WorldWideScience

Sample records for oligonucleotide microarray approach

  1. An imputation approach for oligonucleotide microarrays.

    Directory of Open Access Journals (Sweden)

    Ming Li

    Full Text Available Oligonucleotide microarrays are commonly adopted for detecting and qualifying the abundance of molecules in biological samples. Analysis of microarray data starts with recording and interpreting hybridization signals from CEL images. However, many CEL images may be blemished by noises from various sources, observed as "bright spots", "dark clouds", and "shadowy circles", etc. It is crucial that these image defects are correctly identified and properly processed. Existing approaches mainly focus on detecting defect areas and removing affected intensities. In this article, we propose to use a mixed effect model for imputing the affected intensities. The proposed imputation procedure is a single-array-based approach which does not require any biological replicate or between-array normalization. We further examine its performance by using Affymetrix high-density SNP arrays. The results show that this imputation procedure significantly reduces genotyping error rates. We also discuss the necessary adjustments for its potential extension to other oligonucleotide microarrays, such as gene expression profiling. The R source code for the implementation of approach is freely available upon request.

  2. Conceptual "Heat-Driven" approach to the synthesis of DNA oligonucleotides on microarrays.

    Science.gov (United States)

    Grajkowski, A; Cieślak, J; Chmielewski, M K; Marchán, V; Phillips, L R; Wilk, A; Beaucage, S L

    2003-12-01

    The discovery of deoxyribonucleoside cyclic N-acylphosphoramidites, a novel class of phosphoramidite monomers for solid-phase oligonucleotide synthesis, has led to the development of a number of phosphate protecting groups that can be cleaved from DNA oligonucleotides under thermolytic neutral conditions. These include the 2-(N-formyl-N-methyl)aminoethyl, 4-oxopentyl, 3-(N-tert-butyl)carboxamido-1-propyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, and 4-methythiobutyl groups. When used for 5'-hydroxyl protection of nucleosides, the analogous 1-phenyl-2-[N-methyl-N-(2-pyridyl)]aminoethyloxycarbonyl group exhibited excellent thermolytic properties, which may permit an iterative "heat-driven" synthesis of DNA oligonucleotides on microarrays. In this regard, progress has been made toward the use of deoxyribonucleoside cyclic N-acylphosphoramidites in solid-phase oligonucleotide syntheses without nucleobase protection. Given that deoxyribonucleoside cyclic N-acylphosphoramidites produce oligonucleotides with heat-sensitive phosphate protecting groups, blocking the 5'-hydroxyl of these monomers with, for example, the thermolabile 1-phenyl-2-[N-methyl-N-(2-pyridyl)]aminoethyloxycarbonyl group may provide a convenient thermo-controlled method for the synthesis of oligonucleotides on microarrays.

  3. Design and analysis of mismatch probes for long oligonucleotide microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  4. Design and analysis of mismatch probes for long oligonucleotide microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Ye; He, Zhili; Van Nostrand, Joy D.; Zhou, Jizhong

    2008-08-15

    Nonspecific hybridization is currently a major concern with microarray technology. One of most effective approaches to estimating nonspecific hybridizations in oligonucleotide microarrays is the utilization of mismatch probes; however, this approach has not been used for longer oligonucleotide probes. Here, an oligonucleotide microarray was constructed to evaluate and optimize parameters for 50-mer mismatch probe design. A perfect match (PM) and 28 mismatch (MM) probes were designed for each of ten target genes selected from three microorganisms. The microarrays were hybridized with synthesized complementary oligonucleotide targets at different temperatures (e.g., 42, 45 and 50 C). In general, the probes with evenly distributed mismatches were more distinguishable than those with randomly distributed mismatches. MM probes with 3, 4 and 5 mismatched nucleotides were differentiated for 50-mer oligonucleotide probes hybridized at 50, 45 and 42 C, respectively. Based on the experimental data generated from this study, a modified positional dependent nearest neighbor (MPDNN) model was constructed to adjust the thermodynamic parameters of matched and mismatched dimer nucleotides in the microarray environment. The MM probes with four flexible positional mismatches were designed using the newly established MPDNN model and the experimental results demonstrated that the redesigned MM probes could yield more consistent hybridizations. Conclusions: This study provides guidance on the design of MM probes for long oligonucleotides (e.g., 50 mers). The novel MPDNN model has improved the consistency for long MM probes, and this modeling method can potentially be used for the prediction of oligonucleotide microarray hybridizations.

  5. Particle-Based Microarrays of Oligonucleotides and Oligopeptides.

    Science.gov (United States)

    Nesterov-Mueller, Alexander; Maerkle, Frieder; Hahn, Lothar; Foertsch, Tobias; Schillo, Sebastian; Bykovskaya, Valentina; Sedlmayr, Martyna; Weber, Laura K; Ridder, Barbara; Soehindrijo, Miriam; Muenster, Bastian; Striffler, Jakob; Bischoff, F Ralf; Breitling, Frank; Loeffler, Felix F

    2014-10-28

    In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  6. Particle-Based Microarrays of Oligonucleotides and Oligopeptides

    Directory of Open Access Journals (Sweden)

    Alexander Nesterov-Mueller

    2014-10-01

    Full Text Available In this review, we describe different methods of microarray fabrication based on the use of micro-particles/-beads and point out future tendencies in the development of particle-based arrays. First, we consider oligonucleotide bead arrays, where each bead is a carrier of one specific sequence of oligonucleotides. This bead-based array approach, appearing in the late 1990s, enabled high-throughput oligonucleotide analysis and had a large impact on genome research. Furthermore, we consider particle-based peptide array fabrication using combinatorial chemistry. In this approach, particles can directly participate in both the synthesis and the transfer of synthesized combinatorial molecules to a substrate. Subsequently, we describe in more detail the synthesis of peptide arrays with amino acid polymer particles, which imbed the amino acids inside their polymer matrix. By heating these particles, the polymer matrix is transformed into a highly viscous gel, and thereby, imbedded monomers are allowed to participate in the coupling reaction. Finally, we focus on combinatorial laser fusing of particles for the synthesis of high-density peptide arrays. This method combines the advantages of particles and combinatorial lithographic approaches.

  7. Design of oligonucleotides for microarrays and perspectives for design of multi-transcriptome arrays

    DEFF Research Database (Denmark)

    Nielsen, Henrik Bjørn; Wernersson, Rasmus; Knudsen, Steen

    2003-01-01

    Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer with an ......Optimal design of oligonucleotides for microarrays involves tedious and laborious work evaluating potential oligonucleotides relative to a series of parameters. The currently available tools for this purpose are limited in their flexibility and do not present the oligonucleotide designer...

  8. Sex determination of bovine preimplantation embryos by oligonucleotide microarray.

    Science.gov (United States)

    Yang, Hua; Zhong, Fagang; Yang, Yonglin; Wang, Xinhua; Liu, Shouren; Zhu, Bin

    2013-06-01

    The aim has been to set up a rapid and accurate microarray assay using sandwich mode for sex determination of bovine preimplantation embryos. Twelve sequence-specific oligonucleotide capture probes used to discriminate 12 samples were spotted onto the aldehyde-modified glass slides by Arrayer. The 2 recognition probes used to identify coding regions of the sex-determining region of the Y chromosome gene (SRY) and β-casein (CSN2) reference gene were coupled with biotin. The assay was optimized by using genomic DNA extracted from blood samples of known sex individuals. Polymerase chain reaction (PCR) was used to amplify the fragments in the HMG box region of SRY gene and CSN2 gene with sequence-specific primers. The sex of samples was identified by detecting both the SRY and CSN2 genes simultaneously in 2 reaction cells of microarrays, with the male having SRY and CSN2 signals and the female only CSN2. The sex of 20 bovine preimplantation embryos was determined by oligonucleotide microarray. The protocol was run with a blind test that showed a 100% (82/82) specificity and accuracy in sexing of leukocytes. The bovine embryos were transferred into 20 bovine recipients, with a pregnant rate of 40% (8/20). Three calves were born at term, and 5 fetuses were miscarried. Their sexes were fully in accordance with the embryonic sex predetermination predicted by oligonucleotide microarray. This suggests that the oligonucleotide microarray method of SRY gene analysis can be used in early sex prediction of bovine embryos in breeding programs.

  9. Empirical evaluation of oligonucleotide probe selection for DNA microarrays.

    Directory of Open Access Journals (Sweden)

    Jennifer G Mulle

    Full Text Available DNA-based microarrays are increasingly central to biomedical research. Selecting oligonucleotide sequences that will behave consistently across experiments is essential to the design, production and performance of DNA microarrays. Here our aim was to improve on probe design parameters by empirically and systematically evaluating probe performance in a multivariate context. We used experimental data from 19 array CGH hybridizations to assess the probe performance of 385,474 probes tiled in the Duchenne muscular dystrophy (DMD region of the X chromosome. Our results demonstrate that probe melting temperature, single nucleotide polymorphisms (SNPs, and homocytosine motifs all have a strong effect on probe behavior. These findings, when incorporated into future microarray probe selection algorithms, may improve microarray performance for a wide variety of applications.

  10. Empirical evaluation of oligonucleotide probe selection for DNA microarrays.

    Science.gov (United States)

    Mulle, Jennifer G; Patel, Viren C; Warren, Stephen T; Hegde, Madhuri R; Cutler, David J; Zwick, Michael E

    2010-03-29

    DNA-based microarrays are increasingly central to biomedical research. Selecting oligonucleotide sequences that will behave consistently across experiments is essential to the design, production and performance of DNA microarrays. Here our aim was to improve on probe design parameters by empirically and systematically evaluating probe performance in a multivariate context. We used experimental data from 19 array CGH hybridizations to assess the probe performance of 385,474 probes tiled in the Duchenne muscular dystrophy (DMD) region of the X chromosome. Our results demonstrate that probe melting temperature, single nucleotide polymorphisms (SNPs), and homocytosine motifs all have a strong effect on probe behavior. These findings, when incorporated into future microarray probe selection algorithms, may improve microarray performance for a wide variety of applications.

  11. Application of Oligonucleotide Microarrays for Bacterial Source Tracking of Environmental Enterococcus sp. Isolates

    Directory of Open Access Journals (Sweden)

    John S. Furey

    2005-04-01

    Full Text Available In an effort towards adapting new and defensible methods for assessing and managing the risk posed by microbial pollution, we evaluated the utility of oligonucleotide microarrays for bacterial source tracking (BST of environmental Enterococcus sp. isolates derived from various host sources. Current bacterial source tracking approaches rely on various phenotypic and genotypic methods to identify sources of bacterial contamination resulting from point or non-point pollution. For this study Enterococcus sp. isolates originating from deer, bovine, gull, and human sources were examined using microarrays. Isolates were subjected to Box PCR amplification and the resulting amplification products labeled with Cy5. Fluorescent-labeled templates were hybridized to in-house constructed nonamer oligonucleotide microarrays consisting of 198 probes. Microarray hybridization profiles were obtained using the ArrayPro image analysis software. Principal Components Analysis (PCA and Hierarchical Cluster Analysis (HCA were compared for their ability to visually cluster microarray hybridization profiles based on the environmental source from which the Enterococcus sp. isolates originated. The PCA was visually superior at separating origin-specific clusters, even for as few as 3 factors. A Soft Independent Modeling (SIM classification confirmed the PCA, resulting in zero misclassifications using 5 factors for each class. The implication of these results for the application of random oligonucleotide microarrays for BST is that, given the reproducibility issues, factor-based variable selection such as in PCA and SIM greatly outperforms dendrogram-based similarity measures such as in HCA and K-Nearest Neighbor KNN.

  12. Application of Oligonucleotide Microarrays for Bacterial Source Tracking of Environmental Enterococcus sp. Isolates

    OpenAIRE

    Furey, John S.; Kelley Betts; Indest, Karl J.

    2005-01-01

    In an effort towards adapting new and defensible methods for assessing and managing the risk posed by microbial pollution, we evaluated the utility of oligonucleotide microarrays for bacterial source tracking (BST) of environmental Enterococcus sp. isolates derived from various host sources. Current bacterial source tracking approaches rely on various phenotypic and genotypic methods to identify sources of bacterial contamination resulting from point or non-point pollution. For this study Ent...

  13. A review of statistical methods for preprocessing oligonucleotide microarrays.

    Science.gov (United States)

    Wu, Zhijin

    2009-12-01

    Microarrays have become an indispensable tool in biomedical research. This powerful technology not only makes it possible to quantify a large number of nucleic acid molecules simultaneously, but also produces data with many sources of noise. A number of preprocessing steps are therefore necessary to convert the raw data, usually in the form of hybridisation images, to measures of biological meaning that can be used in further statistical analysis. Preprocessing of oligonucleotide arrays includes image processing, background adjustment, data normalisation/transformation and sometimes summarisation when multiple probes are used to target one genomic unit. In this article, we review the issues encountered in each preprocessing step and introduce the statistical models and methods in preprocessing.

  14. A novel multifunctional oligonucleotide microarray for Toxoplasma gondii

    Directory of Open Access Journals (Sweden)

    Chen Feng

    2010-10-01

    Full Text Available Abstract Background Microarrays are invaluable tools for genome interrogation, SNP detection, and expression analysis, among other applications. Such broad capabilities would be of value to many pathogen research communities, although the development and use of genome-scale microarrays is often a costly undertaking. Therefore, effective methods for reducing unnecessary probes while maintaining or expanding functionality would be relevant to many investigators. Results Taking advantage of available genome sequences and annotation for Toxoplasma gondii (a pathogenic parasite responsible for illness in immunocompromised individuals and Plasmodium falciparum (a related parasite responsible for severe human malaria, we designed a single oligonucleotide microarray capable of supporting a wide range of applications at relatively low cost, including genome-wide expression profiling for Toxoplasma, and single-nucleotide polymorphism (SNP-based genotyping of both T. gondii and P. falciparum. Expression profiling of the three clonotypic lineages dominating T. gondii populations in North America and Europe provides a first comprehensive view of the parasite transcriptome, revealing that ~49% of all annotated genes are expressed in parasite tachyzoites (the acutely lytic stage responsible for pathogenesis and 26% of genes are differentially expressed among strains. A novel design utilizing few probes provided high confidence genotyping, used here to resolve recombination points in the clonal progeny of sexual crosses. Recent sequencing of additional T. gondii isolates identifies >620 K new SNPs, including ~11 K that intersect with expression profiling probes, yielding additional markers for genotyping studies, and further validating the utility of a combined expression profiling/genotyping array design. Additional applications facilitating SNP and transcript discovery, alternative statistical methods for quantifying gene expression, etc. are also pursued at

  15. An oligonucleotide-tagged microarray for routine diagnostics of colon cancer by genotyping KRAS mutations

    DEFF Research Database (Denmark)

    Liu, Yuliang; Guðnason, Haukur; Li, Yiping

    2014-01-01

    or spiked fecal samples. The immobilized tag-probes were stable under multiple thermal cycling treatments, allowing re-use of the tag-microarray and further optimization to solid PCR. Our results demonstrated that a novel oligonucleotide-tagged microarray system has been developed which would be suitable...

  16. Development, characterization and experimental validation of a cultivated sunflower (Helianthus annuus L. gene expression oligonucleotide microarray.

    Directory of Open Access Journals (Sweden)

    Paula Fernandez

    Full Text Available Oligonucleotide-based microarrays with accurate gene coverage represent a key strategy for transcriptional studies in orphan species such as sunflower, H. annuus L., which lacks full genome sequences. The goal of this study was the development and functional annotation of a comprehensive sunflower unigene collection and the design and validation of a custom sunflower oligonucleotide-based microarray. A large scale EST (>130,000 ESTs curation, assembly and sequence annotation was performed using Blast2GO (www.blast2go.de. The EST assembly comprises 41,013 putative transcripts (12,924 contigs and 28,089 singletons. The resulting Sunflower Unigen Resource (SUR version 1.0 was used to design an oligonucleotide-based Agilent microarray for cultivated sunflower. This microarray includes a total of 42,326 features: 1,417 Agilent controls, 74 control probes for sunflower replicated 10 times (740 controls and 40,169 different non-control probes. Microarray performance was validated using a model experiment examining the induction of senescence by water deficit. Pre-processing and differential expression analysis of Agilent microarrays was performed using the Bioconductor limma package. The analyses based on p-values calculated by eBayes (p<0.01 allowed the detection of 558 differentially expressed genes between water stress and control conditions; from these, ten genes were further validated by qPCR. Over-represented ontologies were identified using FatiScan in the Babelomics suite. This work generated a curated and trustable sunflower unigene collection, and a custom, validated sunflower oligonucleotide-based microarray using Agilent technology. Both the curated unigene collection and the validated oligonucleotide microarray provide key resources for sunflower genome analysis, transcriptional studies, and molecular breeding for crop improvement.

  17. Development, characterization and experimental validation of a cultivated sunflower (Helianthus annuus L.) gene expression oligonucleotide microarray.

    Science.gov (United States)

    Fernandez, Paula; Soria, Marcelo; Blesa, David; DiRienzo, Julio; Moschen, Sebastian; Rivarola, Maximo; Clavijo, Bernardo Jose; Gonzalez, Sergio; Peluffo, Lucila; Príncipi, Dario; Dosio, Guillermo; Aguirrezabal, Luis; García-García, Francisco; Conesa, Ana; Hopp, Esteban; Dopazo, Joaquín; Heinz, Ruth Amelia; Paniego, Norma

    2012-01-01

    Oligonucleotide-based microarrays with accurate gene coverage represent a key strategy for transcriptional studies in orphan species such as sunflower, H. annuus L., which lacks full genome sequences. The goal of this study was the development and functional annotation of a comprehensive sunflower unigene collection and the design and validation of a custom sunflower oligonucleotide-based microarray. A large scale EST (>130,000 ESTs) curation, assembly and sequence annotation was performed using Blast2GO (www.blast2go.de). The EST assembly comprises 41,013 putative transcripts (12,924 contigs and 28,089 singletons). The resulting Sunflower Unigen Resource (SUR version 1.0) was used to design an oligonucleotide-based Agilent microarray for cultivated sunflower. This microarray includes a total of 42,326 features: 1,417 Agilent controls, 74 control probes for sunflower replicated 10 times (740 controls) and 40,169 different non-control probes. Microarray performance was validated using a model experiment examining the induction of senescence by water deficit. Pre-processing and differential expression analysis of Agilent microarrays was performed using the Bioconductor limma package. The analyses based on p-values calculated by eBayes (p<0.01) allowed the detection of 558 differentially expressed genes between water stress and control conditions; from these, ten genes were further validated by qPCR. Over-represented ontologies were identified using FatiScan in the Babelomics suite. This work generated a curated and trustable sunflower unigene collection, and a custom, validated sunflower oligonucleotide-based microarray using Agilent technology. Both the curated unigene collection and the validated oligonucleotide microarray provide key resources for sunflower genome analysis, transcriptional studies, and molecular breeding for crop improvement.

  18. Detection and identification of enterohemorrhagic Escherichia coli O157:H7 and Vibrio cholerae O139 using oligonucleotide microarray

    Directory of Open Access Journals (Sweden)

    Zhang Zheng

    2007-12-01

    Full Text Available Abstract Background The rapid and accurate detection and identification of the new subtype of the pathogens is crucial for diagnosis, treatment and control of the contagious disease outbreak. Here, in this study, an approach to detect and identify Escherichia coli O157:H7 and Vibrio cholerae O139 was established using oligonucleotide microarray. We coupled multiplex PCR with oligonucleotide microarray to construct an assay suitable for simultaneous identification of two subtypes of the pathogens. Results The stx1, stx2 gene and uidA gene having the specific mutant spot were chosen as the targets for Escherichia coli O157:H7, and meanwhile the ctxA, tcpA, and LPSgt gene for Vibrio cholerae O139. The oligonucleotide microarray was composed of eight probes including negative control and positive control from 16S rDNA gene. The six primers were designed to amplify target fragments in two triplex PCR, and then hybridized with oligonucleotide microarray. An internal control would be to run a PCR reaction in parallel. Multiplex PCR did not produce any non-specific amplicons when 149 related species or genera of standard bacteria were tested (100% specificity. In addition, Escherichia coli O157:H7 and Escherichia coli O157:non-H7, Vibrio cholerae O139 and Vibrio cholerae O1 had been discriminated respectively. Using recombinant plasmid and target pathogens, we were able to detect positive hybridization signals with 102 copies/μL and 103 cfu/mL per reaction. Conclusion The DNA microarray assay reported here could detect and identify Escherichia coli O157:H7 and Vibrio cholerae O139, and furthermore the subtype was distinguished. This assay was a specific and sensitive tool for simultaneous detection and identification of the new subtype of two pathogens causing diarrhea in human.

  19. LNA-modified isothermal oligonucleotide microarray for differentiating bacilli of similar origin.

    Science.gov (United States)

    Yan, Jing; Yuan, Ying; Mu, Runqing; Shang, Hong; Guan, Yifu

    2014-12-01

    Oligonucleotide microarray has been one of the most powerful tools in the 'Post-Genome Era' for its high sensitivity, high throughput and parallel processing capability. To achieve high detection specificity, we fabricated an isothermal microarray using locked nucleic acid (LNA)-modified oligonucleotide probes, since LNA has demonstrated the advanced ability to enhance the binding affinity toward their complementary nucleotides. After designing the nucleotide sequences of these oligonucleotide probes for gram-positive bacilli of similar origin (Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, Bacillus megaterium and Bacillus circulans), we unified the melting temperatures of these oligonucleotide probes by modifying some nucleotides using LNA. Furthermore, we optimized the experimental procedures of hydrating microarray slides, blocking side surface as well as labelling the PCR products. Experimental results revealed that KOD Dash DNA polymerase could efficiently incorporate Cy3-dCTP into the PCR products, and the LNA-isothermal oligonucleotide microarray were able to distinguish the bacilli of similar origin with a high degree of accuracy and specificity under the optimized experimental condition.

  20. LNA-modified isothermal oligonucleotide microarray for differentiating bacilli of similar origin

    Indian Academy of Sciences (India)

    Jing Yan; Ying Yuan; Runqing Mu; Hong Shang; Yifu Guan

    2014-12-01

    Oligonucleotide microarray has been one of the most powerful tools in the ‘Post-Genome Era’ for its high sensitivity, high throughput and parallel processing capability. To achieve high detection specificity, we fabricated an isothermal microarray using locked nucleic acid (LNA)-modified oligonucleotide probes, since LNA has demonstrated the advanced ability to enhance the binding affinity toward their complementary nucleotides. After designing the nucleotide sequences of these oligonucleotide probes for gram-positive bacilli of similar origin (Bacillus subtilis, Bacillus licheniformis, Bacillus pumilus, Bacillus megaterium and Bacillus circulans), we unified the melting temperatures of these oligonucleotide probes by modifying some nucleotides using LNA. Furthermore, we optimized the experimental procedures of hydrating microarray slides, blocking side surface as well as labelling the PCR products. Experimental results revealed that KOD Dash DNA polymerase could efficiently incorporate Cy3-dCTP into the PCR products, and the LNA-isothermal oligonucleotide microarray were able to distinguish the bacilli of similar origin with a high degree of accuracy and specificity under the optimized experimental condition.

  1. Identification of mycotoxigenic fungi using an oligonucleotide microarray

    CSIR Research Space (South Africa)

    Barros, E

    2013-01-01

    Full Text Available , numerous detection tools have been developed for the detection and analysis of various mycotoxigenic fungi. These include PCR-based assays and microarrays targeting different areas of the fungal genome depending on its application. This chapter describes...

  2. Direct Mutagenesis of Thousands of Genomic Targets using Microarray-derived Oligonucleotides

    DEFF Research Database (Denmark)

    Bonde, Mads; Kosuri, Sriram; Genee, Hans Jasper

    2015-01-01

    operons in E. coli using this method, which we call Microarray-Oligonucleotide (MO)-MAGE. The resulting mutant library was characterized by high-throughput sequencing to show that all attempted insertions were estimated to have occurred at an average frequency of 0.02 % per loci with 0.4 average...

  3. Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays

    NARCIS (Netherlands)

    Urakawa, H.; Fantroussi, El S.; Smidt, H.; Smoot, J.C.; Tribou, E.H.; Kelly, J.J.; Noble, P.A.; Stahl, D.A.

    2003-01-01

    The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of

  4. Design and application of 60mer oligonucleotide microarray in SARS coronavirus detection

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    The 60mer oligonucleotide microarray was designed and applied to detecting of SARS (severe acute respiratory syndrome) coronavirus. Thirty 60mer specific oligos were designed to cover the whole genome of the first submitted coronavirus strain, according to the sequence of TOR2 (GENEBANK Accession: AY274119). These primers were synthesized and printed into a microarray with 12×12 spots. RNAs were extracted from the throat swab and gargling fluid of SARS patients and reverse-transcripted into the double strand cDNAs. The cDNAs were prepared as restricted cDNA fragments by the restriction display (RD) technique and labeled by PCR with the Cy5-universal primer. The labeled samples were then applied to the oligo microarray for hybridization. The diagnostic capability of the microarray was evaluated after the washing and scanning steps. The scanning result showed that samples of SARS patients were hybridized with multiple SARS probes on the microarray, and there is no signal on the negative and blank controls. These results indicate that the genome of SARS coronavirus can be detected in parallel by the 60mer oligonucleotide microarray, which can improve the positive ratio of the diagnosis. The oligo microarray can also be used for monitoring the behavior of the virus genes in different stages of the disease status.

  5. Experimental analysis of oligonucleotide microarray design criteria to detect deletions by comparative genomic hybridization

    Directory of Open Access Journals (Sweden)

    Moerman Donald G

    2008-10-01

    Full Text Available Abstract Background Microarray comparative genomic hybridization (CGH is currently one of the most powerful techniques to measure DNA copy number in large genomes. In humans, microarray CGH is widely used to assess copy number variants in healthy individuals and copy number aberrations associated with various diseases, syndromes and disease susceptibility. In model organisms such as Caenorhabditis elegans (C. elegans the technique has been applied to detect mutations, primarily deletions, in strains of interest. Although various constraints on oligonucleotide properties have been suggested to minimize non-specific hybridization and improve the data quality, there have been few experimental validations for CGH experiments. For genomic regions where strict design filters would limit the coverage it would also be useful to quantify the expected loss in data quality associated with relaxed design criteria. Results We have quantified the effects of filtering various oligonucleotide properties by measuring the resolving power for detecting deletions in the human and C. elegans genomes using NimbleGen microarrays. Approximately twice as many oligonucleotides are typically required to be affected by a deletion in human DNA samples in order to achieve the same statistical confidence as one would observe for a deletion in C. elegans. Surprisingly, the ability to detect deletions strongly depends on the oligonucleotide 15-mer count, which is defined as the sum of the genomic frequency of all the constituent 15-mers within the oligonucleotide. A similarity level above 80% to non-target sequences over the length of the probe produces significant cross-hybridization. We recommend the use of a fairly large melting temperature window of up to 10°C, the elimination of repeat sequences, the elimination of homopolymers longer than 5 nucleotides, and a threshold of -1 kcal/mol on the oligonucleotide self-folding energy. We observed very little difference in data

  6. An oligonucleotide hybridization approach to DNA sequencing.

    Science.gov (United States)

    Khrapko, K R; Lysov YuP; Khorlyn, A A; Shick, V V; Florentiev, V L; Mirzabekov, A D

    1989-10-09

    We have proposed a DNA sequencing method based on hybridization of a DNA fragment to be sequenced with the complete set of fixed-length oligonucleotides (e.g., 4(8) = 65,536 possible 8-mers) immobilized individually as dots of a 2-D matrix [(1989) Dokl. Akad. Nauk SSSR 303, 1508-1511]. It was shown that the list of hybridizing octanucleotides is sufficient for the computer-assisted reconstruction of the structures for 80% of random-sequence fragments up to 200 bases long, based on the analysis of the octanucleotide overlapping. Here a refinement of the method and some experimental data are presented. We have performed hybridizations with oligonucleotides immobilized on a glass plate, and obtained their dissociation curves down to heptanucleotides. Other approaches, e.g., an additional hybridization of short oligonucleotides which continuously extend duplexes formed between the fragment and immobilized oligonucleotides, should considerably increase either the probability of unambiguous reconstruction, or the length of reconstructed sequences, or decrease the size of immobilized oligonucleotides.

  7. Improving signal intensities for genes with low-expression on oligonucleotide microarrays

    Directory of Open Access Journals (Sweden)

    Hu Limei

    2004-06-01

    Full Text Available Abstract Background DNA microarrays using long oligonucleotide probes are widely used to evaluate gene expression in biological samples. These oligonucleotides are pre-synthesized and sequence-optimized to represent specific genes with minimal cross-hybridization to homologous genes. Probe length and concentration are critical factors for signal sensitivity, particularly when genes with various expression levels are being tested. We evaluated the effects of oligonucleotide probe length and concentration on signal intensity measurements of the expression levels of genes in a target sample. Results Selected genes of various expression levels in a single cell line were hybridized to oligonucleotide arrays of four lengths and four concentrations of probes to determine how these critical parameters affected the intensity of the signal representing their expression. We found that oligonucleotides of longer length significantly increased the signals of genes with low-expression in the target. High-expressing gene signals were also boosted but to a lesser degree. Increasing the probe concentration, however, did not linearly increase the signal intensity for either low- or high-expressing genes. Conclusions We conclude that the longer the oligonuclotide probe the better the signal intensities of low expressing genes on oligonucleotide arrays.

  8. Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays

    Institute of Scientific and Technical Information of China (English)

    Lian-Qun Jin; Jun-Wen Li; Sheng-Qi Wang; Fu-Huan Chao; Xin-Wei Wang; Zheng-Quan Yuan

    2005-01-01

    AIM: To detect the common intestinal pathogenic bacteria quickly and accurately.METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays.RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified.CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus,Staphylococcus aureus, Proteus sp., Bacillus cereus,Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range,and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost.

  9. Transcript copy number estimation using a mouse whole-genome oligonucleotide microarray

    OpenAIRE

    Carter, Mark G.; Sharov, Alexei A; VanBuren, Vincent; Dudekula, Dawood B.; Carmack, Condie E; Nelson, Charlie; Ko, Minoru SH

    2005-01-01

    The ability to quantitatively measure the expression of all genes in a given tissue or cell with a single assay is an exciting promise of gene-expression profiling technology. An in situ-synthesized 60-mer oligonucleotide microarray designed to detect transcripts from all mouse genes was validated, as well as a set of exogenous RNA controls derived from the yeast genome (made freely available without restriction), which allow quantitative estimation of absolute endogenous transcript abundance.

  10. Transcript copy number estimation using a mouse whole-genome oligonucleotide microarray

    Science.gov (United States)

    Carter, Mark G; Sharov, Alexei A; VanBuren, Vincent; Dudekula, Dawood B; Carmack, Condie E; Nelson, Charlie; Ko, Minoru SH

    2005-01-01

    The ability to quantitatively measure the expression of all genes in a given tissue or cell with a single assay is an exciting promise of gene-expression profiling technology. An in situ-synthesized 60-mer oligonucleotide microarray designed to detect transcripts from all mouse genes was validated, as well as a set of exogenous RNA controls derived from the yeast genome (made freely available without restriction), which allow quantitative estimation of absolute endogenous transcript abundance. PMID:15998450

  11. nuID: a universal naming scheme of oligonucleotides for Illumina, Affymetrix, and other microarrays

    Directory of Open Access Journals (Sweden)

    Kibbe Warren A

    2007-05-01

    Full Text Available Abstract Background Oligonucleotide probes that are sequence identical may have different identifiers between manufacturers and even between different versions of the same company's microarray; and sometimes the same identifier is reused and represents a completely different oligonucleotide, resulting in ambiguity and potentially mis-identification of the genes hybridizing to that probe. Results We have devised a unique, non-degenerate encoding scheme that can be used as a universal representation to identify an oligonucleotide across manufacturers. We have named the encoded representation 'nuID', for nucleotide universal identifier. Inspired by the fact that the raw sequence of the oligonucleotide is the true definition of identity for a probe, the encoding algorithm uniquely and non-degenerately transforms the sequence itself into a compact identifier (a lossless compression. In addition, we added a redundancy check (checksum to validate the integrity of the identifier. These two steps, encoding plus checksum, result in an nuID, which is a unique, non-degenerate, permanent, robust and efficient representation of the probe sequence. For commercial applications that require the sequence identity to be confidential, we have an encryption schema for nuID. We demonstrate the utility of nuIDs for the annotation of Illumina microarrays, and we believe it has universal applicability as a source-independent naming convention for oligomers. Reviewers This article was reviewed by Itai Yanai, Rong Chen (nominated by Mark Gerstein, and Gregory Schuler (nominated by David Lipman.

  12. The "Clickable" Method for Oligonucleotide Immobilization Onto Azide-Functionalized Microarrays.

    Science.gov (United States)

    Ratajczak, Tomasz; Uszczyńska, Barbara; Frydrych-Tomczak, Emilia; Chmielewski, Marcin K

    2016-01-01

    The DNA microarray technique was supposed to help identifying and analyzing the expression level of tens of thousands of genes in the whole genome. But there is a serious problem concerning fabrication of the microarrays by chemical synthesis, such as specific and efficient linking of probes to a solid support. Therefore, we reckon that applying "click" chemistry to covalently anchor oligonucleotides on chemically modified supports may help construct microarrays in applications such as gene identification. Silanization of the glass support with organofunctional silane makes it possible to link azide groups on glass surface and the nucleic acid probe that is equipped with a pentynyl group. This is followed by direct spotting of the nucleic acid on the azide-modified glass support in the presence of copper ions, and this is a frequently applied method of "click" chemistry.

  13. Identification of chromosomal errors in human preimplantation embryos with oligonucleotide DNA microarray.

    Directory of Open Access Journals (Sweden)

    Lifeng Liang

    Full Text Available A previous study comparing the performance of different platforms for DNA microarray found that the oligonucleotide (oligo microarray platform containing 385K isothermal probes had the best performance when evaluating dosage sensitivity, precision, specificity, sensitivity and copy number variations border definition. Although oligo microarray platform has been used in some research fields and clinics, it has not been used for aneuploidy screening in human embryos. The present study was designed to use this new microarray platform for preimplantation genetic screening in the human. A total of 383 blastocysts from 72 infertility patients with either advanced maternal age or with previous miscarriage were analyzed after biopsy and microarray. Euploid blastocysts were transferred to patients and clinical pregnancy and implantation rates were measured. Chromosomes in some aneuploid blastocysts were further analyzed by fluorescence in-situ hybridization (FISH to evaluate accuracy of the results. We found that most (58.1% of the blastocysts had chromosomal abnormalities that included single or multiple gains and/or losses of chromosome(s, partial chromosome deletions and/or duplications in both euploid and aneuploid embryos. Transfer of normal euploid blastocysts in 34 cycles resulted in 58.8% clinical pregnancy and 54.4% implantation rates. Examination of abnormal blastocysts by FISH showed that all embryos had matching results comparing microarray and FISH analysis. The present study indicates that oligo microarray conducted with a higher resolution and a greater number of probes is able to detect not only aneuploidy, but also minor chromosomal abnormalities, such as partial chromosome deletion and/or duplication in human embryos. Preimplantation genetic screening of the aneuploidy by DNA microarray is an advanced technology used to select embryos for transfer and improved embryo implantation can be obtained after transfer of the screened normal

  14. Strong position-dependent effects of sequence mismatches on signal ratios measured using long oligonucleotide microarrays

    Directory of Open Access Journals (Sweden)

    Hulme Helen

    2008-07-01

    Full Text Available Abstract Background Microarrays are an important and widely used tool. Applications include capturing genomic DNA for high-throughput sequencing in addition to the traditional monitoring of gene expression and identifying DNA copy number variations. Sequence mismatches between probe and target strands are known to affect the stability of the probe-target duplex, and hence the strength of the observed signals from microarrays. Results We describe a large-scale investigation of microarray hybridisations to murine probes with known sequence mismatches, demonstrating that the effect of mismatches is strongly position-dependent and for small numbers of sequence mismatches is correlated with the maximum length of perfectly matched probe-target duplex. Length of perfect match explained 43% of the variance in log2 signal ratios between probes with one and two mismatches. The correlation with maximum length of perfect match does not conform to expectations based on considering the effect of mismatches purely in terms of reducing the binding energy. However, it can be explained qualitatively by considering the entropic contribution to duplex stability from configurations of differing perfect match length. Conclusion The results of this study have implications in terms of array design and analysis. They highlight the significant effect that short sequence mismatches can have upon microarray hybridisation intensities even for long oligonucleotide probes. All microarray data presented in this study are available from the GEO database 1, under accession number [GEO: GSE9669

  15. Improving oligonucleotide fingerprinting of rRNA genes by implementation of polony microarray technology

    Science.gov (United States)

    Ruegger, Paul M.; Bent, Elizabeth; Li, Wei; Jeske, Daniel R.; Cui, Xinping; Braun, Jonathan; Jiang, Tao; Borneman, James

    2012-01-01

    Improvements to oligonucleotide fingerprinting of rRNA genes (OFRG) were obtained by implementing polony microarray technology. OFRG is an array-based method for analyzing microbial community composition. Polonies are discrete clusters of DNA, produced by solid-phase PCR in hydrogels, and derived from individual, spatially isolated DNA molecules. The advantages of a polony-based OFRG method include higher throughput and reductions in the PCR-induced errors and compositional skew inherent in all other PCR-based community composition methods, including high throughput sequencing of rRNA genes. Given the similarities between polony microarrays and certain aspects of sequencing methods such as the Illumina platform, we suggest that if concepts presented in this study were implemented in high throughput sequencing protocols, a reduction of PCR-induced errors and compositional skew may be realized. PMID:22640891

  16. A comparison of alternative 60-mer probe designs in an in-situ synthesized oligonucleotide microarray

    Directory of Open Access Journals (Sweden)

    Fairbanks Benjamin D

    2006-04-01

    Full Text Available Abstract Background DNA microarrays have proven powerful for functional genomics studies. Several technologies exist for the generation of whole-genome arrays. It is well documented that 25mer probes directed against different regions of the same gene produce variable signal intensity values. However, the extent to which this is true for probes of greater length (60mers is not well characterized. Moreover, this information has not previously been reported for whole-genome arrays designed against bacteria, whose genomes may differ substantially in characteristics directly affecting microarray performance. Results We report here an analysis of alternative 60mer probe designs for an in-situ synthesized oligonucleotide array for the GC rich, β-proteobacterium Burkholderia cenocepacia. Probes were designed using the ArrayOligoSel3.5 software package and whole-genome microarrays synthesized by Agilent, Inc. using their in-situ, ink-jet technology platform. We first validated the quality of the microarrays as demonstrated by an average signal to noise ratio of >1000. Next, we determined that the variance of replicate probes (1178 total probes examined of identical sequence was 3.8% whereas the variance of alternative probes (558 total alternative probes examined designs was 9.5%. We determined that depending upon the definition, about 2.4% of replicate and 7.8% of alternative probes produced outlier conclusions. Finally, we determined none of the probe design subscores (GC content, internal repeat, binding energy and self annealment produced by ArrayOligoSel3.5 were predictive or probes that produced outlier signals. Conclusion Our analysis demonstrated that the use of multiple probes per target sequence is not essential for in-situ synthesized 60mer oligonucleotide arrays designed against bacteria. Although probes producing outlier signals were identified, the use of ratios results in less than 10% of such outlier conclusions. We also determined that

  17. Multi-gene detection and identification of mosquito-borne RNA viruses using an oligonucleotide microarray.

    Directory of Open Access Journals (Sweden)

    Nathan D Grubaugh

    Full Text Available BACKGROUND: Arthropod-borne viruses are important emerging pathogens world-wide. Viruses transmitted by mosquitoes, such as dengue, yellow fever, and Japanese encephalitis viruses, infect hundreds of millions of people and animals each year. Global surveillance of these viruses in mosquito vectors using molecular based assays is critical for prevention and control of the associated diseases. Here, we report an oligonucleotide DNA microarray design, termed ArboChip5.1, for multi-gene detection and identification of mosquito-borne RNA viruses from the genera Flavivirus (family Flaviviridae, Alphavirus (Togaviridae, Orthobunyavirus (Bunyaviridae, and Phlebovirus (Bunyaviridae. METHODOLOGY/PRINCIPAL FINDINGS: The assay utilizes targeted PCR amplification of three genes from each virus genus for electrochemical detection on a portable, field-tested microarray platform. Fifty-two viruses propagated in cell-culture were used to evaluate the specificity of the PCR primer sets and the ArboChip5.1 microarray capture probes. The microarray detected all of the tested viruses and differentiated between many closely related viruses such as members of the dengue, Japanese encephalitis, and Semliki Forest virus clades. Laboratory infected mosquitoes were used to simulate field samples and to determine the limits of detection. Additionally, we identified dengue virus type 3, Japanese encephalitis virus, Tembusu virus, Culex flavivirus, and a Quang Binh-like virus from mosquitoes collected in Thailand in 2011 and 2012. CONCLUSIONS/SIGNIFICANCE: We demonstrated that the described assay can be utilized in a comprehensive field surveillance program by the broad-range amplification and specific identification of arboviruses from infected mosquitoes. Furthermore, the microarray platform can be deployed in the field and viral RNA extraction to data analysis can occur in as little as 12 h. The information derived from the ArboChip5.1 microarray can help to establish

  18. Analysis of gene expression profiles in human systemic lupus erythematosus using oligonucleotide microarray.

    Science.gov (United States)

    Han, G-M; Chen, S-L; Shen, N; Ye, S; Bao, C-D; Gu, Y-Y

    2003-04-01

    Epidemiologic studies suggest a strong genetic component for susceptibility to systemic lupus erythematosus (SLE). To investigate the genetic mechanism of pathogenesis of SLE, we studied the difference in gene expression of peripheral blood cells between 10 SLE patients and 18 healthy controls using oligonucleotide microarray. When gene expression for patients was compared to the mean of normal controls, among the 3002 target genes, 61 genes were identified with greater than a two-fold change difference in expression level. Of these genes, 24 were upregulated and 37 downregulated in at least half of the patients. By the Welch's ANOVA/Welch's t-test, all these 61 genes were significantly different (PTSA-1/Sca-2) may play an important role in the mechanism of SLE pathogenesis. TSA-1 antigens may represent an important alternative pathway for T-cell activation that may be involved in IFN-mediated immunomodulation. Hierarchical clustering showed that patient samples were clearly separated from controls based on their gene expression profile. These results demonstrate that high-density oligonucleotide microarray has the potential to explore the mechanism of pathogenesis of systemic lupus erythematosus.

  19. Assessment and integration of publicly available SAGE, cDNA microarray, and oligonucleotide microarray expression data for global coexpression analyses.

    Science.gov (United States)

    Griffith, Obi L; Pleasance, Erin D; Fulton, Debra L; Oveisi, Mehrdad; Ester, Martin; Siddiqui, Asim S; Jones, Steven J M

    2005-10-01

    Large amounts of gene expression data from several different technologies are becoming available to the scientific community. A common practice is to use these data to calculate global gene coexpression for validation or integration of other "omic" data. To assess the utility of publicly available datasets for this purpose we have analyzed Homo sapiens data from 1202 cDNA microarray experiments, 242 SAGE libraries, and 667 Affymetrix oligonucleotide microarray experiments. The three datasets compared demonstrate significant but low levels of global concordance (rc<0.11). Assessment against Gene Ontology (GO) revealed that all three platforms identify more coexpressed gene pairs with common biological processes than expected by chance. As the Pearson correlation for a gene pair increased it was more likely to be confirmed by GO. The Affymetrix dataset performed best individually with gene pairs of correlation 0.9-1.0 confirmed by GO in 74% of cases. However, in all cases, gene pairs confirmed by multiple platforms were more likely to be confirmed by GO. We show that combining results from different expression platforms increases reliability of coexpression. A comparison with other recently published coexpression studies found similar results in terms of performance against GO but with each method producing distinctly different gene pair lists.

  20. Mismatch oligonucleotides in human and yeast: guidelines for probe design on tiling microarrays

    Directory of Open Access Journals (Sweden)

    Jee Justin

    2008-12-01

    Full Text Available Abstract Background Mismatched oligonucleotides are widely used on microarrays to differentiate specific from nonspecific hybridization. While many experiments rely on such oligos, the hybridization behavior of various degrees of mismatch (MM structure has not been extensively studied. Here, we present the results of two large-scale microarray experiments on S. cerevisiae and H. sapiens genomic DNA, to explore MM oligonucleotide behavior with real sample mixtures under tiling-array conditions. Results We examined all possible nucleotide substitutions at the central position of 36-nucleotide probes, and found that nonspecific binding by MM oligos depends upon the individual nucleotide substitutions they incorporate: C→A, C→G and T→A (yielding purine-purine mispairs are most disruptive, whereas A→X were least disruptive. We also quantify a marked GC skew effect: substitutions raising probe GC content exhibit higher intensity (and vice versa. This skew is small in highly-expressed regions (± 0.5% of total intensity range and large (± 2% or more elsewhere. Multiple mismatches per oligo are largely additive in effect: each MM added in a distributed fashion causes an additional 21% intensity drop relative to PM, three-fold more disruptive than adding adjacent mispairs (7% drop per MM. Conclusion We investigate several parameters for oligonucleotide design, including the effects of each central nucleotide substitution on array signal intensity and of multiple MM per oligo. To avoid GC skew, individual substitutions should not alter probe GC content. RNA sample mixture complexity may increase the amount of nonspecific hybridization, magnify GC skew and boost the intensity of MM oligos at all levels.

  1. Construction and Evaluation of Desulfovibrio vulgaris Whole-Genome Oligonucleotide Microarrays

    Energy Technology Data Exchange (ETDEWEB)

    Z. He; Q. He; L. Wu; M.E. Clark; J.D. Wall; Jizhong Zhou; Matthew W. Fields

    2004-03-17

    Desulfovibrio vulgaris Hildenborough has been the focus of biochemical and physiological studies in the laboratory, and the metabolic versatility of this organism has been largely recognized, particularly the reduction of sulfate, fumarate, iron, uranium and chromium. In addition, a Desulfovibrio sp. has been shown to utilize uranium as the sole electron acceptor. D. vulgaris is a d-Proteobacterium with a genome size of 3.6 Mb and 3584 ORFs. The whole-genome microarrays of D. vulgaris have been constructed using 70mer oligonucleotides. All ORFs in the genome were represented with 3471 (97.1%) unique probes and 103 (2.9%) non-specific probes that may have cross-hybridization with other ORFs. In preparation for use of the experimental microarrays, artificial probes and targets were designed to assess specificity and sensitivity and identify optimal hybridization conditions for oligonucleotide microarrays. The results indicated that for 50mer and 70mer oligonucleotide arrays, hybridization at 45 C to 50 C, washing at 37 C and a wash time of 2.5 to 5 minutes obtained specific and strong hybridization signals. In order to evaluate the performance of the experimental microarrays, growth conditions were selected that were expected to give significant hybridization differences for different sets of genes. The initial evaluations were performed using D. vulgaris cells grown at logarithmic and stationary phases. Transcriptional analysis of D. vulgaris cells sampled during logarithmic phase growth indicated that 25% of annotated ORFs were up-regulated and 3% of annotated ORFs were downregulated compared to stationary phase cells. The up-regulated genes included ORFs predicted to be involved with acyl chain biosynthesis, amino acid ABC transporter, translational initiation factors, and ribosomal proteins. In the stationary phase growth cells, the two most up-regulated ORFs (70-fold) were annotated as a carboxynorspermidine decarboxylase and a 2C-methyl-D-erythritol-2

  2. Identification of biomarkers for cervical cancer in peripheral blood lymphocytes using oligonucleotide microarrays

    Institute of Scientific and Technical Information of China (English)

    SHENG Jie; ZHANG Wei-yuan

    2010-01-01

    Background Oligonucleotide microarrays are increasingly being used to identify gene expression profiles that associated with complex genetic diseases. Peripheral lymphocytes communicate with cells and extracellular matrixes in almost all tissues and organs in human body, suggesting that the gene expression profiles in peripheral lymphocytes may reflect the presence of disease in the body. This study aimed to identify molecular biomarkers for cervical cancer in peripheral blood lymphocytes by using oligonucleotide microarrays.Methods Total RNA was extracted from peripheral blood lymphocytes of 24 early stage cervical cancer patients and 18 healthy controls. We used 22K Human Genome microarrays to profile peripheral blood lymphocytes from 4 early stage cervical cancer patients and compared their gene expression profiles with those from 3 healthy controls. Differentially expressed genes would be identified if they had adjusted P values of less than 0.05 and a groupwise average fold change greater than 1.5 or less than 0.67. Then the selected 5 genes were validated in the remaining 20 early stage cervical cancer patients and the 15 healthy controls by using real-time reverse-transcription polymerase chain reaction (RT-PCR).Results Genes identified by the gene selection program expressed differently between the blood samples of the early stage cervical cancer patients and those of the healthy controls. To validate the gene expression data, 5 genes were analyzed by real-time RT-PCR. In three of the 5 identified genes, tenasin-c (TNC), nuceolin (NCL), and enolase 2 (ENO2) showed a significant up-regulation in the blood samples of the early stage cervical cancer patients versus that of the healthy controls.Conclusions The up-regulation of TNC, NCL, and ENO2 in peripheral blood may be used to identify novel blood biomarkers for detecting cervical cancer in a clinically accessible surrogate tissue, and thus to provide a possibility to develop a noninvasive and predictive

  3. A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.

    Science.gov (United States)

    Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei

    2014-01-01

    Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.

  4. Development and validation of an oligonucleotide microarray to characterise ectomycorrhizal fungal communities

    Directory of Open Access Journals (Sweden)

    Reich Marlis

    2009-01-01

    Full Text Available Abstract Background In forest ecosystems, communities of ectomycorrhizal fungi (ECM are influenced by several biotic and abiotic factors. To understand their underlying dynamics, ECM communities have been surveyed with ribosomal DNA-based sequencing methods. However, most identification methods are both time-consuming and limited by the number of samples that can be treated in a realistic time frame. As a result of ongoing implementation, the array technique has gained throughput capacity in terms of the number of samples and the capacity for parallel identification of several species. Thus far, although phylochips (microarrays that are used to detect species have been mostly developed to trace bacterial communities or groups of specific fungi, no phylochip has been developed to carry oligonucleotides for several ectomycorrhizal species that belong to different genera. Results We have constructed a custom ribosomal DNA phylochip to identify ECM fungi. Specific oligonucleotide probes were targeted to the nuclear internal transcribed spacer (ITS regions from 95 fungal species belonging to 21 ECM fungal genera. The phylochip was first validated using PCR amplicons of reference species. Ninety-nine percent of the tested oligonucleotides generated positive hybridisation signals with their corresponding amplicons. Cross-hybridisation was mainly restricted at the genus level, particularly for Cortinarius and Lactarius species. The phylochip was subsequently tested with environmental samples that were composed of ECM fungal DNA from spruce and beech plantation fungal communities. The results were in concordance with the ITS sequencing of morphotypes and the ITS clone library sequencing results that were obtained using the same PCR products. Conclusion For the first time, we developed a custom phylochip that is specific for several ectomycorrhizal fungi. To overcome cross-hybridisation problems, specific filter and evaluation strategies that used spot

  5. Identification of upper respiratory tract pathogens using electrochemical detection on an oligonucleotide microarray.

    Directory of Open Access Journals (Sweden)

    Michael J Lodes

    Full Text Available Bacterial and viral upper respiratory infections (URI produce highly variable clinical symptoms that cannot be used to identify the etiologic agent. Proper treatment, however, depends on correct identification of the pathogen involved as antibiotics provide little or no benefit with viral infections. Here we describe a rapid and sensitive genotyping assay and microarray for URI identification using standard amplification and hybridization techniques, with electrochemical detection (ECD on a semiconductor-based oligonucleotide microarray. The assay was developed to detect four bacterial pathogens (Bordetella pertussis, Streptococcus pyogenes, Chlamydia pneumoniae and Mycoplasma pneumoniae and 9 viral pathogens (adenovirus 4, coronavirus OC43, 229E and HK, influenza A and B, parainfluenza types 1, 2, and 3 and respiratory syncytial virus. This new platform forms the basis for a fully automated diagnostics system that is very flexible and can be customized to suit different or additional pathogens. Multiple probes on a flexible platform allow one to test probes empirically and then select highly reactive probes for further iterative evaluation. Because ECD uses an enzymatic reaction to create electrical signals that can be read directly from the array, there is no need for image analysis or for expensive and delicate optical scanning equipment. We show assay sensitivity and specificity that are excellent for a multiplexed format.

  6. Oligonucleotide microarray identifies genes differentially expressed during tumorigenesis of DMBA-induced pancreatic cancer in rats.

    Directory of Open Access Journals (Sweden)

    Jun-Chao Guo

    Full Text Available The extremely dismal prognosis of pancreatic cancer (PC is attributed, at least in part, to lack of early diagnosis. Therefore, identifying differentially expressed genes in multiple steps of tumorigenesis of PC is of great interest. In the present study, a 7,12-dimethylbenzanthraene (DMBA-induced PC model was established in male Sprague-Dawley rats. The gene expression profile was screened using an oligonucleotide microarray, followed by real-time quantitative polymerase chain reaction (qRT-PCR and immunohistochemical staining validation. A total of 661 differentially expressed genes were identified in stages of pancreatic carcinogenesis. According to GO classification, these genes were involved in multiple molecular pathways. Using two-way hierarchical clustering analysis, normal pancreas, acute and chronic pancreatitis, PanIN, early and advanced pancreatic cancer were completely discriminated. Furthermore, 11 upregulated and 142 downregulated genes (probes were found by Mann-Kendall trend Monotone test, indicating homologous genes of rat and human. The qRT-PCR and immunohistochemistry analysis of CXCR7 and UBe2c, two of the identified genes, confirmed the microarray results. In human PC cell lines, knockdown of CXCR7 resulted in decreased migration and invasion. Collectively, our data identified several promising markers and therapeutic targets of PC based on a comprehensive screening and systemic validation.

  7. Design and verification of a pangenome microarray oligonucleotide probe set for Dehalococcoides spp.

    Science.gov (United States)

    Hug, Laura A; Salehi, Maryam; Nuin, Paulo; Tillier, Elisabeth R; Edwards, Elizabeth A

    2011-08-01

    Dehalococcoides spp. are an industrially relevant group of Chloroflexi bacteria capable of reductively dechlorinating contaminants in groundwater environments. Existing Dehalococcoides genomes revealed a high level of sequence identity within this group, including 98 to 100% 16S rRNA sequence identity between strains with diverse substrate specificities. Common molecular techniques for identification of microbial populations are often not applicable for distinguishing Dehalococcoides strains. Here we describe an oligonucleotide microarray probe set designed based on clustered Dehalococcoides genes from five different sources (strain DET195, CBDB1, BAV1, and VS genomes and the KB-1 metagenome). This "pangenome" probe set provides coverage of core Dehalococcoides genes as well as strain-specific genes while optimizing the potential for hybridization to closely related, previously unknown Dehalococcoides strains. The pangenome probe set was compared to probe sets designed independently for each of the five Dehalococcoides strains. The pangenome probe set demonstrated better predictability and higher detection of Dehalococcoides genes than strain-specific probe sets on nontarget strains with pangenome probe set performs more robustly than the combined strain-specific probe sets in the detection of genes not included in the original design. The pangenome probe set represents a highly specific, universal tool for the detection and characterization of Dehalococcoides from contaminated sites. It has the potential to become a common platform for Dehalococcoides-focused research, allowing meaningful comparisons between microarray experiments regardless of the strain examined.

  8. Oligonucleotide microarray identifies genes differentially expressed during tumorigenesis of DMBA-induced pancreatic cancer in rats.

    Science.gov (United States)

    Guo, Jun-Chao; Li, Jian; Yang, Ying-Chi; Zhou, Li; Zhang, Tai-Ping; Zhao, Yu-Pei

    2013-01-01

    The extremely dismal prognosis of pancreatic cancer (PC) is attributed, at least in part, to lack of early diagnosis. Therefore, identifying differentially expressed genes in multiple steps of tumorigenesis of PC is of great interest. In the present study, a 7,12-dimethylbenzanthraene (DMBA)-induced PC model was established in male Sprague-Dawley rats. The gene expression profile was screened using an oligonucleotide microarray, followed by real-time quantitative polymerase chain reaction (qRT-PCR) and immunohistochemical staining validation. A total of 661 differentially expressed genes were identified in stages of pancreatic carcinogenesis. According to GO classification, these genes were involved in multiple molecular pathways. Using two-way hierarchical clustering analysis, normal pancreas, acute and chronic pancreatitis, PanIN, early and advanced pancreatic cancer were completely discriminated. Furthermore, 11 upregulated and 142 downregulated genes (probes) were found by Mann-Kendall trend Monotone test, indicating homologous genes of rat and human. The qRT-PCR and immunohistochemistry analysis of CXCR7 and UBe2c, two of the identified genes, confirmed the microarray results. In human PC cell lines, knockdown of CXCR7 resulted in decreased migration and invasion. Collectively, our data identified several promising markers and therapeutic targets of PC based on a comprehensive screening and systemic validation.

  9. Development of an oligonucleotide microarray for the detection and monitoring of marine dinoflagellates.

    Science.gov (United States)

    Galluzzi, Luca; Cegna, Alessandra; Casabianca, Silvia; Penna, Antonella; Saunders, Nick; Magnani, Mauro

    2011-02-01

    Harmful Algal Blooms (HABs), mainly caused by dinoflagellates and diatoms, have great economic and sanitary implications. An important contribution for the comprehension of HAB phenomena and for the identification of risks related to toxic algal species is given by the monitoring programs. In the microscopy-based monitoring methods, harmful species are distinguished through their morphological characteristics. This can be time consuming and requires great taxonomic expertise due to the existence of morphologically close-related species. The high throughput, automation possibility and specificity of microarray-based detection assay, makes this technology very promising for qualitative detection of HAB species. In this study, an oligonucleotide microarray targeted to the ITS1-5.8S-ITS2 rDNA region of nine toxic dinoflagellate species/clades was designed and evaluated. Two probes (45-47 nucleotides in length) were designed for each species/clade to reduce the potential for false positives. The specificity and sensitivity of the probes were evaluated with ITS1-5.8S-ITS2 PCR amplicons obtained from 20 dinoflagellates cultured strains. Cross hybridization experiments confirmed the probe specificity; moreover, the assay showed a good sensitivity, allowing the detection of up to 2 ng of labeled PCR product. The applicability of the assay with field samples was demonstrated using net concentrated seawater samples, un-spiked or spiked with known amounts of cultured cells. Despite the general application of microarray technology for harmful algae detection is not new, a peculiar group of target species/clades has been included in this new-format assay. Moreover, novelties regarding mainly the probes and the target rDNA region have allowed sensitivity improvements in comparison to previously published studies.

  10. A Tandem Oligonucleotide Approach for SNP-Selective RNA Degradation Using Modified Antisense Oligonucleotides.

    Science.gov (United States)

    Magner, Dorota; Biala, Ewa; Lisowiec-Wachnicka, Jolanta; Kierzek, Elzbieta; Kierzek, Ryszard

    2015-01-01

    Antisense oligonucleotides have been studied for many years as a tool for gene silencing. One of the most difficult cases of selective RNA silencing involves the alleles of single nucleotide polymorphisms, in which the allele sequence is differentiated by a single nucleotide. A new approach to improve the performance of allele selectivity for antisense oligonucleotides is proposed. It is based on the simultaneous application of two oligonucleotides. One is complementary to the mutated form of the targeted RNA and is able to activate RNase H to cleave the RNA. The other oligonucleotide, which is complementary to the wild type allele of the targeted RNA, is able to inhibit RNase H cleavage. Five types of SNPs, C/G, G/C, G/A, A/G, and C/U, were analyzed within the sequence context of genes associated with neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease, ALS (Amyotrophic Lateral Sclerosis), and Machado-Joseph disease. For most analyzed cases, the application of the tandem approach increased allele-selective RNA degradation 1.5-15 fold relative to the use of a single antisense oligonucleotide. The presented study proves that differentiation between single substitution is highly dependent on the nature of the SNP and surrounding nucleotides. These variables are crucial for determining the proper length of the inhibitor antisense oligonucleotide. In the tandem approach, the comparison of thermodynamic stability of the favorable duplexes WT RNA-inhibitor and Mut RNA-gapmer with the other possible duplexes allows for the evaluation of chances for the allele-selective degradation of RNA. A larger difference in thermodynamic stability between favorable duplexes and those that could possibly form, usually results in the better allele selectivity of RNA degradation.

  11. Optimization of candidate-gene SNP-genotyping by flexible oligonucleotide microarrays; analyzing variations in immune regulator genes of hay-fever samples

    Directory of Open Access Journals (Sweden)

    Beier Markus

    2007-08-01

    Full Text Available Abstract Background Genetic variants in immune regulator genes have been associated with numerous diseases, including allergies and cancer. Increasing evidence suggests a substantially elevated disease risk in individuals who carry a combination of disease-relevant single nucleotide polymorphisms (SNPs. For the genotyping of immune regulator genes, such as cytokines, chemokines and transcription factors, an oligonucleotide microarray for the analysis of 99 relevant SNPs was established. Since the microarray design was based on a platform that permits flexible in situ oligonucleotide synthesis, a set of optimally performing probes could be defined by a selection approach that combined computational and experimental aspects. Results While the in silico process eliminated 9% of the initial probe set, which had been picked purely on the basis of potential association with disease, the subsequent experimental validation excluded more than twice as many. The performance of the optimized microarray was demonstrated in a pilot study. The genotypes of 19 hay-fever patients (aged 40–44 with high IgE levels against inhalant antigens were compared to the results obtained with 19 age- and sex-matched controls. For several variants, allele-frequency differences of more than 10% were identified. Conclusion Based on the ability to improve empirically a chip design, the application of candidate-SNP typing represents a viable approach in the context of molecular epidemiological studies.

  12. Early changes in gene expression profiles of hepatic GVHD uncovered by oligonucleotide microarrays.

    Science.gov (United States)

    Ichiba, Tamotsu; Teshima, Takanori; Kuick, Rork; Misek, David E; Liu, Chen; Takada, Yuichiro; Maeda, Yoshinobu; Reddy, Pavan; Williams, Debra L; Hanash, Samir M; Ferrara, James L M

    2003-07-15

    The liver, skin, and gastrointestinal tract are major target organs of acute graft-versus-host disease (GVHD), the major complication of allogeneic bone marrow transplantation (BMT). In order to gain a better understanding of acute GVHD in the liver, we compared the gene expression profiles of livers after experimental allogeneic and syngeneic BMT using oligonucleotide microarray. At 35 days after allogeneic BMT when hepatic GVHD was histologically evident, genes related to cellular effectors and acute-phase proteins were up-regulated, whereas genes largely related to metabolism and endocrine function were down-regulated. At day 7 after BMT before the development of histologic changes in the liver, interferon gamma (IFN-gamma)-inducible genes, major histocompatibility (MHC) class II molecules, and genes related to leukocyte trafficking had been up-regulated. Immunohistochemistry demonstrated that expression of IFN-gamma protein itself was increased in the spleen but not in hepatic tissue. These results suggest that the increased expression of genes associated with the attraction and activation of donor T cells induced by IFN-gamma early after BMT is important in the initiation of hepatic GVHD in this model and provide new potential molecular targets for early detection and intervention of acute GVHD.

  13. Gene Expression Profile Differences in Gastric Cancer and Normal Gastric Mucosa by Oligonucleotide Microarrays

    Institute of Scientific and Technical Information of China (English)

    Chuanding Yu; Shenhua Xu; HangZhou Mou; Zhiming Jiang; Chihong Zhu; Xianglin Liu

    2006-01-01

    OBJECTIVE To study the difference of gene expression in gastric cancer (T) and normal tissue of gastric mucosa (C), and to screen for associated novel genes in gastric cancers by oligonucleotide microarrays.METHODS U133A (Affymetrix, Santa Clara, CA) gene chip was used to detect the gene expression profile difference in T and C. Bioinformatics was used to analyze the detected results.RESULTS When gastric cancers were compared with normal gastric mucosa, a total of 270 genes were found with a difference of more than 9times in expression levels. Of the 270 genes, 157 were up-regulated (Signal Log Ratio [SLR] ≥3), and 113 were down-regulated (SLR ≤-3).Using a classification of function, the highest number of gene expression differences related to enzymes and their regulatory genes (67, 24.8%),followed by signal-transduction genes (43,15.9%). The third were nucleic acid binding genes (17, 6.3%), fourth were transporter genes (15, 5.5%)and fifth were protein binding genes (12, 4.4%). In addition there were 50genes of unknown function, accounting for 18.5%. The five above mentioned groups made up 56.9% of the total gene number.CONCLUSION The 5 gene groups (enzymes and their regulatory proteins, signal transduction proteins, nucleic acid binding proteins, transporter and protein binding) were abnormally expressed and are important genes for further study in gastric cancers.

  14. Specific discrimination of three pathogenic Salmonella enterica subsp. enterica serotypes by carB-based oligonucleotide microarray.

    Science.gov (United States)

    Shin, Hwa Hui; Hwang, Byeong Hee; Seo, Jeong Hyun; Cha, Hyung Joon

    2014-01-01

    It is important to rapidly and selectively detect and analyze pathogenic Salmonella enterica subsp. enterica in contaminated food to reduce the morbidity and mortality of Salmonella infection and to guarantee food safety. In the present work, we developed an oligonucleotide microarray containing duplicate specific capture probes based on the carB gene, which encodes the carbamoyl phosphate synthetase large subunit, as a competent biomarker evaluated by genetic analysis to selectively and efficiently detect and discriminate three S. enterica subsp. enterica serotypes: Choleraesuis, Enteritidis, and Typhimurium. Using the developed microarray system, three serotype targets were successfully analyzed in a range as low as 1.6 to 3.1 nM and were specifically discriminated from each other without nonspecific signals. In addition, the constructed microarray did not have cross-reactivity with other common pathogenic bacteria and even enabled the clear discrimination of the target Salmonella serotype from a bacterial mixture. Therefore, these results demonstrated that our novel carB-based oligonucleotide microarray can be used as an effective and specific detection system for S. enterica subsp. enterica serotypes.

  15. Sample phenotype clusters in high-density oligonucleotide microarray data sets are revealed using Isomap, a nonlinear algorithm

    Directory of Open Access Journals (Sweden)

    Malyj Wasyl

    2005-08-01

    Full Text Available Abstract Background Life processes are determined by the organism's genetic profile and multiple environmental variables. However the interaction between these factors is inherently non-linear 1. Microarray data is one representation of the nonlinear interactions among genes and genes and environmental factors. Still most microarray studies use linear methods for the interpretation of nonlinear data. In this study, we apply Isomap, a nonlinear method of dimensionality reduction, to analyze three independent large Affymetrix high-density oligonucleotide microarray data sets. Results Isomap discovered low-dimensional structures embedded in the Affymetrix microarray data sets. These structures correspond to and help to interpret biological phenomena present in the data. This analysis provides examples of temporal, spatial, and functional processes revealed by the Isomap algorithm. In a spinal cord injury data set, Isomap discovers the three main modalities of the experiment – location and severity of the injury and the time elapsed after the injury. In a multiple tissue data set, Isomap discovers a low-dimensional structure that corresponds to anatomical locations of the source tissues. This model is capable of describing low- and high-resolution differences in the same model, such as kidney-vs.-brain and differences between the nuclei of the amygdala, respectively. In a high-throughput drug screening data set, Isomap discovers the monocytic and granulocytic differentiation of myeloid cells and maps several chemical compounds on the two-dimensional model. Conclusion Visualization of Isomap models provides useful tools for exploratory analysis of microarray data sets. In most instances, Isomap models explain more of the variance present in the microarray data than PCA or MDS. Finally, Isomap is a promising new algorithm for class discovery and class prediction in high-density oligonucleotide data sets.

  16. Large scale real-time PCR validation on gene expression measurements from two commercial long-oligonucleotide microarrays

    Directory of Open Access Journals (Sweden)

    Chan Frances

    2006-03-01

    Full Text Available Abstract Background DNA microarrays are rapidly becoming a fundamental tool in discovery-based genomic and biomedical research. However, the reliability of the microarray results is being challenged due to the existence of different technologies and non-standard methods of data analysis and interpretation. In the absence of a "gold standard"/"reference method" for the gene expression measurements, studies evaluating and comparing the performance of various microarray platforms have often yielded subjective and conflicting conclusions. To address this issue we have conducted a large scale TaqMan® Gene Expression Assay based real-time PCR experiment and used this data set as the reference to evaluate the performance of two representative commercial microarray platforms. Results In this study, we analyzed the gene expression profiles of three human tissues: brain, lung, liver and one universal human reference sample (UHR using two representative commercial long-oligonucleotide microarray platforms: (1 Applied Biosystems Human Genome Survey Microarrays (based on single-color detection; (2 Agilent Whole Human Genome Oligo Microarrays (based on two-color detection. 1,375 genes represented by both microarray platforms and spanning a wide dynamic range in gene expression levels, were selected for TaqMan® Gene Expression Assay based real-time PCR validation. For each platform, four technical replicates were performed on the same total RNA samples according to each manufacturer's standard protocols. For Agilent arrays, comparative hybridization was performed using incorporation of Cy5 for brain/lung/liver RNA and Cy3 for UHR RNA (common reference. Using the TaqMan® Gene Expression Assay based real-time PCR data set as the reference set, the performance of the two microarray platforms was evaluated focusing on the following criteria: (1 Sensitivity and accuracy in detection of expression; (2 Fold change correlation with real-time PCR data in pair

  17. Structured oligonucleotides for target indexing to allow single-vessel PCR amplification and solid support microarray hybridization.

