A.; Hull-Ryde, E. A.; Maddry, J.; Suto, M.; Janzen, W. P.; Juliano, R. L.

    2015-01-01

    The therapeutic use of antisense and siRNA oligonucleotides has been constrained by the limited ability of these membrane-impermeable molecules to reach their intracellular sites of action. We sought to address this problem using small organic molecules to enhance the effects of oligonucleotides by modulating their intracellular trafficking and release from endosomes. A high-throughput screen of multiple small molecule libraries yielded several hits that markedly potentiated the actions of splice switching oligonucleotides in cell culture. These compounds also enhanced the effects of antisense and siRNA oligonucleotides. The hit compounds preferentially caused release of fluorescent oligonucleotides from late endosomes rather than other intracellular compartments. Studies in a transgenic mouse model indicated that these compounds could enhance the in vivo effects of a splice-switching oligonucleotide without causing significant toxicity. These observations suggest that selected small molecule enhancers may eventually be of value in oligonucleotide-based therapeutics. PMID:25662226

  5. Biophysical and RNA Interference Inhibitory Properties of Oligonucleotides Carrying Tetrathiafulvalene Groups at Terminal Positions

    Directory of Open Access Journals (Sweden)

    Sónia Pérez-Rentero

    2013-01-01

    Full Text Available Oligonucleotide conjugates carrying a single functionalized tetrathiafulvalene (TTF unit linked through a threoninol molecule to the 3′ or 5′ ends were synthesized together with their complementary oligonucleotides carrying a TTF, pyrene, or pentafluorophenyl group. TTF-oligonucleotide conjugates formed duplexes with higher thermal stability than the corresponding unmodified oligonucleotides and pyrene- and pentafluorophenyl-modified oligonucleotides. TTF-modified oligonucleotides are able to bind to citrate-stabilized gold nanoparticles (AuNPs and produce stable gold AuNPs functionalized with oligonucleotides. Finally, TTF-oligoribonucleotides have been synthesized to produce siRNA duplexes carrying TTF units. The presence of the TTF molecule is compatible with the RNA interference mechanism for gene inhibition.

  6. Metal-phosphate binders

    Science.gov (United States)

    Howe, Beth Ann [Lewistown, IL; Chaps-Cabrera, Jesus Guadalupe [Coahuila, MX

    2009-05-12

    A metal-phosphate binder is provided. The binder may include an aqueous phosphoric acid solution, a metal-cation donor including a metal other than aluminum, an aluminum-cation donor, and a non-carbohydrate electron donor.

  7. Phosphate control in dialysis.

    Science.gov (United States)

    Cupisti, Adamasco; Gallieni, Maurizio; Rizzo, Maria Antonietta; Caria, Stefania; Meola, Mario; Bolasco, Piergiorgio

    2013-10-04

    Prevention and correction of hyperphosphatemia is a major goal of chronic kidney disease-mineral and bone disorder (CKD-MBD) management, achievable through avoidance of a positive phosphate balance. To this aim, optimal dialysis removal, careful use of phosphate binders, and dietary phosphate control are needed to optimize the control of phosphate balance in well-nourished patients on a standard three-times-a-week hemodialysis schedule. Using a mixed diffusive-convective hemodialysis tecniques, and increasing the number and/or the duration of dialysis tecniques are all measures able to enhance phosphorus (P) mass removal through dialysis. However, dialytic removal does not equal the high P intake linked to the high dietary protein requirement of dialysis patients; hence, the use of intestinal P binders is mandatory to reduce P net intestinal absorption. Unfortunately, even a large dose of P binders is able to bind approximately 200-300 mg of P on a daily basis, so it is evident that their efficacy is limited in the case of an uncontrolled dietary P load. Hence, limitation of dietary P intake is needed to reach the goal of neutral phosphate balance in dialysis, coupled to an adequate protein intake. To this aim, patients should be informed and educated to avoid foods that are naturally rich in phosphate and also processed food with P-containing preservatives. In addition, patients should preferentially choose food with a low P-to-protein ratio. For example, patients could choose egg white or protein from a vegetable source. Finally, boiling should be the preferred cooking procedure, because it induces food demineralization, including phosphate loss. The integrated approach outlined in this article should be actively adapted as a therapeutic alliance by clinicians, dieticians, and patients for an effective control of phosphate balance in dialysis patients.

  8. Lipase-catalyzed biodiesel synthesis with different acyl acceptors

    Directory of Open Access Journals (Sweden)

    Ognjanović Nevena D.

    2008-01-01

    Full Text Available Biodiesel is an alternative fuel for diesel engine that is environmentally acceptable. Conventionally, biodiesel is produced by transesterification of triglycerides and short alcohols in the presence of an acid or an alkaline catalyst. There are several problems associated with this kind of production that can be resolved by using lipase as the biocatalyst. The aim of the present work was to investigate novel acyl acceptors for biodiesel production. 2-Propanol and n-butanol have a less negative effect on lipase stability, and they also improve low temperature properties of the fuel. However, excess alcohol leads to inactivation of the enzyme, and glycerol, a major byproduct, can block the immobilized enzyme, resulting in low enzymatic activity. This problem was solved by using methyl acetate as acyl acceptor. Triacetylglycerol is produced instead of glycerol, and it has no negative effect on the activity of the lipase.

  9. An organic donor/acceptor lateral superlattice at the nanoscale.

    Science.gov (United States)

    Otero, Roberto; Ecija, David; Fernandez, Gustavo; Gallego, José María; Sanchez, Luis; Martín, Nazario; Miranda, Rodolfo

    2007-09-01

    A precise control of the nanometer-scale morphology in systems containing mixtures of donor/acceptor molecules is a key factor to improve the efficiency of organic photovoltaic devices. Here we report on a scanning tunneling microscopy study of the first stages of growth of 2-[9-(1,3-dithiol-2-ylidene)anthracen-10(9H)-ylidene]-1,3-dithiole, as electron donor, and phenyl-C61-butyric acid methyl ester, as electron acceptor, on a Au(111) substrate under ultrahigh vacuum conditions. Due to differences in bonding strength with the substrate and different interactions with the Au(111) herringbone surface reconstruction, mixed thin films spontaneously segregate into a lateral superlattice of interdigitated nanoscale stripes with a characteristic width of about 10-20 nm, a morphology that has been predicted to optimize the efficiency of organic solar cells.

  10. Functionalization of magnetic gold/iron-oxide composite nanoparticles with oligonucleotides and magnetic separation of specific target

    Energy Technology Data Exchange (ETDEWEB)

    Kinoshita, Takuya [Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan)]. E-mail: t-kinoshita@mit.eng.osaka-u.ac.jp; Seino, Satoshi [Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Mizukoshi, Yoshiteru [Faculty of Engineering, Nagasaki University, 1-14 Bunkyo-machi, Nagasaki 852-8521 (Japan); Nakagawa, Takashi [Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan); Yamamoto, Takao A. [Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan)

    2007-04-15

    Magnetic composite nanoparticles of gold and iron-oxide synthesized with gamma-rays or ultrasonics were functionalized with thiol-modified oligonucleotides. The amount of oligonucleotides bound to the functionalized nanoparticle probes via hybridization was quantified with fluorescently-labeled target oligonucleotides. Our composite nanoparticles magnetically separated the specific target oligonucleotides without the non-specific adsorption.

  11. Electron Acceptor Materials Engineering in Colloidal Quantum Dot Solar Cells

    KAUST Repository

    Liu, Huan

    2011-07-15

    Lead sulfide colloidal quantum dot (CQD) solar cells with a solar power conversion efficiency of 5.6% are reported. The result is achieved through careful optimization of the titanium dioxide electrode that serves as the electron acceptor. Metal-ion-doped sol-gel-derived titanium dioxide electrodes produce a tunable-bandedge, well-passivated materials platform for CQD solar cell optimization. © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Selection of electron acceptors and strategies for in situ bioremediation

    Energy Technology Data Exchange (ETDEWEB)

    Norris, R.D. [Eckenfelder, Inc., Nashville, TN (United States)

    1995-12-31

    The most critical aspect of designing in situ bioremediation systems is, typically, the selection and method of delivery of the electron acceptor. Nitrate, sulfate, and several forms of oxygen can be introduced, depending on the contaminants and the site conditions. Oxygen can be added as air, pure oxygen, hydrogen peroxide, or an oxygen release compound. Simplistic cost calculations can illustrate the advantages of some methods over others, providing technical requirements can be met.

  13. Current advances in fused tetrathiafulvalene donor-acceptor systems.

    Science.gov (United States)

    Bergkamp, Jesse J; Decurtins, Silvio; Liu, Shi-Xia

    2015-02-21

    Electron donor (D) and acceptor (A) systems have been studied extensively. Among them, fused D-A systems have attracted much attention during the past decades. Herein, we will present the evolution of tetrathiafulvalene (TTF) fused D-A systems and their potential applications in areas such as solar cells, OFETs, molecular wires and optoelectronics just to name a few. The synthesis and electrochemical, photophysical and intrinsic properties of fused D-A systems will be described as well.

  14. 2012 Gordon Research Conference, Electron donor-acceptor interactions, August 5-10 2012

    Energy Technology Data Exchange (ETDEWEB)

    McCusker, James [Michigan State Univ., East Lansing, MI (United States)

    2012-08-10

    The upcoming incarnation of the Gordon Research Conference on Electron Donor Acceptor Interactions will feature sessions on classic topics including proton-coupled electron transfer, dye-sensitized solar cells, and biological electron transfer, as well as emerging areas such as quantum coherence effects in donor-acceptor interactions, spintronics, and the application of donor-acceptor interactions in chemical synthesis.

  15. Donor-Acceptor Block Copolymers: Synthesis and Solar Cell Applications

    Directory of Open Access Journals (Sweden)

    Kazuhiro Nakabayashi

    2014-04-01

    Full Text Available Fullerene derivatives have been widely used for conventional acceptor materials in organic photovoltaics (OPVs because of their high electron mobility. However, there are also considerable drawbacks for use in OPVs, such as negligible light absorption in the visible-near-IR regions, less compatibility with donor polymeric materials and high cost for synthesis and purification. Therefore, the investigation of non-fullerene acceptor materials that can potentially replace fullerene derivatives in OPVs is increasingly necessary, which gives rise to the possibility of fabricating all-polymer (polymer/polymer solar cells that can deliver higher performance and that are potentially cheaper than fullerene-based OPVs. Recently, considerable attention has been paid to donor-acceptor (D-A block copolymers, because of their promising applications as fullerene alternative materials in all-polymer solar cells. However, the synthesis of D-A block copolymers is still a challenge, and therefore, the establishment of an efficient synthetic method is now essential. This review highlights the recent advances in D-A block copolymers synthesis and their applications in all-polymer solar cells.

  16. Fullerene derivatives as electron acceptors for organic photovoltaic cells.

    Science.gov (United States)

    Mi, Dongbo; Kim, Ji-Hoon; Kim, Hee Un; Xu, Fei; Hwang, Do-Hoon

    2014-02-01

    Energy is currently one of the most important problems humankind faces. Depletion of traditional energy sources such as coal and oil results in the need to develop new ways to create, transport, and store electricity. In this regard, the sun, which can be considered as a giant nuclear fusion reactor, represents the most powerful source of energy available in our solar system. For photovoltaic cells to gain widespread acceptance as a source of clean and renewable energy, the cost per watt of solar energy must be decreased. Organic photovoltaic cells, developed in the past two decades, have potential as alternatives to traditional inorganic semiconductor photovoltaic cells, which suffer from high environmental pollution and energy consumption during production. Organic photovoltaic cells are composed of a blended film of a conjugated-polymer donor and a soluble fullerene-derivative acceptor sandwiched between a poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate)-coated indium tin oxide positive electrode and a low-work-function metal negative electrode. Considerable research efforts aim at designing and synthesizing novel fullerene derivatives as electron acceptors with up-raised lowest unoccupied molecular orbital energy, better light-harvesting properties, higher electron mobility, and better miscibility with the polymer donor for improving the power conversion efficiency of the organic photovoltaic cells. In this paper, we systematically review novel fullerene acceptors synthesized through chemical modification for enhancing the photovoltaic performance by increasing open-circuit voltage, short-circuit current, and fill factor, which determine the performance of organic photovoltaic cells.

  17. Income-generating activities for family planning acceptors.

    Science.gov (United States)

    1989-07-01

    The Income Generating Activities program for Family Planning Acceptors was introduced in Indonesia in 1979. Capital input by the Indonesian National Family Planning Coordination Board and the UN Fund for Population Activities was used to set up small businesses by family planning acceptors. In 2 years, when the businesses become self-sufficient, the loans are repaid, and the money is used to set up new family planning acceptors in business. The program strengthens family planning acceptance, improves the status of women, and enhances community self-reliance. The increase in household income generated by the program raises the standards of child nutrition, encourages reliance on the survival of children, and decreases the value of large families. Approximately 18,000 Family Planning-Income Generating Activities groups are now functioning all over Indonesia, with financial assistance from the central and local governments, the World Bank, the US Agency for International Development, the UN Population Fund, the Government of the Netherlands, and the Government of Australia through the Association of South East Asian Nations.

  18. Virtual screening of electron acceptor materials for organic photovoltaic applications

    Science.gov (United States)

    Halls, Mathew D.; Djurovich, Peter J.; Giesen, David J.; Goldberg, Alexander; Sommer, Jonathan; McAnally, Eric; Thompson, Mark E.

    2013-10-01

    Virtual screening involves the generation of structure libraries, automated analysis to predict properties related to application performance and subsequent screening to identify lead systems and estimate critical structure-property limits across a targeted chemical design space. This approach holds great promise for informing experimental discovery and development efforts for next-generation materials, such as organic semiconductors. In this work, the virtual screening approach is illustrated for nitrogen-substituted pentacene molecules to identify systems for development as electron acceptor materials for use in organic photovoltaic (OPV) devices. A structure library of tetra-azapentacenes (TAPs) was generated by substituting four nitrogens for CH at 12 sites on the pentacene molecular framework. Molecular properties (e.g. ELUMO, Eg and μ) were computed for each candidate structure using hybrid DFT at the B3LYP/6-311G** level of theory. The resulting TAPs library was then analyzed with respect to intrinsic properties associated with OPV acceptor performance. Marcus reorganization energies for charge transport for the most favorable TAP candidates were then calculated to further determine suitability as OPV electron acceptors. The synthesis, characterization and OPV device testing of TAP materials is underway, guided by these results.

  19. Design directed self-assembly of donor-acceptor polymers.

    Science.gov (United States)

    Marszalek, Tomasz; Li, Mengmeng; Pisula, Wojciech

    2016-09-21

    Donor-acceptor polymers with an alternating array of donor and acceptor moieties have gained particular attention during recent years as active components of organic electronics. By implementation of suitable subunits within the conjugated backbone, these polymers can be made either electron-deficient or -rich. Additionally, their band gap and light absorption can be precisely tuned for improved light-harvesting in solar cells. On the other hand, the polymer design can also be modified to encode the desired supramolecular self-assembly in the solid-state that is essential for an unhindered transport of charge carriers. This review focuses on three major factors playing a role in the assembly of donor-acceptor polymers on surfaces which are (1) nature, geometry and substitution position of solubilizing alkyl side chains, (2) shape of the conjugated polymer defined by the backbone curvature, and (3) molecular weight which determines the conjugation length of the polymer. These factors adjust the fine balance between attractive and repulsive forces and ensure a close polymer packing important for an efficient charge hopping between neighboring chains. On the microscopic scale, an appropriate domain formation with a low density of structural defects in the solution deposited thin film is crucial for the charge transport. The charge carrier transport through such thin films is characterized by field-effect transistors as basic electronic elements.

  20. The glucose 6-phosphate shunt around the Calvin-Benson cycle.

    Science.gov (United States)

    Sharkey, Thomas D; Weise, Sean E

    2016-07-01

    It is just over 60 years since a cycle for the regeneration of the CO2-acceptor used in photosynthesis was proposed. In this opinion paper, we revisit the origins of the Calvin-Benson cycle that occurred at the time that the hexose monophosphate shunt, now called the pentose phosphate pathway, was being worked out. Eventually the pentose phosphate pathway was separated into two branches, an oxidative branch and a non-oxidative branch. It is generally thought that the Calvin-Benson cycle is the reverse of the non-oxidative branch of the pentose phosphate pathway but we describe crucial differences and also propose that some carbon routinely passes through the oxidative branch of the pentose phosphate pathway. This creates a futile cycle but may help to stabilize photosynthesis. If it occurs it could explain a number of enigmas including the lack of complete labelling of the Calvin-Benson cycle intermediates when carbon isotopes are fed to photosynthesizing leaves.

  1. Fluorescence quenching of TMR by guanosine in oligonucleotides

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Nucleotide-specific fluorescence quenching in fluorescently labeled DNA has many applications in biotechnology. We have studied the inter-and intra-molecular quenching of tetramethylrhodamine (TMR) by nucleotides to better understand their quenching mechanism and influencing factors. In agreement with previous work, dGMP can effectively quench TMR, while the quenching of TMR by other nucleotides is negligible. The Stern-Volmer plot between TMR and dGMP delivers a bimolecular quenching constant of Ks=52.3 M-1. The fluorescence of TMR in labeled oligonucleotides decreases efficiently through photoinduced electron transfer by guanosine. The quenching rate constant between TMR and guanosine was measured using fluorescence correlation spectroscopy (FCS). In addition, our data show that the steric hindrance by bases around guanosine has significant effect on the G-quenching. The availability of these data should be useful in designing fluorescent oligonucleotides and understanding the G-quenching process.

  2. Palladium-Catalyzed Modification of Unprotected Nucleosides, Nucleotides, and Oligonucleotides

    Directory of Open Access Journals (Sweden)

    Kevin H. Shaughnessy

    2015-05-01

    Full Text Available Synthetic modification of nucleoside structures provides access to molecules of interest as pharmaceuticals, biochemical probes, and models to study diseases. Covalent modification of the purine and pyrimidine bases is an important strategy for the synthesis of these adducts. Palladium-catalyzed cross-coupling is a powerful method to attach groups to the base heterocycles through the formation of new carbon-carbon and carbon-heteroatom bonds. In this review, approaches to palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides are reviewed. Polar reaction media, such as water or polar aprotic solvents, allow reactions to be performed directly on the hydrophilic nucleosides and nucleotides without the need to use protecting groups. Homogeneous aqueous-phase coupling reactions catalyzed by palladium complexes of water-soluble ligands provide a general approach to the synthesis of modified nucleosides, nucleotides, and oligonucleotides.

  3. One-oligonucleotide method for constructing vectors for RNA interference

    Institute of Scientific and Technical Information of China (English)

    Carlos Fabian FLORES-JASSO; Ines VELAZQUEZ-QUESADA; Carlos LANDA-SOLIS; Andres A GUTIERREZ; Luis VACA

    2005-01-01

    Aim: To develop an easy, fast, automated, and inexpensive method for constructing short-hairpin-RNA cassettes for RNAi studies. Methods: Using single oligonucleotides, a variety of DNA cassettes for RNAi vectors were constructed in only few minutes in an automated manner. The cassettes, targeting the eGFP,were cloned into plasmids driven by RNA polymerase Ⅲ promoter H 1. Then, the plasmids were transfected into HeLa cells that were later infected with a recombinant adenovirus encoding the eGFP gene. The level of eGFP fluorescence was evaluated by confocal imaging and flow cytometry. Results: The plasmids constructed with the DNA cassettes made by the one-oligonucleotide method inhibited eGFP with different potencies, ranging from 55% to 75%. Conclusion: By using the method reported here, it is possible to simultaneously construct hundreds of different DNA cassettes for RNAi experiments in an inexpensive, automated way. This method will facilitate functional genomics studies on mammalian cells.

  4. Typing of enteroviruses by use of microwell oligonucleotide arrays.

    Science.gov (United States)

    Susi, P; Hattara, L; Waris, M; Luoma-Aho, T; Siitari, H; Hyypiä, T; Saviranta, P

    2009-06-01

    We have developed a straightforward assay for the rapid typing of enteroviruses using oligonucleotide arrays in microtiter wells. The viral nucleic acids are concomitantly amplified and labeled during reverse transcription-PCR, and unpurified PCR products are used for hybridization. DNA strands are separated by alkaline denaturation, and hybridization is started by neutralization. The microarray hybridization reactions and the subsequent washes are performed in standard 96-well microtiter plates, which makes the method easily adaptable to high-throughput analysis. We describe here the assay principle and its potential in clinical laboratory use by correctly identifying 10 different enterovirus reference strains. Furthermore, we explore the detection of unknown sequence variants using serotype consensus oligonucleotide probes. With just two consensus probes for the coxsackievirus A9 (CVA9) serotype, we detected 23 out of 25 highly diverse CVA9 isolates. Overall, the assay involves several features aiming at ease of performance, robustness, and applicability to large-scale studies.

  5. Inhibition of HTLV-III by exogenous oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Goodchild, J.; Zamecnik, P.C.

    1989-02-21

    A method is described of detecting the presence of HTLV-III virus in a sample by demonstrating inhibition of replication of the virus in cells which are normally killed by the HTLV-III virus after the cells have been (a) combined with the sample and an oligonucleotide complementary to at least one highly conserved region of the HTLV-III genome necessary for HTLV-III replication and capable of hybridizing with at least the highly conserved region, the highly conserved region of the HTLV-III genome being a nucleotide sequence present in the genomes of HTLV-III isolates and the oligonucleotide complementary to at least one highly conserved region of the HTLV-III genome necessary for HTLV-III replication being complementary to a region of the HTLV-III genome.

  6. Solid-phase synthesis of siRNA oligonucleotides.

    Science.gov (United States)

    Beaucage, Serge L

    2008-03-01

    Since the discovery of RNA interference (RNAi) as a means to silence the expression of specific genes, small interfering RNA (siRNA) oligonucleotides have been recognized as powerful tools for targeting therapeutically important mRNAs and eliciting their destruction. This discovery has created a high demand for synthetic oligoribonucleotides as potential therapeutics and has spurred a renaissance in the development of rapid, efficient methods for solid-phase RNA synthesis. The design and implementation of 2'-hydroxyl protecting groups that provide ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites are key to the production of RNA oligonucleotides in sufficient quantity and purity for pharmaceutical applications. In this context, various siRNAs were chemically modified to identify the biophysical and biochemical parameters necessary for effective and stable RNAi-mediated gene-silencing activities.

  7. Experimental design, modeling and optimization of polyplex formation between DNA oligonucleotides and branched polyethylenimine.

    Science.gov (United States)

    Clima, Lilia; Ursu, Elena L; Cojocaru, Corneliu; Rotaru, Alexandru; Barboiu, Mihail; Pinteala, Mariana

    2015-09-28

    The complexes formed by DNA and polycations have received great attention owing to their potential application in gene therapy. In this study, the binding efficiency between double-stranded oligonucleotides (dsDNA) and branched polyethylenimine (B-PEI) has been quantified by processing of the images captured from the gel electrophoresis assays. The central composite experimental design has been employed to investigate the effects of controllable factors on the binding efficiency. On the basis of experimental data and the response surface methodology, a multivariate regression model has been constructed and statistically validated. The model has enabled us to predict the binding efficiency depending on experimental factors, such as concentrations of dsDNA and B-PEI as well as the initial pH of solution. The optimization of the binding process has been performed using simplex and gradient methods. The optimal conditions determined for polyplex formation have yielded a maximal binding efficiency close to 100%. In order to reveal the mechanism of complex formation at the atomic-scale, a molecular dynamic simulation has been carried out. According to the computation results, B-PEI amine hydrogen atoms have interacted with oxygen atoms from dsDNA phosphate groups. These interactions have led to the formation of hydrogen bonds between macromolecules, stabilizing the polyplex structure.

  8. Spectral, thermal and kinetic studies of charge-transfer complexes formed between the highly effective antibiotic drug metronidazole and two types of acceptors: σ- and π-acceptors.

    Science.gov (United States)

    Refat, Moamen S; Saad, Hosam A; Adam, Abdel Majid A

    2015-04-15

    Understanding the interaction between drugs and small inorganic or organic molecules is critical in being able to interpret the drug-receptor interactions and acting mechanism of these drugs. A combined solution and solid state study was performed to describe the complexation chemistry of drug metronidazole (MZ) which has a broad-spectrum antibacterial activity with two types of acceptors. The acceptors include, σ-acceptor (i.e., iodine) and π-acceptors (i.e., dichlorodicyanobenzoquinone (DDQ), chloranil (CHL) and picric acid (PA)). The molecular structure, spectroscopic characteristics, the binding modes as well as the thermal stability were deduced from IR, UV-vis, (1)H NMR and thermal studies. The binding ratio of complexation (MZ: acceptor) was determined to be 1:2 for the iodine acceptor and 1:1 for the DDQ, CHL or PA acceptor, according to the CHN elemental analyses and spectrophotometric titrations. It has been found that the complexation with CHL and PA acceptors increases the values of enthalpy and entropy, while the complexation with DDQ and iodine acceptors decreases the values of these parameters compared with the free MZ donor.

  9. Thermoplastic polymers surfaces for Dip-Pen Nanolithography of oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Suriano, Raffaella [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta”, Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy); Biella, Serena, E-mail: serena.biella@polimi.it [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta”, Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy); Cesura, Federico; Levi, Marinella; Turri, Stefano [Dipartimento di Chimica, Materiali e Ingegneria Chimica “Giulio Natta”, Politecnico di Milano, Piazza Leonardo da Vinci 32, 20133 Milano (Italy)

    2013-05-15

    Different thermoplastic polymers were spin-coated to prepare smooth surfaces for the direct deposition of end-group modified oligonucleotides by Dip-Pen Nanolithography. A study of the diffusion process was done in order to investigate the dependence of calibration coefficient and quality of deposited features on environmental parameters (temperature, relative humidity) and ink's molecular weight and functionality. The optimization of the process parameters led to the realization of high quality and density nanoarrays on plastics.

  10. Cardiovascular and Metabolic Effects of ANGPTL3 Antisense Oligonucleotides.

    Science.gov (United States)

    Graham, Mark J; Lee, Richard G; Brandt, Teresa A; Tai, Li-Jung; Fu, Wuxia; Peralta, Raechel; Yu, Rosie; Hurh, Eunju; Paz, Erika; McEvoy, Bradley W; Baker, Brenda F; Pham, Nguyen C; Digenio, Andres; Hughes, Steven G; Geary, Richard S; Witztum, Joseph L; Crooke, Rosanne M; Tsimikas, Sotirios

    2017-07-20

    Epidemiologic and genomewide association studies have linked loss-of-function variants in ANGPTL3, encoding angiopoietin-like 3, with low levels of plasma lipoproteins. We evaluated antisense oligonucleotides (ASOs) targeting Angptl3 messenger RNA (mRNA) for effects on plasma lipid levels, triglyceride clearance, liver triglyceride content, insulin sensitivity, and atherosclerosis in mice. Subsequently, 44 human participants (with triglyceride levels of either 90 to 150 mg per deciliter [1.0 to 1.7 mmol per liter] or >150 mg per deciliter, depending on the dose group) were randomly assigned to receive subcutaneous injections of placebo or an antisense oligonucleotide targeting ANGPTL3 mRNA in a single dose (20, 40, or 80 mg) or multiple doses (10, 20, 40, or 60 mg per week for 6 weeks). The main end points were safety, side-effect profile, pharmacokinetic and pharmacodynamic measures, and changes in levels of lipids and lipoproteins. The treated mice had dose-dependent reductions in levels of hepatic Angptl3 mRNA, Angptl3 protein, triglycerides, and low-density lipoprotein (LDL) cholesterol, as well as reductions in liver triglyceride content and atherosclerosis progression and increases in insulin sensitivity. After 6 weeks of treatment, persons in the multiple-dose groups had reductions in levels of ANGPTL3 protein (reductions of 46.6 to 84.5% from baseline, Pantisense oligonucleotide and three who received placebo reported dizziness or headache. There were no serious adverse events. Oligonucleotides targeting mouse Angptl3 retarded the progression of atherosclerosis and reduced levels of atherogenic lipoproteins in mice. Use of the same strategy to target human ANGPTL3 reduced levels of atherogenic lipoproteins in humans. (Funded by Ionis Pharmaceuticals; ClinicalTrials.gov number, NCT02709850 .).

  11. Voltammetric behaviour of oligonucleotide lipoplexes adsorbed onto glassy carbon electrodes

    OpenAIRE

    Piedade, J. A. P.; M. Mano; Lima, M. C. Pedroso de; Oretskaya, T S; Oliveira-Brett, A. M.

    2004-01-01

    The voltammetric behaviour of oligonucleotide lipoplexes (ODN-lipoplexes) prepared from short oligodeoxynucleotides (ODN), with different base compositions, and liposomes of the cationic lipid DOTAP, was studied by differential pulse voltammetry with a glassy carbon mini-electrode. It was found that the ODN base composition influences the ODN-lipoplex voltammetric response. Differential pulse voltammograms for ODN-lipoplexes of the ODN adenosine nucleotides present two different features when...

  12. Sex determination of bovine preimplantation embryos by oligonucleotide microarray.

    Science.gov (United States)

    Yang, Hua; Zhong, Fagang; Yang, Yonglin; Wang, Xinhua; Liu, Shouren; Zhu, Bin

    2013-06-01

    The aim has been to set up a rapid and accurate microarray assay using sandwich mode for sex determination of bovine preimplantation embryos. Twelve sequence-specific oligonucleotide capture probes used to discriminate 12 samples were spotted onto the aldehyde-modified glass slides by Arrayer. The 2 recognition probes used to identify coding regions of the sex-determining region of the Y chromosome gene (SRY) and β-casein (CSN2) reference gene were coupled with biotin. The assay was optimized by using genomic DNA extracted from blood samples of known sex individuals. Polymerase chain reaction (PCR) was used to amplify the fragments in the HMG box region of SRY gene and CSN2 gene with sequence-specific primers. The sex of samples was identified by detecting both the SRY and CSN2 genes simultaneously in 2 reaction cells of microarrays, with the male having SRY and CSN2 signals and the female only CSN2. The sex of 20 bovine preimplantation embryos was determined by oligonucleotide microarray. The protocol was run with a blind test that showed a 100% (82/82) specificity and accuracy in sexing of leukocytes. The bovine embryos were transferred into 20 bovine recipients, with a pregnant rate of 40% (8/20). Three calves were born at term, and 5 fetuses were miscarried. Their sexes were fully in accordance with the embryonic sex predetermination predicted by oligonucleotide microarray. This suggests that the oligonucleotide microarray method of SRY gene analysis can be used in early sex prediction of bovine embryos in breeding programs.

  13. Thermodynamic treatment of oligonucleotide duplex–simplex equilibria

    Science.gov (United States)

    Owczarzy, Richard; Dunietz, Isard; Behlke, Mark A.; Klotz, Irving M.; Walder, Joseph A.

    2003-01-01

    Thermodynamic formulations have been devised to obtain ΔG° values directly from spectroscopic data at a fixed common temperature in nucleic acid duplex–simplex melting curves. In addition, the dependence of melting on salt concentration has been expressed in terms of a stepwise stoichiometric representation, which leads to a specific equation for the partition of the added sodium ions between the different oligonucleotide forms. PMID:14657395

  14. Anti-tumor activity of splice-switching oligonucleotides

    OpenAIRE

    Bauman, John A; Li, Shyh-Dar; Yang, Angela; Huang, Leaf; Kole, Ryszard

    2010-01-01

    Alternative splicing has emerged as an important target for molecular therapies. Splice-switching oligonucleotides (SSOs) modulate alternative splicing by hybridizing to pre-mRNA sequences involved in splicing and blocking access to the transcript by splicing factors. Recently, the efficacy of SSOs has been established in various animal disease models; however, the application of SSOs against cancer targets has been hindered by poor in vivo delivery of antisense therapeutics to tumor cells. T...

  15. Triplex-forming oligonucleotide target sequences in the human genome

    OpenAIRE

    Goñi, J Ramon; de la Cruz, Xavier; Orozco, Modesto

    2004-01-01

    The existence of sequences in the human genome which can be a target for triplex formation, and accordingly are candidates for anti-gene therapies, has been studied by using bioinformatics tools. It was found that the population of triplex-forming oligonucleotide target sequences (TTS) is much more abundant than that expected from simple random models. The population of TTS is large in all the genome, without major differences between chromosomes. A wide analysis along annotated regions of th...

  16. Charge Carrier Dynamics at Silver Nanocluster-Molecular Acceptor Interfaces

    KAUST Repository

    Almansaf, Abdulkhaleq

    2017-07-01

    A fundamental understanding of interfacial charge transfer at donor-acceptor interfaces is very crucial as it is considered among the most important dynamical processes for optimizing performance in many light harvesting systems, including photovoltaics and photo-catalysis. In general, the photo-generated singlet excitons in photoactive materials exhibit very short lifetimes because of their dipole-allowed spin radiative decay and short diffusion lengths. In contrast, the radiative decay of triplet excitons is dipole forbidden; therefore, their lifetimes are considerably longer. The discussion in this thesis primarily focuses on the relevant parameters that are involved in charge separation (CS), charge transfer (CT), intersystem crossing (ISC) rate, triplet state lifetime, and carrier recombination (CR) at silver nanocluster (NCs) molecular-acceptors interfaces. A combination of steady-state and femto- and nanosecond broadband transient absorption spectroscopies were used to investigate the charge carrier dynamics in various donor-acceptor systems. Additionally, this thesis was prolonged to investigate some important factors that influence the charge carrier dynamics in Ag29 silver NCs donor-acceptor systems, such as the metal doping and chemical structure of the nanocluster and molecular acceptors. Interestingly, clear correlations between the steady-state measurements and timeresolved spectroscopy results are found. In the first study, we have investigated the interfacial charge transfer dynamics in positively charged meso units of 5, 10, 15, 20-tetra (1- methyl-4-pyridino)-porphyrin tetra (p-toluene sulfonate) (TMPyP) and neutral charged 5, 10, 15, 20-tetra (4-pyridyl)-porphyrin (TPyP), with negatively charged undoped and gold (Au)- doped silver Ag29 NCs. Moreover, this study showed the impact of Au doping on the charge carrier dynamics of the system. In the second study, we have investigated the interfacial charge transfer dynamics in [Pt2 Ag23 Cl7 (PPh3

  17. Ultrafast Photoinduced Electron Transfer in Bimolecular Donor-Acceptor Systems

    KAUST Repository

    Alsulami, Qana A.

    2016-11-30

    The efficiency of photoconversion systems, such as organic photovoltaic (OPV) cells, is largely controlled by a series of fundamental photophysical processes occurring at the interface before carrier collection. A profound understanding of ultrafast interfacial charge transfer (CT), charge separation (CS), and charge recombination (CR) is the key determinant to improving the overall performances of photovoltaic devices. The discussion in this dissertation primarily focuses on the relevant parameters that are involved in photon absorption, exciton separation, carrier transport, carrier recombination and carrier collection in organic photovoltaic devices. A combination of steady-state and femtosecond broadband transient spectroscopies was used to investigate the photoinduced charge carrier dynamics in various donor-acceptor systems. Furthermore, this study was extended to investigate some important factors that influence charge transfer in donor-acceptor systems, such as the morphology, energy band alignment, electronic properties and chemical structure. Interestingly, clear correlations among the steady-state measurements, time-resolved spectroscopy results, grain alignment of the electron transporting layer (ETL), carrier mobility, and device performance are found. In this thesis, we explored the significant impacts of ultrafast charge separation and charge recombination at donor/acceptor (D/A) interfaces on the performance of a conjugated polymer PTB7-Th device with three fullerene acceptors: PC71BM, PC61BM and IC60BA. Time-resolved laser spectroscopy and high-resolution electron microscopy can illustrate the basis for fabricating solar cell devices with improved performances. In addition, we studied the effects of the incorporation of heavy metals into π-conjugated chromophores on electron transfer by monitoring the triplet state lifetime of the oligomer using transient absorption spectroscopy, as understanding the mechanisms controlling intersystem crossing and

  18. Total Phosphate Influences the Rate of Hydrocarbon Degradation but Phosphate Mineralogy Shapes Microbial Community Composition in Cold-Region Calcareous Soils.

    Science.gov (United States)

    Siciliano, Steven D; Chen, Tingting; Phillips, Courtney; Hamilton, Jordan; Hilger, David; Chartrand, Blaine; Grosskleg, Jay; Bradshaw, Kris; Carlson, Trevor; Peak, Derek

    2016-05-17

    Managing phosphorus bioaccessibility is critical for the bioremediation of hydrocarbons in calcareous soils. This paper explores how soil mineralogy interacts with a novel biostimulatory solution to both control phosphorus bioavailability and influence bioremediation. Two large bore infiltrators (1 m diameter) were installed at a PHC contaminated site and continuously supplied with a solution containing nutrients and an electron acceptor. Soils from eight contaminated sites were prepared and pretreated, analyzed pretrial, spiked with diesel, placed into nylon bags into the infiltrators, and removed after 3 months. From XAS, we learned that three principal phosphate phases had formed: adsorbed phosphate, brushite, and newberyite. All measures of biodegradation in the samples (in situ degradation estimates, mineralization assays, culturable bacteria, catabolic genes) varied depending upon the soil's phosphate speciation. Notably, adsorbed phosphate increased anaerobic phenanthrene degradation and bzdN catabolic gene prevalence. The dominant mineralogical constraints on community composition were the relative amounts of adsorbed phosphate, brushite, and newberyite. Overall, this study finds that total phosphate influences microbial community phenotypes whereas relative percentages of phosphate minerals influences microbial community genotype composition.

  19. Magnetite nanoparticles facilitate methane production from ethanol via acting as electron acceptors.

    Science.gov (United States)

    Yang, Zhiman; Shi, Xiaoshuang; Wang, Chuanshui; Wang, Lin; Guo, Rongbo

    2015-11-12

    Potential for interspecies hydrogen transfer within paddy soil enrichments obtained via addition of magnetite nanoparticles and ethanol (named as PEM) was investigated. To do this, PEM derived from rice field of Hangzhou (named as PEM-HZ) was employed, because it offered the best methane production performance. Methane production and Fe (III) reduction proceeded in parallel in the presence of magnetite. Inhibition experiments with 2-bromoethane sulfonate (BES) or phosphate showed that interspecies hydrogen transfer and Fe (III) reduction also occurred in methane production from ethanol. 16S rRNA-based Illumina sequencing results showed that Dechloromonas, Thauera, Desulfovibrio and Clostridium were the dominant putative Fe (III) -reducers, and that hydrogenotrophic Methanobacterium accounted for about 88% of the total archaeal community. These results indicated that magnetite nanoparticles that acted as electron acceptor could facilitate rapid oxidation of ethanol by members of the Fe (III) -reducers in PEM-HZ and establishment of the syntrophic relationship of Fe (III) -reducers with Methanobacterium via interspecies hydrogen transfer. Our results could offer a model to understand the microbial interaction with magnetite from a novel angle during methanogenesis.

  20. Differentiation of regions with atypical oligonucleotide composition in bacterial genomes

    Directory of Open Access Journals (Sweden)

    Reva Oleg N

    2005-10-01

    Full Text Available Abstract Background Complete sequencing of bacterial genomes has become a common technique of present day microbiology. Thereafter, data mining in the complete sequence is an essential step. New in silico methods are needed that rapidly identify the major features of genome organization and facilitate the prediction of the functional class of ORFs. We tested the usefulness of local oligonucleotide usage (OU patterns to recognize and differentiate types of atypical oligonucleotide composition in DNA sequences of bacterial genomes. Results A total of 163 bacterial genomes of eubacteria and archaea published in the NCBI database were analyzed. Local OU patterns exhibit substantial intrachromosomal variation in bacteria. Loci with alternative OU patterns were parts of horizontally acquired gene islands or ancient regions such as genes for ribosomal proteins and RNAs. OU statistical parameters, such as local pattern deviation (D, pattern skew (PS and OU variance (OUV enabled the detection and visualization of gene islands of different functional classes. Conclusion A set of approaches has been designed for the statistical analysis of nucleotide sequences of bacterial genomes. These methods are useful for the visualization and differentiation of regions with atypical oligonucleotide composition prior to or accompanying gene annotation.

  1. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  2. Recursive construction of perfect DNA molecules from imperfect oligonucleotides.

    Science.gov (United States)

    Linshiz, Gregory; Yehezkel, Tuval Ben; Kaplan, Shai; Gronau, Ilan; Ravid, Sivan; Adar, Rivka; Shapiro, Ehud

    2008-01-01

    Making faultless complex objects from potentially faulty building blocks is a fundamental challenge in computer engineering, nanotechnology and synthetic biology. Here, we show for the first time how recursion can be used to address this challenge and demonstrate a recursive procedure that constructs error-free DNA molecules and their libraries from error-prone oligonucleotides. Divide and Conquer (D&C), the quintessential recursive problem-solving technique, is applied in silico to divide the target DNA sequence into overlapping oligonucleotides short enough to be synthesized directly, albeit with errors; error-prone oligonucleotides are recursively combined in vitro, forming error-prone DNA molecules; error-free fragments of these molecules are then identified, extracted and used as new, typically longer and more accurate, inputs to another iteration of the recursive construction procedure; the entire process repeats until an error-free target molecule is formed. Our recursive construction procedure surpasses existing methods for de novo DNA synthesis in speed, precision, amenability to automation, ease of combining synthetic and natural DNA fragments, and ability to construct designer DNA libraries. It thus provides a novel and robust foundation for the design and construction of synthetic biological molecules and organisms.

  3. Particle-Based Microarrays of Oligonucleotides and Oligopeptides.

    Science.gov (United States)

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F

    2014-10-28

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  4. Particle-Based Microarrays of Oligonucleotides and Oligopeptides

    Directory of Open Access Journals (Sweden)

    Alexander Nesterov-Mueller

    2014-10-01

    Full Text Available In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  5. Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

    Science.gov (United States)

    Moreno, Pedro; Pêgo, Ana

    2014-10-01

    Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

  6. THERAPEUTIC ANTISENSE OLIGONUCLEOTIDES AGAINST CANCER: HURDLING TO THE CLINIC

    Directory of Open Access Journals (Sweden)

    Pedro Miguel Duarte Moreno

    2014-10-01

    Full Text Available Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen, oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

  7. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

    Science.gov (United States)

    Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

    2015-01-01

    Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

  8. Ultrathin oligonucleotide layers for fluorescence-based DNA sensors

    Science.gov (United States)

    Furch, M.; Ueberfeld, J.; Hartmann, Andreas; Bock, Daniel; Seeger, Stefan

    1996-11-01

    Preliminary investigations into the design of an affinity sensor using evanescent wave technology concentrate upon the means of immobilization of the receptor molecules. In this work DNA served as the selective recognition element. The molecular principle of a sequence-selective biosensor for DNA is based on a sandwich-hybridization assay wherein the analyte, a single-stranded (ss)DNA, bound specifically to both an immobilized capture probe and a dye-labeled oligonucleotide in free solution. The efficiency of the capture array depends on the density of highly organized oligonucleotides on the waveguide surface and correlates therefore directly with the specificity and the sensitivity of the sensor. In the present approach using the Langmuir- Blodgett technique cinnamoylbutylether-cellulose monolayers were transferred onto optical fibers or planar waveguides. These films served as matrices for the immobilization of biotinylated oligonucleotides via streptavidin. For the first time streptavidin was immobilized by that manner. The specificity of the streptavidin layer or the following bounded nucleic acid molecules were controlled by an enzyme- linked immunosorbent assay (ELISA). Finally, this application has also shown to be suitable for the detection of Salmonella, which is an important pathogen associated with acute gastroenteritidis and food borne diseases.