    Science.gov (United States)

    Girard, Laurie D; Boissinot, Karel; Peytavi, Régis; Boissinot, Maurice; Bergeron, Michel G

    2015-02-07

    The combination of molecular diagnostic technologies is increasingly used to overcome limitations on sensitivity, specificity or multiplexing capabilities, and provide efficient lab-on-chip devices. Two such techniques, PCR amplification and microarray hybridization are used serially to take advantage of the high sensitivity and specificity of the former combined with high multiplexing capacities of the latter. These methods are usually performed in different buffers and reaction chambers. However, these elaborate methods have high complexity and cost related to reagent requirements, liquid storage and the number of reaction chambers to integrate into automated devices. Furthermore, microarray hybridizations have a sequence dependent efficiency not always predictable. In this work, we have developed the concept of a structured oligonucleotide probe which is activated by cleavage from polymerase exonuclease activity. This technology is called SCISSOHR for Structured Cleavage Induced Single-Stranded Oligonucleotide Hybridization Reaction. The SCISSOHR probes enable indexing the target sequence to a tag sequence. The SCISSOHR technology also allows the combination of nucleic acid amplification and microarray hybridization in a single vessel in presence of the PCR buffer only. The SCISSOHR technology uses an amplification probe that is irreversibly modified in presence of the target, releasing a single-stranded DNA tag for microarray hybridization. Each tag is composed of a 3-nucleotide sequence-dependent segment and a unique "target sequence-independent" 14-nucleotide segment allowing for optimal hybridization with minimal cross-hybridization. We evaluated the performance of five (5) PCR buffers to support microarray hybridization, compared to a conventional hybridization buffer. Finally, as a proof of concept, we developed a multiplexed assay for the amplification, detection, and identification of three (3) DNA targets. This new technology will facilitate the design

  18. Tests for differential gene expression using weights in oligonucleotide microarray experiments

    Directory of Open Access Journals (Sweden)

    Beyene Joseph

    2006-02-01

    Full Text Available Abstract Background Microarray data analysts commonly filter out genes based on a number of ad hoc criteria prior to any high-level statistical analysis. Such ad hoc approaches could lead to conflicting conclusions with no clear guidance as to which method is most likely to be reproducible. Furthermore, the number of tests performed with concomitant inflation in type I error also plagues the statistical analysis of microarray data, since the number of tested quantities in a study significantly affects the family-wise error rate. It would, therefore, be very useful to develop and adopt strategies that allow quantification of the quality of each probeset, to filter out or give little credence to low-quality or unexpressed probesets, and to incorporate these strategies into gene selection within a multiple testing framework. Results We have proposed a unified scheme for filtering and gene selection. For Affymetrix gene expression microarrays, we developed new methods for measuring the reliability of a particular probeset in a single array, and we used these to develop measures for a set of arrays. These measures are then used as weights in standard t-statistic calculations, and are incorporated into the multiple testing procedures. We demonstrated the advantages of our methods using simulated data, publicly available spiked-in data as well as data comparing normal muscle to muscle from patients with Duchenne muscular dystrophy (DMD, in which a set of truly differentially expressed genes is known. Conclusion Our quality measures provide convenient ways to search for individual genes of high quality. The quality weighting strategies we proposed for testing differential gene expression have demonstrable improvement on the traditional filtering methods, the standard t-statistic and a regularized t-statistic in Affymetrix data analysis.

  19. Shrinkage covariance matrix approach for microarray data

    Science.gov (United States)

    Karjanto, Suryaefiza; Aripin, Rasimah

    2013-04-01

    Microarray technology was developed for the purpose of monitoring the expression levels of thousands of genes. A microarray data set typically consists of tens of thousands of genes (variables) from just dozens of samples due to various constraints including the high cost of producing microarray chips. As a result, the widely used standard covariance estimator is not appropriate for this purpose. One such technique is the Hotelling's T2 statistic which is a multivariate test statistic for comparing means between two groups. It requires that the number of observations (n) exceeds the number of genes (p) in the set but in microarray studies it is common that n Hotelling's T2 statistic with the shrinkage approach is proposed to estimate the covariance matrix for testing differential gene expression. The performance of this approach is then compared with other commonly used multivariate tests using a widely analysed diabetes data set as illustrations. The results across the methods are consistent, implying that this approach provides an alternative to existing techniques.

  20. Reproducibility of oligonucleotide microarray transcriptome analyses - An interlaboratory comparison using chemostat cultures of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Piper, M.D.W.; Daran-Lapujade, P.; Bro, Christoffer;

    2002-01-01

    Assessment of reproducibility of DNA-microarray analysis from published data sets is complicated by the use of different microbial strains, cultivation techniques, and analytical procedures. Because intra- and interlaboratory reproducibility is highly relevant for application of DNA-microarray an...

  1. Reproducibility of oligonucleotide microarray transcriptome analyses - An interlaboratory comparison using chemostat cultures of Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Piper, M.D.W.; Daran-Lapujade, P.; Bro, Christoffer

    2002-01-01

    Assessment of reproducibility of DNA-microarray analysis from published data sets is complicated by the use of different microbial strains, cultivation techniques, and analytical procedures. Because intra- and interlaboratory reproducibility is highly relevant for application of DNA-microarray an...

  2. Cassava (Manihot esculenta) transcriptome analysis in response to infection by the fungus Colletotrichum gloeosporioides using an oligonucleotide-DNA microarray.

    Science.gov (United States)

    Utsumi, Yoshinori; Tanaka, Maho; Kurotani, Atsushi; Yoshida, Takuhiro; Mochida, Keiichi; Matsui, Akihiro; Ishitani, Manabu; Sraphet, Supajit; Whankaew, Sukhuman; Asvarak, Thipa; Narangajavana, Jarunya; Triwitayakorn, Kanokporn; Sakurai, Tetsuya; Seki, Motoaki

    2016-07-01

    Cassava anthracnose disease (CAD), caused by the fungus Colletotrichum gloeosporioides f. sp. Manihotis, is a serious disease of cassava (Manihot esculenta) worldwide. In this study, we established a cassava oligonucleotide-DNA microarray representing 59,079 probes corresponding to approximately 30,000 genes based on original expressed sequence tags and RNA-seq information from cassava, and applied it to investigate the molecular mechanisms of resistance to fungal infection using two cassava cultivars, Huay Bong 60 (HB60, resistant to CAD) and Hanatee (HN, sensitive to CAD). Based on quantitative real-time reverse transcription PCR and expression profiling by the microarray, we showed that the expressions of various plant defense-related genes, such as pathogenesis-related (PR) genes, cell wall-related genes, detoxification enzyme, genes related to the response to bacterium, mitogen-activated protein kinase (MAPK), genes related to salicylic acid, jasmonic acid and ethylene pathways were higher in HB60 compared with HN. Our results indicated that the induction of PR genes in HB60 by fungal infection and the higher expressions of defense response-related genes in HB60 compared with HN are likely responsible for the fungal resistance in HB60. We also showed that the use of our cassava oligo microarray could improve our understanding of cassava molecular mechanisms related to environmental responses and development, and advance the molecular breeding of useful cassava plants.

  3. An Efficient Covalent Coating on Glass Slides for Preparation of Optical Oligonucleotide Microarrays

    Directory of Open Access Journals (Sweden)

    Atefeh Pourjahed

    2013-12-01

    The agarose-PLL microarrays had the highest signal (2546 and lowest background signal (205 in hybridization, suggesting that the prepared slides are suitable in analyzing wide concentration range of analytes.

  4. Hybridization kinetics analysis of an oligonucleotide microarray for microRNA detection

    Institute of Scientific and Technical Information of China (English)

    Botao Zhao; Shuo Ding; Wei Li; Youxin Jin

    2011-01-01

    MicroRNA (miRNA) microarrays have been successfully used for profiling miRNA expression in many physiological processes such as development, differentiation, oncogenesis,and other disease processes. Detecting miRNA by miRNA microarray is actually based on nucleic acid hybridization between target molecules and their corresponding complementary probes. Due to the small size and high degree of similarity among miRNA sequences, the hybridization condition must be carefully optimized to get specific and reliable signals. Previously, we reported a microarray platform to detect miRNA expression. In this study, we evaluated the sensitivity and specificity of our microarray platform. After systematic analysis, we determined an optimized hybridization condition with high sensitivity and specificity for miRNA detection. Our results would be helpful for other hybridization-based miRNA detection methods, such as northern blot and nuclease protection assay.

  5. Oliz, a suite of Perl scripts that assist in the design of microarrays using 50mer oligonucleotides from the 3' untranslated region

    Directory of Open Access Journals (Sweden)

    Sharp Burt M

    2002-10-01

    Full Text Available Abstract Background Identifying reliable oligonucleotide sequences for use in microarray experiments is a complex process. Two key issues are the accuracy of the input sequences and the specificity of the oligonucleotide sequences. Results We provide a suite of Perl scripts that facilitates the search for gene-specific oligonucleotides for microarray experiments. Genes of interest are first identified in the form of UniGene clusters. The sequences of these clusters were extracted and assembled into contigs to increase their accuracy. The 3' untranslated region (3'UTR of the contig was parsed. Then, multiple 50mer oligonucleotide sequences with similar melting temperature were obtained from each 3'UTR. These sequences were analyzed for gene specificity. Five Cy3-labeled cDNAs were used to empirically verify the specificity of a set of 1814 50mers. Conclusion Oliz can be used to select oligonucleotide sequences for microarrays. Oliz is freely available for academic users at http://www.utmem.edu/pharmacology/otherlinks/oliz.html

  6. High-density rhesus macaque oligonucleotide microarray design using early-stage rhesus genome sequence information and human genome annotations

    Directory of Open Access Journals (Sweden)

    Magness Charles L

    2007-01-01

    Full Text Available Abstract Background Until recently, few genomic reagents specific for non-human primate research have been available. To address this need, we have constructed a macaque-specific high-density oligonucleotide microarray by using highly fragmented low-pass sequence contigs from the rhesus genome project together with the detailed sequence and exon structure of the human genome. Using this method, we designed oligonucleotide probes to over 17,000 distinct rhesus/human gene orthologs and increased by four-fold the number of available genes relative to our first-generation expressed sequence tag (EST-derived array. Results We constructed a database containing 248,000 exon sequences from 23,000 human RefSeq genes and compared each human exon with its best matching sequence in the January 2005 version of the rhesus genome project list of 486,000 DNA contigs. Best matching rhesus exon sequences for each of the 23,000 human genes were then concatenated in the proper order and orientation to produce a rhesus "virtual transcriptome." Microarray probes were designed, one per gene, to the region closest to the 3' untranslated region (UTR of each rhesus virtual transcript. Each probe was compared to a composite rhesus/human transcript database to test for cross-hybridization potential yielding a final probe set representing 18,296 rhesus/human gene orthologs, including transcript variants, and over 17,000 distinct genes. We hybridized mRNA from rhesus brain and spleen to both the EST- and genome-derived microarrays. Besides four-fold greater gene coverage, the genome-derived array also showed greater mean signal intensities for genes present on both arrays. Genome-derived probes showed 99.4% identity when compared to 4,767 rhesus GenBank sequence tag site (STS sequences indicating that early stage low-pass versions of complex genomes are of sufficient quality to yield valuable functional genomic information when combined with finished genome information from

  7. A newly designed 45 to 60 mer oligonucleotide Agilent platform microarray for global gene expression studies of Synechocystis PCC6803: example salt stress experiment

    NARCIS (Netherlands)

    Aguirre von Wobeser, E.; Huisman, J.; Ibelings, B.; Matthijs, H.C.P.; Matthijs, H.C.P.

    2005-01-01

    A newly designed 45 to 60 mer oligonucleotide Agilent platform microarray for global gene expression studies of Synechocystis PCC6803: example salt stress experiment Eneas Aguirre-von-Wobeser 1, Jef Huisman1, Bas Ibelings2 and Hans C.P. Matthijs1 1 Universiteit van Amsterdam, Amsterdam, The Netherla

  8. Optimization of RNA Isolation from the Archaebacterium Methanosarcina Barkeri and Validation for Oligonucleotide Microarray Analysis

    Energy Technology Data Exchange (ETDEWEB)

    Culley, David E.; Kovacik, William P.; Brockman, Fred J.; Zhang, Weiwen

    2006-10-01

    ABSTRACT-The recent completion of a draft genome sequence for Methanosarcina barkeri has allowed the application of various high throughput post-genomics technologies, such as nucleic acid microarrays and mass spectrometry of proteins to detect global changes in transcription and translation that occur in response to experimental treatments...

  9. Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray

    Directory of Open Access Journals (Sweden)

    Niggli Felix K

    2006-06-01

    Full Text Available Abstract Background The Epstein-Barr virus (EBV is associated with lymphoid malignancies, including Burkitt's lymphoma (BL, and can transform human B cells in vitro. EBV-harboring cell lines are widely used to investigate lymphocyte transformation and oncogenesis. Qualitative EBV gene expression has been extensively described, but knowledge of quantitative transcription is lacking. We hypothesized that transcription levels of EBNA1, the gene essential for EBV persistence within an infected cell, are similar in BL cell lines. Results To compare quantitative gene transcription in the BL cell lines Namalwa, Raji, Akata, Jijoye, and P3HR1, we developed an oligonucleotide microarray chip, including 17 housekeeping genes, six latent EBV genes (EBNA1, EBNA2, EBNA3A, EBNA3C, LMP1, LMP2, and four lytic EBV genes (BZLF1, BXLF2, BKRF2, BZLF2, and used the cell line B95.8 as a reference for EBV gene transcription. Quantitative polymerase chain reaction assays were used to validate microarray results. We found that transcription levels of housekeeping genes differed considerably among BL cell lines. Using a selection of housekeeping genes with similar quantitative transcription in the tested cell lines to normalize EBV gene transcription data, we showed that transcription levels of EBNA1 were quite similar in very different BL cell lines, in contrast to transcription levels of other EBV genes. As demonstrated with Akata cells, the chip allowed us to accurately measure EBV gene transcription changes triggered by treatment interventions. Conclusion Our results suggest uniform EBNA1 transcription levels in BL and that microarray profiling can reveal novel insights on quantitative EBV gene transcription and its impact on lymphocyte biology.

  10. Screening genetically modified organisms using multiplex-PCR coupled with oligonucleotide microarray.

    Science.gov (United States)

    Xu, Jia; Miao, Haizhen; Wu, Houfei; Huang, Wensheng; Tang, Rong; Qiu, Minyan; Wen, Jianguo; Zhu, Shuifang; Li, Yao

    2006-07-15

    In this research, we developed a multiplex polymerase chain reaction (multiplex-PCR) coupled with a DNA microarray system simultaneously aiming at many targets in a consecutive reaction to detect a genetically modified organism (GMO). There are a total of 20 probes for detecting a GMO in a DNA microarray which can be classified into three categories according to their purpose: the first for screening GMO from un-transgenic plants based on the common elements such as promoter, reporter and terminator genes; the second for specific gene confirmation based on the target gene sequences such as herbicide-resistance or insect-resistance genes; the third for species-specific genes which the sequences are unique for different plant species. To ensure the reliability of this method, different kinds of positive and negative controls were used in DNA microarray. Commercial GM soybean, maize, rapeseed and cotton were identified by means of this method and further confirmed by PCR analysis and sequencing. The results indicate that this method discriminates between the GMOs very quickly and in a cost-saving and more time efficient way. It can detect more than 95% of currently commercial GMO plants and the limits of detection are 0.5% for soybean and 1% for maize. This method is proved to be a new method for routine analysis of GMOs.

  11. Cross-species hybridization of woodchuck hepatitis virus-induced hepatocellular carcinoma using human oligonucleotide microarrays

    Institute of Scientific and Technical Information of China (English)

    Paul W Anderson; Bud C Tennant; Zhenghong Lee

    2006-01-01

    AIM: To demonstrate the feasibility of using woodchuck samples on human microarrays, to provide insight into pathways involving positron emission tomography (PET) imaging tracers and to identify genes that could be potential molecular imaging targets for woodchuck hepatocellular carcinoma.METHODS: Labeled cRNA from woodchuck tissue samples were hybridized to Affymetrix U133 plus 2.0 GeneChips(R). Ten genes were selected for validation using quantitative RT-PCR and literature review was made.RESULTS: Testis enhanced gene transcript (BAX Inhibitor 1), alpha-fetoprotein, isocitrate dehydrogenase 3 (NAD+) beta, acetyl-CoA synthetase 2, carnitine palmitoyltransferase 2, and N-myc2 were up-regulated and spermidine/spermine N1-acetyltransferase was down-regulated in the woodchuck HCC. We also found previously published results supporting 8 of the 10 most up-regulated genes and all 10 of the 10 most downregulated genes.CONCLUSION: Many of our microarray results were validated using RT-PCR or literature search. Hence, we believe that woodchuck HCC and non-cancerous liver samples can be used on human microarrays to yield meaningful results.

  12. Detection of cancer with serum miRNAs on an oligonucleotide microarray.

    Directory of Open Access Journals (Sweden)

    Michael J Lodes

    Full Text Available Micro RNAs (miRNAs are a class of small, non-coding RNA species that play critical roles throughout cellular development and regulation. miRNA expression patterns taken from various tissue types often point to the cellular lineage of an individual tissue type, thereby being a more invariant hallmark of tissue type. Recent work has shown that these miRNA expression patterns can be used to classify tumor cells, and that this classification can be more accurate than the classification achieved by using messenger RNA gene expression patterns. One aspect of miRNA biogenesis that makes them particularly attractive as a biomarker is the fact that they are maintained in a protected state in serum and plasma, thus allowing the detection of miRNA expression patterns directly from serum. This study is focused on the evaluation of miRNA expression patterns in human serum for five types of human cancer, prostate, colon, ovarian, breast and lung, using a pan-human microRNA, high density microarray. This microarray platform enables the simultaneous analysis of all human microRNAs by either fluorescent or electrochemical signals, and can be easily redesigned to include newly identified miRNAs. We show that sufficient miRNAs are present in one milliliter of serum to detect miRNA expression patterns, without the need for amplification techniques. In addition, we are able to use these expression patterns to correctly discriminate between normal and cancer patient samples.

  13. Triple X syndrome in a patient with partial lipodystrophy discovered using a high-density oligonucleotide microarray: a case report

    Directory of Open Access Journals (Sweden)

    Lanktree Matthew B

    2009-08-01

    Full Text Available Abstract Introduction Patients with lipodystrophy experience selective or generalized atrophy of adipose tissue. The disruption of lipid metabolism results in an increased risk for development of metabolic syndrome and coronary artery disease. Currently, the mutations responsible for approximately half of lipodystrophy patients are known, but new techniques and examination of different types of genetic variation may identify new disease-causing mechanisms. Case presentation A 53-year-old woman of African descent was referred to a tertiary care endocrinology clinic for treatment of severe insulin resistance, treatment-resistant hypertension and dyslipidemia. After all known lipodystrophy-causing mutations were excluded by DNA sequencing, the patient was found to have triple X syndrome after an initial investigation into copy number variation using a high-density oligonucleotide microarray. The patient also had a previously unobserved duplication of 415 kilobases of chromosome 5q33.2. This is the first case report of a patient with lipodystrophy who also had triple X syndrome. Conclusion While we cannot make a direct link between the presence of triple X syndrome and partial lipodystrophy, if unrelated, this is an extremely rare convergence of syndromes. This patient poses an interesting possibility regarding the influence triple X syndrome may have on an individual with other underlying lipodystrophy susceptibility. Finally, impending large-scale case-control and cohort copy number variation investigations will, as a by-product, further document the prevalence of triple X syndrome in various patient groups.

  14. [mRNA expression analysis and classification of colonic biopsy samples using oligonucleotide and cDNA microarray techniques].

    Science.gov (United States)

    Galamb, Orsolya

    2008-07-20

    Despite tremendous progress in the past few decades, certain important aspects regarding the diagnosis, therapy, and follow-up of colorectal cancer still remain unsolved. In our work we searched for biomarkers of the development of colorectal carcinoma, and performed gene expression analysis for colorectal disease classification. We have established that the oligonucleotide microarray analyses of biopsy samples wholly fulfil the Affymetrix quality requirements, are highly standard and reproducible and the Taqman microfluidic card system is suitable for high-throughput, quick and cost efficient real-time-PCR validation of gene expression changes. We have shown that the sequential overexpression of osteopontin and osteonectin mRNAs and proteins significantly correlates with the progression of the colorectal adenoma-dysplasia-carcinoma sequence. We have identified and validated ten novel markers with continuously increasing mRNA expression in line with the adenoma-dysplasia-carcinoma transition. We have identified the top 27, 13 and 10 genes associated with adenoma, colorectal cancer, and inflammatory bowel diseases.

  15. Oligonucleotide microarray analysis reveals dysregulation of energy-related metabolism in insulin-sensitive tissues of type 2 diabetes patients.

    Science.gov (United States)

    Wang, M; Wang, X C; Zhao, L; Zhang, Y; Yao, L L; Lin, Y; Peng, Y D; Hu, R M

    2014-06-17

    Impaired insulin action within skeletal muscle, adipose tissue, and the liver is an important characteristic of type 2 diabetes (T2D). In order to identify common underlying defects in insulin-sensitive tissues that may be involved in the pathogenesis of T2D, the gene expression profiles of skeletal muscle, visceral adipose tissue, and liver from autopsy donors with or without T2D were examined using oligonucleotide microarrays and quantitative reverse transcriptase-PCR. Compared with controls, 691 genes were commonly dysregulated in these three insulin-sensitive tissues of humans with T2D. These co-expressed genes were enriched within the mitochondrion, with suggested involvement in energy metabolic processes such as glycolysis and gluconeogenesis, fatty acid beta oxidative, tricarboxylic acid cycle, and electron transport. Genes related to energy metabolism were mostly downregulated in diabetic skeletal muscle and visceral adipose tissue, while they were upregulated in the diabetic liver. This observed dysregulation in energy-related metabolism may be the underlying factor leading to the molecular mechanisms responsible for the insulin resistance of patients with T2D.

  16. Development of a Method for Profiling Protein Interactions with LNA-Modified Antisense Oligonucleotides Using Protein Microarrays.

    Science.gov (United States)

    Kakiuchi-Kiyota, Satoko; Whiteley, Lawrence O; Ryan, Anne M; Mathialagan, Nagappan

    2016-04-01

    Development of locked nucleic acid (LNA) gapmers, antisense oligonucleotides used for efficient inhibition of target RNA expression, is limited by nontarget-mediated hepatotoxicity. Increased binding of hepatocellular proteins to toxic LNA gapmers may be one of the mechanisms contributing to LNA gapmer-induced hepatotoxicity in vivo. In the present study, we investigated the protein binding propensity of nontoxic sequence-1 (NTS-1), toxic sequence-2 (TS-2), and severely highly toxic sequence-3 (HTS-3) LNA gapmers using human protein microarrays. We previously demonstrated by the transcription profiling analysis of liver RNA isolated from mice that TS-2 and HTS-3 gapmers modulate different transcriptional pathways in mice leading to hepatotoxicity. Our protein array profiling demonstrated that a greater number of proteins, including ones associated with hepatotoxicity, hepatic system disorder, and cell functions, were bound by TS-2 and HTS-3 compared with NTS-1. However, the profiles of proteins bound by TS-2 and HTS-3 were similar and did not distinguish proteins contributing to severe in vivo toxicity. These results, together with the previous transcription profiling analysis, indicate that the combination of sequence-dependent transcription modulation and increased protein binding of toxic LNA gapmers contributes to hepatotoxicity.

  17. Comparative genomic analysis of Acidithiobacillus ferrooxidans strains using the A. ferrooxidans ATCC 23270 whole-genome oligonucleotide microarray.

    Science.gov (United States)

    Luo, Hailang; Shen, Li; Yin, Huaqun; Li, Qian; Chen, Qijiong; Luo, Yanjie; Liao, Liqin; Qiu, Guanzhou; Liu, Xueduan

    2009-05-01

    Acidithiobacillus ferrooxidans is an important microorganism used in biomining operations for metal recovery. Whole-genomic diversity analysis based on the oligonucleotide microarray was used to analyze the gene content of 12 strains of A. ferrooxidans purified from various mining areas in China. Among the 3100 open reading frames (ORFs) on the slides, 1235 ORFs were absent in at least 1 strain of bacteria and 1385 ORFs were conserved in all strains. The hybridization results showed that these strains were highly diverse from a genomic perspective. The hybridization results of 4 major functional gene categories, namely electron transport, carbon metabolism, extracellular polysaccharides, and detoxification, were analyzed. Based on the hybridization signals obtained, a phylogenetic tree was built to analyze the evolution of the 12 tested strains, which indicated that the geographic distribution was the main factor influencing the strain diversity of these strains. Based on the hybridization signals of genes associated with bioleaching, another phylogenetic tree showed an evolutionary relationship from which the co-relation between the clustering of specific genes and geochemistry could be observed. The results revealed that the main factor was geochemistry, among which the following 6 factors were the most important: pH, Mg, Cu, S, Fe, and Al.

  18. Binding specificity and stability of duplexes formed by modified oligonucleotides with a 4096-hexanucleotide microarray

    Science.gov (United States)

    Timofeev, Edward; Mirzabekov, Andrei

    2001-01-01

    The binding of oligodeoxynucleotides modified with adenine 2′-O-methyl riboside, 2,6-diaminopurine 2′-O-methyl riboside, cytosine 2′-O-methyl riboside, 2,6-diaminopurine deoxyriboside or 5-bromodeoxyuridine was studied with a microarray containing all possible (4096) polyacrylamide-bound hexadeoxynucleotides (a generic microchip). The generic microchip was manufactured by using reductive immobilization of aminooligonucleotides in the activated copolymer of acrylamide, bis-acrylamide and N-(2,2-dimethoxyethyl) acrylamide. The binding of the fluorescently labeled modified octanucleotides to the array was analyzed with the use of both melting profiles and the fluorescence distribution at selected temperatures. Up to three substitutions of adenosines in the octamer sequence by adenine 2′-O-methyl ribosides (Am), 2,6-diaminopurine 2′-O-methyl ribosides (Dm) or 2,6-diaminopurine deoxyribosides (D) resulted in increased mismatch discrimination measured at the melting temperature of the corresponding perfect duplex. The stability of complexes formed by 2′-O-methyl-adenosine-modified oligodeoxynucleotides was slightly decreased with every additional substitution, yielding ∼4°C of total loss in melting temperature for three modifications, as followed from microchip thermal denaturation experiments. 2,6-Diaminopurine 2′-O-methyl riboside modifications led to considerable duplex stabilization. The cytosine 2′-O-methyl riboside and 5-bromodeoxyuridine modifications generally did not change either duplex stability or mismatch resolution. Denaturation experiments conducted with selected perfect duplexes on microchips and in solution showed similar results on thermal stabilities. Some hybridization artifacts were observed that might indicate the formation of parallel DNA. PMID:11410672

  19. Oligonucleotide microarray analysis of dietary-induced hyperlipidemia gene expression profiles in miniature pigs.

    Directory of Open Access Journals (Sweden)

    Junko Takahashi

    Full Text Available BACKGROUND: Hyperlipidemia animal models have been established, but complete gene expression profiles of the transition from normal lipid levels have not been obtained. Miniature pigs are useful model animals for gene expression studies on dietary-induced hyperlipidemia because they have a similar anatomy and digestive physiology to humans, and blood samples can be obtained from them repeatedly. METHODOLOGY: Two typical dietary treatments were used for dietary-induced hyperlipidemia models, by using specific pathogen-free (SPF Clawn miniature pigs. One was a high-fat and high-cholesterol diet (HFCD and the other was a high-fat, high-cholesterol, and high-sucrose diet (HFCSD. Microarray analyses were conducted from whole blood samples during the dietary period and from white blood cells at the end of the dietary period to evaluate the transition of expression profiles of the two dietary models. PRINCIPAL FINDINGS: Variations in whole blood gene expression intensity within the HFCD or the HFCSD group were in the same range as the controls provide with normal diet at all periods. This indicates uniformity of dietary-induced hyperlipidemia for our dietary protocols. Gene ontology- (GO based functional analyses revealed that characteristics of the common changes between HFCD and HFCSD were involved in inflammatory responses and reproduction. The correlation coefficient between whole blood and white blood cell expression profiles at 27 weeks with the HFCSD diet was significantly lower than that of the control and HFCD diet groups. This may be due to the effects of RNA originating from the tissues and/or organs. CONCLUSIONS: No statistically significant differences in fasting plasma lipids and glucose levels between the HFCD and HFCSD groups were observed. However, blood RNA analyses revealed different characteristics corresponding to the dietary protocols. In this study, whole blood RNA analyses proved to be a useful tool to evaluate transitions in

  20. Rapid identification of carbapenemase genes in gram-negative bacteria with an oligonucleotide microarray-based assay.

    Science.gov (United States)

    Braun, Sascha D; Monecke, Stefan; Thürmer, Alexander; Ruppelt, Antje; Makarewicz, Oliwia; Pletz, Mathias; Reiβig, Annett; Slickers, Peter; Ehricht, Ralf

    2014-01-01

    Rapid molecular identification of carbapenemase genes in Gram-negative bacteria is crucial for infection control and prevention, surveillance and for epidemiological purposes. Furthermore, it may have a significant impact upon determining the appropriate initial treatment and greatly benefit for critically ill patients. A novel oligonucleotide microarray-based assay was developed to simultaneously detect genes encoding clinically important carbapenemases as well as selected extended (ESBL) and narrow spectrum (NSBL) beta-lactamases directly from clonal culture material within few hours. Additionally, a panel of species specific markers was included to identify Escherichia coli, Pseudomonas aeruginosa, Citrobacter freundii/braakii, Klebsiella pneumoniae and Acinetobacter baumannii. The assay was tested using a panel of 117 isolates collected from urinary, blood and stool samples. For these isolates, phenotypic identifications and susceptibility tests were available. An independent detection of carbapenemase, ESBL and NSBL genes was carried out by various external reference laboratories using PCR methods. In direct comparison, the microarray correctly identified 98.2% of the covered carbapenemase genes. This included blaVIM (13 out of 13), blaGIM (2/2), blaKPC (27/27), blaNDM (5/5), blaIMP-2/4/7/8/13/14/15/16/31 (10/10), blaOXA-23 (12/13), blaOXA-40-group (7/7), blaOXA-48-group (32/33), blaOXA-51 (1/1) and blaOXA-58 (1/1). Furthermore, the test correctly identified additional beta-lactamases [blaOXA-1 (16/16), blaOXA-2 (4/4), blaOXA-9 (33/33), OXA-10 (3/3), blaOXA-51 (25/25), blaOXA-58 (2/2), CTX-M1/M15 (17/17) and blaVIM (1/1)]. In direct comparison to phenotypical identification obtained by VITEK or MALDI-TOF systems, 114 of 117 (97.4%) isolates, including Acinetobacter baumannii (28/28), Enterobacter spec. (5/5), Escherichia coli (4/4), Klebsiella pneumoniae (62/63), Klebsiella oxytoca (0/2), Pseudomonas aeruginosa (12/12), Citrobacter freundii (1/1) and

  1. Rapid identification of carbapenemase genes in gram-negative bacteria with an oligonucleotide microarray-based assay.

    Directory of Open Access Journals (Sweden)

    Sascha D Braun

    Full Text Available Rapid molecular identification of carbapenemase genes in Gram-negative bacteria is crucial for infection control and prevention, surveillance and for epidemiological purposes. Furthermore, it may have a significant impact upon determining the appropriate initial treatment and greatly benefit for critically ill patients. A novel oligonucleotide microarray-based assay was developed to simultaneously detect genes encoding clinically important carbapenemases as well as selected extended (ESBL and narrow spectrum (NSBL beta-lactamases directly from clonal culture material within few hours. Additionally, a panel of species specific markers was included to identify Escherichia coli, Pseudomonas aeruginosa, Citrobacter freundii/braakii, Klebsiella pneumoniae and Acinetobacter baumannii. The assay was tested using a panel of 117 isolates collected from urinary, blood and stool samples. For these isolates, phenotypic identifications and susceptibility tests were available. An independent detection of carbapenemase, ESBL and NSBL genes was carried out by various external reference laboratories using PCR methods. In direct comparison, the microarray correctly identified 98.2% of the covered carbapenemase genes. This included blaVIM (13 out of 13, blaGIM (2/2, blaKPC (27/27, blaNDM (5/5, blaIMP-2/4/7/8/13/14/15/16/31 (10/10, blaOXA-23 (12/13, blaOXA-40-group (7/7, blaOXA-48-group (32/33, blaOXA-51 (1/1 and blaOXA-58 (1/1. Furthermore, the test correctly identified additional beta-lactamases [blaOXA-1 (16/16, blaOXA-2 (4/4, blaOXA-9 (33/33, OXA-10 (3/3, blaOXA-51 (25/25, blaOXA-58 (2/2, CTX-M1/M15 (17/17 and blaVIM (1/1]. In direct comparison to phenotypical identification obtained by VITEK or MALDI-TOF systems, 114 of 117 (97.4% isolates, including Acinetobacter baumannii (28/28, Enterobacter spec. (5/5, Escherichia coli (4/4, Klebsiella pneumoniae (62/63, Klebsiella oxytoca (0/2, Pseudomonas aeruginosa (12/12, Citrobacter freundii (1/1 and Citrobacter

  2. Rapid Identification of Carbapenemase Genes in Gram-Negative Bacteria with an Oligonucleotide Microarray-Based Assay

    Science.gov (United States)

    Braun, Sascha D.; Monecke, Stefan; Thürmer, Alexander; Ruppelt, Antje; Makarewicz, Oliwia; Pletz, Mathias; Reißig, Annett; Slickers, Peter; Ehricht, Ralf

    2014-01-01

    Rapid molecular identification of carbapenemase genes in Gram-negative bacteria is crucial for infection control and prevention, surveillance and for epidemiological purposes. Furthermore, it may have a significant impact upon determining the appropriate initial treatment and greatly benefit for critically ill patients. A novel oligonucleotide microarray-based assay was developed to simultaneously detect genes encoding clinically important carbapenemases as well as selected extended (ESBL) and narrow spectrum (NSBL) beta-lactamases directly from clonal culture material within few hours. Additionally, a panel of species specific markers was included to identify Escherichia coli, Pseudomonas aeruginosa, Citrobacter freundii/braakii, Klebsiella pneumoniae and Acinetobacter baumannii. The assay was tested using a panel of 117 isolates collected from urinary, blood and stool samples. For these isolates, phenotypic identifications and susceptibility tests were available. An independent detection of carbapenemase, ESBL and NSBL genes was carried out by various external reference laboratories using PCR methods. In direct comparison, the microarray correctly identified 98.2% of the covered carbapenemase genes. This included blaVIM (13 out of 13), blaGIM (2/2), blaKPC (27/27), blaNDM (5/5), blaIMP-2/4/7/8/13/14/15/16/31 (10/10), blaOXA-23 (12/13), blaOXA-40-group (7/7), blaOXA-48-group (32/33), blaOXA-51 (1/1) and blaOXA-58 (1/1). Furthermore, the test correctly identified additional beta-lactamases [blaOXA-1 (16/16), blaOXA-2 (4/4), blaOXA-9 (33/33), OXA-10 (3/3), blaOXA-51 (25/25), blaOXA-58 (2/2), CTX-M1/M15 (17/17) and blaVIM (1/1)]. In direct comparison to phenotypical identification obtained by VITEK or MALDI-TOF systems, 114 of 117 (97.4%) isolates, including Acinetobacter baumannii (28/28), Enterobacter spec. (5/5), Escherichia coli (4/4), Klebsiella pneumoniae (62/63), Klebsiella oxytoca (0/2), Pseudomonas aeruginosa (12/12), Citrobacter freundii (1/1) and

  3. Analysis of baseline and cisplatin-inducible gene expression in Fanconi anemia cells using oligonucleotide-based microarrays

    Directory of Open Access Journals (Sweden)

    Liu Johnson M

    2002-11-01

    Full Text Available Abstract Background Patients with Fanconi anemia (FA suffer from multiple defects, most notably of the hematological compartment (bone marrow failure, and susceptibility to cancer. Cells from FA patients show increased spontaneous chromosomal damage, which is aggravated by exposure to low concentrations of DNA cross-linking agents such as mitomycin C or cisplatin. Five of the identified FA proteins form a nuclear core complex. However, the molecular function of these proteins remains obscure. Methods Oligonucleotide microarrays were used to compare the expression of approximately 12,000 genes from FA cells with matched controls. Expression profiles were studied in lymphoblastoid cell lines derived from three different FA patients, one from the FA-A and two from the FA-C complementation groups. The isogenic control cell lines were obtained by either transfecting the cells with vectors expressing the complementing cDNAs or by using a spontaneous revertant cell line derived from the same patient. In addition, we analyzed expression profiles from two cell line couples at several time points after a 1-hour pulse treatment with a discriminating dose of cisplatin. Results Analysis of the expression profiles showed differences in expression of a number of genes, many of which have unknown function or are difficult to relate to the FA defect. However, from a selected number of proteins involved in cell cycle regulation, DNA repair and chromatin structure, Western blot analysis showed that p21waf1/Cip1 was significantly upregulated after low dose cisplatin treatment in FA cells specifically (as well as being expressed at elevated levels in untreated FA cells. Conclusions The observed increase in expression of p21waf1/Cip1 after treatment of FA cells with crosslinkers suggests that the sustained elevated levels of p21waf1/Cip1 in untreated FA cells detected by Western blot analysis likely reflect increased spontaneous damage in these cells.

  4. Evolution of the MIDTAL microarray: the adaption and testing of oligonucleotide 18S and 28S rDNA probes and evaluation of subsequent microarray generations with Prymnesium spp. cultures and field samples.

    Science.gov (United States)

    McCoy, Gary R; Touzet, Nicolas; Fleming, Gerard T A; Raine, Robin

    2015-07-01

    The toxic microalgal species Prymnesium parvum and Prymnesium polylepis are responsible for numerous fish kills causing economic stress on the aquaculture industry and, through the consumption of contaminated shellfish, can potentially impact on human health. Monitoring of toxic phytoplankton is traditionally carried out by light microscopy. However, molecular methods of identification and quantification are becoming more common place. This study documents the optimisation of the novel Microarrays for the Detection of Toxic Algae (MIDTAL) microarray from its initial stages to the final commercial version now available from Microbia Environnement (France). Existing oligonucleotide probes used in whole-cell fluorescent in situ hybridisation (FISH) for Prymnesium species from higher group probes to species-level probes were adapted and tested on the first-generation microarray. The combination and interaction of numerous other probes specific for a whole range of phytoplankton taxa also spotted on the chip surface caused high cross reactivity, resulting in false-positive results on the microarray. The probe sequences were extended for the subsequent second-generation microarray, and further adaptations of the hybridisation protocol and incubation temperatures significantly reduced false-positive readings from the first to the second-generation chip, thereby increasing the specificity of the MIDTAL microarray. Additional refinement of the subsequent third-generation microarray protocols with the addition of a poly-T amino linker to the 5' end of each probe further enhanced the microarray performance but also highlighted the importance of optimising RNA labelling efficiency when testing with natural seawater samples from Killary Harbour, Ireland.

  5. Nonspecific hybridization scaling of microarray expression estimates: a physicochemical approach for chip-to-chip normalization.

    Science.gov (United States)

    Binder, Hans; Brücker, Jan; Burden, Conrad J

    2009-03-05

    The problem of inferring accurate quantitative estimates of transcript abundances from gene expression microarray data is addressed. Particular attention is paid to correcting chip-to-chip variations arising mainly as a result of unwanted nonspecific background hybridization to give transcript abundances measured in a common scale. This study verifies and generalizes a model of the mutual dependence between nonspecific background hybridization and the sensitivity of the specific signal using an approach based on the physical chemistry of surface hybridization. We have analyzed GeneChip oligonucleotide microarray data taken from a set of five benchmark experiments including dilution, Latin Square, and "Golden spike" designs. Our analysis concentrates on the important effect of changes in the unwanted nonspecific background inherent in the technology due to changes in total RNA target concentration and/or composition. We find that incremental changes in nonspecific background entail opposite sign incremental changes in the effective specific binding constant. This effect, which we refer to as the "up-down" effect, results from the subtle interplay of competing interactions between the probes and specific and nonspecific targets at the chip surface and in bulk solution. We propose special rules for proper normalization of expression values considering the specifics of the up-down effect. Particularly for normalization one has to level the expression values of invariant expressed probes. Existing heuristic normalization techniques which do not exclude absent probes, level intensities instead of expression values, and/or use low variance criteria for identifying invariant sets of probes lead to biased results. Strengths and pitfalls of selected normalization methods are discussed. We also find that the extent of the up-down effect is modified if RNA targets are replaced by DNA targets, in that microarray sensitivity and specificity are improved via a decrease in

  6. DNA microarray synthesis by using PDMS molecular stamp (II) -- Oligonucleotide on-chip synthesis using PDMS stamp

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Based on the standard phosphoramidites chemistry protocol, two oligonucleotides synthetic routes were studied by contact stamping reactants to a modified glass slide. Route A was a contact coupling reaction, in which a nucleoside monomer was transferred and coupled to reactive groups (OH) on a substrate by spreading the nucleoside activated with tetrazole on a polydimethylsiloxane (PDMS) stamp. Route B was a contact detritylation, in which one nucleoside was fixed on the desired synthesis regions where dimethoxytrityl (DMT) protecting groups on the 5′-hydroxyl of the support-bound nucleoside were removed by stamping trichloroacetic acid (TCA) distributed on features on a PDMS stamp. Experiments showed that the synthetic yield and the reaction speed of route A were higher than those of route B. It was shown that 20 mer oligonucleotide arrays immobilized on the glass slide were successfully synthesized using the PDMS stamps, and the coupling efficiency showed no difference between the PDMS stamping and the conventional synthesis methods.

  7. Detection and isolation of selected genes of interest from metagenomic libraries by a DNA microarray approach.

    Science.gov (United States)

    Pathak, Gopal P; Gärtner, Wolfgang

    2010-01-01

    A DNA microarray-based approach is described for screening metagenomic libraries for the presence of selected genes. The protocol is exemplified for the identification of flavin-binding, blue-light-sensitive biological photoreceptors (BL), based on a homology search in already sequenced, annotated genomes. The microarray carried 149 different 54-mer oligonucleotides, derived from consensus sequences of BL photoreceptors. The array could readily identify targets carrying 4% sequence mismatch, and allowed unambiguous identification of a positive cosmid clone of as little as 10 ng against a background of 25 μg of cosmid DNA. The protocol allows screening up to 1,200 library clones in concentrations as low as ca. 20 ng, each with a ca. 40 kb insert size readily in a single batch. Calibration and control conditions are outlined. This protocol, when applied to the thermophilic fraction of a soil sample, yielded the identification and functional characterization of a novel, BL-encoding gene that showed a 58% similarity to a known, BL-encoding gene from Kineococcus radiotolerans SRS30216 (similarity values refer to the respective LOV domains).

  8. Utilization of a labeled tracking oligonucleotide for visualization and quality control of spotted 70-mer arrays

    Directory of Open Access Journals (Sweden)

    Khan Shehnaz

    2004-02-01

    Full Text Available Abstract Background Spotted 70-mer oligonucleotide arrays offer potentially greater specificity and an alternative to expensive cDNA library maintenance and amplification. Since microarray fabrication is a considerable source of data variance, we previously directly tagged cDNA probes with a third fluorophore for prehybridization quality control. Fluorescently modifying oligonucleotide sets is cost prohibitive, therefore, a co-spotted Staphylococcus aureus-specific fluorescein-labeled "tracking" oligonucleotide is described to monitor fabrication variables of a Mycobacterium tuberculosis oligonucleotide microarray. Results Significantly (p M. tuberculosis H37Rv and M. tuberculosis mprA. Linearity between the mean log Cy3/Cy5 ratios of genes differentially expressed from arrays either possessing or lacking the tracking oligonucleotide was observed (R2 = 0.90, p Conclusions This novel approach enables prehybridization array visualization for spotted oligonucleotide arrays and sets the stage for more sophisticated slide qualification and data filtering applications.

  9. Discrimination of bacillus anthracis and closely related microorganisms by analysis of 16S and 23S rRNA with oligonucleotide microarray.

    Energy Technology Data Exchange (ETDEWEB)

    Bavykin, S. G.; Mikhailovich, V. M.; Zakharyev, V. M.; Lysov, Y. P.; Kelly, J. J.; Alferov, O. S.; Jackman, J.; Stahl, D. A.; Mirzabekov, A. D.; Gavin, I. M.; Kukhtin, A. V.; Chandler, D. (Biochip Technology Center); (Engelhardt Inst. of Molecular Biology); (Northwestern Univ.); (Georgetown Univ.)

    2008-01-30

    Analysis of 16S rRNA sequences is a commonly used method for the identification and discrimination of microorganisms. However, the high similarity of 16S and 23S rRNA sequences of Bacillus cereus group organisms (up to 99-100%) and repeatedly failed attempts to develop molecular typing systems that would use DNA sequences to discriminate between species within this group have resulted in several suggestions to consider B. cereus and B. thuringiensis, or these two species together with B. anthracis, as one species. Recently, we divided the B. cereus group into seven subgroups, Anthracis, Cereus A and B, Thuringiensis A and B, and Mycoides A and B, based on 16S rRNA, 23S rRNA and gyrB gene sequences and identified subgroup-specific makers in each of these three genes. Here we for the first time demonstrated discrimination of these seven subgroups, including subgroup Anthracis, with a 3D gel element microarray of oligonucleotide probes targeting 16S and 23S rRNA markers. This is the first microarray enabled identification of B. anthracis and discrimination of these seven subgroups in pure cell cultures and in environmental samples using rRNA sequences. The microarray bearing perfect match/mismatch (p/mm) probe pairs was specific enough to discriminate single nucleotide polymorphisms (SNPs) and was able to identify targeted organisms in 5 min. We also demonstrated the ability of the microarray to determine subgroup affiliations for B. cereus group isolates without rRNA sequencing. Correlation of these seven subgroups with groupings based on multilocus sequence typing (MLST), fluorescent amplified fragment length polymorphism analysis (AFLP) and multilocus enzyme electrophoresis (MME) analysis of a wide spectrum of different genes, and the demonstration of subgroup-specific differences in toxin profiles, psychrotolerance, and the ability to harbor some plasmids, suggest that these seven subgroups are not based solely on neutral genomic polymorphisms, but instead reflect

  10. Two heuristic approaches to describe periodicities in genomic microarrays

    Directory of Open Access Journals (Sweden)

    Jörg Aßmus

    2009-09-01

    Full Text Available In the first part we discuss the filtering of panels of time series based on singular value decomposition. The discussion is based on an approach where this filtering is used to normalize microarray data. We point out effects on the periodicity and phases for time series panels. In the second part we investigate time dependent periodic panels with different phases. We align the time series in the panel and discuss the periodogram of the aligned time series with the purpose of describing the periodic structure of the panel. The method is quite powerful assuming known phases in the model, but it deteriorates rapidly for noisy data.  

  11. Expression profiling of gastric cancer samples by oligonucleotide microarray analysis reveals low degree of intra-tumor variability

    Institute of Scientific and Technical Information of China (English)

    Karolin Trautmann; Christine Steudel; Dana Grossmann; Daniela Aust; Gerhard Ehninger; Stephan Miehlke; Christian Thiede

    2005-01-01

    AIM: Gene expression profiling provides an unique opportunity to gain insight into the development of different types of gastric cancer. Tumor sample heterogeneity is thought to decrease the sensitivity and tumor specificity of microarray analysis. Thus, microdissection and preamplification of RNA is frequently performed. However, this technique may also induce considerable changes to the expression profile. To assess the effect of gastric tumor heterogeneity on expression profiling results, we measured the variation in gene expression within the same gastric cancer sample by performing a gene chip analysis with two RNA preparations extracted from the same tumor specimen.METHODS: Tumor samples from six intestinal T2 gastric tumors were dissected under liquid nitrogen and RNA was prepared from two separate tumor fragments. Each extraction was individually processed and hybridized to an Affymetrix U133A gene chip covering approximately 18 000 human gene transcripts. Expression profiles were analyzed using Microarray Suite 5.0 (Affymetrix) and GeneSpring 6.0 (Silicon Genetics).RESULTS: All gastric cancers showed little variance in expression profiles between different regions of the same tumor sample. In this case, gene chips displayed mean pair wise correlation coefficients of 0.94±0.02 (mean±SD),compared to values of 0.61±0.1 for different tumor samples. Expression of the variance between the two expression profiles as a percentage of "total change"(Affymetrix) revealed a remarkably low average value of 1.18±0.78 for comparing fragments of the same tumor sample.In contrast, comparison of fragments from different tumors revealed a percentage of 24.4±4.5.CONCLUSION: Our study indicates a low degree of expression profile variability within gastric tumor samples isolated from one patient. These data suggest that tumor tissue heterogeneity is not a dominant source of error for microarray analysis of larger tumor samples, making total RNA extraction an appropriate

  12. Comparison of gene expression of mitogenic kinin path in adherent and non-adherent CD 34-stem cells using oligonucleotide microarrays.

    Directory of Open Access Journals (Sweden)

    Krzysztof Machaj

    2008-02-01

    Full Text Available One of the more interesting cells present in the umbilical cord blood - as far as their potential clinical use is concerned - are stem cells not presenting the CD34 antigen. These are the pluripotential cells with their biological properties similar to mesenchymal stem cells, with the ability to differentiate into such tissue types as bone, cartilage, nervous (to some extent, glia and muscle. The authors compared the activity of genes coding the proteins in mitogenic signal paths activated by kinin receptors using oligonucleotide microarrays in adherent and non-adherent CD 34- cells derived from umbilical cord blood. In the linear regression model with a 95% prognosis area for differentiating genes outside this area, the following genes were selected: c-jun (present in 3 isoforms and c-fos. The fos and jun genes create the AP-1 transcriptive factor which regulates the expression of genes taking part in numerous cellular processes, including the cell cycle and mitosis. The obtained results shed some light on the molecular processes behind the MSC proliferation and are a starting point for further studies on the mesenchymal stem cell biology.

  13. Microbial distributions detected by an oligonucleotide microarray across geochemical zones associated with methane in marine sediments from the Ulleung Basin

    Energy Technology Data Exchange (ETDEWEB)

    Briggs, Brandon R; Graw, Michael; Brodie, Eoin L; Bahk, Jang-Jun; Kim, Sung-Han; Hyun, Jung-Ho; Kim, Ji-Hoon; Torres, Marta; Colwell, Frederick S

    2013-11-01

    The biogeochemical processes that occur in marine sediments on continental margins are complex; however, from one perspective they can be considered with respect to three geochemical zones based on the presence and form of methane: sulfate–methane transition (SMTZ), gas hydrate stability zone (GHSZ), and free gas zone (FGZ). These geochemical zones may harbor distinct microbial communities that are important in biogeochemical carbon cycles. The objective of this study was to describe the microbial communities in sediments from the SMTZ, GHSZ, and FGZ using molecular ecology methods (i.e. PhyloChip microarray analysis and terminal restriction fragment length polymorphism (T-RFLP)) and examining the results in the context of non-biological parameters in the sediments. Non-metric multidimensional scaling and multi-response permutation procedures were used to determine whether microbial community compositions were significantly different in the three geochemical zones and to correlate samples with abiotic characteristics of the sediments. This analysis indicated that microbial communities from all three zones were distinct from one another and that variables such as sulfate concentration, hydrate saturation of the nearest gas hydrate layer, and depth (or unmeasured variables associated with depth e.g. temperature, pressure) were correlated to differences between the three zones. The archaeal anaerobic methanotrophs typically attributed to performing anaerobic oxidation of methane were not detected in the SMTZ; however, the marine benthic group-B, which is often found in SMTZ, was detected. Within the GHSZ, samples that were typically closer to layers that contained higher hydrate saturation had indicator sequences related to Vibrio-type taxa. These results suggest that the biogeographic patterns of microbial communities in marine sediments are distinct based on geochemical zones defined by methane.

  14. Transcript-based redefinition of grouped oligonucleotide probe sets using AceView: High-resolution annotation for microarrays

    Directory of Open Access Journals (Sweden)

    Cam Margaret C

    2007-03-01

    Full Text Available Abstract Background Extracting biological information from high-density Affymetrix arrays is a multi-step process that begins with the accurate annotation of microarray probes. Shortfalls in the original Affymetrix probe annotation have been described; however, few studies have provided rigorous solutions for routine data analysis. Results Using AceView, a comprehensive human transcript database, we have reannotated the probes by matching them to RNA transcripts instead of genes. Based on this transcript-level annotation, a new probe set definition was created in which every probe in a probe set maps to a common set of AceView gene transcripts. In addition, using artificial data sets we identified that a minimal probe set size of 4 is necessary for reliable statistical summarization. We further demonstrate that applying the new probe set definition can detect specific transcript variants contributing to differential expression and it also improves cross-platform concordance. Conclusion We conclude that our transcript-level reannotation and redefinition of probe sets complement the original Affymetrix design. Redefinitions introduce probe sets whose sizes may not support reliable statistical summarization; therefore, we advocate using our transcript-level mapping redefinition in a secondary analysis step rather than as a replacement. Knowing which specific transcripts are differentially expressed is important to properly design probe/primer pairs for validation purposes. For convenience, we have created custom chip-description-files (CDFs and annotation files for our new probe set definitions that are compatible with Bioconductor, Affymetrix Expression Console or third party software.

  15. DNA Microarray Data Analysis: A Novel Biclustering Algorithm Approach

    Science.gov (United States)

    Tchagang, Alain B.; Tewfik, Ahmed H.

    2006-12-01

    Biclustering algorithms refer to a distinct class of clustering algorithms that perform simultaneous row-column clustering. Biclustering problems arise in DNA microarray data analysis, collaborative filtering, market research, information retrieval, text mining, electoral trends, exchange analysis, and so forth. When dealing with DNA microarray experimental data for example, the goal of biclustering algorithms is to find submatrices, that is, subgroups of genes and subgroups of conditions, where the genes exhibit highly correlated activities for every condition. In this study, we develop novel biclustering algorithms using basic linear algebra and arithmetic tools. The proposed biclustering algorithms can be used to search for all biclusters with constant values, biclusters with constant values on rows, biclusters with constant values on columns, and biclusters with coherent values from a set of data in a timely manner and without solving any optimization problem. We also show how one of the proposed biclustering algorithms can be adapted to identify biclusters with coherent evolution. The algorithms developed in this study discover all valid biclusters of each type, while almost all previous biclustering approaches will miss some.

  16. DNA Microarray Data Analysis: A Novel Biclustering Algorithm Approach

    Directory of Open Access Journals (Sweden)

    Tewfik Ahmed H

    2006-01-01

    Full Text Available Biclustering algorithms refer to a distinct class of clustering algorithms that perform simultaneous row-column clustering. Biclustering problems arise in DNA microarray data analysis, collaborative filtering, market research, information retrieval, text mining, electoral trends, exchange analysis, and so forth. When dealing with DNA microarray experimental data for example, the goal of biclustering algorithms is to find submatrices, that is, subgroups of genes and subgroups of conditions, where the genes exhibit highly correlated activities for every condition. In this study, we develop novel biclustering algorithms using basic linear algebra and arithmetic tools. The proposed biclustering algorithms can be used to search for all biclusters with constant values, biclusters with constant values on rows, biclusters with constant values on columns, and biclusters with coherent values from a set of data in a timely manner and without solving any optimization problem. We also show how one of the proposed biclustering algorithms can be adapted to identify biclusters with coherent evolution. The algorithms developed in this study discover all valid biclusters of each type, while almost all previous biclustering approaches will miss some.

  17. PCR amplfication on a microarray of gel-immobilized oligonucleotides : detection of bacterial toxin- and drug-resistent genes and their mutations.

    Energy Technology Data Exchange (ETDEWEB)

    Strizhkov, B. N.; Drobyshev, A. L.; Mikhailovich, V. M.; Mirzabekov, A. D.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology

    2000-10-01

    PCR amplification on a microarray of gel-immobilized primers (microchip) has been developed. One of a pair of PCR primers was immobilized inside a separate microchip polyacrylamide porous gel pad of 0.1 x 0.1 x 0.02 (or 0.04) micron in size and 0.2 (or 0.4) nL in volume. The amplification was carried out simultaneously both in solution covering the microchip array and inside gel pads. Each gel pad contained the immobilized forward primers, while the fluorescently labeled reverse primers, as well as all components of the amplification reaction, diffused into the gel pads from the solution. To increase the amplification efficiency, the forward primers were also added into the solution. The kinetics of amplification was measured in real time in parallel for all gel pads with a fluorescent microscope equipped with a charge-coupled device (CCD) camera. The accuracy of the amplification was assessed by using the melting curves obtained for the duplexes formed by the labeled amplification product and the gel-immobilized primers during the amplification process; alternatively, the duplexes were produced by hybridization of the extended immobilized primers with labeled oligonucleotide probes. The on-chip amplification was applied to detect the anthrax toxin genes and the plasmid-borne beta-lactamase gene responsible for bacterial ampicillin resistance. The allele-specific type of PCR amplification was used to identify the Shiga toxin gene and discriminate it from the Shiga-like one. The genomic mutations responsible for rifampicin resistance of the Mycobacterium tuberculosis strains were detected by the same type of PCR amplification of the rpoB gene fragment isolated from sputum of tuberculosis patients. The on-chip PCR amplification has been shown to be a rapid, inexpensive and powerful tool to test genes responsible for bacterial toxin production and drug resistance, as well as to reveal point nucleotide mutations.

  18. The proximal chromosome 14q microdeletion syndrome: delineation of the phenotype using high resolution SNP oligonucleotide microarray analysis (SOMA) and review of the literature.

    Science.gov (United States)

    Torgyekes, Edina; Shanske, Alan L; Anyane-Yeboa, Kwame; Nahum, Odelia; Pirzadeh, Sara; Blumfield, Einat; Jobanputra, Vaidehi; Warburton, Dorothy; Levy, Brynn

    2011-08-01

    We report on two patients with overlapping small interstitial deletions involving regions 14q12 to 14q13.1. Both children had severe developmental delay, failure to thrive, microcephaly, and distinctive facial features, including abnormal spacing of the eyes, epicanthal folds, sloping forehead, low-set ears, rounded eyebrows with triangular media aspect and outer tapering, depressed and broad nasal bridge, small mouth, a long philtrum, and a prominent Cupid's bow. Brain MRI of both children showed partial agenesis of the corpus callosum. Our first patient had bilateral hypoplastic optic nerves causing blindness, mild hearing impairment, sinus arrhythmia, abnormal temperature regulation, frequent apneic episodes, myoclonic jerks, and opisthotonus. Our second patient had a seizure disorder confirmed by EEG, sleep apnea, chronic interstitial lung disease, and several episodes of pneumonia and gastroenteritis. Cytogenetic analysis showed a normal karyotype in Patient 1 and a unique apparently balanced three-way translocation in Patient 2 involving chromosomes 4, 14, and 11. High resolution SNP Oligonucleotide Microarray Analysis (SOMA) revealed a deletion in the proximal region of chromosome 14q overlapping with the deletion of our first patient, and no copy number changes in chromosomes 4 and 11. Here, we review and compare published cases with a deletion involving the 14q12-22.1 chromosomal region in an effort to correlate phenotype and genotype. We also examine the underlying genomic architecture to identify the possible mechanism of the chromosomal abnormality. Our review found a patient with a mirror duplication of our first patient's deletion, confirming the existence of an underlying genomic structural instability in the region. © 2011 Wiley-Liss, Inc.

  19. Use of a rainbow trout oligonucleotide microarray to determine transcriptional patterns in aflatoxin B1-induced hepatocellular carcinoma compared to adjacent liver.

    Science.gov (United States)

    Tilton, Susan C; Gerwick, Lena G; Hendricks, Jerry D; Rosato, Caprice S; Corley-Smith, Graham; Givan, Scott A; Bailey, George S; Bayne, Christopher J; Williams, David E

    2005-12-01

    Hepatocellular carcinoma (HCC) is one of the most common malignant tumors worldwide, and its occurrence is associated with a number of environmental factors including ingestion of the dietary contaminant aflatoxin B(1) (AFB(1)). Research over the last 40 years has revealed rainbow trout (Oncorhynchus mykiss) to be an excellent research model for study of AFB(1)-induced hepatocarcinogenesis; however, little is known about changes at the molecular level in trout tumors. We have developed a rainbow trout oligonucleotide array containing 1672 elements representing over 1400 genes of known or probable relevance to toxicology, comparative immunology, carcinogenesis, endocrinology, and stress physiology. In this study, we applied microarray technology to examine gene expression of AFB(1)-induced HCC in the rainbow trout tumor model. Carcinogenesis was initiated in trout embryos with 50 ppb AFB(1), and after 13 months control livers, tumors, and tumor-adjacent liver tissues were isolated from juvenile fish. Global gene expression was determined in histologically confirmed HCCs compared to noncancerous adjacent tissue and sham-initiated control liver. We observed distinct gene regulation patterns in HCC compared to noncancerous tissue including upregulation of genes important for cell cycle control, transcription, cytoskeletal formation, and the acute phase response and downregulation of genes involved in drug metabolism, lipid metabolism, and retinol metabolism. Interestingly, the expression profiles observed in trout HCC are similar to the transcriptional signatures found in human and rodent HCC, further supporting the validity of the model. Overall, these findings contribute to a better understanding of the mechanism of AFB(1)-induced hepatocarcinogenesis in trout and identify conserved genes important for carcinogenesis in species separated evolutionarily by more than 400 million years.

  20. Experimental Approaches to Microarray Analysis of Tumor Samples

    Science.gov (United States)

    Furge, Laura Lowe; Winter, Michael B.; Meyers, Jacob I.; Furge, Kyle A.

    2008-01-01

    Comprehensive measurement of gene expression using high-density nucleic acid arrays (i.e. microarrays) has become an important tool for investigating the molecular differences in clinical and research samples. Consequently, inclusion of discussion in biochemistry, molecular biology, or other appropriate courses of microarray technologies has…

  1. Statistical approaches for the analysis of DNA methylation microarray data.

    Science.gov (United States)

    Siegmund, Kimberly D

    2011-06-01

    Following the rapid development and adoption in DNA methylation microarray assays, we are now experiencing a growth in the number of statistical tools to analyze the resulting large-scale data sets. As is the case for other microarray applications, biases caused by technical issues are of concern. Some of these issues are old (e.g., two-color dye bias and probe- and array-specific effects), while others are new (e.g., fragment length bias and bisulfite conversion efficiency). Here, I highlight characteristics of DNA methylation that suggest standard statistical tools developed for other data types may not be directly suitable. I then describe the microarray technologies most commonly in use, along with the methods used for preprocessing and obtaining a summary measure. I finish with a section describing downstream analyses of the data, focusing on methods that model percentage DNA methylation as the outcome, and methods for integrating DNA methylation with gene expression or genotype data.

  2. Microarray Applications in Cancer Research

    Science.gov (United States)

    Kim, Il-Jin; Kang, Hio Chung

    2004-01-01

    DNA microarray technology permits simultaneous analysis of thousands of DNA sequences for genomic research and diagnostics applications. Microarray technology represents the most recent and exciting advance in the application of hybridization-based technology for biological sciences analysis. This review focuses on the classification (oligonucleotide vs. cDNA) and application (mutation-genotyping vs. gene expression) of microarrays. Oligonucleotide microarrays can be used both in mutation-genotyping and gene expression analysis, while cDNA microarrays can only be used in gene expression analysis. We review microarray mutation analysis, including examining the use of three oligonucleotide microarrays developed in our laboratory to determine mutations in RET, β-catenin and K-ras genes. We also discuss the use of the Affymetrix GeneChip in mutation analysis. We review microarray gene expression analysis, including the classifying of such studies into four categories: class comparison, class prediction, class discovery and identification of biomarkers. PMID:20368836

  3. DNA Microarray Technologies: A Novel Approach to Geonomic Research

    Energy Technology Data Exchange (ETDEWEB)

    Hinman, R.; Thrall, B.; Wong, K,

    2002-01-01

    A cDNA microarray allows biologists to examine the expression of thousands of genes simultaneously. Researchers may analyze the complete transcriptional program of an organism in response to specific physiological or developmental conditions. By design, a cDNA microarray is an experiment with many variables and few controls. One question that inevitably arises when working with a cDNA microarray is data reproducibility. How easy is it to confirm mRNA expression patterns? In this paper, a case study involving the treatment of a murine macrophage RAW 264.7 cell line with tumor necrosis factor alpha (TNF) was used to obtain a rough estimate of data reproducibility. Two trials were examined and a list of genes displaying either a > 2-fold or > 4-fold increase in gene expression was compiled. Variations in signal mean ratios between the two slides were observed. We can assume that erring in reproducibility may be compensated by greater inductive levels of similar genes. Steps taken to obtain results included serum starvation of cells before treatment, tests of mRNA for quality/consistency, and data normalization.

  4. The delivery of therapeutic oligonucleotides.

    Science.gov (United States)

    Juliano, Rudolph L

    2016-08-19

    The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. © The Author 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. A universal oligonucleotide microarray with a minimal number of probes for the detection and identification of viroids at the genus level.

    Directory of Open Access Journals (Sweden)

    Yongjiang Zhang

    Full Text Available A major challenge in the agricultural industry is the development of techniques that can screen plant samples for viroid infection. Microarrays are promising in this regard, as their high throughput nature can potentially allow for the detection of a range of viroids in a single test. In this paper we present a microarray that can detect a wide spectrum of all 8 reported viroid genera including 37 known plant viroid species. The array was constructed using an automated probe design protocol which generated a minimal number of probes to detect viroids at the genus level. The designed microarray showed a high specificity and sensitivity when tested with a set of standard virus samples. Finally, the microarray was applied to screen infected field samples, with Hop stunt viroid infection identified as the major disease causing pathogen for an infected citrus sample.

  6. A Hybrid Reduction Approach for Enhancing Cancer Classification of Microarray Data

    Directory of Open Access Journals (Sweden)

    Abeer M. Mahmoud

    2014-10-01

    Full Text Available This paper presents a novel hybrid machine learning (MLreduction approach to enhance cancer classification accuracy of microarray data based on two ML gene ranking techniques (T-test and Class Separability (CS. The proposed approach is integrated with two ML classifiers; K-nearest neighbor (KNN and support vector machine (SVM; for mining microarray gene expression profiles. Four public cancer microarray databases are used for evaluating the proposed approach and successfully accomplish the mining process. These are Lymphoma, Leukemia SRBCT, and Lung Cancer. The strategy to select genes only from the training samples and totally excluding the testing samples from the classifier building process is utilized for more accurate and validated results. Also, the computational experiments are illustrated in details and comprehensively presented with literature related results. The results showed that the proposed reduction approach reached promising results of the number of genes supplemented to the classifiers as well as the classification accuracy.

  7. Low-complexity PDE-based approach for automatic microarray image processing.

    Science.gov (United States)

    Belean, Bogdan; Terebes, Romulus; Bot, Adrian

    2015-02-01

    Microarray image processing is known as a valuable tool for gene expression estimation, a crucial step in understanding biological processes within living organisms. Automation and reliability are open subjects in microarray image processing, where grid alignment and spot segmentation are essential processes that can influence the quality of gene expression information. The paper proposes a novel partial differential equation (PDE)-based approach for fully automatic grid alignment in case of microarray images. Our approach can handle image distortions and performs grid alignment using the vertical and horizontal luminance function profiles. These profiles are evolved using a hyperbolic shock filter PDE and then refined using the autocorrelation function. The results are compared with the ones delivered by state-of-the-art approaches for grid alignment in terms of accuracy and computational complexity. Using the same PDE formalism and curve fitting, automatic spot segmentation is achieved and visual results are presented. Considering microarray images with different spots layouts, reliable results in terms of accuracy and reduced computational complexity are achieved, compared with existing software platforms and state-of-the-art methods for microarray image processing.

  8. 基于16S和23S rDNA基因芯片检测和鉴定七种临床常见病原菌%Detection and identification of seven clinical common pathogenic bacteria by oligonucleotide microarray

    Institute of Scientific and Technical Information of China (English)

    邢建明; 张甦; 张红河; 沈翠芬; 毕丹; 李刚; 姚丽惠

    2008-01-01

    Objective Using 16S rDNA and 23S rDNA genes as the target sequences to develop a system based on oligonucleotide microarray and to detect the seven clinical pathogenic bacteria, commonly seen. Methods Double polymerase chain reaction(PCR) was applied to amplify the segments of 16S rDNA and 23S rDNA genes of the target bacteria. An oligonucleotide microarray was constructed to simultaneously detect EHEC O157:H7, Vibrio parahaemolyticus , Saimonella sp., Vibrio cholerae ,Listeria monocytogenes, Campylobacter jejuni and Shigella sp. Specificity, sensitivity and reproducibility of the microarray during detection were checked. And then microarray was used to detect the microbes in stool specimens of 81 patients with diarrhea and vomiting. Results The double PCR method could simultaneously amplify the target sequences of 16S rDNA and 23S rDNA genes of the seven pathogens. The sensitivity of the developed oligonueleotide microarray could reach 103 cfu/ml but no positive results were presented for non-targeted bacteria. The coefficients of differentiation in one lot or among different lots of the microarray slices were 3.89%-5.81%. The positive detection rate of the stool specimens by oligonucleotide microarray was 39.5 % (32/81), with a coincidence of 96.3 % (78/81) for the patients and another coincidence of 96.8% (31/32) for bacterial genus or species identification, when comparing to the results by routine bacteriological examinations. Conclusion The established assay in this study based on oligonucleotide microarray to detect the seven pathogenic bacteria has many advantages such as convenient,rapid, accurate, stable and high flux, which is suitable for clinical specimen examination and epidemiological field investigation.%目的 以细菌16S rDNA和23S rDNA基因为靶序列建立可检测临床七种常见病原菌寡核苷酸芯片系统.方法 采用双重PCR扩增标本中靶细菌16S和23S rDNA基因片段.构建能同时检测肠出血性大肠埃希菌O157:H7

  9. Monitoring of labeled antisense oligonucleotides within living cells by using a multifrequency phase/modulation approach for fluorescence lifetime measurements

    Science.gov (United States)

    Kocisova, E.; Sureau, F.; Praus, P.; Rosenberg, I.; Stepanek, J.; Turpin, P.-Y.

    2003-06-01

    A multifrequency phase/modulation method has been developed for our UV confocal laser microspectrofluorimeter (modulation frequency 1-200 MHz) for fluorescence lifetime measurements. This technique enables excited state lifetimes of mixed fluorescent components to be resolved and the fluorescence spectral contribution of each species to be determined without using any model spectra. This approach is very efficient for analyzing intracellular multicomponent fluorescence signals. Our effort is focused on the elucidation of the intracellular behavior of synthetic modified oligonucleotides - potential drugs for antisense and/or antigene strategies of curing viral and malignant diseases. A novel type single stranded dT 15 oligomer analogue containing isopolar, non-isosteric, phosphonate-based internucleotide linkages (3'-O-P-CH 2-O-5'), labeled with tetramethylrhodamine dye at the 3'-end, has been utilized. This method, along with fluorescence micro-imaging, was used to monitor uptake, distribution and stability of our modified oligonucleotide inside living cells. Binding to Escort™ vector leads to an homogeneous intracellular distribution of fluorescent labeled oligonucleotide, including nucleus staining, while point distribution only is achieved for its free form.

  10. A novel parametric approach to mine gene regulatory relationship from microarray datasets

    Directory of Open Access Journals (Sweden)

    Zhu Yunping

    2010-12-01

    Full Text Available Abstract Background Microarray has been widely used to measure the gene expression level on the genome scale in the current decade. Many algorithms have been developed to reconstruct gene regulatory networks based on microarray data. Unfortunately, most of these models and algorithms focus on global properties of the expression of genes in regulatory networks. And few of them are able to offer intuitive parameters. We wonder whether some simple but basic characteristics of microarray datasets can be found to identify the potential gene regulatory relationship. Results Based on expression correlation, expression level variation and vectors derived from microarray expression levels, we first introduced several novel parameters to measure the characters of regulating gene pairs. Subsequently, we used the naïve Bayesian network to integrate these features as well as the functional co-annotation between transcription factors and their target genes. Then, based on the character of time-delay from the expression profile, we were able to predict the existence and direction of the regulatory relationship respectively. Conclusions Several novel parameters have been proposed and integrated to identify the regulatory relationship. This new model is proved to be of higher efficacy than that of individual features. It is believed that our parametric approach can serve as a fast approach for regulatory relationship mining.

  11. An integrated approach for identifying wrongly labelled samples when performing classification in microarray data.

    Directory of Open Access Journals (Sweden)

    Yuk Yee Leung

    Full Text Available BACKGROUND: Using hybrid approach for gene selection and classification is common as results obtained are generally better than performing the two tasks independently. Yet, for some microarray datasets, both classification accuracy and stability of gene sets obtained still have rooms for improvement. This may be due to the presence of samples with wrong class labels (i.e. outliers. Outlier detection algorithms proposed so far are either not suitable for microarray data, or only solve the outlier detection problem on their own. RESULTS: We tackle the outlier detection problem based on a previously proposed Multiple-Filter-Multiple-Wrapper (MFMW model, which was demonstrated to yield promising results when compared to other hybrid approaches (Leung and Hung, 2010. To incorporate outlier detection and overcome limitations of the existing MFMW model, three new features are introduced in our proposed MFMW-outlier approach: 1 an unbiased external Leave-One-Out Cross-Validation framework is developed to replace internal cross-validation in the previous MFMW model; 2 wrongly labeled samples are identified within the MFMW-outlier model; and 3 a stable set of genes is selected using an L1-norm SVM that removes any redundant genes present. Six binary-class microarray datasets were tested. Comparing with outlier detection studies on the same datasets, MFMW-outlier could detect all the outliers found in the original paper (for which the data was provided for analysis, and the genes selected after outlier removal were proven to have biological relevance. We also compared MFMW-outlier with PRAPIV (Zhang et al., 2006 based on same synthetic datasets. MFMW-outlier gave better average precision and recall values on three different settings. Lastly, artificially flipped microarray datasets were created by removing our detected outliers and flipping some of the remaining samples' labels. Almost all the 'wrong' (artificially flipped samples were detected, suggesting

  12. A non-parametric meta-analysis approach for combining independent microarray datasets: application using two microarray datasets pertaining to chronic allograft nephropathy

    Directory of Open Access Journals (Sweden)

    Archer Kellie J

    2008-02-01

    Full Text Available Abstract Background With the popularity of DNA microarray technology, multiple groups of researchers have studied the gene expression of similar biological conditions. Different methods have been developed to integrate the results from various microarray studies, though most of them rely on distributional assumptions, such as the t-statistic based, mixed-effects model, or Bayesian model methods. However, often the sample size for each individual microarray experiment is small. Therefore, in this paper we present a non-parametric meta-analysis approach for combining data from independent microarray studies, and illustrate its application on two independent Affymetrix GeneChip studies that compared the gene expression of biopsies from kidney transplant recipients with chronic allograft nephropathy (CAN to those with normal functioning allograft. Results The simulation study comparing the non-parametric meta-analysis approach to a commonly used t-statistic based approach shows that the non-parametric approach has better sensitivity and specificity. For the application on the two CAN studies, we identified 309 distinct genes that expressed differently in CAN. By applying Fisher's exact test to identify enriched KEGG pathways among those genes called differentially expressed, we found 6 KEGG pathways to be over-represented among the identified genes. We used the expression measurements of the identified genes as predictors to predict the class labels for 6 additional biopsy samples, and the predicted results all conformed to their pathologist diagnosed class labels. Conclusion We present a new approach for combining data from multiple independent microarray studies. This approach is non-parametric and does not rely on any distributional assumptions. The rationale behind the approach is logically intuitive and can be easily understood by researchers not having advanced training in statistics. Some of the identified genes and pathways have been

  13. A non-parametric meta-analysis approach for combining independent microarray datasets: application using two microarray datasets pertaining to chronic allograft nephropathy.

    Science.gov (United States)

    Kong, Xiangrong; Mas, Valeria; Archer, Kellie J

    2008-02-26

    With the popularity of DNA microarray technology, multiple groups of researchers have studied the gene expression of similar biological conditions. Different methods have been developed to integrate the results from various microarray studies, though most of them rely on distributional assumptions, such as the t-statistic based, mixed-effects model, or Bayesian model methods. However, often the sample size for each individual microarray experiment is small. Therefore, in this paper we present a non-parametric meta-analysis approach for combining data from independent microarray studies, and illustrate its application on two independent Affymetrix GeneChip studies that compared the gene expression of biopsies from kidney transplant recipients with chronic allograft nephropathy (CAN) to those with normal functioning allograft. The simulation study comparing the non-parametric meta-analysis approach to a commonly used t-statistic based approach shows that the non-parametric approach has better sensitivity and specificity. For the application on the two CAN studies, we identified 309 distinct genes that expressed differently in CAN. By applying Fisher's exact test to identify enriched KEGG pathways among those genes called differentially expressed, we found 6 KEGG pathways to be over-represented among the identified genes. We used the expression measurements of the identified genes as predictors to predict the class labels for 6 additional biopsy samples, and the predicted results all conformed to their pathologist diagnosed class labels. We present a new approach for combining data from multiple independent microarray studies. This approach is non-parametric and does not rely on any distributional assumptions. The rationale behind the approach is logically intuitive and can be easily understood by researchers not having advanced training in statistics. Some of the identified genes and pathways have been reported to be relevant to renal diseases. Further study on the

  14. Identification of osteopontin as the most consistently over-expressed gene in intrahepatic cholangiocarcinoma:Detection by oligonucleotide microarray and real-time PCR analysis

    Institute of Scientific and Technical Information of China (English)

    Holger G Hass; Oliver Nehls; Juergen Jobst; Andrea Frilling; Ulrich Vogel; Stephan Kaiser

    2008-01-01

    AIM: To investigate the molecular pathways involved in human cholangiocarcinogenesis by gene expression profiling.METHODS: Oligonucleotide arrays (Affymetr/x U133A)were used to establish a specific gene expression profile of intrahepatic CCC in comparison to corresponding nonmalignant liver tissue.To validate the expression values of the most overexpressed genes, RT-PCR experiments were performed.RESULTS: Five hundred and fifty-two statistically differentially expressed genes/ESTs (221 probes significantly up-regulated, 331 probes down-regulated;P2;≥70%) were identified.Using these data and two-dimensional cluster analysis,a specific gene expression profile was obtained allowing fast and reproducible differentiation of CCC, which was confirmed by supervised neuronal network modelling.The most consistently overexpressed gene (median fold change 33.5, significantly overexpressed in 100%)encoded osteopontin.Furthermore, an association of various genes with the histopathological grading could be demonstrated.CONCLUSION: A highly specific gone expression profile for intrahepatic CCC was identified, allowing for its fast and reproducible discrimination against nonmalignant liver tissue and other liver masses.The most overexpressed gene in intrahepatic CCC was the gene encoding osteopontin.These data may lead to a better understanding of human cholangiocarcinogenesis.

  15. Construction of Whole Genome Microarrays, and Expression Analysis of Desulfovibrio vulgaris cells in Metal-Reducing Conditions (Uranium and Chromium)

    Energy Technology Data Exchange (ETDEWEB)

    Fields, Matthew W.

    2005-06-01

    One of the major goals of the project is to construct whole-genome microarrays for Desulfovibrio vulgaris. Previous whole-genome microarrays constructed at ORNL have been PCR-amplimer based, and we wanted to re-evaluate the type of microarrays being built because oligonucleotide probes have several advantages. Microarrays have been generally constructed with two types of probes, PCR-generated probes that typically range in size between 200 and 2000 bp, and oligonucleotide probes with typical size of 20-70 nt. Producing PCR product-based DNA arrays can be a time-consuming procedure that includes PCR primer design, amplification, size verification, product purification, and product quantification. Also, some ORFs are difficult to amplify and thus the construction of comprehensive arrays can be a challenge. Recently, to alleviate some of the problems associated with PCR product-based microarrays, oligonucleotide microarrays that contain probes longer than 40 nt have been evaluated and used for whole genome expression studies. These microarrays should have higher specificity and are easy to construct, and can thus provide an important alternative approach to monitor gene expression. However, due to the smaller probe size, it is expected that the detection sensitivity of oligonucleotide arrays will be lower than PCR product-based probes.

  16. Query Large Scale Microarray Compendium Datasets Using a Model-Based Bayesian Approach with Variable Selection

    Science.gov (United States)

    Hu, Ming; Qin, Zhaohui S.

    2009-01-01

    In microarray gene expression data analysis, it is often of interest to identify genes that share similar expression profiles with a particular gene such as a key regulatory protein. Multiple studies have been conducted using various correlation measures to identify co-expressed genes. While working well for small datasets, the heterogeneity introduced from increased sample size inevitably reduces the sensitivity and specificity of these approaches. This is because most co-expression relationships do not extend to all experimental conditions. With the rapid increase in the size of microarray datasets, identifying functionally related genes from large and diverse microarray gene expression datasets is a key challenge. We develop a model-based gene expression query algorithm built under the Bayesian model selection framework. It is capable of detecting co-expression profiles under a subset of samples/experimental conditions. In addition, it allows linearly transformed expression patterns to be recognized and is robust against sporadic outliers in the data. Both features are critically important for increasing the power of identifying co-expressed genes in large scale gene expression datasets. Our simulation studies suggest that this method outperforms existing correlation coefficients or mutual information-based query tools. When we apply this new method to the Escherichia coli microarray compendium data, it identifies a majority of known regulons as well as novel potential target genes of numerous key transcription factors. PMID:19214232

  17. DNA Microarray as Part of a Genomic-Assisted Breeding Approach

    DEFF Research Database (Denmark)

    Vincze, Éva; Bowra, Steve

    2010-01-01

    . tissue/pathway specific approaches using an example of focused microarray and how it follows predicted changes during grain development. We describe of an extension of the study to field grown material and conclude that such an approach is able to interpret differences in the gene expression profiles......In the struggle to achieve global food security, crop breeding retains an important role in crop production. A current trend is the diversification of the aims of crop production, to include an increased awareness of aspects and consequences of food quality. The added emphasis on food and feed...... and practical significances, fold changes, validation and possible additional regulatory mechanisms in gene expression. The subject of the fourth section is the applications of DNA microarrays to study of global gene expression during grain filling in monocot crops, especially barley. We compare large arrays vs...

  18. Increased expression of matrix extracellular phosphoglycoprotein (MEPE in cortical bone of the rat tibia after mechanical loading: identification by oligonucleotide microarray.

    Directory of Open Access Journals (Sweden)

    Christianne M A Reijnders

    Full Text Available Skeletal integrity in humans and animals is maintained by daily mechanical loading. It has been widely accepted that osteocytes function as mechanosensors. Many biochemical signaling molecules are involved in the response of osteocytes to mechanical stimulation. The aim of this study was to identify genes involved in the translation of mechanical stimuli into bone formation. The four-point bending model was used to induce a single period of mechanical loading on the right tibia, while the contra lateral left tibia served as control. Six hours after loading, the effects of mechanical loading on gene-expression were determined with microarray analysis. Protein expression of differentially regulated genes was evaluated with immunohistochemistry. Nine genes were found to exhibit a significant differential gene expression in LOAD compared to control. MEPE, Garnl1, V2R2B, and QFG-TN1 olfactory receptor were up-regulated, and creatine kinase (muscle form, fibrinogen-B beta-polypeptide, monoamine oxidase A, troponin-C and kinesin light chain-C were down-regulated. Validation with real-time RT-PCR analysis confirmed the up-regulation of MEPE and the down-regulation of creatine kinase (muscle form and troponin-C in the loaded tibia. Immunohistochemistry showed that the increase of MEPE protein expression was already detectable six hours after mechanical loading. In conclusion, these genes probably play a role during translation of mechanical stimuli six hours after mechanical loading. The modulation of MEPE expression may indicate a connection between bone mineralization and bone formation after mechanical stimulation.

  19. A Bayesian approach to analyzing phenotype microarray data enables estimation of microbial growth parameters.

    Science.gov (United States)

    Gerstgrasser, Matthias; Nicholls, Sarah; Stout, Michael; Smart, Katherine; Powell, Chris; Kypraios, Theodore; Stekel, Dov

    2016-06-01

    Biolog phenotype microarrays (PMs) enable simultaneous, high throughput analysis of cell cultures in different environments. The output is high-density time-course data showing redox curves (approximating growth) for each experimental condition. The software provided with the Omnilog incubator/reader summarizes each time-course as a single datum, so most of the information is not used. However, the time courses can be extremely varied and often contain detailed qualitative (shape of curve) and quantitative (values of parameters) information. We present a novel, Bayesian approach to estimating parameters from Phenotype Microarray data, fitting growth models using Markov Chain Monte Carlo (MCMC) methods to enable high throughput estimation of important information, including length of lag phase, maximal "growth" rate and maximum output. We find that the Baranyi model for microbial growth is useful for fitting Biolog data. Moreover, we introduce a new growth model that allows for diauxic growth with a lag phase, which is particularly useful where Phenotype Microarrays have been applied to cells grown in complex mixtures of substrates, for example in industrial or biotechnological applications, such as worts in brewing. Our approach provides more useful information from Biolog data than existing, competing methods, and allows for valuable comparisons between data series and across different models.

  20. Genome-wide identification of gene expression in the epididymis of infertile rat induced by alpha-chlorohydrin using oligonucleotide microarray

    Institute of Scientific and Technical Information of China (English)

    XIE Shu-wu; ZHU Yan; MA Li; LI Zhi-ling; GUI You-lun; LU Ying-ying; ZHAO Zhi-fang; CAO Lin

    2008-01-01

    Objective To establish a rat model of sterility associated with epididymis and epididymal gene expression profiles relation to fertility by alpha-chlorohydrin. Methods Rats were treated with 10 mg·kg-1. d-1. alpha-chlorohydrin for 10 consecutive days. Sperm maturation and other fertility parameters were analyzed. The sperm motility and morphology were evaluated by computer-assisted sperm analysis (CASA);sperm survival rate was assessed by SYBR-14 and propidium iodide (PI) fluorescent staining; the weights of testes, epididymides, prostates and seminal vesicles were determined by electronic balance; histological examination of above tissues were evaluated by HE staining;and serumal dihydrotestosterone (DHT) and testosterone (T) of rats were detected by enzyme-labeled immunoassay. Each male rat was paired with 2 female rats in proestrus. Female rats were examined the next morning for the presence of sperm in vaginal smears and underwent a cesarean section on day 12 of gestation. Finally the reproductive indices were calculated as follows: copulation index (number of sperm positive females / number of pairings), pregnancy index (number of pregnancies / number of sperm positive females), and fertility index (number of pregnancies / number of pairings). After that we used Affymetrix Rat 230 2.0 oligo-microarray to identify epididymal special genes associated with fertility. Finally, we validated some of these genes by Real-Time quantitative polymerase chain reaction. Results The motility of spermatozoa from the cauda epididymidis of treated rats showed a significant decrease in percentage of motile, progressively motile sperm, and sperm survival rate. At the same time, the morphology of cauda epididymal spermatozoa was also adversely affected by the treatment. In addition, the serumal androgen levels of treated animals weren' t changed compared with the control group. Accordingly, matings with treated males resulted in no successful pregnancy. Then, we classified

  1. The Current Status of DNA Microarrays

    Science.gov (United States)

    Shi, Leming; Perkins, Roger G.; Tong, Weida

    DNA microarray technology that allows simultaneous assay of thousands of genes in a single experiment has steadily advanced to become a mainstream method used in research, and has reached a stage that envisions its use in medical applications and personalized medicine. Many different strategies have been developed for manufacturing DNA microarrays. In this chapter, we discuss the manufacturing characteristics of seven microarray platforms that were used in a recently completed large study by the MicroArray Quality Control (MAQC) consortium, which evaluated the concordance of results across these platforms. The platforms can be grouped into three categories: (1) in situ synthesis of oligonucleotide probes on microarrays (Affymetrix GeneChip® arrays based on photolithography synthesis and Agilent's arrays based on inkjet synthesis); (2) spotting of presynthesized oligonucleotide probes on microarrays (GE Healthcare's CodeLink system, Applied Biosystems' Genome Survey Microarrays, and the custom microarrays printed with Operon's oligonucleotide set); and (3) deposition of presynthesized oligonucleotide probes on bead-based microarrays (Illumina's BeadChip microarrays). We conclude this chapter with our views on the challenges and opportunities toward acceptance of DNA microarray data in clinical and regulatory settings.

  2. Identification biomarkers for cervical cancer in peripheral blood lymphocytes by oligonucleotide microarrays%应用寡核苷酸芯片筛选宫颈癌患者外周血生物标志物的研究

    Institute of Scientific and Technical Information of China (English)

    盛洁; 张为远

    2010-01-01

    Objective To identify the molecular biomarkers for cervical cancer in peripheral blood lymphocytes by oligonucleatide microarrays. Methods Human genome oligonucleotide microarray analysis included 4 early-stage cervical cancer patients and 3 controls. The selected genes from the microarray analysis were validated in additional 20 early-stage cervical cancer patients and 15 controls by real-time reverse-transcription polymerase chain reaction (RT-PCR). Results Genes identified by gene selection program were expressed differently in the blood samples of early-stage cervical cancer from those of healthy controls. To validate the gene expression data, 5 genes were analyzed by real-time RT-PCR. In three of 5 identified genes, tenasin-c, nucleolin, and enolase 2 (ENO2) showed a significant up-regulation in blood samples of early-stage cervical cancer patients versus that of the controls. Conclusion The up-regulation of tenasin-c, nucleolin and ENO2 in peripheral blood may be used to identify novel blood biomarkers for detecting cervical cancer in a clinically accessible surrogate tissue. Thus it may offer a possibility of developing a non-invasive and predictive diagnostic tool for the disease.%目的 应用人类全基因组寡核苷酸芯片技术在宫颈癌患者外周血中确定生物分子标志物.方法 从24例早期宫颈癌患者和18例正常对照者的外周血淋巴细胞中提取总RNA.应用微阵列技术,采用人类全基因组寡核苷酸芯片检测4例宫颈癌患者和3例正常对照者的差异表达基因,再对20例宫颈癌患者和15例正常对照者将初步筛选出的5个候选基因用实时定量逆转录多聚酶链反应(RT-PCR)的方法进行验证.结果 筛选得到57个差异表达基因,其中38个基因表达上调,19个基因表达下调;对初步筛选出的5个候选基因经实时定量逆转录多聚酶链反应的方法进行验证后发现黏合素-C、核仁素和磷酸丙酮酸水合酶2(enolase 2,ENO2)基因在宫

  3. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Directory of Open Access Journals (Sweden)

    Yusuf E Murgha

    Full Text Available Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  4. Methods for the preparation of large quantities of complex single-stranded oligonucleotide libraries.

    Science.gov (United States)

    Murgha, Yusuf E; Rouillard, Jean-Marie; Gulari, Erdogan

    2014-01-01

    Custom-defined oligonucleotide collections have a broad range of applications in fields of synthetic biology, targeted sequencing, and cytogenetics. Also, they are used to encode information for technologies like RNA interference, protein engineering and DNA-encoded libraries. High-throughput parallel DNA synthesis technologies developed for the manufacture of DNA microarrays can produce libraries of large numbers of different oligonucleotides, but in very limited amounts. Here, we compare three approaches to prepare large quantities of single-stranded oligonucleotide libraries derived from microarray synthesized collections. The first approach, alkaline melting of double-stranded PCR amplified libraries with a biotinylated strand captured on streptavidin coated magnetic beads results in little or no non-biotinylated ssDNA. The second method wherein the phosphorylated strand of PCR amplified libraries is nucleolyticaly hydrolyzed is recommended when small amounts of libraries are needed. The third method combining in vitro transcription of PCR amplified libraries to reverse transcription of the RNA product into single-stranded cDNA is our recommended method to produce large amounts of oligonucleotide libraries. Finally, we propose a method to remove any primer binding sequences introduced during library amplification.

  5. Development of a human mitochondrial oligonucleotide microarray (h-MitoArray and gene expression analysis of fibroblast cell lines from 13 patients with isolated F1Fo ATP synthase deficiency

    Directory of Open Access Journals (Sweden)

    Hansíková Hana

    2008-01-01

    Full Text Available Abstract Background To strengthen research and differential diagnostics of mitochondrial disorders, we constructed and validated an oligonucleotide microarray (h-MitoArray allowing expression analysis of 1632 human genes involved in mitochondrial biology, cell cycle regulation, signal transduction and apoptosis. Using h-MitoArray we analyzed gene expression profiles in 9 control and 13 fibroblast cell lines from patients with F1Fo ATP synthase deficiency consisting of 2 patients with mt9205ΔTA microdeletion and a genetically heterogeneous group of 11 patients with not yet characterized nuclear defects. Analysing gene expression profiles, we attempted to classify patients into expected defect specific subgroups, and subsequently reveal group specific compensatory changes, identify potential phenotype causing pathways and define candidate disease causing genes. Results Molecular studies, in combination with unsupervised clustering methods, defined three subgroups of patient cell lines – M group with mtDNA mutation and N1 and N2 groups with nuclear defect. Comparison of expression profiles and functional annotation, gene enrichment and pathway analyses of differentially expressed genes revealed in the M group a transcription profile suggestive of synchronized suppression of mitochondrial biogenesis and G1/S arrest. The N1 group showed elevated expression of complex I and reduced expression of complexes III, V, and V-type ATP synthase subunit genes, reduced expression of genes involved in phosphorylation dependent signaling along MAPK, Jak-STAT, JNK, and p38 MAP kinase pathways, signs of activated apoptosis and oxidative stress resembling phenotype of premature senescent fibroblasts. No specific functionally meaningful changes, except of signs of activated apoptosis, were detected in the N2 group. Evaluation of individual gene expression profiles confirmed already known ATP6/ATP8 defect in patients from the M group and indicated several candidate

  6. Utility of the pooling approach as applied to whole genome association scans with high-density Affymetrix microarrays

    Directory of Open Access Journals (Sweden)

    Gray Joanna

    2010-11-01

    Full Text Available Abstract Background We report an attempt to extend the previously successful approach of combining SNP (single nucleotide polymorphism microarrays and DNA pooling (SNP-MaP employing high-density microarrays. Whereas earlier studies employed a range of Affymetrix SNP microarrays comprising from 10 K to 500 K SNPs, this most recent investigation used the 6.0 chip which displays 906,600 SNP probes and 946,000 probes for the interrogation of CNVs (copy number variations. The genotyping assay using the Affymetrix SNP 6.0 array is highly demanding on sample quality due to the small feature size, low redundancy, and lack of mismatch probes. Findings In the first study published so far using this microarray on pooled DNA, we found that pooled cheek swab DNA could not accurately predict real allele frequencies of the samples that comprised the pools. In contrast, the allele frequency estimates using blood DNA pools were reasonable, although inferior compared to those obtained with previously employed Affymetrix microarrays. However, it might be possible to improve performance by developing improved analysis methods. Conclusions Despite the decreasing costs of genome-wide individual genotyping, the pooling approach may have applications in very large-scale case-control association studies. In such cases, our study suggests that high-quality DNA preparations and lower density platforms should be preferred.

  7. Distinguishing bacterial pathogens of potato using a genome-wide microarray approach.

    Science.gov (United States)

    Aittamaa, M; Somervuo, P; Pirhonen, M; Mattinen, L; Nissinen, R; Auvinen, P; Valkonen, J P T

    2008-09-01

    A set of 9676 probes was designed for the most harmful bacterial pathogens of potato and tested in a microarray format. Gene-specific probes could be designed for all genes of Pectobacterium atrosepticum, c. 50% of the genes of Streptomyces scabies and c. 30% of the genes of Clavibacter michiganensis ssp. sepedonicus utilizing the whole-genome sequence information available. For Streptomyces turgidiscabies, 226 probes were designed according to the sequences of a pathogenicity island containing important virulence genes. In addition, probes were designed for the virulence-associated nip (necrosis-inducing protein) genes of P. atrosepticum, P. carotovorum and Dickeya dadantii and for the intergenic spacer (IGS) sequences of the 16S-23S rRNA gene region. Ralstonia solanacearum was not included in the study, because it is a quarantine organism and is not presently found in Finland, but a few probes were also designed for this species. The probes contained on average 40 target-specific nucleotides and were synthesized on the array in situ, organized as eight sub-arrays with an identical set of probes which could be used for hybridization with different samples. All bacteria were readily distinguished using a single channel system for signal detection. Nearly all of the c. 1000 probes designed for C. michiganensis ssp. sepedonicus, c. 50% and 40% of the c. 4000 probes designed for the genes of S. scabies and P. atrosepticum, respectively, and over 100 probes for S. turgidiscabies showed significant signals only with the respective species. P. atrosepticum, P. carotovorum and Dickeya strains were all detected with 110 common probes. By contrast, the strains of these species were found to differ in their signal profiles. Probes targeting the IGS region and nip genes could be used to place strains of Dickeya to two groups, which correlated with differences in virulence. Taken together, the approach of using a custom-designed, genome-wide microarray provided a robust means

  8. Design Considerations for Array CGH to OligonucleotideArrays

    Energy Technology Data Exchange (ETDEWEB)

    Baldocchi, R.A.; Glynne, R.J.; Chin, K.; Kowbel, D.; Collins, C.; Mack, D.H.; Gray, J.W.

    2005-03-04

    Background: Representational oligonucleotide microarray analysis has been developed for detection of single nucleotide polymorphisms and/or for genome copy number changes. In this process, the intensity of hybridization to oligonucleotides arrays is increased by hybridizing a polymerase chain reaction (PCR)-amplified representation of reduced genomic complexity. However, hybridization to some oligonucleotides is not sufficiently high to allow precise analysis of that portion of the genome. Methods: In an effort to identify aspects of oligonucleotide hybridization affecting signal intensity, we explored the importance of the PCR product strand to which each oligonucleotide is homologous and the sequence of the array oligonucleotides. We accomplished this by hybridizing multiple PCR-amplified products to oligonucleotide arrays carrying two sense and two antisense 50-mer oligonucleotides for each PCR amplicon. Results: In some cases, hybridization intensity depended more strongly on the PCR amplicon strand (i.e., sense vs. antisense) than on the detection oligonucleotide sequence. In other cases, the oligonucleotide sequence seemed to dominate. Conclusion: Oligonucleotide arrays for analysis of DNA copy number or for single nucleotide polymorphism content should be designed to carry probes to sense and antisense strands of each PCR amplicon to ensure sufficient hybridization and signal intensity.

  9. Swarm Intelligence Approach Based on Adaptive ELM Classifier with ICGA Selection for Microarray Gene Expression and Cancer Classification

    Directory of Open Access Journals (Sweden)

    T. Karthikeyan

    2014-05-01

    Full Text Available The aim of this research study is based on efficient gene selection and classification of microarray data analysis using hybrid machine learning algorithms. The beginning of microarray technology has enabled the researchers to quickly measure the position of thousands of genes expressed in an organic/biological tissue samples in a solitary experiment. One of the important applications of this microarray technology is to classify the tissue samples using their gene expression representation, identify numerous type of cancer. Cancer is a group of diseases in which a set of cells shows uncontrolled growth, instance that interrupts upon and destroys nearby tissues and spreading to other locations in the body via lymph or blood. Cancer has becomes a one of the major important disease in current scenario. DNA microarrays turn out to be an effectual tool utilized in molecular biology and cancer diagnosis. Microarrays can be measured to establish the relative quantity of mRNAs in two or additional organic/biological tissue samples for thousands/several thousands of genes at the same time. As the superiority of this technique become exactly analysis/identifying the suitable assessment of microarray data in various open issues. In the field of medical sciences multi-category cancer classification play a major important role to classify the cancer types according to the gene expression. The need of the cancer classification has been become indispensible, because the numbers of cancer victims are increasing steadily identified by recent years. To perform this proposed a combination of Integer-Coded Genetic Algorithm (ICGA and Artificial Bee Colony algorithm (ABC, coupled with an Adaptive Extreme Learning Machine (AELM, is used for gene selection and cancer classification. ICGA is used with ABC based AELM classifier to chose an optimal set of genes which results in an efficient hybrid algorithm that can handle sparse data and sample imbalance. The

  10. "Harshlighting" small blemishes on microarrays

    Directory of Open Access Journals (Sweden)

    Wittkowski Knut M

    2005-03-01

    Full Text Available Abstract Background Microscopists are familiar with many blemishes that fluorescence images can have due to dust and debris, glass flaws, uneven distribution of fluids or surface coatings, etc. Microarray scans show similar artefacts, which affect the analysis, particularly when one tries to detect subtle changes. However, most blemishes are hard to find by the unaided eye, particularly in high-density oligonucleotide arrays (HDONAs. Results We present a method that harnesses the statistical power provided by having several HDONAs available, which are obtained under similar conditions except for the experimental factor. This method "harshlights" blemishes and renders them evident. We find empirically that about 25% of our chips are blemished, and we analyze the impact of masking them on screening for differentially expressed genes. Conclusion Experiments attempting to assess subtle expression changes should be carefully screened for blemishes on the chips. The proposed method provides investigators with a novel robust approach to improve the sensitivity of microarray analyses. By utilizing topological information to identify and mask blemishes prior to model based analyses, the method prevents artefacts from confounding the process of background correction, normalization, and summarization.

  11. Assessing the reliability of amplified RNA used in microarrays: a DUMB table approach.

    Science.gov (United States)

    Bearden, Edward D; Simpson, Pippa M; Peterson, Charlotte A; Beggs, Marjorie L

    2006-01-01

    A certain minimal amount of RNA from biological samples is necessary to perform a microarray experiment with suitable replication. In some cases, the amount of RNA available is insufficient, necessitating RNA amplification prior to target synthesis. However, there is some uncertainty about the reliability of targets that have been generated from amplified RNA, because of nonlinearity and preferential amplification. This current work develops a straightforward strategy to assess the reliability of microarray data obtained from amplified RNA. The tabular method we developed, which utilises a Down-Up-Missing-Below (DUMB) classification scheme, shows that microarrays generated with amplified RNA targets are reliable within constraints. There was an increase in false negatives because of the need for increased filtering. Furthermore, this analysis method is generic and can be broadly applied to evaluate all microarray data. A copy of the Microsoft Excel spreadsheet is available upon request from Edward Bearden.

  12. DNA Microarray-based Ecotoxicological Biomarker Discovery in a Small Fish Model Species

    Science.gov (United States)

    This paper addresses several issues critical to use of zebrafish oligonucleotide microarrays for computational toxicology research on endocrine disrupting chemicals using small fish models, and more generally, the use of microarrays in aquatic toxicology.

  13. Microarray analysis of p-anisaldehyde-induced transcriptome of Saccharomyces cerevisiae.

    Science.gov (United States)

    Yu, Lu; Guo, Na; Yang, Yi; Wu, Xiuping; Meng, Rizeng; Fan, Junwen; Ge, Fa; Wang, Xuelin; Liu, Jingbo; Deng, Xuming

    2010-03-01

    p-Anisaldehyde (4-methoxybenzaldehyde), an extract from Pimpinella anisum L. seeds, is a potential novel preservative. To reveal the possible action mechanism of p-anisaldehyde against microorganisms, yeast-based commercial oligonucleotide microarrays were used to analyze the genome-wide transcriptional changes in response to p-anisaldehyde. Quantitative real-time RT-PCR was performed for selected genes to verify the microarray results. We interpreted our microarray data with the clustering tool, T-profiler. Analysis of microarray data revealed that p-anisaldehyde induced the expression of genes related to sulphur assimilation, aromatic aldehydes metabolism, and secondary metabolism, which demonstrated that the addition of p-anisaldehyde may influence the normal metabolism of aromatic aldehydes. This genome-wide transcriptomics approach revealed first insights into the response of Saccharomyces cerevisiae (S. cerevisiae) to p-anisaldehyde challenge.

  14. Label-free detection of hybridization of oligonucleotides by oblique-incidence reflectivity difference method

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    The microarrays of 20-base oligonucleotide with different concentrations are detected before and after hybridization by the oblique-incidence reflectivity difference (OI-RD) method. The experimental results prove that OI-RD is a label-free method which can not only distinguish the concentration difference of oligonucleotides before and after the hybridization but also detect the hybridization of short oligonucleotides. At present the OI-RD method can detect 0.39 μmol/L 20-base oligonucleotide or less. These results suggest that the OI-RD method is a promising and potential technique for label-free detection of biological microarrays.

  15. Cross-platform analysis of cancer microarray data improves gene expression based classification of phenotypes

    Directory of Open Access Journals (Sweden)

    Eils Roland

    2005-11-01

    Full Text Available Abstract Background The extensive use of DNA microarray technology in the characterization of the cell transcriptome is leading to an ever increasing amount of microarray data from cancer studies. Although similar questions for the same type of cancer are addressed in these different studies, a comparative analysis of their results is hampered by the use of heterogeneous microarray platforms and analysis methods. Results In contrast to a meta-analysis approach where results of different studies are combined on an interpretative level, we investigate here how to directly integrate raw microarray data from different studies for the purpose of supervised classification analysis. We use median rank scores and quantile discretization to derive numerically comparable measures of gene expression from different platforms. These transformed data are then used for training of classifiers based on support vector machines. We apply this approach to six publicly available cancer microarray gene expression data sets, which consist of three pairs of studies, each examining the same type of cancer, i.e. breast cancer, prostate cancer or acute myeloid leukemia. For each pair, one study was performed by means of cDNA microarrays and the other by means of oligonucleotide microarrays. In each pair, high classification accuracies (> 85% were achieved with training and testing on data instances randomly chosen from both data sets in a cross-validation analysis. To exemplify the potential of this cross-platform classification analysis, we use two leukemia microarray data sets to show that important genes with regard to the biology of leukemia are selected in an integrated analysis, which are missed in either single-set analysis. Conclusion Cross-platform classification of multiple cancer microarray data sets yields discriminative gene expression signatures that are found and validated on a large number of microarray samples, generated by different laboratories and

  16. Combined Bacteria Microarray and Quartz Crystal Microbalance Approach for Exploring Glycosignatures of Nontypeable Haemophilus influenzae and Recognition by Host Lectins.

    Science.gov (United States)

    Kalograiaki, Ioanna; Euba, Begoña; Proverbio, Davide; Campanero-Rhodes, María A; Aastrup, Teodor; Garmendia, Junkal; Solís, Dolores

    2016-06-01

    Recognition of bacterial surface epitopes by host receptors plays an important role in the infectious process and is intimately associated with bacterial virulence. Delineation of bacteria-host interactions commonly relies on the detection of binding events between purified bacteria- and host-target molecules. In this work, we describe a combined microarray and quartz crystal microbalance (QCM) approach for the analysis of carbohydrate-mediated interactions directly on the bacterial surface, thus preserving the native environment of the bacterial targets. Nontypeable Haemophilus influenzae (NTHi) was selected as a model pathogenic species not displaying a polysaccharide capsule or O-antigen-containing lipopolysaccharide, a trait commonly found in several important respiratory pathogens. Here, we demonstrate the usefulness of NTHi microarrays for exploring the presence of carbohydrate structures on the bacterial surface. Furthermore, the microarray approach is shown to be efficient for detecting strain-selective binding of three innate immune lectins, namely, surfactant protein D, human galectin-8, and Siglec-14, to different NTHi clinical isolates. In parallel, QCM bacteria-chips were developed for the analysis of lectin-binding kinetics and affinity. This novel QCM approach involves capture of NTHi on lectin-derivatized chips followed by formaldehyde fixation, rendering the bacteria an integrated part of the sensor chip, and subsequent binding assays with label-free lectins. The binding parameters obtained for selected NTHi-lectin pairs provide further insights into the interactions occurring at the bacterial surface.

  17. Triple-target microarray experiments: a novel experimental strategy

    Directory of Open Access Journals (Sweden)

    Cooke Howard J

    2004-02-01

    Full Text Available Abstract Background High-throughput, parallel gene expression analysis by means of microarray technology has become a widely used technique in recent years. There are currently two main dye-labelling strategies for microarray studies based on custom-spotted cDNA or oligonucleotides arrays: (I Dye-labelling of a single target sample with a particular dye, followed by subsequent hybridisation to a single microarray slide, (II Dye-labelling of two different target samples with two different dyes, followed by subsequent co-hybridisation to a single microarray slide. The two dyes most frequently used for either method are Cy3 and Cy5. We propose and evaluate a novel experiment set-up utilising three differently labelled targets co-hybridised to one microarray slide. In addition to Cy3 and Cy5, this incorporates Alexa 594 as a third dye-label. We evaluate this approach in line with current data processing and analysis techniques for microarrays, and run separate analyses on Alexa 594 used in single-target, dual-target and the intended triple-target experiment set-ups (a total of 18 microarray slides. We follow this by pointing out practical applications and suitable analysis methods, and conclude that triple-target microarray experiments can add value to microarray research by reducing material costs for arrays and related processes, and by increasing the number of options for pragmatic experiment design. Results The addition of Alexa 594 as a dye-label for an additional – third – target sample works within the framework of more commonplace Cy5/Cy3 labelled target sample combinations. Standard normalisation methods are still applicable, and the resulting data can be expected to allow identification of expression differences in a biological experiment, given sufficient levels of biological replication (as is necessary for most microarray experiments. Conclusion The use of three dye-labelled target samples can be a valuable addition to the standard

  18. A visual analytics approach for understanding biclustering results from microarray data

    Directory of Open Access Journals (Sweden)

    Quintales Luis

    2008-05-01

    Full Text Available Abstract Background Microarray analysis is an important area of bioinformatics. In the last few years, biclustering has become one of the most popular methods for classifying data from microarrays. Although biclustering can be used in any kind of classification problem, nowadays it is mostly used for microarray data classification. A large number of biclustering algorithms have been developed over the years, however little effort has been devoted to the representation of the results. Results We present an interactive framework that helps to infer differences or similarities between biclustering results, to unravel trends and to highlight robust groupings of genes and conditions. These linked representations of biclusters can complement biological analysis and reduce the time spent by specialists on interpreting the results. Within the framework, besides other standard representations, a visualization technique is presented which is based on a force-directed graph where biclusters are represented as flexible overlapped groups of genes and conditions. This microarray analysis framework (BicOverlapper, is available at http://vis.usal.es/bicoverlapper Conclusion The main visualization technique, tested with different biclustering results on a real dataset, allows researchers to extract interesting features of the biclustering results, especially the highlighting of overlapping zones that usually represent robust groups of genes and/or conditions. The visual analytics methodology will permit biology experts to study biclustering results without inspecting an overwhelming number of biclusters individually.

  19. The Chemistry and Biology of Oligonucleotide Conjugates

    Science.gov (United States)

    Juliano, R.L.; Ming, Xin; Nakagawa, Osamu

    2012-01-01

    CONSPECTUS Short DNA or RNA oligonucleotides have tremendous potential as therapeutic agents. Because of their ability to engage in Watson-Crick base pairing they can interact with messenger mRNA or pre-mRNA targets with high selectivity and thus offer the possibility of precise manipulation of gene expression. This possibility has engendered extensive efforts to develop oligonucleotides as drugs, with many candidates already in clinical trials. However, a major impediment to the maturation of oligonucleotide-based therapeutics is the fact that these relatively large and usually highly charged molecules have great difficulty crossing cellular membranes and thus in penetrating to their sites of action in the cytosol or nucleus. In this Account we first summarize some basic aspects of the biology of antisense and siRNA oligonucleotides and then discuss chemical conjugation as an approach to improving the intracellular delivery and therapeutic potential of these agents. Our emphasis will be on the pharmacological ramifications of oligonucleotide conjugates rather than the details of conjugation chemistry. One important approach has been conjugation with ligands designed to bind to particular receptors and thus provide specificity to the interaction of cells with oligonucleotides. Another approach has been to couple antisense or siRNA with agents such as cell penetrating peptides that are designed to provoke escape of the conjugate from intracellular vesicular compartments. Both of these approaches have enjoyed some success. However, there remains much to be learned before oligonucleotide conjugates can find an important place in human therapeutics. PMID:22353142

  20. A Combinatory Approach for Selecting Prognostic Genes in Microarray Studies of Tumour Survivals

    Directory of Open Access Journals (Sweden)

    Qihua Tan

    2009-01-01

    Full Text Available Different from significant gene expression analysis which looks for genes that are differentially regulated, feature selection in the microarray-based prognostic gene expression analysis aims at finding a subset of marker genes that are not only differentially expressed but also informative for prediction. Unfortunately feature selection in literature of microarray study is predominated by the simple heuristic univariate gene filter paradigm that selects differentially expressed genes according to their statistical significances. We introduce a combinatory feature selection strategy that integrates differential gene expression analysis with the Gram-Schmidt process to identify prognostic genes that are both statistically significant and highly informative for predicting tumour survival outcomes. Empirical application to leukemia and ovarian cancer survival data through-within- and cross-study validations shows that the feature space can be largely reduced while achieving improved testing performances.

  1. Transcription network construction for large-scale microarray datasets using a high-performance computing approach

    OpenAIRE

    Wu Qishi; Zhu Mengxia

    2008-01-01

    Abstract Background The advance in high-throughput genomic technologies including microarrays has demonstrated the potential of generating a tremendous amount of gene expression data for the entire genome. Deciphering transcriptional networks that convey information on intracluster correlations and intercluster connections of genes is a crucial analysis task in the post-sequence era. Most of the existing analysis methods for genome-wide gene expression profiles consist of several steps that o...

  2. A Bayesian approach to analyzing phenotype microarray data enables estimation of microbial growth parameters

    OpenAIRE

    Gerstgrasser, Matthias; Nicholls, Sarah; Stout, Michael; Smart, Katherine; Powell, Chris; Kypraios, Theodore; Stekel, Dov J.

    2016-01-01

    Biolog phenotype microarrays enable simultaneous, high throughput analysis of cell cultures in different environments. The output is high-density time-course data showing redox curves (approximating growth) for each experimental condition. The software provided with the Omnilog incubator/reader summarizes each time-course as a single datum, so most of the information is not used. However, the time courses can be extremely varied and often contain detailed qualitative (shape of curve) and quan...

  3. Carbohydrate microarrays

    DEFF Research Database (Denmark)

    Park, Sungjin; Gildersleeve, Jeffrey C; Blixt, Klas Ola;

    2012-01-01

    In the last decade, carbohydrate microarrays have been core technologies for analyzing carbohydrate-mediated recognition events in a high-throughput fashion. A number of methods have been exploited for immobilizing glycans on the solid surface in a microarray format. This microarray-based technol...

  4. Molecular Mechanisms of Antisense Oligonucleotides.

    Science.gov (United States)

    Crooke, Stanley T

    2017-04-01

    In 1987, when I became interested in the notion of antisense technology, I returned to my roots in RNA biochemistry and began work to understand how oligonucleotides behave in biological systems. Since 1989, my research has focused primarily on this topic, although I have been involved in most areas of research in antisense technology. I believe that the art of excellent science is to frame large important questions that are perhaps not immediately answerable with existing knowledge and methods, and then conceive a long-term (multiyear) research strategy that begins by answering the most pressing answerable questions on the path to the long-term goals. Then, a step-by-step research pathway that will address the strategic questions posed must be implemented, adjusting the plan as new things are learned. This is the approach we have taken at Ionis. Obviously, to create antisense technology, we have had to address a wide array of strategic questions, for example, the medicinal chemistry of oligonucleotides, manufacturing and analytical methods, pharmacokinetics and toxicology, as well as questions about the molecular pharmacology of antisense oligonucleotides (ASOs). Each of these endeavors has consumed nearly three decades of scientific effort, is still very much a work-in-progress, and has resulted in hundreds of publications. As a recipient of the Lifetime Achievement Award 2016 granted by the Oligonucleotide Therapeutic Society, in this note, my goal is to summarize the contributions of my group to the efforts to understand the molecular mechanisms of ASOs.

  5. Synthesis of 3'-, or 5'-, or internal methacrylamido-modified oligonucleotides

    Science.gov (United States)

    Golova, Julia B.; Chernov, Boris K.

    2010-04-27

    New modifiers were synthesized for incorporation of a methacrylic function in 3'-, 5'- and internal positions of oligonucleotides during solid phase synthesis. A modifier was used for synthesis of 5'-methacrylated oligonucleotides for preparation of microarrays by a co-polymerization method.

  6. Direct calibration of PICKY-designed microarrays

    Directory of Open Access Journals (Sweden)

    Ronald Pamela C

    2009-10-01

    Full Text Available Abstract Background Few microarrays have been quantitatively calibrated to identify optimal hybridization conditions because it is difficult to precisely determine the hybridization characteristics of a microarray using biologically variable cDNA samples. Results Using synthesized samples with known concentrations of specific oligonucleotides, a series of microarray experiments was conducted to evaluate microarrays designed by PICKY, an oligo microarray design software tool, and to test a direct microarray calibration method based on the PICKY-predicted, thermodynamically closest nontarget information. The complete set of microarray experiment results is archived in the GEO database with series accession number GSE14717. Additional data files and Perl programs described in this paper can be obtained from the website http://www.complex.iastate.edu under the PICKY Download area. Conclusion PICKY-designed microarray probes are highly reliable over a wide range of hybridization temperatures and sample concentrations. The microarray calibration method reported here allows researchers to experimentally optimize their hybridization conditions. Because this method is straightforward, uses existing microarrays and relatively inexpensive synthesized samples, it can be used by any lab that uses microarrays designed by PICKY. In addition, other microarrays can be reanalyzed by PICKY to obtain the thermodynamically closest nontarget information for calibration.

  7. Meta-coexpression conservation analysis of microarray data: a "subset" approach provides insight into brain-derived neurotrophic factor regulation

    Directory of Open Access Journals (Sweden)

    Timmusk Tõnis

    2009-09-01

    Full Text Available Abstract Background Alterations in brain-derived neurotrophic factor (BDNF gene expression contribute to serious pathologies such as depression, epilepsy, cancer, Alzheimer's, Huntington and Parkinson's disease. Therefore, exploring the mechanisms of BDNF regulation represents a great clinical importance. Studying BDNF expression remains difficult due to its multiple neural activity-dependent and tissue-specific promoters. Thus, microarray data could provide insight into the regulation of this complex gene. Conventional microarray co-expression analysis is usually carried out by merging the datasets or by confirming the re-occurrence of significant correlations across datasets. However, co-expression patterns can be different under various conditions that are represented by subsets in a dataset. Therefore, assessing co-expression by measuring correlation coefficient across merged samples of a dataset or by merging datasets might not capture all correlation patterns. Results In our study, we performed meta-coexpression analysis of publicly available microarray data using BDNF as a "guide-gene" introducing a "subset" approach. The key steps of the analysis included: dividing datasets into subsets with biologically meaningful sample content (e.g. tissue, gender or disease state subsets; analyzing co-expression with the BDNF gene in each subset separately; and confirming co- expression links across subsets. Finally, we analyzed conservation in co-expression with BDNF between human, mouse and rat, and sought for conserved over-represented TFBSs in BDNF and BDNF-correlated genes. Correlated genes discovered in this study regulate nervous system development, and are associated with various types of cancer and neurological disorders. Also, several transcription factor identified here have been reported to regulate BDNF expression in vitro and in vivo. Conclusion The study demonstrates the potential of the "subset" approach in co-expression conservation

  8. Nonparametric variance estimation in the analysis of microarray data: a measurement error approach.

    Science.gov (United States)

    Carroll, Raymond J; Wang, Yuedong

    2008-01-01

    This article investigates the effects of measurement error on the estimation of nonparametric variance functions. We show that either ignoring measurement error or direct application of the simulation extrapolation, SIMEX, method leads to inconsistent estimators. Nevertheless, the direct SIMEX method can reduce bias relative to a naive estimator. We further propose a permutation SIMEX method which leads to consistent estimators in theory. The performance of both SIMEX methods depends on approximations to the exact extrapolants. Simulations show that both SIMEX methods perform better than ignoring measurement error. The methodology is illustrated using microarray data from colon cancer patients.

  9. Development of a high-throughput microfluidic integrated microarray for the detection of chimeric bioweapons.

    Energy Technology Data Exchange (ETDEWEB)

    Sheppod, Timothy; Satterfield, Brent; Hukari, Kyle W.; West, Jason A. A.; Hux, Gary A.

    2006-10-01

    The advancement of DNA cloning has significantly augmented the potential threat of a focused bioweapon assault, such as a terrorist attack. With current DNA cloning techniques, toxin genes from the most dangerous (but environmentally labile) bacterial or viral organism can now be selected and inserted into robust organism to produce an infinite number of deadly chimeric bioweapons. In order to neutralize such a threat, accurate detection of the expressed toxin genes, rather than classification on strain or genealogical decent of these organisms, is critical. The development of a high-throughput microarray approach will enable the detection of unknowns chimeric bioweapons. The development of a high-throughput microarray approach will enable the detection of unknown bioweapons. We have developed a unique microfluidic approach to capture and concentrate these threat genes (mRNA's) upto a 30 fold concentration. These captured oligonucleotides can then be used to synthesize in situ oligonucleotide copies (cDNA probes) of the captured genes. An integrated microfluidic architecture will enable us to control flows of reagents, perform clean-up steps and finally elute nanoliter volumes of synthesized oligonucleotides probes. The integrated approach has enabled a process where chimeric or conventional bioweapons can rapidly be identified based on their toxic function, rather than being restricted to information that may not identify the critical nature of the threat.

  10. A High Throughput Protein Microarray Approach to Classify HIV Monoclonal Antibodies and Variant Antigens.

    Directory of Open Access Journals (Sweden)

    Emmanuel Y Dotsey

    Full Text Available In recent years, high throughput discovery of human recombinant monoclonal antibodies (mAbs has been applied to greatly advance our understanding of the specificity, and functional activity of antibodies against HIV. Thousands of antibodies have been generated and screened in functional neutralization assays, and antibodies associated with cross-strain neutralization and passive protection in primates, have been identified. To facilitate this type of discovery, a high throughput-screening tool is needed to accurately classify mAbs, and their antigen targets. In this study, we analyzed and evaluated a prototype microarray chip comprised of the HIV-1 recombinant proteins gp140, gp120, gp41, and several membrane proximal external region peptides. The protein microarray analysis of 11 HIV-1 envelope-specific mAbs revealed diverse binding affinities and specificities across clades. Half maximal effective concentrations, generated by our chip analysis, correlated significantly (P<0.0001 with concentrations from ELISA binding measurements. Polyclonal immune responses in plasma samples from HIV-1 infected subjects exhibited different binding patterns, and reactivity against printed proteins. Examining the totality of the specificity of the humoral response in this way reveals the exquisite diversity, and specificity of the humoral response to HIV.

  11. A Latent Variable Approach for Meta-Analysis of Gene Expression Data from Multiple Microarray Experiments

    Directory of Open Access Journals (Sweden)

    Chinnaiyan Arul M

    2007-09-01

    Full Text Available Abstract Background With the explosion in data generated using microarray technology by different investigators working on similar experiments, it is of interest to combine results across multiple studies. Results In this article, we describe a general probabilistic framework for combining high-throughput genomic data from several related microarray experiments using mixture models. A key feature of the model is the use of latent variables that represent quantities that can be combined across diverse platforms. We consider two methods for estimation of an index termed the probability of expression (POE. The first, reported in previous work by the authors, involves Markov Chain Monte Carlo (MCMC techniques. The second method is a faster algorithm based on the expectation-maximization (EM algorithm. The methods are illustrated with application to a meta-analysis of datasets for metastatic cancer. Conclusion The statistical methods described in the paper are available as an R package, metaArray 1.8.1, which is at Bioconductor, whose URL is http://www.bioconductor.org/.

  12. Improved statistical analysis of budding yeast TAG microarrays revealed by defined spike-in pools.

    Science.gov (United States)

    Peyser, Brian D; Irizarry, Rafael A; Tiffany, Carol W; Chen, Ou; Yuan, Daniel S; Boeke, Jef D; Spencer, Forrest A

    2005-09-15

    Saccharomyces cerevisiae knockout collection TAG microarrays are an emergent platform for rapid, genome-wide functional characterization of yeast genes. TAG arrays report abundance of unique oligonucleotide 'TAG' sequences incorporated into each deletion mutation of the yeast knockout collection, allowing measurement of relative strain representation across experimental conditions for all knockout mutants simultaneously. One application of TAG arrays is to perform genome-wide synthetic lethality screens, known as synthetic lethality analyzed by microarray (SLAM). We designed a fully defined spike-in pool to resemble typical SLAM experiments and performed TAG microarray hybridizations. We describe a method for analyzing two-color array data to efficiently measure the differential knockout strain representation across two experimental conditions, and use the spike-in pool to show that the sensitivity and specificity of this method exceed typical current approaches.

  13. Formation and characterization of DNA microarrays at silicon nitride substrates.

    Science.gov (United States)

    Manning, Mary; Redmond, Gareth

    2005-01-01

    A versatile method for direct, covalent attachment of DNA microarrays at silicon nitride layers, previously deposited by chemical vapor deposition at silicon wafer substrates, is reported. Each microarray fabrication process step, from silicon nitride substrate deposition, surface cleaning, amino-silanation, and attachment of a homobifunctional cross-linking molecule to covalent immobilization of probe oligonucleotides, is defined, characterized, and optimized to yield consistent probe microarray quality, homogeneity, and probe-target hybridization performance. The developed microarray fabrication methodology provides excellent (high signal-to-background ratio) and reproducible responsivity to target oligonucleotide hybridization with a rugged chemical stability that permits exposure of arrays to stringent pre- and posthybridization wash conditions through many sustained cycles of reuse. Overall, the achieved performance features compare very favorably with those of more mature glass based microarrays. It is proposed that this DNA microarray fabrication strategy has the potential to provide a viable route toward the successful realization of future integrated DNA biochips.

  14. Application of functional genomics to the chimeric mouse model of HCV infection: optimization of microarray protocols and genomics analysis

    Directory of Open Access Journals (Sweden)

    Smith Maria W

    2006-05-01

    Full Text Available Abstract Background Many model systems of human viral disease involve human-mouse chimeric tissue. One such system is the recently developed SCID-beige/Alb-uPA mouse model of hepatitis C virus (HCV infection which involves a human-mouse chimeric liver. The use of functional genomics to study HCV infection in these chimeric tissues is complicated by the potential cross-hybridization of mouse mRNA on human oligonucleotide microarrays. To identify genes affected by mouse liver mRNA hybridization, mRNA from identical human liver samples labeled with either Cy3 or Cy5 was compared in the presence and absence of known amounts of mouse liver mRNA labeled in only one dye. Results The results indicate that hybridization of mouse mRNA to the corresponding human gene probe on Agilent Human 22 K oligonucleotide microarray does occur. The number of genes affected by such cross-hybridization was subsequently reduced to approximately 300 genes both by increasing the hybridization temperature and using liver samples which contain at least 80% human tissue. In addition, Real Time quantitative RT-PCR using human specific probes was shown to be a valid method to verify the expression level in human cells of known cross-hybridizing genes. Conclusion The identification of genes affected by cross-hybridization of mouse liver RNA on human oligonucleotide microarrays makes it feasible to use functional genomics approaches to study the chimeric SCID-beige/Alb-uPA mouse model of HCV infection. This approach used to study cross-species hybridization on oligonucleotide microarrays can be adapted to other chimeric systems of viral disease to facilitate selective analysis of human gene expression.

  15. Carbohydrate microarrays

    DEFF Research Database (Denmark)

    Park, Sungjin; Gildersleeve, Jeffrey C; Blixt, Klas Ola

    2012-01-01

    -based technology has been widely employed for rapid analysis of the glycan binding properties of lectins and antibodies, the quantitative measurements of glycan-protein interactions, detection of cells and pathogens, identification of disease-related anti-glycan antibodies for diagnosis, and fast assessment...... of substrate specificities of glycosyltransferases. This review covers the construction of carbohydrate microarrays, detection methods of carbohydrate microarrays and their applications in biological and biomedical research.......In the last decade, carbohydrate microarrays have been core technologies for analyzing carbohydrate-mediated recognition events in a high-throughput fashion. A number of methods have been exploited for immobilizing glycans on the solid surface in a microarray format. This microarray...

  16. Guanine-tethered antisense oligonucleotides as synthetic riboregulators.

    Science.gov (United States)

    Hagihara, Masaki

    2014-01-01

    Regulation of gene expression by short oligonucleotides (antisense oligonucleotides), which can modulate RNA structures and inhibit subsequent associations with the translation machinery, is a potential approach for gene therapy. This chapter describes an alternative antisense strategy using guanine-tethered antisense oligonucleotides (G-ASs) to introduce a DNA-RNA heteroquadruplex structure at a designated sequence on RNA targets. The feasibility of using G-ASs to modulate RNA conformation may allow control of RNA function by inducing biologically important quadruplex structures. This approach to manipulate quadruplex structures using G-ASs may expand the strategies for regulating RNA structures and the functions of short oligonucleotide riboregulators.

  17. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    Science.gov (United States)

    Nolan, John P.; White, P. Scott

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  18. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    Directory of Open Access Journals (Sweden)

    Agbavwe Christy

    2011-12-01

    Full Text Available Abstract Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies.

  19. Effect of Thyrotropin Releasing Hormone (TRH on Gene Expressions in Rat Pancreas: Approach by Microarray Hybridization

    Directory of Open Access Journals (Sweden)

    Luo LG

    2004-07-01

    Full Text Available CONTEXT: Thyrotropin releasing hormone (TRH, originally identified as a hypothalamic hormone, expresses in the pancreas. The effects of TRH such as, inhibiting amylase secretion in rats through a direct effect on acinar cells, enhancing basal glucagon secretion from isolated perfused rat pancreas, and potentiating glucose-stimulated insulin secretion in perfused rat islets and insulin-secreting clonal beta-cell lines, suggest that TRH may play a role in pancreas. TRH also enlarged pancreas and increased pancreatic DNA content but deletion of TRH gene expression caused hyperglycemia in mice, suggesting that TRH may play a critical role in pancreatic development; however, the biological mechanisms of TRH in the adult pancreas remains unclear. OBJECTIVES: This study explored the effect of TRH on rat pancreas. SUBJECTS: Four male-Sprague-Dawley-rats (200-250 g were given 10 microg/kg BW of TRH intraperitoneally on 1st and 3rd day and sacrificed on 7th day. Four same-strain rats without TRH injection served as controls. MAIN OUTCOME MEASURES: Wet pancreatic weights were measured. Pancreatic tissues were homogenized and extracted. The insulin levels of the extracts were measured by ELISA. Total RNA from the pancreases were fluorescently labeled and hybridized to microarray with 1,081 spot genes. RESULTS: TRH increased pancreatic wet weight and insulin contents. About 75% of the 1,081 genes were detected in the pancreas. TRH regulated up 99 genes and down 76 genes. The administration of TRH induced various types of gene expressions, such as G-protein coupled receptors (GPCR and signal transduction related genes (GPCR kinase 4, transducin beta subunit 5, arrestin beta1MAPK3, MAPK5, c-Src kinase, PKCs, PI3 kinase, growth factors (PDGF-B, IGF-2, IL-18, IGF-1, IL-2, IL-6, endothelin-1 and apoptotic factors (Bcl2, BAD, Bax. CONCLUSION: Reprogramming of transcriptome may be a way for TRH-regulation of pancreatic cellular functions.

  20. Design, construction and validation of a Plasmodium vivax microarray for the transcriptome profiling of clinical isolates.

    Science.gov (United States)

    Boopathi, Pon Arunachalam; Subudhi, Amit Kumar; Middha, Sheetal; Acharya, Jyoti; Mugasimangalam, Raja Chinnadurai; Kochar, Sanjay Kumar; Kochar, Dhanpat Kumar; Das, Ashis

    2016-12-01

    High density oligonucleotide microarrays have been used on Plasmodium vivax field isolates to estimate whole genome expression. However, no microarray platform has been experimentally optimized for studying the transcriptome of field isolates. In the present study, we adopted both bioinformatics and experimental testing approaches to select best optimized probes suitable for detecting parasite transcripts from field samples and included them in designing a custom 15K P. vivax microarray. This microarray has long oligonucleotide probes (60mer) that were in-situ synthesized onto glass slides using Agilent SurePrint technology and has been developed into an 8X15K format (8 identical arrays on a single slide). Probes in this array were experimentally validated and represents 4180 P. vivax genes in sense orientation, of which 1219 genes have also probes in antisense orientation. Validation of the 15K array by using field samples (n=14) has shown 99% of parasite transcript detection from any of the samples. Correlation analysis between duplicate probes (n=85) present in the arrays showed perfect correlation (r(2)=0.98) indicating the reproducibility. Multiple probes representing the same gene exhibited similar kind of expression pattern across the samples (positive correlation, r≥0.6). Comparison of hybridization data with the previous studies and quantitative real-time PCR experiments were performed to highlight the microarray validation procedure. This array is unique in its design, and results indicate that the array is sensitive and reproducible. Hence, this microarray could be a valuable functional genomics tool to generate reliable expression data from P. vivax field isolates.

  1. Design, construction and validation of a Plasmodium vivax microarray for the transcriptome profiling of clinical isolates

    KAUST Repository

    Boopathi, Pon Arunachalam

    2016-10-09

    High density oligonucleotide microarrays have been used on Plasmodium vivax field isolates to estimate whole genome expression. However, no microarray platform has been experimentally optimized for studying the transcriptome of field isolates. In the present study, we adopted both bioinformatics and experimental testing approaches to select best optimized probes suitable for detecting parasite transcripts from field samples and included them in designing a custom 15K P. vivax microarray. This microarray has long oligonucleotide probes (60 mer) that were in-situ synthesized onto glass slides using Agilent SurePrint technology and has been developed into an 8X15K format (8 identical arrays on a single slide). Probes in this array were experimentally validated and represents 4180 P. vivax genes in sense orientation, of which 1219 genes have also probes in antisense orientation. Validation of the 15K array by using field samples (n =14) has shown 99% of parasite transcript detection from any of the samples. Correlation analysis between duplicate probes (n = 85) present in the arrays showed perfect correlation (r(2) = 0.98) indicating the reproducibility. Multiple probes representing the same gene exhibited similar kind of expression pattern across the samples (positive correlation, r >= 0.6). Comparison of hybridization data with the previous studies and quantitative real-time PCR experiments were performed to highlight the microarray validation procedure. This array is unique in its design, and results indicate that the array is sensitive and reproducible. Hence, this microarray could be a valuable functional genomics tool to generate reliable expression data from P. vivax field isolates. (C) 2016 Published by Elsevier B.V.

  2. Synthesis of high-quality libraries of long (150mer) oligonucleotides by a novel depurination controlled process

    National Research Council Canada - National Science Library

    LeProust, Emily M; Peck, Bill J; Spirin, Konstantin; McCuen, Heather Brummel; Moore, Bridget; Namsaraev, Eugeni; Caruthers, Marvin H

    2010-01-01

    ...) in fmol amounts using parallel synthesis of DNA on microarrays. The sequence accuracy of the oligonucleotides in such large-scale syntheses has been limited by the yields and side reactions of the DNA synthesis process used...

  3. Identification of seroreactive proteins of Leptospira interrogans serovar copenhageni using a high-density protein microarray approach.

    Science.gov (United States)

    Lessa-Aquino, Carolina; Borges Rodrigues, Camila; Pablo, Jozelyn; Sasaki, Rie; Jasinskas, Algis; Liang, Li; Wunder, Elsio A; Ribeiro, Guilherme S; Vigil, Adam; Galler, Ricardo; Molina, Douglas; Liang, Xiaowu; Reis, Mitermayer G; Ko, Albert I; Medeiros, Marco Alberto; Felgner, Philip L

    2013-01-01

    Leptospirosis is a widespread zoonotic disease worldwide. The lack of an adequate laboratory test is a major barrier for diagnosis, especially during the early stages of illness, when antibiotic therapy is most effective. Therefore, there is a critical need for an efficient diagnostic test for this life threatening disease. In order to identify new targets that could be used as diagnostic makers for leptopirosis, we constructed a protein microarray chip comprising 61% of Leptospira interrogans proteome and investigated the IgG response from 274 individuals, including 80 acute-phase, 80 convalescent-phase patients and 114 healthy control subjects from regions with endemic, high endemic, and no endemic transmission of leptospirosis. A nitrocellulose line blot assay was performed to validate the accuracy of the protein microarray results. We found 16 antigens that can discriminate between acute cases and healthy individuals from a region with high endemic transmission of leptospirosis, and 18 antigens that distinguish convalescent cases. Some of the antigens identified in this study, such as LipL32, the non-identical domains of the Lig proteins, GroEL, and Loa22 are already known to be recognized by sera from human patients, thus serving as proof-of-concept for the serodiagnostic antigen discovery approach. Several novel antigens were identified, including the hypothetical protein LIC10215 which showed good sensitivity and specificity rates for both acute- and convalescent-phase patients. Our study is the first large-scale evaluation of immunodominant antigens associated with naturally acquired leptospiral infection, and novel as well as known serodiagnostic leptospiral antigens that are recognized by antibodies in the sera of leptospirosis cases were identified. The novel antigens identified here may have potential use in both the development of new tests and the improvement of currently available assays for diagnosing this neglected tropical disease. Further

  4. Identification of seroreactive proteins of Leptospira interrogans serovar copenhageni using a high-density protein microarray approach.

    Directory of Open Access Journals (Sweden)

    Carolina Lessa-Aquino

    Full Text Available Leptospirosis is a widespread zoonotic disease worldwide. The lack of an adequate laboratory test is a major barrier for diagnosis, especially during the early stages of illness, when antibiotic therapy is most effective. Therefore, there is a critical need for an efficient diagnostic test for this life threatening disease.In order to identify new targets that could be used as diagnostic makers for leptopirosis, we constructed a protein microarray chip comprising 61% of Leptospira interrogans proteome and investigated the IgG response from 274 individuals, including 80 acute-phase, 80 convalescent-phase patients and 114 healthy control subjects from regions with endemic, high endemic, and no endemic transmission of leptospirosis. A nitrocellulose line blot assay was performed to validate the accuracy of the protein microarray results.We found 16 antigens that can discriminate between acute cases and healthy individuals from a region with high endemic transmission of leptospirosis, and 18 antigens that distinguish convalescent cases. Some of the antigens identified in this study, such as LipL32, the non-identical domains of the Lig proteins, GroEL, and Loa22 are already known to be recognized by sera from human patients, thus serving as proof-of-concept for the serodiagnostic antigen discovery approach. Several novel antigens were identified, including the hypothetical protein LIC10215 which showed good sensitivity and specificity rates for both acute- and convalescent-phase patients.Our study is the first large-scale evaluation of immunodominant antigens associated with naturally acquired leptospiral infection, and novel as well as known serodiagnostic leptospiral antigens that are recognized by antibodies in the sera of leptospirosis cases were identified. The novel antigens identified here may have potential use in both the development of new tests and the improvement of currently available assays for diagnosing this neglected tropical disease

  5. Microarray-based Functional Nanoproteomics for an Industrial Approach to Cancer. II Mass Spectrometry and Nanoconductimetry

    Directory of Open Access Journals (Sweden)

    Claudio Nicolini

    2016-01-01

    Full Text Available Using the New England BioLabs (NEBL SNAP-based Genes Expression in conjunction with our “sub-micron arrays” (Anodic Porous Allumina and/ or Kapton based Nanopores, we exploit our proprietary microarrays scanner (DNASER, DNA analyzer and Label Free Nanotechnologies to carry out the following tasks: 1 Construction of SNAP-based Genes Nanoarrays, using gold surface coated for 10 minutes with 2% solution of 3-Aminopropyltriethoxysilane (APTES in acetone, rinsed in acetone and dried with filtered air. Full length complementary DNAs (cDNAs for onco-suppressor 53 (p53, Cyclin-dependent kinase 2 (CDK2, SH2 (Src Homology 2 domain of the proto-oncogene tyrosine-protein kinase (Src and tyrosine-protein phosphatase non-receptor type 11 (PTPN11 were amplified and cloned. Printing mix was prepared with 0.66 μg/μl DNA capture reagent BG-PEG-NH2 for the one-step synthesis of SNAP-tag substrates from esters on labels or surfaces; 2 Determination of Protein-Protein Interaction for the chosen cancer following the identification of leader genes (or hub genes, investigated with theoretical ab initio bioinformatics analysis using in-house software and algorithms, and then experimentally confirmed via DNASER. These genes are expressed by PURE (Protein synthesis Using Recombinant Elements Express in spots less than 1 micron size piezo-microdispensed and then characterized via Label Free proprietary Autoflex Mass Spectrometry (MS integrated with ad hoc software, namely the Spectrum Analyzer and Data Set manager (SpADS and a proprietary Quartz Crystal Micro-balance with Dissipation factor monitoring (QCM_D Nanoconductimetry, enabling to describe properties such as changes in frequency and conductance, viscoelasticity and dissipation factor. Solutions without DNA were prepared (called Master Mix, MM, as negative controls, in printing mix. Negative controls were prepared with a varying concentration range of SNAP capture reagent. As a positive control (for

  6. In silico and microarray-based genomic approaches to identifying potential vaccine candidates against Leptospira interrogans

    Directory of Open Access Journals (Sweden)

    Jiang Xu-Cheng

    2006-11-01

    Full Text Available Abstract Background Currently available vaccines against leptospirosis are of low efficacy, have an unacceptable side-effect profile, do not induce long-term protection, and provide no cross-protection against the different serovars of pathogenic leptospira. The current major focus in leptospirosis research is to discover conserved protective antigens that may elicit longer-term protection against a broad range of Leptospira. There is a need to screen vaccine candidate genes in the genome of Leptospira interrogans. Results Bioinformatics, comparative genomic hybridization (CGH analysis and transcriptional analysis were used to identify vaccine candidates in the genome of L. interrogans serovar Lai strain #56601. Of a total of 4727 open reading frames (ORFs, 616 genes were predicted to encode surface-exposed proteins by P-CLASSIFIER combined with signal peptide prediction, α-helix transmembrane topology prediction, integral β-barrel outer membrane protein and lipoprotein prediction, as well as by retaining the genes shared by the two sequenced L. interrogans genomes and by subtracting genes with human homologues. A DNA microarray of L. interrogans strain #56601 was constructed for CGH analysis and transcriptome analysis in vitro. Three hundred and seven differential genes were identified in ten pathogenic serovars by CGH; 1427 genes had high transcriptional levels (Cy3 signal ≥ 342 and Cy5 signal ≥ 363.5, respectively. There were 565 genes in the intersection between the set encoding surface-exposed proteins and the set of 307 differential genes. The number of genes in the intersection between this set of 565 and the set of 1427 highly transcriptionally active genes was 226. These 226 genes were thus identified as putative vaccine candidates. The proteins encoded by these genes are not only potentially surface-exposed in the bacterium, but also conserved in two sequenced L. interrogans. Moreover, these genes are conserved among ten epidemic

  7. In Situ-Synthesized Novel Microarray Optimized for Mouse Stem Cell and Early Developmental Expression Profiling

    OpenAIRE

    Carter, Mark G.; Hamatani, Toshio; Sharov, Alexei A; Carmack, Condie E; Qian, Yong; Aiba, Kazuhiro; Ko, Naomi T.; Dudekula, Dawood B.; Brzoska, Pius M.; Hwang, S. Stuart; Minoru S.H. Ko

    2003-01-01

    Applications of microarray technologies to mouse embryology/genetics have been limited, due to the nonavailability of microarrays containing large numbers of embryonic genes and the gap between microgram quantities of RNA required by typical microarray methods and the miniscule amounts of tissue available to researchers. To overcome these problems, we have developed a microarray platform containing in situ-synthesized 60-mer oligonucleotide probes representing approximately 22,000 unique mous...