  9. Targeting several CAG expansion diseases by a single antisense oligonucleotide.

    Directory of Open Access Journals (Sweden)

    Melvin M Evers

    Full Text Available To date there are 9 known diseases caused by an expanded polyglutamine repeat, with the most prevalent being Huntington's disease. Huntington's disease is a progressive autosomal dominant neurodegenerative disorder for which currently no therapy is available. It is caused by a CAG repeat expansion in the HTT gene, which results in an expansion of a glutamine stretch at the N-terminal end of the huntingtin protein. This polyglutamine expansion plays a central role in the disease and results in the accumulation of cytoplasmic and nuclear aggregates. Here, we make use of modified 2'-O-methyl phosphorothioate (CUGn triplet-repeat antisense oligonucleotides to effectively reduce mutant huntingtin transcript and protein levels in patient-derived Huntington's disease fibroblasts and lymphoblasts. The most effective antisense oligonucleotide, (CUG(7, also reduced mutant ataxin-1 and ataxin-3 mRNA levels in spinocerebellar ataxia 1 and 3, respectively, and atrophin-1 in dentatorubral-pallidoluysian atrophy patient derived fibroblasts. This antisense oligonucleotide is not only a promising therapeutic tool to reduce mutant huntingtin levels in Huntington's disease but our results in spinocerebellar ataxia and dentatorubral-pallidoluysian atrophy cells suggest that this could also be applicable to other polyglutamine expansion disorders as well.

  10. Characterization of self-assembled DNA concatemers from synthetic oligonucleotides

    Directory of Open Access Journals (Sweden)

    Lu Sun

    2014-08-01

    Full Text Available Studies of DNA–ligand interaction on a single molecule level provide opportunities to understand individual behavior of molecules. Construction of DNA molecules with repetitive copies of the same segments of sequences linked in series could be helpful for enhancing the interaction possibility for sequence-specific binding ligand to DNA. Here we report on the use of synthetic oligonucleotides to self-assembly into duplex DNA concatemeric molecules. Two strands of synthetic oligonucleotides used here were designed with 50-mer in length and the sequences are semi-complimentary so to hybridize spontaneously into concatemers of double stranded DNA. In order to optimize the length of the concatemers the oligonucleotides were incubated at different oligomer concentrations, ionic strengths and temperatures for different durations. Increasing the salt concentration to 200 mM NaCl was found to be the major optimizing factor because at this enhanced ionic strength the concatemers formed most quickly and the other parameters had no detectable effect. The size and shape of formed DNA concatemers were studied by gel electrophoresis in agarose, polyacrylamide gels and by AFM. Our results show that linear DNA constructs up to several hundred base pairs were formed and could be separated from a substantial fraction of non-linear constructs.

  11. Engineering the specificity of trehalose phosphorylase as a general strategy for the production of glycosyl phosphates.

    Science.gov (United States)

    Chen, Chao; Van der Borght, Jef; De Vreese, Rob; D'hooghe, Matthias; Soetaert, Wim; Desmet, Tom

    2014-07-25

    A two-step process is reported for the anomeric phosphorylation of galactose, using trehalose phosphorylase as biocatalyst. The monosaccharide enters this process as acceptor but can subsequently be released from the donor side, thanks to the non-reducing nature of the disaccharide intermediate. A key development was the creation of an optimized enzyme variant that displays a strict specificity (99%) for β-galactose 1-phosphate as product.

  12. Synthesis of triazole-linked oligonucleotides with high affinity to DNA complements and an analysis of their compatibility with biosystems.

    Science.gov (United States)

    Varizhuk, Anna M; Kaluzhny, Dmitry N; Novikov, Roman A; Chizhov, Alexandr O; Smirnov, Igor P; Chuvilin, Andrey N; Tatarinova, Olga N; Fisunov, Gleb Y; Pozmogova, Galina E; Florentiev, Vladimir L

    2013-06-21

    New oligonucleotide analogues with triazole internucleotide linkages were synthesized, and their hybridization properties were studied. The analogues demonstrated DNA binding affinities similar to those of unmodified oligonucleotides. The modification was shown to protect the oligonucleotides from nuclease hydrolysis. The modified oligonucleotides were tested as PCR primers. Modifications remote from the 3'-terminus were tolerated by polymerases. Our results suggest that these new oligonucleotide analogues are among the most promising triazole DNA mimics characterized to date.

  13. The effect of intramolecular donor–acceptor moieties with donor–π-bridge–acceptor structure on the solar photovoltaic performance

    Directory of Open Access Journals (Sweden)

    T. L. Wang

    2015-10-01

    Full Text Available A series of intramolecular donor–acceptor polymers containing different contents of (E-1-(2-ethylhexyl-6,9-dioctyl-2-(2-(thiophen-3-ylvinyl-1H-phenanthro[9,10-d]imidazole (thiophene-DOPI moiety and 4,4-diethylhexylcyclopenta[ 2,1-b:3,4-b']dithiophene (CPDT unit was synthesized via Grignard metathesis (GRIM polymerization. The synthesized random copolymers and homopolymer of thiophene-DOPI contain the donor–π-bridge–acceptor conjugated structure to tune the absorption spectra and energy levels of the resultant polymers. UV-vis spectra of the three polymer films exhibit panchromatic absorptions ranging from 300 to 1100 nm and low band gaps from 1.38 to 1.51 eV. It is found that more thiophene-DOPI moieties result in the decrease of band gap and lower the highest occupied molecular orbital (HOMO and lowest unoccupied molecular orbital (LUMO values of polymers. Photovoltaic performance results indicate that if the content of the intramolecular donor–acceptor moiety is high enough, the copolymer structure may be better than homopolymer due to more light-harvesting afforded by both monomer units.

  14. Recognition of Gene Acceptor Site Based on Multi-objective Optimization

    Institute of Scientific and Technical Information of China (English)

    Jing ZHAO; Yue-Min ZHU; Pei-Ming SONG; Qing FANG; Jian-Hua LUO

    2005-01-01

    A new method for predicting the gene acceptor site based on multi-objective optimization is introduced in this paper. The models for the acceptor, branch and distance between acceptor site and branch site were constructed according to the characteristics of the sequences from the exon-intron database and using common biological knowledge. The acceptor function, branch function and distance function were defined respectively, and the multi-objective optimization model was constructed to recognize the splice site. The test results show that the algorithm used in this study performs better than the SplicePredictor,which is one of the leading acceptor site detectors.

  15. Dynamics of iron-acceptor-pair formation in co-doped silicon

    Energy Technology Data Exchange (ETDEWEB)

    Bartel, T.; Gibaja, F.; Graf, O.; Gross, D.; Kaes, M.; Heuer, M.; Kirscht, F. [Calisolar GmbH, Magnusstrasse 11, 12489 Berlin (Germany); Möller, C. [CiS Forschungsinstitut für Mikrosensorik und Photovoltaik GmbH, Konrad-Zuse-Str. 14, 99099 Erfurt (Germany); TU Ilmenau, Institut für Physik, Weimarer Str. 32, 98693 Ilmenau (Germany); Lauer, K. [CiS Forschungsinstitut für Mikrosensorik und Photovoltaik GmbH, Konrad-Zuse-Str. 14, 99099 Erfurt (Germany)

    2013-11-11

    The pairing dynamics of interstitial iron and dopants in silicon co-doped with phosphorous and several acceptor types are presented. The classical picture of iron-acceptor pairing dynamics is expanded to include the thermalization of iron between different dopants. The thermalization is quantitatively described using Boltzmann statistics and different iron-acceptor binding energies. The proper understanding of the pairing dynamics of iron in co-doped silicon will provide additional information on the electronic properties of iron-acceptor pairs and may become an analytical method to quantify and differentiate acceptors in co-doped silicon.

  16. Phosphate control in dialysis

    Directory of Open Access Journals (Sweden)

    Cupisti A

    2013-10-01

    Full Text Available Adamasco Cupisti,1 Maurizio Gallieni,2 Maria Antonietta Rizzo,2 Stefania Caria,3 Mario Meola,4 Piergiorgio Bolasco31Department of Clinical and Experimental Medicine, University of Pisa, Pisa, Italy; 2Nephrology and Dialysis Unit, San Carlo Borromeo Hospital, Milan, Italy; 3Territorial Department of Nephrology and Dialysis, ASL Cagliari, Italy; 4Sant'Anna School of Advanced Studies, University of Pisa, Pisa, ItalyAbstract: Prevention and correction of hyperphosphatemia is a major goal of chronic kidney disease–mineral and bone disorder (CKD–MBD management, achievable through avoidance of a positive phosphate balance. To this aim, optimal dialysis removal, careful use of phosphate binders, and dietary phosphate control are needed to optimize the control of phosphate balance in well-nourished patients on a standard three-times-a-week hemodialysis schedule. Using a mixed diffusive–convective hemodialysis tecniques, and increasing the number and/or the duration of dialysis tecniques are all measures able to enhance phosphorus (P mass removal through dialysis. However, dialytic removal does not equal the high P intake linked to the high dietary protein requirement of dialysis patients; hence, the use of intestinal P binders is mandatory to reduce P net intestinal absorption. Unfortunately, even a large dose of P binders is able to bind approximately 200–300 mg of P on a daily basis, so it is evident that their efficacy is limited in the case of an uncontrolled dietary P load. Hence, limitation of dietary P intake is needed to reach the goal of neutral phosphate balance in dialysis, coupled to an adequate protein intake. To this aim, patients should be informed and educated to avoid foods that are naturally rich in phosphate and also processed food with P-containing preservatives. In addition, patients should preferentially choose food with a low P-to-protein ratio. For example, patients could choose egg white or protein from a vegetable source

  17. A study of oligonucleotide occurrence distributions in DNA coding segments.

    Science.gov (United States)

    Castrignanò, T; Colosimo, A; Morante, S; Parisi, V; Rossi, G C

    1997-02-21

    In this paper we present a general strategy designed to study the occurrence frequency distributions of oligonucleotides in DNA coding segments and to deal with the problem of detecting possible patterns of genomic compositional inhomogeneities and disuniformities. Identifying specific tendencies or peculiar deviations in the distributions of the effective occurrence frequencies of oligonucleotides, with respect to what can be a priori expected, is of the greatest importance in biology. Differences between expected and actual distributions may in fact suggest or confirm the existence of specific biological mechanisms related to them. Similarly, a marked deviation in the occurrence frequency of an oligonucleotide may suggest that it belongs to the class of so-called "DNA signal (target) sequences". The approach we have elaborated is innovative in various aspects. Firstly, the analysis of the genomic data is carried out in the light of the observation that the distribution of the four nucleotides along the coding regions of the genoma is biased by the existence of a well-defined "reading frame". Secondly, the "experimental" numbers found by counting the occurrences of the various oligonucleotide sequences are appropriately corrected for the many kinds of mistakes and redundancies present in the available genetic Data Bases. A methodologically significant further improvement of our approach over the existing searching strategies is represented by the fact that, in order to decide whether or not the (corrected) "experimental" value of the occurrence frequency of a given oligonucleotide is within statistical expectations, a measure of the strength of the selective pressure, having acted on it in the course of the evolution, is assigned to the sequence, in a way that takes into account both the value of the "experimental" occurrence frequency of the sequence and the magnitude of the probability that this number might be the result of statistical fluctuations. If the

  18. Noise-Assisted Quantum Electron Transfer in Multi-Level Donor-Acceptor System

    CERN Document Server

    Gurvitz, Shmuel; Berman, Gennady P

    2014-01-01

    We analytically and numerically study noise-assisted quantum electron transfer (ET) in bio-complexes consisting of a single-level electron donor and an acceptor which is modeled by many electron energy levels. Interactions are included between the donor and the acceptor energy levels and with the protein environment, which is modeled by a diagonal classical noise acting on all donor and acceptor energy levels. Different regions of parameters characterizing (i) the number of the acceptor levels, (ii) the acceptor "band-width", and (iii) the amplitude of noise and its correlation time are considered. Under some conditions, we derive analytical expressions for the ET rate and efficiency, which reveal the coarse-grain features. We obtain equal occupation of all levels at large times, independently of the structure of the acceptor band. We discuss the multi-scale regime of the acceptor population, and the accompanying effect of quantum coherent oscillations, which are analogous to those observed in experiments on ...

  19. Phosphate Mines, Jordan

    Science.gov (United States)

    2008-01-01

    Jordan's leading industry and export commodities are phosphate and potash, ranked in the top three in the world. These are used to make fertilizer. The Jordan Phosphate Mines Company is the sole producer, having started operations in 1935. In addition to mining activities, the company produces phosphoric acid (for fertilizers, detergents, pharmaceuticals), diammonium phosphate (for fertilizer), sulphuric acid (many uses), and aluminum fluoride (a catalyst to make aluminum and magnesium). The image covers an area of 27.5 x 49.4 km, was acquired on September 17, 2005, and is located near 30.8 degrees north latitude, 36.1 degrees east longitude. The U.S. science team is located at NASA's Jet Propulsion Laboratory, Pasadena, Calif. The Terra mission is part of NASA's Science Mission Directorate.

  20. Enhanced biological phosphorus removal. Carbon sources, nitrate as electron acceptor, and characterization of the sludge community

    Energy Technology Data Exchange (ETDEWEB)

    Christensson, M.

    1997-10-01

    Enhanced biological phosphorus removal (EBPR) was studied in laboratory scale experiments as well as in a full scale EBPR process. The studies were focused on carbon source transformations, the use of nitrate as an electron acceptor and characterisation of the microflora. A continuous anaerobic/aerobic laboratory system was operated on synthetic wastewater with acetate as sole carbon source. An efficient EBPR was obtained and mass balances over the anaerobic reactor showed a production of 1.45 g poly-{beta}-hydroxyalcanoic acids (PHA), measured as chemical oxygen demand (COD), per g of acetic acid (as COD) taken up. Furthermore, phosphate was released in the anaerobic reactor in a ratio of 0.33 g phosphorus (P) per g PHA (COD) formed and 0.64 g of glycogen (COD) was consumed per g of acetic acid (COD) taken up. Microscopic investigations revealed a high amount of polyphosphate accumulating organisms (PAO) in the sludge. Isolation and characterisation of bacteria indicated Acinetobacter spp. to be abundant in the sludge, while sequencing of clones obtained in a 16S rDNA clone library showed a large part of the bacteria to be related to the high mole % G+C Gram-positive bacteria and only a minor fraction to be related to the gamma-subclass of proteobacteria to which Acinetobacter belongs. Operation of a similar anaerobic/aerobic laboratory system with ethanol as sole carbon source showed that a high EBPR can be achieved with this compound as carbon source. However, a prolonged detention time in the anaerobic reactor was required. PHA were produced in the anaerobic reactor in an amount of 1.24 g COD per g of soluble DOC taken up, phosphate was released in an amount of 0.4-0.6 g P per g PHA (COD) produced and 0.46 g glycogen (COD) was consumed per g of soluble COD taken up. Studies of the EBPR in the UCT process at the sewage treatment plant in Helsingborg, Sweden, showed the amount of volatile fatty acids (VFA) available to the PAO in the anaerobic stage to be

  1. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore

    Science.gov (United States)

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao

    2016-08-01

    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I.

  2. Utilization of a labeled tracking oligonucleotide for visualization and quality control of spotted 70-mer arrays

    Directory of Open Access Journals (Sweden)

    Khan Shehnaz

    2004-02-01

    Full Text Available Abstract Background Spotted 70-mer oligonucleotide arrays offer potentially greater specificity and an alternative to expensive cDNA library maintenance and amplification. Since microarray fabrication is a considerable source of data variance, we previously directly tagged cDNA probes with a third fluorophore for prehybridization quality control. Fluorescently modifying oligonucleotide sets is cost prohibitive, therefore, a co-spotted Staphylococcus aureus-specific fluorescein-labeled "tracking" oligonucleotide is described to monitor fabrication variables of a Mycobacterium tuberculosis oligonucleotide microarray. Results Significantly (p M. tuberculosis H37Rv and M. tuberculosis mprA. Linearity between the mean log Cy3/Cy5 ratios of genes differentially expressed from arrays either possessing or lacking the tracking oligonucleotide was observed (R2 = 0.90, p Conclusions This novel approach enables prehybridization array visualization for spotted oligonucleotide arrays and sets the stage for more sophisticated slide qualification and data filtering applications.

  3. Acceptor and donor impurities in GaN nanocrystals

    OpenAIRE

    Echeverría-Arrondo, C.; Pérez-Conde, J.; Bhattacharjee, A. K.

    2010-01-01

    We investigate acceptor and donor states in GaN nanocrystals doped with a single substitutional impurity. Quantum dots (QD's) of zinc-blende structure and spherical shape are considered with the radius ranging from 4.5 to 67.7 A. The size-dependent energy spectra are calculated within the sp3d5s* tight-binding model, which yields a good agreement with the confinement-induced blue shifts observed in undoped QD's. The computed binding energy is strongly enhanced with respect to the experimental...

  4. Modulating anti-MicroRNA-21 activity and specificity using oligonucleotide derivatives and length optimization

    DEFF Research Database (Denmark)

    Munoz-Alarcon, Andres; Guterstam, Peter; Romero, Cristian

    2012-01-01

    but reduced specificity when incorporating locked nucleic acid monomers, whereas the opposite was observed when introducing unlocked nucleic acid monomers. Our data suggest that phosphorothioate anti-microRNA oligonucleotides yield a greater activity than their phosphodiester counterparts and that a moderate...... truncation of the anti-microRNA oligonucleotide improves specificity without significantly losing activity. These results provide useful insights for design of anti-microRNA oligonucleotides to achieve both high activity as well as efficient mismatch discrimination....

  5. Synthesis of triazole-nucleoside phosphoramidites and their use in solid-phase oligonucleotide synthesis.

    Science.gov (United States)

    Peel, Brandon J; Efthymiou, Tim C; Desaulniers, Jean-Paul

    2014-12-19

    Triazole-backbone oligonucleotides are macromolecules that have one or more triazole units that are acting as a backbone mimic. Triazoles within the backbone have been used within oligonucleotides for a variety of applications. This unit describes the preparation and synthesis of two triazole-nucleoside phosphoramidites [uracil-triazole-uracil (UtU) and cytosine-triazole-uracil (CtU)] based on a PNA-like scaffold, and their incorporation within oligonucleotides.

  6. A New Achiral Linker Reagent for the Incorporation of Multiple Amino Groups Into Oligonucleotides

    DEFF Research Database (Denmark)

    1997-01-01

    The present invention relates to a new functionalized achiral linker reagent for incorporating multiple primary amino groups or reporter groups into oligonucleotides following the phosphoramidite methodology. It is possible to substitute any ribodeoxynucleotide, deoxynucleotide, or nucleotide wit......, to a method for preparing a labelled oligonucleotide, and to the use of the labelled oligonucleotide as hybridisation probe, in polymerase chain reactions (PCR), in nucleic acid sequencing, in cloning recombinant DNA and $i(in vitro) mutagenesis....

  7. Hemopoiesis-stimulating activity of immobilized oligonucleotides and hyaluronidase during cytostatic-induced myelosuppression.

    Science.gov (United States)

    Dygai, A M; Skurikhin, E G; Pershina, O V; Zhdanov, V V; Khmelevskaya, A M; Andreeva, T V; Poponina, A M; Zjuzkov, G N; Udut, E V; Khrichkova, T Ju; Simanina, E V; Miroshnichenko, L A; Stavrova, L A; Tchaikovsky, A S; Markova, T S; Gurto, R V; Brjushinina, O S; Slepichev, V A

    2011-03-01

    The hemopoiesis-stimulating effect of combined treatment with immobilized oligonucleotides and hyaluronidase preparations was studied during cytostatic-induced myelosuppression caused by cyclophosphamide administration. Immobilized hyaluronidase was shown to increase the efficiency of correction of changes in the erythroid and granulocytic hemopoietic stems with immobilized oligonucleotides. This potentiation of the effect of immobilized oligonucleotides by immobilized hyaluronidase was related to an increase in functional activity of committed hemopoietic precursors.

  8. Efficient assembly of very short oligonucleotides using T4 DNA Ligase

    Directory of Open Access Journals (Sweden)

    Holt Robert A

    2010-11-01

    Full Text Available Abstract Background In principle, a pre-constructed library of all possible short oligonucleotides could be used to construct many distinct gene sequences. In order to assess the feasibility of such an approach, we characterized T4 DNA Ligase activity on short oligonucleotide substrates and defined conditions suitable for assembly of a plurality of oligonucleotides. Findings Ligation by T4 DNA Ligase was found to be dependent on the formation of a double stranded DNA duplex of at least five base pairs surrounding the site of ligation. However, ligations could be performed effectively with overhangs smaller than five base pairs and oligonucleotides as small as octamers, in the presence of a second, complementary oligonucleotide. We demonstrate the feasibility of simultaneous oligonucleotide phosphorylation and ligation and, as a proof of principle for DNA synthesis through the assembly of short oligonucleotides, we performed a hierarchical ligation procedure whereby octamers were combined to construct a target 128-bp segment of the beta-actin gene. Conclusions Oligonucleotides as short as 8 nucleotides can be efficiently assembled using T4 DNA Ligase. Thus, the construction of synthetic genes, without the need for custom oligonucleotide synthesis, appears feasible.

  9. Determination of optimal sites of antisense oligonucleotide cleavage within TNFα mRNA

    Science.gov (United States)

    Lloyd, B. H.; Giles, R. V.; Spiller, D. G.; Grzybowski, J.; Tidd, D. M.; Sibson, D. R.

    2001-01-01

    Antisense oligonucleotides provide a powerful tool in order to determine the consequences of the reduced expression of a selected target gene and may include target validation and therapeutic applications. Methods of predicting optimum antisense sites are not always effective. We have compared the efficacy of antisense oligonucleotides, which were selected in vitro using random combinatorial oligonucleotide libraries of differing length and complexity, upon putative target sites within TNFα mRNA. The relationship of specific target site accessibility and oligonucleotide efficacy with respect to these parameters proved to be complex. Modification of the length of the recognition sequence of the oligonucleotide library illustrated that independent target sites demonstrated a preference for antisense oligonucleotides of a defined and independent optimal length. The efficacy of antisense oligonucleotide sequences selected in vitro paralleled that observed in phorbol 12-myristate 13-acetate (PMA)-activated U937 cells. The application of methylphosphonate:phosphodiester chimaeric oligonucleotides to U937 cells reduced mRNA levels to up to 19.8% that of the untreated cell population. This approach provides a predictive means to profile any mRNA of known sequence with respect to the identification and optimisation of sites accessible to antisense oligonucleotide activity. PMID:11522838

  10. Label-free detection of hybridization of oligonucleotides by oblique-incidence reflectivity difference method

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The microarrays of 20-base oligonucleotide with different concentrations are detected before and after hybridization by the oblique-incidence reflectivity difference (OI-RD) method. The experimental results prove that OI-RD is a label-free method which can not only distinguish the concentration difference of oligonucleotides before and after the hybridization but also detect the hybridization of short oligonucleotides. At present the OI-RD method can detect 0.39 μmol/L 20-base oligonucleotide or less. These results suggest that the OI-RD method is a promising and potential technique for label-free detection of biological microarrays.

  11. [Dynamics of charge transfer along an oligonucleotide at finite temperature].

    Science.gov (United States)

    Lakhno, V D; Fialko, N S

    2004-01-01

    The quantum-statistical approach was used to describe the charge transfer in nucleotide sequences. The results of numerical modeling for hole transfer in the GTTGGG sequence with background temperature noise are given. It was shown that, since guanine has an oxidation potential lower than thymine, the hole created at the G donor in this sequence passes through the thymine barrier into the guanine triplet (acceptor) at a time of approximately 10 ps at a temperature of 37 degrees C.

  12. Research on Uncrystallized Phosphating Film

    Institute of Scientific and Technical Information of China (English)

    TANG En-jun; XING Ze-kuan

    2004-01-01

    This article excogitated a kind of uncrystallized phosphating film bears wearing capacity goodly by adding Ca2 + in normal phosphating solution. This technology is very useful to protect steel parts working in oil from abrasion.

  13. Glucose-6-phosphate dehydrogenase deficiency

    Science.gov (United States)

    ... medlineplus.gov/ency/article/000528.htm Glucose-6-phosphate dehydrogenase deficiency To use the sharing features on this page, please enable JavaScript. Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a condition in which ...

  14. Perylene-Diimide Based Donor-Acceptor-Donor Type Small-Molecule Acceptors for Solution-Processable Organic Solar Cells

    Science.gov (United States)

    Ganesamoorthy, Ramasamy; Vijayaraghavan, Rajagopalan; Sakthivel, Pachagounder

    2017-08-01

    Development of nonfullerene acceptors plays an important role in the commercial availability of plastic solar cells. We report herein synthesis of bay-substituted donor-acceptor-donor (D-A-D)-type perylene diimide (PDI)-based small molecules (SM-1 to SM-4) by Suzuki coupling method and their use as acceptors in bulk heterojunction organic solar cells (BHJ-OSCs) with poly(3-hexylthiophene) (P3HT) polymer donor. We varied the number of electron-rich thiophene units and the solubilizing side chains and also evaluated the optical and electrochemical properties of the small molecules. The synthesized small molecules were confirmed by Fourier-transform infrared (FT-IR) spectroscopy, nuclear magnetic resonance (NMR) spectroscopy, and high-resolution mass spectroscopy (HR-MS). The small molecules showed extensive and strong absorption in the ultraviolet-visible (UV-Vis) region up to 750 nm, with bandgap (E_{{g}}^{{opt}} ) reduced below polymer donor showed maximum power conversion efficiency (PCE) of 0.19% with V oc of 0.30 V, J sc of 1.72 mA cm-2, and fill factor (FF) of 37%. The PCE decreased with the number of thiophene units. The PCE of SM-2 was lower than that of SM-1. This difference in PCE can be explained by the higher aggregation tendency of the bithiophene compared with the thiophene unit. Introduction of the solubilizing group in the bay position increased the aggregation property, leading to much lower PCE than for the small molecules without solubilizing group.

  15. Glutathione Adduct Patterns of Michael-Acceptor Carbonyls.

    Science.gov (United States)

    Slawik, Christian; Rickmeyer, Christiane; Brehm, Martin; Böhme, Alexander; Schüürmann, Gerrit

    2017-02-22

    Glutathione (GSH) has so far been considered to facilitate detoxification of soft organic electrophiles through covalent binding at its cysteine (Cys) thiol group, followed by stepwise catalyzed degradation and eventual elimination along the mercapturic acid pathway. Here we show that in contrast to expectation from HSAB theory, Michael-acceptor ketones, aldehydes and esters may form also single, double and triple adducts with GSH involving β-carbon attack at the much harder N-terminus of the γ-glutamyl (Glu) unit of GSH. In particular, formation of the GSH-N single adduct contradicts the traditional view that S alkylation always forms the initial reaction of GSH with Michael-acceptor carbonyls. To this end, chemoassay analyses of the adduct formation of GSH with nine α,β-unsaturated carbonyls employing high performance liquid chromatography and tandem mass spectrometry have been performed. Besides enriching the GSH adductome and potential biomarker applications, electrophilic N-terminus functio-nalization is likely to impair GSH homeostasis substantially through blocking the γ-glutamyl transferase catalysis of the first breakdown step of modified GSH, and thus its timely reconstitution. The discussion includes a comparison with cyclic adducts of GSH and furan metabolites as reported in literature, and quantum chemically calculated thermodynamics of hard-hard, hard-soft and soft-soft adducts.

  16. Chemically modified oligonucleotides with efficient RNase H response

    DEFF Research Database (Denmark)

    Vester, Birte; Boel, Anne Marie; Lobedanz, Sune;

    2008-01-01

    Ten different chemically modified nucleosides were incorporated into short DNA strands (chimeric oligonucleotides ON3-ON12 and ON15-ON24) and then tested for their capacity to mediate RNAse H cleavage of the complementary RNA strand. The modifications were placed at two central positions directly...... in the RNase H cleaving region. The RNA strand of duplexes with ON3, ON5 and ON12 were cleaved more efficiently than the RNA strand of the DNA:RNA control duplex. There seems to be no correlation between the thermal stability between the duplexes and RNase H cleavage....

  17. Splice-switching antisense oligonucleotides as therapeutic drugs

    OpenAIRE

    Havens, Mallory A.; Hastings, Michelle L.

    2016-01-01

    Splice-switching oligonucleotides (SSOs) are short, synthetic, antisense, modified nucleic acids that base-pair with a pre-mRNA and disrupt the normal splicing repertoire of the transcript by blocking the RNA–RNA base-pairing or protein–RNA binding interactions that occur between components of the splicing machinery and the pre-mRNA. Splicing of pre-mRNA is required for the proper expression of the vast majority of protein-coding genes, and thus, targeting the process offers a means to manipu...

  18. Tandem Oligonucleotide Probe Annealing and Elongation To Discriminate Viral Sequence

    DEFF Research Database (Denmark)

    Taskova, Maria; Uhd, Jesper; Miotke, Laura

    2017-01-01

    followed by click assembly and analysis of the read sequence by various techniques. As we demonstrate in this paper, using our new approach, a viral RNA sequence can be detected in less than 2 h without the need for cDNA synthesis or any other enzymatic reactions and with a sensitivity of ... opportunities in transcriptome analysis, virology, and other fields. Herein, we report for the first time a "click" chemistry approach to oligonucleotide probe elongation as a novel approach to specifically detect a viral sequence. We hybridized a library of short, terminally labeled probes to Ebola virus RNA...

  19. Prodrugs of phosphonates and phosphates: crossing the membrane barrier.

    Science.gov (United States)

    Wiemer, Andrew J; Wiemer, David F

    2015-01-01

    A substantial portion of metabolism involves transformation of phosphate esters, including pathways leading to nucleotides and oligonucleotides, carbohydrates, isoprenoids and steroids, and phosphorylated proteins. Because the natural substrates bear one or more negative charges, drugs that target these enzymes generally must be charged as well, but small charged molecules can have difficulty traversing the cell membrane by means other than endocytosis. The resulting dichotomy has stimulated a great deal of effort to develop effective prodrugs, compounds that carry little or no charge to enable them to transit biological membranes, but able to release the parent drug once inside the target cell. This chapter presents recent studies on advances in prodrug forms, along with representative examples of their application to marketed and developmental drugs.

  20. Practical application of phosphate treatment

    Energy Technology Data Exchange (ETDEWEB)

    Caravaggio, Mike [Integrated Chemistry Solutions Pte. Ltd., Singapore (Singapore)

    2011-05-15

    Phosphate treatment has been applied to subcritical fossil power boilers for well over half a century, as well as being used frequently in heat recovery steam generators. The use of this treatment has evolved over the decades, with the operating sodium to phosphate ratio being the defining factor for the evolution of the treatment. The evolving prescribed sodium to phosphate ratios have been based on the scientific research results and operating experience available at the time, and in the latest EPRI Guidelines issued in 2004 are set at a minimum sodium to phosphate ratio of 3:1, with provision to add up to 1 mg . L{sup -1} of additional free caustic. The ratio limitation has always been set in an effort to minimize the potential for corrosion caused by the potential misapplication of the treatment. Typically, the operating ranges for phosphate treatments are depicted on an x-y plot with the x-axis the phosphate concentration and the y-axis the corrected pH value based on the maximum sodium to phosphate ratio allowed for by the treatment. These operating range plots define the theoretical operating range of a phosphate treatment. This paper briefly discusses the origin of the current phosphate control limits in the EPRI Guidelines, discusses phosphate chemistry, outlines the limitations involved when applying a phosphate treatment and provides additional practical guidance for overcoming these limitations and minimizing the potential for corrosion induced by the incorrect application of a phosphate treatment. (orig.)

  1. The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis.

    Science.gov (United States)

    Wilk, Andrzej; Chmielewski, Marcin K; Grajkowski, Andrzej; Phillips, Lawrence R; Beaucage, Serge L

    2002-09-06

    Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

  2. Progress in ZnO Acceptor Doping: What Is the Best Strategy?

    Directory of Open Access Journals (Sweden)

    Judith G. Reynolds

    2014-01-01

    Full Text Available This paper reviews the recent progress in acceptor doping of ZnO that has been achieved with a focus toward the optimum strategy. There are three main approaches for generating p-type ZnO: substitutional group IA elements on a zinc site, codoping of donors and acceptors, and substitution of group VA elements on an oxygen site. The relevant issues are whether there is sufficient incorporation of the appropriate dopant impurity species, does it reside on the appropriate lattice site, and lastly whether the acceptor ionization energy is sufficiently small to enable significant p-type conduction at room temperature. The potential of nitrogen doping and formation of the appropriate acceptor complexes is highlighted although theoretical calculations predict that nitrogen on an oxygen site is a deep acceptor. We show that an understanding of the growth and annealing steps to achieve the relevant acceptor defect complexes is crucial to meet requirements.

  3. The structure and bonding of iron-acceptor pairs in silicon

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, S.; Assali, L.V.C.; Kimerling, L.C. [Massachusetts Inst. of Technology, Cambridge, MA (United States)

    1995-08-01

    The highly mobile interstitial iron and Group III impurities (B, Al, Ga, In) form iron-acceptor pairs in silicon. Based on the migration kinetics and taking host silicon as a dielectric medium, we have simulated the pairing process in a static silicon lattice. Different from the conventional point charge ionic model, our phenomenological calculations include (1) a correction that takes into account valence electron cloud polarization which adds a short range, attractive interaction in the iron-acceptor pair bonding; and (2) silicon lattice relaxation due to the atomic size difference which causes a local strain field. Our model explains qualitatively (1) trends among the iron-acceptor pairs revealing an increase of the electronic state hole emission energy with increasing principal quantum number of acceptor and decreasing pair separation distance; and (2) the stable and metastable sites and configurational symmetries of the iron-acceptor pairs. The iron-acceptor pairing and bonding mechanism is also discussed.

  4. Binding characteristics of homogeneous molecularly imprinted polymers for acyclovir using an (acceptor-donor-donor)-(donor-acceptor-acceptor) hydrogen-bond strategy, and analytical applications for serum samples.

    Science.gov (United States)

    Wu, Suqin; Tan, Lei; Wang, Ganquan; Peng, Guiming; Kang, Chengcheng; Tang, Youwen

    2013-04-12

    This paper demonstrates a novel approach to assembling homogeneous molecularly imprinted polymers (MIPs) based on mimicking multiple hydrogen bonds between nucleotide bases by preparing acyclovir (ACV) as a template and using coatings grafted on silica supports. (1)H NMR studies confirmed the AAD-DDA (A for acceptor, D for donor) hydrogen-bond array between template and functional monomer, while the resultant monodisperse molecularly imprinted microspheres (MIMs) were evaluated using a binding experiment, high performance liquid chromatography (HPLC), and solid phase extraction. The Langmuir isothermal model and the Langmuir-Freundlich isothermal model suggest that ACV-MIMs have more homogeneous binding sites than MIPs prepared through normal imprinting. In contrast to previous MIP-HPLC columns, there were no apparent tailings for the ACV peaks, and ACV-MIMs had excellent specific binding properties with a Ka peak of 3.44 × 10(5)M(-1). A complete baseline separation is obtained for ACV and structurally similar compounds. This work also successfully used MIMs as a specific sorbent for capturing ACV from serum samples. The detection limit and mean recovery of ACV was 1.8 ng/mL(-1) and 95.6%, respectively, for molecularly imprinted solid phase extraction coupled with HPLC. To our knowledge, this was the first example of MIPs using AAD-DDA hydrogen bonds.

  5. Donor-Acceptor-Type Semiconducting Polymers Consisting of Benzothiadiazole Derivatives as Electron-Acceptor Units for Organic Photovoltaic Cells.

    Science.gov (United States)

    Kim, Hee Su; Park, Jong Baek; Kim, Ji-Hoon; Hwang, Do-Hoon

    2015-11-01

    We synthesized two fused pentacyclic donor-acceptor structures, where the two different outer electron rich thiophene (DTPBT) and electron poor benzene (ICTh) moieties are covalently bonded to the central electron-deficient benzothiadiazole core by two nitrogen bridges. These new electron-acceptor DTPBT and ICTh building blocks were copolymerized with fluorene, as the electron donor group, via Suzuki coupling polymerization, to produce two new alternating copolymers, PFDTPBT and PFICTh, respectively. The average molecular weights of the synthesized polymers were determined by GPC. The number-average molecular weights of PFDTPBT and PFICTh were 19,000 (PDI = 2.5) and 20,000 (PDI = 4.0), respectively. The optical bandgap energies of the polymers were measured from their absorption onsets to be 2.15 and 2.55 eV, depending on the polymer structure. The HOMO energy levels of the polymers were determined, by measuring the oxidation onsets of the polymer films by cyclic voltammetry. The measured HOMO energy levels of PFDTPBT and PFICTh were -5.10 and -5.57 eV, respectively. When the polymers were blended with PC71BM, as the active layer for bulk-heterojunction photovoltaic devices, power conversion efficiencies were 2.08% and 0.34%, respectively, under AM 1.5 G (100 mW cm(-2)) conditions.

  6. Magnetic anisotropy of single Mn acceptors in GaAs in an external magnetic field

    OpenAIRE

    Bozkurt, M Murat; Mahani, MR; Studer, P; Tang, J-M; Schofield, SR; Curson, NJ; Flatté, ME Michael; Silov, AY Andrei; Hirjibehedin, CF; Canali, CM; Koenraad, PM Paul

    2013-01-01

    We investigate the effect of an external magnetic field on the physical properties of the acceptor hole states associated with single Mn acceptors placed near the (110) surface of GaAs. Crosssectional scanning tunneling microscopy images of the acceptor local density of states (LDOS) show that the strongly anisotropic hole wavefunction is not significantly affected by a magnetic field up to 6 T. These experimental results are supported by theoretical calculations based on a tightbinding model...

  7. An overview of sugar-modified oligonucleotides for antisense therapeutics.

    Science.gov (United States)

    Prakash, Thazha P

    2011-09-01

    Among the multitude of chemical modifications that have been described over the past two decades, oligonucleotide analogs that are modified at the 2'-position of the furanose sugar have been especially useful for improving the drug-like properties of antisense oligonucleotides (ASOs). These modifications bias the sugar pucker towards the 3'-endo-conformation and improve ASO affinity for its biological target (i.e., mRNA). In addition, antisense drugs incorporating 2'-modified nucleotides exhibit enhanced metabolic stability, and improved pharmacokinetic and toxicological properties. Further conformational restriction of the 2'-substituent to the 4'-position of the furanose ring yielded the 2',4'-bridged nucleic acid (BNA) analogs. ASOs containing BNA modifications showed unprecedented increase in binding affinity for target RNA, while also improved nuclease resistance, in vitro and in vivo potency. Several ASO drug candidates containing 2'-modified nucleotides have entered clinical trials and continue to make progress in the clinic for a variety of therapeutic indications. 2011 Verlag Helvetica Chimica Acta AG, Zürich.

  8. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Hongguang Sun

    2014-01-01

    Full Text Available Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy.

  9. The use of oligonucleotide probes for meningococcal serotype characterization

    Directory of Open Access Journals (Sweden)

    SACCHI Claudio Tavares

    1998-01-01

    Full Text Available In the present study we examine the potential use of oligonucleotide probes to characterize Neisseria meningitidis serotypes without the use of monoclonal antibodies (MAbs. Antigenic diversity on PorB protein forms the bases of serotyping method. However, the current panel of MAbs underestimated, by at least 50% the PorB variability, presumably because reagents for several PorB variable regions (VRs are lacking, or because a number of VR variants are not recognized by serotype-defining MAbs12. We analyzed the use of oligonucleotide probes to characterize serotype 10 and serotype 19 of N. meningitidis. The porB gene sequence for the prototype strain of serotype 10 was determined, aligned with 7 other porB sequences from different serotypes, and analysis of individual VRs were performed. The results of DNA probes 21U (VR1-A and 615U (VR3-B used against 72 N. meningitidis strains confirm that VR1 type A and VR3 type B encode epitopes for serotype-defined MAbs 19 and 10, respectively. The use of probes for characterizing serotypes possible can type 100% of the PorB VR diversity. It is a simple and rapid method specially useful for analysis of large number of samples.

  10. Calcium Phosphate Biomaterials: An Update

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    Current calcium phosphate (CaP) biomaterials for bone repair, substitution, augmentation and regeneration include hydroxyapatite ( HA ) from synthetic or biologic origin, beta-tricalcium phosphate ( β-TCP ) , biphasic calcium phosphate (BCP), and are available as granules, porous blocks, components of composites (CaP/polymer) cements, and as coatings on orthopedic and dental implants. Experimental calcium phosphate biomaterials include CO3- and F-substituted apatites, Mg-and Zn-substituted β-TCP, calcium phosphate glasses. This paper is a brief review of the different types of CaP biomaterials and their properties such as bioactivity, osteoconductivity, osteoinductivity.

  11. Biomediated continuous release phosphate fertilizer

    Science.gov (United States)

    Goldstein, Alan H.; Rogers, Robert D.

    1999-01-01

    A composition is disclosed for providing phosphate fertilizer to the root zone of plants. The composition comprises a microorganism capable of producing and secreting a solubilization agent, a carbon source for providing raw material for the microorganism to convert into the solubilization agent, and rock phosphate ore for providing a source of insoluble phosphate that is solubilized by the solubilization agent and released as soluble phosphate. The composition is provided in a physical form, such as a granule, that retains the microorganism, carbon source, and rock phosphate ore, but permits water and soluble phosphate to diffuse into the soil. A method of using the composition for providing phosphate fertilizer to plants is also disclosed.

  12. The MOX/SUC precursor strategies: robust ways to construct functionalized oligonucleotides.

    Science.gov (United States)

    Polushin, N

    2001-01-01

    The use of phosphoramidites bearing one or more methoxyoxalamido (MOX) or succinimido (SUC) reactive groups for construction of functionalized oligonucleotides is described. The efficiency of the new precursor strategy was demonstrated in the synthesis of oligonucleotide containing up to 16 imidazole residues.

  13. Multicellular Tumor Spheroids as a Model for Assessing Delivery of Oligonucleotides in Three Dimensions

    Science.gov (United States)

    Carver, Kyle; Ming, Xin; Juliano, Rudolph L

    2014-01-01

    Oligonucleotides have shown promise in selectively manipulating gene expression in vitro, but that success has not translated to the clinic for cancer therapy. A potential reason for this is that cells behave differently in monolayer than in the three-dimensional tumor, resulting in limited penetration and distribution of oligonucleotides in the tumor. This may be especially true when oligonucleotides are associated with nanocarriers such as lipoplexes and polyplexes, commonly used delivery vehicles for oligonucleotides. The multicellular tumor spheroid (MCTS), a three-dimensional model that closely resembles small avascular tumors and micrometastases, has been utilized as an intermediate between monolayer culture and in vivo studies for the screening of small-molecule drugs. However, spheroids have been little used for the study of various oligonucleotide delivery formulations. Here, we have evaluated the uptake and efficacy of splice-switching antisense oligonucleotides using various delivery modalities in two- and three-dimensional culture models. We find that the size of the delivery agent dramatically influences penetration into the spheroid and thus the biological effect of the oligonucleotides. We hypothesize that the MCTS model will prove to be a useful tool in the future development of oligonucleotide delivery formulations. PMID:24618852

  14. Nucleobase azide-ethynylribose click chemistry contributes to stabilizing oligonucleotide duplexes and stem-loop structures.

    Science.gov (United States)

    Kitamura, Yoshiaki; Asakura, Ryo; Terazawa, Koki; Shibata, Aya; Ikeda, Masato; Kitade, Yukio

    2017-06-15

    The formation of 1,4-disubstituted 1,2,3-triazoles through copper-catalyzed azide-alkyne cycloaddition (CuAAC) in oligonucleotides bearing 1-deoxy-1-ethynyl-β-d-ribofuranose (R(E)) can have a positive impact on the stability of oligonucleotide duplexes and stem-loop structures. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Studies on the Syntheses and Properties of 5'-Branched-sugar Isonucleosides and the Related Oligonucleotides

    Institute of Scientific and Technical Information of China (English)

    Tian Xiaobing; Zhang Lihe; Min Jimei

    2001-01-01

    @@ The chemistry of nucleosides and oligonucleotides is an actively investigated field in the search for new drugs. Thesyntheses and the properties of isonucleosides and oligonucleotides have been investigated to improve their stability,antitumor and antiviral activities, and to reduce their toxicity.

  16. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

    Science.gov (United States)

    Golova, Julia B.; Chernov, Boris K.

    2010-04-27

    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  17. Donor-acceptor pair recombination in gallium sulfide

    Science.gov (United States)

    Aydinli, A.; Gasanly, N. M.; Gökşen, K.

    2000-12-01

    Low temperature photoluminescence of GaS single crystals shows three broad emission bands below 2.4 eV. Temperature and excitation light intensity dependencies of these bands reveal that all of them originate from close donor-acceptor pair recombination processes. Temperature dependence of the peak energies of two of these bands in the visible range follow, as expected, the band gap energy shift of GaS. However, the temperature dependence of the peak energy of the third band in the near infrared shows complex behavior by blueshifting at low temperatures followed by a redshift at intermediate temperatures and a second blueshift close to room temperature, which could only be explained via a configuration coordinate model. A simple model calculation indicates that the recombination centers are most likely located at the nearest neighbor lattice or interstitial sites.

  18. Quantum information processing using acceptors in silicon and phonon entanglement

    Science.gov (United States)

    Clark, Susan; Reinke, Charles; McGuinness, Hayden; El-Kady, Ihab

    2014-03-01

    Quantum computing with large numbers of qubits remains challenging due to the decoherence and complexity that arise as more qubits are added to a system. Here I propose a new platform for semiconductor quantum computing which may be robust to common sources of decoherence and may not be difficult to fabricate repeatedly. This system consists of a hole bound to an acceptor in silicon which has been implanted in the center of a mechanical cavity (similar to a photonic crystal cavity) and connected to other cavities by a system of waveguides. I will outline a basic entangling gate and calculations showing the promise of this platform as the ideal qubit. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U. S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000.

  19. Establishment of Plant Acceptor System for Hyperosmosis Transformation.

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Calli and adventitious buds induced from different explants such as young stems and leaves of tomato variety Moneymaker, and mature embryos and young spikelets of rice variety TP309 were used to establish hyperosmotic transformation system at various osmotica treatments.The results revealed that the calli induced from tomato young leaves and rice young spikelets were the ideal transfomation acceptor. The cells of calli were still vigorous when treated wity 0.75 mol/L hyperosmotic solution for 4 hours. The differentiation rates of calli varied from 7.5% to 93.3% in different media. The bud differentiation was apparently inhibited by hyperosmotic treatments. O.75mol/L sucrose hypertonic solution and O.2mol/L CaCl2 solution were favorable hyperosmoticum and hypoosmoticum respectively.

  20. Beyond fullerenes: design of nonfullerene acceptors for efficient organic photovoltaics.

    Science.gov (United States)

    Li, Haiyan; Earmme, Taeshik; Ren, Guoqiang; Saeki, Akinori; Yoshikawa, Saya; Murari, Nishit M; Subramaniyan, Selvam; Crane, Matthew J; Seki, Shu; Jenekhe, Samson A

    2014-10-15

    New electron-acceptor materials are long sought to overcome the small photovoltage, high-cost, poor photochemical stability, and other limitations of fullerene-based organic photovoltaics. However, all known nonfullerene acceptors have so far shown inferior photovoltaic properties compared to fullerene benchmark [6,6]-phenyl-C60-butyric acid methyl ester (PC60BM), and there are as yet no established design principles for realizing improved materials. Herein we report a design strategy that has produced a novel multichromophoric, large size, nonplanar three-dimensional (3D) organic molecule, DBFI-T, whose π-conjugated framework occupies space comparable to an aggregate of 9 [C60]-fullerene molecules. Comparative studies of DBFI-T with its planar monomeric analogue (BFI-P2) and PC60BM in bulk heterojunction (BHJ) solar cells, by using a common thiazolothiazole-dithienosilole copolymer donor (PSEHTT), showed that DBFI-T has superior charge photogeneration and photovoltaic properties; PSEHTT:DBFI-T solar cells combined a high short-circuit current (10.14 mA/cm(2)) with a high open-circuit voltage (0.86 V) to give a power conversion efficiency of 5.0%. The external quantum efficiency spectrum of PSEHTT:DBFI-T devices had peaks of 60-65% in the 380-620 nm range, demonstrating that both hole transfer from photoexcited DBFI-T to PSEHTT and electron transfer from photoexcited PSEHTT to DBFI-T contribute substantially to charge photogeneration. The superior charge photogeneration and electron-accepting properties of DBFI-T were further confirmed by independent Xenon-flash time-resolved microwave conductivity measurements, which correctly predict the relative magnitudes of the conversion efficiencies of the BHJ solar cells: PSEHTT:DBFI-T > PSEHTT:PC60BM > PSEHTT:BFI-P2. The results demonstrate that the large size, multichromophoric, nonplanar 3D molecular design is a promising approach to more efficient organic photovoltaic materials.

  1. Detection of oligonucleotide hybridization on a single microparticle by time-resolved fluorometry: hybridization assays on polymer particles obtained by direct solid phase assembly of the oligonucleotide probes.

    Science.gov (United States)

    Hakala, H; Heinonen, P; Iitiä, A; Lönnberg, H

    1997-01-01

    Oligodeoxyribonucleotides were assembled by conventional phosphoramidite chemistry on uniformly sized (50 microns) porous glycidyl methacrylate/ethylene dimethacrylate (SINTEF) and compact polystyrene (Dynosphere) particles, the aminoalkyl side chains of which were further derivatized with DMTrO-acetyl groups. The linker was completely resistant toward ammonolytic deprotection of the base moieties. The quality of oligonucleotides was assessed by repeating the synthesis on the same particles derivatized with a cleavable ester linker. The ability of the oligonucleotide-coated particles to bind complementary sequences via hybridization was examined by following the attachment of oligonucleotides bearing a photoluminescent europium(III) chelate to the particles. The fluorescence emission was measured directly on a single particle. The effects of the following factors on the kinetics and efficiency of hybridization were studied: number of particles in a given volume of the assay solution, loading of oligonucleotide on the particle, concentration of the target oligonucleotide in solution, length of the hybridizing sequence, presence of noncomplementary sequences, and ionic strength. The fluorescence signal measured on a single particle after hybridization was observed to be proportional to the concentration of the target oligonucleotide in solution over a concentration range of 5 orders of magnitude.

  2. Cellular Uptake and Intracellular Trafficking of Antisense and siRNA Oligonucleotides

    Science.gov (United States)

    Juliano, RL; Ming, Xin; Nakagawa, Osamu

    2012-01-01

    Significant progress is being made concerning the development of oligonucleotides as therapeutic agents. Studies with antisense, siRNA, and other forms of oligonucleotides have shown promise in cellular and animal models and in some clinical studies. Nonetheless our understanding of how oligonucleotides function in cells and tissues is really quite limited. One major issue concerns the modes of uptake and intracellular trafficking of oligonucleotides, whether as ‘free’ molecules, or linked to various delivery moieties such as nanoparticles or targeting ligands. In this review we examine the recent literature on oligonucleotide internalization and subcellular trafficking in the context of current insights into the basic machinery for endocytosis and intracellular vesicular traffic. PMID:21992697

  3. Affinity hydrogels for controlled protein release using nucleic acid aptamers and complementary oligonucleotides.

    Science.gov (United States)

    Soontornworajit, Boonchoy; Zhou, Jing; Snipes, Matthew P; Battig, Mark R; Wang, Yong

    2011-10-01

    Biomaterials for the precise control of protein release are important to the development of new strategies for treating human diseases. This study aimed to fundamentally understand aptamer--protein dissociation triggered by complementary oligonucleotides, and to apply this understanding to develop affinity hydrogels for controlled protein release. The results showed that the oligonucleotide tails of the aptamers played a critical role in inducing intermolecular hybridization and triggering aptamer--protein dissociation. In addition, the attachment of the oligonucleotide tails to the aptamers and the increase of hybridizing length could produce a synergistic effect on the dissociation of bound proteins from their aptamers. More importantly, pegylated complementary oligonucleotides could successfully trigger protein release from the aptamer-functionalized hydrogels at multiple time points. Based on these results, it is believed that aptamer-functionalized hydrogels and complementary oligonucleotides hold great potential of controlling the release of protein drugs to treat human diseases.

  4. Recommendations for safety pharmacology evaluations of oligonucleotide-based therapeutics.

    Science.gov (United States)

    Berman, Cindy L; Cannon, Keri; Cui, Yi; Kornbrust, Douglas J; Lagrutta, Armando; Sun, Sunny Z; Tepper, Jeff; Waldron, Gareth; Younis, Husam S

    2014-08-01

    This document was prepared by the Safety Pharmacology Subcommittee of the Oligonucleotide Safety Working Group (OSWG), a group of industry and regulatory scientists involved in the development and regulation of therapeutic oligonucleotides. The mission of the Subcommittee was to develop scientific recommendations for the industry regarding the appropriate scope and strategies for safety pharmacology evaluations of oligonucleotides (ONs). These recommendations are the consensus opinion of the Subcommittee and do not necessarily reflect the current expectations of regulatory authorities. 1) Safety pharmacology testing, as described in the International Conference on Harmonisation (ICH) S7 guidance, is as applicable to ONs as it is to small molecule drugs and biotherapeutics. 2) Study design considerations for ONs are similar to those for other classes of drugs. In general, as with other therapeutics, studies should evaluate the drug product administered via the clinical route. Species selection should ideally consider relevance of the model with regard to the endpoints of interest, pharmacological responsiveness, and continuity with the nonclinical development program. 3) Evaluation of potential effects in the core battery (cardiovascular, central nervous, and respiratory systems) is recommended. In general: a. In vitro human ether-a-go-go-related gene (hERG) testing does not provide any specific value and is not warranted. b. Emphasis should be placed on in vivo evaluation of cardiovascular function, typically in nonhuman primates (NHPs). c. Due to the low level of concern, neurologic and respiratory function can be assessed concurrently with cardiovascular safety pharmacology evaluation in NHPs, within repeat-dose toxicity studies, or as stand-alone studies. In the latter case, rodents are most commonly used. 4) Other dedicated safety pharmacology studies, beyond the core battery, may have limited value for ONs. Although ONs can accumulate in the kidney and liver

  5. Contrasting performance of donor-acceptor copolymer pairs in ternary blend solar cells and two-acceptor copolymers in binary blend solar cells.

    Science.gov (United States)

    Khlyabich, Petr P; Rudenko, Andrey E; Burkhart, Beate; Thompson, Barry C

    2015-02-04

    Here two contrasting approaches to polymer-fullerene solar cells are compared. In the first approach, two distinct semi-random donor-acceptor copolymers are blended with phenyl-C61-butyric acid methyl ester (PC61BM) to form ternary blend solar cells. The two poly(3-hexylthiophene)-based polymers contain either the acceptor thienopyrroledione (TPD) or diketopyrrolopyrrole (DPP). In the second approach, semi-random donor-acceptor copolymers containing both TPD and DPP acceptors in the same polymer backbone, termed two-acceptor polymers, are blended with PC61BM to give binary blend solar cells. The two approaches result in bulk heterojunction solar cells that have the same molecular active-layer components but differ in the manner in which these molecular components are mixed, either by physical mixing (ternary blend) or chemical "mixing" in the two-acceptor (binary blend) case. Optical properties and photon-to-electron conversion efficiencies of the binary and ternary blends were found to have similar features and were described as a linear combination of the individual components. At the same time, significant differences were observed in the open-circuit voltage (Voc) behaviors of binary and ternary blend solar cells. While in case of two-acceptor polymers, the Voc was found to be in the range of 0.495-0.552 V, ternary blend solar cells showed behavior inherent to organic alloy formation, displaying an intermediate, composition-dependent and tunable Voc in the range from 0.582 to 0.684 V, significantly exceeding the values achieved in the two-acceptor containing binary blend solar cells. Despite the differences between the physical and chemical mixing approaches, both pathways provided solar cells with similar power conversion efficiencies, highlighting the advantages of both pathways toward highly efficient organic solar cells.

  6. Mechanistic studies of the oxygen evolution reaction by a cobalt-phosphate catalyst at neutral pH.

    Science.gov (United States)

    Surendranath, Yogesh; Kanan, Matthew W; Nocera, Daniel G

    2010-11-24

    The mechanism of the oxygen evolution reaction (OER) by catalysts prepared by electrodepositions from Co(2+) solutions in phosphate electrolytes (Co-Pi) was studied at neutral pH by electrokinetic and (18)O isotope experiments. Low-potential electrodepositions enabled the controlled preparation of ultrathin Co-Pi catalyst films (oxygen from water in neutral solutions. The electrochemical rate law exhibits an inverse first order dependence on proton activity and a zeroth order dependence on phosphate for [Pi] ≥ 0.03 M. In the absence of phosphate buffer, the Tafel slope is increased ∼3-fold and the overall activity is greatly diminished. Together, these electrokinetic studies suggest a mechanism involving a rapid, one electron, one proton equilibrium between Co(III)-OH and Co(IV)-O in which a phosphate species is the proton acceptor, followed by a chemical turnover-limiting process involving oxygen-oxygen bond coupling.

  7. Oligonucleotides with 1,4-dioxane-based nucleotide monomers

    DEFF Research Database (Denmark)

    Madsen, Andreas S; Wengel, Jesper

    2012-01-01

    An epimeric mixture of H-phosphonates 5R and 5S has been synthesized in three steps from known secouridine 1. Separation of the epimers has been accomplished by RP-HPLC, allowing full characterization and incorporation of monomers X and Y into 9-mer oligonucleotides using H-phosphonates building...... blocks 5R and 5S, respectively. A single incorporation of either monomer X or monomer Y in the central position of a DNA 9-mer results in decreased thermal affinity toward both DNA and RNA complements (ΔT(m) = -3.5 °C/-3.5 °C for monomer X and ΔT(m) = -11.0 °C/-6.5 °C for monomer Y). CD measurements do...

  8. Antisense Oligonucleotide-Mediated Transcript Knockdown in Zebrafish.

    Directory of Open Access Journals (Sweden)

    Andrea Pauli

    Full Text Available Antisense oligonucleotides (ASOs are synthetic, single-strand RNA-DNA hybrids that induce catalytic degradation of complementary cellular RNAs via RNase H. ASOs are widely used as gene knockdown reagents in tissue culture and in Xenopus and mouse model systems. To test their effectiveness in zebrafish, we targeted 20 developmental genes and compared the morphological changes with mutant and morpholino (MO-induced phenotypes. ASO-mediated transcript knockdown reproduced the published loss-of-function phenotypes for oep, chordin, dnd, ctnnb2, bmp7a, alk8, smad2 and smad5 in a dosage-sensitive manner. ASOs knocked down both maternal and zygotic transcripts, as well as the long noncoding RNA (lncRNA MALAT1. ASOs were only effective within a narrow concentration range and were toxic at higher concentrations. Despite this drawback, quantitation of knockdown efficiency and the ability to degrade lncRNAs make ASOs a useful knockdown reagent in zebrafish.

  9. Antisense Oligonucleotides: Translation from Mouse Models to Human Neurodegenerative Diseases.

    Science.gov (United States)

    Schoch, Kathleen M; Miller, Timothy M

    2017-06-21

    Multiple neurodegenerative diseases are characterized by single-protein dysfunction and aggregation. Treatment strategies for these diseases have often targeted downstream pathways to ameliorate consequences of protein dysfunction; however, targeting the source of that dysfunction, the affected protein itself, seems most judicious to achieve a highly effective therapeutic outcome. Antisense oligonucleotides (ASOs) are small sequences of DNA able to target RNA transcripts, resulting in reduced or modified protein expression. ASOs are ideal candidates for the treatment of neurodegenerative diseases, given numerous advancements made to their chemical modifications and delivery methods. Successes achieved in both animal models and human clinical trials have proven ASOs both safe and effective. With proper considerations in mind regarding the human applicability of ASOs, we anticipate ongoing in vivo research and clinical trial development of ASOs for the treatment of neurodegenerative diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Antisense oligonucleotide targeting midkine suppresses in vivo angiogenesis

    Institute of Scientific and Technical Information of China (English)

    Li-Cheng Dai; Xiang Wang; Xing Yao; Yong-Liang Lu; Jin-Liang Ping; Jian-Fang He

    2007-01-01

    AIM: To evaluate the effect of antisense oligonucleotide targeting midkine (MK-AS) on angiogenesis in chick chorioallantoic membrane (CAM) andin situ human hepatocellular carcinoma (HCC).METHODS: An in situ human hepatocellular carcinoma (HCC) model and CAM assay were used in this experiment. The effect of MK-AS on angiogenesis was evaluated by cell proliferation assay and hematoxylineosin (HE) staining.RESULTS: MK-AS significantly inhibited human umbilical vein endothelial cells (HUVEC) and in situ human HCC growth. At the same time, MK-AS suppressed the angiogenesis both in human hepatocellular carcinoma cell line (HEPG2)-induced CAM and in situ human HCC tissues.CONCLUSION: MK-AS is an effective antiangiogenesis agent in vivo.

  11. A review of statistical methods for preprocessing oligonucleotide microarrays.

    Science.gov (United States)

    Wu, Zhijin

    2009-12-01

    Microarrays have become an indispensable tool in biomedical research. This powerful technology not only makes it possible to quantify a large number of nucleic acid molecules simultaneously, but also produces data with many sources of noise. A number of preprocessing steps are therefore necessary to convert the raw data, usually in the form of hybridisation images, to measures of biological meaning that can be used in further statistical analysis. Preprocessing of oligonucleotide arrays includes image processing, background adjustment, data normalisation/transformation and sometimes summarisation when multiple probes are used to target one genomic unit. In this article, we review the issues encountered in each preprocessing step and introduce the statistical models and methods in preprocessing.

  12. Empirical evaluation of oligonucleotide probe selection for DNA microarrays.

    Directory of Open Access Journals (Sweden)

    Jennifer G Mulle

    Full Text Available DNA-based microarrays are increasingly central to biomedical research. Selecting oligonucleotide sequences that will behave consistently across experiments is essential to the design, production and performance of DNA microarrays. Here our aim was to improve on probe design parameters by empirically and systematically evaluating probe performance in a multivariate context. We used experimental data from 19 array CGH hybridizations to assess the probe performance of 385,474 probes tiled in the Duchenne muscular dystrophy (DMD region of the X chromosome. Our results demonstrate that probe melting temperature, single nucleotide polymorphisms (SNPs, and homocytosine motifs all have a strong effect on probe behavior. These findings, when incorporated into future microarray probe selection algorithms, may improve microarray performance for a wide variety of applications.

  13. Empirical evaluation of oligonucleotide probe selection for DNA microarrays.

    Science.gov (United States)

    Mulle, Jennifer G; Patel, Viren C; Warren, Stephen T; Hegde, Madhuri R; Cutler, David J; Zwick, Michael E

    2010-03-29

    DNA-based microarrays are increasingly central to biomedical research. Selecting oligonucleotide sequences that will behave consistently across experiments is essential to the design, production and performance of DNA microarrays. Here our aim was to improve on probe design parameters by empirically and systematically evaluating probe performance in a multivariate context. We used experimental data from 19 array CGH hybridizations to assess the probe performance of 385,474 probes tiled in the Duchenne muscular dystrophy (DMD) region of the X chromosome. Our results demonstrate that probe melting temperature, single nucleotide polymorphisms (SNPs), and homocytosine motifs all have a strong effect on probe behavior. These findings, when incorporated into future microarray probe selection algorithms, may improve microarray performance for a wide variety of applications.

  14. Tetramerization of an RNA oligonucleotide containing a GGGG sequence.

    Science.gov (United States)

    Kim, J; Cheong, C; Moore, P B

    1991-05-23

    Poly rG can form four-stranded helices. The Hoogsteen-paired quartets of G residues on which such structures depend are so stable that they will form in 5'-GMP solutions, provided that Na+ or K+ are present (see for example, refs 2-4). Telomeric DNA sequences, which are G-rich, adopt four-stranded antiparallel G-quartet conformations in vitro, and parallel tetramerization of G-rich sequences may be involved in meiosis. Here we show that RNAs containing short runs of Gs can also tetramerize. A 19-base oligonucleotide derived from the 5S RNA of Escherichia coli (strand III), 5'GCCGAUGGUAGUGUGGGGU3', forms a K(+)-stabilized tetrameric aggregate that depends on the G residues at its 3' end. This complex is so stable that it would be surprising if similar structures do not occur in nature.

  15. Pyridoxal phosphate-dependent neonatal epileptic encephalopathy.

    Science.gov (United States)

    Bagci, S; Zschocke, J; Hoffmann, G F; Bast, T; Klepper, J; Müller, A; Heep, A; Bartmann, P; Franz, A R

    2008-03-01

    Pyridox(am)ine-5'-phosphate oxidase converts pyridoxine phosphate and pyridoxamine phosphate to pyridoxal phosphate, a cofactor in many metabolic reactions, including neurotransmitter synthesis. A family with a mutation in the pyridox(am)ine-5'-phosphate oxidase gene presenting with neonatal seizures unresponsive to pyridoxine and anticonvulsant treatment but responsive to pyridoxal phosphate is described. Pyridoxal phosphate should be considered in neonatal epileptic encephalopathy unresponsive to pyridoxine.

  16. Pyridoxal phosphate-dependent neonatal epileptic encephalopathy

    OpenAIRE

    2009-01-01

    Pyridox(am)ine-5′-phosphate oxidase converts pyridoxine phosphate and pyridoxamine phosphate to pyridoxal phosphate, a cofactor in many metabolic reactions, including neurotransmitter synthesis. A family with a mutation in the pyridox(am)ine-5′-phosphate oxidase gene presenting with neonatal seizures unresponsive to pyridoxine and anticonvulsant treatment but responsive to pyridoxal phosphate is described. Pyridoxal phosphate should be considered in neonatal epileptic encephalopathy unrespons...

  17. Life in the absence of oxygen: alterative electron acceptors for anaerobic microorganisms in a petroleum environment

    NARCIS (Netherlands)

    Balk, M.

    2007-01-01

    Anaerobic microorganisms derive energy by transferring electrons from an external source or donor to an external electron sink or terminal acceptor and often have the capacity to reduce 2 or more terminal electron acceptors. The well-known type of microbial respiration, in which oxygen serves as an

  18. Electric-field-induced ionization of acceptors in p-GaAs

    CERN Document Server

    Dargys, A; Cesna, A; Zurauskiene, N

    1999-01-01

    Hole de-trapping dynamics out of shallow acceptors subjected to high pulsed electric fields is investigated in pure p-GaAs used in radiation detectors. The characteristic de-trapping times are found from current transients due to impact and tunnel ionization of the acceptors. The de-trapping times are presented as a function of electric field strength. (author)

  19. Phthalimides as exceptionally efficient single electron transfer acceptors in reductive coupling reactions promoted by samarium diiodide.

    Science.gov (United States)

    Vacas, Tatiana; Alvarez, Eleuterio; Chiara, Jose Luis

    2007-12-20

    Experimental and theoretical evidence shows that phthalimides are highly efficient single electron transfer acceptors in reactions promoted by samarium diiodide, affording ketyl radical anion intermediates, which participate in high-yielding inter- and intramolecular reductive coupling processes with different radicophiles including imides, oxime ethers, nitrones, and Michael acceptors.

  20. A combined study of mesomorphism, optical, and electronic properties of donor-acceptor columnar liquid crystals

    NARCIS (Netherlands)

    Eichhorn, S.H.; Shuai, C.; Ahmida, M.; Demenev, A.; Kayal, H.; Raad, F.S.; Kaafarani, B.R.; Patwardhan, S.; Grozema, F.C.; Siebbeles, L.D.A.; Taerum, T.; Perepichka, D.F.; Klenkler, R.

    2011-01-01

    Donor-acceptor structures have recently gained great popularity for the design of low band gap polymeric organic semiconductors. Presented here is a first systematic study of organic semiconductors based on columnar liquid crystals that consist of discotic and board-shaped donor-acceptor structures.

  1. Dichotomous Role of Exciting the Donor or the Acceptor on Charge Generation in Organic Solar Cells.

    Science.gov (United States)

    Hendriks, Koen H; Wijpkema, Alexandra S G; van Franeker, Jacobus J; Wienk, Martijn M; Janssen, René A J

    2016-08-10

    In organic solar cells, photoexcitation of the donor or acceptor phase can result in different efficiencies for charge generation. We investigate this difference for four different 2-pyridyl diketopyrrolopyrrole (DPP) polymer-fullerene solar cells. By comparing the external quantum efficiency spectra of the polymer solar cells fabricated with either [60]PCBM or [70]PCBM fullerene derivatives as acceptor, the efficiency of charge generation via donor excitation and acceptor excitation can both be quantified. Surprisingly, we find that to make charge transfer efficient, the offset in energy between the HOMO levels of donor and acceptor that govern charge transfer after excitation of the acceptor must be larger by ∼0.3 eV than the offset between the corresponding two LUMO levels when the donor is excited. As a consequence, the driving force required for efficient charge generation is significantly higher for excitation of the acceptor than for excitation of the donor. By comparing charge generation for a total of 16 different DPP polymers, we confirm that the minimal driving force, expressed as the photon energy loss, differs by about 0.3 eV for exciting the donor and exciting the acceptor. Marcus theory may explain the dichotomous role of exciting the donor or the acceptor on charge generation in these solar cells.

  2. Multi-scale exciton and electron transfer in multi-level donor-acceptor systems

    Science.gov (United States)

    Gurvitz, Shmuel; Nesterov, Alexander I.; Berman, Gennady P.

    2017-09-01

    We study theoretically the noise-assisted quantum exciton (electron) transfer (ET) in bio-complexes consisting of a single-level electron donor and an acceptor which has a complicated internal structure, and is modeled by many electron energy levels. Interactions are included between the donor and the acceptor energy levels and with the protein-solvent noisy environment. Different regions of parameters are considered, which characterize (i) the number of the acceptor levels, (ii) the acceptor ‘band-width’, and (iii) the amplitude of noise and its correlation time. Under some conditions, we derive analytical expressions for the ET rate and efficiency. We obtain equal occupation of all levels at large times, independent of the structure of the acceptor band and the noise parameters, but under the condition of non-degeneracy of the acceptor energy levels. We discuss the multi-scale dynamics of the acceptor population, and the accompanying effect of quantum coherent oscillations. We also demonstrate that for a large number of levels in the acceptor band, the efficiency of ET can be close to 100%, for both downhill and uphill transitions and for sharp and flat redox potentials.

  3. Direct microcontact printing of oligonucleotides for biochip applications

    Directory of Open Access Journals (Sweden)

    Trévisiol E

    2005-07-01

    Full Text Available Abstract Background A critical step in the fabrication of biochips is the controlled placement of probes molecules on solid surfaces. This is currently performed by sequential deposition of probes on a target surface with split or solid pins. In this article, we present a cost-effective procedure namely microcontact printing using stamps, for a parallel deposition of probes applicable for manufacturing biochips. Results Contrary to a previous work, we showed that the stamps tailored with an elastomeric poly(dimethylsiloxane material did not require any surface modification to be able to adsorb oligonucleotides or PCR products. The adsorbed DNA molecules are subsequently printed efficiently on a target surface with high sub-micron resolution. Secondly, we showed that successive stamping is characterized by an exponential decay of the amount of transferred DNA molecules to the surface up the 4th print, then followed by a second regime of transfer that was dependent on the contact time and which resulted in reduced quality of the features. Thus, while consecutive stamping was possible, this procedure turned out to be less reproducible and more time consuming than simply re-inking the stamps between each print. Thirdly, we showed that the hybridization signals on arrays made by microcontact printing were 5 to 10-times higher than those made by conventional spotting methods. Finally, we demonstrated the validity of this microcontact printing method in manufacturing oligonucleotides arrays for mutations recognition in a yeast gene. Conclusion The microcontact printing can be considered as a new potential technology platform to pattern DNA microarrays that may have significant advantages over the conventional spotting technologies as it is easy to implement, it uses low cost material to make the stamp, and the arrays made by this technology are 10-times more sensitive in term of hybridization signals than those manufactured by conventional spotting

  4. Design and development of thermolytic DNA oligonucleotide prodrugs.

    Science.gov (United States)

    Grajkowski, Andrzej; Pedras-Vasconcelos, Joao; Ausín, Cristina; Verthelyi, Daniela; Beaucage, Serge L

    2005-11-01

    Deoxyribonucleoside phosphoramidites functionalized with the thermolytic 2-(N-formyl-N-methyl)aminoethyl group for phosphorus protection (1a-d) have been prepared and employed in the solid-phase synthesis of CpG ODN fma1555. Given that this modified oligonucleotide can be converted to the immunomodulatory CpG ODN 1555 under neutral conditions at 37 degrees C, its biologic activity was demonstrated in vivo by studies showing that intraperitoneal administration of CpG ODN fma1555 in mice resulted in the activation of cytokine-secreting splenocytes. Furthermore, administration of CpG ODN fma1555 to mice that were challenged intradermally in the ear with live L. major metacyclic promastigotes, reduced the severity of Leishmania skin lesions over time to an extent similar to that obtained with CpG ODN 1555. In another infectious model experiment, CpG ODN fma1555 protected newborn mice from death (65% survival) when administered 3 days before infection with the aggressive Tacaribe (TCRV) virus. A comparable immunoprotection was obtained by treatment of TCRV-infected mice with CpG ODN 1555 administered on the same day of infection (45% survival). However, when TCRV-infected mice were treated with CpG ODN fma1555 on the day of infection, they died as a consequence of the relatively slow conversion of the oligonucleotide prodrug to the bioactive CpG ODN 1555. Co-administration of both CpG ODN 1555 and CpG ODN fma1555 to mice 3 days prior to TCRV infection or on the day of infection provided protection from death (45-65% survival) and thus widened the immunoprotection window against TCRV-infection.

  5. Combining gene expression data from different generations of oligonucleotide arrays

    Directory of Open Access Journals (Sweden)

    Kong Sek

    2004-10-01

    Full Text Available Abstract Background One of the important challenges in microarray analysis is to take full advantage of previously accumulated data, both from one's own laboratory and from public repositories. Through a comparative analysis on a variety of datasets, a more comprehensive view of the underlying mechanism or structure can be obtained. However, as we discover in this work, continual changes in genomic sequence annotations and probe design criteria make it difficult to compare gene expression data even from different generations of the same microarray platform. Results We first describe the extent of discordance between the results derived from two generations of Affymetrix oligonucleotide arrays, as revealed in cluster analysis and in identification of differentially expressed genes. We then propose a method for increasing comparability. The dataset we use consists of a set of 14 human muscle biopsy samples from patients with inflammatory myopathies that were hybridized on both HG-U95Av2 and HG-U133A human arrays. We find that the use of the probe set matching table for comparative analysis provided by Affymetrix produces better results than matching by UniGene or LocusLink identifiers but still remains inadequate. Rescaling of expression values for each gene across samples and data filtering by expression values enhance comparability but only for few specific analyses. As a generic method for improving comparability, we select a subset of probes with overlapping sequence segments in the two array types and recalculate expression values based only on the selected probes. We show that this filtering of probes significantly improves the comparability while retaining a sufficient number of probe sets for further analysis. Conclusions Compatibility between high-density oligonucleotide arrays is significantly affected by probe-level sequence information. With a careful filtering of the probes based on their sequence overlaps, data from different

  6. Hexa-peri-hexabenzocoronene with Different Acceptor Units for Tuning Optoelectronic Properties.

    Science.gov (United States)

    Keerthi, Ashok; Hou, Ian Cheng-Yi; Marszalek, Tomasz; Pisula, Wojciech; Baumgarten, Martin; Narita, Akimitsu

    2016-10-06

    Hexa-peri-hexabenzocoronene (HBC)-based donor-acceptor dyads were synthesized with three different acceptor units, through two pathways: 1) "pre-functionalization" of monobromo-substituted hexaphenylbenzene prior to the cyclodehydrogenation; and 2) "post-functionalization" of monobromo-substituted HBC after the cyclodehydrogenation. The HBC-acceptor dyads demonstrated varying degrees of intramolecular charge-transfer interactions, depending on the attached acceptor units, which allowed tuning of their photophysical and optoelectronic properties, including the energy gaps. The two synthetic pathways described here can be complementary and potentially be applied for the synthesis of nanographene-acceptor dyads with larger aromatic cores, including one-dimensionally extended graphene nanoribbons.

  7. Excitation energy transfer in partly ordered polymer films differing in donor and acceptor transition moments orientation

    Science.gov (United States)

    Synak, A.; Bojarski, P.; Sadownik, M.; Kułak, L.; Gryczynski, I.; Grobelna, B.; Rangełowa-Jankowska, S.; Jankowski, D.; Kubicki, A.

    2016-09-01

    Based on spectroscopic measurements selected properties of nonradiative Förster energy transport are studied in uniaxially stretched polyvinyl alcohol thin films for three systems differing in donor and acceptor transition moments orientation relative to the axis of stretching. In particular, donor - acceptor emission anisotropy spectra yield completely different regularities for these systems in uniaxially stretched films, whereas they are similar in unstretched films. In particular it is shown that acceptor fluorescence can be either strongly polarized after nonradiative energy transfer in stretched films or depolarized depending on the angular distribution of acceptor transition moments in the matrix. Donor and acceptor emission anisotropy decays exhibit similar regularities to those of steady-state measurements. The obtained results are analyzed with the help of Monte Carlo simulations.

  8. The activation energy for Mg acceptor in the Ga-rich InGaN alloys

    Science.gov (United States)

    Zhao, Chuan-Zhen; Wei, Tong; Chen, Li-Ying; Wang, Sha-Sha; Wang, Jun

    2017-02-01

    The activation energy for Mg acceptor in InxGa1-xN alloys is investigated. It is found that there are three factors to influence the activation energy for Mg acceptor. One is the stronger dependence of the VBM of InxGa1-xN depending on In content than that of the Mg acceptor energy level. The other is the concentration of Mg acceptors. Another is the extending of the valence band-tail states into the band gap. In addition, a model based on modifying the effective mass model is developed. It is found that the model can describe the activation energy for Mg acceptor in the Ga-rich InxGa1-xN alloys well after considering the influence of the valence band-tail states.

  9. Rise-Time of FRET-Acceptor Fluorescence Tracks Protein Folding

    Science.gov (United States)

    Lindhoud, Simon; Westphal, Adrie H.; van Mierlo, Carlo P. M.; Visser, Antonie J. W. G.; Borst, Jan Willem

    2014-01-01

    Uniform labeling of proteins with fluorescent donor and acceptor dyes with an equimolar ratio is paramount for accurate determination of Förster resonance energy transfer (FRET) efficiencies. In practice, however, the labeled protein population contains donor-labeled molecules that have no corresponding acceptor. These FRET-inactive donors contaminate the donor fluorescence signal, which leads to underestimation of FRET efficiencies in conventional fluorescence intensity and lifetime-based FRET experiments. Such contamination is avoided if FRET efficiencies are extracted from the rise time of acceptor fluorescence upon donor excitation. The reciprocal value of the rise time of acceptor fluorescence is equal to the decay rate of the FRET-active donor fluorescence. Here, we have determined rise times of sensitized acceptor fluorescence to study the folding of double-labeled apoflavodoxin molecules and show that this approach tracks the characteristics of apoflavodoxinʼs complex folding pathway. PMID:25535076

  10. Stereospecificity of oligonucleotide interactions revisited: no evidence for heterochiral hybridization and ribozyme/DNAzyme activity.

    Directory of Open Access Journals (Sweden)

    Kai Hoehlig

    Full Text Available A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications.

  11. Polymerase-Endonuclease Amplification Reaction (PEAR) for Large-Scale Enzymatic Production of Antisense Oligonucleotides

    Science.gov (United States)

    Wang, Xiaolong; Gou, Deming; Xu, Shuang-yong

    2010-01-01

    Antisense oligonucleotides targeting microRNAs or their mRNA targets prove to be powerful tools for molecular biology research and may eventually emerge as new therapeutic agents. Synthetic oligonucleotides are often contaminated with highly homologous failure sequences. Synthesis of a certain oligonucleotide is difficult to scale up because it requires expensive equipment, hazardous chemicals and a tedious purification process. Here we report a novel thermocyclic reaction, polymerase-endonuclease amplification reaction (PEAR), for the amplification of oligonucleotides. A target oligonucleotide and a tandem repeated antisense probe are subjected to repeated cycles of denaturing, annealing, elongation and cleaving, in which thermostable DNA polymerase elongation and strand slipping generate duplex tandem repeats, and thermostable endonuclease (PspGI) cleavage releases monomeric duplex oligonucleotides. Each round of PEAR achieves over 100-fold amplification. The product can be used in one more round of PEAR directly, and the process can be further repeated. In addition to avoiding dangerous materials and improved product purity, this reaction is easy to scale up and amenable to full automation. PEAR has the potential to be a useful tool for large-scale production of antisense oligonucleotide drugs. PMID:20062528

  12. Managing the sequence-specificity of antisense oligonucleotides in drug discovery.

    Science.gov (United States)

    Hagedorn, Peter H; Hansen, Bo R; Koch, Troels; Lindow, Morten

    2017-03-17

    All drugs perturb the expression of many genes in the cells that are exposed to them. These gene expression changes can be divided into effects resulting from engaging the intended target and effects resulting from engaging unintended targets. For antisense oligonucleotides, developments in bioinformatics algorithms, and the quality of sequence databases, allow oligonucleotide sequences to be analyzed computationally, in terms of the predictability of their interactions with intended and unintended RNA targets. Applying these tools enables selection of sequence-specific oligonucleotides where no- or only few unintended RNA targets are expected. To evaluate oligonucleotide sequence-specificity experimentally, we recommend a transcriptomics protocol where two or more oligonucleotides targeting the same RNA molecule, but with entirely different sequences, are evaluated together. This helps to clarify which changes in cellular RNA levels result from downstream processes of engaging the intended target, and which are likely to be related to engaging unintended targets. As required for all classes of drugs, the toxic potential of oligonucleotides must be evaluated in cell- and animal models before clinical testing. Since potential adverse effects related to unintended targeting are sequence-dependent and therefore species-specific, in vitro toxicology assays in human cells are especially relevant in oligonucleotide drug discovery. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Stereospecificity of Oligonucleotide Interactions Revisited: No Evidence for Heterochiral Hybridization and Ribozyme/DNAzyme Activity

    Science.gov (United States)

    Hoehlig, Kai; Bethge, Lucas; Klussmann, Sven

    2015-01-01

    A major challenge for the application of RNA- or DNA-oligonucleotides in biotechnology and molecular medicine is their susceptibility to abundant nucleases. One intriguing possibility to tackle this problem is the use of mirror-image (l-)oligonucleotides. For aptamers, this concept has successfully been applied to even develop therapeutic agents, so-called Spiegelmers. However, for technologies depending on RNA/RNA or RNA/DNA hybridization, like antisense or RNA interference, it has not been possible to use mirror-image oligonucleotides because Watson-Crick base pairing of complementary strands is (thought to be) stereospecific. Many scientists consider this a general principle if not a dogma. A recent publication proposing heterochiral Watson-Crick base pairing and sequence-specific hydrolysis of natural RNA by mirror-image ribozymes or DNAzymes (and vice versa) prompted us to systematically revisit the stereospecificity of oligonucleotides hybridization and catalytic activity. Using hyperchromicity measurements we demonstrate that hybridization only occurs among homochiral anti-parallel complementary oligonucleotide strands. As expected, achiral PNA hybridizes to RNA and DNA irrespective of their chirality. In functional assays we could not confirm an alleged heterochiral hydrolytic activity of ribozymes or DNAzymes. Our results confirm a strict stereospecificity of oligonucleotide hybridization and clearly argue against the possibility to use mirror-image oligonucleotides for gene silencing or antisense applications. PMID:25679211

  14. Release of DNA oligonucleotides and their conjugates from controlled-pore glass under thermolytic conditions.

    Science.gov (United States)

    Grajkowski, Andrzej; Cieślak, Jacek; Norris, Scott; Freedberg, Darón I; Kauffman, Jon S; Duff, Robert J; Beaucage, Serge L

    2008-12-01

    The sequential functionalization of long-chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and a dinucleoside phosphorotetrazolide leads to a uniquely engineered support for solid-phase synthesis. Unlike conventional succinylated-CPG supports, this support is designed to allow oligonucleotide deprotection and elimination of deprotection side-products to proceed without release of the oligonucleotide. When needed, the DNA oligonucleotide can be thermolytically released in 2 hr under essentially neutral conditions. The modified CPG support has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. On the basis of reversed-phase HPLC and electrophoretic analyses, the purity of the released oligonucleotides is comparable to that of identical oligonucleotides synthesized from succinylated-CPG supports, in terms of both shorter-than-full-length oligonucleotide contaminants and overall yields. The detailed preparation of DNA oligonucleotides conjugated with exemplary reporter or functional groups, either at the 3'-terminus or at both 3'- and 5'-termini, is also described.

  15. Polymerase-endonuclease amplification reaction (PEAR for large-scale enzymatic production of antisense oligonucleotides.

    Directory of Open Access Journals (Sweden)

    Xiaolong Wang

    Full Text Available Antisense oligonucleotides targeting microRNAs or their mRNA targets prove to be powerful tools for molecular biology research and may eventually emerge as new therapeutic agents. Synthetic oligonucleotides are often contaminated with highly homologous failure sequences. Synthesis of a certain oligonucleotide is difficult to scale up because it requires expensive equipment, hazardous chemicals and a tedious purification process. Here we report a novel thermocyclic reaction, polymerase-endonuclease amplification reaction (PEAR, for the amplification of oligonucleotides. A target oligonucleotide and a tandem repeated antisense probe are subjected to repeated cycles of denaturing, annealing, elongation and cleaving, in which thermostable DNA polymerase elongation and strand slipping generate duplex tandem repeats, and thermostable endonuclease (PspGI cleavage releases monomeric duplex oligonucleotides. Each round of PEAR achieves over 100-fold amplification. The product can be used in one more round of PEAR directly, and the process can be further repeated. In addition to avoiding dangerous materials and improved product purity, this reaction is easy to scale up and amenable to full automation. PEAR has the potential to be a useful tool for large-scale production of antisense oligonucleotide drugs.

  16. Calcium phosphate nanoparticles as versatile carrier for small and large molecules across cell membranes

    Energy Technology Data Exchange (ETDEWEB)

    Sokolova, Viktoriya; Rotan, Olga; Klesing, Jan [University of Duisburg-Essen, Inorganic Chemistry and Center for Nanointegration Duisburg-Essen (CeNIDE) (Germany); Nalbant, Perihan [University of Duisburg-Essen, Faculty of Biology, Institute of Molecular Cell Biology (Germany); Buer, Jan; Knuschke, Torben; Westendorf, Astrid M. [University Hospital Essen, University of Duisburg-Essen, Institute of Medical Microbiology (Germany); Epple, Matthias, E-mail: matthias.epple@uni-due.de [University of Duisburg-Essen, Inorganic Chemistry and Center for Nanointegration Duisburg-Essen (CeNIDE) (Germany)

    2012-06-15

    The successful transport of molecules across the cell membrane is a key point in biology and medicine. In most cases, molecules alone cannot penetrate the cell membrane, therefore an efficient carrier is needed. Calcium phosphate nanoparticles (diameter: 100-250 nm, depending on the functionalization) were loaded with fluorescent oligonucleotides, peptide, proteins, antibodies, polymers or porphyrins and characterized by dynamic light scattering, nanoparticle tracking analysis and scanning electron microscopy. Any excess of molecules was removed by ultracentrifugation, and the dissolved molecules at the same concentration were used as control. The uptake of such fluorescence-labeled nanoparticles into HeLa cells was monitored by fluorescence microscopy and confocal laser scanning microscopy. Calcium phosphate nanoparticles were able to transport all molecules across the cell membrane, whereas the dissolved molecules alone were taken up only to a very small extent or even not at all.