  8. DNA nanostructure-based universal microarray platform for high-efficiency multiplex bioanalysis in biofluids.

    Science.gov (United States)

    Li, Zhenhua; Zhao, Bin; Wang, Dongfang; Wen, Yanli; Liu, Gang; Dong, Haoqing; Song, Shiping; Fan, Chunhai

    2014-10-22

    Microarrays of biomolecules have greatly promoted the development of the fields of genomics, proteomics, and clinical assays because of their remarkably parallel and high-throughput assay capability. Immobilization strategies for biomolecules on a solid support surface play a crucial role in the fabrication of high-performance biological microarrays. In this study, rationally designed DNA tetrahedra carrying three amino groups and one single-stranded DNA extension were synthesized by the self-assembly of four oligonucleotides, followed by high-performance liquid chromatography purification. We fabricated DNA tetrahedron-based microarrays by covalently coupling the DNA tetrahedron onto glass substrates. After their biorecognition capability was evaluated, DNA tetrahedron microarrays were utilized for the analysis of different types of bioactive molecules. The gap hybridization strategy, the sandwich configuration, and the engineering aptamer strategy were employed for the assay of miRNA biomarkers, protein cancer biomarkers, and small molecules, respectively. The arrays showed good capability to anchor capture biomolecules for improving biorecognition. Addressable and high-throughput analysis with improved sensitivity and specificity had been achieved. The limit of detection for let-7a miRNA, prostate specific antigen, and cocaine were 10 fM, 40 pg/mL, and 100 nM, respectively. More importantly, we demonstrated that the microarray platform worked well with clinical serum samples and showed good relativity with conventional chemical luminescent immunoassay. We have developed a novel approach for the fabrication of DNA tetrahedron-based microarrays and a universal DNA tetrahedron-based microarray platform for the detection of different types of bioactive molecules. The microarray platform shows great potential for clinical diagnosis.

  9. Antisense oligonucleotides in cancer.

    Science.gov (United States)

    Castanotto, Daniela; Stein, Cy A

    2014-11-01

    Over the past several dozen years, regardless of the substantial effort directed toward developing rational oligonucleotide strategies to silence gene expression, antisense oligonucleotide-based cancer therapy has not been successful. This review focuses on the most likely reasons for this lack of success, and on the barriers that still need to be overcome to make a clinical cancer treatment reality out of the promise of antisense therapy. Considerable progress has been made in the design and delivery of nucleic acid fragments. Chemical modifications have considerably improved oligonucleotide absorption, distribution and metabolism while at the same time reducing toxicity. Nevertheless, the delivery and the cellular uptake of these molecules are still not adequate to provide the desired therapeutic outcome. Recent therapeutic interventional phase III trials of antisense oligodeoxyribonucleotides for a cancer indication will be discussed, in addition to those studies that markedly improve the scientific understanding of the properties of these molecules. We still do not have a marketed antisense oligonucleotide for a cancer indication. This is because critical aspects of the cellular, tumor pharmacology and delivery properties of these agents are still not well understood.

  10. Combination of DNA ligase reaction and gold nanoparticle-quenched fluorescent oligonucleotides: a simple and efficient approach for fluorescent assaying of single-nucleotide polymorphisms.

    Science.gov (United States)

    Wang, Hao; Li, Jishan; Wang, Yongxiang; Jin, Jiangyu; Yang, Ronghua; Wang, Kemin; Tan, Weihong

    2010-09-15

    A new fluorescent sensing approach for detection of single-nucleotide polymorphisms (SNPs) is proposed based on the ligase reaction and gold nanoparticle (AuNPs)-quenched fluorescent oligonucleotides. The design exploits the strong fluorescence quenching of AuNPs for organic dyes and the difference in noncovalent interactions of the nanoparticles with single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), where ssDNA can be adsorbed onto the surface of AuNPs while dsDNA cannot be. In the assay, two half primer DNA probes, one being labeled with a dye and the other being phosphorylated, were first incubated with a target DNA template. In the presence of DNA ligase, the two captured ssDNAs are linked for the perfectly matched DNA target to form a stable duplex, but the duplex could not be formed by the single-base mismatched DNA template. After addition of AuNPs, the fluorescence of dye-tagged DNA probe will be efficiently quenched unless the perfectly matched DNA target is present. To demonstrate the feasibility of this design, the performance of SNP detection using two different DNA ligases, T4 DNA ligase and Escherichia coli DNA ligase, were investigated. In the case of T4 DNA ligase, the signal enhancement of the dye-tagged DNA for perfectly matched DNA target is 4.6-fold higher than that for the single-base mismatched DNA. While in the presence of E. coli DNA ligase, the value raises to be 30.2, suggesting excellent capability for SNP discrimination.

  11. A texture based pattern recognition approach to distinguish melanoma from non-melanoma cells in histopathological tissue microarray sections.

    Directory of Open Access Journals (Sweden)

    Elton Rexhepaj

    Full Text Available AIMS: Immunohistochemistry is a routine practice in clinical cancer diagnostics and also an established technology for tissue-based research regarding biomarker discovery efforts. Tedious manual assessment of immunohistochemically stained tissue needs to be fully automated to take full advantage of the potential for high throughput analyses enabled by tissue microarrays and digital pathology. Such automated tools also need to be reproducible for different experimental conditions and biomarker targets. In this study we present a novel supervised melanoma specific pattern recognition approach that is fully automated and quantitative. METHODS AND RESULTS: Melanoma samples were immunostained for the melanocyte specific target, Melan-A. Images representing immunostained melanoma tissue were then digitally processed to segment regions of interest, highlighting Melan-A positive and negative areas. Color deconvolution was applied to each region of interest to separate the channel containing the immunohistochemistry signal from the hematoxylin counterstaining channel. A support vector machine melanoma classification model was learned from a discovery melanoma patient cohort (n = 264 and subsequently validated on an independent cohort of melanoma patient tissue sample images (n = 157. CONCLUSION: Here we propose a novel method that takes advantage of utilizing an immuhistochemical marker highlighting melanocytes to fully automate the learning of a general melanoma cell classification model. The presented method can be applied on any protein of interest and thus provides a tool for quantification of immunohistochemistry-based protein expression in melanoma.

  12. Fecal source tracking in water using a mitochondrial DNA microarray.

    Science.gov (United States)

    Vuong, Nguyet-Minh; Villemur, Richard; Payment, Pierre; Brousseau, Roland; Topp, Edward; Masson, Luke

    2013-01-01

    A mitochondrial-based microarray (mitoArray) was developed for rapid identification of the presence of 28 animals and one family (cervidae) potentially implicated in fecal pollution in mixed activity watersheds. Oligonucleotide probes for genus or subfamily-level identification were targeted within the 12S rRNA - Val tRNA - 16S rRNA region in the mitochondrial genome. This region, called MI-50, was selected based on three criteria: 1) the ability to be amplified by universal primers 2) these universal primer sequences are present in most commercial and domestic animals of interest in source tracking, and 3) that sufficient sequence variation exists within this region to meet the minimal requirements for microarray probe discrimination. To quantify the overall level of mitochondrial DNA (mtDNA) in samples, a quantitative-PCR (Q-PCR) universal primer pair was also developed. Probe validation was performed using DNA extracted from animal tissues and, for many cases, animal-specific fecal samples. To reduce the amplification of potentially interfering fish mtDNA sequences during the MI-50 enrichment step, a clamping PCR method was designed using a fish-specific peptide nucleic acid. DNA extracted from 19 water samples were subjected to both array and independent PCR analyses. Our results confirm that the mitochondrial microarray approach method could accurately detect the dominant animals present in water samples emphasizing the potential for this methodology in the parallel scanning of a large variety of animals normally monitored in fecal source tracking.

  13. An efficient algorithm for the stochastic simulation of the hybridization of DNA to microarrays

    Directory of Open Access Journals (Sweden)

    Laurenzi Ian J

    2009-12-01

    Full Text Available Abstract Background Although oligonucleotide microarray technology is ubiquitous in genomic research, reproducibility and standardization of expression measurements still concern many researchers. Cross-hybridization between microarray probes and non-target ssDNA has been implicated as a primary factor in sensitivity and selectivity loss. Since hybridization is a chemical process, it may be modeled at a population-level using a combination of material balance equations and thermodynamics. However, the hybridization reaction network may be exceptionally large for commercial arrays, which often possess at least one reporter per transcript. Quantification of the kinetics and equilibrium of exceptionally large chemical systems of this type is numerically infeasible with customary approaches. Results In this paper, we present a robust and computationally efficient algorithm for the simulation of hybridization processes underlying microarray assays. Our method may be utilized to identify the extent to which nucleic acid targets (e.g. cDNA will cross-hybridize with probes, and by extension, characterize probe robustnessusing the information specified by MAGE-TAB. Using this algorithm, we characterize cross-hybridization in a modified commercial microarray assay. Conclusions By integrating stochastic simulation with thermodynamic prediction tools for DNA hybridization, one may robustly and rapidly characterize of the selectivity of a proposed microarray design at the probe and "system" levels. Our code is available at http://www.laurenzi.net.

  14. Fabrication of Unimolecular Double-stranded DNA Microarrays on Solid Surfaces for Probing DNA-Protein/Drug Interactions

    Directory of Open Access Journals (Sweden)

    Zuhong Lu

    2003-01-01

    Full Text Available We present a novel method for fabricating unimole cular double-stranded DNA microarrays on solid surfaces, which were used to probe sequence-specific DNA/protein interactions. For manufacturing the unimolecular double-stranded DNA microarrays, two kinds of special single-stranded oligonucleotides, constant oligonucleotide and target oligonucleotide, were chemically synthesized. The constant oligonucleotides with internal aminated dT were used to capture and immobilize the target oligonucleotides onto the solid surface, and also to provide a primer for later enzymatic extension reactions, while target oligonucleotides took the role of harbouring DNA-binding sites of DNA-binding proteins. The variant target oligonucleotides were annealed and ligated with the constant oligonucleotides to form the new unimolecular oligonucleotides for microspotting. The prepared unimolecular oligonucleotides were microspotted on aldehyde-derivatized glass slides to make partial-dsDNA microarrays. Finally, the partial-dsDNA microarrays were converted into a unimolecular complete-dsDNA microarray by a DNA polymerase extension reaction. The efficiency and accuracy of the polymerase synthesis were demonstrated by the fluorescent-labeled dUTP incorporation in the enzymatic extension reaction and the restriction endonuclease digestion of the fabricated unimolecular complete-dsDNA microarray. The accessibility and specificity of the sequence-specific DNA-binding proteins binding to the immobilized unimolecular dsDNA probes were demonstrated by the binding of Cy3 labeled NF-?B (p50·p50 to the unimolecular dsDNA microarray. This unimolecular dsDNA microarray provides a general technique for high-throughput DNA-protein or DNA-drugs interactions.

  15. Establishment of oligonucleotide microarray for detection of influenza virus subtypes H1N1 and H3N2%H1N1和H3N2亚型流感病毒基因芯片检测方法的建立

    Institute of Scientific and Technical Information of China (English)

    王慧煜; 梅琳; 侯义宏; 李全芬; 林祥梅; 韩雪清

    2011-01-01

    为建立同时能鉴别甲型H1N1和猪流感病毒常见亚型的新型基因芯片检测方法,根据GenBank中已发表的甲型流感病毒MP的基因序列和甲型H1N1(2009)和猪流感病毒H1N1、H3N2亚型的基因序列,设计、筛选并合成7对特异性引物和1对通用引物;根据扩增的靶序列,设计并合成14条特异性探针和3条质控探针,制备了甲型H1N1(2009)流感病毒和猪流感病毒H1N1、H3N2亚型基因芯片;并进行了特异性试验、敏感性试验和田间样品的检测。结果显示,该芯片检测方法与猪细小病毒(PPV)、猪瘟病毒(CSFV)、猪繁殖与呼吸综合征病毒(PRRSV)等猪常见病毒无交叉反应;对猪H1N1、猪H3N2和甲型H1N1(2009)流感病毒而言,最低可检测到105、104和105稀释的病毒株。结果证实,该方法特异性强、敏感性高,是一种高通量的甲型H1N1和猪流感常见亚型筛查方法。%Seven pairs of primers specific for different subtypes and a pair of universal primers were carefully designed based on the genomic sequences of A/H1N1 and swine influenza virus retrieved from GenBank database.Several multiplex RT-PCR methods were then developed.Further 14 oligonucleotide probes specific for A/H1N1 and swine influenza virus were designed according to the published gene in target cDNA domains.Then a microarray for A/H1N1 and swine influenza virus was developed with its specificity and sensitivity validated by using swine influenza virus strains and samples from different areas.The results showed that all the subtypes of swine influenza virus and A/H1N1 virus could be identified simultaneously on this microarray with high sensitivity,which could reach to 105 dilute viruses.Furthermore,there was no cross reactions with PPV,CSFV and PRRSV.Therefore the microarray is a useful diagnostic method with high specificity and sensitivity,and could be used for A/H1N1 and swine influenza surveillance.

  16. Easy and fast detection and genotyping of high-risk human papillomavirus by dedicated DNA microarrays.

    Science.gov (United States)

    Albrecht, Valérie; Chevallier, Anne; Magnone, Virginie; Barbry, Pascal; Vandenbos, Fanny; Bongain, André; Lefebvre, Jean-Claude; Giordanengo, Valérie

    2006-11-01

    Persistent cervical high-risk human papillomavirus (HPV) infection is correlated with an increased risk of developing a high-grade cervical intraepithelial lesion. A two-step method was developed for detection and genotyping of high-risk HPV. DNA was firstly amplified by asymmetrical PCR in the presence of Cy3-labelled primers and dUTP. Labelled DNA was then genotyped using DNA microarray hybridization. The current study evaluated the technical efficacy of laboratory-designed HPV DNA microarrays for high-risk HPV genotyping on 57 malignant and non-malignant cervical smears. The approach was evaluated for a broad range of cytological samples: high-grade squamous intraepithelial lesions (HSIL), low-grade squamous intraepithelial lesions (LSIL) and atypical squamous cells of high-grade (ASC-H). High-risk HPV was also detected in six atypical squamous cells of undetermined significance (ASC-US) samples; among them only one cervical specimen was found uninfected, associated with no histological lesion. The HPV oligonucleotide DNA microarray genotyping detected 36 infections with a single high-risk HPV type and 5 multiple infections with several high-risk types. Taken together, these results demonstrate the sensitivity and specificity of the HPV DNA microarray approach. This approach could improve clinical management of patients with cervical cytological abnormalities.

  17. The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism

    Directory of Open Access Journals (Sweden)

    Aggerbeck Lawrence P

    2008-02-01

    Full Text Available Abstract Background Cholesterol homeostasis and xenobiotic metabolism are complex biological processes, which are difficult to study with traditional methods. Deciphering complex regulation and response of these two processes to different factors is crucial also for understanding of disease development. Systems biology tools as are microarrays can importantly contribute to this knowledge and can also discover novel interactions between the two processes. Results We have developed a low density Sterolgene v0 cDNA microarray dedicated to studies of cholesterol homeostasis and drug metabolism in the mouse. To illustrate its performance, we have analyzed mouse liver samples from studies focused on regulation of cholesterol homeostasis and drug metabolism by diet, drugs and inflammation. We observed down-regulation of cholesterol biosynthesis during fasting and high-cholesterol diet and subsequent up-regulation by inflammation. Drug metabolism was down-regulated by fasting and inflammation, but up-regulated by phenobarbital treatment and high-cholesterol diet. Additionally, the performance of the Sterolgene v0 was compared to the two commercial high density microarray platforms: the Agilent cDNA (G4104A and the Affymetrix MOE430A GeneChip. We hybridized identical RNA samples to the commercial microarrays and showed that the performance of Sterolgene is comparable to commercial arrays in terms of detection of changes in cholesterol homeostasis and drug metabolism. Conclusion Using the Sterolgene v0 microarray we were able to detect important changes in cholesterol homeostasis and drug metabolism caused by diet, drugs and inflammation. Together with its next generations the Sterolgene microarrays represent original and dedicated tools enabling focused and cost effective studies of cholesterol homeostasis and drug metabolism. These microarrays have the potential of being further developed into screening or diagnostic tools.

  18. Uses of Dendrimers for DNA Microarrays

    Science.gov (United States)

    Caminade, Anne-Marie; Padié, Clément; Laurent, Régis; Maraval, Alexandrine; Majoral, Jean-Pierre

    2006-01-01

    Biosensors such as DNA microarrays and microchips are gaining an increasing importance in medicinal, forensic, and environmental analyses. Such devices are based on the detection of supramolecular interactions called hybridizations that occur between complementary oligonucleotides, one linked to a solid surface (the probe), and the other one to be analyzed (the target). This paper focuses on the improvements that hyperbranched and perfectly defined nanomolecules called dendrimers can provide to this methodology. Two main uses of dendrimers for such purpose have been described up to now; either the dendrimer is used as linker between the solid surface and the probe oligonucleotide, or the dendrimer is used as a multilabeled entity linked to the target oligonucleotide. In the first case the dendrimer generally induces a higher loading of probes and an easier hybridization, due to moving away the solid phase. In the second case the high number of localized labels (generally fluorescent) induces an increased sensitivity, allowing the detection of small quantities of biological entities.

  19. Uses of Dendrimers for DNA Microarrays

    Directory of Open Access Journals (Sweden)

    Jean-Pierre Majoral

    2006-08-01

    Full Text Available Biosensors such as DNA microarrays and microchips are gaining an increasingimportance in medicinal, forensic, and environmental analyses. Such devices are based onthe detection of supramolecular interactions called hybridizations that occur betweencomplementary oligonucleotides, one linked to a solid surface (the probe, and the other oneto be analyzed (the target. This paper focuses on the improvements that hyperbranched andperfectly defined nanomolecules called dendrimers can provide to this methodology. Twomain uses of dendrimers for such purpose have been described up to now; either thedendrimer is used as linker between the solid surface and the probe oligonucleotide, or thedendrimer is used as a multilabeled entity linked to the target oligonucleotide. In the firstcase the dendrimer generally induces a higher loading of probes and an easier hybridization,due to moving away the solid phase. In the second case the high number of localized labels(generally fluorescent induces an increased sensitivity, allowing the detection of smallquantities of biological entities.

  20. Microarray-based identification of antigenic variants of foot-and-mouth disease virus: a bioinformatics quality assessment

    Directory of Open Access Journals (Sweden)

    Domingo Esteban

    2006-05-01

    Full Text Available Abstract Background The evolution of viral quasispecies can influence viral pathogenesis and the response to antiviral treatments. Mutant clouds in infected organisms represent the first stage in the genetic and antigenic diversification of RNA viruses, such as foot and mouth disease virus (FMDV, an important animal pathogen. Antigenic variants of FMDV have been classically diagnosed by immunological or RT-PCR-based methods. DNA microarrays are becoming increasingly useful for the analysis of gene expression and single nucleotide polymorphisms (SNPs. Recently, a FMDV microarray was described to detect simultaneously the seven FMDV serotypes. These results encourage the development of new oligonucleotide microarrays to probe the fine genetic and antigenic composition of FMDV for diagnosis, vaccine design, and to gain insight into the molecular epidemiology of this pathogen. Results A FMDV microarray was designed and optimized to detect SNPs at a major antigenic site of the virus. A screening of point mutants of the genomic region encoding antigenic site A of FMDV C-S8c1 was achieved. The hybridization pattern of a mutant includes specific positive and negative signals as well as crosshybridization signals, which are of different intensity depending on the thermodynamic stability of each probe-target pair. Moreover, an array bioinformatic classification method was developed to evaluate the hybridization signals. This statistical analysis shows that the procedure allows a very accurate classification per variant genome. Conclusion A specific approach based on a microarray platform aimed at distinguishing point mutants within an important determinant of antigenicity and host cell tropism, namely the G-H loop of capsid protein VP1, was developed. The procedure is of general applicability as a test for specificity and discriminatory power of microarray-based diagnostic procedures using multiple oligonucleotide probes.

  1. A Strategy to Optimize the Oligo-Probes for Microarray-based Detection of Viruses

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    DNA microarrays have been acknowledged to represent a promising approach for the detection of viral pathogens. However, the probes designed for current arrays could cover only part of the given viral variants, that could result in false-negative or ambiguous data. If all the variants are to be covered, the requirement for more probes would render much higher spot density and thus higher cost of the arrays. Here we have developed a new strategy for oligonucleotide probe design. Using type I human immunodeficiency virus (HIV-1) tat gene as an example, we designed the array probes and validated the optimized parameters in silico. Results show that the oligo number is significantly reduced comparing with the existing methods, while specificity and hybridization efficiency remain intact. The adoption of this method in reducing the oligo numbers could increase the detection capacity for DNA microarrays, and would significantly lower the manufacturing cost for making array chips.

  2. Predicting oligonucleotide-directed mutagenesis failures in protein engineering.

    Science.gov (United States)

    Wassman, Christopher D; Tam, Phillip Y; Lathrop, Richard H; Weiss, Gregory A

    2004-01-01

    Protein engineering uses oligonucleotide-directed mutagenesis to modify DNA sequences through a two-step process of hybridization and enzymatic synthesis. Inefficient reactions confound attempts to introduce mutations, especially for the construction of vast combinatorial protein libraries. This paper applied computational approaches to the problem of inefficient mutagenesis. Several results implicated oligonucleotide annealing to non-target sites, termed 'cross-hybridization', as a significant contributor to mutagenesis reaction failures. Test oligonucleotides demonstrated control over reaction outcomes. A novel cross-hybridization score, quickly computable for any plasmid and oligonucleotide mixture, directly correlated with yields of deleterious mutagenesis side products. Cross-hybridization was confirmed conclusively by partial incorporation of an oligonucleotide at a predicted cross-hybridization site, and by modification of putative template secondary structure to control cross-hybridization. Even in low concentrations, cross-hybridizing species in mixtures poisoned reactions. These results provide a basis for improved mutagenesis efficiencies and increased diversities of cognate protein libraries.

  3. High resolution microarray comparative genomic hybridisation analysis using spotted oligonucleotides.

    NARCIS (Netherlands)

    Carvalho, B; Ouwerkerk, E; Meijer, G.A.; Ylstra, B.

    2004-01-01

    BACKGROUND: Currently, comparative genomic hybridisation array (array CGH) is the method of choice for studying genome wide DNA copy number changes. To date, either amplified representations of bacterial artificial chromosomes (BACs)/phage artificial chromosomes (PACs) or cDNAs have been spotted as

  4. A new tool for the molecular identification of Culicoides species of the Obsoletus group: the glass slide microarray approach.

    Science.gov (United States)

    Deblauwe, I; de Witte, J C; de Deken, G; de Deken, R; Madder, M; van Erk, S; Hoza, F A; Lathouwers, D; Geysen, D

    2012-03-01

    Culicoides species of the Obsoletus group (Diptera: Ceratopogonidae) are potential vectors of bluetongue virus serotype 8 (BTV 8), which was introduced into central Western Europe in 2006. Correct morphological species identification of Obsoletus group females is especially difficult and molecular identification is the method of choice. In this study we present a new molecular tool based on probe hybridization using a DNA microarray format to identify Culicoides species of the Obsoletus group. The internal transcribed spacer 1 (ITS1) gene sequences of 55 Culicoides belonging to 13 different species were determined and used, together with 19 Culicoides ITS1 sequences sourced from GenBank, to design species-specific probes for the microarray test. This test was evaluated using the amplified ITS1 sequences of another 85 Culicoides specimens, belonging to 11 species. The microarray test successfully identified all samples (100%) of the Obsoletus group, identifying each specimen to species level within the group. This test has several advantages over existing polymerase chain reaction (PCR)-based molecular tools, including possible capability for parallel analysis of many species, high sensitivity and specificity, and low background signal noise. Hand-spotting of the microarray slide and the use of detection chemistry make this alternative technique affordable and feasible for any diagnostic laboratory with PCR facilities.

  5. DNA microarray technique for detecting food-borne pathogens

    Directory of Open Access Journals (Sweden)

    Xing GAO

    2012-08-01

    Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.

  6. Efficient oligonucleotide probe selection for pan-genomic tiling arrays

    Directory of Open Access Journals (Sweden)

    Zhang Wei

    2009-09-01

    Full Text Available Abstract Background Array comparative genomic hybridization is a fast and cost-effective method for detecting, genotyping, and comparing the genomic sequence of unknown bacterial isolates. This method, as with all microarray applications, requires adequate coverage of probes targeting the regions of interest. An unbiased tiling of probes across the entire length of the genome is the most flexible design approach. However, such a whole-genome tiling requires that the genome sequence is known in advance. For the accurate analysis of uncharacterized bacteria, an array must query a fully representative set of sequences from the species' pan-genome. Prior microarrays have included only a single strain per array or the conserved sequences of gene families. These arrays omit potentially important genes and sequence variants from the pan-genome. Results This paper presents a new probe selection algorithm (PanArray that can tile multiple whole genomes using a minimal number of probes. Unlike arrays built on clustered gene families, PanArray uses an unbiased, probe-centric approach that does not rely on annotations, gene clustering, or multi-alignments. Instead, probes are evenly tiled across all sequences of the pan-genome at a consistent level of coverage. To minimize the required number of probes, probes conserved across multiple strains in the pan-genome are selected first, and additional probes are used only where necessary to span polymorphic regions of the genome. The viability of the algorithm is demonstrated by array designs for seven different bacterial pan-genomes and, in particular, the design of a 385,000 probe array that fully tiles the genomes of 20 different Listeria monocytogenes strains with overlapping probes at greater than twofold coverage. Conclusion PanArray is an oligonucleotide probe selection algorithm for tiling multiple genome sequences using a minimal number of probes. It is capable of fully tiling all genomes of a species on

  7. A microarray approach to identify genes involved in seed-pericarp cross-talk and development in peach

    Directory of Open Access Journals (Sweden)

    Zaffalon Valerio

    2011-06-01

    Full Text Available Abstract Background Field observations and a few physiological studies have demonstrated that peach embryogenesis and fruit development are tightly coupled. In fact, attempts to stimulate parthenocarpic fruit development by means of external tools have failed. Moreover, physiological disturbances during early embryo development lead to seed abortion and fruitlet abscission. Later in embryo development, the interactions between seed and fruit development become less strict. As there is limited genetic and molecular information about seed-pericarp cross-talk and development in peach, a massive gene approach based on the use of the μPEACH 1.0 array platform and quantitative real time RT-PCR (qRT-PCR was used to study this process. Results A comparative analysis of the transcription profiles conducted in seed and mesocarp (cv Fantasia throughout different developmental stages (S1, S2, S3 and S4 evidenced that 455 genes are differentially expressed in seed and fruit. Among differentially expressed genes some were validated as markers in two subsequent years and in three different genotypes. Seed markers were a LTP1 (lipid transfer protein, a PR (pathogenesis-related protein, a prunin and LEA (Late Embryogenesis Abundant protein, for S1, S2, S3 and S4, respectively. Mesocarp markers were a RD22-like protein, a serin-carboxypeptidase, a senescence related protein and an Aux/IAA, for S1, S2, S3 and S4, respectively. The microarray data, analyzed by using the HORMONOMETER platform, allowed the identification of hormone-responsive genes, some of them putatively involved in seed-pericarp crosstalk. Results indicated that auxin, cytokinins, and gibberellins are good candidates, acting either directly (auxin or indirectly as signals during early development, when the cross-talk is more active and vital for fruit set, whereas abscisic acid and ethylene may be involved later on. Conclusions In this research, genes were identified marking different phases of

  8. A systems biology approach to construct the gene regulatory network of systemic inflammation via microarray and databases mining

    Directory of Open Access Journals (Sweden)

    Lan Chung-Yu

    2008-09-01

    Full Text Available Abstract Background Inflammation is a hallmark of many human diseases. Elucidating the mechanisms underlying systemic inflammation has long been an important topic in basic and clinical research. When primary pathogenetic events remains unclear due to its immense complexity, construction and analysis of the gene regulatory network of inflammation at times becomes the best way to understand the detrimental effects of disease. However, it is difficult to recognize and evaluate relevant biological processes from the huge quantities of experimental data. It is hence appealing to find an algorithm which can generate a gene regulatory network of systemic inflammation from high-throughput genomic studies of human diseases. Such network will be essential for us to extract valuable information from the complex and chaotic network under diseased conditions. Results In this study, we construct a gene regulatory network of inflammation using data extracted from the Ensembl and JASPAR databases. We also integrate and apply a number of systematic algorithms like cross correlation threshold, maximum likelihood estimation method and Akaike Information Criterion (AIC on time-lapsed microarray data to refine the genome-wide transcriptional regulatory network in response to bacterial endotoxins in the context of dynamic activated genes, which are regulated by transcription factors (TFs such as NF-κB. This systematic approach is used to investigate the stochastic interaction represented by the dynamic leukocyte gene expression profiles of human subject exposed to an inflammatory stimulus (bacterial endotoxin. Based on the kinetic parameters of the dynamic gene regulatory network, we identify important properties (such as susceptibility to infection of the immune system, which may be useful for translational research. Finally, robustness of the inflammatory gene network is also inferred by analyzing the hubs and "weak ties" structures of the gene network

  9. An oligo-based microarray offers novel transcriptomic approaches for the analysis of pathogen resistance and fruit quality traits in melon (Cucumis melo L.

    Directory of Open Access Journals (Sweden)

    Garcia-Mas Jordi

    2009-10-01

    Full Text Available Abstract Background Melon (Cucumis melo is a horticultural specie of significant nutritional value, which belongs to the Cucurbitaceae family, whose economic importance is second only to the Solanaceae. Its small genome of approx. 450 Mb coupled to the high genetic diversity has prompted the development of genetic tools in the last decade. However, the unprecedented existence of a transcriptomic approaches in melon, highlight the importance of designing new tools for high-throughput analysis of gene expression. Results We report the construction of an oligo-based microarray using a total of 17,510 unigenes derived from 33,418 high-quality melon ESTs. This chip is particularly enriched with genes that are expressed in fruit and during interaction with pathogens. Hybridizations for three independent experiments allowed the characterization of global gene expression profiles during fruit ripening, as well as in response to viral and fungal infections in plant cotyledons and roots, respectively. Microarray construction, statistical analyses and validation together with functional-enrichment analysis are presented in this study. Conclusion The platform validation and enrichment analyses shown in our study indicate that this oligo-based microarray is amenable for future genetic and functional genomic studies of a wide range of experimental conditions in melon.

  10. Novel design and controls for focused DNA microarrays: applications in quality assurance/control and normalization for the Health Canada ToxArray™

    Directory of Open Access Journals (Sweden)

    Lambert Iain B

    2006-10-01

    Full Text Available Abstract Background Microarray normalizations typically apply methods that assume absence of global transcript shifts, or absence of changes in internal control features such as housekeeping genes. These normalization approaches are not appropriate for focused arrays with small sets of genes where a large portion may be expected to change. Furthermore, many microarrays lack control features that can be used for quality assurance (QA. Here, we describe a novel external control series integrated with a design feature that addresses the above issues. Results An EC dilution series that involves spike-in of a single concentration of the A. thaliana chlorophyll synthase gene to hybridize against spotted dilutions (0.000015 to 100 μM of a single complimentary oligonucleotide representing the gene was developed. The EC series is printed in duplicate within each subgrid of the microarray and covers the full range of signal intensities from background to saturation. The design and placement of the series allows for QA examination of frequently encountered problems in hybridization (e.g., uneven hybridizations and printing (e.g., cross-spot contamination. Additionally, we demonstrate that the series can be integrated with a LOWESS normalization to improve the detection of differential gene expression (improved sensitivity and predictivity over LOWESS normalization on its own. Conclusion The quality of microarray experiments and the normalization methods used affect the ability to measure accurate changes in gene expression. Novel methods are required for normalization of small focused microarrays, and for incorporating measures of performance and quality. We demonstrate that dilution of oligonucleotides on the microarray itself provides an innovative approach allowing the full dynamic range of the scanner to be covered with a single gene spike-in. The dilution series can be used in a composite normalization to improve detection of differential gene

  11. The Sterolgene v0 cDNA microarray: a systemic approach to studies of cholesterol homeostasis and drug metabolism

    OpenAIRE

    2008-01-01

    Abstract Background Cholesterol homeostasis and xenobiotic metabolism are complex biological processes, which are difficult to study with traditional methods. Deciphering complex regulation and response of these two processes to different factors is crucial also for understanding of disease development. Systems biology tools as are microarrays can importantly contribute to this knowledge and can also discover novel interactions between the two processes. Results We have developed a low densit...

  12. Identification of seroreactive proteins of Leptospira interrogans serovar copenhageni using a high-density protein microarray approach

    OpenAIRE

    Lessa-Aquino, Carolina; Rodrigues, Camila Borges; Ribeiro, Guilherme S. et al.

    2013-01-01

    Leptospirosis is a widespread zoonotic disease worldwide. The lack of an adequate laboratory test is a major barrier for diagnosis, especially during the early stages of illness, when antibiotic therapy is most effective. Therefore, there is a critical need for an efficient diagnostic test for this life threatening disease. Methodology: In order to identify new targets that could be used as diagnostic makers for leptopirosis, we constructed a protein microarray chip comprising 61% of Le...

  13. Identification of seroreactive proteins of Leptospira interrogans Serovar Copenhageni using a High-Density protein Microarray approach

    OpenAIRE

    Aquino, Carolina Lessa; Rodrigues, Camila Borges; Pablo, Jozelyn; Sasaki, Rie; Jasinskas, Algis; Guilherme S Ribeiro; Vigil, Adam

    2013-01-01

    p. 1-13 Background: Leptospirosis is a widespread zoonotic disease worldwide. The lack of an adequate laboratory test is a major barrier for diagnosis, especially during the early stages of illness, when antibiotic therapy is most effective. Therefore, there is a critical need for an efficient diagnostic test for this life threatening disease. Methodology: In order to identify new targets that could be used as diagnostic makers for leptopirosis, we constructed a protein microarray chip ...

  14. Towards standardization of microarray-based genotyping of Salmonella

    DEFF Research Database (Denmark)

    Löfström, Charlotta; Grønlund, Hugo Ahlm; Riber, Leise

    2010-01-01

    Genotyping is becoming an increasingly important tool to improve risk assessments of Salmonella. DNA microarray technology is a promising diagnostic tool that can provide high resolution genomic profile of many genes simultaneously. However, standardization of DNA microarray analysis is needed...... of Salmonella at two different laboratories. The low-density array contained 281 of 57-60-mer oligonucleotide probes for detecting a wide range of specific genomic markers associated with antibiotic resistance, cell envelope structures, mobile genetic elements and pathogenicity. Several test parameters...... for a decentralized and simple-to-implement DNA microarray as part of a pan-European source-attribution model for risk assessment of Salmonella....

  15. A universal assay for detection of oncogenic fusion transcripts by oligo microarray analysis

    Directory of Open Access Journals (Sweden)

    Ribeiro Franclim R

    2009-01-01

    Full Text Available Abstract Background The ability to detect neoplasia-specific fusion genes is important not only in cancer research, but also increasingly in clinical settings to ensure that correct diagnosis is made and the optimal treatment is chosen. However, the available methodologies to detect such fusions all have their distinct short-comings. Results We describe a novel oligonucleotide microarray strategy whereby one can screen for all known oncogenic fusion transcripts in a single experiment. To accomplish this, we combine measurements of chimeric transcript junctions with exon-wise measurements of individual fusion partners. To demonstrate the usefulness of the approach, we designed a DNA microarray containing 68,861 oligonucleotide probes that includes oligos covering all combinations of chimeric exon-exon junctions from 275 pairs of fusion genes, as well as sets of oligos internal to all the exons of the fusion partners. Using this array, proof of principle was demonstrated by detection of known fusion genes (such as TCF3:PBX1, ETV6:RUNX1, and TMPRSS2:ERG from all six positive controls consisting of leukemia cell lines and prostate cancer biopsies. Conclusion This new method bears promise of an important complement to currently used diagnostic and research tools for the detection of fusion genes in neoplastic diseases.

  16. Rapid and quantitative quality control of microarrays using cationic nanoparticles.

    Science.gov (United States)

    Sun, Ye; Fan, Wenhua; McCann, Michael P; Golovlev, Val

    2009-02-15

    The fabrication quality of microarrays significantly influences the accuracy and reproducibility of microarray experiments. In this report, we present a simple and fast quality control (QC) method for spotted oligonucleotide and cDNA microarrays. It employs a nonspecific electrostatic interaction of colloidal gold nanoparticles with the chemical groups of DNA molecules and other biomolecules immobilized on the microarray surface that bear positive or negative charges. An inexpensive flatbed scanner is used to visualize and quantify the binding of cationic gold particles to the anionic DNA probes on the microarray surface. An image analysis software was designed to assess the various parameters of the array spots including spot intensity, shape and array homogeneity, calculate the overall array quality score, and save the detailed array quality report in an Excel file. The gold staining technique is fast and sensitive. It can be completed in 10 min and detect less than 1% of the probe amount commonly recommended for microarrays. Compared to the current microarray QC method that utilizes the hybridization of probes with short random sequence oligonucleotides labeled with fluorophore, our gold staining method requires less time for the analysis, reduces the reagent cost, and eliminates the need for the expensive laser scanner.

  17. Stewardship approach for optimizing antimicrobial therapy through use of a rapid microarray assay on blood cultures positive for Enterococcus species.

    Science.gov (United States)

    Sango, Aaron; McCarter, Yvette S; Johnson, Donald; Ferreira, Jason; Guzman, Nilmarie; Jankowski, Christopher A

    2013-12-01

    Enterococci are a major cause of bloodstream infections in hospitalized patients and have limited antimicrobial treatment options due to their many resistance mechanisms. Molecular technologies have significantly shortened the time to enterococcal isolate identification compared with conventional methods. We evaluated the impact of rapid organism identification and resistance detection with the Verigene Gram-positive blood culture microarray assay on clinical and economic outcomes for patients with enterococcal bacteremia. A single-center preintervention/postintervention quasiexperimental study compared inpatients with enterococcal bacteremia from 1 February 2012 to 9 September 2012 (preintervention period) and 10 September 2012 to 28 February 2013 (postintervention period). An infectious disease and/or critical care pharmacist was contacted with the microarray assay results, and effective antibiotics were recommended. The clinical and economic outcomes for 74 patients were assessed. The mean time to appropriate antimicrobial therapy was 23.4 h longer in the preintervention group than in the postintervention group (P = 0.0054). A nonsignificant decrease in the mean time to appropriate antimicrobial therapy was seen for patients infected with vancomycin-susceptible Enterococcus isolates (P = 0.1145). For patients with vancomycin-resistant Enterococcus bacteremia, the mean time to appropriate antimicrobial therapy was 31.1 h longer in the preintervention group than in the postintervention group (P < 0.0001). In the postintervention group, the hospital length of stay was significantly 21.7 days shorter (P = 0.0484) and mean hospital costs were $60,729 lower (P = 0.02) than in the preintervention group. The rates of attributed deaths in the two groups were not statistically different. Microarray technology, supported by pharmacy and microbiology departments, can decrease the time to appropriate antimicrobial therapy, the hospital length of stay, and health care costs.

  18. Antisense oligonucleotides in therapy for neurodegenerative disorders.

    Science.gov (United States)

    Evers, Melvin M; Toonen, Lodewijk J A; van Roon-Mom, Willeke M C

    2015-06-29

    Antisense oligonucleotides are synthetic single stranded strings of nucleic acids that bind to RNA and thereby alter or reduce expression of the target RNA. They can not only reduce expression of mutant proteins by breakdown of the targeted transcript, but also restore protein expression or modify proteins through interference with pre-mRNA splicing. There has been a recent revival of interest in the use of antisense oligonucleotides to treat several neurodegenerative disorders using different approaches to prevent disease onset or halt disease progression and the first clinical trials for spinal muscular atrophy and amyotrophic lateral sclerosis showing promising results. For these trials, intrathecal delivery is being used but direct infusion into the brain ventricles and several methods of passing the blood brain barrier after peripheral administration are also under investigation. Copyright © 2015. Published by Elsevier B.V.

  19. Analytical approach for selecting normalizing genes from a cDNA microarray platform to be used in q-RT-PCR assays: a cnidarian case study.

    Science.gov (United States)

    Rodriguez-Lanetty, Mauricio; Phillips, Wendy S; Dove, Sophie; Hoegh-Guldberg, Ove; Weis, Virginia M

    2008-04-24

    Research in gene function using Quantitative Reverse Transcription PCR (q-RT-PCR) and microarray approaches are emerging and just about to explode in the field of coral and cnidarian biology. These approaches are showing the great potential to significantly advance our understanding of how corals respond to abiotic and biotic stresses, and how host cnidarians/dinoflagellates symbioses are maintained and regulated. With these genomic advances, however, new analytical challenges are also emerging, such as the normalization of gene expression data derived from q-RT-PCR. In this study, an effective analytical method is introduced to identify candidate housekeeping genes (HKG) from a sea anemone (Anthopleura elegantissima) cDNA microarray platform that can be used as internal control genes to normalize q-RT-PCR gene expression data. It is shown that the identified HKGs were stable among the experimental conditions tested in this study. The three most stables genes identified, in term of gene expression, were beta-actin, ribosomal protein L12, and a Poly(a) binding protein. The applications of these HKGs in other cnidarian systems are further discussed.

  20. Typing of enteroviruses by use of microwell oligonucleotide arrays.

    Science.gov (United States)

    Susi, P; Hattara, L; Waris, M; Luoma-Aho, T; Siitari, H; Hyypiä, T; Saviranta, P

    2009-06-01

    We have developed a straightforward assay for the rapid typing of enteroviruses using oligonucleotide arrays in microtiter wells. The viral nucleic acids are concomitantly amplified and labeled during reverse transcription-PCR, and unpurified PCR products are used for hybridization. DNA strands are separated by alkaline denaturation, and hybridization is started by neutralization. The microarray hybridization reactions and the subsequent washes are performed in standard 96-well microtiter plates, which makes the method easily adaptable to high-throughput analysis. We describe here the assay principle and its potential in clinical laboratory use by correctly identifying 10 different enterovirus reference strains. Furthermore, we explore the detection of unknown sequence variants using serotype consensus oligonucleotide probes. With just two consensus probes for the coxsackievirus A9 (CVA9) serotype, we detected 23 out of 25 highly diverse CVA9 isolates. Overall, the assay involves several features aiming at ease of performance, robustness, and applicability to large-scale studies.

  1. Radiolabeled oligonucleotides for antisense imaging

    Science.gov (United States)

    Iyer, Arun K; He, Jiang

    2011-01-01

    Oligonucleotides radiolabeled with isotopes emitting γ-rays (for SPECT imaging) or positrons (for PET imaging) can be useful for targeting messenger RNA (mRNA) thereby serving as non-invasive imaging tools for detection of gene expression in vivo (antisense imaging). Radiolabeled oligonucleotides may also be used for monitoring their in vivo fate, thereby helping us better understand the barriers to its delivery for antisense targeting. These developments have led to a new area of molecular imaging and targeting, utilizing radiolabeled antisense oligonucleotides. However, the success of antisense imaging relies heavily on overcoming the barriers for its targeted delivery in vivo. Furthermore, the low ability of the radiolabeled antisense oligonucleotide to subsequently internalize into the cell and hybridize with its target mRNA poses additional challenges in realizing its potentials. This review covers the advances in the antisense imaging probe development for PET and SPECT, with an emphasis on radiolabeling strategies, stability, delivery and in vivo targeting. PMID:21822406

  2. Peptide-LNA oligonucleotide conjugates

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Hansen, Lykke Haastrup; Vester, Birte

    2013-01-01

    properties, peptides were introduced into oligonucleotides via a 2'-alkyne-2'-amino-LNA scaffold. Derivatives of methionine- and leucine-enkephalins were chosen as model peptides of mixed amino acid content, which were singly and doubly incorporated into LNA/DNA strands using highly efficient copper......Although peptide-oligonucleotide conjugates (POCs) are well-known for nucleic acids delivery and therapy, reports on internal attachment of peptides to oligonucleotides are limited in number. To develop a convenient route for preparation of internally labeled POCs with improved biomedical......(i)-catalyzed azide-alkyne cycloaddition (CuAAC) "click" chemistry. DNA/RNA target binding affinity and selectivity of the resulting POCs were improved in comparison to LNA/DNA mixmers and unmodified DNA controls. This clearly demonstrates that internal attachment of peptides to oligonucleotides can significantly...

  3. Integrated Amplification Microarrays for Infectious Disease Diagnostics

    Directory of Open Access Journals (Sweden)

    Darrell P. Chandler

    2012-11-01

    Full Text Available This overview describes microarray-based tests that combine solution-phase amplification chemistry and microarray hybridization within a single microfluidic chamber. The integrated biochemical approach improves microarray workflow for diagnostic applications by reducing the number of steps and minimizing the potential for sample or amplicon cross-contamination. Examples described herein illustrate a basic, integrated approach for DNA and RNA genomes, and a simple consumable architecture for incorporating wash steps while retaining an entirely closed system. It is anticipated that integrated microarray biochemistry will provide an opportunity to significantly reduce the complexity and cost of microarray consumables, equipment, and workflow, which in turn will enable a broader spectrum of users to exploit the intrinsic multiplexing power of microarrays for infectious disease diagnostics.

  4. Optimized light-directed synthesis of aptamer microarrays.

    Science.gov (United States)

    Franssen-van Hal, Nicole L W; van der Putte, Pepijn; Hellmuth, Klaus; Matysiak, Stefan; Kretschy, Nicole; Somoza, Mark M

    2013-06-18

    Aptamer microarrays are a promising high-throughput method for ultrasensitive detection of multiple analytes, but although much is known about the optimal synthesis of oligonucleotide microarrays used in hybridization-based genomics applications, the bioaffinity interactions between aptamers and their targets is qualitatively different and requires significant changes to synthesis parameters. Focusing on streptavidin-binding DNA aptamers, we employed light-directed in situ synthesis of microarrays to analyze the effects of sequence fidelity, linker length, surface probe density, and substrate functionalization on detection sensitivity. Direct comparison with oligonucleotide hybridization experiments indicates that aptamer microarrays are significantly more sensitive to sequence fidelity and substrate functionalization and have different optimal linker length and surface probe density requirements. Whereas microarray hybridization probes generate maximum signal with multiple deletions, aptamer sequences with the same deletion rate result in a 3-fold binding signal reduction compared with the same sequences synthesized for maximized sequence fidelity. The highest hybridization signal was obtained with dT 5mer linkers, and the highest aptamer signal was obtained with dT 11mers, with shorter aptamer linkers significantly reducing the binding signal. The probe hybridization signal was found to be more sensitive to molecular crowding, whereas the aptamer probe signal does not appear to be constrained within the density of functional surface groups commonly used to synthesize microarrays.

  5. The use of microarrays in microbial ecology

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, G.L.; He, Z.; DeSantis, T.Z.; Brodie, E.L.; Zhou, J.

    2009-09-15

    Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogenetic microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer

  6. Phenotypic MicroRNA Microarrays

    OpenAIRE

    2013-01-01

    Microarray technology has become a very popular approach in cases where multiple experiments need to be conducted repeatedly or done with a variety of samples. In our lab, we are applying our high density spots microarray approach to microscopy visualization of the effects of transiently introduced siRNA or cDNA on cellular morphology or phenotype. In this publication, we are discussing the possibility of using this micro-scale high throughput process to study the role of microRNAs in the bio...

  7. Use of genomic DNA control features and predicted operon structure in microarray data analysis: ArrayLeaRNA – a Bayesian approach

    Directory of Open Access Journals (Sweden)

    Pin Carmen

    2007-11-01

    Full Text Available Abstract Background Microarrays are widely used for the study of gene expression; however deciding on whether observed differences in expression are significant remains a challenge. Results A computing tool (ArrayLeaRNA has been developed for gene expression analysis. It implements a Bayesian approach which is based on the Gumbel distribution and uses printed genomic DNA control features for normalization and for estimation of the parameters of the Bayesian model and prior knowledge from predicted operon structure. The method is compared with two other approaches: the classical LOWESS normalization followed by a two fold cut-off criterion and the OpWise method (Price, et al. 2006. BMC Bioinformatics. 7, 19, a published Bayesian approach also using predicted operon structure. The three methods were compared on experimental datasets with prior knowledge of gene expression. With ArrayLeaRNA, data normalization is carried out according to the genomic features which reflect the results of equally transcribed genes; also the statistical significance of the difference in expression is based on the variability of the equally transcribed genes. The operon information helps the classification of genes with low confidence measurements. ArrayLeaRNA is implemented in Visual Basic and freely available as an Excel add-in at http://www.ifr.ac.uk/safety/ArrayLeaRNA/ Conclusion We have introduced a novel Bayesian model and demonstrated that it is a robust method for analysing microarray expression profiles. ArrayLeaRNA showed a considerable improvement in data normalization, in the estimation of the experimental variability intrinsic to each hybridization and in the establishment of a clear boundary between non-changing and differentially expressed genes. The method is applicable to data derived from hybridizations of labelled cDNA samples as well as from hybridizations of labelled cDNA with genomic DNA and can be used for the analysis of datasets where

  8. The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

    Science.gov (United States)

    2013-01-01

    Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

  9. Combined in vitro transcription and reverse transcription to amplify and label complex synthetic oligonucleotide probe libraries.

    Science.gov (United States)

    Murgha, Yusuf; Beliveau, Brian; Semrau, Kassandra; Schwartz, Donald; Wu, Chao-Ting; Gulari, Erdogan; Rouillard, Jean-Marie

    2015-06-01

    Oligonucleotide microarrays allow the production of complex custom oligonucleotide libraries for nucleic acid detection-based applications such as fluorescence in situ hybridization (FISH). We have developed a PCR-free method to make single-stranded DNA (ssDNA) fluorescent probes through an intermediate RNA library. A double-stranded oligonucleotide library is amplified by transcription to create an RNA library. Next, dye- or hapten-conjugate primers are used to reverse transcribe the RNA to produce a dye-labeled cDNA library. Finally the RNA is hydrolyzed under alkaline conditions to obtain the single-stranded fluorescent probes library. Starting from unique oligonucleotide library constructs, we present two methods to produce single-stranded probe libraries. The two methods differ in the type of reverse transcription (RT) primer, the incorporation of fluorescent dye, and the purification of fluorescent probes. The first method employs dye-labeled reverse transcription primers to produce multiple differentially single-labeled probe subsets from one microarray library. The fluorescent probes are purified from excess primers by oligonucleotide-bead capture. The second method uses an RNA:DNA chimeric primer and amino-modified nucleotides to produce amino-allyl probes. The excess primers and RNA are hydrolyzed under alkaline conditions, followed by probe purification and labeling with amino-reactive dyes. The fluorescent probes created by the combination of transcription and reverse transcription can be used for FISH and to detect any RNA and DNA targets via hybridization.

  10. Rapid Detection of rpoB Gene Mutations in Rif-resistant M.tuberculosis Isolates by Obligonucleotide Microarray

    Institute of Scientific and Technical Information of China (English)

    AI-HUA SUN; XING-LI FAN; LI-WEI LI; LI-FANG WANG; WEN-YING AN; JIE YAN

    2009-01-01

    Objective To detect the specific mutations in rpoB gene of Mycobacterium tuberculosis by oligonucleotide microarray.Methods Four wild-type and 8 mutant probes were used to detect rifampin resistant strains.Target DNA of M.tuberculosis was amplified by PCR,hybridized and scanned.Direct sequencing was performed to verify the results of oligonuclcotide microarray.Results of the 102 rifampin-resistant strains 98 (96.1%) had mutations in the rpoB genes. Conclusion Oligonucleotide microarray with mutation-specific probes is a reliable and useful tool for the rapid and accurate diagnosis of rifampin resistance in M.tuberculosis isolates.

  11. A Reductionist Approach to Extract Robust Molecular Markers from Microarray Data Series -Isolating Markers to Track Osseointegration.

    Science.gov (United States)

    Barik, Anwesha; Banerjee, Satarupa; Dhara, Santanu; Chakravorty, Nishant

    2017-03-10

    Complexities in the full genome expression studies hinder the extraction of tracker genes to analyze the course of biological events. In this study, we demonstrate the applications of supervised machine learning methods to reduce the irrelevance in microarray data series and thereby extract robust molecular markers to track biological processes. The methodology has been illustrated by analyzing whole genome expression studies on bone-implant integration (ossointegration). Being a biological process, osseointegration is known to leave a trail of genetic footprint during the course. In spite of existence of enormous amount of raw data in public repositories, researchers still do not have access to a panel of genes that can definitively track osseointegrtion. The results from our study revealed panels comprising of matrix metalloproteinases and collagen genes were able to track osseointegration on implant surfaces (MMP9 and COL1A2 on micro-textured; MMP12 and COL6A3 on superimposed nano-textured surfaces) 100% classification accuracy, specificity and sensitivity. Further, our analysis showed the importance of the progression of the duration in establishment of the mechanical connection at bone-implant surface. The findings from this study are expected to be useful to researchers investigating osseointegration of novel implant materials especially at the early stage. The methodology demonstrated can be easily adapted by scientists in different fields to analyze large databases for other biological processes.

  12. Microarray-based approach identifies microRNAs and their target functional patterns in polycystic kidney disease

    Directory of Open Access Journals (Sweden)

    Boehn Susanne NE

    2008-12-01

    Full Text Available Abstract Background MicroRNAs (miRNAs play key roles in mammalian gene expression and several cellular processes, including differentiation, development, apoptosis and cancer pathomechanisms. Recently the biological importance of primary cilia has been recognized in a number of human genetic diseases. Numerous disorders are related to cilia dysfunction, including polycystic kidney disease (PKD. Although involvement of certain genes and transcriptional networks in PKD development has been shown, not much is known how they are regulated molecularly. Results Given the emerging role of miRNAs in gene expression, we explored the possibilities of miRNA-based regulations in PKD. Here, we analyzed the simultaneous expression changes of miRNAs and mRNAs by microarrays. 935 genes, classified into 24 functional categories, were differentially regulated between PKD and control animals. In parallel, 30 miRNAs were differentially regulated in PKD rats: our results suggest that several miRNAs might be involved in regulating genetic switches in PKD. Furthermore, we describe some newly detected miRNAs, miR-31 and miR-217, in the kidney which have not been reported previously. We determine functionally related gene sets, or pathways to reveal the functional correlation between differentially expressed mRNAs and miRNAs. Conclusion We find that the functional patterns of predicted miRNA targets and differentially expressed mRNAs are similar. Our results suggest an important role of miRNAs in specific pathways underlying PKD.

  13. Microarray-based approach identifies differentially expressed microRNAs in porcine sexually immature and mature testes.

    Directory of Open Access Journals (Sweden)

    Lifan Luo

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are short non-coding RNA molecules which are proved to be involved in mammalian spermatogenesis. Their expression and function in the porcine germ cells are not fully understood. METHODOLOGY: We employed a miRNA microarray containing 1260 unique miRNA probes to evaluate the miRNA expression patterns between sexually immature (60-day and mature (180-day pig testes. One hundred and twenty nine miRNAs representing 164 reporter miRNAs were expressed differently (p<0.1. Fifty one miRNAs were significantly up-regulated and 78 miRNAs were down-regulated in mature testes. Nine of these differentially expressed miRNAs were validated using quantitative RT-PCR assay. Totally 15,919 putative miRNA-target sites were detected by using RNA22 method to align 445 NCBI pig cDNA sequences with these 129 differentially expressed miRNAs, and seven putative target genes involved in spermatogenesis including DAZL, RNF4 gene were simply confirmed by quantitative RT-PCR. CONCLUSIONS: Overall, the results of this study indicated specific miRNAs expression in porcine testes and suggested that miRNAs had a role in regulating spermatogenesis.

  14. Characteristic archaebacterial 16S rRNA oligonucleotides

    Science.gov (United States)

    McGill, T. J.; Jurka, J.; Sobieski, J. M.; Pickett, M. H.; Woese, C. R.; Fox, G. E.

    1986-01-01

    A method of analyzing 16S rRNA catalog data has been developed in which groupings at various taxonomic levels can be characterized in terms of specific "signature" oligonucleotides. This approach provides an alternative means for evaluating higher order branching possibilities and can be used to assess the phylogenetic position of isolates that are poorly placed by the usual clustering procedures. This signature approach has been applied to forty archaebacterial catalogs and every oligonucleotide with significant signature value has been identified. Sets of specific oligonucleotides were identified for every major group on a dendrogram produced by cluster analysis procedures. Signatures that would establish between group relationships were also sought and found. In the case of the Methanobacteriaceae the clustering methods suggest a specific relationship to the Methanococcaceae. This inclusion is in fact supported by six strong signature oligonucleotides. However there are also significant numbers of signature oligonucleotides supporting a specific relationship of the Methanobacteriaceae to either the Halobacteriaceae or the Methanomicrobiaceae. Thus the placement of the Methanobacteriaceae is less certain than the usual dendrograms imply. The signature approach also was used to assess the phylogenetic position of Thermoplasma acidophilum which is found to be more closely related to the methanogen/halophile Division than to the sulfur dependent Division of the archaebacteria. This does not imply however that Thermoplasma acidophilum is properly regarded as being in the methanogen/halophile Division.

  15. Discrimination of oligonucleotides of different lengths with a wild-type aerolysin nanopore

    Science.gov (United States)

    Cao, Chan; Ying, Yi-Lun; Hu, Zheng-Li; Liao, Dong-Fang; Tian, He; Long, Yi-Tao

    2016-08-01

    Protein nanopores offer an inexpensive, label-free method of analysing single oligonucleotides. The sensitivity of the approach is largely determined by the characteristics of the pore-forming protein employed, and typically relies on nanopores that have been chemically modified or incorporate molecular motors. Effective, high-resolution discrimination of oligonucleotides using wild-type biological nanopores remains difficult to achieve. Here, we show that a wild-type aerolysin nanopore can resolve individual short oligonucleotides that are 2 to 10 bases long. The sensing capabilities are attributed to the geometry of aerolysin and the electrostatic interactions between the nanopore and the oligonucleotides. We also show that the wild-type aerolysin nanopores can distinguish individual oligonucleotides from mixtures and can monitor the stepwise cleavage of oligonucleotides by exonuclease I.

  16. Antisense Oligonucleotide-mediated Suppression of Muscle Glycogen Synthase 1 Synthesis as an Approach for Substrate Reduction Therapy of Pompe Disease

    Directory of Open Access Journals (Sweden)

    Nicholas P Clayton

    2014-01-01

    Full Text Available Pompe disease is an autosomal recessive disorder caused by a deficiency of acid α-glucosidase (GAA; EC 3.2.1.20 and the resultant progressive lysosomal accumulation of glycogen in skeletal and cardiac muscles. Enzyme replacement therapy using recombinant human GAA (rhGAA has proven beneficial in addressing several aspects of the disease such as cardiomyopathy and aberrant motor function. However, residual muscle weakness, hearing loss, and the risks of arrhythmias and osteopenia persist despite enzyme therapy. Here, we evaluated the relative merits of substrate reduction therapy (by inhibiting glycogen synthesis as a potential adjuvant strategy. A phosphorodiamidate morpholino oligonucleotide (PMO designed to invoke exon skipping and premature stop codon usage in the transcript for muscle specific glycogen synthase (Gys1 was identified and conjugated to a cell penetrating peptide (GS-PPMO to facilitate PMO delivery to muscle. GS-PPMO systemic administration to Pompe mice led to a dose-dependent decrease in glycogen synthase transcripts in the quadriceps, and the diaphragm but not the liver. An mRNA response in the heart was seen only at the higher dose tested. Associated with these decreases in transcript levels were correspondingly lower tissue levels of muscle specific glycogen synthase and activity. Importantly, these reductions resulted in significant decreases in the aberrant accumulation of lysosomal glycogen in the quadriceps, diaphragm, and heart of Pompe mice. Treatment was without any overt toxicity, supporting the notion that substrate reduction by GS-PPMO-mediated inhibition of muscle specific glycogen synthase represents a viable therapeutic strategy for Pompe disease after further development.

  17. Genotype of ethanol metabolizing enzyme genes by oligonucleotide microarray in alcoholic liver disease in Chinese people%芯片检测乙醇代谢相关酶基因多态性及其在酒精性肝病中的应用

    Institute of Scientific and Technical Information of China (English)

    虞朝辉; 厉有名; 陈卫星; 乐敏

    2002-01-01

    Objective To explore the relationship between genetic polymorphisms of the ethanol metabolizing enzymes and the occurrence of alcoholic liver disease (ALD). Methods Sixty-five healthy male controls and 165 alcoholisms (including 122 ALD patients and 43 male alcohol abusers without liver complications defined as alcohol-dependent) were analyzed by polymerase chain reaction and hybridized with oligonucleotide microarray to detect the polymorphisms of the ethanol metabolizing enzymes genes. Were shown as 37.69%, 46.51% and 59.02% in control, alcohol-dependent and alcoholisms (ALD group and alcohol-dependent group) than in healthy controls (P<0.01), and significantly higher in ALD group than in significantly higher in alcohol-dependents than in healthy controls lower in alcoholisms than that in the healthy controls, and the deference between ALD group and alcohol-dependent group was significant. No groups.Conclusions Polymorphic ADH2, ADH3 and ALDH2 genes can affect the propensity for alcohol drinking in Chinese.The alleles of ADH2*2,ADH3*1and ALDH2*2 are most likely to play a rotective role against%目的利用基因芯片检测乙醇代谢相关酶的单核苷酸多态性(SNPs),并阐明乙醇代谢相关酶基因多态性与酒精性肝病的关系.方法参照"酒精性肝病的诊断依据及治愈、好转标准", 并排除乙型肝炎表面抗原和丙型肝炎抗体阳性者,不典型者做肝穿刺活检,选择165例嗜酒者,其中无肝脏损害的有43例,酒精性肝病122例;正常对照组65例为研究对象.抽取3ml外周血,分离外周血单核细胞,按常规提取DNA,行4重不对称PCR, PCR 产物与寡核苷酸探针微阵列芯片杂交,并扫描分析结果.结果健康对照组、嗜酒者组、无肝脏损害的嗜酒者组和酒精性肝病组的ADH2*1等位基因频率分别为37.69%, 55.76%, 46.51%,59.02%; ADH2*2 等位基因频率相应为62.31%, 44.24%, 53.49%, 40.98%; 未发现ADH2*3型等位基因.嗜酒者

  18. Microarrays, Integrated Analytical Systems

    Science.gov (United States)

    Combinatorial chemistry is used to find materials that form sensor microarrays. This book discusses the fundamentals, and then proceeds to the many applications of microarrays, from measuring gene expression (DNA microarrays) to protein-protein interactions, peptide chemistry, carbodhydrate chemistry, electrochemical detection, and microfluidics.

  19. Strategies in the preparation of DNA oligonucleotide arrays for diagnostic applications.

    Science.gov (United States)

    Beaucage, S L

    2001-08-01

    This report emphasizes the interfacial chemistry that is required to ensure proper attachment of oligonucleotides onto the surface of microarrays. For example, strategies for the covalent attachment of pre-synthesized oligonucleotides to glass slides, gold films, polyacrylamide gel pads, polypyrrole films, and optical fibers are surveyed in an attempt to better define the parameters for optimal formation and detection of DNA hybrids. These parameters include among others, the nature and length of the linkers attaching oligonucleotides to the arrays, and the surface density of oligonucleotides required for unhindered hybridization with DNA targets. Sensitive detection methods such as the use of light-scattering techniques, molecular beacons, surface plasmon resonance, attenuated total internal reflection-FTIR, and the evanescent field excitation of fluorescence from surface-bound fluorophores have been developed to study the kinetics and specificity of hybridization events. Finally, the synthesis of oligonucleotides directly on glass surfaces and polypropylene sheets has been investigated to enable DNA sequencing by hybridization and achieve oligonucleotide densities of ca. 10(6) sequences per cm(2) on DNA chips.

  20. Biominetic High Density Lipoproteins for the Delivery of Therapeutic Oligonucleotides

    Science.gov (United States)

    Tripathy, Sushant

    Advances in nanotechnology have brought about novel inorganic and hybrid nanoparticles with unique physico-chemical properties that make them suitable for a broad range of applications---from nano-circuitry to drug delivery. A significant part of those advancements have led to ground-breaking discoveries that have changed the approaches to formulation of therapeutics against diseases, such as cancer. Now-a-days the focus does not lie solely on finding a candidate small-molecule therapeutic with minimal adverse effects, but researchers are looking up to nanoparticles to improve biodistribution and biocompatibility profile of clinically proven therapeutics. The plethora of conjugation chemistries offered by currently extant inorganic nanoparticles have, in recent years, led to great leaps in the field of biomimicry---a modality that promises high biocompatibility. Further, in the pursuit of highly specific therapeutic molecules, researchers have turned to silencing oligonucleotides and some have already brought together the strengths of nanoparticles and silencing oligonucleotides in search of an efficacious therapy for cancer with minimal adverse effects. This dissertation work focuses on such a biomimetic platform---a gold nanoparticle based high density lipoprotein biomimetic (HDL NP), for the delivery of therapeutic oligonucleotides. The first chapter of this body of work introduces the molecular target of the silencing oligonucleotides---VEGFR2, and its role in the progression of solid tumor cancers. The background information also covers important aspects of natural high density lipoproteins (HDL), especially their innate capacity to bind and deliver exogenous and endogenous silencing oligonucleotides to tissues that express their high affinity receptor SRB1. We subsequently describe the synthesis of the biomimetic HDL NP and its oligonucleotide conjugates, and establish their biocompatibility. Further on, experimental data demonstrate the efficacy of silencing

  1. Rapid and Sensitive Multiplex Detection of Burkholderia pseudomallei-Specific Antibodies in Melioidosis Patients Based on a Protein Microarray Approach.

    Directory of Open Access Journals (Sweden)

    Christian Kohler

    2016-07-01

    Full Text Available The environmental bacterium Burkholderia pseudomallei causes the infectious disease melioidosis with a high case-fatality rate in tropical and subtropical regions. Direct pathogen detection can be difficult, and therefore an indirect serological test which might aid early diagnosis is desirable. However, current tests for antibodies against B. pseudomallei, including the reference indirect haemagglutination assay (IHA, lack sensitivity, specificity and standardization. Consequently, serological tests currently do not play a role in the diagnosis of melioidosis in endemic areas. Recently, a number of promising diagnostic antigens have been identified, but a standardized, easy-to-perform clinical laboratory test for sensitive multiplex detection of antibodies against B. pseudomallei is still lacking.In this study, we developed and validated a protein microarray which can be used in a standard 96-well format. Our array contains 20 recombinant and purified B. pseudomallei proteins, previously identified as serodiagnostic candidates in melioidosis. In total, we analyzed 196 sera and plasmas from melioidosis patients from northeast Thailand and 210 negative controls from melioidosis-endemic and non-endemic regions. Our protein array clearly discriminated between sera from melioidosis patients and controls with a specificity of 97%. Importantly, the array showed a higher sensitivity than did the IHA in melioidosis patients upon admission (cut-off IHA titer ≥1:160: IHA 57.3%, protein array: 86.7%; p = 0.0001. Testing of sera from single patients at 0, 12 and 52 weeks post-admission revealed that protein antigens induce either a short- or long-term antibody response.Our protein array provides a standardized, rapid, easy-to-perform test for the detection of B. pseudomallei-specific antibody patterns. Thus, this system has the potential to improve the serodiagnosis of melioidosis in clinical settings. Moreover, our high-throughput assay might be useful

  2. Efficient assembly of very short oligonucleotides using T4 DNA Ligase

    Directory of Open Access Journals (Sweden)

    Holt Robert A

    2010-11-01

    Full Text Available Abstract Background In principle, a pre-constructed library of all possible short oligonucleotides could be used to construct many distinct gene sequences. In order to assess the feasibility of such an approach, we characterized T4 DNA Ligase activity on short oligonucleotide substrates and defined conditions suitable for assembly of a plurality of oligonucleotides. Findings Ligation by T4 DNA Ligase was found to be dependent on the formation of a double stranded DNA duplex of at least five base pairs surrounding the site of ligation. However, ligations could be performed effectively with overhangs smaller than five base pairs and oligonucleotides as small as octamers, in the presence of a second, complementary oligonucleotide. We demonstrate the feasibility of simultaneous oligonucleotide phosphorylation and ligation and, as a proof of principle for DNA synthesis through the assembly of short oligonucleotides, we performed a hierarchical ligation procedure whereby octamers were combined to construct a target 128-bp segment of the beta-actin gene. Conclusions Oligonucleotides as short as 8 nucleotides can be efficiently assembled using T4 DNA Ligase. Thus, the construction of synthetic genes, without the need for custom oligonucleotide synthesis, appears feasible.

  3. Determination of optimal sites of antisense oligonucleotide cleavage within TNFα mRNA

    Science.gov (United States)

    Lloyd, B. H.; Giles, R. V.; Spiller, D. G.; Grzybowski, J.; Tidd, D. M.; Sibson, D. R.

    2001-01-01

    Antisense oligonucleotides provide a powerful tool in order to determine the consequences of the reduced expression of a selected target gene and may include target validation and therapeutic applications. Methods of predicting optimum antisense sites are not always effective. We have compared the efficacy of antisense oligonucleotides, which were selected in vitro using random combinatorial oligonucleotide libraries of differing length and complexity, upon putative target sites within TNFα mRNA. The relationship of specific target site accessibility and oligonucleotide efficacy with respect to these parameters proved to be complex. Modification of the length of the recognition sequence of the oligonucleotide library illustrated that independent target sites demonstrated a preference for antisense oligonucleotides of a defined and independent optimal length. The efficacy of antisense oligonucleotide sequences selected in vitro paralleled that observed in phorbol 12-myristate 13-acetate (PMA)-activated U937 cells. The application of methylphosphonate:phosphodiester chimaeric oligonucleotides to U937 cells reduced mRNA levels to up to 19.8% that of the untreated cell population. This approach provides a predictive means to profile any mRNA of known sequence with respect to the identification and optimisation of sites accessible to antisense oligonucleotide activity. PMID:11522838

  4. Phylogenetic microarrays for cultivation-independent identification and metabolic characterization of microorganisms in complex samples.

    Science.gov (United States)

    Loy, Alexander; Pester, Michael; Steger, Doris

    2011-01-01

    High-throughput sequencing and hybridization technologies promise new insights into the natural diversity and dynamics of microorganisms. Among these new technologies are phylogenetic oligonucleotide microarrays (phylochips) that depend on the standard molecules for taxonomic and environmental studies of microorganisms: the ribosomal RNAs and their encoding genes. The beauty of phylochip hybridization is that a sample can be analyzed with hundreds to thousands of rRNA (gene)-targeted probes simultaneously, lending itself to the efficient diagnosis of many target organisms in many samples. An emerging application of phylochips is the highly parallel analysis of structure-function relationships of microbial community members by employing in vivo substrate-mediated isotope labeling of rRNA (via the isotope array approach). This chapter provides an introduction to phylochip and isotope array analysis and detailed wet-lab protocols for preparation, labeling, and hybridization of target nucleic acids.

  5. Biological data warehousing system for identifying transcriptional regulatory sites from gene expressions of microarray data.

    Science.gov (United States)

    Tsou, Ann-Ping; Sun, Yi-Ming; Liu, Chia-Lin; Huang, Hsien-Da; Horng, Jorng-Tzong; Tsai, Meng-Feng; Liu, Baw-Juine

    2006-07-01

    Identification of transcriptional regulatory sites plays an important role in the investigation of gene regulation. For this propose, we designed and implemented a data warehouse to integrate multiple heterogeneous biological data sources with data types such as text-file, XML, image, MySQL database model, and Oracle database model. The utility of the biological data warehouse in predicting transcriptional regulatory sites of coregulated genes was explored using a synexpression group derived from a microarray study. Both of the binding sites of known transcription factors and predicted over-represented (OR) oligonucleotides were demonstrated for the gene group. The potential biological roles of both known nucleotides and one OR nucleotide were demonstrated using bioassays. Therefore, the results from the wet-lab experiments reinforce the power and utility of the data warehouse as an approach to the genome-wide search for important transcription regulatory elements that are the key to many complex biological systems.

  6. Thermodynamics of Oligonucleotide Duplex Melting

    Science.gov (United States)

    Schreiber-Gosche, Sherrie; Edwards, Robert A.

    2009-01-01

    Melting temperatures of oligonucleotides are useful for a number of molecular biology applications, such as the polymerase chain reaction (PCR). Although melting temperatures are often calculated with simplistic empirical equations, application of thermodynamics provides more accurate melting temperatures and an opportunity for students to apply…

  7. Sequence-dependent fluorescence of cyanine dyes on microarrays.

    Science.gov (United States)

    Agbavwe, Christy; Somoza, Mark M

    2011-01-01

    Cy3 and Cy5 are among the most commonly used oligonucleotide labeling molecules. Studies of nucleic acid structure and dynamics use these dyes, and they are ubiquitous in microarray experiments. They are sensitive to their environment and have higher quantum yield when bound to DNA. The fluorescent intensity of terminal cyanine dyes is also known to be significantly dependent on the base sequence of the oligonucleotide. We have developed a very precise and high-throughput method to evaluate the sequence dependence of oligonucleotide labeling dyes using microarrays and have applied the method to Cy3 and Cy5. We used light-directed in-situ synthesis of terminally-labeled microarrays to determine the fluorescence intensity of each dye on all 1024 possible 5'-labeled 5-mers. Their intensity is sensitive to all five bases. Their fluorescence is higher with 5' guanines, and adenines in subsequent positions. Cytosine suppresses fluorescence. Intensity falls by half over the range of all 5-mers for Cy3, and two-thirds for Cy5. Labeling with 5'-biotin-streptavidin-Cy3/-Cy5 gives a completely different sequence dependence and greatly reduces fluorescence compared with direct terminal labeling.

  8. Sequence-dependent fluorescence of cyanine dyes on microarrays.

    Directory of Open Access Journals (Sweden)

    Christy Agbavwe

    Full Text Available Cy3 and Cy5 are among the most commonly used oligonucleotide labeling molecules. Studies of nucleic acid structure and dynamics use these dyes, and they are ubiquitous in microarray experiments. They are sensitive to their environment and have higher quantum yield when bound to DNA. The fluorescent intensity of terminal cyanine dyes is also known to be significantly dependent on the base sequence of the oligonucleotide. We have developed a very precise and high-throughput method to evaluate the sequence dependence of oligonucleotide labeling dyes using microarrays and have applied the method to Cy3 and Cy5. We used light-directed in-situ synthesis of terminally-labeled microarrays to determine the fluorescence intensity of each dye on all 1024 possible 5'-labeled 5-mers. Their intensity is sensitive to all five bases. Their fluorescence is higher with 5' guanines, and adenines in subsequent positions. Cytosine suppresses fluorescence. Intensity falls by half over the range of all 5-mers for Cy3, and two-thirds for Cy5. Labeling with 5'-biotin-streptavidin-Cy3/-Cy5 gives a completely different sequence dependence and greatly reduces fluorescence compared with direct terminal labeling.

  9. MapReduce Algorithms for Inferring Gene Regulatory Networks from Time-Series Microarray Data Using an Information-Theoretic Approach

    Directory of Open Access Journals (Sweden)

    Yasser Abduallah

    2017-01-01

    Full Text Available Gene regulation is a series of processes that control gene expression and its extent. The connections among genes and their regulatory molecules, usually transcription factors, and a descriptive model of such connections are known as gene regulatory networks (GRNs. Elucidating GRNs is crucial to understand the inner workings of the cell and the complexity of gene interactions. To date, numerous algorithms have been developed to infer gene regulatory networks. However, as the number of identified genes increases and the complexity of their interactions is uncovered, networks and their regulatory mechanisms become cumbersome to test. Furthermore, prodding through experimental results requires an enormous amount of computation, resulting in slow data processing. Therefore, new approaches are needed to expeditiously analyze copious amounts of experimental data resulting from cellular GRNs. To meet this need, cloud computing is promising as reported in the literature. Here, we propose new MapReduce algorithms for inferring gene regulatory networks on a Hadoop cluster in a cloud environment. These algorithms employ an information-theoretic approach to infer GRNs using time-series microarray data. Experimental results show that our MapReduce program is much faster than an existing tool while achieving slightly better prediction accuracy than the existing tool.

  10. MapReduce Algorithms for Inferring Gene Regulatory Networks from Time-Series Microarray Data Using an Information-Theoretic Approach.

    Science.gov (United States)

    Abduallah, Yasser; Turki, Turki; Byron, Kevin; Du, Zongxuan; Cervantes-Cervantes, Miguel; Wang, Jason T L

    2017-01-01

    Gene regulation is a series of processes that control gene expression and its extent. The connections among genes and their regulatory molecules, usually transcription factors, and a descriptive model of such connections are known as gene regulatory networks (GRNs). Elucidating GRNs is crucial to understand the inner workings of the cell and the complexity of gene interactions. To date, numerous algorithms have been developed to infer gene regulatory networks. However, as the number of identified genes increases and the complexity of their interactions is uncovered, networks and their regulatory mechanisms become cumbersome to test. Furthermore, prodding through experimental results requires an enormous amount of computation, resulting in slow data processing. Therefore, new approaches are needed to expeditiously analyze copious amounts of experimental data resulting from cellular GRNs. To meet this need, cloud computing is promising as reported in the literature. Here, we propose new MapReduce algorithms for inferring gene regulatory networks on a Hadoop cluster in a cloud environment. These algorithms employ an information-theoretic approach to infer GRNs using time-series microarray data. Experimental results show that our MapReduce program is much faster than an existing tool while achieving slightly better prediction accuracy than the existing tool.

  11. Rapid and accurate synthesis of TALE genes from synthetic oligonucleotides.

    Science.gov (United States)

    Wang, Fenghua; Zhang, Hefei; Gao, Jingxia; Chen, Fengjiao; Chen, Sijie; Zhang, Cuizhen; Peng, Gang

    2016-01-01

    Custom synthesis of transcription activator-like effector (TALE) genes has relied upon plasmid libraries of pre-fabricated TALE-repeat monomers or oligomers. Here we describe a novel synthesis method that directly incorporates annealed synthetic oligonucleotides into the TALE-repeat units. Our approach utilizes iterative sets of oligonucleotides and a translational frame check strategy to ensure the high efficiency and accuracy of TALE-gene synthesis. TALE arrays of more than 20 repeats can be constructed, and the majority of the synthesized constructs have perfect sequences. In addition, this novel oligonucleotide-based method can readily accommodate design changes to the TALE repeats. We demonstrated an increased gene targeting efficiency against a genomic site containing a potentially methylated cytosine by incorporating non-conventional repeat variable di-residue (RVD) sequences.

  12. Combining gene expression data from different generations of oligonucleotide arrays

    Directory of Open Access Journals (Sweden)

    Kong Sek

    2004-10-01

    Full Text Available Abstract Background One of the important challenges in microarray analysis is to take full advantage of previously accumulated data, both from one's own laboratory and from public repositories. Through a comparative analysis on a variety of datasets, a more comprehensive view of the underlying mechanism or structure can be obtained. However, as we discover in this work, continual changes in genomic sequence annotations and probe design criteria make it difficult to compare gene expression data even from different generations of the same microarray platform. Results We first describe the extent of discordance between the results derived from two generations of Affymetrix oligonucleotide arrays, as revealed in cluster analysis and in identification of differentially expressed genes. We then propose a method for increasing comparability. The dataset we use consists of a set of 14 human muscle biopsy samples from patients with inflammatory myopathies that were hybridized on both HG-U95Av2 and HG-U133A human arrays. We find that the use of the probe set matching table for comparative analysis provided by Affymetrix produces better results than matching by UniGene or LocusLink identifiers but still remains inadequate. Rescaling of expression values for each gene across samples and data filtering by expression values enhance comparability but only for few specific analyses. As a generic method for improving comparability, we select a subset of probes with overlapping sequence segments in the two array types and recalculate expression values based only on the selected probes. We show that this filtering of probes significantly improves the comparability while retaining a sufficient number of probe sets for further analysis. Conclusions Compatibility between high-density oligonucleotide arrays is significantly affected by probe-level sequence information. With a careful filtering of the probes based on their sequence overlaps, data from different

  13. Chaotic mixer improves microarray hybridization.

    Science.gov (United States)

    McQuain, Mark K; Seale, Kevin; Peek, Joel; Fisher, Timothy S; Levy, Shawn; Stremler, Mark A; Haselton, Frederick R

    2004-02-15

    Hybridization is an important aspect of microarray experimental design which influences array signal levels and the repeatability of data within an array and across different arrays. Current methods typically require 24h and use target inefficiently. In these studies, we compare hybridization signals obtained in conventional static hybridization, which depends on diffusional target delivery, with signals obtained in a dynamic hybridization chamber, which employs a fluid mixer based on chaotic advection theory to deliver targets across a conventional glass slide array. Microarrays were printed with a pattern of 102 identical probe spots containing a 65-mer oligonucleotide capture probe. Hybridization of a 725-bp fluorescently labeled target was used to measure average target hybridization levels, local signal-to-noise ratios, and array hybridization uniformity. Dynamic hybridization for 1h with 1 or 10ng of target DNA increased hybridization signal intensities approximately threefold over a 24-h static hybridization. Similarly, a 10- or 60-min dynamic hybridization of 10ng of target DNA increased hybridization signal intensities fourfold over a 24h static hybridization. In time course studies, static hybridization reached a maximum within 8 to 12h using either 1 or 10ng of target. In time course studies using the dynamic hybridization chamber, hybridization using 1ng of target increased to a maximum at 4h and that using 10ng of target did not vary over the time points tested. In comparison to static hybridization, dynamic hybridization reduced the signal-to-noise ratios threefold and reduced spot-to-spot variation twofold. Therefore, we conclude that dynamic hybridization based on a chaotic mixer design improves both the speed of hybridization and the maximum level of hybridization while increasing signal-to-noise ratios and reducing spot-to-spot variation.

  14. Oligonucleotide Therapy for Obstructive and Restrictive Respiratory Diseases

    Directory of Open Access Journals (Sweden)

    Wupeng Liao

    2017-01-01

    Full Text Available Inhaled oligonucleotide is an emerging therapeutic modality for various common respiratory diseases, including obstructive airway diseases like asthma and chronic obstructive pulmonary disease (COPD and restrictive airway diseases like idiopathic pulmonary fibrosis (IPF. The advantage of direct accessibility for oligonucleotide molecules to the lung target sites, bypassing systemic administration, makes this therapeutic approach promising with minimized potential systemic side effects. Asthma, COPD, and IPF are common chronic respiratory diseases, characterized by persistent airway inflammation and dysregulated tissue repair and remodeling, although each individual disease has its unique etiology. Corticosteroids have been widely prescribed for the treatment of asthma, COPD, and IPF. However, the effectiveness of corticosteroids as an anti-inflammatory drug is limited by steroid resistance in severe asthma, the majority of COPD cases, and pulmonary fibrosis. There is an urgent medical need to develop target-specific drugs for the treatment of these respiratory conditions. Oligonucleotide therapies, including antisense oligonucleotide (ASO, small interfering RNA (siRNA, and microRNA (miRNA are now being evaluated both pre-clinically and clinically as potential therapeutics. The mechanisms of action of ASO and siRNA are highly target mRNA specific, ultimately leading to target protein knockdown. miRNA has both biomarker and therapeutic values, and its knockdown by a miRNA antagonist (antagomir has a broader but potentially more non-specific biological outcome. This review will compile the current findings of oligonucleotide therapeutic targets, verified in various respiratory disease models and in clinical trials, and evaluate different chemical modification approaches to improve the stability and potency of oligonucleotides for the treatment of respiratory diseases.

  15. Oligonucleotide Therapy for Obstructive and Restrictive Respiratory Diseases.

    Science.gov (United States)

    Liao, Wupeng; Dong, Jinrui; Peh, Hong Yong; Tan, Lay Hong; Lim, Kah Suan; Li, Li; Wong, Wai-Shiu Fred

    2017-01-17

    Inhaled oligonucleotide is an emerging therapeutic modality for various common respiratory diseases, including obstructive airway diseases like asthma and chronic obstructive pulmonary disease (COPD) and restrictive airway diseases like idiopathic pulmonary fibrosis (IPF). The advantage of direct accessibility for oligonucleotide molecules to the lung target sites, bypassing systemic administration, makes this therapeutic approach promising with minimized potential systemic side effects. Asthma, COPD, and IPF are common chronic respiratory diseases, characterized by persistent airway inflammation and dysregulated tissue repair and remodeling, although each individual disease has its unique etiology. Corticosteroids have been widely prescribed for the treatment of asthma, COPD, and IPF. However, the effectiveness of corticosteroids as an anti-inflammatory drug is limited by steroid resistance in severe asthma, the majority of COPD cases, and pulmonary fibrosis. There is an urgent medical need to develop target-specific drugs for the treatment of these respiratory conditions. Oligonucleotide therapies, including antisense oligonucleotide (ASO), small interfering RNA (siRNA), and microRNA (miRNA) are now being evaluated both pre-clinically and clinically as potential therapeutics. The mechanisms of action of ASO and siRNA are highly target mRNA specific, ultimately leading to target protein knockdown. miRNA has both biomarker and therapeutic values, and its knockdown by a miRNA antagonist (antagomir) has a broader but potentially more non-specific biological outcome. This review will compile the current findings of oligonucleotide therapeutic targets, verified in various respiratory disease models and in clinical trials, and evaluate different chemical modification approaches to improve the stability and potency of oligonucleotides for the treatment of respiratory diseases.

  16. In control: systematic assessment of microarray performance.

    Science.gov (United States)

    van Bakel, Harm; Holstege, Frank C P

    2004-10-01

    Expression profiling using DNA microarrays is a powerful technique that is widely used in the life sciences. How reliable are microarray-derived measurements? The assessment of performance is challenging because of the complicated nature of microarray experiments and the many different technology platforms. There is a mounting call for standards to be introduced, and this review addresses some of the issues that are involved. Two important characteristics of performance are accuracy and precision. The assessment of these factors can be either for the purpose of technology optimization or for the evaluation of individual microarray hybridizations. Microarray performance has been evaluated by at least four approaches in the past. Here, we argue that external RNA controls offer the most versatile system for determining performance and describe how such standards could be implemented. Other uses of external controls are discussed, along with the importance of probe sequence availability and the quantification of labelled material.

  17. The EADGENE Microarray Data Analysis Workshop

    DEFF Research Database (Denmark)

    de Koning, Dirk-Jan; Jaffrézic, Florence; Lund, Mogens Sandø

    2007-01-01

    Microarray analyses have become an important tool in animal genomics. While their use is becoming widespread, there is still a lot of ongoing research regarding the analysis of microarray data. In the context of a European Network of Excellence, 31 researchers representing 14 research groups from...... 10 countries performed and discussed the statistical analyses of real and simulated 2-colour microarray data that were distributed among participants. The real data consisted of 48 microarrays from a disease challenge experiment in dairy cattle, while the simulated data consisted of 10 microarrays...... statistical weights, to omitting a large number of spots or omitting entire slides. Surprisingly, these very different approaches gave quite similar results when applied to the simulated data, although not all participating groups analysed both real and simulated data. The workshop was very successful...

  18. Introduction to microarray technology.

    Science.gov (United States)

    Dufva, Martin

    2009-01-01

    DNA microarrays can be used for large number of application where high-throughput is needed. The ability to probe a sample for hundred to million different molecules at once has made DNA microarray one of the fastest growing techniques since its introduction about 15 years ago. Microarray technology can be used for large scale genotyping, gene expression profiling, comparative genomic hybridization and resequencing among other applications. Microarray technology is a complex mixture of numerous technology and research fields such as mechanics, microfabrication, chemistry, DNA behaviour, microfluidics, enzymology, optics and bioinformatics. This chapter will give an introduction to each five basic steps in microarray technology that includes fabrication, target preparation, hybridization, detection and data analysis. Basic concepts and nomenclature used in the field of microarray technology and their relationships will also be explained.

  19. Antisense Oligonucleotide Therapy in Diabetic Retinopathy

    Science.gov (United States)

    Hnik, Peter; Boyer, David S.; Grillone, Lisa R.; Clement, John G.; Henry, Scott P.; Green, Ellen A.

    2009-01-01

    Diabetic retinopathy is one of the leading causes of blindness in the United States and other parts of the world. Historically, laser photocoagulation and vitrectomy surgery have been used for the treatment of diabetic retinopathy, including diabetic macular edema. Both procedures have proven to be useful under certain conditions but have their limitations. New pathways and processes that promote diabetic retinopathy have been identified, and several new therapeutic approaches are under investigation. These new therapies may be beneficial in the treatment of diabetic retinopathy and include antivascular endothelial growth factor agents, corticosteroids, and therapies that may potentially target a number of additional diabetic retinopathy-related factors and processes, including antisense oligonucleotides. Second-generation antisense oligonucleotides, such as iCo-007, may offer a significant advantage in the treatment of diabetic retinopathy by downregulating the signal pathways of multiple growth factors that seem to play a critical role in the process of ocular angiogenesis and vascular leakage. Benefits of such molecules are expected to include the specificity of the kinase target and an extended half-life, resulting in less frequent intravitreal drug administration, resistance to molecule degradation, and a good safety profile. PMID:20144342

  20. Unraveling the rat blood genome-wide transcriptome after oral administration of lavender oil by a two-color dye-swap DNA microarray approach

    Directory of Open Access Journals (Sweden)

    Motohide Hori

    2016-06-01

    Full Text Available Lavender oil (LO is a commonly used essential oil in aromatherapy as non-traditional medicine. With an aim to demonstrate LO effects on the body, we have recently established an animal model investigating the influence of orally administered LO in rat tissues, genome-wide. In this brief, we investigate the effect of LO ingestion in the blood of rat. Rats were administered LO at usual therapeutic dose (5 mg/kg in humans, and following collection of the venous blood from the heart and extraction of total RNA, the differentially expressed genes were screened using a 4 × 44-K whole-genome rat chip (Agilent microarray platform; Agilent Technologies, Palo Alto, CA, USA in conjunction with a two-color dye-swap approach. A total of 834 differentially expressed genes in the blood were identified: 362 up-regulated and 472 down-regulated. These genes were functionally categorized using bioinformatics tools. The gene expression inventory of rat blood transcriptome under LO, a first report, has been deposited into the Gene Expression Omnibus (GEO: GSE67499. The data will be a valuable resource in examining the effects of natural products, and which could also serve as a human model for further functional analysis and investigation.

  1. A Double-Hybridization Approach for the Transcription- and Amplification-Free Detection of Specific mRNA on a Microarray

    Directory of Open Access Journals (Sweden)

    Michaela Haider

    2016-02-01

    Full Text Available A double-hybridization approach was developed for the enzyme-free detection of specific mRNA of a housekeeping gene. Targeted mRNA was immobilized by hybridization to complementary DNA capture probes spotted onto a microarray. A second hybridization step of Cy5-conjugated label DNA to another section of the mRNA enabled specific labeling of the target. Thus, enzymatic artifacts could be avoided by omitting transcription and amplification steps. This manuscript describes the development of capture probe molecules used in the transcription- and amplification-free analysis of RPLP0 mRNA in isolated total RNA. An increase in specific signal was found with increasing length of the target-specific section of capture probes. Unspecific signal comprising spot autofluorescence and unspecific label binding did not correlate with the capture length. An additional spacer between the specific part of the capture probe and the substrate attachment site increased the signal significantly only on a short capture probe of approximately 30 nt length.

  2. A novel approach combining the Calgary Biofilm Device and Phenotype MicroArray for the characterization of the chemical sensitivity of bacterial biofilms.

    Science.gov (United States)

    Santopolo, L; Marchi, E; Frediani, L; Decorosi, F; Viti, C; Giovannetti, L

    2012-01-01

    A rapid method for screening the metabolic susceptibility of biofilms to toxic compounds was developed by combining the Calgary Biofilm Device (MBEC device) and Phenotype MicroArray (PM) technology. The method was developed using Pseudomonas alcaliphila 34, a Cr(VI)-hyper-resistant bacterium, as the test organism. P. alcaliphila produced a robust biofilm after incubation for 16 h, reaching the maximum value after incubation for 24 h (9.4 × 10(6) ± 3.3 × 10(6) CFU peg(-1)). In order to detect the metabolic activity of cells in the biofilm, dye E (5×) and menadione sodium bisulphate (100 μM) were selected for redox detection chemistry, because they produced a high colorimetric yield in response to bacterial metabolism (340.4 ± 6.9 Omnilog Arbitrary Units). This combined approach, which avoids the limitations of traditional plate counts, was validated by testing the susceptibility of P. alcaliphila biofilm to 22 toxic compounds. For each compound the concentration level that significantly lowered the metabolic activity of the biofilm was identified. Chemical sensitivity analysis of the planktonic culture was also performed, allowing comparison of the metabolic susceptibility patterns of biofilm and planktonic cultures.

  3. Multiple platform assessment of the EGF dependent transcriptome by microarray and deep tag sequencing analysis

    Directory of Open Access Journals (Sweden)

    Iraola Susana

    2011-06-01

    Full Text Available Abstract Background Epidermal Growth Factor (EGF is a key regulatory growth factor activating many processes relevant to normal development and disease, affecting cell proliferation and survival. Here we use a combined approach to study the EGF dependent transcriptome of HeLa cells by using multiple long oligonucleotide based microarray platforms (from Agilent, Operon, and Illumina in combination with digital gene expression profiling (DGE with the Illumina Genome Analyzer. Results By applying a procedure for cross-platform data meta-analysis based on RankProd and GlobalAncova tests, we establish a well validated gene set with transcript levels altered after EGF treatment. We use this robust gene list to build higher order networks of gene interaction by interconnecting associated networks, supporting and extending the important role of the EGF signaling pathway in cancer. In addition, we find an entirely new set of genes previously unrelated to the currently accepted EGF associated cellular functions. Conclusions We propose that the use of global genomic cross-validation derived from high content technologies (microarrays or deep sequencing can be used to generate more reliable datasets. This approach should help to improve the confidence of downstream in silico functional inference analyses based on high content data.

  4. DNA Microarray Technique

    Directory of Open Access Journals (Sweden)

    Thakare SP

    2012-11-01

    Full Text Available DNA Microarray is the emerging technique in Biotechnology. The many varieties of DNA microarray or DNA chip devices and systems are described along with their methods for fabrication and their use. It also includes screening and diagnostic applications. The DNA microarray hybridization applications include the important areas of gene expression analysis and genotyping for point mutations, single nucleotide polymorphisms (SNPs, and short tandem repeats (STRs. In addition to the many molecular biological and genomic research uses, this review covers applications of microarray devices and systems for pharmacogenomic research and drug discovery, infectious and genetic disease and cancer diagnostics, and forensic and genetic identification purposes.

  5. 同时检测猪圆环病毒2型、猪细小病毒和伪狂犬病毒连接酶检测反应-PCR基因芯片检测方法的建立%A universal oligonucleotide microarray based on ligase detection reaction (LDR)-PCR for parallel detection of porcine circovirus type 2,porcine parvovirus and pseudorabies virus

    Institute of Scientific and Technical Information of China (English)

    郭瑶; 汪平; 董沁芳; 程菊会; 徐辉; 丁先锋; 郭江峰; 姜永厚

    2011-01-01

    为快速、灵敏、准确地同时检测和鉴别猪圆环病毒2型(PCV2)、猪细小病毒(PPV)和伪狂犬病毒(PRV)的方法,本研究采用连接酶检测反应(LDR)-PCR和基因芯片技术建立一种新型检测方法.首先在3种病毒的保守区内分别设计一对LDR探针,两端各连接一段通用序列,依次进行LDR、通用引物荧光标记扩增和芯片杂交,同时比较引物标记和Cy5 -dCTP标记方法的灵敏度.结果表明该方法可以特异地检测PCV2、PPV和PRV3种病毒,而对牛病毒性腹泻病毒、猪传染性胃肠炎病毒、猪流行性腹泻病毒、猪繁殖与呼吸障碍综合征病毒、猪瘟病毒、乙型脑炎病毒、猪圆环病毒1型检测结果均为阴性;对3种病毒的最低检测限少于10个拷贝;Cy5-dCTP标记检测的灵敏度显著高于引物标记.利用建立的方法对41例临床样品进行检测,与普通PCR检测结果符合率为97.6%~100%.该方法的建立为基础研究和临床应用提供了技术平台.%To establish a sensitive detection method for porcine circovims type 2 (PCV2), porcine parvovirus (PPV) and pseudorabies virus (PRV) which cause swine severe reproductive and/or respiratory failure, a novel diagnostic oligonucleotide microarray based on ligase detection reaction PCR (LDR-PCR) was developed in this study. According to alignment of the viral sequences, LDR probes for each virus were designed, which were flanked by universal sequences on both sides of the probes. Through asymmetric PCR enrichment of the ligation products by universal primers, labeling and microarray hybridization, the target viruses were detected and differentiated. Compared to the labeling method with Cy5-primer, Cy5-dCTP labeling was more sensitive in this assay. The specific test result showed that the assay had no cross reaction with bovine viral diarrhea (BVDV), transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), porcine reproductive and respiratory

  6. Prognostic meta-signature of breast cancer developed by two-stage mixture modeling of microarray data

    Directory of Open Access Journals (Sweden)

    Ghosh Debashis

    2004-12-01

    Full Text Available Abstract Background An increasing number of studies have profiled tumor specimens using distinct microarray platforms and analysis techniques. With the accumulating amount of microarray data, one of the most intriguing yet challenging tasks is to develop robust statistical models to integrate the findings. Results By applying a two-stage Bayesian mixture modeling strategy, we were able to assimilate and analyze four independent microarray studies to derive an inter-study validated "meta-signature" associated with breast cancer prognosis. Combining multiple studies (n = 305 samples on a common probability scale, we developed a 90-gene meta-signature, which strongly associated with survival in breast cancer patients. Given the set of independent studies using different microarray platforms which included spotted cDNAs, Affymetrix GeneChip, and inkjet oligonucleotides, the individually identified classifiers yielded gene sets predictive of survival in each study cohort. The study-specific gene signatures, however, had minimal overlap with each other, and performed poorly in pairwise cross-validation. The meta-signature, on the other hand, accommodated such heterogeneity and achieved comparable or better prognostic performance when compared with the individual signatures. Further by comparing to a global standardization method, the mixture model based data transformation demonstrated superior properties for data integration and provided solid basis for building classifiers at the second stage. Functional annotation revealed that genes involved in cell cycle and signal transduction activities were over-represented in the meta-signature. Conclusion The mixture modeling approach unifies disparate gene expression data on a common probability scale allowing for robust, inter-study validated prognostic signatures to be obtained. With the emerging utility of microarrays for cancer prognosis, it will be important to establish paradigms to meta

  7. Comparison of three microarray probe annotation pipelines: differences in strategies and their effect on downstream analysis

    NARCIS (Netherlands)

    Neerincx, P.B.T.; Casel, P.; Prickett, D.; Nie, H.; Watson, M.; Leunissen, J.A.M.; Groenen, M.A.M.; Klopp, C.

    2009-01-01

    Background - Reliable annotation linking oligonucleotide probes to target genes is essential for functional biological analysis of microarray experiments. We used the IMAD, OligoRAP and sigReannot pipelines to update the annotation for the ARK-Genomics Chicken 20 K array as part of a joined EADGENE/

  8. Position dependent mismatch discrimination on DNA microarrays – experiments and model

    Directory of Open Access Journals (Sweden)

    Michel Wolfgang

    2008-12-01

    Full Text Available Abstract Background The propensity of oligonucleotide strands to form stable duplexes with complementary sequences is fundamental to a variety of biological and biotechnological processes as various as microRNA signalling, microarray hybridization and PCR. Yet our understanding of oligonucleotide hybridization, in particular in presence of surfaces, is rather limited. Here we use oligonucleotide microarrays made in-house by optically controlled DNA synthesis to produce probe sets comprising all possible single base mismatches and base bulges for each of 20 sequence motifs under study. Results We observe that mismatch discrimination is mostly determined by the defect position (relative to the duplex ends as well as by the sequence context. We investigate the thermodynamics of the oligonucleotide duplexes on the basis of double-ended molecular zipper. Theoretical predictions of defect positional influence as well as long range sequence influence agree well with the experimental results. Conclusion Molecular zipping at thermodynamic equilibrium explains the binding affinity of mismatched DNA duplexes on microarrays well. The position dependent nearest neighbor model (PDNN can be inferred from it. Quantitative understanding of microarray experiments from first principles is in reach.

  9. Comparison of three microarray probe annotation pipelines: differences in strategies and their effect on downstream analysis

    NARCIS (Netherlands)

    Neerincx, P.B.T.; Casel, P.; Prickett, D.; Nie, H.; Watson, M.; Leunissen, J.A.M.; Groenen, M.A.M.; Klopp, C.

    2009-01-01

    Background - Reliable annotation linking oligonucleotide probes to target genes is essential for functional biological analysis of microarray experiments. We used the IMAD, OligoRAP and sigReannot pipelines to update the annotation for the ARK-Genomics Chicken 20 K array as part of a joined EADGENE/

  10. Genomic DNA enrichment using sequence capture microarrays: a novel approach to discover sequence nucleotide polymorphisms (SNP in Brassica napus L.

    Directory of Open Access Journals (Sweden)

    Wayne E Clarke

    Full Text Available Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38. The main goal of this project was to combine sequence capture with next generation sequencing (NGS to discover single nucleotide polymorphisms (SNPs in specific areas of the B. napus genome historically associated (via quantitative trait loci -QTL- analysis to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively. Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species.

  11. Refinement of light-responsive transcript lists using rice oligonucleotide arrays: evaluation of gene-redundancy.

    Directory of Open Access Journals (Sweden)

    Ki-Hong Jung

    Full Text Available Studies of gene function are often hampered by gene-redundancy, especially in organisms with large genomes such as rice (Oryza sativa. We present an approach for using transcriptomics data to focus functional studies and address redundancy. To this end, we have constructed and validated an inexpensive and publicly available rice oligonucleotide near-whole genome array, called the rice NSF45K array. We generated expression profiles for light- vs. dark-grown rice leaf tissue and validated the biological significance of the data by analyzing sources of variation and confirming expression trends with reverse transcription polymerase chain reaction. We examined trends in the data by evaluating enrichment of gene ontology terms at multiple false discovery rate thresholds. To compare data generated with the NSF45K array with published results, we developed publicly available, web-based tools (www.ricearray.org. The Oligo and EST Anatomy Viewer enables visualization of EST-based expression profiling data for all genes on the array. The Rice Multi-platform Microarray Search Tool facilitates comparison of gene expression profiles across multiple rice microarray platforms. Finally, we incorporated gene expression and biochemical pathway data to reduce the number of candidate gene products putatively participating in the eight steps of the photorespiration pathway from 52 to 10, based on expression levels of putatively functionally redundant genes. We confirmed the efficacy of this method to cope with redundancy by correctly predicting participation in photorespiration of a gene with five paralogs. Applying these methods will accelerate rice functional genomics.

  12. Microarray-based method for detecting methylation changes of p16Ink4a gene 5'-CpG islands in gastric carcinomas

    Institute of Scientific and Technical Information of China (English)

    Peng Hou; Jia-Yao Shen; Mei-Ju Ji; Nong-Yue He; Zu-Hong Lu

    2004-01-01

    AIM: Aberrant DNA methylation of CpG site is among the earliest and most frequent alterations in cancer. Several studies suggest that aberrant methylation of the CpG sites of the tumor suppressor gene is closely associated with carcinogenesis. However, large-scale analysis of candidate genes has so far been hampered by the lack of highthroughput approach for analyzing DNA methylation. The aim of this study was to describe a microarray-based method for detecting changes of DNA methylation in cancer.METHODS: This method used bisulfite-modified DNA as a template for PCR amplification, resulting in conversion of unmethylated cytosine, but not methylated cytosine, into thymine within CpG islands of interest. Therefore, the amplified product might contain a pool of DNA fragments with altered nucleotide sequences due to differential methylation status.Nine sets of oligonucleotide probes were designed to fabricate a DNA microarray to detect the methylation changes of p16 gene CpG islands in gastric carcinomas. The results were further validated by methylation-specific PCR (MSP).RESULTS: The experimental results showed that the microarray assay could successfully detect methylation changes of p16 gene in 18 gastric tumor samples. Moreover,it could also potentially increase the frequency of detecting p16 methylation from tumor samples than MSP.CONCLUSION: Microarray assay could be applied as a useful tool for mapping methylation changes in multiple CpG loci and for generating epigenetic profiles in cancer.

  13. A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina

    Directory of Open Access Journals (Sweden)

    Bidard Frédérique

    2010-06-01

    Full Text Available Abstract Background The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. Findings We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS, we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. Conclusions A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis.

  14. Microarray Technology for the Diagnosis of Fetal Chromosomal Aberrations: Which Platform Should We Use?

    Directory of Open Access Journals (Sweden)

    Evangelia Karampetsou

    2014-06-01

    Full Text Available The advantage of microarray (array over conventional karyotype for the diagnosis of fetal pathogenic chromosomal anomalies has prompted the use of microarrays in prenatal diagnostics. In this review we compare the performance of different array platforms (BAC, oligonucleotide CGH, SNP and designs (targeted, whole genome, whole genome, and targeted, custom and discuss their advantages and disadvantages in relation to prenatal testing. We also discuss the factors to consider when implementing a microarray testing service for the diagnosis of fetal chromosomal aberrations.

  15. Diffusion of Oligonucleotides from within Iron-Crosslinked Polyelectrolyte-Modified Alginate Beads: A Model System for Drug Release

    CERN Document Server

    Privman, Vladimir; Luz, Roberto A S; Guz, Nataliia; Glasser, M Lawrence; Katz, Evgeny

    2016-01-01

    We developed and experimentally verified an analytical model to describe diffusion of oligonucleotides from stable hydrogel beads. The synthesized alginate beads are Fe3+-cross-linked as well as polyelectrolyte-doped for uniformity and stability at physiological pH. Data on diffusion of oligonucleotides from inside the beads provide physical insights into the volume nature of the immobilization of a fraction of oligonucleotides due to polyelectrolyte cross-linking, i.e., the absence of the surface-layer barrier in this case. Furthermore, our results suggest a new simple approach to measuring the diffusion coefficient of the mobile oligonucleotide molecules inside hydrogel. The considered alginate beads provide a model for a well-defined component in drug release systems and for the oligonucleotide-release transduction steps in drug-delivering and biocomputing applications. This is illustrated by destabilizing the beads with citrate that induces full oligonucleotide release with non-diffusional kinetics.

  16. A simple and rapid method for the preparation of homologous DNA oligonucleotide hybridization probes from heterologous gene sequences and probes.

    Science.gov (United States)

    Maxwell, E S; Sarge, K D

    1988-11-30

    We describe a simple and rapid method for the preparation of homologous DNA oligonucleotide probes for hybridization analysis and/or cDNA/genomic library screening. With this method, a synthetic DNA oligonucleotide derived from a known heterologous DNA/RNA/protein sequence is annealed to an RNA preparation containing the gene transcript of interest. Any unpaired 3'-terminal oligonucleotides of the heterologous DNA primer are then removed using the 3' exonuclease activity of the DNA Polymerase I Klenow fragment before primer extension/dideoxynucleotide sequencing of the annealed RNA species with AMV reverse transcriptase. From the determined RNA sequence, a completely homologous DNA oligonucleotide probe is then prepared. This approach has been used to prepare a homologous DNA oligonucleotide probe for the successful library screening of the yeast hybRNA gene starting with a heterologous mouse hybRNA DNA oligonucleotide probe.

  17. MARS: Microarray analysis, retrieval, and storage system

    Directory of Open Access Journals (Sweden)

    Scheideler Marcel

    2005-04-01

    Full Text Available Abstract Background Microarray analysis has become a widely used technique for the study of gene-expression patterns on a genomic scale. As more and more laboratories are adopting microarray technology, there is a need for powerful and easy to use microarray databases facilitating array fabrication, labeling, hybridization, and data analysis. The wealth of data generated by this high throughput approach renders adequate database and analysis tools crucial for the pursuit of insights into the transcriptomic behavior of cells. Results MARS (Microarray Analysis and Retrieval System provides a comprehensive MIAME supportive suite for storing, retrieving, and analyzing multi color microarray data. The system comprises a laboratory information management system (LIMS, a quality control management, as well as a sophisticated user management system. MARS is fully integrated into an analytical pipeline of microarray image analysis, normalization, gene expression clustering, and mapping of gene expression data onto biological pathways. The incorporation of ontologies and the use of MAGE-ML enables an export of studies stored in MARS to public repositories and other databases accepting these documents. Conclusion We have developed an integrated system tailored to serve the specific needs of microarray based research projects using a unique fusion of Web based and standalone applications connected to the latest J2EE application server technology. The presented system is freely available for academic and non-profit institutions. More information can be found at http://genome.tugraz.at.

  18. Profiling cellular protein complexes by proximity ligation with dual tag microarray readout.

    Directory of Open Access Journals (Sweden)

    Maria Hammond

    Full Text Available Patterns of protein interactions provide important insights in basic biology, and their analysis plays an increasing role in drug development and diagnostics of disease. We have established a scalable technique to compare two biological samples for the levels of all pairwise interactions among a set of targeted protein molecules. The technique is a combination of the proximity ligation assay with readout via dual tag microarrays. In the proximity ligation assay protein identities are encoded as DNA sequences by attaching DNA oligonucleotides to antibodies directed against the proteins of interest. Upon binding by pairs of antibodies to proteins present in the same molecular complexes, ligation reactions give rise to reporter DNA molecules that contain the combined sequence information from the two DNA strands. The ligation reactions also serve to incorporate a sample barcode in the reporter molecules to allow for direct comparison between pairs of samples. The samples are evaluated using a dual tag microarray where information is decoded, revealing which pairs of tags that have become joined. As a proof-of-concept we demonstrate that this approach can be used to detect a set of five proteins and their pairwise interactions both in cellular lysates and in fixed tissue culture cells. This paper provides a general strategy to analyze the extent of any pairwise interactions in large sets of molecules by decoding reporter DNA strands that identify the interacting molecules.

  19. Microarray Analysis in Glioblastomas

    Science.gov (United States)

    Bhawe, Kaumudi M.; Aghi, Manish K.

    2016-01-01

    Microarray analysis in glioblastomas is done using either cell lines or patient samples as starting material. A survey of the current literature points to transcript-based microarrays and immunohistochemistry (IHC)-based tissue microarrays as being the preferred methods of choice in cancers of neurological origin. Microarray analysis may be carried out for various purposes including the following: To correlate gene expression signatures of glioblastoma cell lines or tumors with response to chemotherapy (DeLay et al., Clin Cancer Res 18(10):2930–2942, 2012)To correlate gene expression patterns with biological features like proliferation or invasiveness of the glioblastoma cells (Jiang et al., PLoS One 8(6):e66008, 2013)To discover new tumor classificatory systems based on gene expression signature, and to correlate therapeutic response and prognosis with these signatures (Huse et al., Annu Rev Med 64(1):59–70, 2013; Verhaak et al., Cancer Cell 17(1):98–110, 2010) While investigators can sometimes use archived tumor gene expression data available from repositories such as the NCBI Gene Expression Omnibus to answer their questions, new arrays must often be run to adequately answer specific questions. Here, we provide a detailed description of microarray methodologies, how to select the appropriate methodology for a given question, and analytical strategies that can be used. Experimental methodology for protein microarrays is outside the scope of this chapter, but basic sample preparation techniques for transcript-based microarrays are included here. PMID:26113463

  20. Three microarray platforms: an analysis of their concordance in profiling gene expression

    Directory of Open Access Journals (Sweden)

    Petersen David

    2005-05-01

    Full Text Available Abstract Background Microarrays for the analysis of gene expression are of three different types: short oligonucleotide (25–30 base, long oligonucleotide (50–80 base, and cDNA (highly variable in length. The short oligonucleotide and cDNA arrays have been the mainstay of expression analysis to date, but long oligonucleotide platforms are gaining in popularity and will probably replace cDNA arrays. As part of a validation study for the long oligonucleotide arrays, we compared and contrasted expression profiles from the three formats, testing RNA from six different cell lines against a universal reference standard. Results The three platforms had 6430 genes in common. In general, correlation of gene expression levels across the platforms was good when defined by concordance in the direction of expression difference (upregulation or downregulation, scatter plot analysis, principal component analysis, cell line correlation or quantitative RT-PCR. The overall correlations (r values between platforms were in the range 0.7 to 0.8, as determined by analysis of scatter plots. When concordance was measured for expression ratios significant at p-values of Conclusion Our results indicate that the long oligonucleotide platform is highly suitable for expression analysis and compares favorably with the cDNA and short oligonucleotide varieties. All three platforms can give similar and reproducible results if the criterion is the direction of change in gene expression and minimal emphasis is placed on the magnitude of change.

  1. Plant-pathogen interactions: what microarray tells about it?

    Science.gov (United States)

    Lodha, T D; Basak, J

    2012-01-01

    Plant defense responses are mediated by elementary regulatory proteins that affect expression of thousands of genes. Over the last decade, microarray technology has played a key role in deciphering the underlying networks of gene regulation in plants that lead to a wide variety of defence responses. Microarray is an important tool to quantify and profile the expression of thousands of genes simultaneously, with two main aims: (1) gene discovery and (2) global expression profiling. Several microarray technologies are currently in use; most include a glass slide platform with spotted cDNA or oligonucleotides. Till date, microarray technology has been used in the identification of regulatory genes, end-point defence genes, to understand the signal transduction processes underlying disease resistance and its intimate links to other physiological pathways. Microarray technology can be used for in-depth, simultaneous profiling of host/pathogen genes as the disease progresses from infection to resistance/susceptibility at different developmental stages of the host, which can be done in different environments, for clearer understanding of the processes involved. A thorough knowledge of plant disease resistance using successful combination of microarray and other high throughput techniques, as well as biochemical, genetic, and cell biological experiments is needed for practical application to secure and stabilize yield of many crop plants. This review starts with a brief introduction to microarray technology, followed by the basics of plant-pathogen interaction, the use of DNA microarrays over the last decade to unravel the mysteries of plant-pathogen interaction, and ends with the future prospects of this technology.

  2. Synthesis, Dynamic Combinatorial Chemistry, and PCR Amplification of 3'-5' and 3'-6' Disulfide-linked Oligonucleotides

    DEFF Research Database (Denmark)

    Hansen, Dennis Jul; Manuguerra, Ilenia; Kjelstrup, Michael Brøndum;

    2014-01-01

    Disulfide dithymidines linked 3'-5' or 3'-6' were synthesized and incorporated into oligonucleotides through a combined phosphotriester and phosphoramidite solid-phase oligonucleotide synthesis approach. The disulfide links are cleaved and formed reversibly in the presence of thiols and oligonucl...

  3. Glycoclusters on oligonucleotide and PNA scaffolds: synthesis and applications.

    Science.gov (United States)

    Spinelli, Nicolas; Defrancq, Eric; Morvan, François

    2013-06-07

    Conjugation of oligonucleotides (ONs) to a variety of reporter groups has been the subject of intensive research during the last decade. Conjugation is indeed of great interest because it can be used not only to improve the existing ONs properties but also to impart new ones. In this context tremendous efforts have been made to conjugate carbohydrate moieties to ONs. Indeed carbohydrates play an important role in biological processes such as signal transduction and cell adhesion through the recognition with sugar-binding proteins (i.e. lectins) located on the surface of cells. For this reason, carbohydrate-oligonucleotide conjugates (COCs) have been first developed for improving the poor cellular uptake or tissue specific delivery of ONs through receptor-mediated endocytosis. Besides the targeted ONs delivery, carbohydrate-oligonucleotide conjugates (COCs) are also evaluated in the context of carbohydrate biochips in which surface coating with carbohydrates is achieved by using the DNA-directed immobilization strategy (DDI). Peptide nucleic acids (PNAs) have also been extensively investigated as a surrogate of DNA for diverse applications. Therefore attachment of carbohydrate moieties to this class of molecules has been studied. The aforementioned applications of COCs require mimicking of the natural processes, in which the weak individual protein-carbohydrate binding is overcome by using multivalent interactions. This tutorial review focuses on the recent advances in carbohydrate-oligonucleotide conjugates and describes the major synthetic approaches available. In addition, an overview of applications that have been developed using various scaffolds allowing multivalent interactions is provided. Finally recent results on the use of peptide nucleic acids as oligonucleotides surrogate are described.

  4. Thermolytic 4-methylthio-1-butyl group for phosphate/thiophosphate protection in solid-phase synthesis of DNA oligonucleotides.

    Science.gov (United States)

    Cieślak, Jacek; Grajkowski, Andrzej; Livengood, Victor; Beaucage, Serge L

    2004-04-02

    The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a-d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 degrees C in an aqueous buffer under neutral conditions or within 2 h at 55 degrees C in concentrated NH(4)OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating those of large-scale (>50 mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.

  5. Palladium-Catalyzed Modification of Unprotected Nucleosides, Nucleotides, and Oligonucleotides

    Directory of Open Access Journals (Sweden)

    Kevin H. Shaughnessy

    2015-05-01

    Full Text Available Synthetic modification of nucleoside structures provides access to molecules of interest as pharmaceuticals, biochemical probes, and models to study diseases. Covalent modification of the purine and pyrimidine bases is an important strategy for the synthesis of these adducts. Palladium-catalyzed cross-coupling is a powerful method to attach groups to the base heterocycles through the formation of new carbon-carbon and carbon-heteroatom bonds. In this review, approaches to palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides are reviewed. Polar reaction media, such as water or polar aprotic solvents, allow reactions to be performed directly on the hydrophilic nucleosides and nucleotides without the need to use protecting groups. Homogeneous aqueous-phase coupling reactions catalyzed by palladium complexes of water-soluble ligands provide a general approach to the synthesis of modified nucleosides, nucleotides, and oligonucleotides.

  6. Microarray on digital versatile disc for identification and genotyping of Salmonella and Campylobacter in meat products.

    Science.gov (United States)

    Tortajada-Genaro, Luis Antonio; Rodrigo, Alejandro; Hevia, Elizabeth; Mena, Salvador; Niñoles, Regina; Maquieira, Ángel

    2015-09-01

    Highly portable, cost-effective, and rapid-response devices are required for the subtyping of the most frequent food-borne bacteria; thereby the sample rejection strategies and hygienization techniques along the food chain can be tailor-designed. Here, a novel biosensor is presented for the generic detection of Salmonella and Campylobacter and the discrimination between their most prevalent serovars (Salmonella Enteritidis, Salmonella Typhimurium) and species (Campylobacter jejuni, Campylobacter coli), respectively. The method is based on DNA microarray developed on a standard digital versatile disc (DVD) as support for a hybridization assay and a DVD driver as scanner. This approach was found to be highly sensitive (detection limit down to 0.2 pg of genomic DNA), reproducible (relative standard deviation 4-19 %), and high working capacity (20 samples per disc). The inclusivity and exclusivity assays indicated that designed oligonucleotides (primers and probes) were able to discriminate targeted pathogens from other Salmonella serovars, Campylobacter species, or common food-borne pathogens potentially present in the indigenous microflora. One hundred isolates from meat samples, collected in a poultry factory, were analyzed by the DVD microarraying and fluorescent real-time PCR. An excellent correlation was observed for both generic and specific detection (relative sensitivity 93-99 % and relative specificity 93-100 %). Therefore, the developed assay has been shown to be a reliable tool to be used in routine food safety analysis, especially in settings with limited infrastructure due to the excellent efficiency-cost ratio of compact disc technology. Graphical Abstract DNA microarray performed by DVD technology for pathogen genotyping.

  7. Microarray MAPH: accurate array-based detection of relative copy number in genomic DNA

    Directory of Open Access Journals (Sweden)

    Chan Alan

    2006-06-01

    Full Text Available Abstract Background Current methods for measurement of copy number do not combine all the desirable qualities of convenience, throughput, economy, accuracy and resolution. In this study, to improve the throughput associated with Multiplex Amplifiable Probe Hybridisation (MAPH we aimed to develop a modification based on the 3-Dimensional, Flow-Through Microarray Platform from PamGene International. In this new method, electrophoretic analysis of amplified products is replaced with photometric analysis of a probed oligonucleotide array. Copy number analysis of hybridised probes is based on a dual-label approach by comparing the intensity of Cy3-labelled MAPH probes amplified from test samples co-hybridised with similarly amplified Cy5-labelled reference MAPH probes. The key feature of using a hybridisation-based end point with MAPH is that discrimination of amplified probes is based on sequence and not fragment length. Results In this study we showed that microarray MAPH measurement of PMP22 gene dosage correlates well with PMP22 gene dosage determined by capillary MAPH and that copy number was accurately reported in analyses of DNA from 38 individuals, 12 of which were known to have Charcot-Marie-Tooth disease type 1A (CMT1A. Conclusion Measurement of microarray-based endpoints for MAPH appears to be of comparable accuracy to electrophoretic methods, and holds the prospect of fully exploiting the potential multiplicity of MAPH. The technology has the potential to simplify copy number assays for genes with a large number of exons, or of expanded sets of probes from dispersed genomic locations.

  8. Reversing Antisense Oligonucleotide Activity with a Sense Oligonucleotide Antidote: Proof of Concept Targeting Prothrombin.

    Science.gov (United States)

    Crosby, Jeff R; Zhao, Chenguang; Zhang, Hong; MacLeod, A Robert; Guo, Shuling; Monia, Brett P

    2015-12-01

    The tissue half-life of second-generation antisense oligonucleotide drugs (ASOs) is generally longer than traditional small molecule therapeutics. Thus, a strategy to reverse the activity of antisense drugs is warranted in certain settings. In this study, we describe a strategy employing the administration of a complementary sense oligonucleotide antidote (SOA). As a model system we have chosen to target the coagulation factor and antithrombotic drug target, prothrombin, to assess the feasibility of this approach. ASO targeting mouse prothrombin specifically suppressed >90% hepatic prothrombin mRNA levels and circulating prothrombin protein in mice. These effects were dose- and time-dependent, and as expected produced predictable increases in anticoagulation activity [prothrombin time/activated partial thromboplastin time (PT/aPTT)]. Treatment with prothrombin SOAs resulted in a dose-dependent reversal of ASO activity, as measured by a return in prothrombin mRNA levels and thrombin activity, and normalization of aPTT and PT. The antithrombotic activity of prothrombin ASOs was demonstrated in a FeCl3-induced thrombosis mouse model, and as predicted for this target, the doses required for antithrombotic activity were also associated with increased bleeding. Treatment with SOA was able to prevent prothrombin ASO-induced bleeding in a dose-dependent manner. These studies demonstrate for the first time the utility of SOAs to selectively and specifically reverse the intracellular effects of an antisense therapy.

  9. A comparative analysis of existing oligonucleotides selection ...

    African Journals Online (AJOL)

    SERVER

    2007-07-04

    Jul 4, 2007 ... In system biology, DNA microarray technology is an indispensable tool for the ... the microarray probes are of critical importance for the hybridization experiments as ... at unraveling molecular systems (the function of the gen-.

  10. Adaptive resolution simulation of oligonucleotides

    Science.gov (United States)

    Netz, Paulo A.; Potestio, Raffaello; Kremer, Kurt

    2016-12-01

    Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

  11. D-MaPs - DNA-microarray projects: web-based software for multi-platform microarray analysis

    Directory of Open Access Journals (Sweden)

    Marcelo F. Carazzolle

    2009-01-01

    Full Text Available The web application D-Maps provides a user-friendly interface to researchers performing studies based on microarrays. The program was developed to manage and process one- or two-color microarray data obtained from several platforms (currently, GeneTAC, ScanArray, CodeLink, NimbleGen and Affymetrix. Despite the availability of many algorithms and many software programs designed to perform microarray analysis on the internet, these usually require sophisticated knowledge of mathematics, statistics and computation. D-maps was developed to overcome the requirement of high performance computers or programming experience. D-Maps performs raw data processing, normalization and statistical analysis, allowing access to the analyzed data in text or graphical format. An original feature presented by D-Maps is GEO (Gene Expression Omnibus submission format service. The D-MaPs application was already used for analysis of oligonucleotide microarrays and PCR-spotted arrays (one- and two-color, laser and light scanner. In conclusion, D-Maps is a valuable tool for microarray research community, especially in the case of groups without a bioinformatic core.

  12. The Impact of Photobleaching on Microarray Analysis

    Directory of Open Access Journals (Sweden)

    Marcel von der Haar

    2015-09-01

    Full Text Available DNA-Microarrays have become a potent technology for high-throughput analysis of genetic regulation. However, the wide dynamic range of signal intensities of fluorophore-based microarrays exceeds the dynamic range of a single array scan by far, thus limiting the key benefit of microarray technology: parallelization. The implementation of multi-scan techniques represents a promising approach to overcome these limitations. These techniques are, in turn, limited by the fluorophores’ susceptibility to photobleaching when exposed to the scanner’s laser light. In this paper the photobleaching characteristics of cyanine-3 and cyanine-5 as part of solid state DNA microarrays are studied. The effects of initial fluorophore intensity as well as laser scanner dependent variables such as the photomultiplier tube’s voltage on bleaching and imaging are investigated. The resulting data is used to develop a model capable of simulating the expected degree of signal intensity reduction caused by photobleaching for each fluorophore individually, allowing for the removal of photobleaching-induced, systematic bias in multi-scan procedures. Single-scan applications also benefit as they rely on pre-scans to determine the optimal scanner settings. These findings constitute a step towards standardization of microarray experiments and analysis and may help to increase the lab-to-lab comparability of microarray experiment results.

  13. CGHScan: finding variable regions using high-density microarray comparative genomic hybridization data

    Directory of Open Access Journals (Sweden)

    Rajashekara Gireesh

    2006-04-01

    Full Text Available Abstract Background Comparative genomic hybridization can rapidly identify chromosomal regions that vary between organisms and tissues. This technique has been applied to detecting differences between normal and cancerous tissues in eukaryotes as well as genomic variability in microbial strains and species. The density of oligonucleotide probes available on current microarray platforms is particularly well-suited for comparisons of organisms with smaller genomes like bacteria and yeast where an entire genome can be assayed on a single microarray with high resolution. Available methods for analyzing these experiments typically confine analyses to data from pre-defined annotated genome features, such as entire genes. Many of these methods are ill suited for datasets with the number of measurements typical of high-density microarrays. Results We present an algorithm for analyzing microarray hybridization data to aid identification of regions that vary between an unsequenced genome and a sequenced reference genome. The program, CGHScan, uses an iterative random walk approach integrating multi-layered significance testing to detect these regions from comparative genomic hybridization data. The algorithm tolerates a high level of noise in measurements of individual probe intensities and is relatively insensitive to the choice of method for normalizing probe intensity values and identifying probes that differ between samples. When applied to comparative genomic hybridization data from a published experiment, CGHScan identified eight of nine known deletions in a Brucella ovis strain as compared to Brucella melitensis. The same result was obtained using two different normalization methods and two different scores to classify data for individual probes as representing conserved or variable genomic regions. The undetected region is a small (58 base pair deletion that is below the resolution of CGHScan given the array design employed in the study

  14. Microarray analysis of the developing cortex.

    Science.gov (United States)

    Semeralul, Mawahib O; Boutros, Paul C; Likhodi, Olga; Okey, Allan B; Van Tol, Hubert H M; Wong, Albert H C

    2006-12-01

    Abnormal development of the prefrontal cortex (PFC) is associated with a number of neuropsychiatric disorders that have an onset in childhood or adolescence. Although the basic laminar structure of the PFC is established in utero, extensive remodeling continues into adolescence. To map the overall pattern of changes in cortical gene transcripts during postnatal development, we made serial measurements of mRNA levels in mouse PFC using oligonucleotide microarrays. We observed changes in mRNA transcripts consistent with known postnatal morphological and biochemical events. Overall, most transcripts that changed significantly showed a progressive decrease in abundance after birth, with the majority of change between postnatal weeks 2 and 4. Genes with cell proliferative, cytoskeletal, extracellular matrix, plasma membrane lipid/transport, protein folding, and regulatory functions had decreases in mRNA levels. Quantitative PCR verified the microarray results for six selected genes: DNA methyltransferase 3A (Dnmt3a), procollagen, type III, alpha 1 (Col3a1), solute carrier family 16 (monocarboxylic acid transporters), member 1 (Slc16a1), MARCKS-like 1 (Marcksl1), nidogen 1 (Nid1) and 3-hydroxybutyrate dehydrogenase (heart, mitochondrial) (Bdh).

  15. Tandem Oligonucleotide Probe Annealing and Elongation To Discriminate Viral Sequence

    DEFF Research Database (Denmark)

    Taskova, Maria; Uhd, Jesper; Miotke, Laura

    2017-01-01

    followed by click assembly and analysis of the read sequence by various techniques. As we demonstrate in this paper, using our new approach, a viral RNA sequence can be detected in less than 2 h without the need for cDNA synthesis or any other enzymatic reactions and with a sensitivity of ... opportunities in transcriptome analysis, virology, and other fields. Herein, we report for the first time a "click" chemistry approach to oligonucleotide probe elongation as a novel approach to specifically detect a viral sequence. We hybridized a library of short, terminally labeled probes to Ebola virus RNA...

  16. Construction and validation of the APOCHIP, a spotted oligo-microarray for the study of beta-cell apoptosis

    Directory of Open Access Journals (Sweden)

    Ørntoft Torben F

    2005-12-01

    Full Text Available Abstract Background Type 1 diabetes mellitus (T1DM is a autoimmune disease caused by a long-term negative balance between immune-mediated beta-cell damage and beta-cell repair/regeneration. Following immune-mediated damage the beta-cell fate depends on several genes up- or down-regulated in parallel and/or sequentially. Based on the information obtained by the analysis of several microarray experiments of beta-cells exposed to pro-apoptotic conditions (e.g. double stranded RNA (dsRNA and cytokines, we have developed a spotted rat oligonucleotide microarray, the APOCHIP, containing 60-mer probes for 574 genes selected for the study of beta-cell apoptosis. Results The APOCHIP was validated by a combination of approaches. First we performed an internal validation of the spotted probes based on a weighted linear regression model using dilution series experiments. Second we profiled expression measurements in ten dissimilar rat RNA samples for 515 genes that were represented on both the spotted oligonucleotide collection and on the in situ-synthesized 25-mer arrays (Affymetrix GeneChips. Internal validation showed that most of the spotted probes displayed a pattern of reaction close to that predicted by the model. By using simple rules for comparison of data between platforms we found strong correlations (rmedian= 0.84 between relative gene expression measurements made with spotted probes and in situ-synthesized 25-mer probe sets. Conclusion In conclusion our data suggest that there is a high reproducibility of the APOCHIP in terms of technical replication and that relative gene expression measurements obtained with the APOCHIP compare well to the Affymetrix GeneChip. The APOCHIP is available to the scientific community and is a useful tool to study the molecular mechanisms regulating beta-cell apoptosis.

  17. Improved elucidation of biological processes linked to diabetic nephropathy by single probe-based microarray data analysis.

    Directory of Open Access Journals (Sweden)

    Clemens D Cohen

    Full Text Available BACKGROUND: Diabetic nephropathy (DN is a complex and chronic metabolic disease that evolves into a progressive fibrosing renal disorder. Effective transcriptomic profiling of slowly evolving disease processes such as DN can be problematic. The changes that occur are often subtle and can escape detection by conventional oligonucleotide DNA array analyses. METHODOLOGY/PRINCIPAL FINDINGS: We examined microdissected human renal tissue with or without DN using Affymetrix oligonucleotide microarrays (HG-U133A by standard Robust Multi-array Analysis (RMA. Subsequent gene ontology analysis by Database for Annotation, Visualization and Integrated Discovery (DAVID showed limited detection of biological processes previously identified as central mechanisms in the development of DN (e.g. inflammation and angiogenesis. This apparent lack of sensitivity may be associated with the gene-oriented averaging of oligonucleotide probe signals, as this includes signals from cross-hybridizing probes and gene annotation that is based on out of date genomic data. We then examined the same CEL file data using a different methodology to determine how well it could correlate transcriptomic data with observed biology. ChipInspector (CI is based on single probe analysis and de novo gene annotation that bypasses probe set definitions. Both methods, RMA and CI, used at default settings yielded comparable numbers of differentially regulated genes. However, when verified by RT-PCR, the single probe based analysis demonstrated reduced background noise with enhanced sensitivity and fewer false positives. CONCLUSIONS/SIGNIFICANCE: Using a single probe based analysis approach with de novo gene annotation allowed an improved representation of the biological processes linked to the development and progression of DN. The improved analysis was exemplified by the detection of Wnt signaling pathway activation in DN, a process not previously reported to be involved in this disease.

  18. Genomotyping of Pseudomonas putida strains using P. putida KT2440-based high-density DNA microarrays: Implications for transcriptomics studies

    NARCIS (Netherlands)

    Ballerstedt, H.; Volkers, R.J.M.; Mars, A.E.; Hallsworth, J.E.; Santos, V.A.M.D.; Puchalka, J.; Duuren, J. van; Eggink, G.; Timmis, K.N.; Bont, J.A.M. de; Wery, J.

    2007-01-01

    Pseudomonas putida KT2440 is the only fully sequenced P. putida strain. Thus, for transcriptomics and proteomics studies with other P. putida strains, the P. putida KT2440 genomic database serves as standard reference. The utility of KT2440 whole-genome, high-density oligonucleotide microarrays for

  19. Maize microarray annotation database

    Directory of Open Access Journals (Sweden)

    Berger Dave K

    2011-10-01

    Full Text Available Abstract Background Microarray technology has matured over the past fifteen years into a cost-effective solution with established data analysis protocols for global gene expression profiling. The Agilent-016047 maize 44 K microarray was custom-designed from EST sequences, but only reporter sequences with EST accession numbers are publicly available. The following information is lacking: (a reporter - gene model match, (b number of reporters per gene model, (c potential for cross hybridization, (d sense/antisense orientation of reporters, (e position of reporter on B73 genome sequence (for eQTL studies, and (f functional annotations of genes represented by reporters. To address this, we developed a strategy to annotate the Agilent-016047 maize microarray, and built a publicly accessible annotation database. Description Genomic annotation of the 42,034 reporters on the Agilent-016047 maize microarray was based on BLASTN results of the 60-mer reporter sequences and their corresponding ESTs against the maize B73 RefGen v2 "Working Gene Set" (WGS predicted transcripts and the genome sequence. The agreement between the EST, WGS transcript and gDNA BLASTN results were used to assign the reporters into six genomic annotation groups. These annotation groups were: (i "annotation by sense gene model" (23,668 reporters, (ii "annotation by antisense gene model" (4,330; (iii "annotation by gDNA" without a WGS transcript hit (1,549; (iv "annotation by EST", in which case the EST from which the reporter was designed, but not the reporter itself, has a WGS transcript hit (3,390; (v "ambiguous annotation" (2,608; and (vi "inconclusive annotation" (6,489. Functional annotations of reporters were obtained by BLASTX and Blast2GO analysis of corresponding WGS transcripts against GenBank. The annotations are available in the Maize Microarray Annotation Database http://MaizeArrayAnnot.bi.up.ac.za/, as well as through a GBrowse annotation file that can be uploaded to

  20. Injection site reactions after subcutaneous oligonucleotide therapy

    NARCIS (Netherlands)

    van Meer, L. (Leonie); M. Moerland (Matthijs); Gallagher, J. (Jolie); M.B.A. van Doorn (Martijn); E.P. Prens (Errol); A.F. Cohen; Rissmann, R. (Robert); J. Burggraaf (Jacobus)

    2016-01-01

    textabstractOligonucleotides (ONs) are short fragments of nucleic acids, currently being investigated as therapeutic agents. When administered subcutaneously (sc), ONs cause a specific local reaction originating around the injection site, such as erythema, itching, discomfort and pain, including

  1. Differential analysis for high density tiling microarray data

    Directory of Open Access Journals (Sweden)

    Kapranov Philipp

    2007-09-01

    Full Text Available Abstract Background High density oligonucleotide tiling arrays are an effective and powerful platform for conducting unbiased genome-wide studies. The ab initio probe selection method employed in tiling arrays is unbiased, and thus ensures consistent sampling across coding and non-coding regions of the genome. These arrays are being increasingly used to study the associated processes of transcription, transcription factor binding, chromatin structure and their association. Studies of differential expression and/or regulation provide critical insight into the mechanics of transcription and regulation that occurs during the developmental program of a cell. The time-course experiment, which comprises an in-vivo system and the proposed analyses, is used to determine if annotated and un-annotated portions of genome manifest coordinated differential response to the induced developmental program. Results We have proposed a novel approach, based on a piece-wise function – to analyze genome-wide differential response. This enables segmentation of the response based on protein-coding and non-coding regions; for genes the methodology also partitions differential response with a 5' versus 3' versus intra-genic bias. Conclusion The algorithm built upon the framework of Significance Analysis of Microarrays, uses a generalized logic to define regions/patterns of coordinated differential change. By not adhering to the gene-centric paradigm, discordant differential expression patterns between exons and introns have been identified at a FDR of less than 12 percent. A co-localization of differential binding between RNA Polymerase II and tetra-acetylated histone has been quantified at a p-value -13. The prototype R code has been made available as supplementary material [see Additional file 1]. Additional file 1 gsam_prototypercode.zip. File archive comprising of prototype R code for gSAM implementation including readme and examples. Click here for file

  2. Differential analysis for high density tiling microarray data.

    Science.gov (United States)

    Ghosh, Srinka; Hirsch, Heather A; Sekinger, Edward A; Kapranov, Philipp; Struhl, Kevin; Gingeras, Thomas R

    2007-09-24

    High density oligonucleotide tiling arrays are an effective and powerful platform for conducting unbiased genome-wide studies. The ab initio probe selection method employed in tiling arrays is unbiased, and thus ensures consistent sampling across coding and non-coding regions of the genome. These arrays are being increasingly used to study the associated processes of transcription, transcription factor binding, chromatin structure and their association. Studies of differential expression and/or regulation provide critical insight into the mechanics of transcription and regulation that occurs during the developmental program of a cell. The time-course experiment, which comprises an in-vivo system and the proposed analyses, is used to determine if annotated and un-annotated portions of genome manifest coordinated differential response to the induced developmental program. We have proposed a novel approach, based on a piece-wise function - to analyze genome-wide differential response. This enables segmentation of the response based on protein-coding and non-coding regions; for genes the methodology also partitions differential response with a 5' versus 3' versus intra-genic bias. The algorithm built upon the framework of Significance Analysis of Microarrays, uses a generalized logic to define regions/patterns of coordinated differential change. By not adhering to the gene-centric paradigm, discordant differential expression patterns between exons and introns have been identified at a FDR of less than 12 percent. A co-localization of differential binding between RNA Polymerase II and tetra-acetylated histone has been quantified at a p-value < 0.003; it is most significant at the 5' end of genes, at a p-value < 10-13. The prototype R code has been made available as supplementary material [see Additional file 1].

  3. Differentiation of regions with atypical oligonucleotide composition in bacterial genomes

    Directory of Open Access Journals (Sweden)

    Reva Oleg N

    2005-10-01

    Full Text Available Abstract Background Complete sequencing of bacterial genomes has become a common technique of present day microbiology. Thereafter, data mining in the complete sequence is an essential step. New in silico methods are needed that rapidly identify the major features of genome organization and facilitate the prediction of the functional class of ORFs. We tested the usefulness of local oligonucleotide usage (OU patterns to recognize and differentiate types of atypical oligonucleotide composition in DNA sequences of bacterial genomes. Results A total of 163 bacterial genomes of eubacteria and archaea published in the NCBI database were analyzed. Local OU patterns exhibit substantial intrachromosomal variation in bacteria. Loci with alternative OU patterns were parts of horizontally acquired gene islands or ancient regions such as genes for ribosomal proteins and RNAs. OU statistical parameters, such as local pattern deviation (D, pattern skew (PS and OU variance (OUV enabled the detection and visualization of gene islands of different functional classes. Conclusion A set of approaches has been designed for the statistical analysis of nucleotide sequences of bacterial genomes. These methods are useful for the visualization and differentiation of regions with atypical oligonucleotide composition prior to or accompanying gene annotation.

  4. G-Quadruplex Forming Oligonucleotides as Anti-HIV Agents.

    Science.gov (United States)

    Musumeci, Domenica; Riccardi, Claudia; Montesarchio, Daniela

    2015-09-22

    Though a variety of different non-canonical nucleic acids conformations have been recognized, G-quadruplex structures are probably the structural motifs most commonly found within known oligonucleotide-based aptamers. This could be ascribed to several factors, as their large conformational diversity, marked responsiveness of their folding/unfolding processes to external stimuli, high structural compactness and chemo-enzymatic and thermodynamic stability. A number of G-quadruplex-forming oligonucleotides having relevant in vitro anti-HIV activity have been discovered in the last two decades through either SELEX or rational design approaches. Improved aptamers have been obtained by chemical modifications of natural oligonucleotides, as terminal conjugations with large hydrophobic groups, replacement of phosphodiester linkages with phosphorothioate bonds or other surrogates, insertion of base-modified monomers, etc. In turn, detailed structural studies have elucidated the peculiar architectures adopted by many G-quadruplex-based aptamers and provided insight into their mechanism of action. An overview of the state-of-the-art knowledge of the relevance of putative G-quadruplex forming sequences within the viral genome and of the most studied G-quadruplex-forming aptamers, selectively targeting HIV proteins, is here presented.

  5. Ultrathin oligonucleotide layers for fluorescence-based DNA sensors

    Science.gov (United States)

    Furch, M.; Ueberfeld, J.; Hartmann, Andreas; Bock, Daniel; Seeger, Stefan

    1996-11-01

    Preliminary investigations into the design of an affinity sensor using evanescent wave technology concentrate upon the means of immobilization of the receptor molecules. In this work DNA served as the selective recognition element. The molecular principle of a sequence-selective biosensor for DNA is based on a sandwich-hybridization assay wherein the analyte, a single-stranded (ss)DNA, bound specifically to both an immobilized capture probe and a dye-labeled oligonucleotide in free solution. The efficiency of the capture array depends on the density of highly organized oligonucleotides on the waveguide surface and correlates therefore directly with the specificity and the sensitivity of the sensor. In the present approach using the Langmuir- Blodgett technique cinnamoylbutylether-cellulose monolayers were transferred onto optical fibers or planar waveguides. These films served as matrices for the immobilization of biotinylated oligonucleotides via streptavidin. For the first time streptavidin was immobilized by that manner. The specificity of the streptavidin layer or the following bounded nucleic acid molecules were controlled by an enzyme- linked immunosorbent assay (ELISA). Finally, this application has also shown to be suitable for the detection of Salmonella, which is an important pathogen associated with acute gastroenteritidis and food borne diseases.