  17. Triphenyl phosphate allergy from spectacle frames

    DEFF Research Database (Denmark)

    Carlsen, L; Andersen, K E; Egsgaard, Helge

    1986-01-01

    A case of triphenyl phosphate allergy from spectacle frames is reported. Patch tests with analytical grade triphenyl phosphate, tri-m-cresyl phosphate, and tri-p-cresyl phosphate in the concentrations 5%, 0.5% and 0.05% pet. showed positive reactions to 0.05% triphenyl phosphate and 0.5% tri-m-cr...

  18. Terahertz Stimulated Emission from Silicon Doped by Hydrogenlike Acceptors

    Directory of Open Access Journals (Sweden)

    S. G. Pavlov

    2014-04-01

    Full Text Available Stimulated emission in the terahertz frequency range has been realized from boron acceptor centers in silicon. Population inversion is achieved at resonant optical excitation on the 1Γ_{8}^{+} → 1Γ_{7}^{−}, 1Γ_{6}^{−}, 4Γ_{8}^{−} intracenter transitions with a midinfrared free-electron laser. Lasing occurs on two intracenter transitions around 1.75 THz. The upper laser levels are the 1Γ_{7}^{−}, 1Γ_{6}^{−}, and 4Γ_{8}^{−} states, and the lower laser level for both emission lines is the 2Γ_{8}^{+} state. In contrast to n-type intracenter silicon lasers, boron-doped silicon lasers do not involve the excited states with the longest lifetimes. Instead, the absorption cross section for the pump radiation is the dominating factor. The four-level lasing scheme implies that the deepest even-parity boron state is the 2Γ_{8}^{+} state and not the 1Γ_{7}^{+} split-off ground state, as indicated by other experiments. This is confirmed by infrared absorption spectroscopy of Si:B.

  19. DONOR-ACCEPTOR CONJUGATED COOLIGOMERS FOR SINGLE MOLECULE SOLAR CELLS

    Institute of Scientific and Technical Information of China (English)

    Jian-fei Qu; Jian Liu; Si-da Li; Zhi-yuan Xie; Yan-hou Geng

    2013-01-01

    Five novel donor-acceptor (D-A) conjugated cooligomers (F4B-hP,F5B-hP,F5B2[1,2]-hP,F5B2[1,3]-hP and F7B2[1,2]-hP) were synthesized.The absorption spectra of the cooligomers cover a wide range from 300 nm to 630 nm.The cooligomers could form films featured by alternating D-A lamellar nanostructures with the periods relative to the molecular lengths after thermal annealing or solvent vapor annealing.Single molecule solar cells were fabricated,and F5B-hP exhibited the best device performance.When the film of F5B-hP was thermally annealed,a power conversion efficiency (PCE) of 1.56% was realized.With solvent vapor annealing,the PCE could be further improved to 1.72% with a short-circuit current (Jsc) of 5.76 mA/cm2,an open-circuit voltage (VoC) of 0.87 V and a fill factor (FF) of 0.34.

  20. Serum cholesterol acceptor capacity in intrauterine growth restricted fetuses.

    Science.gov (United States)

    Pecks, Ulrich; Rath, Werner; Bauerschlag, Dirk O; Maass, Nicolai; Orlikowsky, Thorsten; Mohaupt, Markus G; Escher, Geneviève

    2017-02-14

    Intrauterine growth restriction (IUGR) is an independent risk factor for the development of cardiovascular diseases later in life. The mechanisms whereby slowed intrauterine growth confers vascular risk are not clearly established. In general, a disturbed cholesterol efflux has been linked to atherosclerosis. The capacity of serum to accept cholesterol has been repeatedly evaluated in clinical studies by the use of macrophage-based cholesterol efflux assays and, if disturbed, precedes atherosclerotic diseases years before the clinical diagnosis. We now hypothesized that circulating cholesterol acceptors in IUGR sera specifically interfere with cholesterol transport mechanisms leading to diminished cholesterol efflux. RAW264.7 cells were used to determine efflux of [3H]-cholesterol in response to [umbilical cord serum (IUGR), n=20; controls (CTRL), n=20]. Cholesterol efflux was lower in IUGR as compared to controls [controls: mean 7.7% fractional [3H]-cholesterol efflux, standard deviation (SD)=0.98; IUGR: mean 6.3%, SD=0.79; P<0.0001]. Values strongly correlated to HDL (ρ=0.655, P<0.0001) and apoE (ρ=0.510, P=0.0008), and mildly to apoA1 (ρ=0.3926, P=0.0122) concentrations. Reduced cholesterol efflux in IUGR could account for the enhanced risk of developing cardiovascular diseases later in life.

  1. Analysis of nonlinear optical properties in donor–acceptor materials

    Energy Technology Data Exchange (ETDEWEB)

    Day, Paul N. [Air Force Research Laboratory, Wright-Patterson Air Force Base, Ohio 45433 (United States); General Dynamics Information Technology, Inc., Dayton, Ohio 45431 (United States); Pachter, Ruth [Air Force Research Laboratory, Wright-Patterson Air Force Base, Ohio 45433 (United States); Nguyen, Kiet A. [Air Force Research Laboratory, Wright-Patterson Air Force Base, Ohio 45433 (United States); UES, Inc., Dayton, Ohio 45432 (United States)

    2014-05-14

    Time-dependent density functional theory has been used to calculate nonlinear optical (NLO) properties, including the first and second hyperpolarizabilities as well as the two-photon absorption cross-section, for the donor-acceptor molecules p-nitroaniline and dimethylamino nitrostilbene, and for respective materials attached to a gold dimer. The CAMB3LYP, B3LYP, PBE0, and PBE exchange-correlation functionals all had fair but variable performance when compared to higher-level theory and to experiment. The CAMB3LYP functional had the best performance on these compounds of the functionals tested. However, our comprehensive analysis has shown that quantitative prediction of hyperpolarizabilities is still a challenge, hampered by inadequate functionals, basis sets, and solvation models, requiring further experimental characterization. Attachment of the Au{sub 2}S group to molecules already known for their relatively large NLO properties was found to further enhance the response. While our calculations show a modest enhancement for the first hyperpolarizability, the enhancement of the second hyperpolarizability is predicted to be more than an order of magnitude.

  2. Effects of Hydrogen on Acceptor Activation in Ternary Nitride Semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Fioretti, Angela N. [National Renewable Energy Laboratory, Golden CO 80401 USA; Colorado School of Mines, Golden CO 80401 USA; Stokes, Adam [National Renewable Energy Laboratory, Golden CO 80401 USA; Colorado School of Mines, Golden CO 80401 USA; Young, Matthew R. [National Renewable Energy Laboratory, Golden CO 80401 USA; Gorman, Brian [Colorado School of Mines, Golden CO 80401 USA; Toberer, Eric S. [National Renewable Energy Laboratory, Golden CO 80401 USA; Colorado School of Mines, Golden CO 80401 USA; Tamboli, Adele C. [National Renewable Energy Laboratory, Golden CO 80401 USA; Colorado School of Mines, Golden CO 80401 USA; Zakutayev, Andriy [National Renewable Energy Laboratory, Golden CO 80401 USA

    2017-02-09

    Doping control is necessary to unlock the scientific and technological potential of many materials, including ternary II-IV-nitride semiconductors, which are closely related to binary GaN. In particular, ZnSnN2 has been reported to have degenerate doping density, despite bandgap energies that are well suited for solar energy conversion. Here, we show that annealing Zn-rich Zn1+xSn1-xN2 grown with added hydrogen reduces its free electron density by orders of magnitude, down to 4 x 1016 cm-3. This experimental observation can be explained by hydrogen passivation of acceptors in Zn1+xSn1-xN2 during growth, lowering the driving force for unintentional donor formation. These results indicate that the doping control principles used in GaN can be translated to ZnSnN2, suggesting that other strategies used in binary III-Vs can be applied to accelerate the technological development of ternary II-IV-N2 materials.

  3. Solid-phase synthesis of 2{sup '}-O-methoxyethyl oligonucleotides using dimeric phosphoramidate blocks

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Gi Weon; Kang, Yong Han [Dept. of Applied Chemistry, Hanyang University, Ansan (Korea, Republic of)

    2016-11-15

    This research focused on the method of using dimeric phosphoramidite blocks to synthesize oligonucleotides for development as oligonucleotide drugs. A 16-mer oligonucleotide with the randomly selected sequence of C*C*T*C*G*C *T*C*T*C*G*C*C* C*G*C was synthesized using CC, GC, and TC dimers, a combination of monomers and dimers, or only monomers as building blocks. Using dimer blocks in this synthetic method provided a significant decrease in critical impurities that had similar properties to the main product, which was confirmed by LC-MS and HPLC analysis.

  4. Recombination of synthetic oligonucleotides with prokaryotic chromosomes: substrate requirements of the Escherichia coli/lambdaRed and Sulfolobus acidocaldarius recombination systems.

    Science.gov (United States)

    Grogan, Dennis W; Stengel, Kristy R

    2008-09-01

    In order to reveal functional properties of recombination involving short ssDNAs in hyperthermophilic archaea, we evaluated oligonucleotide-mediated transformation (OMT) in Sulfolobus acidocaldarius and Escherichia coli as a function of the molecular properties of the ssDNA substrates. Unmodified ssDNAs as short as 20-22 nt yielded recombinants in both organisms, as did longer DNAs forming as few as 2-5 base pairs on one side of the genomic mutation. The two OMT systems showed similar responses to certain end modifications of the oligonucleotides, but E. coli was found to require a 5' phosphate on 5'-limited ssDNA whereas this requirement was not evident in S. acidocaldarius. The ability of both E. coli and S. acidocaldarius to incorporate short, mismatched ssDNAs into their genomes raises questions about the biological significance of this capability, including its phylogenetic distribution among microorganisms and its impact on genome stability. These questions seem particularly relevant for S. acidocaldarius, as this archaeon has natural competence for OMT, encodes no MutSL homologues and thrives under environmental conditions that accelerate DNA decomposition.

  5. Antisense Oligonucleotide-based Splice Correction for USH2A-associated Retinal Degeneration Caused by a Frequent Deep-intronic Mutation

    Directory of Open Access Journals (Sweden)

    Radulfus WN Slijkerman

    2016-01-01

    Full Text Available Usher syndrome (USH is the most common cause of combined deaf-blindness in man. The hearing loss can be partly compensated by providing patients with hearing aids or cochlear implants, but the loss of vision is currently untreatable. In general, mutations in the USH2A gene are the most frequent cause of USH explaining up to 50% of all patients worldwide. The first deep-intronic mutation in the USH2A gene (c.7595-2144A>G was reported in 2012, leading to the insertion of a pseudoexon (PE40 into the mature USH2A transcript. When translated, this PE40-containing transcript is predicted to result in a truncated non-functional USH2A protein. In this study, we explored the potential of antisense oligonucleotides (AONs to prevent aberrant splicing of USH2A pre-mRNA as a consequence of the c.7595-2144A>G mutation. Engineered 2'-O-methylphosphorothioate AONs targeting the PE40 splice acceptor site and/or exonic splice enhancer regions displayed significant splice correction potential in both patient derived fibroblasts and a minigene splice assay for USH2A c.7595-2144A>G, whereas a non-binding sense oligonucleotide had no effect on splicing. Altogether, AON-based splice correction could be a promising approach for the development of a future treatment for USH2A-associated retinitis pigmentosa caused by the deep-intronic c.7595-2144A>G mutation.

  6. Analysis of Shewanella oneidensis Membrane Protein Expression in Response to Electron Acceptor Availability

    Energy Technology Data Exchange (ETDEWEB)

    Giometti, Carol S.; Khare, Tripti; Verberkmoes, Nathan; O' Loughlin, Ed; Lindberg, Carl; Thompson, Melissa; Hettich, Robert

    2006-04-05

    Shewanella oneidensis MR-1, a gram negative metal-reducing bacterium, can utilize a large number of electron acceptors. In the natural environment, S. oneidensis utilizes insoluble metal oxides as well as soluble terminal electron acceptors. The purpose of this ERSP project is to identify differentially expressed proteins associated with the membranes of S. oneidensis MR-1 cells grown with different electron acceptors, including insoluble metal oxides. We hypothesize that through the use of surface labeling, subcellular fractionation, and a combination of proteome analysis tools, proteins involved in the reduction of different terminal electron acceptors will be elucidated. We are comparing the protein profiles from cells grown with the soluble electron acceptors oxygen and fumarate and with those from cells grown with the insoluble iron oxides goethite, ferrihydrite and lepidocrocite. Comparison of the cell surface proteins isolated from cells grown with oxygen or anaerobically with fumarate revealed an increase in the abundance of over 25 proteins in anaerobic cells, including agglutination protein and flagellin proteins along with the several hypothetical proteins. In addition, the surface protein composition of cells grown with the insoluble iron oxides varies considerably from the protein composition observed with either soluble electron acceptor as well as between the different insoluble acceptors.

  7. Carboranyl Nucleosides & Oligonucleotides for Neutron Capture Therapy Final Report

    Energy Technology Data Exchange (ETDEWEB)

    Schinazi, Raymond F.

    2004-12-01

    This proposal enabled us to synthesize and develop boron-rich nucleosides and oligonucleotide analogues for boron neutron capture therapy (BNCT) and the treatment of various malignancies. First, we determined the relationship between structure, cellular accumulation and tissue distribution of 5-o-carboranyl-2'-deoxyuridine (D-CDU) and its derivatives D-ribo-CU and 5-o-carboranyluracil (CU), to potentially target brain and other solid tumors for neutron capture therapy. Synthesized carborane containing nucleoside derivatives of CDU, D- and L-enantiomers of CDU, D-ribo-CU and CU were used. We measured tissue disposition in xenografted mice bearing 9479 human prostate tumors xenografts and in rats bearing 9L gliosarcoma isografts in their flanks and intracranially. The accumulation of D-CDU, 1-({beta}-L-arabinosyl)-5-o-carboranyluracil, D-ribo-CU, and CU were also studied in LnCap human prostate tumor cells and their retention was measured in male nude mice bearing LnCap and 9479 human prostate tumor xenografts. D-CDU, D-ribo-CU and CU levels were measured after administration in mice bearing 9479 human prostate tumors in their flanks. D-CDU achieved high cellular concentrations in LnCap cells and up to 2.5% of the total cellular compound was recovered in the 5'-monophosphorylated form. D-CDU cellular concentrations were similar in LnCap and 9479 tumor xenografts. Studies in tumor bearing animals indicated that increasing the number of hydroxyl moieties in the sugar constituent of the carboranyl nucleosides lead to increased rate and extent of renal elimination, a decrease in serum half-lives and an increased tissue specificity. Tumor/brain ratios were greatest for CDU and D-ribo-CU, while tumor/prostate ratios were greatest with CU. CDU and D-ribo-CU have potential for BNCT of brain malignancies, while CU may be further developed for prostate cancer. A method was developed for the solid phase synthesis of oligonucleotides containing (ocarboran-1-yl

  8. Synthesis and electrochemical studies of charge-transfer complexes of thiazolidine-2,4-dione with σ and π acceptors

    Science.gov (United States)

    Singh, Prashant; Kumar, Pradeep; Katyal, Anju; Kalra, Rashmi; Dass, Sujata K.; Prakash, Satya; Chandra, Ramesh

    2010-03-01

    In the present work, we report the synthesis and characterization of novel charge-transfer complexes of thiazolidine-2,4-dione (TZD) with sigma acceptor (iodine) and pi acceptors (chloranil, dichlorodicyanoquinone, picric acid and duraquinone). We also evaluated their thermal and electrochemical properties and we conclude that these complexes are frequency dependent. Charge-transfer complex between thiazolidine-2,4-dione and iodine give best conductivity. In conclusion, complex with sigma acceptors are more conducting than with pi acceptors.

  9. Light weight phosphate cements

    Science.gov (United States)

    Wagh, Arun S.; Natarajan, Ramkumar,; Kahn, David

    2010-03-09

    A sealant having a specific gravity in the range of from about 0.7 to about 1.6 for heavy oil and/or coal bed methane fields is disclosed. The sealant has a binder including an oxide or hydroxide of Al or of Fe and a phosphoric acid solution. The binder may have MgO or an oxide of Fe and/or an acid phosphate. The binder is present from about 20 to about 50% by weight of the sealant with a lightweight additive present in the range of from about 1 to about 10% by weight of said sealant, a filler, and water sufficient to provide chemically bound water present in the range of from about 9 to about 36% by weight of the sealant when set. A porous ceramic is also disclosed.

  10. Conjugation with receptor-targeted histidine-rich peptides enhances the pharmacological effectiveness of antisense oligonucleotides.

    Science.gov (United States)

    Nakagawa, Osamu; Ming, Xin; Carver, Kyle; Juliano, Rudy

    2014-01-15

    Ineffective delivery to intracellular sites of action is one of the key limitations to the use of antisense and siRNA oligonucleotides as therapeutic agents. Here, we describe molecular scale antisense oligonucleotide conjugates that bind selectively to a cell surface receptor, are internalized, and then partially escape from nonproductive endosomal locations to reach their sites of action in the nucleus. Peptides that include bombesin sequences for receptor targeting and a run of histidine residues for endosomal disruption were covalently linked to a splice switching antisense oligonucleotide. The conjugates were tested for their ability to correct splicing and up-regulate expression of a luciferase reporter in prostate cancer cells that express the bombesin receptor. We found that trivalent conjugates that included both the targeting sequence and several histidine residues were substantially more effective than conjugates containing only the bombesin or histidine moieties. This demonstrates the potential of creating molecular scale oligonucleotide conjugates with both targeting and endosome escape capabilities.

  11. Chemically robust fluoroalkyl phthalocyanine-oligonucleotide bioconjugates and their GRP78 oncogene photocleavage activity.

    Science.gov (United States)

    Patel, Pradeepkumar; Patel, Hemantbhai H; Borland, Emily; Gorun, Sergiu M; Sabatino, David

    2014-06-18

    The first representative of functionalized fluoroalkyl phthalocyanines, F48H7(COOH)PcZn, is reported. The complex generates (1)O2 affording long-lasting photooxidation of an external substrate without self-decomposition. The carboxylic group couples with an antisense oligonucleotide targeting GRP78 oncogenes, resulting in the F48H7PcZn-cancer targeting oligonucleotide (CTO). The bioconjugated fluorophthalocyanine effectively hybridizes complementary GRP78 DNA and mRNA sequences. Piperidine cleavage assays reveal desired photochemical oligonucleotide oxidative degradation for both F48H7PcZn-CTO:DNA and F48H7PcZn-CTO:mRNA hybrids. This new materials strategy could be extended to other functional fluorinated phthalocyanines-antisense oligonucleotide combinations for long-lasting oncogene-targeting photodynamic therapy.

  12. Oligonucleotide-based biosensors for in vitro diagnostics and environmental hazard detection.

    Science.gov (United States)

    Jung, Il Young; Lee, Eun Hee; Suh, Ah Young; Lee, Seung Jin; Lee, Hyukjin

    2016-04-01

    Oligonucleotide-based biosensors have drawn much attention because of their broad applications in in vitro diagnostics and environmental hazard detection. They are particularly of interest to many researchers because of their high specificity as well as excellent sensitivity. Recently, oligonucleotide-based biosensors have been used to achieve not only genetic detection of targets but also the detection of small molecules, peptides, and proteins. This has further broadened the applications of these sensors in the medical and health care industry. In this review, we highlight various examples of oligonucleotide-based biosensors for the detection of diseases, drugs, and environmentally hazardous chemicals. Each example is provided with detailed schematics of the detection mechanism in addition to the supporting experimental results. Furthermore, future perspectives and new challenges in oligonucleotide-based biosensors are discussed.

  13. Exploiting Protected Maleimides to Modify Oligonucleotides, Peptides and Peptide Nucleic Acids

    Directory of Open Access Journals (Sweden)

    Clément Paris

    2015-04-01

    Full Text Available This manuscript reviews the possibilities offered by 2,5-dimethylfuran-protected maleimides. Suitably derivatized building blocks incorporating the exo Diels-Alder cycloadduct can be introduced at any position of oligonucleotides, peptide nucleic acids, peptides and peptoids, making use of standard solid-phase procedures. Maleimide deprotection takes place upon heating, which can be followed by either Michael-type or Diels-Alder click conjugation reactions. However, the one-pot procedure in which maleimide deprotection and conjugation are simultaneously carried out provides the target conjugate more quickly and, more importantly, in better yield. This procedure is compatible with conjugates involving oligonucleotides, peptides and peptide nucleic acids. A variety of cyclic peptides and oligonucleotides can be obtained from peptide and oligonucleotide precursors incorporating protected maleimides and thiols.

  14. Nucleoside, nucleotide and oligonucleotide based amphiphiles: a successful marriage of nucleic acids with lipids.

    Science.gov (United States)

    Gissot, Arnaud; Camplo, Michel; Grinstaff, Mark W; Barthélémy, Philippe

    2008-04-21

    Amphiphilic molecules based on nucleosides, nucleotides and oligonucleotides are finding more and more biotechnological applications. This Perspective highlights their synthesis, supramolecular organization as well as their applications in the field of biotechnology.

  15. New Type of Donor-Acceptor Through-Space Conjugated Polymer

    Directory of Open Access Journals (Sweden)

    Lin Lin

    2010-01-01

    Full Text Available We report the synthesis and properties of a novel through-space conjugated polymer with a [2.2]paracyclophane skeleton. The obtained polymer possessed donor (fluorene and acceptor (2,1,3-benzothiadiazole segments that were alternately π-stacked in proximity via the [2.2]paracyclophane moieties. The good overlap between the emission peak of the donor unit (fluorene and the CT band of the acceptor unit (2,1,3-benzothiadiazole caused fluorescence resonance energy transfer, and the visible green light emission from the acceptor unit was observed.

  16. Pyrimidone-based series of glucokinase activators with alternative donor-acceptor motif.

    Science.gov (United States)

    Filipski, Kevin J; Guzman-Perez, Angel; Bian, Jianwei; Perreault, Christian; Aspnes, Gary E; Didiuk, Mary T; Dow, Robert L; Hank, Richard F; Jones, Christopher S; Maguire, Robert J; Tu, Meihua; Zeng, Dongxiang; Liu, Shenping; Knafels, John D; Litchfield, John; Atkinson, Karen; Derksen, David R; Bourbonais, Francis; Gajiwala, Ketan S; Hickey, Michael; Johnson, Theodore O; Humphries, Paul S; Pfefferkorn, Jeffrey A

    2013-08-15

    Glucokinase activators are a class of experimental agents under investigation as a therapy for Type 2 diabetes mellitus. An X-ray crystal structure of a modestly potent agent revealed the potential to substitute the common heterocyclic amide donor-acceptor motif for a pyridone moiety. We have successfully demonstrated that both pyridone and pyrimidone heterocycles can be used as a potent donor-acceptor substituent. Several sub-micromolar analogs that possess the desired partial activator profile were synthesized and characterized. Unfortunately, the most potent activators suffered from sub-optimal pharmacokinetic properties. Nonetheless, these donor-acceptor motifs may find utility in other glucokinase activator series or beyond.

  17. Optical spectroscopy of single beryllium acceptors in GaAs/AlGaAs quantum well

    Science.gov (United States)

    Petrov, P. V.; Kokurin, I. A.; Klimko, G. V.; Ivanov, S. V.; Ivánov, Yu. L.; Koenraad, P. M.; Silov, A. Yu.; Averkiev, N. S.

    2016-09-01

    We carry out microphotoluminescence measurements of an acceptor-bound exciton (A0X ) recombination in the applied magnetic field with a single impurity resolution. In order to describe the obtained spectra we develop a theoretical model taking into account a quantum well (QW) confinement, an electron-hole and hole-hole exchange interaction. By means of fitting the measured data with the model we are able to study the fine structure of individual acceptors inside the QW. The good agreement between our experiments and the model indicates that we observe single acceptors in a pure two-dimensional environment whose states are unstrained in the QW plain.

  18. A Polyethylenimine-Containing and Transferrin-Conjugated Lipid Nanoparticle System for Antisense Oligonucleotide Delivery to AML

    Directory of Open Access Journals (Sweden)

    Yiming Yuan

    2016-01-01

    Full Text Available Limited success of antisense oligonucleotides (ASO in clinical anticancer therapy calls for more effective delivery carriers. The goal of this study was to develop a nanoparticle system for delivery of ASO G3139, which targets mRNA of antiapoptotic protein Bcl-2, to acute myeloid leukemia (AML cells. The synthesized nanoparticle Tf-LPN-G3139 contained a small molecular weight polyethylenimine and two cationic lipids as condensing agents, with transferrin on its surface for selective binding and enhanced cellular uptake. The optimized nitrogen to phosphate (N/P ratio was 4 to achieve small particle size and high G3139 entrapment efficiency. The Tf-LPN-G3139 exhibited excellent colloidal stability during storage for at least 12 weeks and remained intact for 4 hours in nuclease-containing serum. The cellular uptake results showed extensive internalization of fluorescence-labelled G3139 in MV4-11 cells through Tf-LPN. Following transfection, Tf-LPN-G3139 at 1 µM ASO level induced 54% Bcl-2 downregulation and >20-fold apoptosis compared to no treatment. When evaluated in mice bearing human xenograft AML tumors, Tf-LPN-G3139 suppressed tumor growth by ~60% at the end of treatment period, accompanied by remarkable pharmacological effect of Bcl-2 inhibition in tumor. In conclusion, Tf-LPN-G3139 is a promising nanoparticle system for ASO G3139 delivery to AML and warrants further investigations.

  19. Crystallo-chemical analyses of calcium phosphates

    Energy Technology Data Exchange (ETDEWEB)

    Sakae, Toshiro; Hayakawa, Tohru; Maruyama, Fumiaki; Nemoto, Kimiya; Kozawa, Yukishige [Nihon Univ., Matsudo, Chiba (Japan). School of Dentistry

    1997-12-01

    Several analytical techniques, methodology and their practical data processing were briefly described to investigate the crystallographic properties of calcium phosphates which are encountered in the field of dental sciences. The applied analytical techniques were X-ray fluorescence spectrometry (XFS), energy dispersive spectrometry (EDS), Fourier transform infrared spectrometry (FT-IR) and X-ray diffraction (XRD). The used materials were tetracalcium phosphate, hydroxyapatite, fluorapatite, {alpha}-tricalcium phosphate, {beta}-tricalcium phosphate, octacalcium phosphate, monetite, brushite and monocalcium phosphate monohydrate. (author)

  20. Sheath liquid effects in capillary high-performance liquid chromatography-electrospray mass spectrometry of oligonucleotides.

    Science.gov (United States)

    Huber, C G; Krajete, A

    2000-02-18

    Fused-silica capillary columns of 200 microm inner diameter were packed with micropellicular, octadecylated, 2.3 microm poly(styrene-divinylbenzene) particles and applied to the separation of oligonucleotides by ion-pair reversed-phase high-performance liquid chromatography. Oligonucleotides were eluted at 50 degrees C with gradients of 3-13% acetonitrile in 50 mM triethylammonium bicarbonate. Addition of sheath liquid to the column effluent allowed the detection of oligonucleotides by electrospray ionization mass spectrometry using full-scan data acquisition with a detectability comparable to that obtained with UV detection. The signal-to-noise ratios with different sheath liquids increased in the order isopropanololigonucleotides longer than 20 nucleotide units whereas no significant effect was observed with shorter oligonucleotides. Organic acids and bases in the sheath liquid generally deteriorated the signal-to-noise ratios in the chromatograms and mass spectra mainly because of increased background noise. Only a few charge states were observed in the mass spectra of oligonucleotides because of charge state reduction due to the presence of carbonic acid in the eluent. With triethylammonium hydrogencarbonate as chromatographic eluent and acetonitrile as sheath liquid, very few cation adducts of oligonucleotides were observed in the mass spectra. However, the presence of small amounts of monopotassium adducts enabled the calculation of the charge state of multiply charged ions. With acetonitrile as sheath liquid, 710 amol of a 16-mer oligonucleotide were detected using selected ion monitoring data acquisition with a signal-to-noise ratio of 3:1. Finally, capillary ion-pair reversed-phase high-performance liquid chromatography-electrospray ionization mass spectrometry was

  1. Complexes of carbon nanotubes with oligonucleotides in thin Langmuir-Blodgett films to detect electrochemically hybridization

    Science.gov (United States)

    Egorov, A. S.; Egorova, V. P.; Krylova, H. V.; Lipnevich, I. V.; Orekhovskaya, T. I.; Veligura, A. A.; Govorov, M. I.; Shulitsky, B. G.

    2014-10-01

    Self-assembled complexes consisting of thin multi-walled carbon nanotubes (MWCNTs) and DNA-oligonucleotides which are able to a cooperative binding to complementary oligonucleotides have been investigated. It was establised a high-performance charge transport in nanostructured Langmuir-Blodgett complexes thin MWCNTs/DNA. A method to electrochemically detect DNA hybridization on the self-organized structures has been proposed.

  2. Respirable antisense oligonucleotides: a new drug class for respiratory disease

    Directory of Open Access Journals (Sweden)

    Tanaka Makoto

    2000-12-01

    Full Text Available Abstract Respirable antisense oligonucleotides (RASONs, which attenuate specific disease-associated mRNAs, represent a new class of respiratory therapeutics with considerable potential. RASONs overcome previous obstacles that have impeded the development of antisense therapeutics targeting diseases in other organ systems. RASONs are delivered directly to the target tissue via inhalation; their uptake seems to be enhanced by cationic properties inherent in pulmonary surfactant, and, because of the markedly different target properties of mRNA and proteins, they can have very long durations of effect compared with traditional drugs targeting the protein of the same gene. RASONs contain chemical modifications that decrease their degradation by cellular nucleases. However, total insensitivity to nucleases is probably not an optimal design criterion for RASONs, because moderate nuclease sensitivity can prevent their systemic delivery, decreasing the potential for systemic toxicity. EPI-2010 is a 21-mer phosphorothioate RASON that attenuates bronchoconstriction, inflammation and surfactant depletion in preclinical models of human asthma, has a duration of effect of seven days, and seems to undergo minimal systemic delivery.

  3. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    Science.gov (United States)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-05-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  4. Enzymic synthesis of oligonucleotides containing methylphosphonate internucleotide linkages.

    Science.gov (United States)

    Higuchi, H; Endo, T; Kaji, A

    1990-09-18

    Thymidine 5'-O-(pyrophosphoryl methylphosphonate) (dTTP alpha CH3) has been chemically synthesized by condensation of thymidine 5'-O-(methylphosphonate) with pyrophosphate. This novel nucleotide, which contained an alpha-phosphorus atom as methylphosphonate, was used as a substrate of terminal deoxynucleotidyltransferase (TDTase) in the presence of oligonucleotide (5'-GCTGTATCGTCAAGGCACTC-3') as an initiator. The reaction products were separated into two components by reverse-phase high-performance liquid chromatography (RP-HPLC). These products were, after purification, digested with nuclease P1 and alkaline phosphatase followed by separation of digested products by RP-HPLC. The result showed the presence of one of the isomers of 2'-deoxycytidyl-3'-methylphosphonyl-5'-thymidine (dCpCH3T) and 2'-deoxycytidyl-3'-methylphosphonyl-5'-thymidyl-3'-methyl phosphonyl-5'-thymidin e (dCpCH3TpCH3T), respectively. Fast atom bombardment mass spectrometry of these products further supported identification of the dinucleotide and the trinucleotide. These results indicated that dTTP alpha CH3 was used as a substrate of TDTase, resulting in methylphosphonate linkages. Produced oligomers were resistant to hydrolysis by snake venom phosphodiesterase I.

  5. Advancements of antisense oligonucleotides in treatment of breast cancer

    Institute of Scientific and Technical Information of China (English)

    YANGShuan-Ping; SONGSan-Tai; 等

    2003-01-01

    Breast cancer is one kind of multi-gene related malignancy.Overexpression of some oncogenes such as HER-2(c-erbB-2,Neu),bcl-2/bcl-xL,protein kinase A(PKA),and transferrin receptor gene(TfR gene),etc significantly affect the prognosis of breast cancer.It was shown that specific suppression of the overexpressed genes above resulted in the improvement of the therapy of breast cancer.Antisense interference.one of useful tools for inhibiting the overexpression of specific oncogenes,was involved in the therapy of breast cancer in recent years. Data indicated that antisense oligonucleotides(ON)could inhibit specially the expression of the target genes on mRNA or protein levels in most of cases;some ON candidates showed encouraging therapeutic effects in vitro and in vivo on breast cancer cell lines or xenografts.Furthermore,the combination use of the antisense ON and normal chemotherapeutic agents indicated synergistic antitumor effects,which was probably the best utilization of antisense ON in the treatment of breast cancer.

  6. Antineoplastic effect of decoy oligonucleotide derived from MGMT enhancer.

    Directory of Open Access Journals (Sweden)

    Tamar Canello

    Full Text Available Silencing of O(6-methylguanine-DNA-methyltransferase (MGMT in tumors, mainly through promoter methylation, correlates with a better therapeutic response and with increased survival. Therefore, it is conceivable to consider MGMT as a potential therapeutic target for the treatment of cancers. Our previous results demonstrated the pivotal role of NF-kappaB in MGMT expression, mediated mainly through p65/NF-kappaB homodimers. Here we show that the non-canonical NF-KappaB motif (MGMT-kappaB1 within MGMT enhancer is probably the major inducer of MGMT expression following NF-kappaB activation. Thus, in an attempt to attenuate the transcription activity of MGMT in tumors we designed locked nucleic acids (LNA modified decoy oligonucleotides corresponding to the specific sequence of MGMT-kappaB1 (MGMT-kB1-LODN. Following confirmation of the ability of MGMT-kB1-LODN to interfere with the binding of p65/NF-kappaB to the NF-KappaB motif within MGMT enhancer, the efficacy of the decoy was studied in-vitro and in-vivo. The results of these experiments show that the decoy MGMT-kB1-LODN have a substantial antineoplastic effect when used either in combination with temozolomide or as monotherapy. Our results suggest that MGMT-kB1-LODN may provide a novel strategy for cancer therapy.

  7. Nanoexplosive gene therapy using triplex-forming oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Oh, Eun Jung; Min, Hye Jung; Choe, Jae Gol; Park, Gil Hong; Kim, Meyoung Kon [College of Medicine, Korea Univ., Seoul (Korea, Republic of)

    2001-07-01

    Triplex forming oligonucleotides (TFO) labeled with Auger emitter could be ideal vehicles for delivering radiation energy to specific DNA sequences, and followed by double-stranded DNA breaks and subsequent inactivation of targeted genes. We designed TFOs targeting the selected DNA fragments (i.e., estrogen receptors and N-myc promoter) and labeled with {sup 125}I and {sup 111}In. Various Cancer cells, e.g., MCF-7 (breast adenocarcinoma), MCF-10A (immortalized breast cells), Jurkat (T-cell leukemia), ARO (thyroid cancer), SNU-449 (Colon Caner), and HL-60 (polymyelocytic leukemia), were prepared and treated with radiolabeled TFO for 24 h. After the incubation, subcellular fractions (i.e., cell nucleus, cytoplasm and cultured medium) were collected and measured radioactivity by a gamma scintillation counter, respectively. The mean value of % injected dose for each fraction was ranged as follows: nucleus, 4.4-20%; cytoplasm, 8.2-29%; and medium, 64-87%. Therefore, we speculated that TFO labeled with Auger emitter could be a next-generation therapeutic tool in nanoexplosive gene therapy.

  8. Efficient in vivo delivery of antisense oligonucleotide to choroid plexus.

    Science.gov (United States)

    Piao, Wenying; Nishina, Kazutaka; Yoshida-Tanaka, Kie; Kuwahara, Hiroya; Nishina, Tomoko; Sakata, Mina; Mizusawa, Hidehiro; Yokota, Takanori

    2013-03-01

    The choroid plexus (CP) is present on the ventricular walls of the brain, produces cerebrospinal fluid (CSF), contains many blood vessels, and is a major functional component of the blood-CSF barrier. The CP is an important site in the pathophysiology of various neurological diseases, including Alzheimer's disease and meningeal amyloidosis. We performed gene silencing in the CP in vivo by using an antisense oligonucleotide (ASO). A short ASO of length 12 nucleotides was intravenously injected into rats. The ASO was not delivered to neurons or glia in the central nervous system, but was successfully delivered into the CP, and resulted in a significant reduction of endogenous target gene expression in epithelial cells within the CP. Although the mechanism of uptake of the ASO by the CP was not elucidated, the ASO bound to albumin in vivo, and the distribution of ASO delivery was similar to that of albumin delivery. These findings suggest that we inhibited target gene expression in the epithelial cells of the CP via albumin-ASO conjugates. This strategy should be useful for investigations of the function of CP, and for the development of new gene-silencing therapies for diseases with pathophysiology related to the CP.

  9. Antineoplastic effect of decoy oligonucleotide derived from MGMT enhancer.

    Science.gov (United States)

    Canello, Tamar; Ovadia, Haim; Refael, Miri; Zrihan, Daniel; Siegal, Tali; Lavon, Iris

    2014-01-01

    Silencing of O(6)-methylguanine-DNA-methyltransferase (MGMT) in tumors, mainly through promoter methylation, correlates with a better therapeutic response and with increased survival. Therefore, it is conceivable to consider MGMT as a potential therapeutic target for the treatment of cancers. Our previous results demonstrated the pivotal role of NF-kappaB in MGMT expression, mediated mainly through p65/NF-kappaB homodimers. Here we show that the non-canonical NF-KappaB motif (MGMT-kappaB1) within MGMT enhancer is probably the major inducer of MGMT expression following NF-kappaB activation. Thus, in an attempt to attenuate the transcription activity of MGMT in tumors we designed locked nucleic acids (LNA) modified decoy oligonucleotides corresponding to the specific sequence of MGMT-kappaB1 (MGMT-kB1-LODN). Following confirmation of the ability of MGMT-kB1-LODN to interfere with the binding of p65/NF-kappaB to the NF-KappaB motif within MGMT enhancer, the efficacy of the decoy was studied in-vitro and in-vivo. The results of these experiments show that the decoy MGMT-kB1-LODN have a substantial antineoplastic effect when used either in combination with temozolomide or as monotherapy. Our results suggest that MGMT-kB1-LODN may provide a novel strategy for cancer therapy.

  10. Chimeric Antisense Oligonucleotide Conjugated to α-Tocopherol

    Directory of Open Access Journals (Sweden)

    Tomoko Nishina

    2015-01-01

    Full Text Available We developed an efficient system for delivering short interfering RNA (siRNA to the liver by using α-tocopherol conjugation. The α-tocopherol–conjugated siRNA was effective and safe for RNA interference–mediated gene silencing in vivo. In contrast, when the 13-mer LNA (locked nucleic acid-DNA gapmer antisense oligonucleotide (ASO was directly conjugated with α-tocopherol it showed markedly reduced silencing activity in mouse liver. Here, therefore, we tried to extend the 5′-end of the ASO sequence by using 5′-α-tocopherol–conjugated 4- to 7-mers of unlocked nucleic acid (UNA as a “second wing.” Intravenous injection of mice with this α-tocopherol–conjugated chimeric ASO achieved more potent silencing than ASO alone in the liver, suggesting increased delivery of the ASO to the liver. Within the cells, the UNA wing was cleaved or degraded and α-tocopherol was released from the 13-mer gapmer ASO, resulting in activation of the gapmer. The α-tocopherol–conjugated chimeric ASO showed high efficacy, with hepatic tropism, and was effective and safe for gene silencing in vivo. We have thus identified a new, effective LNA-DNA gapmer structure in which drug delivery system (DDS molecules are bound to ASO with UNA sequences.

  11. Kinetic Hairpin Oligonucleotide Blockers for Selective Amplification of Rare Mutations

    Science.gov (United States)

    Jia, Yanwei; Sanchez, J. Aquiles; Wangh, Lawrence J.

    2014-01-01

    Detection of rare mutant alleles in an excess of wild type alleles is increasingly important in cancer diagnosis. Several methods for selective amplification of a mutant allele via the polymerase chain reaction (PCR) have been reported, but each of these methods has its own limitations. A common problem is that Taq DNA polymerase errors early during amplification generate false positive mutations which also accumulate exponentially. In this paper, we described a novel method using hairpin oligonucleotide blockers that can selectively inhibit the amplification of wild type DNA during LATE-PCR amplification. LATE-PCR generates double-stranded DNA exponentially followed by linear amplification of single-stranded DNA. The efficiency of the blocker is optimized by adjusting the LATE-PCR temperature cycling profile. We also demonstrate that it is possible to minimize false positive signals caused by Taq DNA polymerase errors by using a mismatched excess primer plus a modified PCR profile to preferentially enrich for mutant target sequences prior to the start of the exponential phase of LATE-PCR amplification. In combination these procedures permit amplification of specific KRAS mutations in the presence of more than 10,000 fold excess of wild type DNA without false positive signals. PMID:25082368

  12. The development of bioactive triple helix-forming oligonucleotides.

    Science.gov (United States)

    Seidman, Michael M; Puri, Nitin; Majumdar, Alokes; Cuenoud, Bernard; Miller, Paul S; Alam, Rowshon

    2005-11-01

    We are developing triple helix-forming oligonucleotides (TFOs) as gene targeting reagents in mammalian cells. We have described psoralen-conjugated TFOs containing 2'-O-methyl (2'OMe) and 2'-O-aminoethoxy (AE) ribose substitutions. TFOs with a cluster of 3-4 AE residues, with all other sugars as 2'OMe, were bioactive in a gene knockout assay in mammalian cells. In contrast, TFOs with one or two clustered, or three dispersed, AE residues were inactive. Thermal stability analysis of the triplexes indicated that there were only incremental differences between the active and inactive TFOs. However the active and inactive TFOs could be distinguished by their association kinetics. The bioactive TFOs showed markedly greater on-rates than the inactive TFOs. It appears that the on-rate is a better predictor of TFO bioactivity than thermal stability. Our data are consistent with a model in which a cluster of 3-4 AE residues stabilizes the nucleation event that precedes formation of a complete triplex. It is likely that triplexes in cells are much less stable than triplexes in vitro probably as a result of elution by chromatin-associated translocases and helicases. Consequently the biologic assay will favor TFOs that can bind and rebind genomic targets quickly.

  13. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  14. Advantages of ion-exchange chromatography for oligonucleotide analysis.

    Science.gov (United States)

    Cook, Ken; Thayer, Jim

    2011-05-01

    The rapid development of therapeutic oligonucleotides (ONs) has created a need for in-depth characterization of ONs, beyond previous requirements. The natural migration to LC-MS requires the use of chromatography with MS-compatible eluents to introduce the large, highly charged biopolymers into the mass spectrometer. Most frequently this employs ion-pair reversed-phase liquid chromatography, which may leave gaps in the characterization, but these can be filled with the use of high-resolution ion-exchange chromatography. Several classes of isobaric isomers are among the impurities that will require further separation prior to MS analysis. This review shows how the use of ion exchange as an additional orthogonal analytical method can be used as standalone or interfaced with MS to achieve the highest possible analytical coverage in the characterization and quantification of impurities present in single- and double-stranded ON formulations. Some of these techniques have been in use for some time and the importance of others is just being recognized.

  15. Porous silicon-cell penetrating peptide hybrid nanocarrier for intracellular delivery of oligonucleotides.

    Science.gov (United States)

    Rytkönen, Jussi; Arukuusk, Piret; Xu, Wujun; Kurrikoff, Kaido; Langel, Ulo; Lehto, Vesa-Pekka; Närvänen, Ale

    2014-02-01

    The largest obstacle to the use of oligonucleotides as therapeutic agents is the delivery of these large and negatively charged biomolecules through cell membranes into intracellular space. Mesoporous silicon (PSi) is widely recognized as a potential material for drug delivery purposes due to its several beneficial features like large surface area and pore volume, high loading capacity, biocompatibility, and biodegradability. In the present study, PSi nanoparticles stabilized by thermal oxidation or thermal carbonization and subsequently modified by grafting aminosilanes on the surface are utilized as an oligonucleotide carrier. Splice correcting oligonucleotides (SCOs), a model oligonucleotide drug, were loaded into the positively charged PSi nanoparticles with a loading degree as high as 14.3% (w/w). Rapid loading was achieved by electrostatic interactions, with the loading efficiencies reaching 100% within 5 min. The nanoparticles were shown to deliver and release SCOs, in its biologically active form, inside cells when formulated together with cell penetrating peptides (CPP). The biological effect was monitored with splice correction assay and confocal microscopy utilizing HeLa pLuc 705 cells. Furthermore, the use of PSi carrier platform in oligonucleotide delivery did not reduce the cell viability. Additionally, the SCO-CPP complexes formed in the pores of the carrier were stabilized against proteolytic digestion. The advantageous properties of protecting and releasing the cargo and the possibility to further functionalize the carrier surface make the hybrid nanoparticles a potential system for oligonucleotide delivery.

  16. Investigation of the structural organization of cationic nanoemulsion/antisense oligonucleotide complexes.

    Science.gov (United States)

    Bruxel, Fernanda; Vilela, José Mario Carneiro; Andrade, Margareth Spangler; Malachias, Ângelo; Perez, Carlos A; Magalhães-Paniago, Rogério; Oliveira, Mônica Cristina; Teixeira, Helder F

    2013-12-01

    Atomic force microscopy image analysis and energy dispersive X-ray diffraction experiments were used to investigate the structural organization of cationic nanoemulsion/oligonucleotide complexes. Oligonucleotides targeting topoisomerase II gene were adsorbed on cationic nanoemulsions obtained by means of spontaneous emulsification procedure. Topographical analysis by atomic force microscopy allowed the observation of the nanoemulsion/oligonucleotide complexes through three-dimensional high-resolution images. Flattening of the oil droplets was observed, which was reduced in the complexes obtained at high amount of adsorbed oligonucleotides. In such conditions, complexes exhibit droplet size in the 600nm range. The oligonucleotides molecules were detected on the surface of the droplets, preventing their fusion during aggregation. A lamellar structure organization was identified by energy dispersive X-ray diffraction experiments. The presence of the nucleic acid molecules led to a disorganization of the lipid arrangement and an expansion in the lattice spacing, which was proportional to the amount of oligonucleotides added. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Fragment-based solid-phase assembly of oligonucleotide conjugates with peptide and polyethylene glycol ligands.

    Science.gov (United States)

    Dirin, Mehrdad; Urban, Ernst; Noe, Christian R; Winkler, Johannes

    2016-10-04

    Ligand conjugation to oligonucleotides is an attractive strategy for enhancing the therapeutic potential of antisense and siRNA agents by inferring properties such as improved cellular uptake or better pharmacokinetic properties. Disulfide linkages enable dissociation of ligands and oligonucleotides in reducing environments found in endosomal compartments after cellular uptake. Solution-phase fragment coupling procedures for producing oligonucleotide conjugates are often tedious, produce moderate yields and reaction byproducts are frequently difficult to remove. We have developed an improved method for solid-phase coupling of ligands to oligonucleotides via disulfides directly after solid-phase synthesis. A 2'-thiol introduced using a modified nucleotide building block was orthogonally deprotected on the controlled pore glass solid support with N-butylphosphine. Oligolysine peptides and a short monodisperse ethylene glycol chain were successfully coupled to the deprotected thiol. Cleavage from the resin and full removal of oligonucleotide protection groups were achieved using methanolic ammonia. After standard desalting, and without further purification, homogenous conjugates were obtained as demonstrated by HPLC, gel electrophoresis, and mass spectrometry. The attachment of both amphiphilic and cationic ligands proves the versatility of the conjugation procedure. An antisense oligonucleotide conjugate with hexalysine showed pronounced gene silencing in a cell culture tumor model in the absence of a transfection reagent and the corresponding ethylene glycol conjugate resulted in down regulation of the target gene to nearly 50% after naked application. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  18. The small molecule Retro-1 enhances the pharmacological actions of antisense and splice switching oligonucleotides.

    Science.gov (United States)

    Ming, Xin; Carver, Kyle; Fisher, Michael; Noel, Romain; Cintrat, Jean-Christophe; Gillet, Daniel; Barbier, Julien; Cao, Canhong; Bauman, John; Juliano, Rudolph L

    2013-04-01

    The attainment of strong pharmacological effects with oligonucleotides is hampered by inefficient access of these molecules to their sites of action in the cytosol or nucleus. Attempts to address this problem with lipid or polymeric delivery systems have been only partially successful. Here, we describe a novel alternative approach involving the use of a non-toxic small molecule to enhance the pharmacological effects of oligonucleotides. The compound Retro-1 was discovered in a screen for small molecules that reduce the actions of bacterial toxins and has been shown to block the retrograde trafficking pathway. We demonstrate that Retro-1 can also substantially enhance the effectiveness of antisense and splice switching oligonucleotides in cell culture. This effect occurs at the level of intracellular trafficking or processing and is correlated with increased oligonucleotide accumulation in the nucleus but does not involve the perturbation of lysosomal compartments. We also show that Retro-1 can alter the effectiveness of splice switching oligonucleotides in the in vivo setting. These observations indicate that it is possible to enhance the pharmacological actions of oligonucleotides using non-toxic and non-lysosomotropic small molecule adjuncts.

  19. Improving signal intensities for genes with low-expression on oligonucleotide microarrays

    Directory of Open Access Journals (Sweden)

    Hu Limei

    2004-06-01

    Full Text Available Abstract Background DNA microarrays using long oligonucleotide probes are widely used to evaluate gene expression in biological samples. These oligonucleotides are pre-synthesized and sequence-optimized to represent specific genes with minimal cross-hybridization to homologous genes. Probe length and concentration are critical factors for signal sensitivity, particularly when genes with various expression levels are being tested. We evaluated the effects of oligonucleotide probe length and concentration on signal intensity measurements of the expression levels of genes in a target sample. Results Selected genes of various expression levels in a single cell line were hybridized to oligonucleotide arrays of four lengths and four concentrations of probes to determine how these critical parameters affected the intensity of the signal representing their expression. We found that oligonucleotides of longer length significantly increased the signals of genes with low-expression in the target. High-expressing gene signals were also boosted but to a lesser degree. Increasing the probe concentration, however, did not linearly increase the signal intensity for either low- or high-expressing genes. Conclusions We conclude that the longer the oligonuclotide probe the better the signal intensities of low expressing genes on oligonucleotide arrays.

  20. Oligonucleotide chip, real-time PCR and sequencing for genotyping of hepatitis B virus

    Institute of Scientific and Technical Information of China (English)

    Yong-Zhong Wang; Guo-Xiang Wu; Li-Bo Luo; Min Chen; Li-Hua Ruan

    2007-01-01

    AIM: To compare the oligonucleotide chip, real-time PCR and sequencing for genotyping of hepatitis B virus in Chinese patients with chronic hepatitis B.METHODS: Mixture of samples with different genotypes and clinical serum samples from 126 chronic hepatitis B patients was tested for hepatitis B virus genotypes by oligonucleotide chip, real-time PCR and sequencing of PCR products, respectively. Clinical performances, time required and costs of the three assays were evaluated.RESULTS: Oligonucleotide chips and real-time PCR detected 1% and 0.1% genotypes, respectively, in mixed samples. Of the 126 clinical samples from patients with chronic hepatitis B, genotype B was detected in 41(33%), 41 (33%) and 45 (36%) samples, and genotype C in 76 (60%), 76 (60%) and 81 (64%) samples, by oligonucleotide chip, real-time PCR and sequencing,respectively. Oligonucleotide chip and real-time PCR detected mixed genotypes B and C in 9 samples. Realtime PCR was the rapidest and cheapest among the three assays.CONCLUSION: Oligonucleotide chip and real-time PCR are able to detect mixed genotypes, while sequencing only detects the dominant genotype in clinical samples.

  1. Strategies in the preparation of DNA oligonucleotide arrays for diagnostic applications.

    Science.gov (United States)

    Beaucage, S L

    2001-08-01

    This report emphasizes the interfacial chemistry that is required to ensure proper attachment of oligonucleotides onto the surface of microarrays. For example, strategies for the covalent attachment of pre-synthesized oligonucleotides to glass slides, gold films, polyacrylamide gel pads, polypyrrole films, and optical fibers are surveyed in an attempt to better define the parameters for optimal formation and detection of DNA hybrids. These parameters include among others, the nature and length of the linkers attaching oligonucleotides to the arrays, and the surface density of oligonucleotides required for unhindered hybridization with DNA targets. Sensitive detection methods such as the use of light-scattering techniques, molecular beacons, surface plasmon resonance, attenuated total internal reflection-FTIR, and the evanescent field excitation of fluorescence from surface-bound fluorophores have been developed to study the kinetics and specificity of hybridization events. Finally, the synthesis of oligonucleotides directly on glass surfaces and polypropylene sheets has been investigated to enable DNA sequencing by hybridization and achieve oligonucleotide densities of ca. 10(6) sequences per cm(2) on DNA chips.

  2. Examining the role of phosphate in glycosyl transfer reactions of Cellulomonas uda cellobiose phosphorylase using D-glucal as donor substrate.

    Science.gov (United States)

    Wildberger, Patricia; Brecker, Lothar; Nidetzky, Bernd

    2012-07-15

    Cellobiose phosphorylase from Cellulomonas uda (CuCPase) is shown to utilize D-glucal as slow alternative donor substrate for stereospecific glycosyl transfer to inorganic phosphate, giving 2-deoxy-α-D-glucose 1-phosphate as the product. When performed in D(2)O, enzymatic phosphorolysis of D-glucal proceeds with incorporation of deuterium in equatorial position at C-2, implying a stereochemical course of reaction where substrate becomes protonated from below its six-membered ring through stereoselective re side attack at C-2. The proposed catalytic mechanism, which is supported by results of docking studies, involves direct protonation of D-glucal by the enzyme-bound phosphate, which then performs nucleophilic attack on the reactive C-1 of donor substrate. When offered D-glucose next to D-glucal and phosphate, CuCPase produces 2-deoxy-β-D-glucosyl-(1→4)-D-glucose and 2-deoxy-α-D-glucose 1-phosphate in a ratio governed by mass action of the two acceptor substrates present. Enzymatic synthesis of 2-deoxy-β-D-glucosyl-(1→4)-D-glucose is effectively promoted by catalytic concentrations of phosphate, suggesting that catalytic reaction proceeds through a quaternary complex of CuCPase, D-glucal, phosphate, and D-glucose. Conversion of D-glucal and phosphate presents a convenient single-step synthesis of 2-deoxy-α-D-glucose 1-phosphate that is difficult to prepare chemically.

  3. Bionano donor-acceptor hybrids of porphyrin, ssDNA, and semiconductive single-wall carbon nanotubes for electron transfer via porphyrin excitation.

    Science.gov (United States)

    D'Souza, Francis; Das, Sushanta K; Zandler, Melvin E; Sandanayaka, Atula S D; Ito, Osamu

    2011-12-14

    Photoinduced electron transfer in self-assemblies of porphyrins ion-paired with ssDNA wrapped around single-wall carbon nanotubes (SWCNTs) has been reported. To accomplish the three-component hybrids, two kinds of diameter-sorted semiconducting SWCNT(n,m)s of different diameter ((n,m) = (6,5) and (7,6)) and free-base or zinc porphyrin bearing peripheral positive charges ((TMPyP(+))M (tetrakis(4-N-methylpyridyl)porphyrin); M = Zn and H(2)) serving as light-absorbing photoactive materials are utilized. The donor-acceptor hybrids are held by ion-pairing between the negatively charged phosphate groups of ssDNA on the surface of the SWCNT and the positively charged at the ring periphery porphyrin macrocycle. The newly assembled bionano donor-acceptor hybrids have been characterized by transmission electron microscopy (TEM) and spectroscopic methods. Photoinduced electron transfer from the excited singlet porphyrin to the SWCNTs directly and/or via ssDNA as an electron mediator has been established by performing systematic studies involving the steady-state and time-resolved emission as well as the transient absorption studies. Higher charge-separation efficiency has been successfully demonstrated by the selection of the appropriate semiconductive SWCNTs with the right band gap, in addition to the aid of ssDNA as the electron mediator. © 2011 American Chemical Society

  4. Interface-induced heavy-hole/light-hole splitting of acceptors in silicon

    Energy Technology Data Exchange (ETDEWEB)

    Mol, J. A. [Centre for Quantum Computation and Communication Technology, School of Physics, University of New South Wales, Sydney, New South Wales 2052 (Australia); Department of Materials, University of Oxford, 16 Parks Road, Oxford OX1 3PH (United Kingdom); Salfi, J.; Simmons, M. Y.; Rogge, S., E-mail: s.rogge@unsw.edu.au [Centre for Quantum Computation and Communication Technology, School of Physics, University of New South Wales, Sydney, New South Wales 2052 (Australia); Rahman, R.; Hsueh, Y.; Klimeck, G. [Purdue University, West Lafayette, Indiana 47906 (United States); Miwa, J. A. [Centre for Quantum Computation and Communication Technology, School of Physics, University of New South Wales, Sydney, New South Wales 2052 (Australia); Department of Physics and Astronomy, Interdisciplinary Nanoscience Center (iNANO), Aarhus University, 8000 Aarhus C (Denmark)

    2015-05-18

    The energy spectrum of spin-orbit coupled states of individual sub-surface boron acceptor dopants in silicon have been investigated using scanning tunneling spectroscopy at cryogenic temperatures. The spatially resolved tunnel spectra show two resonances, which we ascribe to the heavy- and light-hole Kramers doublets. This type of broken degeneracy has recently been argued to be advantageous for the lifetime of acceptor-based qubits [R. Ruskov and C. Tahan, Phys. Rev. B 88, 064308 (2013)]. The depth dependent energy splitting between the heavy- and light-hole Kramers doublets is consistent with tight binding calculations, and is in excess of 1 meV for all acceptors within the experimentally accessible depth range (<2 nm from the surface). These results will aid the development of tunable acceptor-based qubits in silicon with long coherence times and the possibility for electrical manipulation.

  5. Time-resolved spectroscopy of the fluorescence quenching of a donor — acceptor pair by halothane

    Science.gov (United States)

    Sharma, A.; Draxler, S.; Lippitsch, M. E.

    1992-04-01

    Donor (anthracene) sensitized acceptor (perylene) fluorescence is quenched more efficiently by halothane than is intrinsic perylene fluorescence. The underlying process of dynamic fluorescence quenching is investigated by time-resolved fluorescence spectroscopy.

  6. Computational design of donor-bridge-acceptor systems exhibiting pronounced quantum interference effects.

    Science.gov (United States)

    Gorczak, Natalie; Renaud, Nicolas; Galan, Elena; Eelkema, Rienk; Siebbeles, Laurens D A; Grozema, Ferdinand C

    2016-03-01

    Quantum interference is a well-known phenomenon that dictates charge transport properties of single molecule junctions. However, reports on quantum interference in donor-bridge-acceptor molecules are scarce. This might be due to the difficulties in meeting the conditions for the presence of quantum interference in a donor-bridge-acceptor system. The electronic coupling between the donor, bridge, and acceptor moieties must be weak in order to ensure localised initial and final states for charge transfer. Yet, it must be strong enough to allow all bridge orbitals to mediate charge transfer. We present the computational route to the design of a donor-bridge-acceptor molecule that features the right balance between these contradicting requirements and exhibits pronounced interference effects.

  7. A Novel Donor Acceptor Substituted Chiroptical Molecular Switch : Physical Properties and Photoisomerization Behavior

    NARCIS (Netherlands)

    Delden, R.A. van; Schoevaars, A.M.; Feringa, B.L.

    2000-01-01

    A novel donor acceptor substituted sterically overcrowded alkene was synthesized and characterized. Photoisomerization experiments it showed that this system could be converted with high efficiency towards a cis photostationary state and although the reverse isomerization towards the trans state was

  8. Triphenyl phosphate allergy from spectacle frames

    DEFF Research Database (Denmark)

    Carlsen, Lars; Andersen, Klaus E.; Egsgaard, Helge

    1986-01-01

    A case of triphenyl phosphate allergy from spectacle frames is reported. Patch tests with analytical grade triphenyl phosphate, tri-m-cresyl phosphate, and tri-p-cresyl phosphate in the concentrations 5%, 0.5% and 0.05% pet. showed positive reactions to 0.05% triphenyl phosphate and 0.5% tri......-m-cresyl phosphate, but no reaction to tri-p-cresyl phosphate. Gas chromatography of the tricresyl phosphate 5% pet. patch test material supplied from Trolab showed that it contained a mixture of a wide range of triaryl phosphates, including 0.08% triphenyl phosphate which is above the threshold for detecting...... triphenyl phosphate allergy in our patient....

  9. Electron Donor-Acceptor Quenching and Photoinduced Electron Transfer for Coumarin Dyes.

    Science.gov (United States)

    1983-10-31

    Mechanism of cousarin photodegradation . Ithe behavior of eoiuma dyes is water ad In aqueous detergent media,. and the effsects of medism aud, additives on...D-i36 345 ELECTRON DONOR-ACCEPTOR UENCHING AND PHOTOINDUCED i/i Ai ELECTRON TRANSFER FOR COUMARIN DYES (U) BOSTON UNIY MR DEPT OF CHEMISTRY G JONES...TYPE OF REPORT & PEIOD COVERED Electron Donor-acceptor Quenching and Photo- Technical, 1/1/82-10/31/82 induced Electron Transfer for Coumarin Dyes S

  10. Grain boundary defect chemistry of acceptor-doped titanates: Space charge layer width

    Energy Technology Data Exchange (ETDEWEB)

    Vollman, M.; Waser, R. [Inst. fuer Werkstoffe der Elektrotechnik, Aachen (Germany)

    1994-01-01

    The grain boundary space charge depletion layers in acceptor-doped SrTiO{sub 3} ceramics were investigated by impedance spectroscopy in the time and frequency domain. Based on the layer and its dependence on the acceptor concentration, the temperature, and the oxygen partial pressure during annealing, a suggestion for a refined Schottky model is proposed. The local distribution of the donor type grain boundary states causing the depletion layer and the resulting band bending are discussed.

  11. Ternary Organic Solar Cells Based on Two Compatible Nonfullerene Acceptors with Power Conversion Efficiency >10.

    Science.gov (United States)

    Liu, Tao; Guo, Yuan; Yi, Yuanping; Huo, Lijun; Xue, Xiaonan; Sun, Xiaobo; Fu, Huiting; Xiong, Wentao; Meng, Dong; Wang, Zhaohui; Liu, Feng; Russell, Thomas P; Sun, Yanming

    2016-12-01

    Two different nonfullerene acceptors and one copolymer are used to fabricate ternary organic solar cells (OSCs). The two acceptors show unique interactions that reduce crystallinity and form a homogeneous mixed phase in the blend film, leading to a high efficiency of ≈10.3%, the highest performance reported for nonfullerene ternary blends. This work provides a new approach to fabricate high-performance OSCs.

  12. Rise-time of FRET-acceptor fluorescence tracks protein folding

    OpenAIRE

    Simon Lindhoud; Adrie H. Westphal; van Mierlo, Carlo P. M.; Visser, Antonie J. W. G.; Jan Willem Borst

    2014-01-01

    Uniform labeling of proteins with fluorescent donor and acceptor dyes with an equimolar ratio is paramount for accurate determination of Förster resonance energy transfer (FRET) efficiencies. In practice, however, the labeled protein population contains donor-labeled molecules that have no corresponding acceptor. These FRET-inactive donors contaminate the donor fluorescence signal, which leads to underestimation of FRET efficiencies in conventional fluorescence intensity and lifetime-based F...

  13. 2-O-[2-(Methylthio)ethyl]-Modified Oligonucleotide: An Analog of 2-O-[2-(Methoxy)ethyl]-Modified Oligonucleotide with Improved Protein Binding Properties and High Binding Affinity to Target RNA

    Energy Technology Data Exchange (ETDEWEB)

    Prakash, T.P.; Manoharan, M.; Fraser, A.S.; Kawasaki, A.M.; Lesnik, E.; Sioufi, N.; Leeds, J.M.; Teplova, M.; Egli, M.

    2010-03-08

    A novel 2'-modification, 2'-O-[2-(methylthio)ethyl] or 2'-O-MTE, has been incorporated into oligonucleotides and evaluated for properties relevant to antisense activity. The results were compared with the previously characterized 2'-O-[2-(methoxy)ethyl] 2'-O-MOE modification. As expected, the 2'-O-MTE modified oligonucleotides exhibited improved binding to human serum albumin compared to the 2'-O-MOE modified oligonucleotides. The 2'-O-MTE oligonucleotides maintained high binding affinity to target RNA. Nuclease digestion of 2'-O-MTE oligonucleotides showed that they have limited resistance to exonuclease degradation. We analyzed the crystal structure of a decamer DNA duplex containing the 2'-O-MTE modifcation. Analysis of the crystal structure provides insight into the improved RNA binding affinity, protein binding affinity and limited resistance of 2'-O-MTE modified oligonucleotides to exonuclease degradation.

  14. DNA sequence analysis by hybridization with oligonucleotide microchips : MALDI mass spectrometry identification of 5mers contiguously stacked to microchip oligonucleotides.

    Energy Technology Data Exchange (ETDEWEB)

    Stomakhin, A. A.; Vasiliskov, V. A.; Timofeev, E.; Schulga, D.; Cotter, R. J.; Mirzabekov, A. D.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology; Moscow Inst. of Physics and Technology; Middle Atlantic Mass Spectrometry Lab.; Johns Hopkins Univ. School of Medicine

    2000-01-01

    Matrix-assisted laser desorption ionization mass spectrometry (MALDI MS) has been applied to increase the informational output from DNA sequence analysis. It has been used to analyze DNA by hybridization with microarrays of gel-immobilized oligonucleotides extended with stacked 5mers. In model experiments, a 28 nt long DNA fragment was hybridized with 10 immobilized, overlapping 8mers. Then, in a second round of hybridization DNA-8mer duplexes were hybridized with a mixture of 10 5mers. The stability of the 5mer complex with DNA was increased to raise the melting temperature of the duplex by 10-15{sup o}C as a result of stacking interaction with 8mers. Contiguous 13 bp duplexes containing an internal break were formed. MALDI MS identified one or, in some cases, two 5mers contiguously stacked to each DNA-8mer duplex formed on the microchip. Incorporating a mass label into 5mers optimized MALDI MS monitoring. This procedure enabled us to reconstitute the sequence of a model DNA fragment and identify polymorphic nucleotides. The application of MALDI MS identification of contiguously stacked 5mers to increase the length of DNA for sequence analysis is discussed.

  15. Beyond Fullerenes: Designing Alternative Molecular Electron Acceptors for Solution-Processable Bulk Heterojunction Organic Photovoltaics.

    Science.gov (United States)

    Sauvé, Geneviève; Fernando, Roshan

    2015-09-17

    Organic photovoltaics (OPVs) are promising candidates for providing a low cost, widespread energy source by converting sunlight into electricity. Solution-processable active layers have predominantly consisted of a conjugated polymer donor blended with a fullerene derivative as the acceptor. Although fullerene derivatives have been the acceptor of choice, they have drawbacks such as weak visible light absorption and poor energy tuning that limit overall efficiencies. This has recently fueled new research to explore alternative acceptors that would overcome those limitations. During this exploration, one question arises: what are the important design principles for developing nonfullerene acceptors? It is generally accepted that acceptors should have high electron affinity, electron mobility, and absorption coefficient in the visible and near-IR region of the spectra. In this Perspective, we argue that alternative molecular acceptors, when blended with a conjugated polymer donor, should also have large nonplanar structures to promote nanoscale phase separation, charge separation and charge transport in blend films. Additionally, new material design should address the low dielectric constant of organic semiconductors that have so far limited their widespread application.

  16. The Effect of Acceptor and Donor Doping on Oxygen Vacancy Concentrations in Lead Zirconate Titanate (PZT

    Directory of Open Access Journals (Sweden)

    Christoph Slouka

    2016-11-01

    Full Text Available The different properties of acceptor-doped (hard and donor-doped (soft lead zirconate titanate (PZT ceramics are often attributed to different amounts of oxygen vacancies introduced by the dopant. Acceptor doping is believed to cause high oxygen vacancy concentrations, while donors are expected to strongly suppress their amount. In this study, La3+ donor-doped, Fe3+ acceptor-doped and La3+/Fe3+-co-doped PZT samples were investigated by oxygen tracer exchange and electrochemical impedance spectroscopy in order to analyse the effect of doping on oxygen vacancy concentrations. Relative changes in the tracer diffusion coefficients for different doping and quantitative relations between defect concentrations allowed estimates of oxygen vacancy concentrations. Donor doping does not completely suppress the formation of oxygen vacancies; rather, it concentrates them in the grain boundary region. Acceptor doping enhances the amount of oxygen vacancies but estimates suggest that bulk concentrations are still in the ppm range, even for 1% acceptor doping. Trapped holes might thus considerably contribute to the charge balancing of the acceptor dopants. This could also be of relevance in understanding the properties of hard and soft PZT.

  17. The Effect of Acceptor and Donor Doping on Oxygen Vacancy Concentrations in Lead Zirconate Titanate (PZT)

    Science.gov (United States)

    Slouka, Christoph; Kainz, Theresa; Navickas, Edvinas; Walch, Gregor; Hutter, Herbert; Reichmann, Klaus; Fleig, Jürgen

    2016-01-01

    The different properties of acceptor-doped (hard) and donor-doped (soft) lead zirconate titanate (PZT) ceramics are often attributed to different amounts of oxygen vacancies introduced by the dopant. Acceptor doping is believed to cause high oxygen vacancy concentrations, while donors are expected to strongly suppress their amount. In this study, La3+ donor-doped, Fe3+ acceptor-doped and La3+/Fe3+-co-doped PZT samples were investigated by oxygen tracer exchange and electrochemical impedance spectroscopy in order to analyse the effect of doping on oxygen vacancy concentrations. Relative changes in the tracer diffusion coefficients for different doping and quantitative relations between defect concentrations allowed estimates of oxygen vacancy concentrations. Donor doping does not completely suppress the formation of oxygen vacancies; rather, it concentrates them in the grain boundary region. Acceptor doping enhances the amount of oxygen vacancies but estimates suggest that bulk concentrations are still in the ppm range, even for 1% acceptor doping. Trapped holes might thus considerably contribute to the charge balancing of the acceptor dopants. This could also be of relevance in understanding the properties of hard and soft PZT. PMID:28774067

  18. Molecular helices as electron acceptors in high-performance bulk heterojunction solar cells.

    Science.gov (United States)

    Zhong, Yu; Trinh, M Tuan; Chen, Rongsheng; Purdum, Geoffrey E; Khlyabich, Petr P; Sezen, Melda; Oh, Seokjoon; Zhu, Haiming; Fowler, Brandon; Zhang, Boyuan; Wang, Wei; Nam, Chang-Yong; Sfeir, Matthew Y; Black, Charles T; Steigerwald, Michael L; Loo, Yueh-Lin; Ng, Fay; Zhu, X-Y; Nuckolls, Colin

    2015-09-18

    Despite numerous organic semiconducting materials synthesized for organic photovoltaics in the past decade, fullerenes are widely used as electron acceptors in highly efficient bulk-heterojunction solar cells. None of the non-fullerene bulk heterojunction solar cells have achieved efficiencies as high as fullerene-based solar cells. Design principles for fullerene-free acceptors remain unclear in the field. Here we report examples of helical molecular semiconductors as electron acceptors that are on par with fullerene derivatives in efficient solar cells. We achieved an 8.3% power conversion efficiency in a solar cell, which is a record high for non-fullerene bulk heterojunctions. Femtosecond transient absorption spectroscopy revealed both electron and hole transfer processes at the donor-acceptor interfaces. Atomic force microscopy reveals a mesh-like network of acceptors with pores that are tens of nanometres in diameter for efficient exciton separation and charge transport. This study describes a new motif for designing highly efficient acceptors for organic solar cells.

  19. Calcium phosphates for biomedical applications

    Energy Technology Data Exchange (ETDEWEB)

    Canillas, M.; Pena, P.; Aza, A.H. de; Rodriguez, M.A.

    2017-07-01

    The history of calcium phosphates in the medicine field starts in 1769 when the first evidence of its existence in the bone tissue is discovered. Since then, the interest for calcium phosphates has increased among the scientific community. Their study has been developed in parallel with new advances in materials sciences, medicine or tissue engineering areas. Bone tissue engineering is the field where calcium phosphates have had a great importance. While the first bioceramics are selected according to bioinert, biocompatibility and mechanical properties with the aim to replace bone tissue damaged, calcium phosphates open the way to the bone tissue regeneration challenge. Nowadays, they are present in the majority of commercial products directed to repair or regenerate damaged bone tissue. Finally, in the last few decades, they have been suggested and studied as drug delivering devices and as vehicles of DNA and RNA for the future generation therapies. (Author)

  20. Variability of nitrate and phosphate

    Digital Repository Service at National Institute of Oceanography (India)

    Sardessai, S.; Sundar, D.

    Nitrate and phosphate are important elements of the biogeochemical system of an estuary. Observations carried out during the dry season April-May 2002, and March 2003 and wet season September 2002, show temporal and spatial variability of these two...

  1. Recent advances in phosphate biosensors.

    Science.gov (United States)

    Upadhyay, Lata Sheo Bachan; Verma, Nishant

    2015-07-01

    A number of biosensors have been developed for phosphate analysis particularly, concerning its negative impact within the environmental and biological systems. Enzymatic biosensors comprising either a single or multiple enzymatic system have been extensively used for the direct and indirect analysis of phosphate ions. Furthermore, some non-enzymatic biosensors, such as affinity-based biosensors, provide an alternative analytical approach with a higher selectivity. This article reviews the recent advances in the field of biosensor developed for phosphate estimation in clinical and environmental samples, concerning the techniques involved, and the sensitivity toward phosphate ions. The biosensors have been classified and discussed on the basis of the number of enzymes used to develop the analytical system, and a comparative analysis has been performed.

  2. Diffusion of Oligonucleotides from within Iron-Crosslinked Polyelectrolyte-Modified Alginate Beads: A Model System for Drug Release

    CERN Document Server

    Privman, Vladimir; Luz, Roberto A S; Guz, Nataliia; Glasser, M Lawrence; Katz, Evgeny

    2016-01-01

    We developed and experimentally verified an analytical model to describe diffusion of oligonucleotides from stable hydrogel beads. The synthesized alginate beads are Fe3+-cross-linked as well as polyelectrolyte-doped for uniformity and stability at physiological pH. Data on diffusion of oligonucleotides from inside the beads provide physical insights into the volume nature of the immobilization of a fraction of oligonucleotides due to polyelectrolyte cross-linking, i.e., the absence of the surface-layer barrier in this case. Furthermore, our results suggest a new simple approach to measuring the diffusion coefficient of the mobile oligonucleotide molecules inside hydrogel. The considered alginate beads provide a model for a well-defined component in drug release systems and for the oligonucleotide-release transduction steps in drug-delivering and biocomputing applications. This is illustrated by destabilizing the beads with citrate that induces full oligonucleotide release with non-diffusional kinetics.

  3. A simple and rapid method for the preparation of homologous DNA oligonucleotide hybridization probes from heterologous gene sequences and probes.

    Science.gov (United States)

    Maxwell, E S; Sarge, K D

    1988-11-30

    We describe a simple and rapid method for the preparation of homologous DNA oligonucleotide probes for hybridization analysis and/or cDNA/genomic library screening. With this method, a synthetic DNA oligonucleotide derived from a known heterologous DNA/RNA/protein sequence is annealed to an RNA preparation containing the gene transcript of interest. Any unpaired 3'-terminal oligonucleotides of the heterologous DNA primer are then removed using the 3' exonuclease activity of the DNA Polymerase I Klenow fragment before primer extension/dideoxynucleotide sequencing of the annealed RNA species with AMV reverse transcriptase. From the determined RNA sequence, a completely homologous DNA oligonucleotide probe is then prepared. This approach has been used to prepare a homologous DNA oligonucleotide probe for the successful library screening of the yeast hybRNA gene starting with a heterologous mouse hybRNA DNA oligonucleotide probe.

  4. 'Specific' oligonucleotides often recognize more than one gene: the limits of in situ hybridization applied to GABA receptors.

    Science.gov (United States)

    Mladinic, M; Didelon, F; Cherubini, E; Bradbury, A

    2000-05-15

    As exquisite probes for gene sequences, oligonucleotides are one of the most powerful tools of recombinant molecular biology. In studying the GABA receptor subunits in the neonatal hippocampus we have used oligonucleotide probes in in situ hybridization and cloning techniques. The oligonucleotides used and assumed to be specific for the target gene, actually recognized more than one gene, leading to surprising and contradictory results. In particular, we found that a GABA(A)-rho specific oligonucleotide recognized an abundant, previously unknown, transcription factor in both in situ and library screening, while oligos 'specific' for GABA(A) subunits were able to recognize 30 additional unrelated genes in library screening. This suggests that positive results obtained with oligonucleotides should be interpreted with caution unless confirmed by identical results with oligonucleotides from different parts of the same gene, or cDNA library screening excludes the presence of other hybridizing species.

  5. A Novel Family of Small Molecules that Enhance the Intracellular Delivery and Pharmacological Effectiveness of Antisense and Splice Switching Oligonucleotides.

    Science.gov (United States)

    Wang, Ling; Ariyarathna, Yamuna; Ming, Xin; Yang, Bing; James, Lindsey I; Kreda, Silvia M; Porter, Melissa; Janzen, William; Juliano, Rudolph L

    2017-08-18

    The pharmacological effectiveness of oligonucleotides has been hampered by their tendency to remain entrapped in endosomes, thus limiting their access to cytosolic or nuclear targets. We have previously reported a group of small molecules that enhance the effects of oligonucleotides by causing their release from endosomes. Here, we describe a second novel family of oligonucleotide enhancing compounds (OECs) that is chemically distinct from the compounds reported previously. We demonstrate that these molecules substantially augment the actions of splice switching oligonucleotides (SSOs) and antisense oligonucleotides (ASOs) in cell culture. We also find enhancement of SSO effects in a murine model. These new compounds act by increasing endosome permeability and causing partial release of entrapped oligonucleotides. While they also affect the permeability of lysosomes, they are clearly different from typical lysosomotropic agents. Current members of this compound family display a relatively narrow window between effective dose and toxic dose. Thus, further improvements are necessary before these agents can become suitable for therapeutic use.

  6. Profiled support vector machines for antisense oligonucleotide efficacy prediction

    Directory of Open Access Journals (Sweden)

    Martín-Guerrero José D

    2004-09-01

    Full Text Available Abstract Background This paper presents the use of Support Vector Machines (SVMs for prediction and analysis of antisense oligonucleotide (AO efficacy. The collected database comprises 315 AO molecules including 68 features each, inducing a problem well-suited to SVMs. The task of feature selection is crucial given the presence of noisy or redundant features, and the well-known problem of the curse of dimensionality. We propose a two-stage strategy to develop an optimal model: (1 feature selection using correlation analysis, mutual information, and SVM-based recursive feature elimination (SVM-RFE, and (2 AO prediction using standard and profiled SVM formulations. A profiled SVM gives different weights to different parts of the training data to focus the training on the most important regions. Results In the first stage, the SVM-RFE technique was most efficient and robust in the presence of low number of samples and high input space dimension. This method yielded an optimal subset of 14 representative features, which were all related to energy and sequence motifs. The second stage evaluated the performance of the predictors (overall correlation coefficient between observed and predicted efficacy, r; mean error, ME; and root-mean-square-error, RMSE using 8-fold and minus-one-RNA cross-validation methods. The profiled SVM produced the best results (r = 0.44, ME = 0.022, and RMSE= 0.278 and predicted high (>75% inhibition of gene expression and low efficacy (http://aosvm.cgb.ki.se/. Conclusions The SVM approach is well suited to the AO prediction problem, and yields a prediction accuracy superior to previous methods. The profiled SVM was found to perform better than the standard SVM, suggesting that it could lead to improvements in other prediction problems as well.

  7. Correction of a Cystic Fibrosis Splicing Mutation by Antisense Oligonucleotides.

    Science.gov (United States)

    Igreja, Susana; Clarke, Luka A; Botelho, Hugo M; Marques, Luís; Amaral, Margarida D

    2016-02-01

    Cystic fibrosis (CF), the most common life-threatening genetic disease in Caucasians, is caused by ∼2,000 different mutations in the CF transmembrane conductance regulator (CFTR) gene. A significant fraction of these (∼13%) affect pre-mRNA splicing for which novel therapies have been somewhat neglected. We have previously described the effect of the CFTR splicing mutation c.2657+5G>A in IVS16, showing that it originates transcripts lacking exon 16 as well as wild-type transcripts. Here, we tested an RNA-based antisense oligonucleotide (AON) strategy to correct the aberrant splicing caused by this mutation. Two AONs (AON1/2) complementary to the pre-mRNA IVS16 mutant region were designed and their effect on splicing was assessed at the RNA and protein levels, on intracellular protein localization and function. To this end, we used the 2657+5G>A mutant CFTR minigene stably expressed in HEK293 Flp-In cells that express a single copy of the transgene. RNA data from AON1-treated mutant cells show that exon 16 inclusion was almost completely restored (to 95%), also resulting in increased levels of correctly localized CFTR protein at the plasma membrane (PM) and with increased function. A novel two-color CFTR splicing reporter minigene developed here allowed the quantitative monitoring of splicing by automated microscopy localization of CFTR at the PM. The AON strategy is thus a promising therapeutic approach for the specific correction of alternative splicing.

  8. Liposome-coated lipoplex-based carrier for antisense oligonucleotides.

    Science.gov (United States)

    Wyrozumska, Paulina; Meissner, Justyna; Toporkiewicz, Monika; Szarawarska, Marta; Kuliczkowski, Kazimierz; Ugorski, Maciej; Walasek, Marta A; Sikorski, Aleksander F

    2015-01-01

    The chemical nature of genetic drugs (e.g. antisense oligonucleotides, siRNA, vectors) requires a suitable carrier system to protect them from enzymatic degradation without changing their properties and enable efficient delivery into target cells. Lipid vectors for nucleic acid delivery that have been widely investigated for years can be very effective. As the majority of attempts made in the field of cancer gene therapy have focused on solid tumors, while blood cancer cells have attracted less attention, the latter became the subject of our investigation. The lipid carrier proposed here is based on liposomes constructed by others but the lipid composition is original. A liposome-coated lipoplex (L-cL) consists of a core arising from complexation of positively charged lipid and negatively charged oligodeoxynucleotide (ODN) or plasmid DNA coated by a neutral or anionic lipid bilayer. Moreover, our lipid vector demonstrates size stability and is able to retain a high content of enclosed plasmid DNA or antisense oligodeoxynucleotides (asODNs). Observed transfection efficacies of the tested preparation using a plasmid coding for fluorescent protein were up to 60-85% of examined leukemia cells (Jurkat T and HL-60 lines) in the absence or the presence of serum. When BCL‑2 asODN was encapsulated in the L-cL, specific silencing of this gene product at both the mRNA and protein level and also a markedly decreased cell survival rate were observed in vitro. Moreover, biodistribution analysis in mice indicates prolonged circulation characteristic for PEG-modified liposomal carriers. Experiments on tumor-engrafted animals indicate substantial inhibition of tumor growth.

  9. Mongersen, an oral SMAD7 antisense oligonucleotide, and Crohn's disease.

    Science.gov (United States)

    Monteleone, Giovanni; Neurath, Markus F; Ardizzone, Sandro; Di Sabatino, Antonio; Fantini, Massimo C; Castiglione, Fabiana; Scribano, Maria L; Armuzzi, Alessandro; Caprioli, Flavio; Sturniolo, Giacomo C; Rogai, Francesca; Vecchi, Maurizio; Atreya, Raja; Bossa, Fabrizio; Onali, Sara; Fichera, Maria; Corazza, Gino R; Biancone, Livia; Savarino, Vincenzo; Pica, Roberta; Orlando, Ambrogio; Pallone, Francesco

    2015-03-19

    Crohn's disease-related inflammation is characterized by reduced activity of the immunosuppressive cytokine transforming growth factor β1 (TGF-β1) due to high levels of SMAD7, an inhibitor of TGF-β1 signaling. Preclinical studies and a phase 1 study have shown that an oral SMAD7 antisense oligonucleotide, mongersen, targets ileal and colonic SMAD7. In a double-blind, placebo-controlled, phase 2 trial, we evaluated the efficacy of mongersen for the treatment of persons with active Crohn's disease. Patients were randomly assigned to receive 10, 40, or 160 mg of mongersen or placebo per day for 2 weeks. The primary outcomes were clinical remission at day 15, defined as a Crohn's Disease Activity Index (CDAI) score of less than 150, with maintenance of remission for at least 2 weeks, and the safety of mongersen treatment. A secondary outcome was clinical response (defined as a reduction of 100 points or more in the CDAI score) at day 28. The proportions of patients who reached the primary end point were 55% and 65% for the 40-mg and 160-mg mongersen groups, respectively, as compared with 10% for the placebo group (P<0.001). There was no significant difference in the percentage of participants reaching clinical remission between the 10-mg group (12%) and the placebo group. The rate of clinical response was significantly greater among patients receiving 10 mg (37%), 40 mg (58%), or 160 mg (72%) of mongersen than among those receiving placebo (17%) (P=0.04, P<0.001, and P<0.001, respectively). Most adverse events were related to complications and symptoms of Crohn's disease. We found that study participants with Crohn's disease who received mongersen had significantly higher rates of remission and clinical response than those who received placebo. (Funded by Giuliani; EudraCT number, 2011-002640-27.).

  10. Application of heteronuclear couplings to conformational analysis of oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, G. [Univ. of Maryland, College Park, MD (United States); Live, D. [Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Bax, A. [NIDDK National Institutes of Health, Bethesda, MD (United States)

    1994-12-01

    The value of vicinal coupling constants extracted from NMR spectra in deducing torsion angles for conformational analysis is well recognized. Due to the abundance of protons, their couplings have been mostly widely used. In many instances, couplings between protons and other nuclei may be a valuable complement to proton-proton couplings or, in some instances, may be the only coupling available to characterize the torsion angle about a bond. Recently, heteronuclear couplings have been used to great benefit in studies of isotopically enriched proteins, and this general approach has been extended to peptides at natural abundance. The possibility of using this approach to study oligonucleotides is also attractive but has not as yet been widely exploited. With the development of strategies for labeling such molecules, particularly RNAs, this may become an important component in conformational analysis. For DNA, labeling is less accessible, but sufficient quantities of unlabeled material are readily available for measuring these couplings at natural abundance. We chose several DNA systems to explore the usefulness of heteronuclear couplings in addressing the sugar conformation and the glycosidic torsion angle. Intensities of cross peaks in long-range HMQC experiments can be related to the couplings. Crosspeaks involving H1{prime} and C1{prime} atoms have been emphasized because of the superior shift dispersion at these positions between sugar protons and carbon atoms. Results will be shown for the self-complementary Dickerson duplex dodecamer sequence d(CGCGAATTCGCG) and for d(GGTCGG), which dimerizes to form a G-tetrad structure incorporating both syn and anti base orientations. The couplings provide a clear discrimination between presence of C3{prime}-endo and C2{prime}-endo conformations of the sugars and syn and anti bases arrangements.

  11. 21 CFR 573.320 - Diammonium phosphate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Diammonium phosphate. 573.320 Section 573.320 Food... Additive Listing § 573.320 Diammonium phosphate. The food additive diammonium phosphate may be safely used... crude protein from diammonium phosphate, adequate directions for use and a prominent statement,...

  12. 21 CFR 184.1434 - Magnesium phosphate.

    Science.gov (United States)

    2010-04-01

    ... solution of magnesite with phosphoric acid. (b) Magnesium phosphate, dibasic, meets the specifications of... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Magnesium phosphate. 184.1434 Section 184.1434 Food... Specific Substances Affirmed as GRAS § 184.1434 Magnesium phosphate. (a) Magnesium phosphate includes...