  6. Protein microarrays for systems biology

    Institute of Scientific and Technical Information of China (English)

    Lina Yang; Shujuan Guo; Yang Li; Shumin Zhou; Shengce Tao

    2011-01-01

    Systems biology holds the key for understanding biological systems on a system level. It eventually holds the key for the treatment and cure of complex diseases such as cancer,diabetes, obesity, mental disorders, and many others. The '-omics' technologies, such as genomics, transcriptomics,proteomics, and metabonomics, are among the major driving forces of systems biology. Featured as highthroughput, miniaturized, and capable of parallel analysis,protein microarrays have already become an important technology platform for systems biology, In this review, we will focus on the system level or global analysis of biological systems using protein microarrays. Four major types of protein microarrays will be discussed: proteome microarrays, antibody microarrays, reverse-phase protein arrays,and lectin microarrays. We will also discuss the challenges and future directions of protein microarray technologies and their applications for systems biology. We strongly believe that protein microarrays will soon become an indispensable and invaluable tool for systems biology.

  7. Hole hopping rates in single strand oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Borrelli, Raffaele [Dipartimento di Scienze Agrarie, Forestali e Alimentari, Università di Torino, Largo Paolo Braccini 2, I-10095 Grugliasco, TO (Italy); Capobianco, Amedeo [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy); Peluso, Andrea, E-mail: apeluso@unisa.it [Dipartimento di Chimica e Biologia, Università di Salerno, Via Giovanni Paolo II, I-84084 Fisciano, SA (Italy)

    2014-08-31

    Highlights: • DNA hole transfer rates have been computed. • Delocalized adenine domains significantly affect hole transfer rates in DNA. • Franck–Condon weighted density of state from DFT normal modes. • DNA application in molecular electronics. - Abstract: The rates of hole transfer between guanine and adenine in single strand DNA have been evaluated by using Fermi’s golden rule and Kubo’s generating function approach for the Franck–Condon weighted density of states. The whole sets of the normal modes and vibrational frequencies of the two nucleobases, obtained at DFT/B3LYP level of calculation, have been considered in computations. The results show that in single strand the pyramidalization/planarization mode of the amino groups of both nucleobases plays the major role. At room temperature, the Franck–Condon density of states extends over a wide range of hole site energy difference, 0–1 eV, giving some hints about the design of oligonucleotides of potential technological interest.

  8. The small molecule Retro-1 enhances the pharmacological actions of antisense and splice switching oligonucleotides.

    Science.gov (United States)

    Ming, Xin; Carver, Kyle; Fisher, Michael; Noel, Romain; Cintrat, Jean-Christophe; Gillet, Daniel; Barbier, Julien; Cao, Canhong; Bauman, John; Juliano, Rudolph L

    2013-04-01

    The attainment of strong pharmacological effects with oligonucleotides is hampered by inefficient access of these molecules to their sites of action in the cytosol or nucleus. Attempts to address this problem with lipid or polymeric delivery systems have been only partially successful. Here, we describe a novel alternative approach involving the use of a non-toxic small molecule to enhance the pharmacological effects of oligonucleotides. The compound Retro-1 was discovered in a screen for small molecules that reduce the actions of bacterial toxins and has been shown to block the retrograde trafficking pathway. We demonstrate that Retro-1 can also substantially enhance the effectiveness of antisense and splice switching oligonucleotides in cell culture. This effect occurs at the level of intracellular trafficking or processing and is correlated with increased oligonucleotide accumulation in the nucleus but does not involve the perturbation of lysosomal compartments. We also show that Retro-1 can alter the effectiveness of splice switching oligonucleotides in the in vivo setting. These observations indicate that it is possible to enhance the pharmacological actions of oligonucleotides using non-toxic and non-lysosomotropic small molecule adjuncts.

  9. A New Generation Microarray for the Simultaneous Detection and Identification of Yersinia pestis and Bacillus anthracis in Food

    Directory of Open Access Journals (Sweden)

    Noriko Goji

    2012-01-01

    Full Text Available The use of microarrays as a multiple analytic system has generated increased interest and provided a powerful analytical tool for the simultaneous detection of pathogens in a single experiment. A wide array of applications for this technology has been reported. A low density oligonucleotide microarray was generated from the genetic sequences of Y. pestis and B. anthracis and used to fabricate a microarray chip. The new generation chip, consisting of 2,240 spots in 4 quadrants with the capability of stripping/rehybridization, was designated as “Y-PESTIS/B-ANTHRACIS 4x2K Array.” The chip was tested for specificity using DNA from a panel of bacteria that may be potentially present in food. In all, 37 unique Y. pestis-specific and 83 B. anthracis-specific probes were identified. The microarray assay distinguished Y. pestis and B. anthracis from the other bacterial species tested and correctly identified the Y. pestis-specific oligonucleotide probes using DNA extracted from experimentally inoculated milk samples. Using a whole genome amplification method, the assay was able to detect as low as 1 ng genomic DNA as the start sample. The results suggest that oligonucleotide microarray can specifically detect and identify Y. pestis and B. anthracis and may be a potentially useful diagnostic tool for detecting and confirming the organisms in food during a bioterrorism event.

  10. Direct microcontact printing of oligonucleotides for biochip applications

    Directory of Open Access Journals (Sweden)

    Trévisiol E

    2005-07-01

    Full Text Available Abstract Background A critical step in the fabrication of biochips is the controlled placement of probes molecules on solid surfaces. This is currently performed by sequential deposition of probes on a target surface with split or solid pins. In this article, we present a cost-effective procedure namely microcontact printing using stamps, for a parallel deposition of probes applicable for manufacturing biochips. Results Contrary to a previous work, we showed that the stamps tailored with an elastomeric poly(dimethylsiloxane material did not require any surface modification to be able to adsorb oligonucleotides or PCR products. The adsorbed DNA molecules are subsequently printed efficiently on a target surface with high sub-micron resolution. Secondly, we showed that successive stamping is characterized by an exponential decay of the amount of transferred DNA molecules to the surface up the 4th print, then followed by a second regime of transfer that was dependent on the contact time and which resulted in reduced quality of the features. Thus, while consecutive stamping was possible, this procedure turned out to be less reproducible and more time consuming than simply re-inking the stamps between each print. Thirdly, we showed that the hybridization signals on arrays made by microcontact printing were 5 to 10-times higher than those made by conventional spotting methods. Finally, we demonstrated the validity of this microcontact printing method in manufacturing oligonucleotides arrays for mutations recognition in a yeast gene. Conclusion The microcontact printing can be considered as a new potential technology platform to pattern DNA microarrays that may have significant advantages over the conventional spotting technologies as it is easy to implement, it uses low cost material to make the stamp, and the arrays made by this technology are 10-times more sensitive in term of hybridization signals than those manufactured by conventional spotting

  11. Identification of Putative Ortholog Gene Blocks Involved in Gestant and Lactating Mammary Gland Development: A Rodent Cross-Species Microarray Transcriptomics Approach

    Science.gov (United States)

    Rodríguez-Cruz, Maricela; Coral-Vázquez, Ramón M.; Hernández-Stengele, Gabriel; Sánchez, Raúl; Salazar, Emmanuel; Sanchez-Muñoz, Fausto; Encarnación-Guevara, Sergio; Ramírez-Salcedo, Jorge

    2013-01-01

    The mammary gland (MG) undergoes functional and metabolic changes during the transition from pregnancy to lactation, possibly by regulation of conserved genes. The objective was to elucidate orthologous genes, chromosome clusters and putative conserved transcriptional modules during MG development. We analyzed expression of 22,000 transcripts using murine microarrays and RNA samples of MG from virgin, pregnant, and lactating rats by cross-species hybridization. We identified 521 transcripts differentially expressed; upregulated in early (78%) and midpregnancy (89%) and early lactation (64%), but downregulated in mid-lactation (61%). Putative orthologous genes were identified. We mapped the altered genes to orthologous chromosomal locations in human and mouse. Eighteen sets of conserved genes associated with key cellular functions were revealed and conserved transcription factor binding site search entailed possible coregulation among all eight block sets of genes. This study demonstrates that the use of heterologous array hybridization for screening of orthologous gene expression from rat revealed sets of conserved genes arranged in chromosomal order implicated in signaling pathways and functional ontology. Results demonstrate the utilization power of comparative genomics and prove the feasibility of using rodent microarrays to identification of putative coexpressed orthologous genes involved in the control of human mammary gland development. PMID:24288657

  12. Identification of Putative Ortholog Gene Blocks Involved in Gestant and Lactating Mammary Gland Development: A Rodent Cross-Species Microarray Transcriptomics Approach

    Directory of Open Access Journals (Sweden)

    Maricela Rodríguez-Cruz

    2013-01-01

    Full Text Available The mammary gland (MG undergoes functional and metabolic changes during the transition from pregnancy to lactation, possibly by regulation of conserved genes. The objective was to elucidate orthologous genes, chromosome clusters and putative conserved transcriptional modules during MG development. We analyzed expression of 22,000 transcripts using murine microarrays and RNA samples of MG from virgin, pregnant, and lactating rats by cross-species hybridization. We identified 521 transcripts differentially expressed; upregulated in early (78% and midpregnancy (89% and early lactation (64%, but downregulated in mid-lactation (61%. Putative orthologous genes were identified. We mapped the altered genes to orthologous chromosomal locations in human and mouse. Eighteen sets of conserved genes associated with key cellular functions were revealed and conserved transcription factor binding site search entailed possible coregulation among all eight block sets of genes. This study demonstrates that the use of heterologous array hybridization for screening of orthologous gene expression from rat revealed sets of conserved genes arranged in chromosomal order implicated in signaling pathways and functional ontology. Results demonstrate the utilization power of comparative genomics and prove the feasibility of using rodent microarrays to identification of putative coexpressed orthologous genes involved in the control of human mammary gland development.

  13. A graph-theoretic approach for identifying non-redundant and relevant gene markers from microarray data using multiobjective binary PSO.

    Science.gov (United States)

    Mandal, Monalisa; Mukhopadhyay, Anirban

    2014-01-01

    The purpose of feature selection is to identify the relevant and non-redundant features from a dataset. In this article, the feature selection problem is organized as a graph-theoretic problem where a feature-dissimilarity graph is shaped from the data matrix. The nodes represent features and the edges represent their dissimilarity. Both nodes and edges are given weight according to the feature's relevance and dissimilarity among the features, respectively. The problem of finding relevant and non-redundant features is then mapped into densest subgraph finding problem. We have proposed a multiobjective particle swarm optimization (PSO)-based algorithm that optimizes average node-weight and average edge-weight of the candidate subgraph simultaneously. The proposed algorithm is applied for identifying relevant and non-redundant disease-related genes from microarray gene expression data. The performance of the proposed method is compared with that of several other existing feature selection techniques on different real-life microarray gene expression datasets.

  14. A graph-theoretic approach for identifying non-redundant and relevant gene markers from microarray data using multiobjective binary PSO.

    Directory of Open Access Journals (Sweden)

    Monalisa Mandal

    Full Text Available The purpose of feature selection is to identify the relevant and non-redundant features from a dataset. In this article, the feature selection problem is organized as a graph-theoretic problem where a feature-dissimilarity graph is shaped from the data matrix. The nodes represent features and the edges represent their dissimilarity. Both nodes and edges are given weight according to the feature's relevance and dissimilarity among the features, respectively. The problem of finding relevant and non-redundant features is then mapped into densest subgraph finding problem. We have proposed a multiobjective particle swarm optimization (PSO-based algorithm that optimizes average node-weight and average edge-weight of the candidate subgraph simultaneously. The proposed algorithm is applied for identifying relevant and non-redundant disease-related genes from microarray gene expression data. The performance of the proposed method is compared with that of several other existing feature selection techniques on different real-life microarray gene expression datasets.

  15. The impact of 1,25(OH)2D3 and its structural analogs on gene expression in cancer cells--a microarray approach.

    Science.gov (United States)

    Kriebitzsch, Carsten; Verlinden, Lieve; Eelen, Guy; Tan, Biauw Keng; Van Camp, Mark; Bouillon, Roger; Verstuyf, Annemieke

    2009-09-01

    The active form of vitamin D3, 1alpha,25-dihydroxyvitamin D3 [1,25(OH)2D3], is an important regulator of bone metabolism, calcium and phosphate homeostasis but also has potent antiproliferative and pro-differentiating effects on a wide variety of cell types. To identify key genes that are (directly) regulated by 1,25(OH)2D3, a large number of microarray studies have been performed on different types of cancer cells (prostate, breast, ovarian, colorectal, squamous cell carcinoma and leukemia). The variety of target genes identified through these studies reflects the pleiotropic action of 1,25(OH)2D3. Common cellular processes targeted by 1,25(OH)2D3 in the different cancer cell lines include cell cycle progression, apoptosis, cellular adhesion, oxidative stress, immune function and steroid metabolism. Upon comparison of the lists of genes regulated by 1,25(OH)2D3 in the different microarray studies, only a small set of individual genes were commonly regulated, among which are included 24-hydroxylase, growth arrest and DNA-damage-inducible protein, cathelicidin antimicrobial peptide and multiple cyclins.

  16. Assessing the Detection Capacity of Microarrays as Bio/Nanosensing Platforms

    Directory of Open Access Journals (Sweden)

    Ju Seok Lee

    2013-01-01

    Full Text Available Microarray is one of the most powerful detection systems with multiplexing and high throughput capability. It has significant potential as a versatile biosensing platform for environmental monitoring, pathogen detection, medical therapeutics, and drug screening to name a few. To date, however, microarray applications are still limited to preliminary screening of genome-scale transcription profiling or gene ontology analysis. Expanding the utility of microarrays as a detection tool for various biological and biomedical applications requires information about performance such as the limits of detection and quantification, which are considered as an essential information to decide the detection sensitivity of sensing devices. Here we present a calibration design that integrates detection limit theory and linear dynamic range to obtain a performance index of microarray detection platform using oligonucleotide arrays as a model system. Two different types of limits of detection and quantification are proposed by the prediction or tolerance interval for two common cyanine fluorescence dyes, Cy3 and Cy5. Besides oligonucleotide, the proposed method can be generalized to other microarray formats with various biomolecules such as complementary DNA, protein, peptide, carbohydrate, tissue, or other small biomolecules. Also, it can be easily applied to other fluorescence dyes for further dye chemistry improvement.

  17. A study of oligonucleotide occurrence distributions in DNA coding segments.

    Science.gov (United States)

    Castrignanò, T; Colosimo, A; Morante, S; Parisi, V; Rossi, G C

    1997-02-21

    In this paper we present a general strategy designed to study the occurrence frequency distributions of oligonucleotides in DNA coding segments and to deal with the problem of detecting possible patterns of genomic compositional inhomogeneities and disuniformities. Identifying specific tendencies or peculiar deviations in the distributions of the effective occurrence frequencies of oligonucleotides, with respect to what can be a priori expected, is of the greatest importance in biology. Differences between expected and actual distributions may in fact suggest or confirm the existence of specific biological mechanisms related to them. Similarly, a marked deviation in the occurrence frequency of an oligonucleotide may suggest that it belongs to the class of so-called "DNA signal (target) sequences". The approach we have elaborated is innovative in various aspects. Firstly, the analysis of the genomic data is carried out in the light of the observation that the distribution of the four nucleotides along the coding regions of the genoma is biased by the existence of a well-defined "reading frame". Secondly, the "experimental" numbers found by counting the occurrences of the various oligonucleotide sequences are appropriately corrected for the many kinds of mistakes and redundancies present in the available genetic Data Bases. A methodologically significant further improvement of our approach over the existing searching strategies is represented by the fact that, in order to decide whether or not the (corrected) "experimental" value of the occurrence frequency of a given oligonucleotide is within statistical expectations, a measure of the strength of the selective pressure, having acted on it in the course of the evolution, is assigned to the sequence, in a way that takes into account both the value of the "experimental" occurrence frequency of the sequence and the magnitude of the probability that this number might be the result of statistical fluctuations. If the

  18. Biolog phenotype microarrays.

    Science.gov (United States)

    Shea, April; Wolcott, Mark; Daefler, Simon; Rozak, David A

    2012-01-01

    Phenotype microarrays nicely complement traditional genomic, transcriptomic, and proteomic analysis by offering opportunities for researchers to ground microbial systems analysis and modeling in a broad yet quantitative assessment of the organism's physiological response to different metabolites and environments. Biolog phenotype assays achieve this by coupling tetrazolium dyes with minimally defined nutrients to measure the impact of hundreds of carbon, nitrogen, phosphorous, and sulfur sources on redox reactions that result from compound-induced effects on the electron transport chain. Over the years, we have used Biolog's reproducible and highly sensitive assays to distinguish closely related bacterial isolates, to understand their metabolic differences, and to model their metabolic behavior using flux balance analysis. This chapter describes Biolog phenotype microarray system components, reagents, and methods, particularly as they apply to bacterial identification, characterization, and metabolic analysis.

  19. Considerations for the Characterization and Interpretation of Results Related to Alternative Complement Activation in Monkeys Associated with Oligonucleotide-Based Therapeutics.

    Science.gov (United States)

    Henry, Scott P; Seguin, Rosanne; Cavagnaro, Joy; Berman, Cindy; Tepper, Jeff; Kornbrust, Douglas

    2016-08-01

    This article provides an overview of the discussions held by the Immunomodulatory Subcommittee of the Oligonucleotide Safety Working Group on complement activation induced by oligonucleotides, most notably the phosphorothioate-containing oligonucleotides. Alternative complement pathway activation in monkeys is a common effect of single-stranded phosphorothioate backbone oligonucleotides in toxicology studies. This article discusses the mechanism for activation, general investigational strategy, and the impact of various chemical modifications. The goal is to provide the best practice approach to characterizing this effect, understanding the implication of the species specificity, and the interpretation of clinical relevance.

  20. Analyzing Microarray Data.

    Science.gov (United States)

    Hung, Jui-Hung; Weng, Zhiping

    2017-03-01

    Because there is no widely used software for analyzing RNA-seq data that has a graphical user interface, this protocol provides an example of analyzing microarray data using Babelomics. This analysis entails performing quantile normalization and then detecting differentially expressed genes associated with the transgenesis of a human oncogene c-Myc in mice. Finally, hierarchical clustering is performed on the differentially expressed genes using the Cluster program, and the results are visualized using TreeView.

  1. Analysis of mutations in oral poliovirus vaccine by hybridization with generic oligonucleotide microchips.

    Energy Technology Data Exchange (ETDEWEB)

    Proudnikov, D.; Kirillov, E.; Chumakov, K.; Donion, J.; Rezapkin, G.; Mirzabekov, A.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology; Center for Biologics Evaluation and Research

    2000-01-01

    This paper describes use of a new technology of hybridization with a micro-array of immobilized oligonucleotides for detection and quantification of neurovirulent mutants in Oral Poliovirus Vaccine (OPV). We used a micro-array consisting of three-dimensional gel-elements containing all possible hexamers (total of 4096 probes). Hybridization of fluorescently labelled viral cDNA samples with such microchips resulted in a pattern of spots that was registered and quantified by a computer-linked CCD camera, so that the sequence of the original cDNA could be deduced. The method could reliably identify single point mutations, since each of them affected fluorescence intensity of 12 micro-array elements. Micro-array hybridization of DNA mixtures with varying contents of point mutants demonstrated that the method can detect as little as 10% of revertants in a population of vaccine virus. This new technology should be useful for quality control of live viral vaccines, as well as for other applications requiring identification and quantification of point mutations.

  2. Discovering biological progression underlying microarray samples.

    Directory of Open Access Journals (Sweden)

    Peng Qiu

    2011-04-01

    Full Text Available In biological systems that undergo processes such as differentiation, a clear concept of progression exists. We present a novel computational approach, called Sample Progression Discovery (SPD, to discover patterns of biological progression underlying microarray gene expression data. SPD assumes that individual samples of a microarray dataset are related by an unknown biological process (i.e., differentiation, development, cell cycle, disease progression, and that each sample represents one unknown point along the progression of that process. SPD aims to organize the samples in a manner that reveals the underlying progression and to simultaneously identify subsets of genes that are responsible for that progression. We demonstrate the performance of SPD on a variety of microarray datasets that were generated by sampling a biological process at different points along its progression, without providing SPD any information of the underlying process. When applied to a cell cycle time series microarray dataset, SPD was not provided any prior knowledge of samples' time order or of which genes are cell-cycle regulated, yet SPD recovered the correct time order and identified many genes that have been associated with the cell cycle. When applied to B-cell differentiation data, SPD recovered the correct order of stages of normal B-cell differentiation and the linkage between preB-ALL tumor cells with their cell origin preB. When applied to mouse embryonic stem cell differentiation data, SPD uncovered a landscape of ESC differentiation into various lineages and genes that represent both generic and lineage specific processes. When applied to a prostate cancer microarray dataset, SPD identified gene modules that reflect a progression consistent with disease stages. SPD may be best viewed as a novel tool for synthesizing biological hypotheses because it provides a likely biological progression underlying a microarray dataset and, perhaps more importantly, the

  3. Antisense oligonucleotides for the treatment of dyslipidaemia.

    Science.gov (United States)

    Visser, Maartje E; Witztum, Joseph L; Stroes, Erik S G; Kastelein, John J P

    2012-06-01

    Antisense oligonucleotides (ASOs) are short synthetic analogues of natural nucleic acids designed to specifically bind to a target messenger RNA (mRNA) by Watson-Crick hybridization, inducing selective degradation of the mRNA or prohibiting translation of the selected mRNA into protein. Antisense technology has the ability to inhibit unique targets with high specificity and can be used to inhibit synthesis of a wide range of proteins that could influence lipoprotein levels and other targets. A number of different classes of antisense agents are under development. To date, mipomersen, a 2'-O-methoxyethyl phosphorothioate 20-mer ASO, is the most advanced ASO in clinical development. It is a second-generation ASO developed to inhibit the synthesis of apolipoprotein B (apoB)-100 in the liver. In Phase 3 clinical trials, mipomersen has been shown to significantly reduce plasma low-density lipoprotein cholesterol (LDL-c) as well as other atherogenic apoB containing lipoproteins such as lipoprotein (a) [Lp(a)] and small-dense LDL particles. Although concerns have been raised because of an increase in intrahepatic triglyceride content, preliminary data from long-term studies suggest that with continued treatment, liver fat levels tend to stabilize or decline. Further studies are needed to evaluate potential clinical relevance of these changes. Proprotein convertase subtilisin/kexin-9 (PCSK9) is another promising novel target for lowering LDL-c by ASOs. Both second-generation ASOs and ASOs using locked nucleic acid technology have been developed to inhibit PCSK9 and are under clinical development. Other targets currently being addressed include apoC-III and apo(a) or Lp(a). By directly inhibiting the synthesis of specific proteins, ASO technology offers a promising new approach to influence the metabolism of lipids and to control lipoprotein levels. Its application to a wide variety of potential targets can be expected if these agents prove to be clinically safe and

  4. Protein microarray applications: Autoantibody detection and posttranslational modification.

    Science.gov (United States)

    Atak, Apurva; Mukherjee, Shuvolina; Jain, Rekha; Gupta, Shabarni; Singh, Vedita Anand; Gahoi, Nikita; K P, Manubhai; Srivastava, Sanjeeva

    2016-10-01

    The discovery of DNA microarrays was a major milestone in genomics; however, it could not adequately predict the structure or dynamics of underlying protein entities, which are the ultimate effector molecules in a cell. Protein microarrays allow simultaneous study of thousands of proteins/peptides, and various advancements in array technologies have made this platform suitable for several diagnostic and functional studies. Antibody arrays enable researchers to quantify the abundance of target proteins in biological fluids and assess PTMs by using the antibodies. Protein microarrays have been used to assess protein-protein interactions, protein-ligand interactions, and autoantibody profiling in various disease conditions. Here, we summarize different microarray platforms with focus on its biological and clinical applications in autoantibody profiling and PTM studies. We also enumerate the potential of tissue microarrays to validate findings from protein arrays as well as other approaches, highlighting their significance in proteomics.

  5. Microintaglio Printing for Soft Lithography-Based in Situ Microarrays

    Directory of Open Access Journals (Sweden)

    Manish Biyani

    2015-07-01

    Full Text Available Advances in lithographic approaches to fabricating bio-microarrays have been extensively explored over the last two decades. However, the need for pattern flexibility, a high density, a high resolution, affordability and on-demand fabrication is promoting the development of unconventional routes for microarray fabrication. This review highlights the development and uses of a new molecular lithography approach, called “microintaglio printing technology”, for large-scale bio-microarray fabrication using a microreactor array (µRA-based chip consisting of uniformly-arranged, femtoliter-size µRA molds. In this method, a single-molecule-amplified DNA microarray pattern is self-assembled onto a µRA mold and subsequently converted into a messenger RNA or protein microarray pattern by simultaneously producing and transferring (immobilizing a messenger RNA or a protein from a µRA mold to a glass surface. Microintaglio printing allows the self-assembly and patterning of in situ-synthesized biomolecules into high-density (kilo-giga-density, ordered arrays on a chip surface with µm-order precision. This holistic aim, which is difficult to achieve using conventional printing and microarray approaches, is expected to revolutionize and reshape proteomics. This review is not written comprehensively, but rather substantively, highlighting the versatility of microintaglio printing for developing a prerequisite platform for microarray technology for the postgenomic era.

  6. Microintaglio Printing for Soft Lithography-Based in Situ Microarrays.

    Science.gov (United States)

    Biyani, Manish; Ichiki, Takanori

    2015-07-14

    Advances in lithographic approaches to fabricating bio-microarrays have been extensively explored over the last two decades. However, the need for pattern flexibility, a high density, a high resolution, affordability and on-demand fabrication is promoting the development of unconventional routes for microarray fabrication. This review highlights the development and uses of a new molecular lithography approach, called "microintaglio printing technology", for large-scale bio-microarray fabrication using a microreactor array (µRA)-based chip consisting of uniformly-arranged, femtoliter-size µRA molds. In this method, a single-molecule-amplified DNA microarray pattern is self-assembled onto a µRA mold and subsequently converted into a messenger RNA or protein microarray pattern by simultaneously producing and transferring (immobilizing) a messenger RNA or a protein from a µRA mold to a glass surface. Microintaglio printing allows the self-assembly and patterning of in situ-synthesized biomolecules into high-density (kilo-giga-density), ordered arrays on a chip surface with µm-order precision. This holistic aim, which is difficult to achieve using conventional printing and microarray approaches, is expected to revolutionize and reshape proteomics. This review is not written comprehensively, but rather substantively, highlighting the versatility of microintaglio printing for developing a prerequisite platform for microarray technology for the postgenomic era.

  7. Microgel Tethering For Microarray-Based Nucleic Acid Diagnostics

    Science.gov (United States)

    Dai, Xiaoguang

    Molecular diagnostics (MDx) have radically changed the process of clinical microbial identification based on identifying genetic information, MDx approaches are both specific and fast. They can identify microbes to the species and strain level over a time scale that can be as short as one hour. With such information clinicians can administer the most effective and appropriate antimicrobial treatment at an early time point with substantial implications both for patient well-being and for easing the burden on the health-care system. Among the different MDx approaches, such as fluorescence in-situ hybridization, microarrays, next-generation sequencing, and mass spectrometry, point-of-care MDx platforms are drawing particular interest due to their low cost, robustness, and wide application. This dissertation develops a novel MDx technology platform capable of high target amplification and detection performance. For nucleic acid target detection, we fabricate an array of electron-beam-patterned microgels on a standard glass microscope slide. The microgels can be as small as a few hundred nanometers. The unique way of energy deposition during electron-beam lithography provides the microgels with a very diffuse water -gel interface that enables them to not only serve as substrates to immobilize DNA probes but do so while preserving them in a highly hydrated environment that optimizes their performance. Benefiting from the high spatial resolution provided by such techniques as position-sensitive microspotting and dip-pen nanolithography, multiple oligonucleotide probes known as molecular beacons (MBs) can be patterned on microgels. Furthermore, nucleic acid target amplification can be conducted in direct contact with the microgel-tethered detection array. Specifically, we use an isothermal RNA amplification reaction - nucleic acid sequence-based amplification (NASBA). ssRNA amplicons of from the NASBA reaction can directly hybridize with microgel-tethered MBs, and the

  8. Evaluation of current and new biomarkers in severe preeclampsia: a microarray approach reveals the VSIG4 gene as a potential blood biomarker.

    Science.gov (United States)

    Textoris, Julien; Ivorra, Delphine; Ben Amara, Amira; Sabatier, Florence; Ménard, Jean-Pierre; Heckenroth, Hélène; Bretelle, Florence; Mege, Jean-Louis

    2013-01-01

    Preeclampsia is a placental disease characterized by hypertension and proteinuria in pregnant women, and it is associated with a high maternal and neonatal morbidity. However, circulating biomarkers that are able to predict the prognosis of preeclampsia are lacking. Thirty-eight women were included in the current study. They consisted of 19 patients with preeclampsia (13 with severe preeclampsia and 6 with non-severe preeclampsia) and 19 gestational age-matched women with normal pregnancies as controls. We measured circulating factors that are associated with the coagulation pathway (including fibrinogen, fibronectin, factor VIII, antithrombin, protein S and protein C), endothelial activation (such as soluble endoglin and CD146), and the release of total and platelet-derived microparticles. These markers enabled us to discriminate the preeclampsia condition from a normal pregnancy but were not sufficient to distinguish severe from non-severe preeclampsia. We then used a microarray to study the transcriptional signature of blood samples. Preeclampsia patients exhibited a specific transcriptional program distinct from that of the control group of women. Interestingly, we also identified a severity-related transcriptional signature. Functional annotation of the upmodulated signature in severe preeclampsia highlighted two main functions related to "ribosome" and "complement". Finally, we identified 8 genes that were specifically upmodulated in severe preeclampsia compared with non-severe preeclampsia and the normotensive controls. Among these genes, we identified VSIG4 as a potential diagnostic marker of severe preeclampsia. The determination of this gene may improve the prognostic assessment of severe preeclampsia.

  9. Evaluation of current and new biomarkers in severe preeclampsia: a microarray approach reveals the VSIG4 gene as a potential blood biomarker.

    Directory of Open Access Journals (Sweden)

    Julien Textoris

    Full Text Available Preeclampsia is a placental disease characterized by hypertension and proteinuria in pregnant women, and it is associated with a high maternal and neonatal morbidity. However, circulating biomarkers that are able to predict the prognosis of preeclampsia are lacking. Thirty-eight women were included in the current study. They consisted of 19 patients with preeclampsia (13 with severe preeclampsia and 6 with non-severe preeclampsia and 19 gestational age-matched women with normal pregnancies as controls. We measured circulating factors that are associated with the coagulation pathway (including fibrinogen, fibronectin, factor VIII, antithrombin, protein S and protein C, endothelial activation (such as soluble endoglin and CD146, and the release of total and platelet-derived microparticles. These markers enabled us to discriminate the preeclampsia condition from a normal pregnancy but were not sufficient to distinguish severe from non-severe preeclampsia. We then used a microarray to study the transcriptional signature of blood samples. Preeclampsia patients exhibited a specific transcriptional program distinct from that of the control group of women. Interestingly, we also identified a severity-related transcriptional signature. Functional annotation of the upmodulated signature in severe preeclampsia highlighted two main functions related to "ribosome" and "complement". Finally, we identified 8 genes that were specifically upmodulated in severe preeclampsia compared with non-severe preeclampsia and the normotensive controls. Among these genes, we identified VSIG4 as a potential diagnostic marker of severe preeclampsia. The determination of this gene may improve the prognostic assessment of severe preeclampsia.

  10. Analysis of pigmented villonodular synovitis with genome-wide complementary DNA microarray and tissue array technology reveals insight into potential novel therapeutic approaches.

    Science.gov (United States)

    Finis, Katharina; Sültmann, Holger; Ruschhaupt, Markus; Buness, Andreas; Helmchen, Birgit; Kuner, Ruprecht; Gross, Marie-Luise; Fink, Bernd; Schirmacher, Peter; Poustka, Annemarie; Berger, Irina

    2006-03-01

    To characterize the gene expression profile and determine potential diagnostic markers and therapeutic targets in pigmented villonodular synovitis (PVNS). Gene expression patterns in 11 patients with PVNS, 18 patients with rheumatoid arthritis (RA), and 19 patients with osteoarthritis (OA) were investigated using genome-wide complementary DNA microarrays. Validation of differentially expressed genes was performed by real-time quantitative polymerase chain reaction and immunohistochemical analysis on tissue arrays (80 patients with PVNS, 51 patients with RA, and 20 patients with OA). The gene expression profile in PVNS was clearly distinct from those in RA and OA. One hundred forty-one up-regulated genes and 47 down-regulated genes were found in PVNS compared with RA, and 153 up-regulated genes and 89 down-regulated genes were found in PVNS compared with OA (fold change > or = 1.5; Q PVNS were involved in apoptosis regulation, matrix degradation, and inflammation (ALOX5AP, ATP6V1B2, CD53, CHI3L1, CTSL, CXCR4, HSPA8, HSPCA, LAPTM5, MMP9, MOAP1, and SPP1). The gene expression signature in PVNS is similar to that of activated macrophages and is consistent with the local destructive course of the disease. The gene and protein expression patterns suggest that the ongoing proliferation in PVNS is sustained by apoptosis resistance. This result suggests the possibility of a potential novel therapeutic intervention against PVNS.

  11. Development and production of an oligonucleotide MuscleChip: use for validation of ambiguous ESTs

    Directory of Open Access Journals (Sweden)

    Lanfranchi Gerolamo

    2002-10-01

    Full Text Available Abstract Background We describe the development, validation, and use of a highly redundant 120,000 oligonucleotide microarray (MuscleChip containing 4,601 probe sets representing 1,150 known genes expressed in muscle and 2,075 EST clusters from a non-normalized subtracted muscle EST sequencing project (28,074 EST sequences. This set included 369 novel EST clusters showing no match to previously characterized proteins in any database. Each probe set was designed to contain 20–32 25 mer oligonucleotides (10–16 paired perfect match and mismatch probe pairs per gene, with each probe evaluated for hybridization kinetics (Tm and similarity to other sequences. The 120,000 oligonucleotides were synthesized by photolithography and light-activated chemistry on each microarray. Results Hybridization of human muscle cRNAs to this MuscleChip (33 samples showed a correlation of 0.6 between the number of ESTs sequenced in each cluster and hybridization intensity. Out of 369 novel EST clusters not showing any similarity to previously characterized proteins, we focused on 250 EST clusters that were represented by robust probe sets on the MuscleChip fulfilling all stringent rules. 102 (41% were found to be consistently "present" by analysis of hybridization to human muscle RNA, of which 40 ESTs (39% could be genome anchored to potential transcription units in the human genome sequence. 19 ESTs of the 40 ESTs were furthermore computer-predicted as exons by one or more than three gene identification algorithms. Conclusion Our analysis found 40 transcriptionally validated, genome-anchored novel EST clusters to be expressed in human muscle. As most of these ESTs were low copy clusters (duplex and triplex in the original 28,000 EST project, the identification of these as significantly expressed is a robust validation of the transcript units that permits subsequent focus on the novel proteins encoded by these genes.

  12. DNA sequence analysis by hybridization with oligonucleotide microchips : MALDI mass spectrometry identification of 5mers contiguously stacked to microchip oligonucleotides.

    Energy Technology Data Exchange (ETDEWEB)

    Stomakhin, A. A.; Vasiliskov, V. A.; Timofeev, E.; Schulga, D.; Cotter, R. J.; Mirzabekov, A. D.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology; Moscow Inst. of Physics and Technology; Middle Atlantic Mass Spectrometry Lab.; Johns Hopkins Univ. School of Medicine

    2000-01-01

    Matrix-assisted laser desorption ionization mass spectrometry (MALDI MS) has been applied to increase the informational output from DNA sequence analysis. It has been used to analyze DNA by hybridization with microarrays of gel-immobilized oligonucleotides extended with stacked 5mers. In model experiments, a 28 nt long DNA fragment was hybridized with 10 immobilized, overlapping 8mers. Then, in a second round of hybridization DNA-8mer duplexes were hybridized with a mixture of 10 5mers. The stability of the 5mer complex with DNA was increased to raise the melting temperature of the duplex by 10-15{sup o}C as a result of stacking interaction with 8mers. Contiguous 13 bp duplexes containing an internal break were formed. MALDI MS identified one or, in some cases, two 5mers contiguously stacked to each DNA-8mer duplex formed on the microchip. Incorporating a mass label into 5mers optimized MALDI MS monitoring. This procedure enabled us to reconstitute the sequence of a model DNA fragment and identify polymorphic nucleotides. The application of MALDI MS identification of contiguously stacked 5mers to increase the length of DNA for sequence analysis is discussed.

  13. Methidium intercalator inserted into synthetic oligonucleotides.

    Energy Technology Data Exchange (ETDEWEB)

    Timofeev, E. N.; Smirnov, I. P.; Haff, L. A.; Tishchenko, E. I.; Mirzabekov, A. D.; Florentiev, V. L.; Center for Mechanistic Biology and Biotechnology; Engelhardt Inst. of Molecular Biology; PerSeptive BioSystems Inc.

    1996-01-01

    A new methidium intercalator phosphoramidite has been synthesized. Methidium incorporation into an oligonucleotide during the synthesis was confirmed by UV and MALDI TOF MS data. UV melting experiments showed enhanced stability of a duplex, containing internal methidium. Methidium phosphoramidite has been synthesized and used for insertion of intercalator into the deoxyoligonucleotides.

  14. Unusual intron conservation near tissue-regulated exons found by splicing microarrays.

    Directory of Open Access Journals (Sweden)

    Charles W Sugnet

    2006-01-01

    Full Text Available Alternative splicing contributes to both gene regulation and protein diversity. To discover broad relationships between regulation of alternative splicing and sequence conservation, we applied a systems approach, using oligonucleotide microarrays designed to capture splicing information across the mouse genome. In a set of 22 adult tissues, we observe differential expression of RNA containing at least two alternative splice junctions for about 40% of the 6,216 alternative events we could detect. Statistical comparisons identify 171 cassette exons whose inclusion or skipping is different in brain relative to other tissues and another 28 exons whose splicing is different in muscle. A subset of these exons is associated with unusual blocks of intron sequence whose conservation in vertebrates rivals that of protein-coding exons. By focusing on sets of exons with similar regulatory patterns, we have identified new sequence motifs implicated in brain and muscle splicing regulation. Of note is a motif that is strikingly similar to the branchpoint consensus but is located downstream of the 5' splice site of exons included in muscle. Analysis of three paralogous membrane-associated guanylate kinase genes reveals that each contains a paralogous tissue-regulated exon with a similar tissue inclusion pattern. While the intron sequences flanking these exons remain highly conserved among mammalian orthologs, the paralogous flanking intron sequences have diverged considerably, suggesting unusually complex evolution of the regulation of alternative splicing in multigene families.

  15. Nanoparticle probes and mid-infrared chemical imaging for DNA microarray detection.

    Science.gov (United States)

    Mossoba, Magdi M; Al-Khaldi, Sufian F; Schoen, Brianna; Yakes, Betsy Jean

    2010-11-01

    To date most mid-infrared spectroscopic studies have been limited, due to lack of sensitivity, to the structural characterization of a single oligonucleotide probe immobilized over the entire surface of a gold-coated slide or other infrared substrate. By contrast, widely used and commercially available glass slides and a microarray spotter that prints approximately 120-μm-diameter DNA spots were employed in the present work. To our knowledge, mid-infrared chemical imaging (IRCI) in the external reflection mode has been applied in the present study for the first time to the detection of nanostructure-based DNA microarrays spotted on glass slides. Alkyl amine-modified oligonucleotide probes were immobilized on glass slides that had been prefunctionalized with succinimidyl ester groups. This molecular fluorophore-free method entailed the binding of gold-nanoparticle-streptavidin conjugates to biotinylated DNA targets. Hybridization was visualized by the silver enhancement of gold nanoparticles. The adlayer of silver, selectively bound only to hybridized spots in a microarray, formed the external reflective infrared substrate that was necessary for the detection of DNA hybridization by IRCI in the present proof-of-concept study. IRCI made it possible to discriminate between diffuse and specular external reflection modes. The promising qualitative results are presented herein, and the implications for quantitative determination of DNA microarrays are discussed.

  16. Phytochip: development of a DNA-microarray for rapid and accurate identification of Pseudo-nitzschia spp and other harmful algal species.

    Science.gov (United States)

    Noyer, Charlotte; Abot, Anne; Trouilh, Lidwine; Leberre, Véronique Anton; Dreanno, Catherine

    2015-05-01

    Detection of harmful algal blooms has become a challenging concern because of the direct impacts on public health and economy. The identification of toxic dinoflagellates and diatoms in monitoring programs requires an extensive taxonomic expertise and is time consuming. Advances in molecular biology have allowed the development of new approaches, more rapid, accurate and cost-effective for detecting these microorganisms. In this context, we developed a new DNA microarray (called, Phytochip) for the simultaneous detection of multiple HAB species with a particular emphasis on Pseudo-nitzschia species. Oligonucleotide probes were designed along the rRNA operon. After DNA extraction, the target rDNA genes were amplified and labeled using an asymmetric PCR; then, the amplicons were hybridized to the oligonucleotide probes present on the chips. The total assay from seawater sampling to data acquisition can be performed within a working day. Specificity and sensitivity were assessed by using monoclonal cultures, mixtures of species and field samples spiked with a known amount of cultured cells. The Phytochip with its 81 validated oligonucleotide probes was able to detect 12 species of Pseudo-nitzschia and 11 species of dinoflagellates among which were 3 species of Karenia and 3 species of Alexandrium. The Phytochip was applied to environmental samples already characterized by light microscopy and cloned into DNA libraries. The hybridizations on the Phytochip were in good agreement with the sequences retrieved from the clone libraries and the microscopic observations. The Phytochip enables a reliable multiplex detection of phytoplankton and can assist a water quality monitoring program as well as more general ecological research.

  17. Compressive Sensing DNA Microarrays

    Directory of Open Access Journals (Sweden)

    Richard G. Baraniuk

    2009-01-01

    Full Text Available Compressive sensing microarrays (CSMs are DNA-based sensors that operate using group testing and compressive sensing (CS principles. In contrast to conventional DNA microarrays, in which each genetic sensor is designed to respond to a single target, in a CSM, each sensor responds to a set of targets. We study the problem of designing CSMs that simultaneously account for both the constraints from CS theory and the biochemistry of probe-target DNA hybridization. An appropriate cross-hybridization model is proposed for CSMs, and several methods are developed for probe design and CS signal recovery based on the new model. Lab experiments suggest that in order to achieve accurate hybridization profiling, consensus probe sequences are required to have sequence homology of at least 80% with all targets to be detected. Furthermore, out-of-equilibrium datasets are usually as accurate as those obtained from equilibrium conditions. Consequently, one can use CSMs in applications in which only short hybridization times are allowed.

  18. Novel Efficient Cell-Penetrating, Peptide-Mediated Strategy for Enhancing Telomerase Inhibitor Oligonucleotides.

    Science.gov (United States)

    Muñoz-Alarcón, Andrés; Eriksson, Jonas; Langel, Ülo

    2015-12-01

    At present, there are several therapeutic approaches for targeting telomerase in tumors. One in particular, currently undergoing clinical trials, is based on synthetic lipid-modified oligonucleotide antagonists aimed at inhibiting the ribonucleoprotein subunit of human telomerase. However, while enabling efficient uptake, the lipid modifications reduce the potency of the therapeutic oligonucleotides compared to nonmodified oligonucleotides. Moreover, lipid modification may increase oligonucleotide accumulation in the liver causing undesirable hepatotoxicity. Noncovalent complexation strategies for cell-penetrating peptide (CPP)-mediated delivery present an option to circumvent the need for potency-reducing modifications, while allowing for a highly efficient uptake, and could significantly improve the efficiency of telomerase-targeting cancer therapeutics. Delivery of a nonlipidated locked nucleic acid/2'-O-methyl mixmer significantly inhibits the telomerase activity in treated HeLa cells. The inhibitory effect was further improved through addition of a CPP. Furthermore, calculated IC50-values for the oligonucleotide delivered by CPPs into HeLa cells are more than 20 times lower than telomerase inhibitor Imetelstat, currently undergoing clinical trials. These results emphasize the potential of CPP-mediated delivery of future pharmaceuticals and provide means by which to enhance an already promising therapeutic strategy for cancer treatment.

  19. Chemosensitization by antisense oligonucleotides targeting MDM2.

    Science.gov (United States)

    Bianco, Roberto; Ciardiello, Fortunato; Tortora, Giampaolo

    2005-02-01

    The MDM2 oncogene is overexpressed in many human cancers, including sarcomas, certain hematologic malignancies, and breast, colon and prostate cancers. The p53-MDM2 interaction pathway has been suggested as a novel target for cancer therapy. To that end, several strategies have been explored, including the use of small polypeptides targeted to the MDM2-p53 binding domain, anti-MDM2 antisense oligonucleotides, and natural agents. Different generations of anti-human-MDM2 oligonucleotides have been tested in in vitro and in vivo human cancer models, revealing specific inhibition of MDM2 expression and significant antitumor activity. Use of antisense oligos potentiated the effects of growth inhibition, p53 activation and p21 induction by several chemotherapeutic agents. Increased therapeutic effectiveness of chemotherapeutic drugs in human cancer cell lines carrying p53 mutations or deletions have shown the ability of MDM2 inhibitors to act as chemosensitizers in various types of tumors through both p53-dependent and p53-independent mechanisms. Inhibiting MDM2 appears to also have a role in radiation therapy for human cancer, regardless of p53 status, providing a rationale for the development of a new class of radiosensitizers. Moreover, MDM2 antisense oligonucleotides potentiate the effect of epidermal growth factor receptor (EGFR) inhibitors by affecting in vitro and in vivo proliferation, apoptosis and protein expression in hormone-refractory and hormone-dependent human prostate cancer cells. These data support the development, among other MDM2 inhibitors, of anti-MDM2 antisense oligonucleotides as a novel class of anticancer agents, and suggest a potentially relevant role for the oligonucleotides when integrated with conventional treatments and/or other signaling inhibitors in novel therapeutic strategies.

  20. Microintaglio Printing of In situ Synthesized Proteins Enables Rapid Printing of High-Density Protein Microarrays Directly from DNA Microarrays

    Science.gov (United States)

    Biyani, Manish; Moriyasu, Junpei; Tanaka, Yoko; Sato, Shusuke; Ueno, Shingo; Ichiki, Takanori

    2013-08-01

    A simple and versatile approach to the simultaneous on-chip synthesis and printing of proteins has been studied for high-density protein microarray applications. The method used is based on the principle of intaglio printing using microengraved plates. Unlike conventional approaches that require multistep reactions for synthesizing proteins off the chip followed by printing using a robotic spotter, our approach demonstrates the following: (i) parallel and spotter-free printing of high-density protein microarrays directly from a type of DNA microarray and (ii) microcompartmentalization of cell-free coupled transcription/translation reaction and direct transferring of picoliter protein solution per spot to pattern microarrays of 25-100 µm features.

  1. The EADGENE Microarray Data Analysis Workshop (Open Access publication

    Directory of Open Access Journals (Sweden)

    Jiménez-Marín Ángeles

    2007-11-01

    Full Text Available Abstract Microarray analyses have become an important tool in animal genomics. While their use is becoming widespread, there is still a lot of ongoing research regarding the analysis of microarray data. In the context of a European Network of Excellence, 31 researchers representing 14 research groups from 10 countries performed and discussed the statistical analyses of real and simulated 2-colour microarray data that were distributed among participants. The real data consisted of 48 microarrays from a disease challenge experiment in dairy cattle, while the simulated data consisted of 10 microarrays from a direct comparison of two treatments (dye-balanced. While there was broader agreement with regards to methods of microarray normalisation and significance testing, there were major differences with regards to quality control. The quality control approaches varied from none, through using statistical weights, to omitting a large number of spots or omitting entire slides. Surprisingly, these very different approaches gave quite similar results when applied to the simulated data, although not all participating groups analysed both real and simulated data. The workshop was very successful in facilitating interaction between scientists with a diverse background but a common interest in microarray analyses.

  2. Oligonucleotides conjugated with short chemically defined polyethylene glycol chains are efficient antisense agents.

    Science.gov (United States)

    Shokrzadeh, Nasrin; Winkler, Anna-Maria; Dirin, Mehrdad; Winkler, Johannes

    2014-12-15

    Ligand conjugation is an attractive approach to rationally modify the poor pharmacokinetic behavior and cellular uptake properties of antisense oligonucleotides. Polyethylene glycol (PEG) attachment is a method to increase solubility of oligonucleotides and prevent the rapid elimination, thus increasing tissue distribution. On the other hand, the attachment of long PEG chains negatively influences the pharmacodynamic effect by reducing the hybridization efficiency. We examined the use of short PEG ligands on the in vitro effect of antisense agents. Circular dichroism showed that the tethering of PEG12-chains to phosphodiester and phosphorothioate oligonucleotides had no influence on their secondary structure and did not reduce the affinity to the counter strand. In an in vitro tumor model, a luciferase reporter assay indicated unchanged gene silencing activity compared to unmodified compounds, and even slightly superior target down regulation was found after treatment with a phosphorothioate modified conjugate. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Gene silencing by siRNAs and antisense oligonucleotides in the laboratory and the clinic

    Science.gov (United States)

    Watts, Jonathan K.; Corey, David R.

    2014-01-01

    Synthetic nucleic acids are commonly used laboratory tools for modulating gene expression and have the potential to be widely used in the clinic. Progress towards nucleic acid drugs, however, has been slow and many challenges remain to be overcome before their full impact on patient care can be understood. Antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs) are the two most widely used strategies for silencing gene expression. We first describe these two approaches and contrast their relative strengths and weaknesses for laboratory applications. We then review the choices faced during development of clinical candidates and the current state of clinical trials. Attitudes towards clinical development of nucleic acid silencing strategies have repeatedly swung from optimism to depression during the past twenty years. Our goal is to provide the information needed to design robust studies with oligonucleotides, making use of the strengths of each oligonucleotide technology. PMID:22069063

  4. Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

    Science.gov (United States)

    Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

    1996-11-01

    In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

  5. Oligonucleotide microarray for the identification of potential mycotoxigenic fungi on crops

    CSIR Research Space (South Africa)

    Lezar, S

    2009-09-01

    Full Text Available :3047-3054 P en F eF A V E R P en F eR P en E xR P en F eF P en C or R Penicillium corylophilum Penicillium expansum P en C or F P en E xR A ni gF P en F eF A N IG A ni gR P en E xF P en C or F P en C... or F P en E xR P en F eR A ni gF A ni gR A ni gR A N IG P en E xF A V E R P en C or R A ni gF P en F eR A V E R P en C or R Aspergillus versicolor A B P en E xF A N IG P en F eF A V E R...

  6. DNA Microarray-Based Diagnostics.

    Science.gov (United States)

    Marzancola, Mahsa Gharibi; Sedighi, Abootaleb; Li, Paul C H

    2016-01-01

    The DNA microarray technology is currently a useful biomedical tool which has been developed for a variety of diagnostic applications. However, the development pathway has not been smooth and the technology has faced some challenges. The reliability of the microarray data and also the clinical utility of the results in the early days were criticized. These criticisms added to the severe competition from other techniques, such as next-generation sequencing (NGS), impacting the growth of microarray-based tests in the molecular diagnostic market.Thanks to the advances in the underlying technologies as well as the tremendous effort offered by the research community and commercial vendors, these challenges have mostly been addressed. Nowadays, the microarray platform has achieved sufficient standardization and method validation as well as efficient probe printing, liquid handling and signal visualization. Integration of various steps of the microarray assay into a harmonized and miniaturized handheld lab-on-a-chip (LOC) device has been a goal for the microarray community. In this respect, notable progress has been achieved in coupling the DNA microarray with the liquid manipulation microsystem as well as the supporting subsystem that will generate the stand-alone LOC device.In this chapter, we discuss the major challenges that microarray technology has faced in its almost two decades of development and also describe the solutions to overcome the challenges. In addition, we review the advancements of the technology, especially the progress toward developing the LOC devices for DNA diagnostic applications.

  7. Mechanism of antisense oligonucleotide interaction with natural RNAs.

    Science.gov (United States)

    Serikov, R; Petyuk, V; Vorobijev, Y; Koval, V; Fedorova, O; Vlassov, V; Zenkova, M

    2011-08-01

    Oligonucleotides find several numbers of applications: as diagnostic probes, RT and PCR primers and antisense agents due to their ability of forming specific interactions with complementary nucleotide sequences within nucleic acids. These interactions are strongly affected by accessibility of the target sequence in the RNA structure. In the present work the mechanism of invasion of RNA structure by oligonucleotide was investigated using a model system: yeast tRNA(Phe) and oligonucleotides complementary to the 3'-part of this molecule. Kinetics of interaction of oligonucleotides with in vitro transcript of yeast tRNAPhe was studied using stopped-flow technique with fluorescence quenching detection, 5'-DABCYL labeled oligonucleotide was hybridized with 3'-fluorescein labeled tRNA(Phe). The results evidence for a four-step invasion process of the oligonucleotide-RNA complex formation. The process is initiated by formation of transition complexes with nucleotides in the T-loop and ACCA sequence. This complex formation is followed by RNA unfolding and formation of an extended heteroduplex with the oligonucleotide via strand displacement process. Computer modeling of oligonucleotide-tRNA(Phe) interaction revealed potential factors that could favor transition complexes formation and confirmed the proposed mechanism, showing the oligonucleotide to be a molecular "wedge". Our data evidence that oligonucleotide invasion into structured RNA is initiated by loop-single strand interactions, similar to the initial step of the antisense RNA-RNA interactions. The obtained results can be used for choosing efficient oligonucleotide probes.

  8. Microarray analysis reveals the actual specificity of enrichment media used for food safety assessment.

    Science.gov (United States)

    Kostić, Tanja; Stessl, Beatrix; Wagner, Martin; Sessitsch, Angela

    2011-06-01

    Microbial diagnostic microarrays are tools for simultaneous detection and identification of microorganisms in food, clinical, and environmental samples. In comparison to classic methods, microarray-based systems have the potential for high throughput, parallelism, and miniaturization. High specificity and high sensitivity of detection have been demonstrated. A microbial diagnostic microarray for the detection of the most relevant bacterial food- and waterborne pathogens and indicator organisms was developed and thoroughly validated. The microarray platform based on sequence-specific end labeling of oligonucleotides and the phylogenetically robust gyrB marker gene allowed a highly specific (resolution on genus and/or species level) and sensitive (0.1% relative and 10(4) CFU absolute sensitivity) detection of the target pathogens. In initial challenge studies of the applicability of microarray-based food analysis, we obtained results demonstrating the questionable specificity of standardized culture-dependent microbiological detection methods. Taking into consideration the importance of reliable food safety assessment methods, comprehensive performance assessment is essential. Results demonstrate the potential of this new pathogen diagnostic microarray to evaluate culture-based standard methods in microbiological food analysis.

  9. Microarray analysis of genes associated with cell surface NIS protein levels in breast cancer

    Directory of Open Access Journals (Sweden)

    Richardson Andrea L

    2011-10-01

    Full Text Available Abstract Background Na+/I- symporter (NIS-mediated iodide uptake allows radioiodine therapy for thyroid cancer. NIS is also expressed in breast tumors, raising potential for radionuclide therapy of breast cancer. However, NIS expression in most breast cancers is low and may not be sufficient for radionuclide therapy. We aimed to identify biomarkers associated with NIS expression such that mechanisms underlying NIS modulation in human breast tumors may be elucidated. Methods Published oligonucleotide microarray data within the National Center for Biotechnology Information Gene Expression Omnibus database were analyzed to identify gene expression tightly correlated with NIS mRNA level among human breast tumors. NIS immunostaining was performed in a tissue microarray composed of 28 human breast tumors which had corresponding oligonucleotide microarray data available for each tumor such that gene expression associated with cell surface NIS protein level could be identified. Results and Discussion NIS mRNA levels do not vary among breast tumors or when compared to normal breast tissues when detected by Affymetrix oligonucleotide microarray platforms. Cell surface NIS protein levels are much more variable than their corresponding NIS mRNA levels. Despite a limited number of breast tumors examined, our analysis identified cysteinyl-tRNA synthetase as a biomarker that is highly associated with cell surface NIS protein levels in the ER-positive breast cancer subtype. Conclusions Further investigation on genes associated with cell surface NIS protein levels within each breast cancer molecular subtype may lead to novel targets for selectively increasing NIS expression/function in a subset of breast cancers patients.

  10. Oligonucleotide Aptamers: New Tools for Targeted Cancer Therapy

    Directory of Open Access Journals (Sweden)

    Hongguang Sun

    2014-01-01

    Full Text Available Aptamers are a class of small nucleic acid ligands that are composed of RNA or single-stranded DNA oligonucleotides and have high specificity and affinity for their targets. Similar to antibodies, aptamers interact with their targets by recognizing a specific three-dimensional structure and are thus termed “chemical antibodies.” In contrast to protein antibodies, aptamers offer unique chemical and biological characteristics based on their oligonucleotide properties. Hence, they are more suitable for the development of novel clinical applications. Aptamer technology has been widely investigated in various biomedical fields for biomarker discovery, in vitro diagnosis, in vivo imaging, and targeted therapy. This review will discuss the potential applications of aptamer technology as a new tool for targeted cancer therapy with emphasis on the development of aptamers that are able to specifically target cell surface biomarkers. Additionally, we will describe several approaches for the use of aptamers in targeted therapeutics, including aptamer-drug conjugation, aptamer-nanoparticle conjugation, aptamer-mediated targeted gene therapy, aptamer-mediated immunotherapy, and aptamer-mediated biotherapy.

  11. Electrochemical study of hepta–oligonucleotides

    Directory of Open Access Journals (Sweden)

    Zdenka Balcarova

    2010-12-01

    Full Text Available The study deals with the description and characterization of twohepta–oligonucleotides (DNA and RNA forming special structures.We studied their electrochemical behaviour by means of cyclicvoltammetry (CV and elimination voltammetry with linear scan(EVLS in combination with adsorptive stripping (AdS technique.Differences in electrochemical behaviour of hepta–deoxyribonucleotide and its RNA analog were discussed with regardto their different structures in solutions and their melting points.

  12. Abundant oligonucleotides common to most bacteria.

    Directory of Open Access Journals (Sweden)

    Colin F Davenport

    Full Text Available BACKGROUND: Bacteria show a bias in their genomic oligonucleotide composition far beyond that dictated by G+C content. Patterns of over- and underrepresented oligonucleotides carry a phylogenetic signal and are thus diagnostic for individual species. Patterns of short oligomers have been investigated by multiple groups in large numbers of bacteria genomes. However, global distributions of the most highly overrepresented mid-sized oligomers have not been assessed across all prokaryotes to date. We surveyed overrepresented mid-length oligomers across all prokaryotes and normalised for base composition and embedded oligomers using zero and second order Markov models. PRINCIPAL FINDINGS: Here we report a presumably ancient set of oligomers conserved and overrepresented in nearly all branches of prokaryotic life, including Archaea. These oligomers are either adenine rich homopurines with one to three guanine nucleosides, or homopyridimines with one to four cytosine nucleosides. They do not show a consistent preference for coding or non-coding regions or aggregate in any coding frame, implying a role in DNA structure and as polypeptide binding sites. Structural parameters indicate these oligonucleotides to be an extreme and rigid form of B-DNA prone to forming triple stranded helices under common physiological conditions. Moreover, the narrow minor grooves of these structures are recognised by DNA binding and nucleoid associated proteins such as HU. CONCLUSION: Homopurine and homopyrimidine oligomers exhibit distinct and unusual structural features and are present at high copy number in nearly all prokaryotic lineages. This fact suggests a non-neutral role of these oligonucleotides for bacterial genome organization that has been maintained throughout evolution.

  13. Synthesis and hybridization properties of inverse oligonucleotides.

    OpenAIRE

    Marangoni, M.; Van Aerschot, Arthur; Augustijns, Patrick; Rozenski, Jef; Herdewijn , Piet

    1997-01-01

    The synthesis of adenine and thymine cyclopentylethyl nucleosides is presented. This novel constrained monomeric building block is very difficult to incorporate into oligonucleotides. It was introduced in 13mer oligodeoxynucleotide sequences at a single position using H-phosphonate chemistry. Phosphoramidite chemistry completely failed in this particular case. The H-phosphonate building blocks were obtained starting from the corresponding phosphoramidites. Stability of duplexes with RNA and D...

  14. Evaluation of methods for oligonucleotide array data via quantitative real-time PCR

    Directory of Open Access Journals (Sweden)

    Morris Daryl E

    2006-01-01

    Full Text Available Abstract Background There are currently many different methods for processing and summarizing probe-level data from Affymetrix oligonucleotide arrays. It is of great interest to validate these methods and identify those that are most effective. There is no single best way to do this validation, and a variety of approaches is needed. Moreover, gene expression data are collected to answer a variety of scientific questions, and the same method may not be best for all questions. Only a handful of validation studies have been done so far, most of which rely on spike-in datasets and focus on the question of detecting differential expression. Here we seek methods that excel at estimating relative expression. We evaluate methods by identifying those that give the strongest linear association between expression measurements by array and the "gold-standard" assay. Quantitative reverse-transcription polymerase chain reaction (qRT-PCR is generally considered the "gold-standard" assay for measuring gene expression by biologists and is often used to confirm findings from microarray data. Here we use qRT-PCR measurements to validate methods for the components of processing oligo array data: background adjustment, normalization, mismatch adjustment, and probeset summary. An advantage of our approach over spike-in studies is that methods are validated on a real dataset that was collected to address a scientific question. Results We initially identify three of six popular methods that consistently produced the best agreement between oligo array and RT-PCR data for medium- and high-intensity genes. The three methods are generally known as MAS5, gcRMA, and the dChip mismatch mode. For medium- and high-intensity genes, we identified use of data from mismatch probes (as in MAS5 and dChip mismatch and a sequence-based method of background adjustment (as in gcRMA as the most important factors in methods' performances. However, we found poor reliability for methods

  15. Genome-wide transcription analyses in rice using tiling microarrays

    DEFF Research Database (Denmark)

    Li, Lei; Wang, Xiangfeng; Stolc, Viktor;

    2006-01-01

    Sequencing and computational annotation revealed several features, including high gene numbers, unusual composition of the predicted genes and a large number of genes lacking homology to known genes, that distinguish the rice (Oryza sativa) genome from that of other fully sequenced model species....... We report here a full-genome transcription analysis of the indica rice subspecies using high-density oligonucleotide tiling microarrays. Our results provided expression data support for the existence of 35,970 (81.9%) annotated gene models and identified 5,464 unique transcribed intergenic regions...... activity between duplicated segments of the genome. Collectively, our results provide the first whole-genome transcription map useful for further understanding the rice genome. Udgivelsesdato: 2006-Jan...

  16. Carbohydrate Microarrays in Plant Science

    DEFF Research Database (Denmark)

    Fangel, Jonatan Ulrik; Pedersen, H.L.; Vidal-Melgosa, S.

    2012-01-01

    industrially and nutritionally. Understanding the biological roles of plant glycans and the effective exploitation of their useful properties requires a detailed understanding of their structures, occurrence, and molecular interactions. Microarray technology has revolutionized the massively high......-throughput analysis of nucleotides, proteins, and increasingly carbohydrates. Using microarrays, the abundance of and interactions between hundreds and thousands of molecules can be assessed simultaneously using very small amounts of analytes. Here we show that carbohydrate microarrays are multifunctional tools...... for plant research and can be used to map glycan populations across large numbers of samples to screen antibodies, carbohydrate binding proteins, and carbohydrate binding modules and to investigate enzyme activities....

  17. Transfection microarray and the applications.

    Science.gov (United States)

    Miyake, Masato; Yoshikawa, Tomohiro; Fujita, Satoshi; Miyake, Jun

    2009-05-01

    Microarray transfection has been extensively studied for high-throughput functional analysis of mammalian cells. However, control of efficiency and reproducibility are the critical issues for practical use. By using solid-phase transfection accelerators and nano-scaffold, we provide a highly efficient and reproducible microarray-transfection device, "transfection microarray". The device would be applied to the limited number of available primary cells and stem cells not only for large-scale functional analysis but also reporter-based time-lapse cellular event analysis.

  18. Microarray analyses of SREBP-1a and SREBP-1c target genes identify new regulatory pathways in muscle.

    OpenAIRE

    Rome, Sophie; Lecomte, Virginie; Meugnier, Emmanuelle; Rieusset, Jennifer; Debard, Cyrille; Euthine, Vanessa; Vidal, Hubert; Lefai, Etienne

    2008-01-01

    International audience; In this study we have identified the target genes of sterol regulatory element binding protein (SREBP)-1a and SREBP-1c in primary cultures of human skeletal muscle cells, using adenoviral vectors expressing the mature nuclear form of human SREBP-1a or SREBP-1c combined with oligonucleotide microarrays. Overexpression of SREBP-1a led to significant changes in the expression of 1,315 genes (655 upregulated and 660 downregulated), whereas overexpression of SREBP-1c modifi...

  19. Discovery and development of the G-rich oligonucleotide AS1411 as a novel treatment for cancer.

    Science.gov (United States)

    Bates, Paula J; Laber, Damian A; Miller, Donald M; Thomas, Shelia D; Trent, John O

    2009-06-01

    Certain guanine-rich (G-rich) DNA and RNA molecules can associate intermolecularly or intramolecularly to form four stranded or "quadruplex" structures, which have unusual biophysical and biological properties. Several synthetic G-rich quadruplex-forming oligodeoxynucleotides have recently been investigated as therapeutic agents for various human diseases. We refer to these biologically active G-rich oligonucleotides as aptamers because their activities arise from binding to protein targets via shape-specific recognition (analogous to antibody-antigen binding). As therapeutic agents, the G-rich aptamers may have some advantages over monoclonal antibodies and other oligonucleotide-based approaches. For example, quadruplex oligonucleotides are non-immunogenic, heat stable and they have increased resistance to serum nucleases and enhanced cellular uptake compared to unstructured sequences. In this review, we describe the characteristics and activities of G-rich oligonucleotides. We also give a personal perspective on the discovery and development of AS1411, an antiproliferative G-rich phosphodiester oligonucleotide that is currently being tested as an anticancer agent in Phase II clinical trials. This molecule functions as an aptamer to nucleolin, a multifunctional protein that is highly expressed by cancer cells, both intracellularly and on the cell surface. Thus, the serendipitous discovery of the G-rich oligonucleotides also led to the identification of nucleolin as a new molecular target for cancer therapy.

  20. Effect of iontophoresis on the in vitro trans-scleral transport of three single stranded oligonucleotides.

    Science.gov (United States)

    Pescina, Silvia; Antopolsky, Maxim; Santi, Patrizia; Nicoli, Sara; Murtomäki, Lasse

    2013-05-13

    Oligonucleotides represent a subject of clinical interest due to their potential ability to treat several diseases, including those affecting the posterior segment of the eye. Unfortunately, therapeutic oligonucleotides are currently administered by means of highly invasive approaches, such as intravitreal injections. The aim of the present work was to study in vitro, across isolated bovine sclera, the effect of iontophoresis on the transport of three single stranded oligonucleotides (ssDNA), 12-, 24- and 36-mer, selected as reference compounds in view of a non-invasive drug delivery to the back of the eye. All the three sequences were able to cross bovine sclera in vitro without iontophoresis. When anodal iontophoresis was applied, no change in flux was observed, while in the presence of cathodal iontophoresis the permeability coefficients increased four-fold compared to passive conditions. This behavior can be ascribed to the electrorepulsive mechanism, due to the negative charge of the nucleic acid backbone. It was also observed that the molecular weights of the three sequences did not affect trans-scleral transport, neither in passive, nor in current assisted permeation. Furthermore, increasing the current intensity from 1.75 mA to 3 mA, no effect on the trans-scleral transport of the 24-mer was noticed. Although preliminary, the results demonstrate that cathodal iontophoresis enhances trans-scleral transport of single stranded oligonucleotides and suggest its use as a novel non-invasive approach for the treatment of diseases affecting the posterior segment of the eye.

  1. Cell-Based Microarrays for In Vitro Toxicology.

    Science.gov (United States)

    Wegener, Joachim

    2015-01-01

    DNA/RNA and protein microarrays have proven their outstanding bioanalytical performance throughout the past decades, given the unprecedented level of parallelization by which molecular recognition assays can be performed and analyzed. Cell microarrays (CMAs) make use of similar construction principles. They are applied to profile a given cell population with respect to the expression of specific molecular markers and also to measure functional cell responses to drugs and chemicals. This review focuses on the use of cell-based microarrays for assessing the cytotoxicity of drugs, toxins, or chemicals in general. It also summarizes CMA construction principles with respect to the cell types that are used for such microarrays, the readout parameters to assess toxicity, and the various formats that have been established and applied. The review ends with a critical comparison of CMAs and well-established microtiter plate (MTP) approaches.

  2. Cell-Based Microarrays for In Vitro Toxicology

    Science.gov (United States)

    Wegener, Joachim

    2015-07-01

    DNA/RNA and protein microarrays have proven their outstanding bioanalytical performance throughout the past decades, given the unprecedented level of parallelization by which molecular recognition assays can be performed and analyzed. Cell microarrays (CMAs) make use of similar construction principles. They are applied to profile a given cell population with respect to the expression of specific molecular markers and also to measure functional cell responses to drugs and chemicals. This review focuses on the use of cell-based microarrays for assessing the cytotoxicity of drugs, toxins, or chemicals in general. It also summarizes CMA construction principles with respect to the cell types that are used for such microarrays, the readout parameters to assess toxicity, and the various formats that have been established and applied. The review ends with a critical comparison of CMAs and well-established microtiter plate (MTP) approaches.

  3. Novel approach to meta-analysis of microarray datasets reveals muscle remodeling-related drug targets and biomarkers in Duchenne muscular dystrophy.

    Directory of Open Access Journals (Sweden)

    Ekaterina Kotelnikova

    2012-02-01

    Full Text Available Elucidation of new biomarkers and potential drug targets from high-throughput profiling data is a challenging task due to a limited number of available biological samples and questionable reproducibility of differential changes in cross-dataset comparisons. In this paper we propose a novel computational approach for drug and biomarkers discovery using comprehensive analysis of multiple expression profiling datasets.The new method relies on aggregation of individual profiling experiments combined with leave-one-dataset-out validation approach. Aggregated datasets were studied using Sub-Network Enrichment Analysis algorithm (SNEA to find consistent statistically significant key regulators within the global literature-extracted expression regulation network. These regulators were linked to the consistent differentially expressed genes.We have applied our approach to several publicly available human muscle gene expression profiling datasets related to Duchenne muscular dystrophy (DMD. In order to detect both enhanced and repressed processes we considered up- and down-regulated genes separately. Applying the proposed approach to the regulators search we discovered the disturbance in the activity of several muscle-related transcription factors (e.g. MYOG and MYOD1, regulators of inflammation, regeneration, and fibrosis. Almost all SNEA-derived regulators of down-regulated genes (e.g. AMPK, TORC2, PPARGC1A correspond to a single common pathway important for fast-to-slow twitch fiber type transition. We hypothesize that this process can affect the severity of DMD symptoms, making corresponding regulators and downstream genes valuable candidates for being potential drug targets and exploratory biomarkers.