  13. Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides

    OpenAIRE

    Pawel Bialk; Brett Sansbury; Natalia Rivera-Torres; Kevin Bloh; Dula Man; Kmiec, Eric B.

    2016-01-01

    The repair of a point mutation can be facilitated by combined activity of a single-stranded oligonucleotide and a CRISPR/Cas9 system. While the mechanism of action of combinatorial gene editing remains to be elucidated, the regulatory circuitry of nucleotide exchange executed by oligonucleotides alone has been largely defined. The presence of the appropriate CRISPR/Cas9 system leads to an enhancement in the frequency of gene editing directed by single-stranded DNA oligonucleotides. While CRIS...

  14. Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides

    OpenAIRE

    Pawel Bialk; Brett Sansbury; Natalia Rivera-Torres; Kevin Bloh; Dula Man; Kmiec, Eric B.

    2016-01-01

    The repair of a point mutation can be facilitated by combined activity of a single-stranded oligonucleotide and a CRISPR/Cas9 system. While the mechanism of action of combinatorial gene editing remains to be elucidated, the regulatory circuitry of nucleotide exchange executed by oligonucleotides alone has been largely defined. The presence of the appropriate CRISPR/Cas9 system leads to an enhancement in the frequency of gene editing directed by single-stranded DNA oligonucleotides. While CRIS...

  15. Antisense Oligonucleotides Promote Exon Inclusion and Correct the Common c.-32-13T>G GAA Splicing Variant in Pompe Disease

    Directory of Open Access Journals (Sweden)

    Erik van der Wal

    2017-06-01

    Full Text Available The most common variant causing Pompe disease is c.-32-13T>G (IVS1 in the acid α-glucosidase (GAA gene, which weakens the splice acceptor of GAA exon 2 and induces partial and complete exon 2 skipping. It also allows a low level of leaky wild-type splicing, leading to a childhood/adult phenotype. We hypothesized that cis-acting splicing motifs may exist that could be blocked using antisense oligonucleotides (AONs to promote exon inclusion. To test this, a screen was performed in patient-derived primary fibroblasts using a tiling array of U7 small nuclear RNA (snRNA-based AONs. This resulted in the identification of a splicing regulatory element in GAA intron 1. We designed phosphorodiamidate morpholino oligomer-based AONs to this element, and these promoted exon 2 inclusion and enhanced GAA enzyme activity to levels above the disease threshold. These results indicate that the common IVS1 GAA splicing variant in Pompe disease is subject to negative regulation, and inhibition of a splicing regulatory element using AONs is able to restore canonical GAA splicing and endogenous GAA enzyme activity.

  16. Impact of donor-acceptor geometry and metal chelation on photophysical properties and applications of triarylboranes.

    Science.gov (United States)

    Hudson, Zachary M; Wang, Suning

    2009-10-20

    Three-coordinate organoboron compounds have recently found a wide range of applications in materials chemistry as nonlinear optical materials, chemical sensors, and emitters for organic light-emitting diodes (OLEDs). These compounds are excellent electron acceptors due to the empty p(pi) orbital on the boron center. When accompanied by electron donors such as amines, these molecules possess large electronic dipoles, which promote donor-acceptor charge-transfer upon excitation with light. Because of this, donor-acceptor triarylboranes are often highly luminescent both in the solid state and in solution. In this Account, we describe our research to develop donor-acceptor triarylboranes as efficient blue emitters for OLEDs. Through the use of hole-transporting donor groups such as 1-napthylphenylamines, we have prepared multifunctional triarylboranes that can act as the emissive, electron transport, or hole transport layers in OLEDs. We have also examined donor-acceptor compounds based on 2,2'-dipyridylamine or 7-azaindolyl donors, several of which have fluorescent quantum efficiencies approaching 100%. We are also investigating the chemistry of metal-containing triarylboranes. Our studies show that the electron-deficient boryl group can greatly facilitate metal-to-ligand charge-transfer transitions and phosphorescence. In addition, electronegative linker groups such as 2,2'-bipyridine can act in synergy with metal chelation to greatly improve the electron-accepting ability and Lewis acidity of triarylboranes. Donor-acceptor triarylboranes developed in our laboratory can also serve as a series of "switch-on" sensors for fluoride ions. When the donor and acceptor are linked by rigid naphthyl or nonrigid silane linkers, donor-acceptor conjugation is disrupted and charge transfer occurs primarily through space. The binding of fluoride ions to the boron center disrupts this charge transfer, activating alternative pi --> pi* transitions in the molecule and changing the

  17. Rat liver microsomes catalyse mannosyl transfer from GDP-d-mannose to retinyl phosphate with high efficiency in the absence of detergents

    Science.gov (United States)

    Shidoji, Yoshihiro; De Luca, Luigi M.

    1981-01-01

    . The amount of retinyl phosphate mannose formed in the bovine serum albumin/retinyl phosphate incubation is about 100-fold greater than in incubations containing 0.5% Triton X-100. In contrast with the lack of activity as a mannosyl acceptor for exogenous dolichyl phosphate in the present assay system, endogenous dolichyl phosphate clearly functions as an acceptor. Moreover in the same incubations a mannolipid with chromatographic properties of retinyl phosphate mannose was also synthesized from endogenous lipid acceptor. The biosynthesis of this mannolipid (retinyl phosphate mannose) was optimal at MnCl2 concentrations between 5 and 10mm and could not be detected below 0.6mm-MnCl2, when synthesis of dolichyl phosphate mannose from endogenous dolichyl phosphate was about 80% of optimal synthesis. Under optimal conditions (5mm-MnCl2) endogenous retinyl phosphate mannose represented about 20% of dolichyl phosphate mannose at 15min of incubation at 37°C. ImagesFig. 9. PMID:6177313

  18. Experimental analysis of oligonucleotide microarray design criteria to detect deletions by comparative genomic hybridization

    Directory of Open Access Journals (Sweden)

    Moerman Donald G

    2008-10-01

    Full Text Available Abstract Background Microarray comparative genomic hybridization (CGH is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. Results We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10°C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data

  19. Natural alkaloid Luotonin A and its affixed acceptor molecules: Serum albumin binding studies.

    Science.gov (United States)

    Kesavan, Mookkandi Palsamy; Kumar, Gujuluva Gangatharan Vinoth; Anitha, Kandasamy; Ravi, Lokesh; Raja, Jeyaraj Dhaveethu; Rajagopal, Gurusamy; Rajesh, Jegathalaprathaban

    2017-08-01

    Effective interaction of natural alkaloid Luotonin A (L) and its affixed acceptor molecules 1 and 2 with donor molecule as Bovine serum albumin (BSA) at various pH (4.0, 7.4 and 10.0) medium have been demonstrated using various conventional spectroscopic techniques. These analyses provide some valuable features on the interaction between BSA and acceptor molecules (L, 1 and 2). From the absorption and fluorescence spectral titration studies, the formation of ground-state complexes between the acceptor molecules (L, 1 and 2) and the BSA have been confirmed. The results of the afore titrations analysis reveal that, the strong binding of receptor 1 with BSA (Kapp 5.68×10(4)M(-1); KSV 1.86×10(6)Lmol(-1); Ka 6.42×10(5)Lmol(-1); Kass 8.09×10(6)M(-1); ΔG -33.35kJ/mol) at physiological pH medium (7.4) than other receptor molecules 2 and L. The Förster resonance energy transfer (FRET) efficiency between the tryptophan (Trp) residues of BSA and acceptor molecules L, 1 and 2 during the interaction, are 28.85, 85.24 and 53.25 % respectively. The superior binding efficacy of acceptor 1 at physiological pH condition has been further confirmed by FT-IR and Raman spectral analysis methods. Moreover, theoretical docking studies of acceptors L, 1 and 2 towards HSA have been demonstrated to differentiate their binding behaviours. It reveals that, acceptor 1 has the strongest binding ability with HSA through two hydrogen bonding and the Atomic contact energy (ACE) value of -483.96kcal/mol. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Metabolic response of Geobacter sulfurreducens towards electron donor/acceptor variation

    Directory of Open Access Journals (Sweden)

    Lovley Derek R

    2010-11-01

    Full Text Available Abstract Background Geobacter sulfurreducens is capable of coupling the complete oxidation of organic compounds to iron reduction. The metabolic response of G. sulfurreducens towards variations in electron donors (acetate, hydrogen and acceptors (Fe(III, fumarate was investigated via 13C-based metabolic flux analysis. We examined the 13C-labeling patterns of proteinogenic amino acids obtained from G. sulfurreducens cultured with 13C-acetate. Results Using 13C-based metabolic flux analysis, we observed that donor and acceptor variations gave rise to differences in gluconeogenetic initiation, tricarboxylic acid cycle activity, and amino acid biosynthesis pathways. Culturing G. sulfurreducens cells with Fe(III as the electron acceptor and acetate as the electron donor resulted in pyruvate as the primary carbon source for gluconeogenesis. When fumarate was provided as the electron acceptor and acetate as the electron donor, the flux analysis suggested that fumarate served as both an electron acceptor and, in conjunction with acetate, a carbon source. Growth on fumarate and acetate resulted in the initiation of gluconeogenesis by phosphoenolpyruvate carboxykinase and a slightly elevated flux through the oxidative tricarboxylic acid cycle as compared to growth with Fe(III as the electron acceptor. In addition, the direction of net flux between acetyl-CoA and pyruvate was reversed during growth on fumarate relative to Fe(III, while growth in the presence of Fe(III and acetate which provided hydrogen as an electron donor, resulted in decreased flux through the tricarboxylic acid cycle. Conclusions We gained detailed insight into the metabolism of G. sulfurreducens cells under various electron donor/acceptor conditions using 13C-based metabolic flux analysis. Our results can be used for the development of G. sulfurreducens as a chassis for a variety of applications including bioremediation and renewable biofuel production.

  1. A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide

    Directory of Open Access Journals (Sweden)

    Roh C

    2012-05-01

    Full Text Available Changhyun RohDivision of Biotechnology, Advanced Radiation Technology Institute (ARTI, Korea Atomic Energy Research Institute (KAERI, Jeongeup, Republic of KoreaAbstract: Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS, and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV nucleocapsid (N protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (--catechin gallate and (--gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (--catechin gallate and (--gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 µg mL–1, (--catechin gallate and (--gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system.Keywords: SARS, RNA oligonucleotide, quantum dots, inhibitor, screening

  2. LNA-modified isothermal oligonucleotide microarray for differentiating bacilli of similar origin.

    Science.gov (United States)

    Yan, Jing; Yuan, Ying; Mu, Runqing; Shang, Hong; Guan, Yifu

    2014-12-01

    Oligonucleotide microarray has been one of the most powerful tools in the 'Post-Genome Era' for its high sensitivity, high throughput and parallel processing capability. To achieve high detection specificity, we fabricated an isothermal microarray using locked nucleic acid (LNA)-modified oligonucleotide probes, since LNA has demonstrated the advanced ability to enhance the binding affinity toward their complementary nucleotides. After designing the nucleotide sequences of these oligonucleotide probes for gram-positive bacilli of similar origin (Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, Bacillus megaterium and Bacillus circulans), we unified the melting temperatures of these oligonucleotide probes by modifying some nucleotides using LNA. Furthermore, we optimized the experimental procedures of hydrating microarray slides, blocking side surface as well as labelling the PCR products. Experimental results revealed that KOD Dash DNA polymerase could efficiently incorporate Cy3-dCTP into the PCR products, and the LNA-isothermal oligonucleotide microarray were able to distinguish the bacilli of similar origin with a high degree of accuracy and specificity under the optimized experimental condition.

  3. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    Science.gov (United States)

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  4. LNA-modified isothermal oligonucleotide microarray for differentiating bacilli of similar origin

    Indian Academy of Sciences (India)

    Jing Yan; Ying Yuan; Runqing Mu; Hong Shang; Yifu Guan

    2014-12-01

    Oligonucleotide microarray has been one of the most powerful tools in the ‘Post-Genome Era’ for its high sensitivity, high throughput and parallel processing capability. To achieve high detection specificity, we fabricated an isothermal microarray using locked nucleic acid (LNA)-modified oligonucleotide probes, since LNA has demonstrated the advanced ability to enhance the binding affinity toward their complementary nucleotides. After designing the nucleotide sequences of these oligonucleotide probes for gram-positive bacilli of similar origin (Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, Bacillus megaterium and Bacillus circulans), we unified the melting temperatures of these oligonucleotide probes by modifying some nucleotides using LNA. Furthermore, we optimized the experimental procedures of hydrating microarray slides, blocking side surface as well as labelling the PCR products. Experimental results revealed that KOD Dash DNA polymerase could efficiently incorporate Cy3-dCTP into the PCR products, and the LNA-isothermal oligonucleotide microarray were able to distinguish the bacilli of similar origin with a high degree of accuracy and specificity under the optimized experimental condition.

  5. Surface modification of plasmonic nanostructured materials with thiolated oligonucleotides in 10 seconds using selective microwave heating

    Energy Technology Data Exchange (ETDEWEB)

    Abel, B.; Aslan, K. [Morgan State University, Department of Chemistry, 1700 East Cold Spring Lane, Baltimore, MD 21251 (United States)

    2012-11-15

    This study demonstrates the proof-of-principle of rapid surface modification of plasmonic nanostructured materials with oligonucleotides using low power microwave heating. Due to their interesting optical and electronic properties, silver nanoparticle films (SNFs, 2 nm thick) deposited onto glass slides were used as the model plasmonic nanostructured materials. Rapid surface modification of SNFs with oligonucleotides was carried out using two strategies (1) Strategy 1: for ss-oligonucleotides, surface hybridization and (2) Strategy 2: for ds-oligonucleotides, solution hybridization, where the samples were exposed to 10, 15, 30 and 60 seconds microwave heating. To assess the efficacy of our new rapid surface modification technique, identical experiments carried out without the microwave heating (i.e., conventional method), which requires 24 hours for the completion of the identical steps. It was found that SNFs can be modified with ss- and ds-oligonucleotides in 10 seconds, which typically requires several hours of incubation time for the chemisorption of thiol groups on to the planar metal surface using conventional techniques. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  6. Novel Efficient Cell-Penetrating, Peptide-Mediated Strategy for Enhancing Telomerase Inhibitor Oligonucleotides.

    Science.gov (United States)

    Muñoz-Alarcón, Andrés; Eriksson, Jonas; Langel, Ülo

    2015-12-01

    At present, there are several therapeutic approaches for targeting telomerase in tumors. One in particular, currently undergoing clinical trials, is based on synthetic lipid-modified oligonucleotide antagonists aimed at inhibiting the ribonucleoprotein subunit of human telomerase. However, while enabling efficient uptake, the lipid modifications reduce the potency of the therapeutic oligonucleotides compared to nonmodified oligonucleotides. Moreover, lipid modification may increase oligonucleotide accumulation in the liver causing undesirable hepatotoxicity. Noncovalent complexation strategies for cell-penetrating peptide (CPP)-mediated delivery present an option to circumvent the need for potency-reducing modifications, while allowing for a highly efficient uptake, and could significantly improve the efficiency of telomerase-targeting cancer therapeutics. Delivery of a nonlipidated locked nucleic acid/2'-O-methyl mixmer significantly inhibits the telomerase activity in treated HeLa cells. The inhibitory effect was further improved through addition of a CPP. Furthermore, calculated IC50-values for the oligonucleotide delivered by CPPs into HeLa cells are more than 20 times lower than telomerase inhibitor Imetelstat, currently undergoing clinical trials. These results emphasize the potential of CPP-mediated delivery of future pharmaceuticals and provide means by which to enhance an already promising therapeutic strategy for cancer treatment.

  7. Aspects of oligonucleotide and peptide sequencing with MALDI and electrospray mass spectrometry.

    Science.gov (United States)

    Owens, D R; Bothner, B; Phung, Q; Harris, K; Siuzdak, G

    1998-09-01

    Biopolymer sequencing with mass spectrometry has become increasingly important and accessible with the development of matrix-assisted laser desorption/ionization (MALDI) and electrospray ionization (ESI). Here we examine the use of sequential digestion for the rapid identification of proteolytic fragments, in turn highlighting the general utility of enzymatic MALDI ladder sequencing and ESI tandem mass spectrometry. Analyses were performed on oligonucleotides ranging in size from 2 to 50 residues, on peptides ranging in size from 7 to 44 residues and on viral coat proteins. MALDI ladder sequencing using exonuclease digestion generated a uniform distribution of ions and provided complete sequence information on the oligonucleotides 2-30 nucleic acid residues long. Only partial sequence information was obtained on the longer oligonucleotides. C-terminal peptide ladder sequencing typically provided information from 4 to 7 amino acids into the peptide. Sequential digestion, or endoprotease followed by exoprotease exposure, was also successfully applied to a trypsin digest of viral proteins. Analysis of ladder sequenced peptides by LCMS generated less information than in the MALDI-MS analysis and ESI-MS2 normally provided partial sequence information on both the small oligonucleotides and peptides. In general, MALDI ladder sequencing offered information on a broader mass range of biopolymers than ESI-MS2 and was relatively straightforward to interpret, especially for oligonucleotides.

  8. Efficient gene silencing by delivery of locked nucleic acid antisense oligonucleotides, unassisted by transfection reagents.

    Science.gov (United States)

    Stein, C A; Hansen, J Bo; Lai, Johnathan; Wu, SiJian; Voskresenskiy, Anatoliy; Høg, Anja; Worm, Jesper; Hedtjärn, Maj; Souleimanian, Naira; Miller, Paul; Soifer, Harris S; Castanotto, Daniella; Benimetskaya, Luba; Ørum, Henrik; Koch, Troels

    2010-01-01

    For the past 15-20 years, the intracellular delivery and silencing activity of oligodeoxynucleotides have been essentially completely dependent on the use of a delivery technology (e.g. lipofection). We have developed a method (called 'gymnosis') that does not require the use of any transfection reagent or any additives to serum whatsoever, but rather takes advantage of the normal growth properties of cells in tissue culture in order to promote productive oligonucleotide uptake. This robust method permits the sequence-specific silencing of multiple targets in a large number of cell types in tissue culture, both at the protein and mRNA level, at concentrations in the low micromolar range. Optimum results were obtained with locked nucleic acid (LNA) phosphorothioate gap-mers. By appropriate manipulation of oligonucleotide dosing, this silencing can be continuously maintained with little or no toxicity for >240 days. High levels of oligonucleotide in the cell nucleus are not a requirement for gene silencing, contrary to long accepted dogma. In addition, gymnotic delivery can efficiently deliver oligonucleotides to suspension cells that are known to be very difficult to transfect. Finally, the pattern of gene silencing of in vitro gymnotically delivered oligonucleotides correlates particularly well with in vivo silencing. The establishment of this link is of particular significance to those in the academic research and drug discovery and development communities.

  9. Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II and Al(III were active as photosensitizers in the generation of singlet oxygen 1 O 2 , while phthalocyanine of Co(II promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ( ⋅ O 2 − , O 2 H 2 , OH. Irradiation of the reaction mixture containing either Zn(II- or Al(III-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA with light of > 340 nm wavelength (Hg lamp or He/Ne laser resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT. A conjugate of Co(II-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O 2 and 2-mercaptoethanol or in the presence of O 2 H 2 . Under both sensitized and catalyzed conditions, the nucleotides G 13 – G 15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.

  10. Oligonucleotide-induced alternative splicing of serotonin 2C receptor reduces food intake.

    Science.gov (United States)

    Zhang, Zhaiyi; Shen, Manli; Gresch, Paul J; Ghamari-Langroudi, Masoud; Rabchevsky, Alexander G; Emeson, Ronald B; Stamm, Stefan

    2016-08-01

    The serotonin 2C receptor regulates food uptake, and its activity is regulated by alternative pre-mRNA splicing. Alternative exon skipping is predicted to generate a truncated receptor protein isoform, whose existence was confirmed with a new antiserum. The truncated receptor sequesters the full-length receptor in intracellular membranes. We developed an oligonucleotide that promotes exon inclusion, which increases the ratio of the full-length to truncated receptor protein. Decreasing the amount of truncated receptor results in the accumulation of full-length, constitutively active receptor at the cell surface. After injection into the third ventricle of mice, the oligonucleotide accumulates in the arcuate nucleus, where it changes alternative splicing of the serotonin 2C receptor and increases pro-opiomelanocortin expression. Oligonucleotide injection reduced food intake in both wild-type and ob/ob mice. Unexpectedly, the oligonucleotide crossed the blood-brain barrier and its systemic delivery reduced food intake in wild-type mice. The physiological effect of the oligonucleotide suggests that a truncated splice variant regulates the activity of the serotonin 2C receptor, indicating that therapies aimed to change pre-mRNA processing could be useful to treat hyperphagia, characteristic for disorders like Prader-Willi syndrome.

  11. Efficient oligonucleotide probe selection for pan-genomic tiling arrays

    Directory of Open Access Journals (Sweden)

    Zhang Wei

    2009-09-01

    Full Text Available Abstract Background Array comparative genomic hybridization is a fast and cost-effective method for detecting, genotyping, and comparing the genomic sequence of unknown bacterial isolates. This method, as with all microarray applications, requires adequate coverage of probes targeting the regions of interest. An unbiased tiling of probes across the entire length of the genome is the most flexible design approach. However, such a whole-genome tiling requires that the genome sequence is known in advance. For the accurate analysis of uncharacterized bacteria, an array must query a fully representative set of sequences from the species' pan-genome. Prior microarrays have included only a single strain per array or the conserved sequences of gene families. These arrays omit potentially important genes and sequence variants from the pan-genome. Results This paper presents a new probe selection algorithm (PanArray that can tile multiple whole genomes using a minimal number of probes. Unlike arrays built on clustered gene families, PanArray uses an unbiased, probe-centric approach that does not rely on annotations, gene clustering, or multi-alignments. Instead, probes are evenly tiled across all sequences of the pan-genome at a consistent level of coverage. To minimize the required number of probes, probes conserved across multiple strains in the pan-genome are selected first, and additional probes are used only where necessary to span polymorphic regions of the genome. The viability of the algorithm is demonstrated by array designs for seven different bacterial pan-genomes and, in particular, the design of a 385,000 probe array that fully tiles the genomes of 20 different Listeria monocytogenes strains with overlapping probes at greater than twofold coverage. Conclusion PanArray is an oligonucleotide probe selection algorithm for tiling multiple genome sequences using a minimal number of probes. It is capable of fully tiling all genomes of a species on

  12. Factor XI antisense oligonucleotide for prevention of venous thrombosis.

    Science.gov (United States)

    Büller, Harry R; Bethune, Claudette; Bhanot, Sanjay; Gailani, David; Monia, Brett P; Raskob, Gary E; Segers, Annelise; Verhamme, Peter; Weitz, Jeffrey I

    2015-01-15

    Experimental data indicate that reducing factor XI levels attenuates thrombosis without causing bleeding, but the role of factor XI in the prevention of postoperative venous thrombosis in humans is unknown. FXI-ASO (ISIS 416858) is a second-generation antisense oligonucleotide that specifically reduces factor XI levels. We compared the efficacy and safety of FXI-ASO with those of enoxaparin in patients undergoing total knee arthroplasty. In this open-label, parallel-group study, we randomly assigned 300 patients who were undergoing elective primary unilateral total knee arthroplasty to receive one of two doses of FXI-ASO (200 mg or 300 mg) or 40 mg of enoxaparin once daily. The primary efficacy outcome was the incidence of venous thromboembolism (assessed by mandatory bilateral venography or report of symptomatic events). The principal safety outcome was major or clinically relevant nonmajor bleeding. Around the time of surgery, the mean (±SE) factor XI levels were 0.38±0.01 units per milliliter in the 200-mg FXI-ASO group, 0.20±0.01 units per milliliter in the 300-mg FXI-ASO group, and 0.93±0.02 units per milliliter in the enoxaparin group. The primary efficacy outcome occurred in 36 of 134 patients (27%) who received the 200-mg dose of FXI-ASO and in 3 of 71 patients (4%) who received the 300-mg dose of FXI-ASO, as compared with 21 of 69 patients (30%) who received enoxaparin. The 200-mg regimen was noninferior, and the 300-mg regimen was superior, to enoxaparin (P<0.001). Bleeding occurred in 3%, 3%, and 8% of the patients in the three study groups, respectively. This study showed that factor XI contributes to postoperative venous thromboembolism; reducing factor XI levels in patients undergoing elective primary unilateral total knee arthroplasty was an effective method for its prevention and appeared to be safe with respect to the risk of bleeding. (Funded by Isis Pharmaceuticals; FXI-ASO TKA ClinicalTrials.gov number, NCT01713361.).

  13. A novel multifunctional oligonucleotide microarray for Toxoplasma gondii

    Directory of Open Access Journals (Sweden)

    Chen Feng

    2010-10-01

    Full Text Available Abstract Background Microarrays are invaluable tools for genome interrogation, SNP detection, and expression analysis, among other applications. Such broad capabilities would be of value to many pathogen research communities, although the development and use of genome-scale microarrays is often a costly undertaking. Therefore, effective methods for reducing unnecessary probes while maintaining or expanding functionality would be relevant to many investigators. Results Taking advantage of available genome sequences and annotation for Toxoplasma gondii (a pathogenic parasite responsible for illness in immunocompromised individuals and Plasmodium falciparum (a related parasite responsible for severe human malaria, we designed a single oligonucleotide microarray capable of supporting a wide range of applications at relatively low cost, including genome-wide expression profiling for Toxoplasma, and single-nucleotide polymorphism (SNP-based genotyping of both T. gondii and P. falciparum. Expression profiling of the three clonotypic lineages dominating T. gondii populations in North America and Europe provides a first comprehensive view of the parasite transcriptome, revealing that ~49% of all annotated genes are expressed in parasite tachyzoites (the acutely lytic stage responsible for pathogenesis and 26% of genes are differentially expressed among strains. A novel design utilizing few probes provided high confidence genotyping, used here to resolve recombination points in the clonal progeny of sexual crosses. Recent sequencing of additional T. gondii isolates identifies >620 K new SNPs, including ~11 K that intersect with expression profiling probes, yielding additional markers for genotyping studies, and further validating the utility of a combined expression profiling/genotyping array design. Additional applications facilitating SNP and transcript discovery, alternative statistical methods for quantifying gene expression, etc. are also pursued at

  14. Non-Fullerene Electron Acceptors for Use in Organic Solar Cells

    KAUST Repository

    Nielsen, Christian B.

    2015-10-27

    The active layer in a solution processed organic photovoltaic device comprises a light absorbing electron donor semiconductor, typically a polymer, and an electron accepting fullerene acceptor. Although there has been huge effort targeted to optimize the absorbing, energetic, and transport properties of the donor material, fullerenes remain as the exclusive electron acceptor in all high performance devices. Very recently, some new non-fullerene acceptors have been demonstrated to outperform fullerenes in comparative devices. This Account describes this progress, discussing molecular design considerations and the structure–property relationships that are emerging. The motivation to replace fullerene acceptors stems from their synthetic inflexibility, leading to constraints in manipulating frontier energy levels, as well as poor absorption in the solar spectrum range, and an inherent tendency to undergo postfabrication crystallization, resulting in device instability. New acceptors have to address these limitations, providing tunable absorption with high extinction coefficients, thus contributing to device photocurrent. The ability to vary and optimize the lowest unoccupied molecular orbital (LUMO) energy level for a specific donor polymer is also an important requirement, ensuring minimal energy loss on electron transfer and as high an internal voltage as possible. Initially perylene diimide acceptors were evaluated as promising acceptor materials. These electron deficient aromatic molecules can exhibit good electron transport, facilitated by close packed herringbone crystal motifs, and their energy levels can be synthetically tuned. The principal drawback of this class of materials, their tendency to crystallize on too large a length scale for an optimal heterojunction nanostructure, has been shown to be overcome through introduction of conformation twisting through steric effects. This has been primarily achieved by coupling two units together, forming dimers

  15. Physiological response of Desulfurispirillum indicum S5 to arsenate and nitrate as terminal electron acceptors.

    Science.gov (United States)

    Rauschenbach, Ines; Bini, Elisabetta; Häggblom, Max M; Yee, Nathan

    2012-07-01

    The ability of anaerobic prokaryotes to employ different terminal electron acceptors for respiration enables these organisms to flourish in subsurface ecosystems. Desulfurispirillum indicum strain S5 is an obligate anaerobic bacterium that is able to grow by respiring a range of different electron acceptors, including arsenate and nitrate. Here, we examined the growth, electron acceptor utilization, and gene expression of D. indicum growing under arsenate and nitrate-reducing conditions. Consistent with thermodynamic predictions, the experimental results showed that the reduction of nitrate to ammonium yielded higher cell densities than the reduction of arsenate to arsenite. However, D. indicum grew considerably faster by respiration on arsenate compared with nitrate, with doubling times of 4.3 ± 0.2 h and 19.2 ± 2.0 h, respectively. Desulfurispirillum indicum growing on both electron acceptors exhibited the preferential utilization of arsenate before nitrate. The expression of the arsenate reductase gene arrA was up-regulated approximately 100-fold during arsenate reduction, as determined by qRT-PCR. Conversely, the nitrate reductase genes narG and napA were not differentially regulated under the conditions tested. The results of this study suggest that physiology, rather than thermodynamics, controls the growth rates and hierarchy of electron acceptor utilization in D. indicum.

  16. Porphyrin Donor and Tunable Push-Pull Acceptor Conjugates-Experimental Investigation of Marcus Theory.

    Science.gov (United States)

    Reekie, Tristan A; Sekita, Michael; Urner, Lorenz M; Bauroth, Stefan; Ruhlmann, Laurent; Gisselbrecht, Jean-Paul; Boudon, Corinne; Trapp, Nils; Clark, Timothy; Guldi, Dirk M; Diederich, François

    2017-05-05

    We report on a series of electron donor-acceptor conjugates incorporating a Zn(II) -porphyrin-based electron donor and a variety of non-conjugated rigid linkers connecting to push-pull chromophores as electron acceptors. The electron acceptors comprize multicyanobutadienes or extended tetracyanoquinodimethane analogues with first reduction potentials ranging from -1.67 to -0.23 V vs. Fc(+) /Fc in CH2 Cl2 , which are accessible through a final-step cycloaddition-retroelectrocyclization (CA-RE) reaction. Characterization of the conjugates includes electrochemistry, spectroelectrochemistry, DFT calculations, and photophysical measurements in a range of solvents. The collected data allows for the construction of multiple Marcus curves that consider electron-acceptor strength, linker length, and solvent, with data points extending well into the inverted region. The enhancement of electron-vibration couplings, resulting from the rigid spacers and, in particular, multicyano-groups in the conformationally highly fixed push-pull acceptor chromophores affects the charge-recombination kinetics in the inverted region drastically. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. A rhodanine flanked nonfullerene acceptor for solution-processed organic photovoltaics

    KAUST Repository

    Holliday, Sarah

    2015-01-21

    A novel small molecule, FBR, bearing 3-ethylrhodanine flanking groups was synthesized as a nonfullerene electron acceptor for solution-processed bulk heterojunction organic photovoltaics (OPV). A straightforward synthesis route was employed, offering the potential for large scale preparation of this material. Inverted OPV devices employing poly(3-hexylthiophene) (P3HT) as the donor polymer and FBR as the acceptor gave power conversion efficiencies (PCE) up to 4.1%. Transient and steady state optical spectroscopies indicated efficient, ultrafast charge generation and efficient photocurrent generation from both donor and acceptor. Ultrafast transient absorption spectroscopy was used to investigate polaron generation efficiency as well as recombination dynamics. It was determined that the P3HT:FBR blend is highly intermixed, leading to increased charge generation relative to comparative devices with P3HT:PC60BM, but also faster recombination due to a nonideal morphology in which, in contrast to P3HT:PC60BM devices, the acceptor does not aggregate enough to create appropriate percolation pathways that prevent fast nongeminate recombination. Despite this nonoptimal morphology the P3HT:FBR devices exhibit better performance than P3HT:PC60BM devices, used as control, demonstrating that this acceptor shows great promise for further optimization.

  18. Formation of phosphatidylinositol 3-phosphate by isomerization from phosphatidylinositol 4-phosphate.

    OpenAIRE

    Walsh, J P; Caldwell, K K; Majerus, P W

    1991-01-01

    We have synthesized phosphatidylinositol 3-phosphate from phosphatidylinositol 4-phosphate by using diisopropylcarbodiimide to promote migration of the 4-phosphate via a cyclic phosphodiester intermediate. The product was isolated by a thin-layer chromatographic method that depends on the ability of phosphatidylinositol 4-phosphate, but not phosphatidylinositol 3-phosphate, to form complexes with boric acid. The final yield of the procedure was 8% phosphatidylinositol 3-phosphate, which was a...

  19. Cellular uptake of antisense oligonucleotides after complexing or conjugation with cell-penetrating model peptides.

    Science.gov (United States)

    Oehlke, J; Birth, P; Klauschenz, E; Wiesner, B; Beyermann, M; Oksche, A; Bienert, M

    2002-08-01

    The uptake by mammalian cells of phosphorothioate oligonucleotides was compared with that of their respective complexes or conjugates with cationic, cell-penetrating model peptides of varying helix-forming propensity and amphipathicity. An HPLC-based protocol for the synthesis and purification of disulfide bridged conjugates in the 10-100 nmol range was developed. Confocal laser scanning microscopy (CLSM) in combination with gel-capillary electrophoresis and laser induced fluorescence detection (GCE-LIF) revealed cytoplasmic and nuclear accumulationin all cases. The uptake differences between naked oligonucleotides and their respective peptide complexes or conjugates were generally confined to one order of magnitude. No significant influence of the structural properties of the peptide components upon cellular uptake was found. Our results question the common belief that the increased biological activity of oligonucleotides after derivatization with membrane permeable peptides may be primarily due to improved membrane translocation.

  20. Oligonucleotides conjugated with short chemically defined polyethylene glycol chains are efficient antisense agents.

    Science.gov (United States)

    Shokrzadeh, Nasrin; Winkler, Anna-Maria; Dirin, Mehrdad; Winkler, Johannes

    2014-12-15

    Ligand conjugation is an attractive approach to rationally modify the poor pharmacokinetic behavior and cellular uptake properties of antisense oligonucleotides. Polyethylene glycol (PEG) attachment is a method to increase solubility of oligonucleotides and prevent the rapid elimination, thus increasing tissue distribution. On the other hand, the attachment of long PEG chains negatively influences the pharmacodynamic effect by reducing the hybridization efficiency. We examined the use of short PEG ligands on the in vitro effect of antisense agents. Circular dichroism showed that the tethering of PEG12-chains to phosphodiester and phosphorothioate oligonucleotides had no influence on their secondary structure and did not reduce the affinity to the counter strand. In an in vitro tumor model, a luciferase reporter assay indicated unchanged gene silencing activity compared to unmodified compounds, and even slightly superior target down regulation was found after treatment with a phosphorothioate modified conjugate. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Gene silencing by siRNAs and antisense oligonucleotides in the laboratory and the clinic

    Science.gov (United States)

    Watts, Jonathan K.; Corey, David R.

    2014-01-01

    Synthetic nucleic acids are commonly used laboratory tools for modulating gene expression and have the potential to be widely used in the clinic. Progress towards nucleic acid drugs, however, has been slow and many challenges remain to be overcome before their full impact on patient care can be understood. Antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs) are the two most widely used strategies for silencing gene expression. We first describe these two approaches and contrast their relative strengths and weaknesses for laboratory applications. We then review the choices faced during development of clinical candidates and the current state of clinical trials. Attitudes towards clinical development of nucleic acid silencing strategies have repeatedly swung from optimism to depression during the past twenty years. Our goal is to provide the information needed to design robust studies with oligonucleotides, making use of the strengths of each oligonucleotide technology. PMID:22069063

  2. Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

    Science.gov (United States)

    Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

    1996-11-01

    In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

  3. ProbeMaker: an extensible framework for design of sets of oligonucleotide probes

    Science.gov (United States)

    Stenberg, Johan; Nilsson, Mats; Landegren, Ulf

    2005-01-01

    Background Procedures for genetic analyses based on oligonucleotide probes are powerful tools that can allow highly parallel investigations of genetic material. Such procedures require the design of large sets of probes using application-specific design constraints. Results ProbeMaker is a software framework for computer-assisted design and analysis of sets of oligonucleotide probe sequences. The tool assists in the design of probes for sets of target sequences, incorporating sequence motifs for purposes such as amplification, visualization, or identification. An extension system allows the framework to be equipped with application-specific components for evaluation of probe sequences, and provides the possibility to include support for importing sequence data from a variety of file formats. Conclusion ProbeMaker is a suitable tool for many different oligonucleotide design and analysis tasks, including the design of probe sets for various types of parallel genetic analyses, experimental validation of design parameters, and in silico testing of probe sequence evaluation algorithms. PMID:16171527

  4. Streptavidin-coated gold nanoparticles: critical role of oligonucleotides on stability and fractal aggregation

    Directory of Open Access Journals (Sweden)

    Roberta D'Agata

    2017-01-01

    Full Text Available Gold nanoparticles (AuNPs exhibit unique properties that can be modulated through a tailored surface functionalization, enabling their targeted use in biochemical sensing and medical diagnostics. In particular, streptavidin-modified AuNPs are increasingly used for biosensing purposes. We report here a study of AuNPs surface-functionalized with streptavidin-biotinylated oligonucleotide, focussing on the role played by the oligonucleotide probes in the stabilization/destabilization of the functionalized nanoparticle dispersion. The behaviour of the modified AuNP dispersion as a consequence of the competitive displacement of the biotinylated oligonucleotide has been investigated and the critical role of displaced oligonucletides in triggering the quasi one-dimensional aggregation of nanoparticles is demonstrated for the first time. The thorough understanding of the fundamental properties of bioconjugated AuNPs is of great importance for the design of highly sensitive and reliable functionalized AuNP-based assays.

  5. Hydration-dependent dynamics of human telomeric oligonucleotides in the picosecond timescale: A neutron scattering study

    Science.gov (United States)

    Sebastiani, F.; Longo, M.; Orecchini, A.; Comez, L.; De Francesco, A.; Muthmann, M.; Teixeira, S. C. M.; Petrillo, C.; Sacchetti, F.; Paciaroni, A.

    2015-07-01

    The dynamics of the human oligonucleotide AG3(T2AG3)3 has been investigated by incoherent neutron scattering in the sub-nanosecond timescale. A hydration-dependent dynamical activation of thermal fluctuations in weakly hydrated samples was found, similar to that of protein powders. The amplitudes of such thermal fluctuations were evaluated in two different exchanged wave-vector ranges, so as to single out the different contributions from intra- and inter-nucleotide dynamics. The activation energy was calculated from the temperature-dependent characteristic times of the corresponding dynamical processes. The trends of both amplitudes and activation energies support a picture where oligonucleotides possess a larger conformational flexibility than long DNA sequences. This additional flexibility, which likely results from a significant relative chain-end contribution to the average chain dynamics, could be related to the strong structural polymorphism of the investigated oligonucleotides.

  6. Hydration-dependent dynamics of human telomeric oligonucleotides in the picosecond timescale: A neutron scattering study

    Energy Technology Data Exchange (ETDEWEB)

    Sebastiani, F.; Comez, L.; Sacchetti, F. [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); CNR, Istituto Officina dei Materiali, Unità di Perugia, c/o Dipartimento di Fisica e Geologia, Università di Perugia, 06123 Perugia (Italy); Longo, M. [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); Elettra—Sincrotrone Trieste, 34149 Basovizza, Trieste (Italy); Orecchini, A.; Petrillo, C.; Paciaroni, A., E-mail: alessandro.paciaroni@fisica.unipg.it [Dipartimento di Fisica e Geologia, Università degli Studi di Perugia, Via A. Pascoli, 06123 Perugia (Italy); De Francesco, A. [CNR-IOM OGG c/o Institut Laue-Langevin, 71 Avenue des Martyrs, CS20156, 38042 Grenoble Cedex 9 (France); Muthmann, M. [Jülich Centre for Neutron Science, Forschungszentrum Jülich GmbH, Outstation at Heinz Maier-Leibnitz Zentrum, Lichtenbergstrasse 1, 85747 Garching (Germany); Teixeira, S. C. M. [EPSAM, Keele University, Staffordshire ST5 5BG (United Kingdom); Institut Laue–Langevin, 71 Avenue des Martyrs, CS20156, 38042 Grenoble Cedex 9 (France)

    2015-07-07

    The dynamics of the human oligonucleotide AG{sub 3}(T{sub 2}AG{sub 3}){sub 3} has been investigated by incoherent neutron scattering in the sub-nanosecond timescale. A hydration-dependent dynamical activation of thermal fluctuations in weakly hydrated samples was found, similar to that of protein powders. The amplitudes of such thermal fluctuations were evaluated in two different exchanged wave-vector ranges, so as to single out the different contributions from intra- and inter-nucleotide dynamics. The activation energy was calculated from the temperature-dependent characteristic times of the corresponding dynamical processes. The trends of both amplitudes and activation energies support a picture where oligonucleotides possess a larger conformational flexibility than long DNA sequences. This additional flexibility, which likely results from a significant relative chain-end contribution to the average chain dynamics, could be related to the strong structural polymorphism of the investigated oligonucleotides.

  7. Antisense Oligonucleotides Internally Labeled with Peptides Show Improved Target Recognition and Stability to Enzymatic Degradation

    DEFF Research Database (Denmark)

    Taskova, Maria; Madsen, Charlotte Stahl; Jensen, Knud Jørgen

    2017-01-01

    , most often at the terminal position of the oligonucleotide. Herein, we for the first time systematically investigate the influence of internally attached short peptides on the properties of antisense oligonucleotides. We report the synthesis and internal double labeling of 21-mer oligonucleotides...... by the internal attachment of peptides but not by LNA alone. Independently of the peptide sequence, the conjugates are stable for up to 24 h in 90% human serum and duplexes of POCs with complementary DNA for up to 160 h in 90% human serum. Such excellent stability has not been previously reported for DNA...... and makes internally labeled POCs an exciting object of study, i.e., showing high target specificity and simultaneous stability in biological media....

  8. Kinetic effects on signal normalization in oligonucleotide microchips with labeled immobilized probes.

    Science.gov (United States)

    Pan'kov, S V; Chechetkin, V R; Somova, O G; Antonova, O V; Moiseeva, O V; Prokopenko, D V; Yurasov, R A; Gryadunov, D A; Chudinov, A V

    2009-10-01

    Among various factors affecting operation of oligonucleotide microchips, the variations in concentration and in homogeneous distribution of immobilized probes over the cells are one of the most important. The labeling of immobilized probes ensures the complete current monitoring on the probe distribution and is reliable and convenient. Using hydrogel-based oligonucleotide microchips, the applicability of Cy3-labeled immobilized probes for quality control and signal normalization after hybridization with Cy5-labeled target DNA was investigated. This study showed that proper signal normalization should be different in thermodynamic conditions and in transient regime with hybridization far from saturation. This kinetic effect holds for both hydrogel-based and surface oligonucleotide microchips. Besides proving basic features, the technique was assessed on a sampling batch of 50 microchips developed for identifying mutations responsible for rifampicin and isoniazid resistance of Mycobacterium tuberculosis.

  9. Dynamics of human telomerase RNA structure revealed by antisense oligonucleotide technique.

    Science.gov (United States)

    Vasilkova, Daria V; Azhibek, Dulat M; Zatsepin, Timofei S; Naraikina, Yulia V; Prassolov, Vladimir S; Prokofjeva, Maria M; Zvereva, Maria I; Rubtsova, Maria P

    2013-12-01

    Telomeres are the nucleoprotein complexes that cap the linear chromosome ends. Telomerase is a ribonucleoprotein that maintains telomere length in stem, embryonic and cancer cells. Somatic cells don't contain active telomerase and telomere function as mitotic clock and telomere length determines the number of cell divisions. Telomerase RNA (TER) contains the template for telomere synthesis and serves as a structural scaffold for holoenzyme assembly. We compared different oligonucleotide based methods for telomerase RNA inhibition, such as antisense oligonucleotides, knockdown by transient siRNA transfection and silencing by miRNA derived from short expressed RNA hairpin in HEK293 cells. All of these methods were applied to different TER regions. Our results revealed that CR2/CR3 domain of TER is accessible in vitro and in vivo and could serve as an optimal site for oligonucleotide-based telomerase silencing.