  4. Microarray Scanner for Fluorescence Detection

    Institute of Scientific and Technical Information of China (English)

    Wang Liqiang; Lu zukang; Li Yingsheng; Zheng Xufeng

    2003-01-01

    A novel pseudo confocal microarray scanner is introduced, in which one dimension scanning is performed by a galvanometer optical scanner and a telecentric objective, another dimension scanning is performed by a stepping motor.

  5. Template-Directed Ligation of Peptides to Oligonucleotides

    Science.gov (United States)

    Bruick, Richard K.; Dawson, Philip E.; Kent, Stephen BH; Usman, Nassim; Joyce, Gerald F.

    1996-01-01

    Synthetic oligonucleotides and peptides have enjoyed a wide range of applications in both biology and chemistry. As a consequence, oligonucleotide-peptide conjugates have received considerable attention, most notably in the development of antisense constructs with improved pharmacological properties. In addition, oligonucleotide-peptide conjugates have been used as molecular tags, in the assembly of supramolecular arrays and in the construction of encoded combinatorial libraries. To make these chimeric molecules more accessible for a broad range of investigations, we sought to develop a facile method for joining fully deprotected oligonucleotides and peptides through a stable amide bond linkage. Furthermore, we wished to make this ligation reaction addressable, enabling one to direct the ligation of specific oligonucleotide and peptide components.To confer specificity and accelerate the rate of the reaction, the ligation process was designed to be dependent on the presence of a complementary oligonucleotide template.

  6. Microarrays for rapid identification of plant viruses.

    Science.gov (United States)

    Boonham, Neil; Tomlinson, Jenny; Mumford, Rick

    2007-01-01

    Many factors affect the development and application of diagnostic techniques. Plant viruses are an inherently diverse group that, unlike cellular pathogens, possess no nucleotide sequence type (e.g., ribosomal RNA sequences) in common. Detection of plant viruses is becoming more challenging as globalization of trade, particularly in ornamentals, and the potential effects of climate change enhance the movement of viruses and their vectors, transforming the diagnostic landscape. Techniques for assessing seed, other propagation materials and field samples for the presence of specific viruses include biological indexing, electron microscopy, antibody-based detection, including enzyme-linked immunosorbent assay (ELISA), polymerase chain reaction (PCR), and microarray detection. Of these, microarray detection provides the greatest capability for parallel yet specific testing, and can be used to detect individual, or combinations of viruses and, using current approaches, to do so with a sensitivity comparable to ELISA. Methods based on PCR provide the greatest sensitivity among the listed techniques but are limited in parallel detection capability even in "multiplexed" applications. Various aspects of microarray technology, including probe development, array fabrication, assay target preparation, hybridization, washing, scanning, and interpretation are presented and discussed, for both current and developing technology.

  7. A New Distribution Family for Microarray Data

    Directory of Open Access Journals (Sweden)

    Diana Mabel Kelmansky

    2017-02-01

    Full Text Available The traditional approach with microarray data has been to apply transformations that approximately normalize them, with the drawback of losing the original scale. The alternative stand point taken here is to search for models that fit the data, characterized by the presence of negative values, preserving their scale; one advantage of this strategy is that it facilitates a direct interpretation of the results. A new family of distributions named gpower-normal indexed by p∈R is introduced and it is proven that these variables become normal or truncated normal when a suitable gpower transformation is applied. Expressions are given for moments and quantiles, in terms of the truncated normal density. This new family can be used to model asymmetric data that include non-positive values, as required for microarray analysis. Moreover, it has been proven that the gpower-normal family is a special case of pseudo-dispersion models, inheriting all the good properties of these models, such as asymptotic normality for small variances. A combined maximum likelihood method is proposed to estimate the model parameters, and it is applied to microarray and contamination data. Rcodes are available from the authors upon request.

  8. The IronChip evaluation package: a package of perl modules for robust analysis of custom microarrays

    Directory of Open Access Journals (Sweden)

    Brazma Alvis

    2010-03-01

    Full Text Available Abstract Background Gene expression studies greatly contribute to our understanding of complex relationships in gene regulatory networks. However, the complexity of array design, production and manipulations are limiting factors, affecting data quality. The use of customized DNA microarrays improves overall data quality in many situations, however, only if for these specifically designed microarrays analysis tools are available. Results The IronChip Evaluation Package (ICEP is a collection of Perl utilities and an easy to use data evaluation pipeline for the analysis of microarray data with a focus on data quality of custom-designed microarrays. The package has been developed for the statistical and bioinformatical analysis of the custom cDNA microarray IronChip but can be easily adapted for other cDNA or oligonucleotide-based designed microarray platforms. ICEP uses decision tree-based algorithms to assign quality flags and performs robust analysis based on chip design properties regarding multiple repetitions, ratio cut-off, background and negative controls. Conclusions ICEP is a stand-alone Windows application to obtain optimal data quality from custom-designed microarrays and is freely available here (see "Additional Files" section and at: http://www.alice-dsl.net/evgeniy.vainshtein/ICEP/

  9. De novo Transcriptome Sequencing and Development of Abscission Zone-Specific Microarray as a New Molecular Tool for Analysis of Tomato Organ Abscission

    Science.gov (United States)

    Sundaresan, Srivignesh; Philosoph-Hadas, Sonia; Riov, Joseph; Mugasimangalam, Raja; Kuravadi, Nagesh A.; Kochanek, Bettina; Salim, Shoshana; Tucker, Mark L.; Meir, Shimon

    2016-01-01

    Abscission of flower pedicels and leaf petioles of tomato (Solanum lycopersicum) can be induced by flower removal or leaf deblading, respectively, which leads to auxin depletion, resulting in increased sensitivity of the abscission zone (AZ) to ethylene. However, the molecular mechanisms that drive the acquisition of abscission competence and its modulation by auxin gradients are not yet known. We used RNA-Sequencing (RNA-Seq) to obtain a comprehensive transcriptome of tomato flower AZ (FAZ) and leaf AZ (LAZ) during abscission. RNA-Seq was performed on a pool of total RNA extracted from tomato FAZ and LAZ, at different abscission stages, followed by de novo assembly. The assembled clusters contained transcripts that are already known in the Solanaceae (SOL) genomics and NCBI databases, and over 8823 identified novel tomato transcripts of varying sizes. An AZ-specific microarray, encompassing the novel transcripts identified in this study and all known transcripts from the SOL genomics and NCBI databases, was constructed to study the abscission process. Multiple probes for longer genes and key AZ-specific genes, including antisense probes for all transcripts, make this array a unique tool for studying abscission with a comprehensive set of transcripts, and for mining for naturally occurring antisense transcripts. We focused on comparing the global transcriptomes generated from the FAZ and the LAZ to establish the divergences and similarities in their transcriptional networks, and particularly to characterize the processes and transcriptional regulators enriched in gene clusters that are differentially regulated in these two AZs. This study is the first attempt to analyze the global gene expression in different AZs in tomato by combining the RNA-Seq technique with oligonucleotide microarrays. Our AZ-specific microarray chip provides a cost-effective approach for expression profiling and robust analysis of multiple samples in a rapid succession. PMID:26834766

  10. De novo transcriptome sequencing and development of abscission zone-specific microarray as a new molecular tool for analysis of tomato organ abscission

    Directory of Open Access Journals (Sweden)

    Srivignesh eSundaresan

    2016-01-01

    Full Text Available Abscission of flower pedicels and leaf petioles of tomato (Solanum lycopersicum can be induced by flower removal or leaf deblading, respectively, leading to auxin depletion, which results in increased sensitivity of the abscission zone (AZ to ethylene. However, the molecular mechanisms that drive the acquisition of abscission competence and its modulation by auxin gradients are not yet known. We used RNA-Sequencing (RNA-Seq to obtain the comprehensive transcriptome of tomato flower AZ (FAZ and leaf AZ (LAZ during abscission. RNA-Seq was performed on a pool of total RNA extracted from different abscission stages of tomato FAZ and LAZ, followed by de novo assembly. The assembled clusters contained transcripts that are already known in Solanaceae (SOL genomics database and NCBI databases, and over 8,823 identified novel tomato transcripts of varying sizes. An AZ-specific microarray, encompassing these novel transcripts identified in this study and all known transcripts from the SOL genomics and NCBI databases, was constructed to study the abscission process. Multiple probes for longer genes and key AZ-specific genes, including antisense probes for all transcripts, make this array a unique tool for studying abscission with a comprehensive set of transcripts, and for mining for naturally occurring antisense transcripts. We focused on comparing the global transcriptomes generated from the FAZ and the LAZ to establish the divergences and similarities in their transcriptional networks, and particularly to characterize the processes and transcriptional regulators enriched in gene clusters that are differentially regulated in these two AZs. This study is the first attempt to analyze the global gene expression in different AZs in tomato by combining the RNA-Seq technique with oligonucleotide microarrays. Our AZ-specific microarray chip provides a cost-effective approach for expression profiling and robust analysis of multiple samples in a rapid succession.

  11. Linking microarray reporters with protein functions

    Directory of Open Access Journals (Sweden)

    Gaj Stan

    2007-09-01

    Full Text Available Abstract Background The analysis of microarray experiments requires accurate and up-to-date functional annotation of the microarray reporters to optimize the interpretation of the biological processes involved. Pathway visualization tools are used to connect gene expression data with existing biological pathways by using specific database identifiers that link reporters with elements in the pathways. Results This paper proposes a novel method that aims to improve microarray reporter annotation by BLASTing the original reporter sequences against a species-specific EMBL subset, that was derived from and crosslinked back to the highly curated UniProt database. The resulting alignments were filtered using high quality alignment criteria and further compared with the outcome of a more traditional approach, where reporter sequences were BLASTed against EnsEMBL followed by locating the corresponding protein (UniProt entry for the high quality hits. Combining the results of both methods resulted in successful annotation of > 58% of all reporter sequences with UniProt IDs on two commercial array platforms, increasing the amount of Incyte reporters that could be coupled to Gene Ontology terms from 32.7% to 58.3% and to a local GenMAPP pathway from 9.6% to 16.7%. For Agilent, 35.3% of the total reporters are now linked towards GO nodes and 7.1% on local pathways. Conclusion Our methods increased the annotation quality of microarray reporter sequences and allowed us to visualize more reporters using pathway visualization tools. Even in cases where the original reporter annotation showed the correct description the new identifiers often allowed improved pathway and Gene Ontology linking. These methods are freely available at http://www.bigcat.unimaas.nl/public/publications/Gaj_Annotation/.

  12. Error, reproducibility and sensitivity: a pipeline for data processing of Agilent oligonucleotide expression arrays

    Directory of Open Access Journals (Sweden)

    Posch Wilfried

    2010-06-01

    Full Text Available Abstract Background Expression microarrays are increasingly used to obtain large scale transcriptomic information on a wide range of biological samples. Nevertheless, there is still much debate on the best ways to process data, to design experiments and analyse the output. Furthermore, many of the more sophisticated mathematical approaches to data analysis in the literature remain inaccessible to much of the biological research community. In this study we examine ways of extracting and analysing a large data set obtained using the Agilent long oligonucleotide transcriptomics platform, applied to a set of human macrophage and dendritic cell samples. Results We describe and validate a series of data extraction, transformation and normalisation steps which are implemented via a new R function. Analysis of replicate normalised reference data demonstrate that intrarray variability is small (only around 2% of the mean log signal, while interarray variability from replicate array measurements has a standard deviation (SD of around 0.5 log2 units ( 6% of mean. The common practise of working with ratios of Cy5/Cy3 signal offers little further improvement in terms of reducing error. Comparison to expression data obtained using Arabidopsis samples demonstrates that the large number of genes in each sample showing a low level of transcription reflect the real complexity of the cellular transcriptome. Multidimensional scaling is used to show that the processed data identifies an underlying structure which reflect some of the key biological variables which define the data set. This structure is robust, allowing reliable comparison of samples collected over a number of years and collected by a variety of operators. Conclusions This study outlines a robust and easily implemented pipeline for extracting, transforming normalising and visualising transcriptomic array data from Agilent expression platform. The analysis is used to obtain quantitative estimates of

  13. Application of hybridization control probe to increase accuracy on ligation detection or minisequencing diagnostic microarrays

    Directory of Open Access Journals (Sweden)

    Hultman Jenni

    2009-12-01

    Full Text Available Abstract Background Nucleic acid detection based on ligation reaction or single nucleotide extension of ssDNA probes followed by tag microarray hybridization provides an accurate and sensitive detection tool for various diagnostic purposes. Since microarray quality is crucial for reliable detection, these methods can benefit from correcting for microarray artefacts using specifically adapted techniques. Findings Here we demonstrate the application of a per-spot hybridization control oligonucleotide probe and a novel way of computing normalization for tag array data. The method takes into account the absolute value of the detection probe signal and the variability in the control probe signal to significantly alleviate problems caused by artefacts and noise on low quality microarrays. Conclusions Diagnostic microarray platforms require experimental and computational tools to enable efficient correction of array artefacts. The techniques presented here improve the signal to noise ratio and help in determining true positives with better statistical significance and in allowing the use of arrays with poor quality that would otherwise be discarded.

  14. Development and application of the active surveillance of pathogens microarray to monitor bacterial gene flux

    Directory of Open Access Journals (Sweden)

    Hinds Jason

    2008-10-01

    Full Text Available Abstract Background Human and animal health is constantly under threat by emerging pathogens that have recently acquired genetic determinants that enhance their survival, transmissibility and virulence. We describe the construction and development of an Active Surveillance of Pathogens (ASP oligonucleotide microarray, designed to 'actively survey' the genome of a given bacterial pathogen for virulence-associated genes. Results The microarray consists of 4958 reporters from 151 bacterial species and include genes for the identification of individual bacterial species as well as mobile genetic elements (transposons, plasmid and phage, virulence genes and antibiotic resistance genes. The ASP microarray was validated with nineteen bacterial pathogens species, including Francisella tularensis, Clostridium difficile, Staphylococcus aureus, Enterococcus faecium and Stenotrophomonas maltophilia. The ASP microarray identified these bacteria, and provided information on potential antibiotic resistance (eg sufamethoxazole resistance and sulfonamide resistance and virulence determinants including genes likely to be acquired by horizontal gene transfer (e.g. an alpha-haemolysin. Conclusion The ASP microarray has potential in the clinic as a diagnostic tool, as a research tool for both known and emerging pathogens, and as an early warning system for pathogenic bacteria that have been recently modified either naturally or deliberately.

  15. In Situ-Synthesized Novel Microarray Optimized for Mouse Stem Cell and Early Developmental Expression Profiling

    Science.gov (United States)

    Carter, Mark G.; Hamatani, Toshio; Sharov, Alexei A.; Carmack, Condie E.; Qian, Yong; Aiba, Kazuhiro; Ko, Naomi T.; Dudekula, Dawood B.; Brzoska, Pius M.; Hwang, S. Stuart; Ko, Minoru S.H.

    2003-01-01

    Applications of microarray technologies to mouse embryology/genetics have been limited, due to the nonavailability of microarrays containing large numbers of embryonic genes and the gap between microgram quantities of RNA required by typical microarray methods and the miniscule amounts of tissue available to researchers. To overcome these problems, we have developed a microarray platform containing in situ-synthesized 60-mer oligonucleotide probes representing approximately 22,000 unique mouse transcripts, assembled primarily from sequences of stem cell and embryo cDNA libraries. We have optimized RNA labeling protocols and experimental designs to use as little as 2 ng total RNA reliably and reproducibly. At least 98% of the probes contained in the microarray correspond to clones in our publicly available collections, making cDNAs readily available for further experimentation on genes of interest. These characteristics, combined with the ability to profile very small samples, make this system a resource for stem cell and embryogenomics research. [Supplemental material is available online at www.genome.org and at the NIA Mouse cDNA Project Web site, http://lgsun.grc.nia.nih.gov/cDNA/cDNA.html.] PMID:12727912

  16. Fabrication of DNA Microarrays on Polydopamine-Modified Gold Thin Films for SPR Imaging Measurements

    Science.gov (United States)

    Wood, Jennifer B.; Szyndler, Megan W.; Halpern, Aaron R.; Cho, Kyunghee

    2013-01-01

    Polydopamine (PDA) films were fabricated on thin film gold substrates in a single-step polymerization-deposition process from dopamine solutions and then employed in the construction of robust DNA microarrays for the ultra-sensitive detection of biomolecules with nanoparticle-enhanced surface plasmon resonance (SPR) imaging. PDA multilayers with thicknesses varying from 1 to 5 nm were characterized with a combination of scanning angle SPR and AFM experiments, and 1.3 ± 0.2 nm PDA multilayers were chosen as an optimal thickness for the SPR imaging measurements. DNA microarrays were then fabricated by the reaction of amine-functionalized single-stranded DNA (ssDNA) oligonucleotides with PDA-modified gold thin film microarray elements, and were subsequently employed in SPR imaging measurements of DNA hybridization adsorption and protein-DNA binding. Concurrent control experiments with noncomplementary ssDNA sequences demonstrated that the adhesive PDA multilayer was also able to provide good resistance to the nonspecific binding of biomolecules. Finally, a series of SPR imaging measurements of the hybridization adsorption of DNA-modified gold nanoparticles onto mixed sequence DNA microarrays were used to confirm that the use of PDA multilayer films is a simple, rapid and versatile method for fabricating DNA microarrays for ultrasensitive nanoparticle-enhanced SPR imaging biosensing. PMID:23902428

  17. Fabrication of DNA microarrays on polydopamine-modified gold thin films for SPR imaging measurements.

    Science.gov (United States)

    Wood, Jennifer B; Szyndler, Megan W; Halpern, Aaron R; Cho, Kyunghee; Corn, Robert M

    2013-08-27

    Polydopamine (PDA) films were fabricated on thin film gold substrates in a single-step polymerization-deposition process from dopamine solutions and then employed in the construction of robust DNA microarrays for the ultrasensitive detection of biomolecules with nanoparticle-enhanced surface plasmon resonance (SPR) imaging. PDA multilayers with thicknesses varying from 1 to 5 nm were characterized with a combination of scanning angle SPR and AFM experiments, and 1.3 ± 0.2 nm PDA multilayers were chosen as an optimal thickness for the SPR imaging measurements. DNA microarrays were then fabricated by the reaction of amine-functionalized single-stranded DNA (ssDNA) oligonucleotides with PDA-modified gold thin film microarray elements, and were subsequently employed in SPR imaging measurements of DNA hybridization adsorption and protein-DNA binding. Concurrent control experiments with non-complementary ssDNA sequences demonstrated that the adhesive PDA multilayer was also able to provide good resistance to the nonspecific binding of biomolecules. Finally, a series of SPR imaging measurements of the hybridization adsorption of DNA-modified gold nanoparticles onto mixed sequence DNA microarrays were used to confirm that the use of PDA multilayer films is a simple, rapid, and versatile method for fabricating DNA microarrays for ultrasensitive nanoparticle-enhanced SPR imaging biosensing.

  18. An event-specific DNA microarray to identify genetically modified organisms in processed foods.

    Science.gov (United States)

    Kim, Jae-Hwan; Kim, Su-Youn; Lee, Hyungjae; Kim, Young-Rok; Kim, Hae-Yeong

    2010-05-26

    We developed an event-specific DNA microarray system to identify 19 genetically modified organisms (GMOs), including two GM soybeans (GTS-40-3-2 and A2704-12), thirteen GM maizes (Bt176, Bt11, MON810, MON863, NK603, GA21, T25, TC1507, Bt10, DAS59122-7, TC6275, MIR604, and LY038), three GM canolas (GT73, MS8xRF3, and T45), and one GM cotton (LLcotton25). The microarray included 27 oligonucleotide probes optimized to identify endogenous reference targets, event-specific targets, screening targets (35S promoter and nos terminator), and an internal target (18S rRNA gene). Thirty-seven maize-containing food products purchased from South Korean and US markets were tested for the presence of GM maize using this microarray system. Thirteen GM maize events were simultaneously detected using multiplex PCR coupled with microarray on a single chip, at a limit of detection of approximately 0.5%. Using the system described here, we detected GM maize in 11 of the 37 food samples tested. These results suggest that an event-specific DNA microarray system can reliably detect GMOs in processed foods.

  19. Lipid Oligonucleotide Conjugates as Responsive Material

    Science.gov (United States)

    2012-09-28

    U.S. Army Research Office P.O. Box 12211 Research Triangle Park, NC 27709-2211 15. SUBJECT TERMS Amphiphiles, oligonucleotides, lipids...peer-reviewed journals: (c) Presentations 1. Philippe Barthélémy, « Hybrid Lipids for Biomedical Applications », Targeting and Triggering Basic Research ...Steadel C. ; Pierre, N. ; Barthélémy, P. : Oligonucléotides amphiphile : Journée Scientifique de l’IFR 66, Talence, le 2 décembre 2008, France 29. Taib

  20. Comparative analysis of copy number detection by whole-genome BAC and oligonucleotide array CGH

    Directory of Open Access Journals (Sweden)

    Bejjani Bassem A

    2010-06-01

    Full Text Available Abstract Background Microarray-based comparative genomic hybridization (aCGH is a powerful diagnostic tool for the detection of DNA copy number gains and losses associated with chromosome abnormalities, many of which are below the resolution of conventional chromosome analysis. It has been presumed that whole-genome oligonucleotide (oligo arrays identify more clinically significant copy-number abnormalities than whole-genome bacterial artificial chromosome (BAC arrays, yet this has not been systematically studied in a clinical diagnostic setting. Results To determine the difference in detection rate between similarly designed BAC and oligo arrays, we developed whole-genome BAC and oligonucleotide microarrays and validated them in a side-by-side comparison of 466 consecutive clinical specimens submitted to our laboratory for aCGH. Of the 466 cases studied, 67 (14.3% had a copy-number imbalance of potential clinical significance detectable by the whole-genome BAC array, and 73 (15.6% had a copy-number imbalance of potential clinical significance detectable by the whole-genome oligo array. However, because both platforms identified copy number variants of unclear clinical significance, we designed a systematic method for the interpretation of copy number alterations and tested an additional 3,443 cases by BAC array and 3,096 cases by oligo array. Of those cases tested on the BAC array, 17.6% were found to have a copy-number abnormality of potential clinical significance, whereas the detection rate increased to 22.5% for the cases tested by oligo array. In addition, we validated the oligo array for detection of mosaicism and found that it could routinely detect mosaicism at levels of 30% and greater. Conclusions Although BAC arrays have faster turnaround times, the increased detection rate of oligo arrays makes them attractive for clinical cytogenetic testing.

  1. Analysis of oligonucleotide array experiments with repeated measures using mixed models

    Directory of Open Access Journals (Sweden)

    Getchell Thomas V

    2004-12-01

    Full Text Available Abstract Background Two or more factor mixed factorial experiments are becoming increasingly common in microarray data analysis. In this case study, the two factors are presence (Patients with Alzheimer's disease or absence (Control of the disease, and brain regions including olfactory bulb (OB or cerebellum (CER. In the design considered in this manuscript, OB and CER are repeated measurements from the same subject and, hence, are correlated. It is critical to identify sources of variability in the analysis of oligonucleotide array experiments with repeated measures and correlations among data points have to be considered. In addition, multiple testing problems are more complicated in experiments with multi-level treatments or treatment combinations. Results In this study we adopted a linear mixed model to analyze oligonucleotide array experiments with repeated measures. We first construct a generalized F test to select differentially expressed genes. The Benjamini and Hochberg (BH procedure of controlling false discovery rate (FDR at 5% was applied to the P values of the generalized F test. For those genes with significant generalized F test, we then categorize them based on whether the interaction terms were significant or not at the α-level (αnew = 0.0033 determined by the FDR procedure. Since simple effects may be examined for the genes with significant interaction effect, we adopt the protected Fisher's least significant difference test (LSD procedure at the level of αnew to control the family-wise error rate (FWER for each gene examined. Conclusions A linear mixed model is appropriate for analysis of oligonucleotide array experiments with repeated measures. We constructed a generalized F test to select differentially expressed genes, and then applied a specific sequence of tests to identify factorial effects. This sequence of tests applied was designed to control for gene based FWER.

  2. Analysis of oligonucleotide array experiments with repeated measures using mixed models.

    Science.gov (United States)

    Li, Hao; Wood, Constance L; Getchell, Thomas V; Getchell, Marilyn L; Stromberg, Arnold J

    2004-12-30

    Two or more factor mixed factorial experiments are becoming increasingly common in microarray data analysis. In this case study, the two factors are presence (Patients with Alzheimer's disease) or absence (Control) of the disease, and brain regions including olfactory bulb (OB) or cerebellum (CER). In the design considered in this manuscript, OB and CER are repeated measurements from the same subject and, hence, are correlated. It is critical to identify sources of variability in the analysis of oligonucleotide array experiments with repeated measures and correlations among data points have to be considered. In addition, multiple testing problems are more complicated in experiments with multi-level treatments or treatment combinations. In this study we adopted a linear mixed model to analyze oligonucleotide array experiments with repeated measures. We first construct a generalized F test to select differentially expressed genes. The Benjamini and Hochberg (BH) procedure of controlling false discovery rate (FDR) at 5% was applied to the P values of the generalized F test. For those genes with significant generalized F test, we then categorize them based on whether the interaction terms were significant or not at the alpha-level (alphanew = 0.0033) determined by the FDR procedure. Since simple effects may be examined for the genes with significant interaction effect, we adopt the protected Fisher's least significant difference test (LSD) procedure at the level of alphanew to control the family-wise error rate (FWER) for each gene examined. A linear mixed model is appropriate for analysis of oligonucleotide array experiments with repeated measures. We constructed a generalized F test to select differentially expressed genes, and then applied a specific sequence of tests to identify factorial effects. This sequence of tests applied was designed to control for gene based FWER.

  3. Harshlight: a "corrective make-up" program for microarray chips

    Directory of Open Access Journals (Sweden)

    Wittkowski Knut M

    2005-12-01

    Full Text Available Abstract Background Microscopists are familiar with many blemishes that fluorescence images can have due to dust and debris, glass flaws, uneven distribution of fluids or surface coatings, etc. Microarray scans do show similar artifacts, which might affect subsequent analysis. Although all but the starkest blemishes are hard to find by the unaided eye, particularly in high-density oligonucleotide arrays (HDONAs, few tools are available to help with the detection of those defects. Results We develop a novel tool, Harshlight, for the automatic detection and masking of blemishes in HDONA microarray chips. Harshlight uses a combination of statistic and image processing methods to identify three different types of defects: localized blemishes affecting a few probes, diffuse defects affecting larger areas, and extended defects which may invalidate an entire chip. Conclusion We demonstrate the use of Harshlight can materially improve analysis of HDONA chips, especially for experiments with subtle changes between samples. For the widely used MAS5 algorithm, we show that compact blemishes cause an average of 8 gene expression values per chip to change by more than 50%, two of them by more than twofold; our masking algorithm restores about two thirds of this damage. Large-scale artifacts are successfully detected and eliminated.

  4. Template switching between PNA and RNA oligonucleotides

    Science.gov (United States)

    Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

    1995-01-01

    The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

  5. Microarray Technologies in Fungal Diagnostics.

    Science.gov (United States)

    Rupp, Steffen

    2017-01-01

    Microarray technologies have been a major research tool in the last decades. In addition they have been introduced into several fields of diagnostics including diagnostics of infectious diseases. Microarrays are highly parallelized assay systems that initially were developed for multiparametric nucleic acid detection. From there on they rapidly developed towards a tool for the detection of all kind of biological compounds (DNA, RNA, proteins, cells, nucleic acids, carbohydrates, etc.) or their modifications (methylation, phosphorylation, etc.). The combination of closed-tube systems and lab on chip devices with microarrays further enabled a higher automation degree with a reduced contamination risk. Microarray-based diagnostic applications currently complement and may in the future replace classical methods in clinical microbiology like blood cultures, resistance determination, microscopic and metabolic analyses as well as biochemical or immunohistochemical assays. In addition, novel diagnostic markers appear, like noncoding RNAs and miRNAs providing additional room for novel nucleic acid based biomarkers. Here I focus an microarray technologies in diagnostics and as research tools, based on nucleic acid-based arrays.

  6. Sediment denitrifier community composition and nirS gene expression investigated with functional gene microarrays

    DEFF Research Database (Denmark)

    Francis, C.A.; Jackson, G.A.; Ward, B.B.

    2008-01-01

    total RNA extracts) targets were hybridized to the same array to compare the profiles of community composition at the DNA (relative abundance) and mRNA (gene expression) levels. Only the three dominant denitrifying groups (in terms of relative strength of DNA hybridization signal) were detected at the m......A functional gene microarray was used to investigate denitrifier community composition and nitrite reductase (nirS) gene expression in sediments along the estuarine gradient in Chesapeake Bay, USA. The nirS oligonucleotide probe set was designed to represent a sequence database containing 539...

  7. Microarray analysis in caudal medulla of cattle orally challenged with bovine spongiform encephalopathy.

    Science.gov (United States)

    Almeida, L M; Basu, U; Williams, J L; Moore, S S; Guan, L L

    2011-10-25

    Bovine spongiform encephalopathy (BSE) is a fatal disorder in cattle characterized by progressive neurodegeneration of the central nervous system. We investigated the molecular mechanisms involved in neurodegeneration during prion infection through the identification of genes that are differentially expressed (DE) between experimentally infected and non-challenged cattle. Gene expression of caudal medulla from control and orally infected animals was compared by microarray analysis using 24,000 bovine oligonucleotides representing 16,846 different genes to identify DE genes associated with BSE disease. In total, 182 DE genes were identified between normal and BSE-infected tissues (>2.0-fold change, P bovine species.

  8. Oligonucleotides Containing Aminated 2′-Amino-LNA Nucleotides

    DEFF Research Database (Denmark)

    Lou, Chenguang; Samuelsen, Simone V.; Christensen, Niels Johan

    2017-01-01

    Mono- and diaminated 2′-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested...... that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2′-amino-LNA monomers and the host oligonucleotide backbone....

  9. Voltage-gated calcium channel and antisense oligonucleotides thereto

    Science.gov (United States)

    Hruska, Keith A. (Inventor); Friedman, Peter A. (Inventor); Barry, Elizabeth L. R. (Inventor); Duncan, Randall L. (Inventor)

    1998-01-01

    An antisense oligonucleotide of 10 to 35 nucleotides in length that can hybridize with a region of the .alpha..sub.1 subunit of the SA-Cat channel gene DNA or mRNA is provided, together with pharmaceutical compositions containing and methods utilizing such antisense oligonucleotide.

  10. Pharmacokinetics, biodistribution and cell uptake of antisense oligonucleotides.

    Science.gov (United States)

    Geary, Richard S; Norris, Daniel; Yu, Rosie; Bennett, C Frank

    2015-06-29

    Pharmacokinetic properties of oligonucleotides are largely driven by chemistry of the backbone and thus are sequence independent within a chemical class. Tissue bioavailability (% of administered dose) is assisted by plasma protein binding that limits glomerular filtration and ultimate urinary excretion of oligonucleotides. The substitution of one non-bridging oxygen with the more hydrophobic sulfur atom (phosphorothioate) increases both plasma stability and plasma protein binding and thus, ultimately, tissue bioavailability. Additional modifications of the sugar at the 2' position, increase RNA binding affinity and significantly increase potency, tissue half-life and prolong RNA inhibitory activity. Oligonucleotides modified in this manner consistently exhibit the highest tissue bioavailability (>90%). Systemic biodistribution is broad, and organs typically with highest concentrations are liver and kidney followed by bone marrow, adipocytes, and lymph nodes. Cell uptake is predominantly mediated by endocytosis. Both size and charge for most oligonucleotides prevents distribution across the blood brain barrier. However, modified single-strand oligonucleotides administered by intrathecal injection into the CSF distribute broadly in the CNS. The majority of intracellular oligonucleotide distribution following systemic or local administration occurs rapidly in just a few hours following administration and is facilitated by rapid endocytotic uptake mechanisms. Further understanding of the intracellular trafficking of oligonucleotides may provide further enhancements in design and ultimate potency of antisense oligonucleotides in the future. Copyright © 2015. Published by Elsevier B.V.

  11. Enhanced fluorescence of silver nanoclusters stabilized with branched oligonucleotides.

    Science.gov (United States)

    Latorre, Alfonso; Lorca, Romina; Zamora, Félix; Somoza, Álvaro

    2013-05-28

    DNA stabilized silver nanoclusters (AgNCs) are promising optical materials, whose fluorescence properties can be tuned by the selection of the DNA sequence employed. In this work we have used modified oligonucleotides in the preparation of AgNCs. The fluorescent intensity obtained was 60 times higher than that achieved with standard oligonucleotides.

  12. Development of a genotyping microarray for Usher syndrome

    Science.gov (United States)

    Cremers, Frans P M; Kimberling, William J; Külm, Maigi; de Brouwer, Arjan P; van Wijk, Erwin; te Brinke, Heleen; Cremers, Cor W R J; Hoefsloot, Lies H; Banfi, Sandro; Simonelli, Francesca; Fleischhauer, Johannes C; Berger, Wolfgang; Kelley, Phil M; Haralambous, Elene; Bitner‐Glindzicz, Maria; Webster, Andrew R; Saihan, Zubin; De Baere, Elfride; Leroy, Bart P; Silvestri, Giuliana; McKay, Gareth J; Koenekoop, Robert K; Millan, Jose M; Rosenberg, Thomas; Joensuu, Tarja; Sankila, Eeva‐Marja; Weil, Dominique; Weston, Mike D; Wissinger, Bernd; Kremer, Hannie

    2007-01-01

    Background Usher syndrome, a combination of retinitis pigmentosa (RP) and sensorineural hearing loss with or without vestibular dysfunction, displays a high degree of clinical and genetic heterogeneity. Three clinical subtypes can be distinguished, based on the age of onset and severity of the hearing impairment, and the presence or absence of vestibular abnormalities. Thus far, eight genes have been implicated in the syndrome, together comprising 347 protein‐coding exons. Methods: To improve DNA diagnostics for patients with Usher syndrome, we developed a genotyping microarray based on the arrayed primer extension (APEX) method. Allele‐specific oligonucleotides corresponding to all 298 Usher syndrome‐associated sequence variants known to date, 76 of which are novel, were arrayed. Results Approximately half of these variants were validated using original patient DNAs, which yielded an accuracy of >98%. The efficiency of the Usher genotyping microarray was tested using DNAs from 370 unrelated European and American patients with Usher syndrome. Sequence variants were identified in 64/140 (46%) patients with Usher syndrome type I, 45/189 (24%) patients with Usher syndrome type II, 6/21 (29%) patients with Usher syndrome type III and 6/20 (30%) patients with atypical Usher syndrome. The chip also identified two novel sequence variants, c.400C>T (p.R134X) in PCDH15 and c.1606T>C (p.C536S) in USH2A. Conclusion The Usher genotyping microarray is a versatile and affordable screening tool for Usher syndrome. Its efficiency will improve with the addition of novel sequence variants with minimal extra costs, making it a very useful first‐pass screening tool. PMID:16963483

  13. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    Science.gov (United States)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-05-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  14. Short G-rich oligonucleotides as a potential therapeutic for Huntington's Disease

    Directory of Open Access Journals (Sweden)

    Parekh-Olmedo Hetal

    2006-10-01

    Full Text Available Abstract Background Huntington's Disease (HD is an inherited autosomal dominant genetic disorder in which neuronal tissue degenerates. The pathogenesis of the disease appears to center on the development of protein aggregates that arise initially from the misfolding of the mutant HD protein. Mutant huntingtin (Htt is produced by HD genes that contain an increased number of glutamine codons within the first exon and this expansion leads to the production of a protein that misfolds. Recent studies suggest that mutant Htt can nucleate protein aggregation and interfere with a multitude of normal cellular functions. Results As such, efforts to find a therapy for HD have focused on agents that disrupt or block the mutant Htt aggregation pathway. Here, we report that short guanosine monotonic oligonucleotides capable of adopting a G-quartet structure, are effective inhibitors of aggregation. By utilizing a biochemical/immunoblotting assay as an initial screen, we identified a 20-mer, all G-oligonucleotide (HDG as an active molecule. Subsequent testing in a cell-based assay revealed that HDG was an effective inhibitor of aggregation of a fusion protein, comprised of a mutant Htt fragment and green fluorescent protein (eGFP. Taken together, our results suggest that a monotonic G-oligonucleotide, capable of adopting a G-quartet conformation is an effective inhibitor of aggregation. This oligonucleotide can also enable cell survival in PC12 cells overexpressing a mutant Htt fragment fusion gene. Conclusion Single-stranded DNA oligonucleotides capable of forming stable G-quartets can inhibit aggregation of the mutant Htt fragment protein. This activity maybe an important part of the pathogenecity of Huntington's Disease. Our results reveal a new class of agents that could be developed as a therapeutic approach for Huntington's Disease.

  15. Advanced spot quality analysis in two-colour microarray experiments

    Directory of Open Access Journals (Sweden)

    Vetter Guillaume

    2008-09-01

    Full Text Available Abstract Background Image analysis of microarrays and, in particular, spot quantification and spot quality control, is one of the most important steps in statistical analysis of microarray data. Recent methods of spot quality control are still in early age of development, often leading to underestimation of true positive microarray features and, consequently, to loss of important biological information. Therefore, improving and standardizing the statistical approaches of spot quality control are essential to facilitate the overall analysis of microarray data and subsequent extraction of biological information. Findings We evaluated the performance of two image analysis packages MAIA and GenePix (GP using two complementary experimental approaches with a focus on the statistical analysis of spot quality factors. First, we developed control microarrays with a priori known fluorescence ratios to verify the accuracy and precision of the ratio estimation of signal intensities. Next, we developed advanced semi-automatic protocols of spot quality evaluation in MAIA and GP and compared their performance with available facilities of spot quantitative filtering in GP. We evaluated these algorithms for standardised spot quality analysis in a whole-genome microarray experiment assessing well-characterised transcriptional modifications induced by the transcription regulator SNAI1. Using a set of RT-PCR or qRT-PCR validated microarray data, we found that the semi-automatic protocol of spot quality control we developed with MAIA allowed recovering approximately 13% more spots and 38% more differentially expressed genes (at FDR = 5% than GP with default spot filtering conditions. Conclusion Careful control of spot quality characteristics with advanced spot quality evaluation can significantly increase the amount of confident and accurate data resulting in more meaningful biological conclusions.

  16. Carbohydrate microarrays in plant science.

    Science.gov (United States)

    Fangel, Jonatan U; Pedersen, Henriette L; Vidal-Melgosa, Silvia; Ahl, Louise I; Salmean, Armando Asuncion; Egelund, Jack; Rydahl, Maja Gro; Clausen, Mads H; Willats, William G T

    2012-01-01

    Almost all plant cells are surrounded by glycan-rich cell walls, which form much of the plant body and collectively are the largest source of biomass on earth. Plants use polysaccharides for support, defense, signaling, cell adhesion, and as energy storage, and many plant glycans are also important industrially and nutritionally. Understanding the biological roles of plant glycans and the effective exploitation of their useful properties requires a detailed understanding of their structures, occurrence, and molecular interactions. Microarray technology has revolutionized the massively high-throughput analysis of nucleotides, proteins, and increasingly carbohydrates. Using microarrays, the abundance of and interactions between hundreds and thousands of molecules can be assessed simultaneously using very small amounts of analytes. Here we show that carbohydrate microarrays are multifunctional tools for plant research and can be used to map glycan populations across large numbers of samples to screen antibodies, carbohydrate binding proteins, and carbohydrate binding modules and to investigate enzyme activities.

  17. Glass slides to DNA microarrays

    Directory of Open Access Journals (Sweden)

    Samuel D Conzone

    2004-03-01

    Full Text Available A tremendous interest in deoxyribonucleic acid (DNA characterization tools was spurred by the mapping and sequencing of the human genome. New tools were needed, beginning in the early 1990s, to cope with the unprecedented amount of genomic information that was being discovered. Such needs led to the development of DNA microarrays; tiny gene-based sensors traditionally prepared on coated glass microscope slides. The following review is intended to provide historical insight into the advent of the DNA microarray, followed by a description of the technology from both the application and fabrication points of view. Finally, the unmet challenges and needs associated with DNA microarrays will be described to define areas of potential future developments for the materials researcher.

  18. DETECTING LOW-LEVEL SYNTHESIS IMPURITIES IN MODIFIED PHOSPHOROTHIOATE OLIGONUCLEOTIDES USING LIQUID CHROMATOGRAPHY - HIGH RESOLUTION MASS SPECTROMETRY.

    Science.gov (United States)

    Nikcevic, Irena; Wyrzykiewicz, Tadeusz K; Limbach, Patrick A

    2011-07-01

    An LC-MS method based on the use of high resolution Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS) for profiling oligonucleotides synthesis impurities is described.Oligonucleotide phosphorothioatediesters (phosphorothioate oligonucleotides), in which one of the non-bridging oxygen atoms at each phosphorus center is replaced by a sulfur atom, are now one of the most popular oligonucleotide modifications due to their ease of chemical synthesis and advantageous pharmacokinetic properties. Despite significant progress in the solid-phase oligomerization chemistry used in the manufacturing of these oligonucleotides, multiple classes of low-level impurities always accompany synthetic oligonucleotides. Liquid chromatography-mass spectrometry has emerged as a powerful technique for the identification of these synthesis impurities. However, impurity profiling, where the entire complement of low-level synthetic impurities is identified in a single analysis, is more challenging. Here we present an LC-MS method based the use of high resolution-mass spectrometry, specifically Fourier transform ion cyclotron resonance mass spectrometry (FTIRCMS or FTMS). The optimal LC-FTMS conditions, including the stationary phase and mobile phases for the separation and identification of phosphorothioate oligonucleotides, were found. The characteristics of FTMS enable charge state determination from single m/z values of low-level impurities. Charge state information then enables more accurate modeling of the detected isotopic distribution for identification of the chemical composition of the detected impurity. Using this approach, a number of phosphorothioate impurities can be detected by LC-FTMS including failure sequences carrying 3'-terminal phosphate monoester and 3'-terminal phosphorothioate monoester, incomplete backbone sulfurization and desulfurization products, high molecular weight impurities, and chloral, isobutyryl, and N(3) (2-cyanoethyl) adducts of the full

  19. Noncoding oligonucleotides: the belle of the ball in gene therapy.

    Science.gov (United States)

    Shum, Ka-To; Rossi, John J

    2015-01-01

    Gene therapy carries the promise of cures for many diseases based on manipulating the expression of a person's genes toward the therapeutic goal. The relevance of noncoding oligonucleotides to human disease is attracting widespread attention. Noncoding oligonucleotides are not only involved in gene regulation, but can also be modified into therapeutic tools. There are many strategies that leverage noncoding oligonucleotides for gene therapy, including small interfering RNAs, antisense oligonucleotides, aptamers, ribozymes, decoys, and bacteriophage phi 29 RNAs. In this chapter, we will provide a broad, comprehensive overview of gene therapies that use noncoding oligonucleotides for disease treatment. The mechanism and development of each therapeutic will be described, with a particular focus on its clinical development. Finally, we will discuss the challenges associated with developing nucleic acid therapeutics and the prospects for future success.

  20. Performance comparison of SLFN training algorithms for DNA microarray classification.

    Science.gov (United States)

    Huynh, Hieu Trung; Kim, Jung-Ja; Won, Yonggwan

    2011-01-01

    The classification of biological samples measured by DNA microarrays has been a major topic of interest in the last decade, and several approaches to this topic have been investigated. However, till now, classifying the high-dimensional data of microarrays still presents a challenge to researchers. In this chapter, we focus on evaluating the performance of the training algorithms of the single hidden layer feedforward neural networks (SLFNs) to classify DNA microarrays. The training algorithms consist of backpropagation (BP), extreme learning machine (ELM) and regularized least squares ELM (RLS-ELM), and an effective algorithm called neural-SVD has recently been proposed. We also compare the performance of the neural network approaches with popular classifiers such as support vector machine (SVM), principle component analysis (PCA) and fisher discriminant analysis (FDA).

  1. Analysis Method of Citrus Genome Microarray%浅谈柑橘基因组芯片分析方法

    Institute of Scientific and Technical Information of China (English)

    杨雪莲; 贝学军; 朱友娟

    2012-01-01

    cDNA microarray and oligonucleotide microarray are currently used for analysing citrus gene expression profile.The data analysis of genome microarray include data preprocessing,screening differential expression genes,and further analysing the differential expression genes.Through data analysis and integration of biological information,this paper studies the plant physiological changes.%指出了cDNA芯片和寡核苷酸芯片是目前用于柑橘基因表达谱分析的方法,基因组芯片数据分析主要包括数据预处理,筛选差异基因,差异基因再进一步分析。通过数据分析及整合样点的生物学信息,研究了植物生理变化。

  2. Assessment of a direct hybridization microarray strategy for comprehensive monitoring of genetically modified organisms (GMOs).

    Science.gov (United States)

    Turkec, Aydin; Lucas, Stuart J; Karacanli, Burçin; Baykut, Aykut; Yuksel, Hakki

    2016-03-01

    Detection of GMO material in crop and food samples is the primary step in GMO monitoring and regulation, with the increasing number of GM events in the world market requiring detection solutions with high multiplexing capacity. In this study, we test the suitability of a high-density oligonucleotide microarray platform for direct, quantitative detection of GMOs found in the Turkish feed market. We tested 1830 different 60nt probes designed to cover the GM cassettes from 12 different GM cultivars (3 soya, 9 maize), as well as plant species-specific and contamination controls, and developed a data analysis method aiming to provide maximum throughput and sensitivity. The system was able specifically to identify each cultivar, and in 10/12 cases was sensitive enough to detect GMO DNA at concentrations of ⩽1%. These GMOs could also be quantified using the microarray, as their fluorescence signals increased linearly with GMO concentration.

  3. 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides.

    Science.gov (United States)

    Marchán, Vicente; Cieślak, Jacek; Livengood, Victor; Beaucage, Serge L

    2004-08-11

    Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.

  4. Microarray screening for target genes of the proto-oncogene PLAG1.

    Science.gov (United States)

    Voz, Marianne L; Mathys, Janick; Hensen, Karen; Pendeville, Hélène; Van Valckenborgh, Isabelle; Van Huffel, Christophe; Chavez, Marcela; Van Damme, Boudewijn; De Moor, Bart; Moreau, Yves; Van de Ven, Wim J M

    2004-01-08

    PLAG1 is a proto-oncogene whose ectopic expression can trigger the development of pleomorphic adenomas of the salivary glands and of lipoblastomas. As PLAG1 is a transcription factor, able to activate transcription through the binding to the consensus sequence GRGGC(N)(6-8)GGG, its ectopic expression presumably results in the deregulation of target genes, leading to uncontrolled cell proliferation. The identification of PLAG1 target genes is therefore a crucial step in understanding the molecular mechanisms involved in PLAG1-induced tumorigenesis. To this end, we analysed the changes in gene expression caused by the conditional induction of PLAG1 expression in fetal kidney 293 cell lines. Using oligonucleotide microarray analyses of about 12 000 genes, we consistently identified 47 genes induced and 12 genes repressed by PLAG1. One of the largest classes identified as upregulated PLAG1 targets consists of growth factors such as the insulin-like growth factor II and the cytokine-like factor 1. The in silico search for PLAG1 consensus sequences in the promoter of the upregulated genes reveals that a large proportion of them harbor several copies of the PLAG1-binding motif, suggesting that they represent direct PLAG1 targets. Our approach was complemented by the comparison of the expression profiles of pleomorphic adenomas induced by PLAG1 versus normal salivary glands. Concordance between these two sets of experiments pinpointed 12 genes that were significantly and consistently upregulated in pleomorphic adenomas and in PLAG1-expressing cells, identifying them as putative PLAG1 targets in these tumors.

  5. Establishment of Self-incompatibility Gene cDNA Microarray to Identify S-genotypes of Pyrus pyrifolia

    Directory of Open Access Journals (Sweden)

    Jiang Nan

    2015-11-01

    Full Text Available Based on the cDNA sequences from hyper variable (HV regions of identified 52 S-alleles in Oriental pear cultivars, S-RNase cDNA probes were designed, and a cDNA microarray for S-RNase detections was established. Each microarray contained 240 sites from 55 cDNA probes, including all specific cDNA sequences from the HV regions of the S-alleles. Using the cDNA of pistils of tested pear cultivars as template and Cy3 fluorescently labeling primers by PCR amplification, microarray hybridization detected the S-genotype of each pear cultivar. The genotypes inferred from the cDNA microarray hybridization signals of pear cultivars such as ‘Lijiang Huangsuanli’, ‘Xiuyu’, ‘Midu Yuli’, ‘Baimianli’, and ‘Deshengxiang’ were similar to the known genotypes of all tested cultivars. The S-RNase cDNA microarrays and the oligonucleotide gene chips were then used to conduct parallel testing of 24 P. pyrifolia cultivars with unknown S-genotypes. In conclusion, the construction of cDNA microarrays has further improved the pear S-RNase detection platform.

  6. Cellular uptake and trafficking of antisense oligonucleotides.

    Science.gov (United States)

    Crooke, Stanley T; Wang, Shiyu; Vickers, Timothy A; Shen, Wen; Liang, Xue-Hai

    2017-03-01

    Antisense oligonucleotides (ASOs) modified with phosphorothioate (PS) linkages and different 2' modifications can be used either as drugs (e.g., to treat homozygous familial hypercholesterolemia and spinal muscular atrophy) or as research tools to alter gene expression. PS-ASOs can enter cells without additional modification or formulation and can be designed to mediate sequence-specific cleavage of different types of RNA (including mRNA and non-coding RNA) targeted by endogenous RNase H1. Although PS-ASOs function in both the cytoplasm and nucleus, localization to different subcellular regions can affect their therapeutic potency. Cellular uptake and intracellular distribution of PS ASOs are mediated by protein interactions. The main proteins involved in these processes have been identified, and intracellular sites in which PS ASOs are active, or inactive, cataloged.

  7. Conjugation of fluorescent proteins with DNA oligonucleotides.

    Science.gov (United States)

    Lapiene, Vidmantas; Kukolka, Florian; Kiko, Kathrin; Arndt, Andreas; Niemeyer, Christof M

    2010-05-19

    This work describes the synthesis of covalent ssDNA conjugates of six fluorescent proteins, ECFP, EGFP, E(2)GFP, mDsRed, Dronpa, and mCherry, which were cloned with an accessible C-terminal cystein residue to enable site-selective coupling using a heterobispecific cross-linker. The resulting conjugates revealed similar fluorescence emission intensity to the unconjugated proteins, and the functionality of the tethered oligonucleotide was proven by specific Watson-Crick base pairing to cDNA-modified gold nanoparticles. Fluorescence spectroscopy analysis indicated that the fluorescence of the FP is quenched by the gold particle, and the extent of quenching varied with the intrinsic spectroscopic properties of FP as well as with the configuration of surface attachment. Since this study demonstrates that biological fluorophores can be selectively incorporated into and optically coupled with nanoparticle-based devices, applications in DNA-based nanofabrication can be foreseen.

  8. Direct oligonucleotide-photosensitizer conjugates for photochemical delivery of antisense oligonucleotides.

    Science.gov (United States)

    Yuan, Ahu; Laing, Brian; Hu, Yiqiao; Ming, Xin

    2015-04-18

    Activation of photosensitizers in endosomes enables release of therapeutic macromolecules into the cytosol of the target cells for pharmacological actions. In this study, we demonstrate that direct conjugation of photosensitizers to oligonucleotides (ONs) allows spatial and temporal co-localization of the two modalities in the target cells, and thus leads to superior functional delivery of ONs. Further, light-activated delivery of an anticancer ON caused cancer cell killing via modulation of an oncogene and photodynamic therapy.

  9. Design and evaluation of Actichip, a thematic microarray for the study of the actin cytoskeleton

    Directory of Open Access Journals (Sweden)

    Chalmel Frédéric

    2007-08-01

    Full Text Available Abstract Background The actin cytoskeleton plays a crucial role in supporting and regulating numerous cellular processes. Mutations or alterations in the expression levels affecting the actin cytoskeleton system or related regulatory mechanisms are often associated with complex diseases such as cancer. Understanding how qualitative or quantitative changes in expression of the set of actin cytoskeleton genes are integrated to control actin dynamics and organisation is currently a challenge and should provide insights in identifying potential targets for drug discovery. Here we report the development of a dedicated microarray, the Actichip, containing 60-mer oligonucleotide probes for 327 genes selected for transcriptome analysis of the human actin cytoskeleton. Results Genomic data and sequence analysis features were retrieved from GenBank and stored in an integrative database called Actinome. From these data, probes were designed using a home-made program (CADO4MI allowing sequence refinement and improved probe specificity by combining the complementary information recovered from the UniGene and RefSeq databases. Actichip performance was analysed by hybridisation with RNAs extracted from epithelial MCF-7 cells and human skeletal muscle. Using thoroughly standardised procedures, we obtained microarray images with excellent quality resulting in high data reproducibility. Actichip displayed a large dynamic range extending over three logs with a limit of sensitivity between one and ten copies of transcript per cell. The array allowed accurate detection of small changes in gene expression and reliable classification of samples based on the expression profiles of tissue-specific genes. When compared to two other oligonucleotide microarray platforms, Actichip showed similar sensitivity and concordant expression ratios. Moreover, Actichip was able to discriminate the highly similar actin isoforms whereas the two other platforms did not. Conclusion Our

  10. Preparation and application of triple helix forming oligonucleotides and single strand oligonucleotide donors for gene correction.

    Science.gov (United States)

    Alam, Rowshon; Thazhathveetil, Arun Kalliat; Li, Hong; Seidman, Michael M

    2014-01-01

    Strategies for site-specific modulation of genomic sequences in mammalian cells require two components. One must be capable of recognizing and activating a specific target sequence in vivo, driving that site into an exploitable repair pathway. Information is transferred to the site via participation in the pathway by the second component, a donor nucleic acid, resulting in a permanent change in the target sequence. We have developed biologically active triple helix forming oligonucleotides (TFOs) as site-specific gene targeting reagents. These TFOs, linked to DNA reactive compounds (such as a cross-linking agent), activate pathways that can engage informational donors. We have used the combination of a psoralen-TFO and single strand oligonucleotide donors to generate novel cell lines with directed sequence changes at the target site. Here we describe the synthesis and purification of bioactive psoralen-linked TFOs, their co-introduction into mammalian cells with donor nucleic acids, and the identification of cells with sequence conversion of the target site. We have emphasized details in the synthesis and purification of the oligonucleotides that are essential for preparation of reagents with optimal activity.

  11. Combining microarrays and genetic analysis

    NARCIS (Netherlands)

    Alberts, Rudi; Fu, Jingyuan; Swertz, Morris A.; Lubbers, L. Alrik; Albers, Casper J.; Jansen, Ritsert C.

    2005-01-01

    Gene expression can be studied at a genome-wide scale with the aid of modern microarray technologies. Expression profiling of tens to hundreds of individuals in a genetic population can reveal the consequences of genetic variation. In this paper it is argued that the design and analysis of such a

  12. Combining microarrays and genetic analysis

    NARCIS (Netherlands)

    Alberts, Rudi; Fu, Jingyuan; Swertz, Morris A.; Lubbers, L. Alrik; Albers, Casper J.; Jansen, Ritsert C.

    2005-01-01

    Gene expression can be studied at a genome-wide scale with the aid of modern microarray technologies. Expression profiling of tens to hundreds of individuals in a genetic population can reveal the consequences of genetic variation. In this paper it is argued that the design and analysis of such a st

  13. Picky: oligo microarray design for large genomes

    National Research Council Canada - National Science Library

    Chou, Hui-Hsien; Hsia, An-Ping; Mooney, Denise L; Schnable, Patrick S

    2004-01-01

    Many large genomes are getting sequenced nowadays. Biologists are eager to start microarray analysis taking advantage of all known genes of a species, but existing microarray design tools were very inefficient for large genomes...

  14. Antisense Oligonucleotide-Based Therapy for Neuromuscular Disease.

    Science.gov (United States)

    Sardone, Valentina; Zhou, Haiyan; Muntoni, Francesco; Ferlini, Alessandra; Falzarano, Maria Sofia

    2017-04-05

    Neuromuscular disorders such as Duchenne Muscular Dystrophy and Spinal Muscular Atrophy are neurodegenerative genetic diseases characterized primarily by muscle weakness and wasting. Until recently there were no effective therapies for these conditions, but antisense oligonucleotides, a new class of synthetic single stranded molecules of nucleic acids, have demonstrated promising experimental results and are at different stages of regulatory approval. The antisense oligonucleotides can modulate the protein expression via targeting hnRNAs or mRNAs and inducing interference with splicing, mRNA degradation, or arrest of translation, finally, resulting in rescue or reduction of the target protein expression. Different classes of antisense oligonucleotides are being tested in several clinical trials, and limitations of their clinical efficacy and toxicity have been reported for some of these compounds, while more encouraging results have supported the development of others. New generation antisense oligonucleotides are also being tested in preclinical models together with specific delivery systems that could allow some of the limitations of current antisense oligonucleotides to be overcome, to improve the cell penetration, to achieve more robust target engagement, and hopefully also be associated with acceptable toxicity. This review article describes the chemical properties and molecular mechanisms of action of the antisense oligonucleotides and the therapeutic implications these compounds have in neuromuscular diseases. Current strategies and carrier systems available for the oligonucleotides delivery will be also described to provide an overview on the past, present and future of these appealing molecules.

  15. Antisense oligonucleotide induction of progerin in human myogenic cells.

    Directory of Open Access Journals (Sweden)

    Yue-Bei Luo

    Full Text Available We sought to use splice-switching antisense oligonucleotides to produce a model of accelerated ageing by enhancing expression of progerin, translated from a mis-spliced lamin A gene (LMNA transcript in human myogenic cells. The progerin transcript (LMNA Δ150 lacks the last 150 bases of exon 11, and is translated into a truncated protein associated with the severe premature ageing disease, Hutchinson-Gilford progeria syndrome (HGPS. HGPS arises from de novo mutations that activate a cryptic splice site in exon 11 of LMNA and result in progerin accumulation in tissues of mesodermal origin. Progerin has also been proposed to play a role in the 'natural' ageing process in tissues. We sought to test this hypothesis by producing a model of accelerated muscle ageing in human myogenic cells. A panel of splice-switching antisense oligonucleotides were designed to anneal across exon 11 of the LMNA pre-mRNA, and these compounds were transfected into primary human myogenic cells. RT-PCR showed that the majority of oligonucleotides were able to modify LMNA transcript processing. Oligonucleotides that annealed within the 150 base region of exon 11 that is missing in the progerin transcript, as well as those that targeted the normal exon 11 donor site induced the LMNA Δ150 transcript, but most oligonucleotides also generated variable levels of LMNA transcript missing the entire exon 11. Upon evaluation of different oligomer chemistries, the morpholino phosphorodiamidate oligonucleotides were found to be more efficient than the equivalent sequences prepared as oligonucleotides with 2'-O-methyl modified bases on a phosphorothioate backbone. The morpholino oligonucleotides induced nuclear localised progerin, demonstrated by immunostaining, and morphological nuclear changes typical of HGPS cells. We show that it is possible to induce progerin expression in myogenic cells using splice-switching oligonucleotides to redirect splicing of LMNA. This may offer a model

  16. Overview of Microarray Analysis of Gene Expression and its Applications to Cervical Cancer Investigation

    Directory of Open Access Journals (Sweden)

    Angel Chao

    2007-12-01

    Full Text Available Cervical cancer is one of the leading female cancers in Taiwan and ranks as the fifth cause of cancer death in the female population. Human papillomavirus has been established as the causative agent for cervical neoplasia and cervical cancer. However, the tumor biology involved in the prognoses of different cell types in early cancers and tumor responses to radiation in advanced cancers remain largely unknown. The introduction of microarray technologies in the 1990s has provided genome-wide strategies for searching tens of thousands of genes simultaneously. In this review, we first summarize the two types of microarrays: oligonucleotides microarray and cDNA microarray. Then, we review the studies of functional genomics in cervical cancer. Gene expression studies that involved cervical cancer cell lines, cervical cells of cancer versus normal ectocervix, cancer tissues of different histology, radioresistant versus radiosensitive patients, and the combinatorial gene expression associated with chromosomal amplifications are discussed. In particular, CEACAM5, TACSTD1, S100P, and MSLN have shown to be upregulated in adenocarcinoma, and increased expression levels of CEACAM5 and TACSTD1 were significantly correlated with poorer patient outcomes. On the other hand, 35 genes, including apoptotic genes (e.g. BIK, TEGT, SSI-3, hypoxia-inducible genes (e.g. HIF1A, CA12, and tumor cell invasion and metastasis genes (e.g. CTSL, CTSB, PLAU, CD44, have been noted to echo the hypothesis that increased tumor hypoxia leads to radiation resistance in cervical cancer during radiation.

  17. Optical Characterization of Oligonucleotide DNA Influenced by Magnetic Fields

    Directory of Open Access Journals (Sweden)

    Seyedeh Maryam Banihashemian

    2013-09-01

    Full Text Available UV-VIS spectroscopic analysis of oligonucleotide DNA exposed to different magnetic fields was performed in order to investigate the relationship between DNA extinction coefficients and optical parameters according to magnetic-field strength. The results with the oligonucleotides adenine-thymine 100 mer (AT-100 DNA and cytosine-guanine 100 mer (CG-100 DNA indicate that the magnetic field influences DNA molar extinction coefficients and refractive indexes. The imaginary parts of the refractive index and molar extinction coefficients of the AT-100 and CG-100 DNA decreased after exposure to a magnetic field of 750 mT due to cleavage of the DNA oligonucleotides into smaller segments.

  18. The role of antisense oligonucleotide therapy in patients with familial hypercholesterolemia: risks, benefits, and management recommendations.

    Science.gov (United States)

    Agarwala, Anandita; Jones, Peter; Nambi, Vijay

    2015-01-01

    Antisense oligonucleotide therapy is a promising approach for the treatment of a broad variety of medical conditions. It functions at the cellular level by interfering with RNA function, often leading to degradation of specifically targeted abnormal gene products implicated in the disease process. Mipomersen is a novel antisense oligonucleotide directed at apolipoprotein (apoB)-100, the primary apolipoprotein associated with low-density lipoprotein cholesterol (LDL-C), which has recently been approved for the treatment of familial hypercholesterolemia. A number of clinical studies have demonstrated its efficacy in lowering LDL-C and apoB levels in patients with elevated LDL-C despite maximal medical therapy using conventional lipid-lowering agents. This review outlines the risks and benefits of therapy and provides recommendations on the use of mipomersen.

  19. Microarray-based Identification of Novel Biomarkers in Asthma

    Directory of Open Access Journals (Sweden)

    Kenji Izuhara

    2006-01-01

    Full Text Available Bronchial asthma is a complicated and diverse disorder affected by genetic and environmental factors. It is widely accepted that it is a Th2-type inflammation originating in lung and caused by inhalation of ubiquitous allergens. The complicated and diverse pathogenesis of this disease yet to be clarified. Functional genomics is the analysis of whole gene expression profiling under given condition, and microarray technology is now the most powerful tool for functional genomics. Several attempts to clarify the pathogenesis of bronchial asthma have been carried out using microarray technology, providing us some novel biomarkers for diagnosis, therapeutic targets or understanding pathogenic mechanisms of bronchial asthma. In this article, we review the outcomes of these analyses by the microarray approach as applied to this disease by focusing on the identification of novel biomarkers.

  20. Comparative analysis of genomic signal processing for microarray data clustering.

    Science.gov (United States)

    Istepanian, Robert S H; Sungoor, Ala; Nebel, Jean-Christophe

    2011-12-01

    Genomic signal processing is a new area of research that combines advanced digital signal processing methodologies for enhanced genetic data analysis. It has many promising applications in bioinformatics and next generation of healthcare systems, in particular, in the field of microarray data clustering. In this paper we present a comparative performance analysis of enhanced digital spectral analysis methods for robust clustering of gene expression across multiple microarray data samples. Three digital signal processing methods: linear predictive coding, wavelet decomposition, and fractal dimension are studied to provide a comparative evaluation of the clustering performance of these methods on several microarray datasets. The results of this study show that the fractal approach provides the best clustering accuracy compared to other digital signal processing and well known statistical methods.

  1. A high-throughput pipeline for designing microarray-based pathogen diagnostic assays

    Directory of Open Access Journals (Sweden)

    Reifman Jaques

    2008-04-01

    Full Text Available Abstract Background We present a methodology for high-throughput design of oligonucleotide fingerprints for microarray-based pathogen diagnostic assays. The oligonucleotide fingerprints, or DNA microarray probes, are designed for identifying target organisms in environmental or clinical samples. The design process is implemented in a high-performance computing software pipeline that incorporates major algorithmic improvements over a previous version to both reduce computation time and improve specificity assessment. Results The algorithmic improvements result in significant reduction in runtimes, with the updated pipeline being nearly up to five-times faster than the previous version. The improvements in specificity assessment, based on multiple specificity criteria, result in robust and consistent evaluation of cross-hybridization with nontarget sequences. In addition, the multiple criteria provide finer control on the number of resulting fingerprints, which helps in obtaining a larger number of fingerprints with high specificity. Simulation tests for Francisella tularensis and Yersinia pestis, using a well-established hybridization model to estimate cross-hybridization with nontarget sequences, show that the improved specificity criteria yield a larger number of fingerprints as compared to using a single specificity criterion. Conclusion The faster runtimes, achieved as the result of algorithmic improvements, are critical for extending the pipeline to process multiple target genomes. The larger numbers of identified fingerprints, obtained by considering broader specificity criteria, are essential for designing probes for hard-to-distinguish target sequences.

  2. Application of the Taguchi method to the analysis of the deposition step in microarray production.

    Science.gov (United States)

    Severgnini, Marco; Pattini, Linda; Consolandi, Clarissa; Rizzi, Ermanno; Battaglia, Cristina; De Bellis, Gianluca; Cerutti, Sergio

    2006-09-01

    Every microarray experiment is affected by many possible sources of variability that may even corrupt biological evidence on analyzed sequences. We applied a "Taguchi method" strategy, based on the use of orthogonal arrays to optimize the deposition step of oligonucleotide sequences on glass slides. We chose three critical deposition parameters (humidity, surface, and buffer) at two levels each, in order to establish optimum settings. A L8 orthogonal array was used in order to monitor both the main effects and interactions on the deposition of a 25 mer oligonucleotide hybridized to its fluorescent-labeled complementary. Signal-background ratio and deposition homogeneity in terms of mean intensity and spot diameter were considered as significant outputs. An analysis of variance (ANOVA) was applied to raw data and to mean results for each slide and experimental run. Finally we calculated an overall evaluation coefficient to group together important outputs in one number. Environmental humidity and surface-buffer interaction were recognized as the most critical factors, for which a 50% humidity, associated to a chitosan-covered slide and a sodium phosphate + 25% dimethyl sulfoxide (DMSO) buffer gave best performances. Our results also suggested that Taguchi methods can be efficiently applied in optimization of microarray procedures.

  3. Unraveling the Rat Intestine, Spleen and Liver Genome-Wide Transcriptome after the Oral Administration of Lavender Oil by a Two-Color Dye-Swap DNA Microarray Approach.

    Directory of Open Access Journals (Sweden)

    Hiroko Kubo

    Full Text Available The use of lavender oil (LO--a commonly, used oil in aromatherapy, with well-defined volatile components linalool and linalyl acetate--in non-traditional medicine is increasing globally. To understand and demonstrate the potential positive effects of LO on the body, we have established an animal model in this current study, investigating the orally administered LO effects genome wide in the rat small intestine, spleen, and liver. The rats were administered LO at 5 mg/kg (usual therapeutic dose in humans followed by the screening of differentially expressed genes in the tissues, using a 4×44-K whole-genome rat chip (Agilent microarray platform; Agilent Technologies, Palo Alto, CA, USA in conjunction with a dye-swap approach, a novelty of this study. Fourteen days after LO treatment and compared with a control group (sham, a total of 156 and 154 up (≧ 1.5-fold- and down (≦ 0.75-fold-regulated genes, 174 and 66 up- (≧ 1.5-fold- and down (≦ 0.75-fold-regulated genes, and 222 and 322 up- (≧ 1.5-fold- and down (≦ 0.75-fold-regulated genes showed differential expression at the mRNA level in the small intestine, spleen and liver, respectively. The reverse transcription-polymerase chain reaction (RT-PCR validation of highly up- and down-regulated genes confirmed the regulation of the Papd4, Lrp1b, Alb, Cyr61, Cyp2c, and Cxcl1 genes by LO as examples in these tissues. Using bioinformatics, including Ingenuity Pathway Analysis (IPA, differentially expressed genes were functionally categorized by their Gene Ontology (GO and biological function and network analysis, revealing their diverse functions and potential roles in LO-mediated effects in rat. Further IPA analysis in particular unraveled the presence of novel genes, such as Papd4, Or8k5, Gprc5b, Taar5, Trpc6, Pld2 and Onecut3 (up-regulated top molecules and Tnf, Slc45a4, Slc25a23 and Samt4 (down-regulated top molecules, to be influenced by LO treatment in the small intestine, spleen and

  4. Unraveling the Rat Intestine, Spleen and Liver Genome-Wide Transcriptome after the Oral Administration of Lavender Oil by a Two-Color Dye-Swap DNA Microarray Approach.