  10. Bolaamphiphile-based nanocomplex delivery of phosphorothioate gapmer antisense oligonucleotides as a treatment for Clostridium difficile.

    Science.gov (United States)

    Hegarty, John P; Krzeminski, Jacek; Sharma, Arun K; Guzman-Villanueva, Diana; Weissig, Volkmar; Stewart, David B

    2016-01-01

    Despite being a conceptually appealing alternative to conventional antibiotics, a major challenge toward the successful implementation of antisense treatments for bacterial infections is the development of efficient oligonucleotide delivery systems. Cationic vesicles (bolasomes) composed of dequalinium chloride ("DQAsomes") have been used to deliver plasmid DNA across the cardiolipin-rich inner membrane of mitochondria. As cardiolipin is also a component of many bacterial membranes, we investigated the application of cationic bolasomes to bacteria as an oligonucleotide delivery system. Antisense sequences designed in silico to target the expression of essential genes of the bacterial pathogen, Clostridium difficile, were synthesized as 2'-O-methyl phosphorothioate gapmer antisense oligonucleotides (ASO). These antisense gapmers were quantitatively assessed for their ability to block mRNA translation using luciferase reporter and C. difficile protein expression plasmid constructs in a coupled transcription-translation system. Cationic bolaamphiphile compounds (dequalinium derivatives) of varying alkyl chain length were synthesized and bolasomes were prepared via probe sonication of an aqueous suspension. Bolasomes were characterized by particle size distribution, zeta potential, and binding capacities for anionic oligonucleotide. Bolasomes and antisense gapmers were combined to form antisense nanocomplexes. Anaerobic C. difficile log phase cultures were treated with serial doses of gapmer nanocomplexes or equivalent amounts of empty bolasomes for 24 hours. Antisense gapmers for four gene targets achieved nanomolar minimum inhibitory concentrations for C. difficile, with the lowest values observed for oligonucleotides targeting polymerase genes rpoB and dnaE. No inhibition of bacterial growth was observed from treatments at matched dosages of scrambled gapmer nanocomplexes or plain, oligonucleotide-free bolasomes compared to untreated control cultures. We describe

  11. Acute kidney injury during therapy with an antisense oligonucleotide directed against PCSK9.

    Science.gov (United States)

    van Poelgeest, Eveline P; Swart, Reinout M; Betjes, Michiel G H; Moerland, Matthijs; Weening, Jan J; Tessier, Yann; Hodges, Michael R; Levin, Arthur A; Burggraaf, Jacobus

    2013-10-01

    Antisense oligonucleotides have been explored widely in clinical trials and generally are considered to be nontoxic for the kidney, even at high concentrations. We report a case of toxic acute tubular injury in a healthy 56-year-old female volunteer after a pharmacologically active dose of a locked nucleic acid antisense oligonucleotide was administered. The patient received 3 weekly subcutaneous doses of experimental drug SPC5001, an antisense oligonucleotide directed against PCSK9 (proprotein convertase subtilisin/kexin type 9) that is under investigation as an agent to reduce low-density lipoprotein cholesterol levels. Five days after the last dose, the patient's serum creatinine level increased from 0.81 mg/dL at baseline (corresponding to an estimated glomerular filtration rate [eGFR] of 78 mL/min/1.73 m(2)) to 2.67 mg/dL (eGFR, 20 mL/min/1.73 m(2)), and this increase coincided with the presence of white blood cells, granular casts, and minimal hematuria on urine microscopy. The patient's serum creatinine level peaked at 3.81 mg/dL (eGFR, 13 mL/min/1.73 m(2)) 1 week after the last oligonucleotide dose. Kidney biopsy showed multifocal tubular necrosis and signs of oligonucleotide accumulation. Upon conservative treatment, the patient's serum creatinine level gradually decreased and reached her baseline level 44 days after the last oligonucleotide was administered. The patient recovered fully and kidney function was normal at every follow-up visit. Copyright © 2013 National Kidney Foundation, Inc. Published by Elsevier Inc. All rights reserved.

  12. Proficiency of acceptor-donor-acceptor organic dye with spiro-MeOTAD HTM on the photovoltaic performance of dye sensitized solar cell

    Science.gov (United States)

    Ramavenkateswari, K.; Venkatachalam, P.

    2016-09-01

    This work investigates the proficiency of acceptor-donor-acceptor (A-D-A) organic dye Diisopropyl azodicarboxylate (DIAC) as photosensitizer on the photovoltaic parameters of silver (Ag) doped TiO2 photoanode dye-sensitized solar cells (DSSCs) with quasi-solid state electrolyte/hole transport material (HTM) spiro-MeOTAD. TNSs (TiO2 nanosticks) photoanodes are prepared through sol-gel method and hydrothermal technique. X-ray powder diffraction (XRD), transmission electron microscope (TEM), scanning electron microscopy (SEM) and BET measurement were used to characterize the structure and morphology of TiO2 nanostructures. The Diisopropyl azodicarboxylate organic dye with TNPs-Ag@TNSs composite photoanode structure and spiro-MeOTAD HTM exhibited better power conversion efficiency (PCE).

  13. Use of thiolated oligonucleotides as anti-fouling diluents in electrochemical peptide-based sensors.

    Science.gov (United States)

    McQuistan, Adam; Zaitouna, Anita J; Echeverria, Elena; Lai, Rebecca Y

    2014-05-11

    We incorporated short thiolated oligonucleotides as passivating diluents in the fabrication of electrochemical peptide-based (E-PB) sensors, with the goal of creating a negatively charged layer capable of resisting non-specific adsorption of matrix contaminants. The E-PB HIV sensors fabricated using these diluents were found to be more specific and selective, while retaining attributes similar to the sensor fabricated without these diluents. Overall, these results highlight the advantages of using oligonucleotides as anti-fouling diluents in self-assembled monolayer-based sensors.

  14. Oligonucleotide-templated chemical reactions: pushing the boundaries of a nature-inspired process.

    Science.gov (United States)

    Percivalle, Claudia; Bartolo, Jean-François; Ladame, Sylvain

    2013-01-07

    Widespread in nature, oligonucleotide-templated reactions of phosphodiester bond formation have inspired chemists who are now applying this elegant strategy to the catalysis of a broad range of otherwise inefficient reactions. This review highlights the increasing diversity of chemical reactions that can be efficiently catalysed by an oligonucleotide template, using Watson-Crick base-pairing to bring both reagents in close enough proximity to react, thus increasing significantly their effective molarity. The applications of this elegant concept for nucleic acid sensing and controlled organic synthesis will also be discussed.

  15. Transcriptional inhibition of the bacteriophage T7 early promoter region by oligonucleotide triple helix formation.

    Science.gov (United States)

    Ross, C; Samuel, M; Broitman, S L

    1992-12-30

    We have identified a purine-rich triplex binding sequence overlapping a -35 transcriptional early promoter region of the bacteriophage T7. Triplex-forming oligonucleotide designed to bind this target was annealed to T7 templates and introduced into in vitro transcription systems under conditions favoring specific initiation from this promoter. These templates demonstrated significant transcriptional inhibition relative to naked genomic templates and templates mixed with non-triplex-forming oligonucleotide. It is suggested that triplex formation along this target interferes with transcriptional initiation, and this mechanism may hold potential to disrupt bacteriophage T7 early transcription in vivo.

  16. Identifying members of the domain Archaea with rRNA-targeted oligonucleotide probes.

    Science.gov (United States)

    Burggraf, S; Mayer, T; Amann, R; Schadhauser, S; Woese, C R; Stetter, K O

    1994-09-01

    Two 16S rRNA-targeted oligonucleotide probes were designed for the archaeal kingdoms Euryachaeota and Crenarchaeota. Probe specificities were evaluated by nonradioactive dot blot hybridization against selected reference organisms. The successful application of fluorescent-probe derivatives for whole-cell hybridization required organism-specific optimizations of fixation and hybridization conditions to assure probe penetration and morphological integrity of the cells. The probes allowed preliminary grouping of three new hyperthermophilic isolates. Together with other group-specific rRNA-targeted oligonucleotide probes, these probes will facilitate rapid in situ monitoring of the populations present in hydrothermal systems and support cultivation attempts.

  17. Customized oligonucleotide microchips that convert multiple genetic information to simple patterns, are portable and reusable

    Science.gov (United States)

    Mirzabekov, Andrei; Guschin, Dmitry Y.; Chik, Valentine; Drobyshev, Aleksei; Fotin, Alexander; Yershov, Gennadiy; Lysov, Yuri

    2002-01-01

    This invention relates to using customized oligonucleotide microchips as biosensors for the detection and identification of nucleic acids specific for different genes, organisms and/or individuals in the environment, in food and in biological samples. The microchips are designed to convert multiple bits of genetic information into simpler patterns of signals that are interpreted as a unit. Because of an improved method of hybridizing oligonucleotides from samples to microchips, microchips are reusable and transportable. For field study, portable laser or bar code scanners are suitable.

  18. Sequence selective naked-eye detection of DNA harnessing extension of oligonucleotide-modified nucleotides.

    Science.gov (United States)

    Verga, Daniela; Welter, Moritz; Marx, Andreas

    2016-02-01

    DNA polymerases can efficiently and sequence selectively incorporate oligonucleotide (ODN)-modified nucleotides and the incorporated oligonucleotide strand can be employed as primer in rolling circle amplification (RCA). The effective amplification of the DNA primer by Φ29 DNA polymerase allows the sequence-selective hybridisation of the amplified strand with a G-quadruplex DNA sequence that has horse radish peroxidase-like activity. Based on these findings we develop a system that allows DNA detection with single-base resolution by naked eye.

  19. An alpha-glucose-1-phosphate phosphodiesterase is present in rat liver cytosol

    Energy Technology Data Exchange (ETDEWEB)

    Srisomsap, C.; Richardson, K.L.; Jay, J.C.; Marchase, R.B. (Univ. of Alabama, Birmingham (USA))

    1989-12-05

    UDP-glucose:glycoprotein glucose-1-phosphotransferase (Glc-phosphotransferase) catalyzes the transfer of alpha-Glc-1-P from UDP-Glc to mannose residues on acceptor glycoproteins. The predominant acceptor for this transfer in both mammalian cells and Paramecium is a cytoplasmic glycoprotein of 62-63 kDa. When cytoplasmic proteins from rat liver were fractionated by preparative isoelectric focusing following incubation of a liver homogenate with the 35S-labeled phosphorothioate analogue of UDP-Glc ((beta-35S)UDP-Glc), the acceptor was found to have a pI of about 6.0. This fraction, when not labeled prior to the focusing, became very heavily labeled when mixed with (beta-35S). UDP-Glc and intact liver microsomes, a rich source of the Glc-phosphotransferase. In addition, it was observed that the isoelectric fractions of the cytosol having pI values of 2-3.2 contained a degradative activity, alpha-Glc-1-P phosphodiesterase, that was capable of removing alpha-Glc-1-P, monitored through radioactive labeling both in the sugar and the phosphate, as an intact unit from the 62-kDa acceptor. Identification of the product of this cleavage was substantiated by its partial transformation to UDP-Glc in the presence of UTP and UDP-Glc pyrophosphorylase. The alpha-Glc-1-P phosphodiesterase had a pH optimum of 7.5 and was not effectively inhibited by any of the potential biochemical inhibitors that were tested. Specificity for the Glc-alpha-1-P-6-Man diester was suggested by the diesterase's inability to degrade UDP-Glc or glucosylphosphoryldolichol. This enzyme may be important in the regulation of secretion since the alpha-Glc-1-P present on the 62-kDa phosphoglycoprotein appears to be removed and then rapidly replaced in response to secretagogue.

  20. [Phosphate metabolism and iron deficiency].

    Science.gov (United States)

    Yokoyama, Keitaro

    2016-02-01

    Autosomal dominant hypophosphatemic rickets(ADHR)is caused by gain-of-function mutations in FGF23 that prevent its proteolytic cleavage. Fibroblast growth factor 23(FGF23)is a hormone that inhibits renal phosphate reabsorption and 1,25-dihydroxyvitamin D biosynthesis. Low iron status plays a role in the pathophysiology of ADHR. Iron deficiency is an environmental trigger that stimulates FGF23 expression and hypophosphatemia in ADHR. It was reported that FGF23 elevation in patients with CKD, who are often iron deficient. In patients with nondialysis-dependent CKD, treatment with ferric citrate hydrate resulted in significant reductions in serum phosphate and FGF23.

  1. Neutralization and bonding mechanisms of shallow acceptors at grain boundaries in polycrystalline silicon

    Energy Technology Data Exchange (ETDEWEB)

    Kazmerski, L.L.; Nelson, A.J.; Dhere, R.G.; Yahia, A.; Abou-Elfotouh, F.

    1988-05-01

    Interactions between shallow acceptors (B, Al, Ga, and In) and hydrogen in polycrystalline Si are investigated. The bonding mechanisms involved in the acceptor neutralization process at grain boundaries are examined using microanalytical techniques. Differences in the incorporation of molecular and atomic hydrogen, and corresponding variations in electrical passivation at grain boundaries, are observed. Low-temperature Auger difference spectroscopy confirms Si--H bonding to dominate B, Ga, and In-doped cases, with no direct acceptor--hydrogen bonding. Al-rich grain boundaries show H-complex and hydroxyl bonding. The data confirm chemical bond strength trends with B

  2. Molecular nitrogen acceptors in ZnO nanowires induced by nitrogen plasma annealing

    Science.gov (United States)

    Ton-That, C.; Zhu, L.; Lockrey, M. N.; Phillips, M. R.; Cowie, B. C. C.; Tadich, A.; Thomsen, L.; Khachadorian, S.; Schlichting, S.; Jankowski, N.; Hoffmann, A.

    2015-07-01

    X-ray absorption near-edge spectroscopy, photoluminescence, cathodoluminescence, and Raman spectroscopy have been used to investigate the chemical states of nitrogen dopants in ZnO nanowires. It is found that nitrogen exists in multiple states: NO,NZn, and loosely bound N2 molecule. The results establish a direct link between a donor-acceptor pair emission at 3.232 eV and the concentration of loosely bound N2. This work confirms that N2 at Zn site is a potential candidate for producing a shallow acceptor state in N-doped ZnO as theoretically predicted by Lambrecht and Boonchun [Phys. Rev. B 87, 195207 (2013), 10.1103/PhysRevB.87.195207]. Additionally, shallow acceptor states arising from NO complexes have been ruled out in this paper.

  3. Photoinduced Electron Transfer within Supramolecular Donor-Acceptor Peptide Nanostructures under Aqueous Conditions.

    Science.gov (United States)

    Sanders, Allix M; Magnanelli, Timothy J; Bragg, Arthur E; Tovar, John D

    2016-03-16

    We report the synthesis, self-assembly, and electron transfer capabilities of peptide-based electron donor-acceptor molecules and supramolecular nanostructures. These modified peptides contain π-conjugated oligothiophene electron donor cores that are peripherally substituted with naphthalene diimide electron acceptors installed via imidation of site-specific lysine residues. These molecules self-assemble into one-dimensional nanostructures in aqueous media, as shown through steady-state absorption, photoluminescence, and circular dichroism spectra, as well as transmission electron microscopy. Excitation of the oligothiophene donor moieties results in electron transfer to the acceptor units, ultimately creating polar, charge-separated states that persist for over a nanosecond as observed with transient absorption spectroscopy. This study demonstrates how transient electric fields can be engineered into aqueous nanomaterials of biomedical relevance through external, temporally controlled photonic inputs.

  4. Electroluminescence from charge transfer states in Donor/Acceptor solar cells

    DEFF Research Database (Denmark)

    Sherafatipour, Golenaz; Madsen, Morten

    charge transfer (CT) excitons, which is Coulombically bound interfacial electron- hole pairs residing at the donor/acceptor heterojunctions. The CT state represents an intermediate state between the exciton dissociation and recombination back to the ground state. Since the recombination of photo...... at the donor/acceptor interface is detected. As a less studied system, we examine here the interfacial charge transfer state recombination in DBP:C70 thin-films. The weak EL from the small molecule solar cell biased in the forward direction gives valuable information about the CT state recombination, from...... which the maximum open-circuit voltage can be estimated, and further can be used in the modeling and optimization of the OPV devices. [1] C. Deibe, T. Strobe, and V. Dyakonov, “Role of the charge transfer state in organic donor-acceptor solar cells,” Adv. Mater., vol. 22, pp. 4097–4111, 2010. [2] K...

  5. Synthesis and characterization of acceptor-substituted oligothiophenes for solar cell applications

    Energy Technology Data Exchange (ETDEWEB)

    Mishra, Amaresh; Reinold, Egon; Baeuerle, Peter [Institute of Organic Chemistry II and Advanced Materials, University of Ulm, Albert-Einstein-Allee 11, 89081 Ulm (Germany); Uhrich, Christian; Pfeiffer, Martin [Heliatek GmbH, Treidlerstr. 3, 01139 Dresden (Germany)

    2011-03-18

    We report the synthesis of novel acceptor-substituted oligothiophenes and their application in m-i-p type planar heterojunction solar cells. Optical absorption spectra and electrochemical properties of the dyes are investigated. The determined energy levels of these dyes suggest that they should be ideal for use in heterojunction solar cells. We further investigate the influence of acceptor groups on the device performance by introducing 1,1-dicyano-2-methyl-vinyl and 1,1-dicyano-2-phenyl-vinyl groups, respectively, as acceptor units. Photovoltaic devices incorporating these dyes show an open circuit voltage of up to 0.96 V and power conversion efficiencies in the range of 1.5-3.0% under full sun illumination (simulated AM 1.5G sunlight, 100 mW cm{sup -2}). (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  6. Effect of cathode electron acceptors on simultaneous anaerobic sulfide and nitrate removal in microbial fuel cell.

    Science.gov (United States)

    Cai, Jing; Zheng, Ping; Mahmood, Qaisar

    2016-01-01

    The current investigation reports the effect of cathode electron acceptors on simultaneous sulfide and nitrate removal in two-chamber microbial fuel cells (MFCs). Potassium permanganate and potassium ferricyanide were common cathode electron acceptors and evaluated for substrate removal and electricity generation. The abiotic MFCs produced electricity through spontaneous electrochemical oxidation of sulfide. In comparison with abiotic MFC, the biotic MFC showed better ability for simultaneous nitrate and sulfide removal along with electricity generation. Keeping external resistance of 1,000 Ω, both MFCs showed good capacities for substrate removal where nitrogen and sulfate were the main end products. The steady voltage with potassium permanganate electrodes was nearly twice that of with potassium ferricyanide. Cyclic voltammetry curves confirmed that the potassium permanganate had higher catalytic activity than potassium ferricyanide. The potassium permanganate may be a suitable choice as cathode electron acceptor for enhanced electricity generation during simultaneous treatment of sulfide and nitrate in MFCs.

  7. Förster Resonance Energy Transfer between Quantum Dot Donors and Quantum Dot Acceptors

    Directory of Open Access Journals (Sweden)

    Kenny F. Chou

    2015-06-01

    Full Text Available Förster (or fluorescence resonance energy transfer amongst semiconductor quantum dots (QDs is reviewed, with particular interest in biosensing applications. The unique optical properties of QDs provide certain advantages and also specific challenges with regards to sensor design, compared to other FRET systems. The brightness and photostability of QDs make them attractive for highly sensitive sensing and long-term, repetitive imaging applications, respectively, but the overlapping donor and acceptor excitation signals that arise when QDs serve as both the donor and acceptor lead to high background signals from direct excitation of the acceptor. The fundamentals of FRET within a nominally homogeneous QD population as well as energy transfer between two distinct colors of QDs are discussed. Examples of successful sensors are highlighted, as is cascading FRET, which can be used for solar harvesting.

  8. External field effects on aging phenomenon of acceptor-doped BaTiO3 ceramics

    Directory of Open Access Journals (Sweden)

    Y. Y. Guo

    2015-09-01

    Full Text Available Our experiments on ferroelectric aging phenomena of a series of acceptor-doped BaTiO3 ceramics demonstrate that after well-aging, all samples show a similar double hysteresis loop under smaller applied electric field, regardless of ionic radius or ionic valence of the acceptor. However, with increasing the applied electric field, the completely constricted loops gradually start to open, indicating the aging effect becomes weak under larger electric field. The unified microscopic mechanism responsible for the similar aging behavior in different acceptor-doped BaTiO3 ceramics may be that the larger field is considered to kinetically facilitate a part of oxygen vacancies short-range hopping. As a result, the defect dipole field provided by oxygen vacancies and the associated defect dipoles frozen in the original states decreases, thus contributing to the weaker aging effect.

  9. FRET study in oligopeptide-linked donor–acceptor system in PVA matrix

    Science.gov (United States)

    Shah, Sunil; Mandecki, Wlodek; Li, Ji; Gryczynski, Zygmunt; Borejdo, Julian; Gryczynski, Ignacy; Fudala, Rafal

    2016-12-01

    An oligopeptide: Lys-Gly-Pro-Arg-Ser-Leu-Ser-Gly-Lys-NH2, cleaved specifically by a matrix metalloproteinase 9 (MMP-9) at the Ser-Leu bond, was labeled on the ε-NH2 groups of lysine with donor (5, 6 TAMRA) and acceptor (HiLyte647) dye. The donor control was a peptide labeled with 5, 6 TAMRA only on the C-terminal lysine, and the acceptor control was free HiLyte647. Following three products were studied by dissolving in 10% (w/w) poly(vinyl alcohol) and dried on glass slides forming 200 micron films. Absorption spectra of the films show full additivity of donor and acceptor absorptions. A strong Fluorescence Resonance Energy Transfer (FRET) with an efficiency of about 85% was observed in the fluorescence emission and excitation spectra. The lifetime of the donor was shorter and heterogeneous compared with the donor control.

  10. Rational design of two-dimensional molecular donor-acceptor nanostructure arrays

    Science.gov (United States)

    Zhang, Jia Lin; Zhong, Shu; Zhong, Jian Qiang; Niu, Tian Chao; Hu, Wen Ping; Wee, Andrew Thye Shen; Chen, Wei

    2015-02-01

    The construction of long-range ordered organic donor-acceptor nanostructure arrays over microscopic areas supported on solid substrates is one of the most challenging tasks towards the realization of molecular nanodevices. They can also be used as ideal model systems to understand light induced charge transfer, charge separation and energy conversion processes and mechanisms at the nanometer scale. The aim of this paper is to highlight recent advances and progress in this topic. Special attention is given to two different strategies for the construction of organic donor-acceptor nanostructure arrays, namely (i) molecular self-assembly on artificially patterned or pre-defined molecular surface nanotemplates and (ii) molecular nanostructure formation steered via directional and selective intermolecular interactions. The interfacial charge transfer and the energy level alignment of these donor-acceptor nanostructures are also discussed.

  11. Identification of Ag-acceptor related photoluminescence in $^{111}\\!$Ag doped CdTe

    CERN Document Server

    Hamann, J; Deicher, M; Filz, T; Ostheimer, V; Schmitz, C; Wolf, H; Wichert, T

    1998-01-01

    Bridgman-grown, nominally undoped CdTe crystals were doped with Ag by implanting radioactive $^{111}\\!$Ag. Photoluminescence spectra of the crystals show a donor-acceptor pair (DAP) line at 1.491 eV. The decrease of the intensity of this line with a half life of T$_{1/2}$=(7.2$\\pm$0.4) d is in good agreement with the half life of the $\\beta\\!^{-}$-decay of $^{111}\\!$Ag to $^{111}\\!$Cd of 7.45 d. This decrease is not caused by the aging behavior of Ag which was reported in the literature. The data show that the involved acceptor defect contains exactly one Ag atom and confirm the earlier assignment of the acceptor to the AgCd defect. Based on the DAP line at 1.491 eV, the spectra did not reveal a contamination of the CdTe crystals by stable Ag.

  12. Double acceptor in p-type GaAsN grown by chemical beam epitaxy

    Science.gov (United States)

    Elleuch, Omar; Wang, Li; Lee, Kan-Hua; Ikeda, Kazuma; Kojima, Nobuaki; Ohshita, Yoshio; Yamaguchi, Masafumi

    2015-12-01

    The properties of the acceptor states in GaAsN grown by chemical beam epitaxy (CBE) are studied by analyzing their charges based on the Poole-Frenkel model. Deep level transient spectroscopy (DLTS) shows two acceptor levels at 0.11 and 0.19 eV above the valence band maximum. The emission rates of carriers from these states are enhanced with increasing the electric field during the DLTS measurement, which indicates that the energies required for the emission are decreased. By analyzing this field-enhanced emission process, the polarizabilities of the levels at 0.11 and 0.19 eV are found to be -1 (±0.1) and -2 (±0.1), respectively. In addition, these states have almost the same concentration. Therefore, we conclude that they originate from the same defect, acting as a double acceptor in GaAsN film grown by CBE.

  13. Rapid Energy Transfer Enabling Control of Emission Polarization in Perylene Bisimide Donor-Acceptor Triads.

    Science.gov (United States)

    Menelaou, Christopher; ter Schiphorst, Jeroen; Kendhale, Amol M; Parkinson, Patrick; Debije, Michael G; Schenning, Albertus P H J; Herz, Laura M

    2015-04-02

    Materials showing rapid intramolecular energy transfer and polarization switching are of interest for both their fundamental photophysics and potential for use in real-world applications. Here, we report two donor-acceptor-donor triad dyes based on perylene-bisimide subunits, with the long axis of the donors arranged either parallel or perpendicular to that of the central acceptor. We observe rapid energy transfer (energy transfer rate for the linearly arranged triad but severely underestimates it for the orthogonal case. We show that the rapid energy transfer arises from a combination of through-bond coupling and through-space transfer between donor and acceptor units. As they allow energy cascading to an excited state with controllable polarization, these triad dyes show high potential for use in luminescent solar concentrator devices.

  14. Ultrafast Non-Förster Intramolecular Donor-Acceptor Excitation Energy Transfer.

    Science.gov (United States)

    Athanasopoulos, Stavros; Alfonso Hernandez, Laura; Beljonne, David; Fernandez-Alberti, Sebastian; Tretiak, Sergei

    2017-04-06

    Ultrafast intramolecular electronic energy transfer in a conjugated donor-acceptor system is simulated using nonadiabatic excited-state molecular dynamics. After initial site-selective photoexcitation of the donor, transition density localization is monitored throughout the S2 → S1 internal conversion process, revealing an efficient unidirectional donor → acceptor energy-transfer process. Detailed analysis of the excited-state trajectories uncovers several salient features of the energy-transfer dynamics. While a weak temperature dependence is observed during the entire electronic energy relaxation, an ultrafast initially temperature-independent process allows the molecular system to approach the S2-S1 potential energy crossing seam within the first ten femtoseconds. Efficient energy transfer occurs in the absence of spectral overlap between the donor and acceptor units and is assisted by a transient delocalization phenomenon of the excited-state wave function acquiring Frenkel-exciton character at the moment of quantum transition.

  15. Pyridoxal-5'-phosphate-dependent catalytic antibodies.

    Science.gov (United States)

    Gramatikova, Svetlana; Mouratou, Barbara; Stetefeld, Jörg; Mehta, Perdeep K; Christen, Philipp

    2002-11-01

    Strategies for expanding the catalytic scope of antibodies include the incorporation of inorganic or organic cofactors into their binding sites. An obvious choice is pyridoxal-5'-phosphate (PLP), which is probably the most versatile organic cofactor of enzymes. Monoclonal antibodies against the hapten N(alpha)-(5'-phosphopyridoxyl)-L-lysine, a stable analog of the covalent coenzyme-substrate adducts were screened by a competition ELISA for binding of the PLP-amino acid Schiff base adduct. The Schiff base with its C4'-N alpha double bond is, in contrast to the hapten, a planar compound and is an obligatory intermediate in all PLP-dependent reactions of amino acids. This highly discriminating screening step eliminated all but 5 of 24 hapten-binding antibodies. The five remaining antibodies were tested for catalysis of the PLP-dependent alpha,beta-elimination reaction of beta-chloroalanine. Antibody 15A9 complied with this selection criterion and catalyzed in addition the cofactor-dependent transamination reaction of hydrophobic D-amino acids and oxo acids (k(cat)'=0.42 min(-1) with D-alanine at 25 degrees C). Homology modeling together with alanine scanning yielded a 3D model of Fab 15A9. The striking analogy between antibody 15A9 and PLP-dependent enzymes includes the following features: (1) The binding sites accommodate the planar coenzyme-amino acid adduct. (2) The bond at C alpha to be broken lies together with the C alpha-N bond in a plane orthogonal to the plane of coenzyme and imine bond. (3) The alpha-carboxylate group of the substrate is bound by an arginine residue. (4) The coenzyme-substrate adduct assumes a cisoid conformation. (5) PLP markedly contributes to catalytic efficiency, being a 10(4) times more efficient amino group acceptor than pyruvate. The protein moiety, however, ensures reaction as well as substrate specificity, and further accelerates the reaction (in 15A9 k(cat (Ab x PLP))'/k(cat (PLP))'=5 x 10(3)). The analogies of antibody 15A9 with

  16. Synthesis, Dynamic Combinatorial Chemistry, and PCR Amplification of 3'-5' and 3'-6' Disulfide-linked Oligonucleotides

    DEFF Research Database (Denmark)

    Hansen, Dennis Jul; Manuguerra, Ilenia; Kjelstrup, Michael Brøndum;

    2014-01-01

    Disulfide dithymidines linked 3'-5' or 3'-6' were synthesized and incorporated into oligonucleotides through a combined phosphotriester and phosphoramidite solid-phase oligonucleotide synthesis approach. The disulfide links are cleaved and formed reversibly in the presence of thiols and oligonucl...

  17. Studies on the Syntheses and Properties of 5'-Branched-sugar Isonucleosides and the Related Oligonucleotides

    Institute of Scientific and Technical Information of China (English)

    TianXiaobing; ZhangLihe; MinJimei

    2001-01-01

    The chemistry of nucleosides and oligonucleotides is an actively investigated field in the search for new drugs. Thesyntheses and the properties of isonucleosides and oligonucleotides have been investigated to improve their stability,antitumor and antiviral activities, and to reduce their toxicity.

  18. Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

    Science.gov (United States)

    Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

    2017-04-05

    Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

  19. Characterization of phosphorus removal bacteria in (AO)2 SBR system by using different electron acceptors

    Institute of Scientific and Technical Information of China (English)

    JIANG Yi-feng; WANG Lin; YU Ying; WANG Bao-zhen; LIU Shuo; SHEN Zheng

    2007-01-01

    Characteristics of phosphorus removal bacteria were investigated by using three different types of electron acceptors, as well as the positive role of nitrite in phosphorus removal process. An (AO)2 SBR (anaerobic-aerobic-anoxic-aerobic sequencing batch reactor) was thereby employed to enrich denitrifying phosphorus removal bacteria for simultaneously removing phosphorus and nitrogen via anoxic phosphorus uptake. Ammonium oxidation was controlled at the first phase of the nitrification process. Nitrite-inhibition batch tests illustrated that nitrite was not an inhibitor to phosphorus uptake process, but served as an alternative electron acceptor to nitrate and oxygen if the concentration was under the inhibition level of 40mg NO2 - N · L- 1. It implied that in addition to the two well-accepted groups of phosphorus removal bacterium ( one can only utilize oxygen as electron acceptor, P1, while the other can use both oxygen and nitrate as electron acceptor, P2 ), a new group of phosphorus removal bacterium P3, which could use oxygen, nitrate and nitrite as electron acceptor to take up phosphorus were identified in the test system. To understand (AO)2 SBR sludge better, the relative population of the different bacteria in this system, plus another A/O SBR sludge (seed sludge) were respectively estimated by the phosphorus uptake batch tests with either oxygen or nitrate or nitrite as electron acceptor. The results demonstrated that phosphorus removal capability of (AO)2 SBR sludge had a little degradation after A/O sludge was cultivated in the (AO)2 mode over a long period of time. However, denitrifying phosphorus removal bacteria ( P2 and P3 ) was significantly enriched showed by the relative population of the three types of bacteria,which implied that energy for aeration and COD consumption could be reduced in theory.

  20. Local Intermolecular Order Controls Photoinduced Charge Separation at Donor/Acceptor Interfaces in Organic Semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Feier, Hilary M.; Reid, Obadiah G.; Pace, Natalie A.; Park, Jaehong; Bergkamp, Jesse J.; Sellinger, Alan; Gust, Devens; Rumbles, Garry

    2016-03-23

    How free charge is generated at organic donor-acceptor interfaces is an important question, as the binding energy of the lowest energy (localized) charge transfer states should be too high for the electron and hole to escape each other. Recently, it has been proposed that delocalization of the electronic states participating in charge transfer is crucial, and aggregated or otherwise locally ordered structures of the donor or the acceptor are the precondition for this electronic characteristic. The effect of intermolecular aggregation of both the polymer donor and fullerene acceptor on charge separation is studied. In the first case, the dilute electron acceptor triethylsilylhydroxy-1,4,8,11,15,18,22,25-octabutoxyphthalocyaninatosilicon(IV) (SiPc) is used to eliminate the influence of acceptor aggregation, and control polymer order through side-chain regioregularity, comparing charge generation in 96% regioregular (RR-) poly(3-hexylthiophene) (P3HT) with its regiorandom (RRa-) counterpart. In the second case, ordered phases in the polymer are eliminated by using RRa-P3HT, and phenyl-C61-butyric acid methyl ester (PC61BM) is used as the acceptor, varying its concentration to control aggregation. Time-resolved microwave conductivity, time-resolved photoluminescence, and transient absorption spectroscopy measurements show that while ultrafast charge transfer occurs in all samples, long-lived charge carriers are only produced in films with intermolecular aggregates of either RR-P3HT or PC61BM, and that polymer aggregates are just as effective in this regard as those of fullerenes.

  1. Novel benzodithiophene-based polymer acceptors for efficient organic solar cells.

    Science.gov (United States)

    Wang, Yan-Ling; Li, Quan-Song; Li, Ze-Sheng

    2017-08-30

    All polymer organic solar cells afford unique potentials due to the tunable chemical and electronic properties of both polymer donors and polymer acceptors. Compared with the rapid development of polymer donors, the development of polymer acceptors lags far behind. To seek high-performance polymer acceptors used in organic solar cells, based on the experimentally reported D-A polymer acceptor (NDI2OD-T2)n (P1), a series of novel acceptors, designated as (BDTNDI2OD-T2)n(P2), (BDTNDTI)n(P3), (BDTNDI2OD-Tz2)n(P4), and (BDTNDTzI)n(P5), were designed by introduction of a benzodithiophene (BDT) unit and the nitrogen atom in the bridged thiophene ring. The density functional theory (DFT) and time-dependent density functional theory (TDDFT) methods were applied to study the effect of the BDT unit and the nitrogen atom on the geometrical, optical, electronic, and charge transport properties. The obtained results show that incorporation of the electron-donating BDT unit into P1 and the replacement of a carbon atom by the nitrogen atom in the bridged thiophene ring are effective strategies to lower the lowest unoccupied molecular orbital (LUMO) energy and exciton binding energy, and enhance light-absorbing capacity and electron mobility. Moreover, among the investigated molecules, P2 and P5 exhibit stronger and broader light absorption, higher light absorption efficiency and exciton separation ability as well as electron mobility; therefore they are recommended as promising polymer acceptors for future high-efficiency organic solar cells.

  2. Differences in gene expression of human xylosyltransferases and determination of acceptor specificities for various proteoglycans

    Energy Technology Data Exchange (ETDEWEB)

    Roch, Christina; Kuhn, Joachim; Kleesiek, Knut [Institut fuer Laboratoriums- und Transfusionsmedizin, Herz- und Diabeteszentrum NRW, Universitaetsklinik der Ruhr-Universitaet Bochum, 32545 Bad Oeynhausen (Germany); Goetting, Christian, E-mail: cgoetting@hdz-nrw.de [Institut fuer Laboratoriums- und Transfusionsmedizin, Herz- und Diabeteszentrum NRW, Universitaetsklinik der Ruhr-Universitaet Bochum, 32545 Bad Oeynhausen (Germany)

    2010-01-01

    The xylosyltransferase (XT) isoforms XT-I and XT-II initiate the posttranslational glycosaminoglycan (GAG) synthesis. Here, we determined the relative expression of both isoforms in 33 human cell lines. The majority of tested cell lines showed dominant XYLT2 gene expression, while only in 23132/87, JAR, NCI-H510A and THP-1 was the XT-I mRNA expression higher. Nearly equal expression levels were detected in six cell lines. Additionally, to shed light on putative differences in acceptor specificities the acceptor properties of potential acceptor sequences were determined. Peptides were expressed as glutathione-S-transferase fusion proteins containing putative or known GAG attachment sites of in vivo proteoglycans. Kinetic analysis showed that K{sub m} and V{sub max} values for XT-I mediated xylosylation were slightly higher than those for XT-II, and that XT-I showed a lesser stringency concerning the acceptor sequence. Mutagenesis of the bikunin peptide sequence in the G-S-G attachment site and flanking regions generated potential acceptor molecules. Here, mutations on the N-terminal side and the attachment site were found to be more susceptible to a loss of acceptor function than mutations in the C-terminus. Altogether the known consensus sequence a-a-a-a-G-S-G-a-a/G-a ('a' representing Asp or Glu) for XT-I mediated xylosylation could be approved and additionally extended to apply to XT-II as well.

  3. Threshold-like complexation of conjugated polymers with small molecule acceptors in solution within the neighbor-effect model.

    Science.gov (United States)

    Sosorev, Andrey Yu; Parashchuk, Olga D; Zapunidi, Sergey A; Kashtanov, Grigoriy S; Golovnin, Ilya V; Kommanaboyina, Srikanth; Perepichka, Igor F; Paraschuk, Dmitry Yu

    2016-02-14

    In some donor-acceptor blends based on conjugated polymers, a pronounced charge-transfer complex (CTC) forms in the electronic ground state. In contrast to small-molecule donor-acceptor blends, the CTC concentration in polymer:acceptor solution can increase with the acceptor content in a threshold-like way. This threshold-like behavior was earlier attributed to the neighbor effect (NE) in the polymer complexation, i.e., next CTCs are preferentially formed near the existing ones; however, the NE origin is unknown. To address the factors affecting the NE, we record the optical absorption data for blends of the most studied conjugated polymers, poly(2-methoxy-5-(2-ethylhexyloxy)-1,4-phenylenevinylene) (MEH-PPV) and poly(3-hexylthiophene) (P3HT), with electron acceptors of fluorene series, 1,8-dinitro-9,10-antraquinone (), and 7,7,8,8-tetracyanoquinodimethane () in different solvents, and then analyze the data within the NE model. We have found that the NE depends on the polymer and acceptor molecular skeletons and solvent, while it does not depend on the acceptor electron affinity and polymer concentration. We conclude that the NE operates within a single macromolecule and stems from planarization of the polymer chain involved in the CTC with an acceptor molecule; as a result, the probability of further complexation with the next acceptor molecules at the adjacent repeat units increases. The steric and electronic microscopic mechanisms of NE are discussed.

  4. Receptor-mediated hepatic uptake of M6P-BSA-conjugated triplex-forming oligonucleotides in rats.

    Science.gov (United States)

    Ye, Zhaoyang; Cheng, Kun; Guntaka, Ramareddy V; Mahato, Ram I

    2006-01-01

    Excessive production of extracellular matrix, predominantly type I collagen, results in liver fibrosis. Earlier we synthesized mannose 6-phosphate-bovine serum albumin (M6P-BSA) and conjugated to the type I collagen specific triplex-forming oligonucleotide (TFO) for its enhanced delivery to hepatic stellate cells (HSCs), which is the principal liver fibrogenic cell. In this report, we demonstrate a time-dependent cellular uptake of M6P-BSA-33P-TFO by HSC-T6 cells. Both cellular uptake and nuclear deposition of M6P-BSA-33P-TFO were significantly higher than those of 33P-TFO, leading to enhanced inhibition of type I collagen transcription. Following systemic administration into rats, hepatic accumulation of M6P-BSA-33P-TFO increased from 55% to 68% with the number of M6P per BSA from 14 to 27. Unlike 33P-TFO, there was no significant decrease in the hepatic uptake of (M6P)20-BSA-33P-TFO in fibrotic rats. Prior administration of excess M6P-BSA decreased the hepatic uptake of (M6P)20-BSA-33P-TFO from 66% to 40% in normal rats, and from 60% to 15% in fibrotic rats, suggesting M6P/insulin-like growth factor II (M6P/IGF II) receptor-mediated endocytosis of M6P-BSA-33P-TFO by HSCs. Almost 82% of the total liver uptake in fibrotic rats was contributed by HSCs. In conclusion, by conjugation with M6P-BSA, the TFO could be potentially used for the treatment of liver fibrosis.

  5. Photorelease of phosphates: Mild methods for protecting phosphate derivatives

    Directory of Open Access Journals (Sweden)

    Sanjeewa N. Senadheera

    2014-08-01

    Full Text Available We have developed a new photoremovable protecting group for caging phosphates in the near UV. Diethyl 2-(4-hydroxy-1-naphthyl-2-oxoethyl phosphate (14a quantitatively releases diethyl phosphate upon irradiation in aq MeOH or aq MeCN at 350 nm, with quantum efficiencies ranging from 0.021 to 0.067 depending on the solvent composition. The deprotection reactions originate from the triplet excited state, are robust under ambient conditions and can be carried on to 100% conversion. Similar results were found with diethyl 2-(4-methoxy-1-naphthyl-2-oxoethyl phosphate (14b, although it was significantly less efficient compared with 14a. A key step in the deprotection reaction in aq MeOH is considered to be a Favorskii rearrangement of the naphthyl ketone motif of 14a,b to naphthylacetate esters 25 and 26. Disruption of the ketone-naphthyl ring conjugation significantly shifts the photoproduct absorption away from the effective incident wavelength for decaging of 14, driving the reaction to completion. The Favorskii rearrangement does not occur in aqueous acetonitrile although diethyl phosphate is released. Other substitution patterns on the naphthyl or quinolin-5-yl core, such as the 2,6-naphthyl 10 or 8-benzyloxyquinolin-5-yl 24 platforms, also do not rearrange by aryl migration upon photolysis and, therefore, do not proceed to completion. The 2,6-naphthyl ketone platform instead remains intact whereas the quinolin-5-yl ketone fragments to a much more complex, highly absorbing reaction mixture that competes for the incident light.

  6. Phosphorus release from phosphate rock and iron phosphate by low-molecular-weight organic acids

    Institute of Scientific and Technical Information of China (English)

    XU Ren-kou; ZHU Yong-guan; David Chittleborough

    2004-01-01

    Low-molecular-weight(LMW) organic acids widely exist in soils, particularly in the rhizosphere. A series of batch experiments were carried out to investigate the phosphorus release from rock phosphate and iron phosphate by Iow-molecular-weight organic acids.Results showed that citric acid had the highest capacity to solubilize P from both rock and iron phosphate. P solubilization from rock phosphate and iron phosphate resulted in net proton consumption. P release from rock phosphate was positively correlated with the pKa values. P release from iron phosphate was positively correlated with Fe-organic acid stability constants except for aromatic acids, but was not correlated with PKa. Increase in the concentrations of organic acids enhanced P solubilization from both rock and iron phosphate almost linearrly. Addition of phenolic compounds further increased the P release from iron phosphate. Initial solution pH had much more substantial effect on P release from rock phosphate than from iron phosphate.

  7. Evaluation of deoxygenated oligosaccharide acceptor analogs as specific inhibitors of glycosyltransferases.

    Science.gov (United States)

    Hindsgaul, O; Kaur, K J; Srivastava, G; Blaszczyk-Thurin, M; Crawley, S C; Heerze, L D; Palcic, M M

    1991-09-25

    The glycosyltransferases controlling the biosynthesis of cell-surface complex carbohydrates transfer glycosyl residues from sugar nucleotides to specific hydroxyl groups of acceptor oligosaccharides. These enzymes represent prime targets for the design of glycosylation inhibitors with the potential to specifically alter the structures of cell-surface glycoconjugates. With the aim of producing such inhibitors, synthetic oligosaccharide substrates were prepared for eight different glycosyltransferases. The enzymes investigated were: A, alpha(1----2, porcine submaxillary gland); B, alpha(1----3/4, Lewis); C, alpha(1----4, mung bean); D, alpha(1----3, Lex)-fucosyltransferases; E, beta(1----4)-galactosyltransferase; F, beta(1----6)-N-acetylglucosaminyltransferase V; G, beta(1----6)-mucin-N-acetylglucosaminyltransferase ("core-2" transferase); and H, alpha(2----3)-sialyltransferase from rat liver. These enzymes all transfer sugar residues from their respective sugar nucleotides (GDP-Fuc, UDP-Gal, UDP-GlcNAc, and CMP-sialic acid) with inversion of configuration at their anomeric centers. The Km values for their synthetic oligosaccharide acceptors were in the range of 0.036-1.3 mM. For each of these eight enzymes, acceptor analogs were next prepared where the hydroxyl group undergoing glycosylation was chemically removed and replaced by hydrogen. The resulting deoxygenated acceptor analogs can no longer be substrates for the corresponding glycosyltransferases and, if still bound by the enzymes, should act as competitive inhibitors. In only four of the eight cases examined (enzymes A, C, F, and G) did the deoxygenated acceptor analogs inhibit their target enzymes, and their Ki values (all competitive) remained in the general range of the corresponding acceptor Km values. No inhibition was observed for the remaining four enzymes even at high concentrations of deoxygenated acceptor analog. For these latter enzymes it is suggested that the reactive acceptor hydroxyl groups are

  8. Exploring Directional LLʹCT in (donor)M(acceptor) Complexes

    OpenAIRE

    Kramer, Wesley William

    2014-01-01

    The overarching theme of the work presented in this dissertation is the to develope a better understanding of the factors which govern the properties of donor-acceptor (D-A) LL'CT transition metal complexes. Chapter 2 describes a series of (catcholate)Ni(diimine) D-A LL'CT complexes. The spectroscopic and electrochemical properties can be tuned independently through variations in donor or acceptor ligand electronics. Chapter 3 describes the Group 10 series of (cat-tBu2)M(bdi) complexes (M = ...

  9. Synthesis and Characterization of Organic Dyes Containing Various Donors and Acceptors

    Directory of Open Access Journals (Sweden)

    Wen-Chung Ou-Yang

    2010-01-01

    Full Text Available New organic dyes comprising carbazole, iminodibenzyl, or phenothiazine moieties, respectively, as the electron donors, and cyanoacetic acid or acrylic acid moieties as the electron acceptors/anchoring groups were synthesized and characterized. The influence of heteroatoms on carbazole, iminodibenzyl and phenothiazine donors, and cyano-substitution on the acid acceptor is evidenced by spectral, electrochemical, photovoltaic experiments, and density functional theory calculations. The phenothiazine dyes show solar-energy-to-electricity conversion efficiency (η of 3.46–5.53%, whereas carbazole andiminodibenzyl dyesshow η of 2.43% and 3.49%, respectively.

  10. Effect of electronic acceptor segments on photophysical properties of low-band-gap ambipolar polymers.

    Science.gov (United States)

    Li, Yuanzuo; Cui, Jingang; Zhao, Jianing; Liu, Jinglin; Song, Peng; Ma, Fengcai

    2013-01-01

    Stimulated by a recent experimental report, charge transfer and photophysical properties of donor-acceptor ambipolar polymer were studied with the quantum chemistry calculation and the developed 3D charge difference density method. The effects of electronic acceptor strength on the structure, energy levels, electron density distribution, ionization potentials, and electron affinities were also obtained to estimate the transporting ability of hole and electron. With the developed 3D charge difference density, one visualizes the charge transfer process, distinguishes the role of molecular units, and finds the relationship between the role of DPP and excitation energy for the three polymers during photo-excitation.

  11. Solution-processable donor-acceptor polymers with modular electronic properties and very narrow bandgaps.

    Science.gov (United States)

    Foster, Michael E; Zhang, Benjamin A; Murtagh, Dustin; Liu, Yi; Sfeir, Matthew Y; Wong, Bryan M; Azoulay, Jason D

    2014-09-01

    Bridgehead imine-substituted cyclopentadithiophene structural units, in combination with highly electronegative acceptors that exhibit progressively delocalized π-systems, afford donor-acceptor (DA) conjugated polymers with broad absorption profiles that span technologically relevant wavelength (λ) ranges from 0.7 electronic properties so as to achieve very narrow optical bandgaps (Eg (opt) < 0.5 eV). This strategy affords modular DA copolymers with broad- and long-wavelength light absorption in the infrared and materials with some of the narrowest bandgaps reported to date.

  12. Modular supramolecular approach for co-crystallization of donors and acceptors into ordered networks

    Science.gov (United States)

    Stupp, Samuel I.; Stoddart, J. Fraser; Shveyd, Alex K.; Tayi, Alok S.; Sue, Andrew C. H.; Narayanan, Ashwin

    2016-09-20

    Organic charge-transfer (CT) co-crystals in a mixed stack system are disclosed, wherein a donor molecule (D) and an acceptor molecule (A) occupy alternating positions (DADADA) along the CT axis. A platform is provided which amplifies the molecular recognition of donors and acceptors and produces co-crystals at ambient conditions, wherein the platform comprises (i) a molecular design of the first constituent (.alpha.-complement), (ii) a molecular design of the second compound (.beta.-complement), and (iii) a solvent system that promotes co-crystallization.

  13. Structural instability of N-acceptors in homo- and heteroepitaxially grown ZnO by MBE

    Energy Technology Data Exchange (ETDEWEB)

    Ando, K.; Abe, T.; Taya, T.; Ishihara, Y.; Enomoto, K.; Yamazaki, Y.; Yoshikawa, J.; Fujino, K.; Nakamura, H.; Ohno, T.; Kasada, H. [Department of Information and Electronic Engineering, Graduate School of Engineering, Tottori University, 4-1-1 Koyama-Minami, Tottori 680-8550 (Japan)

    2010-06-15

    Unique properties of the N-acceptor in homo- and heteroepitaxially grown ZnO by molecular beam epitaxy (MBE) are studied by means of microproving of surface sheet-resistance, Hall-effect measurement, persistent photoconduction (PPC) and thermally stimulated current (TSC). Rapid postanneal of N-doped ZnO is found to induce the change in the conduction type from n-type (as-grown) to p/n-type mixed conduction, forming island structure, and these properties are related to a structural instability of the N-acceptor. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  14. Copper-catalyzed asymmetric conjugate addition of organometallic reagents to extended Michael acceptors

    Directory of Open Access Journals (Sweden)

    Thibault E. Schmid

    2015-12-01

    Full Text Available The copper-catalyzed asymmetric conjugate addition (ACA of nucleophiles onto polyenic Michael acceptors represents an attractive and powerful methodology for the synthesis of relevant chiral molecules, as it enables in a straightforward manner the sequential generation of two or more stereogenic centers. In the last decade, various chiral copper-based catalysts were evaluated in combination with different nucleophiles and Michael acceptors, and have unambiguously demonstrated their usefulness in the control of the regio- and enantioselectivity of the addition. The aim of this review is to report recent breakthroughs achieved in this challenging field.

  15. Doping of germanium and silicon crystals with non-hydrogenic acceptors for far infrared lasers

    Science.gov (United States)

    Haller, Eugene E.; Brundermann, Erik

    2000-01-01

    A method for doping semiconductors used for far infrared lasers with non-hydrogenic acceptors having binding energies larger than the energy of the laser photons. Doping of germanium or silicon crystals with beryllium, zinc or copper. A far infrared laser comprising germanium crystals doped with double or triple acceptor dopants permitting the doped laser to be tuned continuously from 1 to 4 terahertz and to operate in continuous mode. A method for operating semiconductor hole population inversion lasers with a closed cycle refrigerator.

  16. Investigation of acceptor states in ZnO by junction DLTS

    Science.gov (United States)

    von Wenckstern, H.; Pickenhain, R.; Schmidt, H.; Brandt, M.; Biehne, G.; Lorenz, M.; Grundmann, M.; Brauer, G.

    2007-07-01

    We have realized a p-type ZnO surface layer by N + ion implantation of a high quality ZnO wafer and subsequent annealing. The conduction type of this surface layer was revealed by scanning capacitance microscopy. Rectifying current-voltage characteristics for processed devices were coherent with the existence of an internal pn junction. Deep donor- and acceptor-like defects were investigated by junction deep level transient spectroscopy. The donor-like levels correspond to those commonly observed for E1 and E3 defects. The acceptor states resolved have thermal activation energies of about 150 meV and 280 meV, respectively.

  17. A 4% efficient organic solar cell using a fluorinated fused subphthalocyanine dimer as an electron acceptor

    Energy Technology Data Exchange (ETDEWEB)

    Verreet, Bregt; Heremans, Paul [IMEC, Kapeldreef 75, B-3001 Leuven (Belgium); ESAT, Katholieke Universiteit Leuven, Kasteelpark Arenberg 10, B-3001 Leuven (Belgium); Rand, Barry P.; Cheyns, David; Hadipour, Afshin; Aernouts, Tom [IMEC, Kapeldreef 75, B-3001 Leuven (Belgium); Medina, Anais; Claessens, Christian G. [Departamento de Quimica Organica, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Torres, Tomas [Departamento de Quimica Organica, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); IMDEA-Nanociencia, Facultad de Ciencias, Ciudad Universitaria de Cantoblanco, 28049 Madrid (Spain)

    2011-07-15

    Planar bilayer organic solar cells with a fluorinated fused subphthalocyanine dimer (FSubPcDimer) as an acceptor and chloroboron (III) subphthalocyanine (SubPc) as a donor obtain a 60% higher J{sub sc} compared to cells using C{sub 60} as an acceptor, resulting in a power conversion efficiency of 4%. This is obtained thanks to the important contribution to the photocurrent of the low-bandgap FSubPcDimer. (Copyright copyright 2011 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  18. Phosphate Recognition in Structural Biology

    NARCIS (Netherlands)

    Hirsch, Anna K.H.; Fischer, Felix R.; Diederich, François

    2007-01-01

    Drug-discovery research in the past decade has seen an increased selection of targets with phosphate recognition sites, such as protein kinases and phosphatases, in the past decade. This review attempts, with the help of database-mining tools, to give an overview of the most important principles in

  19. Sintering of calcium phosphate bioceramics.

    Science.gov (United States)

    Champion, E

    2013-04-01

    Calcium phosphate ceramics have become of prime importance for biological applications in the field of bone tissue engineering. This paper reviews the sintering behaviour of these bioceramics. Conventional pressureless sintering of hydroxyapatite, Ca10(PO4)6(OH)2, a reference compound, has been extensively studied. Its physico-chemistry is detailed. It can be seen as a competition between two thermally activated phenomena that proceed by solid-state diffusion of matter: densification and grain growth. Usually, the objective is to promote the first and prevent the second. Literature data are analysed from sintering maps (i.e. grain growth vs. densification). Sintering trajectories of hydroxyapatite produced by conventional pressureless sintering and non-conventional techniques, including two-step sintering, liquid phase sintering, hot pressing, hot isostatic pressing, ultrahigh pressure, microwave and spark plasma sintering, are presented. Whatever the sintering technique may be, grain growth occurs mainly during the last step of sintering, when the relative bulk density reaches 95% of the maximum value. Though often considered very advantageous, most assisted sintering techniques do not appear very superior to conventional pressureless sintering. Sintering of tricalcium phosphate or biphasic calcium phosphates is also discussed. The chemical composition of calcium phosphate influences the behaviour. Similarly, ionic substitutions in hydroxyapatite or in tricalcium phosphate create lattice defects that modify the sintering rate. Depending on their nature, they can either accelerate or slow down the sintering rate. The thermal stability of compounds at the sintering temperature must also be taken into account. Controlled atmospheres may be required to prevent thermal decomposition, and flash sintering techniques, which allow consolidation at low temperature, can be helpful.

  20. Phosphate based oil well cements

    Science.gov (United States)

    Natarajan, Ramkumar

    The main application of the cement in an oil well is to stabilize the steel casing in the borehole and protect it from corrosion. The cement is pumped through the borehole and is pushed upwards through the annulus between the casing and the formation. The cement will be exposed to temperature and pressure gradients of the borehole. Modified Portland cement that is being used presently has several shortcomings for borehole sealant. The setting of the Portland cement in permafrost regions is poor because the water in it will freeze even before the cement sets and because of high porosity and calcium oxide, a major ingredient it gets easily affected by the down hole gases such as carbon dioxide. The concept of phosphate bonded cements was born out of considerable work at Argonne National Laboratory (ANL) on their use in stabilization of radioactive and hazardous wastes. Novel cements were synthesized by an acid base reaction between a metal oxide and acid phosphate solution. The major objective of this research is to develop phosphate based oil well cements. We have used thermodynamics along with solution chemistry principles to select calcined magnesium oxide as candidate metal oxide for temperatures up to 200°F (93.3°C) and alumina for temperatures greater than 200°F (93.3°C). Solution chemistry helped us in selecting mono potassium phosphate as the acid component for temperatures less than 200°F (93.3°C) and phosphoric acid solution greater than 200°F (93.3°C). These phosphate cements have performance superior to common Portland well cements in providing suitable thickening time, better mechanical and physical properties.

  1. 21 CFR 184.1301 - Ferric phosphate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Ferric phosphate. 184.1301 Section 184.1301 Food... Specific Substances Affirmed as GRAS § 184.1301 Ferric phosphate. (a) Ferric phosphate (ferric orthophosphate, iron (III) phosphate, FePO4·xH2O, CAS Reg. No. 10045-86-0) is an odorless, yellowish-white...

  2. Negative electrospray ionization mass spectrometry of synthetic and chemically modified oligonucleotides

    NARCIS (Netherlands)

    Potier, N.; Van Dorsselaer, A.; Cordier, Y.; Roch, O.; Bischoff, Rainer

    1994-01-01

    We report here on the analysis of synthetic oligonucleotides by electrospray ionization mass spectrometry (ESI-MS). After intensive removal of salt ions (especially sodium cations), negative ion mass spectra, allowing mass measurement with an accuracy of 0.01%, were obtained on several oligonucleoti

  3. Direct Mutagenesis of Thousands of Genomic Targets using Microarray-derived Oligonucleotides

    DEFF Research Database (Denmark)

    Bonde, Mads; Kosuri, Sriram; Genee, Hans Jasper

    2015-01-01

    operons in E. coli using this method, which we call Microarray-Oligonucleotide (MO)-MAGE. The resulting mutant library was characterized by high-throughput sequencing to show that all attempted insertions were estimated to have occurred at an average frequency of 0.02 % per loci with 0.4 average...

  4. Obstructive Effects of Ultrasonic Microbubble Intensifier on CHG-5 Cell with Survivin Antisense Oligonucleotides Transfection

    Institute of Scientific and Technical Information of China (English)

    CAO Hong-ying; CAO You-de; WANG Zhi-gang; LI Pan

    2008-01-01

    Objective:To study the effects on human glioma cell line CHG-5 by ultrasonic microbubble intensifier with survivin antisense oligonucleotides (ASODN)transfection. Methods: Antisense oligonucleotides targeting survivin mRNA was designed and synthesized.Four regimen groups were designed,group A:survivin antisense oligonucleotides transfected with ultrasonic microbubble intensifier combined with ultrasound irradiation,group B: survivin antisense oligonucleotides transfected with lipofectamine combined with ultrasound irradiation,group C:survivin antisense oligonucelotides with lipofectamine transfection.group D:blank control.The expression changes of surviving protein were measured by immunohistochemical staining and Western blotting,and MTr assay was used to measure the changes of proliferation.Results:Survivin protein expression in group A was decreased significantly in human glioma cell line CHG-5 than other groups(P<0.05),and the proliferating rate of CHG-5 in group A was also significantly inhibited(P<0.05).Conclusion:Ultrasonic microbubble intensifier transfection combined with ultrasound irradiation is a promising method in gene transfection effectively and noninvasively.

  5. An oligonucleotide-tagged microarray for routine diagnostics of colon cancer by genotyping KRAS mutations

    DEFF Research Database (Denmark)

    Liu, Yuliang; Guðnason, Haukur; Li, Yiping

    2014-01-01

    or spiked fecal samples. The immobilized tag-probes were stable under multiple thermal cycling treatments, allowing re-use of the tag-microarray and further optimization to solid PCR. Our results demonstrated that a novel oligonucleotide-tagged microarray system has been developed which would be suitable...

  6. Application of decoy oligonucleotides as novel therapeutic strategy: a contemporary overview.

    Science.gov (United States)

    Ahmad, Mohammad Zaki; Akhter, Sohail; Mallik, Neha; Anwar, Mohammad; Tabassum, Wajda; Ahmad, Farhan Jalees

    2013-03-01

    Molecular therapy is emerging as a potential strategy for the treatment of many diseases. Correct regulation of gene expression is essential for both, to normal development and proper functioning of the all the organisms. Even after four decades of intensive research, it is still a major problem from regulatory and technical point of view, to replace defective genes. The technology of decoy oligonucleotides has received considerable attention to treat and cure a variety of diseases and abnormal physiological conditions, because they provide a rational way to design and selective regulation of a specific gene expression. Decoy oligonucleotides are widely used as inhibitors of specific gene expression because they can offer exciting possibility of expression and blocking of a particular gene without any changes in the functions of other genes. Advances in the decoy oligonucleotides are rapidly paving the way to new insights into the origin and treatment of inflammatory, cancer and/or other immune disorders. The review covers the progress achieved towards the development of decoy oligonucleotides as a potential strategy in a new class of molecular therapy.

  7. Cellular Internalization of Therapeutic Oligonucleotides by Peptide Amphiphile Nanofibers and Nanospheres.

    Science.gov (United States)

    Mumcuoglu, Didem; Sardan Ekiz, Melis; Gunay, Gokhan; Tekinay, Turgay; Tekinay, Ayse B; Guler, Mustafa O

    2016-05-11

    Oligonucleotides are promising drug candidates due to the exceptionally high specificity they exhibit toward their target DNA and RNA sequences. However, their poor pharmacokinetic and pharmacodynamic properties, in conjunction with problems associated with their internalization by cells, necessitates their delivery through specialized carrier systems for efficient therapy. Here, we investigate the effects of carrier morphology on the cellular internalization mechanisms of oligonucleotides by using self-assembled fibrous or spherical peptide nanostructures. Size and geometry were both found to be important parameters for the oligonucleotide internalization process; direct penetration was determined to be the major mechanism for the internalization of nanosphere carriers, whereas nanofibers were internalized by clathrin- and dynamin-dependent endocytosis pathways. We further showed that glucose conjugation to carrier nanosystems improved cellular internalization in cancer cells due to the enhanced glucose metabolism associated with oncogenesis, and the internalization of the glucose-conjugated peptide/oligonucleotide complexes was found to be dependent on glucose transporters present on the surface of the cell membrane.

  8. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Directory of Open Access Journals (Sweden)

    Yusuf E Murgha

    Full Text Available Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  9. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  10. nuID: a universal naming scheme of oligonucleotides for Illumina, Affymetrix, and other microarrays

    Directory of Open Access Journals (Sweden)

    Kibbe Warren A

    2007-05-01

    Full Text Available Abstract Background Oligonucleotide probes that are sequence identical may have different identifiers between manufacturers and even between different versions of the same company's microarray; and sometimes the same identifier is reused and represents a completely different oligonucleotide, resulting in ambiguity and potentially mis-identification of the genes hybridizing to that probe. Results We have devised a unique, non-degenerate encoding scheme that can be used as a universal representation to identify an oligonucleotide across manufacturers. We have named the encoded representation 'nuID', for nucleotide universal identifier. Inspired by the fact that the raw sequence of the oligonucleotide is the true definition of identity for a probe, the encoding algorithm uniquely and non-degenerately transforms the sequence itself into a compact identifier (a lossless compression. In addition, we added a redundancy check (checksum to validate the integrity of the identifier. These two steps, encoding plus checksum, result in an nuID, which is a unique, non-degenerate, permanent, robust and efficient representation of the probe sequence. For commercial applications that require the sequence identity to be confidential, we have an encryption schema for nuID. We demonstrate the utility of nuIDs for the annotation of Illumina microarrays, and we believe it has universal applicability as a source-independent naming convention for oligomers. Reviewers This article was reviewed by Itai Yanai, Rong Chen (nominated by Mark Gerstein, and Gregory Schuler (nominated by David Lipman.

  11. Synthesis and antisense properties of 2'-O-(2S-methoxypropyl)-RNA-modified gapmer antisense oligonucleotides.

    Science.gov (United States)

    Yu, Jinghua; Pandey, Sanjay K; Khatri, Hetal; Prakash, Thazha P; Swayze, Eric E; Seth, Punit P

    2014-09-01

    To ascertain whether increasing hydrophobicity can enhance the activity of second-generation antisense oligonucleotides (ASOs) in muscle, we investigated the antisense properties of 2'-O-(2S-methoxypropyl)-RNA (2S-MOP)-modified ASOs. Synthesis of the 2S-MOP 5-methyl uridine phosphoramidite was accomplished on a multi-gram scale by Lewis-acid-catalyzed ring opening of 5'-O-tert-butyldiphenylsilyl ether-protected 2,2'-anhydro-5-methyl uridine with 2S-methoxy-1-propanol. Synthesis of the 2S-MOP 5-methyl cytidine nucleoside from the corresponding 5-methyl uridine nucleoside was accomplished by formation and displacement of a 4-triazolide intermediate with aqueous ammonia. 2S-MOP-modified oligonucleotides were prepared on an automated DNA synthesizer and showed similar enhancements in duplex thermal stability as 2'-O-methoxyethyl RNA (MOE)-modified oligonucleotides. 2S-MOP-containing antisense oligonucleotides were evaluated in Balb-c mice and showed good activity for decreasing the expression levels of scavenger receptor B1 (Srb1) and phosphatase and tensin homologue (PTEN) mRNA in liver and muscle tissue. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. PCSK9 LNA antisense oligonucleotides induce sustained reduction of LDL cholesterol in nonhuman primates.

    Science.gov (United States)

    Lindholm, Marie W; Elmén, Joacim; Fisker, Niels; Hansen, Henrik F; Persson, Robert; Møller, Marianne R; Rosenbohm, Christoph; Ørum, Henrik; Straarup, Ellen M; Koch, Troels

    2012-02-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) has emerged as a therapeutic target for the reduction of low-density lipoprotein cholesterol (LDL-C). PCSK9 increases the degradation of the LDL receptor, resulting in high LDL-C in individuals with high PCSK9 activity. Here, we show that two locked nucleic acid (LNA) antisense oligonucleotides targeting PCSK9 produce sustained reduction of LDL-C in nonhuman primates after a loading dose (20 mg/kg) and four weekly maintenance doses (5 mg/kg). PCSK9 messenger RNA (mRNA) and serum PCSK9 protein were reduced by 85% which resulted in a 50% reduction in circulating LDL-C. Serum total cholesterol (TC) levels were reduced to the same extent as LDL-C with no reduction in high-density lipoprotein levels, demonstrating a specific pharmacological effect on LDL-C. The reduction in hepatic PCSK9 mRNA correlated with liver LNA oligonucleotide content. This verified that anti-PCSK9 LNA oligonucleotides regulated LDL-C through an antisense mechanism. The compounds were well tolerated with no observed effects on toxicological parameters (liver and kidney histology, alanine aminotransferase, aspartate aminotransferase, urea, and creatinine). The pharmacologic evidence and initial safety profile of the compounds used in this study indicate that LNA antisense oligonucleotides targeting PCSK9 provide a viable therapeutic strategy and are potential complements to statins in managing high LDL-C.

  13. Evaluation of fluorine-18-labeled alkylating agents as potential synthons for the labeling of oligonucleotides

    NARCIS (Netherlands)

    de Vries, EFJ; Vroegh, J; Elsinga, PH; Vaalburg, W

    2003-01-01

    Six fluorine-18-labeled alkylating agents were selected as potentially suitable synthons for the labeling of antisense oligonucleotides. The selected synthons were evaluated in a model reaction with the monomer adenosine 5'-O-thiomonophosphate. Of these synthons, alpha-bromo-alpha'-[F-18]fluoro-m-xy

  14. Refinement of antisense oligonucleotide mediated exon skipping as therapy for Duchenne muscular dystrophy

    NARCIS (Netherlands)

    Heemskerk, Johannes Antonius

    2011-01-01

    In recent years, modulation of mRNA has emerged as a promising therapeutic tool. For instance, in the field of neuromuscular disorders therapeutic strategies are being developed for several diseases, including antisense oligonucleotide (AON) mediated exon skipping for Duchenne Muscular Dystrophy (DM

  15. Refinement of antisense oligonucleotide mediated exon skipping as therapy for Duchenne muscular dystrophy

    NARCIS (Netherlands)

    Heemskerk, Johannes Antonius

    2011-01-01

    In recent years, modulation of mRNA has emerged as a promising therapeutic tool. For instance, in the field of neuromuscular disorders therapeutic strategies are being developed for several diseases, including antisense oligonucleotide (AON) mediated exon skipping for Duchenne Muscular Dystrophy (DM

  16. PCSK9 LNA antisense oligonucleotides induce sustained reduction of LDL cholesterol in nonhuman primates

    DEFF Research Database (Denmark)

    Lindholm, Marie W; Elmén, Joacim; Fisker, Niels

    2012-01-01

    locked nucleic acid (LNA) antisense oligonucleotides targeting PCSK9 produce sustained reduction of LDL-C in nonhuman primates after a loading dose (20 mg/kg) and four weekly maintenance doses (5 mg/kg). PCSK9 messenger RNA (mRNA) and serum PCSK9 protein were reduced by 85% which resulted in a 50...

  17. Thermal Stability of Modified i-Motif Oligonucleotides with Naphthalimide Intercalating Nucleic Acids

    DEFF Research Database (Denmark)

    El-Sayed, Ahmed Ali; Pedersen, Erik B.; Khaireldin, Nahid Y.

    2016-01-01

    In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion of naphtha......In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion...... of naphthalimide (1H-benzo[de]isoquinoline-1,3(2H)-dione) as the intercalating nucleic acid. The stabilities of i-motif structures with inserted naphthalimide intercalating nucleotides were studied using UV melting temperatures (Tm) and circular dichroism spectra at different pH values and conditions (crowding...... and non-crowding). This study indicated a positive effect of the naphthalimide intercalating nucleotides on the stabilities of the i-motif structures compared to the wild-type structure which is in contrast to a previous observation for a pyrene-intercalating nucleotide showing a decrease in Tm values....

  18. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    Science.gov (United States)

    2013-01-01

    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  19. Design and analysis of effects of triplet repeat oligonucleotides in cell models for myotonic dystrophy

    NARCIS (Netherlands)

    Gonzalez-Barriga, A.; Mulders, S.A.M.; Giessen, J. van der; Hooijer, J.D.; Bijl, S.; Kessel, I.D.G. van; Beers, J. van; Deutekom, J.C. van; Fransen, J.A.M.; Wieringa, B.; Wansink, D.G.

    2013-01-01

    Myotonic dystrophy type 1 (DM1) is caused by DM protein kinase (DMPK) transcripts containing an expanded (CUG)n repeat. Antisense oligonucleotide (AON)-mediated suppression of these mutant RNAs is considered a promising therapeutic strategy for this severe disorder. Earlier, we identified a 2'-O-met

  20. Comparison of small molecules and oligonucleotides that target a toxic, non-coding RNA.

    Science.gov (United States)

    Costales, Matthew G; Rzuczek, Suzanne G; Disney, Matthew D

    2016-06-01

    Potential RNA targets for chemical probes and therapeutic modalities are pervasive in the transcriptome. Oligonucleotide-based therapeutics are commonly used to target RNA sequence. Small molecules are emerging as a modality to target RNA structures selectively, but their development is still in its infancy. In this work, we compare the activity of oligonucleotides and several classes of small molecules that target the non-coding r(CCUG) repeat expansion (r(CCUG)(exp)) that causes myotonic dystrophy type 2 (DM2), an incurable disease that is the second-most common cause of adult onset muscular dystrophy. Small molecule types investigated include monomers, dimers, and multivalent compounds synthesized on-site by using RNA-templated click chemistry. Oligonucleotides investigated include phosphorothioates that cleave their target and vivo-morpholinos that modulate target RNA activity via binding. We show that compounds assembled on-site that recognize structure have the highest potencies amongst small molecules and are similar in potency to a vivo-morpholino modified oligonucleotide that targets sequence. These studies are likely to impact the design of therapeutic modalities targeting other repeats expansions that cause fragile X syndrome and amyotrophic lateral sclerosis, for example.

  1. Synthesis and Excellent Duplex Stability of Oligonucleotides Containing 2'-Amino-LNA Functionalized with Galactose Units

    DEFF Research Database (Denmark)

    Kumar, Rajesh; Ries, Annika; Wengel, Jesper

    2017-01-01

    A convenient method for the preparation of oligonucleotides containing internally-attached galactose and triantennary galactose units has been developed based on click chemistry between 2'-N-alkyne 2'-amino-LNA nucleosides and azido-functionalized galactosyl building blocks. The synthesized...

  2. Design and analysis of effects of triplet repeat oligonucleotides in cell models for myotonic dystrophy

    NARCIS (Netherlands)

    Gonzalez-Barriga, A.; Mulders, S.A.M.; Giessen, J. van der; Hooijer, J.D.; Bijl, S.; Kessel, I.D.G. van; Beers, J. van; Deutekom, J.C. van; Fransen, J.A.M.; Wieringa, B.; Wansink, D.G.

    2013-01-01

    Myotonic dystrophy type 1 (DM1) is caused by DM protein kinase (DMPK) transcripts containing an expanded (CUG)n repeat. Antisense oligonucleotide (AON)-mediated suppression of these mutant RNAs is considered a promising therapeutic strategy for this severe disorder. Earlier, we identified a 2'-O-met

  3. Precise construction of oligonucleotide-Fab fragment conjugate for homogeneous immunoassay using HaloTag technology.

    Science.gov (United States)

    Päkkilä, Henna; Peltomaa, Riikka; Lamminmäki, Urpo; Soukka, Tero

    2015-03-01

    The use of oligonucleotide-protein conjugates enables the development of novel types of bioanalytical assays. However, convenient methods for producing covalent and stoichiometric oligonucleotide-protein conjugates are still rare. Here we demonstrate, for the first time, covalent conjugation of DNA oligonucleotide to Fab fragments with a 1:1 ratio using HaloTag self-labeling technology. The oligonucleotide coupling was carried out while the Fab was attached to protein G matrix, thereby enabling straightforward production of covalent conjugates. Furthermore, it allowed convenient purification of the product because the unreacted components were easily removed before the elution of the high-purity conjugate. The prepared conjugate was employed in a homogeneous immunoassay where prostate-specific antigen was used as a model analyte. Switchable lanthanide luminescence was used for detection, and the obtained limit of detection was 0.27 ng/ml. In the future, the developed method for covalent conjugation and successive purification in protein G column could also be applied for introducing other kinds of modifications to Fab fragments in a simple and site-specific manner.

  4. Rapid identification of bacteria in blood cultures by using fluorescently labeled oligonucleotide probes

    NARCIS (Netherlands)

    Jansen, GJ; Mooibroek, M; Idema, J; Harmsen, HJM; Welling, GW; Degener, JE

    2000-01-01

    The applicability of whole-cell hybridization for the identification of pathogenic bacteria in blood from septic patients was examined. Oligonucleotide probes, fluorescently labeled with fluorescein isothiocyanate, directed against the variable regions of the 16S rRNAs of the following bacterial spe

  5. Pd0-Catalyzed Methyl Transfer on Nucleosides and Oligonucleotides, Envisaged as a PET Tracer

    Directory of Open Access Journals (Sweden)

    Eric Fouquet

    2013-11-01

    Full Text Available The methyl transfer reaction from activated monomethyltin, via a modified Stille coupling reaction, was studied under “ligandless” conditions on fully deprotected 5'-modified nucleosides and one dinucleotide. The reaction was optimized to proceed in a few minutes and quantitative yield, even under dilute conditions, thus affording a rapid and efficient new method for oligonucleotide labelling with carbon-11.

  6. A new achiral reagent for the incorporation of multiple amino groups into oligonucleotides

    DEFF Research Database (Denmark)

    Behrens, Carsten; Petersen, Kenneth H.; Egholm, Michael

    1995-01-01

    The synthesis of a new functionalized achiral linker reagent (10) for the incorporation of multiple primary amino groups into oligonucleotides is described. The linker reagent is compatible with conventional DNA-synthesis following the phosphoramidite methodology, and the linker can be incorporat...

  7. A facile inhibitor screening of SARS coronavirus N protein using nanoparticle-based RNA oligonucleotide.

    Science.gov (United States)

    Roh, Changhyun

    2012-01-01

    Hundreds of million people worldwide have been infected with severe acute respiratory syndrome (SARS), and the rate of global death from SARS has remarkably increased. Hence, the development of efficient drug treatments for the biological effects of SARS is highly needed. We have previously shown that quantum dots (QDs)-conjugated RNA oligonucleotide is sensitive to the specific recognition of the SARS-associated coronavirus (SARS-CoV) nucleocapsid (N) protein. In this study, we found that a designed biochip could analyze inhibitors of the SARS-CoV N protein using nanoparticle-based RNA oligonucleotide. Among the polyphenolic compounds examined, (-)-catechin gallate and (-)-gallocatechin gallate demonstrated a remarkable inhibition activity on SARS-CoV N protein. (-)-catechin gallate and (-)-gallocatechin gallate attenuated the binding affinity in a concentrated manner as evidenced by QDs-conjugated RNA oligonucleotide on a designed biochip. At a concentration of 0.05 μg mL(-1), (-)-catechin gallate and (-)-gallocatechin gallate showed more than 40% inhibition activity on a nanoparticle-based RNA oligonucleotide biochip system.

  8. A triple-helix forming oligonucleotide targeting genomic DNA fails to induce mutation.

    Science.gov (United States)

    Reshat, Reshat; Priestley, Catherine C; Gooderham, Nigel J

    2012-11-01

    Purine tracts in duplex DNA can bind oligonucleotide strands in a sequence specific manner to form triple-helix structures. Triple-helix forming oligonucleotides (TFOs) targeting supFG1 constructs have previously been shown to be mutagenic raising safety concerns for oligonucleotide-based pharmaceuticals. We have engineered a TFO, TFO27, to target the genomic Hypoxanthine-guanine phosphoribosyltransferase (HPRT) locus to define the mutagenic potential of such structures at genomic DNA. We report that TFO27 was resistant to nuclease degradation and readily binds to its target motif in a cell free system. Contrary to previous studies using the supFG1 reporter construct, TFO27 failed to induce mutation within the genomic HPRT locus. We suggest that it is possible that previous reports of triplex-mediated mutation using the supFG1 reporter construct could be confounded by DNA quadruplex formation. Although the present study indicates that a TFO targeting a genomic locus lacks mutagenic activity, it is unclear if this finding can be generalised to all TFOs and their targets. For the present, we suggest that it is prudent to avoid large purine stretches in oligonucleotide pharmaceutical design to minimise concern regarding off-target genotoxicity.

  9. In situ entry of oligonucleotides into brain cells can occur through a nucleic acid channel

    NARCIS (Netherlands)

    Shi, Fuxin; Gounko, Natasha V.; Wang, Xiaoqin; Ronken, Eric; Hoekstra, Dick

    2007-01-01

    Brain tissue has become a challenging therapeutic target, in part because of failure of conventional treatments of brain tumors and a gradually increasing number of neurodegenerative diseases. Because antisense oligonucleotides are readily internalized by neuronal cells in culture, these compounds c

  10. Effect of iontophoresis on the in vitro trans-scleral transport of three single stranded oligonucleotides.

    Science.gov (United States)

    Pescina, Silvia; Antopolsky, Maxim; Santi, Patrizia; Nicoli, Sara; Murtomäki, Lasse

    2013-05-13

    Oligonucleotides represent a subject of clinical interest due to their potential ability to treat several diseases, including those affecting the posterior segment of the eye. Unfortunately, therapeutic oligonucleotides are currently administered by means of highly invasive approaches, such as intravitreal injections. The aim of the present work was to study in vitro, across isolated bovine sclera, the effect of iontophoresis on the transport of three single stranded oligonucleotides (ssDNA), 12-, 24- and 36-mer, selected as reference compounds in view of a non-invasive drug delivery to the back of the eye. All the three sequences were able to cross bovine sclera in vitro without iontophoresis. When anodal iontophoresis was applied, no change in flux was observed, while in the presence of cathodal iontophoresis the permeability coefficients increased four-fold compared to passive conditions. This behavior can be ascribed to the electrorepulsive mechanism, due to the negative charge of the nucleic acid backbone. It was also observed that the molecular weights of the three sequences did not affect trans-scleral transport, neither in passive, nor in current assisted permeation. Furthermore, increasing the current intensity from 1.75 mA to 3 mA, no effect on the trans-scleral transport of the 24-mer was noticed. Although preliminary, the results demonstrate that cathodal iontophoresis enhances trans-scleral transport of single stranded oligonucleotides and suggest its use as a novel non-invasive approach for the treatment of diseases affecting the posterior segment of the eye.

  11. Stable gene targeting in human cells using single-strand oligonucleotides with modified bases.

    Directory of Open Access Journals (Sweden)

    Xavier Rios

    Full Text Available Recent advances allow multiplexed genome engineering in E. coli, employing easily designed oligonucleotides to edit multiple loci simultaneously. A similar technology in human cells would greatly expedite functional genomics, both by enhancing our ability to test how individual variants such as single nucleotide polymorphisms (SNPs are related to specific phenotypes, and potentially allowing simultaneous mutation of multiple loci. However, oligo-mediated targeting of human cells is currently limited by low targeting efficiencies and low survival of modified cells. Using a HeLa-based EGFP-rescue reporter system we show that use of modified base analogs can increase targeting efficiency, in part by avoiding the mismatch repair machinery. We investigate the effects of oligonucleotide toxicity and find a strong correlation between the number of phosphorothioate bonds and toxicity. Stably EGFP-corrected cells were generated at a frequency of ~0.05% with an optimized oligonucleotide design combining modified bases and reduced number of phosphorothioate bonds. We provide evidence from comparative RNA-seq analysis suggesting cellular immunity induced by the oligonucleotides might contribute to the low viability of oligo-corrected cells. Further optimization of this method should allow rapid and scalable genome engineering in human cells.

  12. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NARCIS (Netherlands)

    Urakawa, H.; Fantroussi, El S.; Smidt, H.; Smoot, J.C.; Tribou, E.H.; Kelly, J.J.; Noble, P.A.; Stahl, D.A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of

  13. An oral oligonucleotide delivery system based on a thiolated polymer: Development and in vitro evaluation.

    Science.gov (United States)

    Martien, Ronny; Hoyer, Herbert; Perera, Glen; Schnürch, Andreas Bernkop

    2011-08-01

    The purpose of this study was to develop and evaluate an oral oligonucleotide delivery system based on a thiolated polymer/reduced glutathione (GSH) system providing a protective effect toward nucleases and permeation enhancement. A polycarbophil-cysteine conjugate (PCP-Cys) was synthesized. Enzymatic degradation of a model oligonucleotide by DNase I and within freshly collected intestinal fluid was investigated in the absence and presence of PCP-Cys. Permeation studies with PCP-Cys/GSH versus control were performed in vitro on Caco-2 cell monolayers and ex vivo on rat intestinal mucosa. PCP-Cys displayed 223 ± 13.8 μmol thiol groups per gram polymer. After 4h, 61% of the free oligonucleotides were degraded by DNase I and 80% within intestinal fluid. In contrast, less than 41% (DNase I) and 60% (intestinal fluid) were degraded in the presence of 0.02% (m/v) PCP-Cys. Permeation studies revealed an 8-fold (Caco-2) and 10-fold (intestinal mucosa) increase in apparent permeability compared to buffer control. Hence, this PCP-Cys/GSH system might be a promising tool for the oral administration of oligonucleotides as it allows a significant protection toward degrading enzymes and facilitates their transport across intestinal membranes.

  14. Oligonucleotide array outperforms SNP array on formalin-fixed paraffin-embedded clinical samples.

    Science.gov (United States)

    Nasri, Soroush; Anjomshoaa, Ahmad; Song, Sarah; Guilford, Parry; McNoe, Les; Black, Michael; Phillips, Vicky; Reeve, Anthony; Humar, Bostjan

    2010-04-01

    Compromised quality of formalin-fixed paraffin-embedded (FFPE)-derived DNA has compounded the use of archival specimens for array-based genomic studies. Recent technological advances have led to first successes in this field; however, there is currently no general agreement on the most suitable platform for the array-based analysis of FFPE DNA. In this study, FFPE and matched fresh-frozen (FF) specimens were separately analyzed with Affymetrix single nucleotide polymorphism (SNP) 6.0 and Agilent 4x44K oligonucleotide arrays to compare the genomic profiles from the two tissue sources and to assess the relative performance of the two platforms on FFPE material. Genomic DNA was extracted from matched FFPE-FF pairs of normal intestinal epithelium from four patients and were applied to the SNP and oligonucleotide platforms according to the manufacturer-recommended protocols. On the Affymetrix platform, a substantial increase in apparent copy number alterations was observed in all FFPE tissues relative to their matched FF counterparts. In contrast, FFPE and matched FF genomic profiles obtained via the Agilent platform were very similar. Both the SNP and the oligonucleotide platform performed comparably on FF material. This study demonstrates that Agilent oligonucleotide array comparative genomic hybridization generates reliable results from FFPE extracted DNA, whereas the Affymetrix SNP-based array seems less suitable for the analysis of FFPE material.

  15. Tetrahedron-structured DNA and functional oligonucleotide for construction of an electrochemical DNA-based biosensor.

    Science.gov (United States)

    Bu, Nan-Nan; Tang, Chun-Xia; He, Xi-Wen; Yin, Xue-Bo

    2011-07-21

    Tetrahedron-structured DNA (ts-DNA) in combination with a functionalized oligonucleotide was used to develop a "turn-on" biosensor for Hg(2+) ions. The ts-DNA provided an improved sensitivity and was used to block the active sites.

  16. 21 CFR 182.1778 - Sodium phosphate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sodium phosphate. 182.1778 Section 182.1778 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... Substances § 182.1778 Sodium phosphate. (a) Product. Sodium phosphate (mono-, di-, and tribasic)....

  17. 21 CFR 582.5301 - Ferric phosphate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Ferric phosphate. 582.5301 Section 582.5301 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Supplements 1 § 582.5301 Ferric phosphate. (a) Product. Ferric phosphate. (b) Conditions of use....

  18. 21 CFR 182.8778 - Sodium phosphate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sodium phosphate. 182.8778 Section 182.8778 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR... phosphate. (a) Product. Sodium phosphate (mono-, di-, and tribasic). (b) Conditions of use. This...

  19. 21 CFR 582.6778 - Sodium phosphate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Sodium phosphate. 582.6778 Section 582.6778 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Sodium phosphate. (a) Product. Sodium phosphate (mono-, di-, and tribasic). (b) Conditions of use....

  20. 21 CFR 582.1778 - Sodium phosphate.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Sodium phosphate. 582.1778 Section 582.1778 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) ANIMAL... Additives § 582.1778 Sodium phosphate. (a) Product. Sodium phosphate (mono-, di-, and tribasic)....