    Science.gov (United States)

    Kubo, Hiroko; Shibato, Junko; Saito, Tomomi; Ogawa, Tetsuo; Rakwal, Randeep; Shioda, Seiji

    2015-01-01

    The use of lavender oil (LO)--a commonly, used oil in aromatherapy, with well-defined volatile components linalool and linalyl acetate--in non-traditional medicine is increasing globally. To understand and demonstrate the potential positive effects of LO on the body, we have established an animal model in this current study, investigating the orally administered LO effects genome wide in the rat small intestine, spleen, and liver. The rats were administered LO at 5 mg/kg (usual therapeutic dose in humans) followed by the screening of differentially expressed genes in the tissues, using a 4×44-K whole-genome rat chip (Agilent microarray platform; Agilent Technologies, Palo Alto, CA, USA) in conjunction with a dye-swap approach, a novelty of this study. Fourteen days after LO treatment and compared with a control group (sham), a total of 156 and 154 up (≧ 1.5-fold)- and down (≦ 0.75-fold)-regulated genes, 174 and 66 up- (≧ 1.5-fold)- and down (≦ 0.75-fold)-regulated genes, and 222 and 322 up- (≧ 1.5-fold)- and down (≦ 0.75-fold)-regulated genes showed differential expression at the mRNA level in the small intestine, spleen and liver, respectively. The reverse transcription-polymerase chain reaction (RT-PCR) validation of highly up- and down-regulated genes confirmed the regulation of the Papd4, Lrp1b, Alb, Cyr61, Cyp2c, and Cxcl1 genes by LO as examples in these tissues. Using bioinformatics, including Ingenuity Pathway Analysis (IPA), differentially expressed genes were functionally categorized by their Gene Ontology (GO) and biological function and network analysis, revealing their diverse functions and potential roles in LO-mediated effects in rat. Further IPA analysis in particular unraveled the presence of novel genes, such as Papd4, Or8k5, Gprc5b, Taar5, Trpc6, Pld2 and Onecut3 (up-regulated top molecules) and Tnf, Slc45a4, Slc25a23 and Samt4 (down-regulated top molecules), to be influenced by LO treatment in the small intestine, spleen and liver

  5. Biclustering of time series microarray data.

    Science.gov (United States)

    Meng, Jia; Huang, Yufei

    2012-01-01

    Clustering is a popular data exploration technique widely used in microarray data analysis. In this chapter, we review ideas and algorithms of bicluster and its applications in time series microarray analysis. We introduce first the concept and importance of biclustering and its different variations. We then focus our discussion on the popular iterative signature algorithm (ISA) for searching biclusters in microarray dataset. Next, we discuss in detail the enrichment constraint time-dependent ISA (ECTDISA) for identifying biologically meaningful temporal transcription modules from time series microarray dataset. In the end, we provide an example of ECTDISA application to time series microarray data of Kaposi's Sarcoma-associated Herpesvirus (KSHV) infection.

  6. Dynamic probe selection for studying microbial transcriptome with high-density genomic tiling microarrays

    Directory of Open Access Journals (Sweden)

    Chen Tsute

    2010-02-01

    Full Text Available Abstract Background Current commercial high-density oligonucleotide microarrays can hold millions of probe spots on a single microscopic glass slide and are ideal for studying the transcriptome of microbial genomes using a tiling probe design. This paper describes a comprehensive computational pipeline implemented specifically for designing tiling probe sets to study microbial transcriptome profiles. Results The pipeline identifies every possible probe sequence from both forward and reverse-complement strands of all DNA sequences in the target genome including circular or linear chromosomes and plasmids. Final probe sequence lengths are adjusted based on the maximal oligonucleotide synthesis cycles and best isothermality allowed. Optimal probes are then selected in two stages - sequential and gap-filling. In the sequential stage, probes are selected from sequence windows tiled alongside the genome. In the gap-filling stage, additional probes are selected from the largest gaps between adjacent probes that have already been selected, until a predefined number of probes is reached. Selection of the highest quality probe within each window and gap is based on five criteria: sequence uniqueness, probe self-annealing, melting temperature, oligonucleotide length, and probe position. Conclusions The probe selection pipeline evaluates global and local probe sequence properties and selects a set of probes dynamically and evenly distributed along the target genome. Unique to other similar methods, an exact number of non-redundant probes can be designed to utilize all the available probe spots on any chosen microarray platform. The pipeline can be applied to microbial genomes when designing high-density tiling arrays for comparative genomics, ChIP chip, gene expression and comprehensive transcriptome studies.

  7. Oligonucleotide and Long Polymeric DNA Encoding

    Energy Technology Data Exchange (ETDEWEB)

    Miller, E; Mariella Jr., R P; Christian, A T; Gardner, S N; Williams, J M

    2003-11-24

    This report summarizes the work done at Lawrence Livermore National Laboratory for the Oligonucleotide and Long Polymeric DNA Encoding project, part of the Microelectronic Bioprocesses Program at DARPA. The goal of the project was to develop a process by which long (circa 10,000 base-pair) synthetic DNA molecules could be synthesized in a timely and economic manner. During construction of the long molecule, errors in DNA sequence occur during hybridization and/or the subsequent enzymatic process. The work done on this project has resulted in a novel synthesis scheme that we call the parallel pyramid synthesis protocol, the development of a suit of computational tools to minimize and quantify errors in the synthesized DNA sequence, and experimental proof of this technique. The modeling consists of three interrelated modules: the bioinformatics code which determines the specifics of parallel pyramid synthesis for a given chain of long DNA, the thermodynamics code which tracks the products of DNA hybridization and polymerase extension during the later steps in the process, and the kinetics model which examines the temporal and spatial processes during one thermocycle. Most importantly, we conducted the first successful syntheses of a gene using small starting oligomers (tetramers). The synthesized sequence, 813 base pairs long, contained a 725 base pair gene, modified green fluorescent protein (mGFP), which has been shown to be a functional gene by cloning into cells and observing its green fluorescent product.

  8. Silver and Cyanine Staining of Oligonucleotides in Polyacrylamide Gel.

    Directory of Open Access Journals (Sweden)

    Weizhong Tang

    Full Text Available To explore why some oligonucleotides in denaturing polyacrylamide gel could not be silver-stained, 134 different oligonucleotides were analyzed using denaturing polyacrylamide gel electrophoresis stained with silver and asymmetric cyanine. As a result, we found that the sensitivity of oligos (dA, (dC, (dG and (dT to silver staining could be ranged as (dA > (dG > (dC > (dT from high to low. It was unexpected that oligo (dT was hard to be silver-stained. Moreover, the silver staining of an oligonucleotide containing base T could be partially or completely inhibited by base T. The inhibition of silver staining by base T was a competitive inhibition which could be affected by the amounts of the argyrophil nucleobase and base T, the cis-distance between the argyrophil nucleobase and base T, and the gel concentration. The changes of the intensity of an oligonucleotide band caused by the changes of DNA base composition were diverse and interesting. The intensity of some oligonucleotide bands would significantly change when the changes of DNA base composition accumulated to a certain extent (usually ≥ 4 nt. The sensitivity of cyanine staining of ≤ 11-nt long oligonucleotides could be enhanced about 250-fold by fixing the gels with methanol fixing solution.

  9. Immobilization of oligonucleotide probes on silicon surfaces using biotin–streptavidin system examined with microscopic and spectroscopic techniques

    Energy Technology Data Exchange (ETDEWEB)

    Awsiuk, K., E-mail: kamil.awsiuk@uj.edu.pl [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, Kraków 30-059 (Poland); Rysz, J. [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, Kraków 30-059 (Poland); Petrou, P. [Institute of Nuclear and Radiological Sciences and Technology, Energy and Safety, NCSR “Demokritos”, End Patriarchou Gregoriou Str., Aghia Paraskevi 15310 (Greece); Budkowski, A. [M. Smoluchowski Institute of Physics, Jagiellonian University, Reymonta 4, Kraków 30-059 (Poland); Bernasik, A. [Faculty of Physics and Applied Computer Science, AGH-University of Science and Technology, Al. Mickiewicza 30, Kraków 30-059 (Poland); Kakabakos, S. [Institute of Nuclear and Radiological Sciences and Technology, Energy and Safety, NCSR “Demokritos”, End Patriarchou Gregoriou Str., Aghia Paraskevi 15310 (Greece); Marzec, M.M. [Faculty of Physics and Applied Computer Science, AGH-University of Science and Technology, Al. Mickiewicza 30, Kraków 30-059 (Poland); Raptis, I. [Institute for Advanced Materials, Physicochemical Processes, Nanotechnology and Microsystems, NCSR “Demokritos”, End Patriarchou Gregoriou Str., Aghia Paraskevi 15310 (Greece)

    2014-01-30

    To immobilize effectively oligonucleotide probes on SiO{sub 2} modified with (3-aminopropyl)triethoxysilane, four procedures based on streptavidin–biotin system are compared with Atomic Force Microscopy, Angle-Resolved X-ray Photoelectron Spectroscopy and Time-of-Flight Secondary Ion Mass Spectrometry. The first approach involves: adsorption of biotinylated Bovine Serum Albumin, blocking free surface sites with BSA, binding of streptavidin and biotinylated oligonucleotide (b-oligo). Final steps are exchanged in the second procedure with immobilization of preformed streptavidin–b-oligo conjugate. The third approach consists of streptavidin adsorption, blocking with BSA and b-oligo binding. Finally, streptavidin–b-oligo conjugate is immobilized directly within the fourth method. Surface coverage with biomolecules, determined from ARXPS, accords with average AFM height, and is anti-correlated with the intensity of Si+ ions. Higher biomolecular coverage was achieved during the last steps of the first (2.45(±0.38) mg/m{sup 2}) and second (1.31(±0.22) mg/m{sup 2}) approach, as compared to lower surface density resulting from the third (0.58(±0.20) mg/m{sup 2}) and fourth (0.41(±0.11) mg/m{sup 2}) method. Phosphorus atomic concentration indicates effectiveness of oligonucleotide immobilization. Secondary ions intensities, characteristic for oligonucleotides, streptavidin, BSA, and proteins, allow additional insight into overlayer composition. These measurements verify the ARXPS results and show the superiority of the first two immobilization approaches in terms of streptavidin and oligonucleotide density achieved onto the surface.

  10. Multiplexed, rapid detection of H5N1 using a PCR-free nanoparticle-based genomic microarray assay

    Directory of Open Access Journals (Sweden)

    Ragupathy Viswanath

    2010-10-01

    Full Text Available Abstract Background For more than a decade there has been increasing interest in the use of nanotechnology and microarray platforms for diagnostic applications. In this report, we describe a rapid and simple gold nanoparticle (NP-based genomic microarray assay for specific identification of avian influenza virus H5N1 and its discrimination from other major influenza A virus strains (H1N1, H3N2. Results Capture and intermediate oligonucleotides were designed based on the consensus sequences of the matrix (M gene of H1N1, H3N2 and H5N1 viruses, and sequences specific for the hemaglutinin (HA and neuraminidase (NA genes of the H5N1 virus. Viral RNA was detected within 2.5 hours using capture-target-intermediate oligonucleotide hybridization and gold NP-mediated silver staining in the absence of RNA fragmentation, target amplification, and enzymatic reactions. The lower limit of detection (LOD of the assay was less than 100 fM for purified PCR fragments and 103 TCID50 units for H5N1 viral RNA. Conclusions The NP-based microarray assay was able to detect and distinguish H5N1 sequences from those of major influenza A viruses (H1N1, H3N2. The new method described here may be useful for simultaneous detection and subtyping of major influenza A viruses.

  11. i-Genome: A database to summarize oligonucleotide data in genomes

    Directory of Open Access Journals (Sweden)

    Chang Yu-Chung

    2004-10-01

    Full Text Available Abstract Background Information on the occurrence of sequence features in genomes is crucial to comparative genomics, evolutionary analysis, the analyses of regulatory sequences and the quantitative evaluation of sequences. Computing the frequencies and the occurrences of a pattern in complete genomes is time-consuming. Results The proposed database provides information about sequence features generated by exhaustively computing the sequences of the complete genome. The repetitive elements in the eukaryotic genomes, such as LINEs, SINEs, Alu and LTR, are obtained from Repbase. The database supports various complete genomes including human, yeast, worm, and 128 microbial genomes. Conclusions This investigation presents and implements an efficiently computational approach to accumulate the occurrences of the oligonucleotides or patterns in complete genomes. A database is established to maintain the information of the sequence features, including the distributions of oligonucleotide, the gene distribution, the distribution of repetitive elements in genomes and the occurrences of the oligonucleotides. The database can provide more effective and efficient way to access the repetitive features in genomes.

  12. Target gene knockdown by 2',4'-BNA/LNA antisense oligonucleotides in zebrafish.

    Science.gov (United States)

    Itoh, Motoyuki; Nakaura, Mizuki; Imanishi, Takeshi; Obika, Satoshi

    2014-06-01

    Gene knockdowns using oligonucleotide-based approaches are useful for studying gene function in both in vitro cell culture systems and in vivo animal models. We evaluated the efficacy of 2',4'-bridged nucleic acids (BNA)-modified antisense oligonucleotides (AONs) for gene knockdown in zebrafish. We used the tcf7l1a gene as a model for testing the knockdown efficacy of 2',4'-BNA AONs and examined how the target sites/affinity and RNase H induction activity of 2',4'-BNA AONs affect knockdown efficacy. We found that tcf7l1a gene function was knocked down by 2',4'-BNA AONs that target the start codon and induce RNase H activity. Although nonspecific p53-mediated developmental defects were observed at higher doses, the effective dose of the 2',4'-BNA AONs for tcf7l1a is much lower than that of morpholino oligonucleotides. Our data thus show a potential application for 2',4'-BNA AONs in the downregulation of specific genes in zebrafish.

  13. Efficient delivery of RNA interference oligonucleotides to polarized airway epithelia in vitro.

    Science.gov (United States)

    Ramachandran, Shyam; Krishnamurthy, Sateesh; Jacobi, Ashley M; Wohlford-Lenane, Christine; Behlke, Mark A; Davidson, Beverly L; McCray, Paul B

    2013-07-01

    Polarized and pseudostratified primary airway epithelia present barriers that significantly reduce their transfection efficiency and the efficacy of RNA interference oligonucleotides. This creates an impediment in studies of the airway epithelium, diminishing the utility of loss-of-function as a research tool. Here we outline methods to introduce RNAi oligonucleotides into primary human and porcine airway epithelia grown at an air-liquid interface and difficult-to-transfect transformed epithelial cell lines grown on plastic. At the time of plating, we reverse transfect small-interfering RNA (siRNA), Dicer-substrate siRNA, or microRNA oligonucleotides into cells by use of lipid or peptide transfection reagents. Using this approach we achieve significant knockdown in vitro of hypoxanthine-guanine phosphoribosyltransferase, IL-8, and CFTR expression at the mRNA and protein levels in 1-3 days. We also attain significant reduction of secreted IL-8 in polarized primary pig airway epithelia 3 days posttransfection and inhibition of CFTR-mediated Cl⁻ conductance in polarized air-liquid interface cultures of human airway epithelia 2 wk posttransfection. These results highlight an efficient means to deliver RNA interference reagents to airway epithelial cells and achieve significant knockdown of target gene expression and function. The ability to reliably conduct loss-of-function assays in polarized primary airway epithelia offers benefits to research in studies of epithelial cell homeostasis, candidate gene function, gene-based therapeutics, microRNA biology, and targeting the replication of respiratory viruses.

  14. Targeting of single stranded oligonucleotides through metal-induced cyclization of short complementary strands : Targeting of single stranded oligonucleotides

    OpenAIRE

    Freville, Fabrice; Richard, Tristan; Bathany, Katell; Moreau, Serge

    2006-01-01

    International audience; A new strategy to cyclize a short synthetic oligonucleotide on a DNA or a RNA target strand is described. This one relies on a metal-mediated cyclization of short synthetic oligonucleotides conjugated with two chelating 2,2':6',2”-terpyridine moieties at their 3' and 5' ends. Cyclization following metal addition (Zn2+, Fe2+) was demonstrated using UV monitored thermal denaturation experiments, mass spectrometry analysis and gel shift assays. NMR experiments were used t...

  15. PTPan--overcoming memory limitations in oligonucleotide string matching for primer/probe design.

    Science.gov (United States)

    Eissler, Tilo; Hodges, Christopher P; Meier, Harald

    2011-10-15

    Nucleic acid diagnostics has high demands for non-heuristic exact and approximate oligonucleotide string matching concerning in silico primer/probe design in huge nucleic acid sequence collections. Unfortunately, public sequence repositories grow much faster than computer hardware performance and main memory capacity do. This growth imposes severe problems on existing oligonucleotide primer/probe design applications necessitating new approaches based on space-efficient indexing structures. We developed PTPan (spoken Peter Pan, 'PT' is for Position Tree, the earlier name of suffix trees), a space-efficient indexing structure for approximate oligonucleotide string matching in nucleic acid sequence data. Based on suffix trees, it combines partitioning, truncation and a new suffix tree stream compression to deal with large amounts of aligned and unaligned data. PTPan operates efficiently in main memory and on secondary storage, balancing between memory consumption and runtime during construction and application. Based on PTPan, applications supporting similarity search and primer/probe design have been implemented, namely FindFamily, ProbeMatch and ProbeDesign. All three use a weighted Levenshtein distance metric for approximative queries to find and rate matches with indels as well as substitutions. We integrated PTPan in the worldwide used software package ARB to demonstrate usability and performance. Comparing PTPan and the original ARB index for the very large ssu-rRNA database SILVA, we recognized a shorter construction time, extended functionality and dramatically reduced memory requirements at the price of expanded, but very reasonable query times. PTPan enables indexing of huge nucleic acid sequence collections at reasonable application response times. Not being limited by main memory, PTPan constitutes a major advancement regarding rapid oligonucleotide string matching in primer/probe design now and in the future facing the enormous growth of molecular

  16. Advances in Antisense Oligonucleotide Development for Target Identification, Validation, and as Novel Therapeutics

    Directory of Open Access Journals (Sweden)

    Moizza Mansoor

    2008-01-01

    Full Text Available Antisense oligonucleotides (As-ODNs are single stranded, synthetically prepared strands of deoxynucleotide sequences, usually 18–21 nucleotides in length, complementary to the mRNA sequence of the target gene. As-ODNs are able to selectively bind cognate mRNA sequences by sequence-specific hybridization. This results in cleavage or disablement of the mRNA and, thus, inhibits the expression of the target gene. The specificity of the As approach is based on the probability that, in the human genome, any sequence longer than a minimal number of nucleotides (nt, 13 for RNA and 17 for DNA, normally occurs only once. The potential applications of As-ODNs are numerous because mRNA is ubiquitous and is more accessible to manipulation than DNA. With the publication of the human genome sequence, it has become theoretically possible to inhibit mRNA of almost any gene by As-ODNs, in order to get a better understanding of gene function, investigate its role in disease pathology and to study novel therapeutic targets for the diseases caused by dysregulated gene expression. The conceptual simplicity, the availability of gene sequence information from the human genome, the inexpensive availability of synthetic oligonucleotides and the possibility of rational drug design makes As-ODNs powerful tools for target identification, validation and therapeutic intervention. In this review we discuss the latest developments in antisense oligonucleotide design, delivery, pharmacokinetics and potential side effects, as well as its uses in target identification and validation, and finally focus on the current developments of antisense oligonucleotides in therapeutic intervention in various diseases.

  17. Viral discovery and sequence recovery using DNA microarrays.

    Directory of Open Access Journals (Sweden)

    David Wang

    2003-11-01

    Full Text Available Because of the constant threat posed by emerging infectious diseases and the limitations of existing approaches used to identify new pathogens, there is a great demand for new technological methods for viral discovery. We describe herein a DNA microarray-based platform for novel virus identification and characterization. Central to this approach was a DNA microarray designed to detect a wide range of known viruses as well as novel members of existing viral families; this microarray contained the most highly conserved 70mer sequences from every fully sequenced reference viral genome in GenBank. During an outbreak of severe acute respiratory syndrome (SARS in March 2003, hybridization to this microarray revealed the presence of a previously uncharacterized coronavirus in a viral isolate cultivated from a SARS patient. To further characterize this new virus, approximately 1 kb of the unknown virus genome was cloned by physically recovering viral sequences hybridized to individual array elements. Sequencing of these fragments confirmed that the virus was indeed a new member of the coronavirus family. This combination of array hybridization followed by direct viral sequence recovery should prove to be a general strategy for the rapid identification and characterization of novel viruses and emerging infectious disease.

  18. VIPR: A probabilistic algorithm for analysis of microbial detection microarrays

    Directory of Open Access Journals (Sweden)

    Holbrook Michael R

    2010-07-01

    Full Text Available Abstract Background All infectious disease oriented clinical diagnostic assays in use today focus on detecting the presence of a single, well defined target agent or a set of agents. In recent years, microarray-based diagnostics have been developed that greatly facilitate the highly parallel detection of multiple microbes that may be present in a given clinical specimen. While several algorithms have been described for interpretation of diagnostic microarrays, none of the existing approaches is capable of incorporating training data generated from positive control samples to improve performance. Results To specifically address this issue we have developed a novel interpretive algorithm, VIPR (Viral Identification using a PRobabilistic algorithm, which uses Bayesian inference to capitalize on empirical training data to optimize detection sensitivity. To illustrate this approach, we have focused on the detection of viruses that cause hemorrhagic fever (HF using a custom HF-virus microarray. VIPR was used to analyze 110 empirical microarray hybridizations generated from 33 distinct virus species. An accuracy of 94% was achieved as measured by leave-one-out cross validation. Conclusions VIPR outperformed previously described algorithms for this dataset. The VIPR algorithm has potential to be broadly applicable to clinical diagnostic settings, wherein positive controls are typically readily available for generation of training data.

  19. Microarray analysis of Escherichia coli0157:H7

    Institute of Scientific and Technical Information of China (English)

    Hui-Ying Jin; Kai-Hua Tao; Yue-Xi Li; Fa-Qing Li; Su-Qin Li

    2005-01-01

    AIM: To establish the rapid, specific, and sensitive method for detecting O157:H7 with DNA microchips.METHODS: Specific oligonucleotide probes (26-28 nt) of bacterial antigenic and virulent genes of E. coli O157:H7 and other related pathogen genes were pre-synthesized and immobilized on a solid support to make microchips. The four genes encoding O157 somatic antigen (rfbE), H7 fiagellar antigen (fliC) and toxins (SLT1, SLT2) were monitored by multiplex PCR with four pairs of specific primers. Fluorescence-Cy3 labeled samples for hybridization were generated by PCR with Cy3-labeled single prime. Hybridization was performed for 60 min at 45 ℃. Microchip images were taken using a confocal fluorescent scanner.RESULTS: Twelve different bacterial strains were detected with various combinations of four virulent genes. All the O157:H7 strains yielded positive results by multiplex PCR.The size of the PCR products generated with these primers varied from 210 to 678 bp. All the rfbE/fliC/SLT1/SLT2 probes specifically recognized Cy3-labeled fluorescent samples from O157:H7 strains, or strains containing O157 and H7 genes. No cross hybridization of O157:H7 fluorescent samples occurred in other probes. Non-O157:H7 pathogens failed to yield any signal under comparable conditions. If the Cy3-labeled fluorescent product of O157 single PCR was diluted 50-fold, no signal was found in agarose gel electrophoresis, but a positive signal was found in microarray hybridization.CONCLUSION: Microarray analysis of O157:H7 is a rapid,specific, and efficient method for identification and detection of bacterial pathogens.

  20. Microarray Inspector: tissue cross contamination detection tool for microarray data.

    Science.gov (United States)

    Stępniak, Piotr; Maycock, Matthew; Wojdan, Konrad; Markowska, Monika; Perun, Serhiy; Srivastava, Aashish; Wyrwicz, Lucjan S; Świrski, Konrad

    2013-01-01

    Microarray technology changed the landscape of contemporary life sciences by providing vast amounts of expression data. Researchers are building up repositories of experiment results with various conditions and samples which serve the scientific community as a precious resource. Ensuring that the sample is of high quality is of utmost importance to this effort. The task is complicated by the fact that in many cases datasets lack information concerning pre-experimental quality assessment. Transcription profiling of tissue samples may be invalidated by an error caused by heterogeneity of the material. The risk of tissue cross contamination is especially high in oncological studies, where it is often difficult to extract the sample. Therefore, there is a need of developing a method detecting tissue contamination in a post-experimental phase. We propose Microarray Inspector: customizable, user-friendly software that enables easy detection of samples containing mixed tissue types. The advantage of the tool is that it uses raw expression data files and analyses each array independently. In addition, the system allows the user to adjust the criteria of the analysis to conform to individual needs and research requirements. The final output of the program contains comfortable to read reports about tissue contamination assessment with detailed information about the test parameters and results. Microarray Inspector provides a list of contaminant biomarkers needed in the analysis of adipose tissue contamination. Using real data (datasets from public repositories) and our tool, we confirmed high specificity of the software in detecting contamination. The results indicated the presence of adipose tissue admixture in a range from approximately 4% to 13% in several tested surgical samples.

  1. Microarchitecture of a MultiCore SoC for Data Analysis of a Lab-on-Chip Microarray

    Directory of Open Access Journals (Sweden)

    S. Blionas

    2008-07-01

    Full Text Available This paper presents a reconfigurable architecture of a lab-on-chip (LoC microarray device capable to process data either in genotyping or in gene expression applications in a fraction of the time that is required by the usual software methods running on a standard computer. The entire LoC consists of a microfluidics part for the sample preparation and hybridization, a microsystem part including the application specific array of sensors for the electronic detection, and finally a reconfigurable processing part for the data analysis. The proposed data processing and analysis electronic module are an embedded multicore reconfigurable system-on-chip designed to analyze data from the forthcoming high-density oligonucleotide microarrays. The proposed architecture employs reconfigurable technology and has the capacity to process data from microarrays of various sizes from small size ones used in genotyping up to large-scale gene expression arrays. Additionally, the embedded processing cores feature reconfigurable circuitry for implementing the intense part of the processing, supplementing the various computational needs of the diverse applications for microarray real-time data processing and for a scalable reconfigurable architecture to handle also the future high-density microarrays.

  2. Immune and inflammatory gene signature in rat cerebrum in subarachnoid hemorrhage with microarray analysis.

    Science.gov (United States)

    Lee, Chu-I; Chou, An-Kuo; Lin, Ching-Chih; Chou, Chia-Hua; Loh, Joon-Khim; Lieu, Ann-Shung; Wang, Chih-Jen; Huang, Chi-Ying F; Howng, Shen-Long; Hong, Yi-Ren

    2012-01-01

    Cerebral vasospasm following subarachnoid hemorrhage (SAH) has been studied in terms of a contraction of the major cerebral arteries, but the effect of cerebrum tissue in SAH is not yet well understood. To gain insight into the biology of SAH-expressing cerebrum, we employed oligonucleotide microarrays to characterize the gene expression profiles of cerebrum tissue at the early stage of SAH. Functional gene expression in the cerebrum was analyzed 2 h following stage 1-hemorrhage in Sprague-Dawley rats. mRNA was investigated by performing microarray and quantitative real-time PCR analyses, and protein expression was determined by Western blot analysis. In this study, 18 upregulated and 18 downregulated genes displayed at least a 1.5-fold change. Five genes were verified by real-time PCR, including three upregulated genes [prostaglandin E synthase (PGES), CD14 antigen, and tissue inhibitor of metalloproteinase 1 (TIMP1)] as well as two downregulated genes [KRAB-zinc finger protein-2 (KZF-2) and γ-aminobutyric acid B receptor 1 (GABA B receptor)]. Notably, there were functional implications for the three upregulated genes involved in the inflammatory SAH process. However, the mechanisms leading to decreased KZF-2 and GABA B receptor expression in SAH have never been characterized. We conclude that oligonucleotide microarrays have the potential for use as a method to identify candidate genes associated with SAH and to provide novel investigational targets, including genes involved in the immune and inflammatory response. Furthermore, understanding the regulation of MMP9/TIMP1 during the early stages of SAH may elucidate the pathophysiological mechanisms in SAH rats.

  3. Final Report Construction of Whole Genome Microarrays, and Expression Analysis of Desulfovibrio vulgaris cells in Metal-Reducing Conditions

    Energy Technology Data Exchange (ETDEWEB)

    M.W. Fields; J.D. Wall; J. Keasling; J. Zhou

    2008-05-15

    We continue to utilize the oligonucleotide microarrays that were constructed through funding with this project to characterize growth responses of Desulfovibrio vulgaris relevant to metal-reducing conditions. To effectively immobilize heavy metals and radionuclides via sulfate-reduction, it is important to understand the cellular responses to adverse factors observed at contaminated subsurface environments (e.g., nutrients, pH, contaminants, growth requirements and products). One of the major goals of the project is to construct whole-genome microarrays for Desulfovibrio vulgaris. First, in order to experimentally establish the criteria for designing gene-specific oligonucleotide probes, an oligonucleotide array was constructed that contained perfect match (PM) and mismatch (MM) probes (50mers and 70mers) based upon 4 genes. The effects of probe-target identity, continuous stretch, mismatch position, and hybridization free energy on specificity were examined. Little hybridization was observed at a probe-target identity of <85% for both 50mer and 70mer probes. 33 to 48% of the PM signal intensities were detected at a probe-target identity of 94% for 50mer oligonucleotides, and 43 to 55% for 70mer probes at a probe-target identity of 96%. When the effects of sequence identity and continuous stretch were considered independently, a stretch probe (>15 bases) contributed an additional 9% of the PM signal intensity compared to a non-stretch probe (< 15 bases) at the same identity level. Cross-hybridization increased as the length of continuous stretch increased. A 35-base stretch for 50mer probes or a 50-base stretch for 70mer probes had approximately 55% of the PM signal. Mismatches should be as close to the middle position of an oligonucleotide probe as possible to minimize cross-hybridization. Little cross-hybridization was observed for probes with a minimal binding free energy greater than -30 kcal/mol for 50mer probes or -40 kcal/mol for 70mer probes. Based on the

  4. Surface characterization of carbohydrate microarrays.

    Science.gov (United States)

    Scurr, David J; Horlacher, Tim; Oberli, Matthias A; Werz, Daniel B; Kroeck, Lenz; Bufali, Simone; Seeberger, Peter H; Shard, Alexander G; Alexander, Morgan R

    2010-11-16

    Carbohydrate microarrays are essential tools to determine the biological function of glycans. Here, we analyze a glycan array by time-of-flight secondary ion mass spectrometry (ToF-SIMS) to gain a better understanding of the physicochemical properties of the individual spots and to improve carbohydrate microarray quality. The carbohydrate microarray is prepared by piezo printing of thiol-terminated sugars onto a maleimide functionalized glass slide. The hyperspectral ToF-SIMS imaging data are analyzed by multivariate curve resolution (MCR) to discern secondary ions from regions of the array containing saccharide, linker, salts from the printing buffer, and the background linker chemistry. Analysis of secondary ions from the linker common to all of the sugar molecules employed reveals a relatively uniform distribution of the sugars within the spots formed from solutions with saccharide concentration of 0.4 mM and less, whereas a doughnut shape is often formed at higher-concentration solutions. A detailed analysis of individual spots reveals that in the larger spots the phosphate buffered saline (PBS) salts are heterogeneously distributed, apparently resulting in saccharide concentrated at the rim of the spots. A model of spot formation from the evaporating sessile drop is proposed to explain these observations. Saccharide spot diameters increase with saccharide concentration due to a reduction in surface tension of the saccharide solution compared to PBS. The multivariate analytical partial least squares (PLS) technique identifies ions from the sugars that in the complex ToF-SIMS spectra correlate with the binding of galectin proteins.

  5. Gene ARMADA: an integrated multi-analysis platform for microarray data implemented in MATLAB.

    Science.gov (United States)

    Chatziioannou, Aristotelis; Moulos, Panagiotis; Kolisis, Fragiskos N

    2009-10-27

    The microarray data analysis realm is ever growing through the development of various tools, open source and commercial. However there is absence of predefined rational algorithmic analysis workflows or batch standardized processing to incorporate all steps, from raw data import up to the derivation of significantly differentially expressed gene lists. This absence obfuscates the analytical procedure and obstructs the massive comparative processing of genomic microarray datasets. Moreover, the solutions provided, heavily depend on the programming skills of the user, whereas in the case of GUI embedded solutions, they do not provide direct support of various raw image analysis formats or a versatile and simultaneously flexible combination of signal processing methods. We describe here Gene ARMADA (Automated Robust MicroArray Data Analysis), a MATLAB implemented platform with a Graphical User Interface. This suite integrates all steps of microarray data analysis including automated data import, noise correction and filtering, normalization, statistical selection of differentially expressed genes, clustering, classification and annotation. In its current version, Gene ARMADA fully supports 2 coloured cDNA and Affymetrix oligonucleotide arrays, plus custom arrays for which experimental details are given in tabular form (Excel spreadsheet, comma separated values, tab-delimited text formats). It also supports the analysis of already processed results through its versatile import editor. Besides being fully automated, Gene ARMADA incorporates numerous functionalities of the Statistics and Bioinformatics Toolboxes of MATLAB. In addition, it provides numerous visualization and exploration tools plus customizable export data formats for seamless integration by other analysis tools or MATLAB, for further processing. Gene ARMADA requires MATLAB 7.4 (R2007a) or higher and is also distributed as a stand-alone application with MATLAB Component Runtime. Gene ARMADA provides a

  6. Spotting effect in microarray experiments

    Directory of Open Access Journals (Sweden)

    Mary-Huard Tristan

    2004-05-01

    Full Text Available Abstract Background Microarray data must be normalized because they suffer from multiple biases. We have identified a source of spatial experimental variability that significantly affects data obtained with Cy3/Cy5 spotted glass arrays. It yields a periodic pattern altering both signal (Cy3/Cy5 ratio and intensity across the array. Results Using the variogram, a geostatistical tool, we characterized the observed variability, called here the spotting effect because it most probably arises during steps in the array printing procedure. Conclusions The spotting effect is not appropriately corrected by current normalization methods, even by those addressing spatial variability. Importantly, the spotting effect may alter differential and clustering analysis.

  7. Ontology-Based Analysis of Microarray Data.

    Science.gov (United States)

    Giuseppe, Agapito; Milano, Marianna

    2016-01-01

    The importance of semantic-based methods and algorithms for the analysis and management of biological data is growing for two main reasons. From a biological side, knowledge contained in ontologies is more and more accurate and complete, from a computational side, recent algorithms are using in a valuable way such knowledge. Here we focus on semantic-based management and analysis of protein interaction networks referring to all the approaches of analysis of protein-protein interaction data that uses knowledge encoded into biological ontologies. Semantic approaches for studying high-throughput data have been largely used in the past to mine genomic and expression data. Recently, the emergence of network approaches for investigating molecular machineries has stimulated in a parallel way the introduction of semantic-based techniques for analysis and management of network data. The application of these computational approaches to the study of microarray data can broad the application scenario of them and simultaneously can help the understanding of disease development and progress.

  8. FPGA based system for automatic cDNA microarray image processing.

    Science.gov (United States)

    Belean, Bogdan; Borda, Monica; Le Gal, Bertrand; Terebes, Romulus

    2012-07-01

    Automation is an open subject in DNA microarray image processing, aiming reliable gene expression estimation. The paper presents a novel shock filter based approach for automatic microarray grid alignment. The proposed method brings up significantly reduced computational complexity compared to state of the art approaches, while similar results in terms of accuracy are achieved. Based on this approach, we also propose an FPGA based system for microarray image analysis that eliminates the shortcomings of existing software platforms: user intervention, increased computational time and cost. Our system includes application-specific architectures which involve algorithm parallelization, aiming fast and automated cDNA microarray image processing. The proposed automated image processing chain is implemented both on a general purpose processor and using the developed hardware architectures as co-processors in a FPGA based system. The comparative results included in the last section show that an important gain in terms of computational time is obtained using hardware based implementations.

  9. Application of heteronuclear couplings to conformational analysis of oligonucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, G. [Univ. of Maryland, College Park, MD (United States); Live, D. [Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Bax, A. [NIDDK National Institutes of Health, Bethesda, MD (United States)

    1994-12-01

    The value of vicinal coupling constants extracted from NMR spectra in deducing torsion angles for conformational analysis is well recognized. Due to the abundance of protons, their couplings have been mostly widely used. In many instances, couplings between protons and other nuclei may be a valuable complement to proton-proton couplings or, in some instances, may be the only coupling available to characterize the torsion angle about a bond. Recently, heteronuclear couplings have been used to great benefit in studies of isotopically enriched proteins, and this general approach has been extended to peptides at natural abundance. The possibility of using this approach to study oligonucleotides is also attractive but has not as yet been widely exploited. With the development of strategies for labeling such molecules, particularly RNAs, this may become an important component in conformational analysis. For DNA, labeling is less accessible, but sufficient quantities of unlabeled material are readily available for measuring these couplings at natural abundance. We chose several DNA systems to explore the usefulness of heteronuclear couplings in addressing the sugar conformation and the glycosidic torsion angle. Intensities of cross peaks in long-range HMQC experiments can be related to the couplings. Crosspeaks involving H1{prime} and C1{prime} atoms have been emphasized because of the superior shift dispersion at these positions between sugar protons and carbon atoms. Results will be shown for the self-complementary Dickerson duplex dodecamer sequence d(CGCGAATTCGCG) and for d(GGTCGG), which dimerizes to form a G-tetrad structure incorporating both syn and anti base orientations. The couplings provide a clear discrimination between presence of C3{prime}-endo and C2{prime}-endo conformations of the sugars and syn and anti bases arrangements.

  10. DNA microarray-based solid-phase PCR on copoly (DMA-NAS-MAPS) silicon coated slides: An example of relevant clinical application.

    Science.gov (United States)

    Damin, Francesco; Galbiati, Silvia; Ferrari, Maurizio; Chiari, Marcella

    2016-04-15

    In a previous study we developed a highly sensitive DNA microarray for the detection of common KRAS oncogenic mutations, which has been proven to be highly specific in assigning the correct genotype without any enrichment strategy even in the presence of minority mutated alleles. However, in this approach, the need of a spotter for the deposition of the purified PCR products on the substrates and the purification step of the conventional PCR are serious drawbacks. To overcome these limitations we have introduced the solid-phase polymerase chain reaction (SP-PCR) to form the array of PCR products starting from the oligonucleotide primers. This work was possible thanks to the great thermal stability of the copoly (DMA-NAS-MAPS) coating which withstands PCR thermal cycling temperatures. As an example of the application of this platform we performed the analysis of six common mutations in the codon 12 of KRAS gene (G12A, G12C, G12D, G12R, G12S, and G12V). In conclusion solid-phase PCR, combined with dual-color hybridization, allows mutation analysis in a shorter time span and is more suitable for automation.

  11. Living Cell Microarrays: An Overview of Concepts

    Directory of Open Access Journals (Sweden)

    Rebecca Jonczyk

    2016-05-01

    Full Text Available Living cell microarrays are a highly efficient cellular screening system. Due to the low number of cells required per spot, cell microarrays enable the use of primary and stem cells and provide resolution close to the single-cell level. Apart from a variety of conventional static designs, microfluidic microarray systems have also been established. An alternative format is a microarray consisting of three-dimensional cell constructs ranging from cell spheroids to cells encapsulated in hydrogel. These systems provide an in vivo-like microenvironment and are preferably used for the investigation of cellular physiology, cytotoxicity, and drug screening. Thus, many different high-tech microarray platforms are currently available. Disadvantages of many systems include their high cost, the requirement of specialized equipment for their manufacture, and the poor comparability of results between different platforms. In this article, we provide an overview of static, microfluidic, and 3D cell microarrays. In addition, we describe a simple method for the printing of living cell microarrays on modified microscope glass slides using standard DNA microarray equipment available in most laboratories. Applications in research and diagnostics are discussed, e.g., the selective and sensitive detection of biomarkers. Finally, we highlight current limitations and the future prospects of living cell microarrays.

  12. Dimension reduction methods for microarray data: a review

    Directory of Open Access Journals (Sweden)

    Rabia Aziz

    2017-03-01

    Full Text Available Dimension reduction has become inevitable for pre-processing of high dimensional data. “Gene expression microarray data” is an instance of such high dimensional data. Gene expression microarray data displays the maximum number of genes (features simultaneously at a molecular level with a very small number of samples. The copious numbers of genes are usually provided to a learning algorithm for producing a complete characterization of the classification task. However, most of the times the majority of the genes are irrelevant or redundant to the learning task. It will deteriorate the learning accuracy and training speed as well as lead to the problem of overfitting. Thus, dimension reduction of microarray data is a crucial preprocessing step for prediction and classification of disease. Various feature selection and feature extraction techniques have been proposed in the literature to identify the genes, that have direct impact on the various machine learning algorithms for classification and eliminate the remaining ones. This paper describes the taxonomy of dimension reduction methods with their characteristics, evaluation criteria, advantages and disadvantages. It also presents a review of numerous dimension reduction approaches for microarray data, mainly those methods that have been proposed over the past few years.

  13. A methodology for global validation of microarray experiments

    Directory of Open Access Journals (Sweden)

    Sladek Robert

    2006-07-01

    Full Text Available Abstract Background DNA microarrays are popular tools for measuring gene expression of biological samples. This ever increasing popularity is ensuring that a large number of microarray studies are conducted, many of which with data publicly available for mining by other investigators. Under most circumstances, validation of differential expression of genes is performed on a gene to gene basis. Thus, it is not possible to generalize validation results to the remaining majority of non-validated genes or to evaluate the overall quality of these studies. Results We present an approach for the global validation of DNA microarray experiments that will allow researchers to evaluate the general quality of their experiment and to extrapolate validation results of a subset of genes to the remaining non-validated genes. We illustrate why the popular strategy of selecting only the most differentially expressed genes for validation generally fails as a global validation strategy and propose random-stratified sampling as a better gene selection method. We also illustrate shortcomings of often-used validation indices such as overlap of significant effects and the correlation coefficient and recommend the concordance correlation coefficient (CCC as an alternative. Conclusion We provide recommendations that will enhance validity checks of microarray experiments while minimizing the need to run a large number of labour-intensive individual validation assays.

  14. Electrostatic readout of DNA microarrays with charged microspheres

    Energy Technology Data Exchange (ETDEWEB)

    Clack, Nathan G. [Univ. of California, Berkeley, CA (United States). Biophysics Graduate Group; Salaita, Khalid [Univ. of California, Berkeley, CA (United States). Department of Chemistry; Groves, Jay T. [Univ. of California, Berkeley, CA (United States). Biophysics Graduate Group and Department of Chemistry

    2008-06-29

    DNA microarrays are used for gene-expression profiling, single-nucleotide polymorphism detection and disease diagnosis. A persistent challenge in this area is the lack of microarray screening technology suitable for integration into routine clinical care. In this paper, we describe a method for sensitive and label-free electrostatic readout of DNA or RNA hybridization on microarrays. The electrostatic properties of the microarray are measured from the position and motion of charged microspheres randomly dispersed over the surface. We demonstrate nondestructive electrostatic imaging with 10-μm lateral resolution over centimeter-length scales, which is four-orders of magnitude larger than that achievable with conventional scanning electrostatic force microscopy. Changes in surface charge density as a result of specific hybridization can be detected and quantified with 50-pM sensitivity, single base-pair mismatch selectivity and in the presence of complex background. Lastly, because the naked eye is sufficient to read out hybridization, this approach may facilitate broad application of multiplexed assays.

  15. Chemically Modified Oligonucleotides Modulate an Epigenetically Varied and Transient Form of Transcription Silencing of HIV-1 in Human Cells

    Directory of Open Access Journals (Sweden)

    Stuart Knowling

    2012-01-01

    Full Text Available Small noncoding RNAs (ncRNAs have been shown to guide epigenetic silencing complexes to target loci in human cells. When targeted to gene promoters, these small RNAs can lead to long-term stable epigenetic silencing of gene transcription. To date, small RNAs have been shown to modulate transcriptional gene silencing (TGS of human immunodeficiency virus type 1 (HIV-1 as well as several other disease-related genes, but it has remained unknown as to what extent particular chemistries can be used to generate single-stranded backbone-modified oligonucleotides that are amenable to this form of gene targeting and regulation. Here, we present data indicating that specific combinations of backbone modifications can be used to generate single-stranded antisense oligonucleotides that can functionally direct TGS of HIV-1 in a manner that is however, independent of epigenetic changes at the target loci. Furthermore, this functionality appears contingent on the absence of a 5′ phosphate in the oligonucleotide. These data suggest that chemically modified oligonucleotide based approaches could be implemented as a means to regulate gene transcription in an epigenetically independent manner.

  16. Environment-responsive fluorescent nucleoside analogue probe for studying oligonucleotide dynamics in a model cell-like compartment.

    Science.gov (United States)

    Pawar, Maroti G; Srivatsan, Seergazhi G

    2013-11-21

    The majority of fluorescent nucleoside analogue probes that have been used in the in vitro study of nucleic acids are not suitable for cell-based biophysical assays because they exhibit excitation maxima in the UV region and low quantum yields within oligonucleotides. Therefore, we propose that the photophysical characterization of oligonucleotides labeled with a fluorescent nucleoside analogue in reverse micelles (RM), which are good biological membrane models and UV-transparent, could provide an alternative approach to studying the properties of nucleic acids in a cell-like confined environment. In this context, we describe the photophysical properties of an environment-sensitive fluorescent uridine analogue (1), based on the 5-(benzo[b]thiophen-2-yl)pyrimidine core, in micelles and RM. The emissive nucleoside, which is polarity- and viscosity-sensitive, reports the environment of the surfactant assemblies via changes in its fluorescence properties. The nucleoside analogue, incorporated into an RNA oligonucleotide and hybridized to its complementary DNA and RNA oligonucleotides, exhibits a significantly higher fluorescence intensity, lifetime, and anisotropy in RM than in aqueous buffer, which is consistent with the environment of RM. Collectively, our results demonstrate that nucleoside 1 could be utilized as a fluorescent label to study the function of nucleic acids in a model cellular milieu.

  17. Identification of Escherichia coli O157 by using a novel colorimetric detection method with DNA microarrays.

    Science.gov (United States)

    Quiñones, Beatriz; Swimley, Michelle S; Taylor, Amber W; Dawson, Erica D

    2011-06-01

    Shiga toxin-producing Escherichia coli O157 is a leading cause of foodborne illness worldwide. To evaluate better methods to rapidly detect and genotype E. coli O157 strains, the present study evaluated the use of ampliPHOX, a novel colorimetric detection method based on photopolymerization, for pathogen identification with DNA microarrays. A low-density DNA oligonucleotide microarray was designed to target stx1 and stx2 genes encoding Shiga toxin production, the eae gene coding for adherence membrane protein, and the per gene encoding the O157-antigen perosamine synthetase. Results from the validation experiments demonstrated that the use of ampliPHOX allowed the accurate genotyping of the tested E. coli strains, and positive hybridization signals were observed for only probes targeting virulence genes present in the reference strains. Quantification showed that the average signal-to-noise ratio values ranged from 47.73 ± 7.12 to 76.71 ± 8.33, whereas average signal-to-noise ratio values below 2.5 were determined for probes where no polymer was formed due to lack of specific hybridization. Sensitivity tests demonstrated that the sensitivity threshold for E. coli O157 detection was 100-1000 CFU/mL. Thus, the use of DNA microarrays in combination with photopolymerization allowed the rapid and accurate genotyping of E. coli O157 strains.

  18. Differential splicing using whole-transcript microarrays

    Directory of Open Access Journals (Sweden)

    Robinson Mark D

    2009-05-01

    Full Text Available Abstract Background The latest generation of Affymetrix microarrays are designed to interrogate expression over the entire length of every locus, thus giving the opportunity to study alternative splicing genome-wide. The Exon 1.0 ST (sense target platform, with versions for Human, Mouse and Rat, is designed primarily to probe every known or predicted exon. The smaller Gene 1.0 ST array is designed as an expression microarray but still interrogates expression with probes along the full length of each well-characterized transcript. We explore the possibility of using the Gene 1.0 ST platform to identify differential splicing events. Results We propose a strategy to score differential splicing by using the auxiliary information from fitting the statistical model, RMA (robust multichip analysis. RMA partitions the probe-level data into probe effects and expression levels, operating robustly so that if a small number of probes behave differently than the rest, they are downweighted in the fitting step. We argue that adjacent poorly fitting probes for a given sample can be evidence of differential splicing and have designed a statistic to search for this behaviour. Using a public tissue panel dataset, we show many examples of tissue-specific alternative splicing. Furthermore, we show that evidence for putative alternative splicing has a strong correspondence between the Gene 1.0 ST and Exon 1.0 ST platforms. Conclusion We propose a new approach, FIRMAGene, to search for differentially spliced genes using the Gene 1.0 ST platform. Such an analysis complements the search for differential expression. We validate the method by illustrating several known examples and we note some of the challenges in interpreting the probe-level data. Software implementing our methods is freely available as an R package.

  19. Improved detection of differentially expressed genes in microarray experiments through multiple scanning and image integration

    Science.gov (United States)

    Romualdi, Chiara; Trevisan, Silvia; Celegato, Barbara; Costa, Germano; Lanfranchi, Gerolamo

    2003-01-01

    The variability of results in microarray technology is in part due to the fact that independent scans of a single hybridised microarray give spot images that are not quite the same. To solve this problem and turn it to our advantage, we introduced the approach of multiple scanning and of image integration of microarrays. To this end, we have developed specific software that creates a virtual image that statistically summarises a series of consecutive scans of a microarray. We provide evidence that the use of multiple imaging (i) enhances the detection of differentially expressed genes; (ii) increases the image homogeneity; and (iii) reveals false-positive results such as differentially expressed genes that are detected by a single scan but not confirmed by successive scanning replicates. The increase in the final number of differentially expressed genes detected in a microarray experiment with this approach is remarkable; 50% more for microarrays hybridised with targets labelled by reverse transcriptase, and 200% more for microarrays developed with the tyramide signal amplification (TSA) technique. The results have been confirmed by semi-quantitative RT–PCR tests. PMID:14627839

  20. Reusable conductimetric array of interdigitated microelectrodes for the readout of low-density microarrays.

    Science.gov (United States)

    Mallén, Maria; Díaz-González, María; Bonilla, Diana; Salvador, Juan P; Marco, María P; Baldi, Antoni; Fernández-Sánchez, César

    2014-06-17

    Low-density protein microarrays are emerging tools in diagnostics whose deployment could be primarily limited by the cost of fluorescence detection schemes. This paper describes an electrical readout system of microarrays comprising an array of gold interdigitated microelectrodes and an array of polydimethylsiloxane microwells, which enabled multiplexed detection of up to thirty six biological events on the same substrate. Similarly to fluorescent readout counterparts, the microarray can be developed on disposable glass slide substrates. However, unlike them, the presented approach is compact and requires a simple and inexpensive instrumentation. The system makes use of urease labeled affinity reagents for developing the microarrays and is based on detection of conductivity changes taking place when ionic species are generated in solution due to the catalytic hydrolysis of urea. The use of a polydimethylsiloxane microwell array facilitates the positioning of the measurement solution on every spot of the microarray. Also, it ensures the liquid tightness and isolation from the surrounding ones during the microarray readout process, thereby avoiding evaporation and chemical cross-talk effects that were shown to affect the sensitivity and reliability of the system. The performance of the system is demonstrated by carrying out the readout of a microarray for boldenone anabolic androgenic steroid hormone. Analytical results are comparable to those obtained by fluorescent scanner detection approaches. The estimated detection limit is 4.0 ng mL(-1), this being below the threshold value set by the World Anti-Doping Agency and the European Community.

  1. Investigating amoebic pathogenesis using Entamoeba histolytica DNA microarrays

    Indian Academy of Sciences (India)

    Upinder Singh; Preetam Shah

    2002-11-01

    Entamoeba histolytica, a protozoan parasite, causes diarrhea and liver abscesses resulting in 50 million cases of infection worldwide annually. Elucidation of parasite virulence determinants has recently been investigated using genetic approaches. We have undertaken a genomics approach to identify novel virulence determinants in the parasite. A DNA microarray of E. histolytica is being developed based on sequenced genomic clones from the genome sequencing efforts of The Institute of Genomic Research (TIGR) and the Sanger Center. Hybridization of the slides with samples labelled differentially using fluorescent dyes allows the characterization of transcriptional profiles of genes under the biological conditions tested. Additionally, a genome-wide comparison of E. histolytica and E. dispar can be undertaken. The development of an E. histolytica microarray will be outlined and its uses in identifying novel virulence determinants and characterizing amoebic biology will be discussed.

  2. Investigations of oligonucleotide usage variance within and between prokaryotes

    DEFF Research Database (Denmark)

    Bohlin, J.; Skjerve, E.; Ussery, David

    2008-01-01

    Oligonucleotide usage in archaeal and bacterial genomes can be linked to a number of properties, including codon usage (trinucleotides), DNA base-stacking energy (dinucleotides), and DNA structural conformation (di-to tetranucleotides). We wanted to assess the statistical information potential...... was that prokaryotic chromosomes can be described by hexanucleotide frequencies, suggesting that prokaryotic DNA is predominantly short range correlated, i. e., information in prokaryotic genomes is encoded in short oligonucleotides. Oligonucleotide usage varied more within AT-rich and host-associated genomes than...... in GC-rich and free-living genomes, and this variation was mainly located in non-coding regions. Bias (selectional pressure) in tetranucleotide usage correlated with GC content, and coding regions were more biased than non-coding regions. Non-coding regions were also found to be approximately 5.5% more...

  3. Delivery of RNAi-Based Oligonucleotides by Electropermeabilization

    Directory of Open Access Journals (Sweden)

    Muriel Golzio

    2013-04-01

    Full Text Available For more than a decade, understanding of RNA interference (RNAi has been a growing field of interest. The potent gene silencing ability that small oligonucleotides have offers new perspectives for cancer therapeutics. One of the present limits is that many biological barriers exist for their efficient delivery into target cells or tissues. Electropermeabilization (EP is one of the physical methods successfully used to transfer small oligonucleotides into cells or tissues. EP consists in the direct application of calibrated electric pulses to cells or tissues that transiently permeabilize the plasma membranes, allowing efficient in vitro and in vivo. cytoplasmic delivery of exogenous molecules. The present review reports on the type of therapeutic RNAi-based oligonucleotides that can be electrotransferred, the mechanism(s of their electrotransfer and the technical settings for pre-clinical purposes.

  4. Retro-1 Analogues Differentially Affect Oligonucleotide Delivery and Toxin Trafficking.

    Science.gov (United States)

    Yang, Bing; Ming, Xin; Abdelkafi, Hajer; Pons, Valerie; Michau, Aurelien; Gillet, Daniel; Cintrat, Jean-Christophe; Barbier, Julien; Juliano, Rudy

    2016-11-21

    Retro-1 is a small molecule that displays two important biological activities: First, it blocks the actions of certain toxins by altering their intracellular trafficking. Second, it enhances the activity of oligonucleotides by releasing them from entrapment in endosomes. This raises the question of whether the two actions involve the same cellular target. Herein we report the effects of several Retro-1 analogues on both toxins and oligonucleotides. We found analogues that affect toxins but not oligonucleotides and vice-versa, while Retro-1 is the only compound that affects both. This indicates that the molecular target(s) involved in the two processes are distinct. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Secondary structure in the target as a confounding factor in synthetic oligomer microarray design

    Directory of Open Access Journals (Sweden)

    Gibas Cynthia J

    2005-03-01

    Full Text Available Abstract Background Secondary structure in the target is a property not usually considered in software applications for design of optimal custom oligonucleotide probes. It is frequently assumed that eliminating self-complementarity, or screening for secondary structure in the probe, is sufficient to avoid interference with hybridization by stable secondary structures in the probe binding site. Prediction and thermodynamic analysis of secondary structure formation in a genome-wide set of transcripts from Brucella suis 1330 demonstrates that the properties of the target molecule have the potential to strongly influence the rate and extent of hybridization between transcript and tethered oligonucleotide probe in a microarray experiment. Results Despite the relatively high hybridization temperatures and 1M monovalent salt imposed in the modeling process to approximate hybridization conditions used in the laboratory, we find that parts of the target molecules are likely to be inaccessible to intermolecular hybridization due to the formation of stable intramolecular secondary structure. For example, at 65°C, 28 ± 7% of the average cDNA target sequence is predicted to be inaccessible to hybridization. We also analyzed the specific binding sites of a set of 70mer probes previously designed for Brucella using a freely available oligo design software package. 21 ± 13% of the nucleotides in each probe binding site are within a double-stranded structure in over half of the folds predicted for the cDNA target at 65°C. The intramolecular structures formed are more stable and extensive when an RNA target is modeled rather than cDNA. When random shearing of the target is modeled for fragments of 200, 100 and 50 nt, an overall destabilization of secondary structure is predicted, but shearing does not eliminate secondary structure. Conclusion Secondary structure in the target is pervasive, and a significant fraction of the target is found in double stranded

  6. MicroArray Facility: a laboratory information management system with extended support for Nylon based technologies

    Directory of Open Access Journals (Sweden)

    Beaudoing Emmanuel

    2006-09-01

    Full Text Available Abstract Background High throughput gene expression profiling (GEP is becoming a routine technique in life science laboratories. With experimental designs that repeatedly span thousands of genes and hundreds of samples, relying on a dedicated database infrastructure is no longer an option. GEP technology is a fast moving target, with new approaches constantly broadening the field diversity. This technology heterogeneity, compounded by the informatics complexity of GEP databases, means that software developments have so far focused on mainstream techniques, leaving less typical yet established techniques such as Nylon microarrays at best partially supported. Results MAF (MicroArray Facility is the laboratory database system we have developed for managing the design, production and hybridization of spotted microarrays. Although it can support the widely used glass microarrays and oligo-chips, MAF was designed with the specific idiosyncrasies of Nylon based microarrays in mind. Notably single channel radioactive probes, microarray stripping and reuse, vector control hybridizations and spike-in controls are all natively supported by the software suite. MicroArray Facility is MIAME supportive and dynamically provides feedback on missing annotations to help users estimate effective MIAME compliance. Genomic data such as clone identifiers and gene symbols are also directly annotated by MAF software using standard public resources. The MAGE-ML data format is implemented for full data export. Journalized database operations (audit tracking, data anonymization, material traceability and user/project level confidentiality policies are also managed by MAF. Conclusion MicroArray Facility is a complete data management system for microarray producers and end-users. Particular care has been devoted to adequately model Nylon based microarrays. The MAF system, developed and implemented in both private and academic environments, has proved a robust solution for

  7. Use of a multi-thermal washer for DNA microarrays simplifies probe design and gives robust genotyping assays

    DEFF Research Database (Denmark)

    Petersen, J.; Poulsen, Lena; Petronis, S.

    2008-01-01

    DNA microarrays are generally operated at a single condition, which severely limits the freedom of designing probes for allele-specific hybridization assays. Here, we demonstrate a fluidic device for multi-stringency posthybridization washing of microarrays on microscope slides. This device...... is called a multi-thermal array washer (MTAW), and it has eight individually controlled heating zones, each of which corresponds to the location of a subarray on a slide. Allele-specific oligonucleotide probes for nine mutations in the beta-globin gene were spotted in eight identical subarrays at positions...... corresponding to the temperature zones of the MTAW. After hybridization with amplified patient material, the slides were mounted in the MTAW, and each subarray was exposed to different temperatures ranging from 22 to 40 degrees C. When processed in the MTAW, probes selected without considering melting...

  8. Gel-forming reagents and uses thereof for preparing microarrays

    Science.gov (United States)

    Golova, Julia; Chernov, Boris; Perov, Alexander

    2010-11-09

    New gel-forming reagents including monomers and cross-linkers, which can be applied to gel-drop microarray manufacturing by using co-polymerization approaches are disclosed. Compositions for the preparation of co-polymerization mixtures with new gel-forming monomers and cross-linker reagents are described herein. New co-polymerization compositions and cross-linkers with variable length linker groups between unsaturated C.dbd.C bonds that participate in the formation of gel networks are disclosed.

  9. A novel catechol-based universal support for oligonucleotide synthesis.

    Science.gov (United States)

    Anderson, Keith M; Jaquinod, Laurent; Jensen, Michael A; Ngo, Nam; Davis, Ronald W

    2007-12-21

    A novel universal support for deoxyribo- and ribonucleic acid synthesis has been developed. The support, constructed from 1,4-dimethoxycatechol, represents an improvement over existing universal supports because of its ability to cleave and deprotect under mild conditions in standard reagents. Because no nonvolatile additives are required for cleavage and deprotection, the synthesized oligonucleotides do not require purification prior to use in biochemical assays. Using reverse phase HPLC and electrospray mass spectroscopy, it was determined that oligonucleotides synthesized on the universal support (UL1) 3'-dephosphorylate quickly (9 h in 28-30% ammonium hydroxide (NH4OH) at 55 degrees C, 2 h in 28-30% NH4OH at 80 degrees C, or <1 h in ammonium hydroxide/methylamine (1:1) (AMA) at 80 degrees C). Oligonucleotides used as primers for the polymerase chain reaction (PCR) assay were found to perform identically to control primers, demonstrating full biological compatibility. In addition, a method was developed for sintering the universal support directly into a filter plug which can be pressure fit into the synthesis column of a commercial synthesizer. The universal support plugs allow the synthesis of high-quality oligonucleotides at least 120 nucleotides in length, with purity comparable to non-universal commercial supports and approximately 50% lower reagent consumption. The universal support plugs are routinely used to synthesize deoxyribo-, ribo-, 3'-modified, 5'-modified, and thioated oligonucleotides. The flexibility of the universal support and the efficiency of 3'-dephosphorylation are expected to increase the use of universal supports in oligonucleotide synthesis.

  10. Co-Administration of an Excipient Oligonucleotide Helps Delineate Pathways of Productive and Nonproductive Uptake of Phosphorothioate Antisense Oligonucleotides in the Liver.

    Science.gov (United States)

    Donner, Aaron J; Wancewicz, Edward V; Murray, Heather M; Greenlee, Sarah; Post, Noah; Bell, Melanie; Lima, Walt F; Swayze, Eric E; Seth, Punit P

    2017-08-01

    Phosphorothioate (PS) modified antisense oligonucleotides (ASOs) have progressed rapidly in the clinic for treating a variety of disease indications. We previously demonstrated that the activity of PS ASOs in the liver can be enhanced by co-infusion of an excipient oligonucleotide (EON). It was posited that the EON saturates a nonproductive uptake pathway(s) thereby permitting accumulation of the PS ASO in a productive tissue compartment. In this report, we measured PS ASO activity following administration by bolus, infusion or co-fusion with EON within hepatocytes and nonparenchymal cells (NPCs), of the liver. This revealed that while ASOs accumulate preferentially in NPCs, they are intrinsically more active in hepatocytes. Furthermore, we show that the EON enhances ASO potency when infused up to 72 h before or after administration of the active ASO suggesting that the EON can saturate and displace the ASO from nonproductive to productive compartments. Physical presence of the EON in tissues was required for optimal potentiation suggesting that there is a dynamic distribution of the ASO and EON between the compartments. Lastly, using a candidate approach, we confirmed Stabilin-2 as a molecular pathway for ASO uptake in sinusoidal endothelial cells and the ASGR as a pathway for ASO uptake into hepatocytes in the liver.

  11. Lipid-modified G4-decoy oligonucleotide anchored to nanoparticles

    DEFF Research Database (Denmark)

    Cogoi, S; Jakobsen, U; Pedersen, E B

    2016-01-01

    KRAS is mutated in >90% of pancreatic ductal adenocarcinomas. As its inactivation leads to tumour regression, mutant KRAS is considered an attractive target for anticancer drugs. In this study we report a new delivery strategy for a G4-decoy oligonucleotide that sequesters MAZ, a transcription...... factor essential for KRAS transcription. It is based on the use of palmitoyl-oleyl-phosphatidylcholine (POPC) liposomes functionalized with lipid-modified G4-decoy oligonucleotides and a lipid-modified cell penetrating TAT peptide. The potency of the strategy in pancreatic cancer cells is demonstrated...

  12. Inhibition of microRNA with antisense oligonucleotides.

    Science.gov (United States)

    Esau, Christine C

    2008-01-01

    Antisense inhibition of microRNA (miRNA) function has been an important tool for uncovering miRNA biology. Chemical modification of anti-miRNA oligonucleotides (AMOs) is necessary to improve affinity for target miRNA, stabilize the AMO to nuclease degradation, and to promote tissue uptake for in vivo delivery. Here I summarize the work done to evaluate the effectiveness of various chemically modified AMOs for use in cultured cells and rodent models, and outline important issues to consider when inhibiting miRNAs with antisense oligonucleotides.

  13. Synthesis of Peptide-Oligonucleotide Conjugates Using a Heterobifunctional Crosslinker

    Science.gov (United States)

    Williams, Berea A.R.; Chaput, John C.

    2010-01-01

    Peptide-oligonucleotide conjugates (POCs) are molecular chimeras composed of a nucleic acid moiety covalently attached to a polypeptide moiety. POCs have been used in numerous applications from therapeutics to nanotechnology, and most recently as combinatorial agents in the assembly of bivalent protein affinity reagents. This unit describes the synthesis and purification of POC molecules using the heterobifunctional crosslinking reagent succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), which enables amine-modified oligonucleotides to become covalently linked to cysteine-modified polypeptides. This solution-based protocol consists of a two-step synthesis followed by a single purification step. PMID:20827717

  14. Chemical phosphorylation of deoxyribonucleosides and thermolytic DNA oligonucleotides.

    Science.gov (United States)

    Ausín, Cristina; Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L

    2006-10-01

    The phosphorylating reagent bis[S-(4,4'-dimethoxytrityl)-2-mercaptoethyl]-N,N-diisopropylphosphoramidite is prepared in three steps from commercial methyl thioglycolate and diisopropylphosphoramidous dichloride. The phosphorylating reagent has been used successfully in the solid-phase synthesis of deoxyribonucleoside 5'-/3'-phosphate or -thiophosphate monoesters and oligonucleotide 5'-phosphate/-thiophosphate monoesters. Bis[S-(4,4'-dimethoxytrityl)-2-mercaptoethyl]-N,N-diisopropylphosphoramidite has also been employed in the construction of a thermolytic dinucleotide prodrug model to evaluate the ability of the reagent to produce thermosentive oligonucleotide prodrugs under mild temperature conditions ( approximately 25 degrees C) for potential therapeutic applications.

  15. Versatile functionalization of nanoelectrodes by oligonucleotides via pyrrole electrochemistry.

    Science.gov (United States)

    Descamps, Emeline; Nguyen, Khoa; Bouchain-Gautier, Christelle; Filoramo, Arianna; Goux-Capes, Laurence; Goffman, Marcello; Bourgoin, Jean-Philippe; Mailley, Pascal; Livache, Thierry

    2010-11-15

    Surface modification at the nanometer scale is a challenge for the future of molecular electronics. In particular, the precise anchoring and electrical addressing of biological scaffolds such as complex DNA nanonetworks is of importance for generating bio-directed assemblies of nano-objects for nanocircuit purposes. Herein, we consider the individual modification of nanoelectrodes with different oligonucleotide sequences by an electrochemically driven co-polymerization process of pyrrole and modified oligonucleotide sequences bearing pyrrole monomers. We demonstrate that this one-step technique presents the advantages of simplicity, localization of surface modification, mechanical, biological and chemical stability of the coatings, and high lateral resolution.

  16. Pineal function: impact of microarray analysis

    DEFF Research Database (Denmark)

    Klein, David C; Bailey, Michael J; Carter, David A

    2009-01-01

    Microarray analysis has provided a new understanding of pineal function by identifying genes that are highly expressed in this tissue relative to other tissues and also by identifying over 600 genes that are expressed on a 24-h schedule. This effort has highlighted surprising similarity...... foundation that microarray analysis has provided will broadly support future research on pineal function....

  17. The EADGENE Microarray Data Analysis Workshop

    NARCIS (Netherlands)

    Koning, de D.J.; Jaffrezic, F.; Lund, M.S.; Watson, M.; Channing, C.; Hulsegge, B.; Pool, M.H.; Buitenhuis, B.; Hedegaard, J.; Hornshoj, H.; Sorensen, P.; Marot, G.; Delmas, C.; Lê Cao, K.A.; San Cristobal, M.; Baron, M.D.; Malinverni, R.; Stella, A.; Brunner, R.M.; Seyfert, H.M.; Jensen, K.; Mouzaki, D.; Waddington, D.; Jiménez-Marín, A.; Perez-Alegre, M.; Perez-Reinado, E.; Closset, R.; Detilleux, J.C.; Dovc, P.; Lavric, M.; Nie, H.; Janss, L.

    2007-01-01

    Microarray analyses have become an important tool in animal genomics. While their use is becoming widespread, there is still a lot of ongoing research regarding the analysis of microarray data. In the context of a European Network of Excellence, 31 researchers representing 14 research groups from 10

  18. Seeded Bayesian Networks: Constructing genetic networks from microarray data

    Directory of Open Access Journals (Sweden)

    Quackenbush John

    2008-07-01

    Full Text Available Abstract Background DNA microarrays and other genomics-inspired technologies provide large datasets that often include hidden patterns of correlation between genes reflecting the complex processes that underlie cellular metabolism and physiology. The challenge in analyzing large-scale expression data has been to extract biologically meaningful inferences regarding these processes – often represented as networks – in an environment where the datasets are often imperfect and biological noise can obscure the actual signal. Although many techniques have been developed in an attempt to address these issues, to date their ability to extract meaningful and predictive network relationships has been limited. Here we describe a method that draws on prior information about gene-gene interactions to infer biologically relevant pathways from microarray data. Our approach consists of using preliminary networks derived from the literature and/or protein-protein interaction data as seeds for a Bayesian network analysis of microarray results. Results Through a bootstrap analysis of gene expression data derived from a number of leukemia studies, we demonstrate that seeded Bayesian Networks have the ability to identify high-confidence gene-gene interactions which can then be validated by comparison to other sources of pathway data. Conclusion The use of network seeds greatly improves the ability of Bayesian Network analysis to learn gene interaction networks from gene expression data. We demonstrate that the use of seeds derived from the biomedical literature or high-throughput protein-protein interaction data, or the combination, provides improvement over a standard Bayesian Network analysis, allowing networks involving dynamic processes to be deduced from the static snapshots of biological systems that represent the most common source of microarray data. Software implementing these methods has been included in the widely used TM4 microarray analysis package.

  19. Profiled support vector machines for antisense oligonucleotide efficacy prediction

    Directory of Open Access Journals (Sweden)

    Martín-Guerrero José D

    2004-09-01

    Full Text Available Abstract Background This paper presents the use of Support Vector Machines (SVMs for prediction and analysis of antisense oligonucleotide (AO efficacy. The collected database comprises 315 AO molecules including 68 features each, inducing a problem well-suited to SVMs. The task of feature selection is crucial given the presence of noisy or redundant features, and the well-known problem of the curse of dimensionality. We propose a two-stage strategy to develop an optimal model: (1 feature selection using correlation analysis, mutual information, and SVM-based recursive feature elimination (SVM-RFE, and (2 AO prediction using standard and profiled SVM formulations. A profiled SVM gives different weights to different parts of the training data to focus the training on the most important regions. Results In the first stage, the SVM-RFE technique was most efficient and robust in the presence of low number of samples and high input space dimension. This method yielded an optimal subset of 14 representative features, which were all related to energy and sequence motifs. The second stage evaluated the performance of the predictors (overall correlation coefficient between observed and predicted efficacy, r; mean error, ME; and root-mean-square-error, RMSE using 8-fold and minus-one-RNA cross-validation methods. The profiled SVM produced the best results (r = 0.44, ME = 0.022, and RMSE= 0.278 and predicted high (>75% inhibition of gene expression and low efficacy (http://aosvm.cgb.ki.se/. Conclusions The SVM approach is well suited to the AO prediction problem, and yields a prediction accuracy superior to previous methods. The profiled SVM was found to perform better than the standard SVM, suggesting that it could lead to improvements in other prediction problems as well.

  20. Correction of a Cystic Fibrosis Splicing Mutation by Antisense Oligonucleotides.

    Science.gov (United States)

    Igreja, Susana; Clarke, Luka A; Botelho, Hugo M; Marques, Luís; Amaral, Margarida D

    2016-02-01

    Cystic fibrosis (CF), the most common life-threatening genetic disease in Caucasians, is caused by ∼2,000 different mutations in the CF transmembrane conductance regulator (CFTR) gene. A significant fraction of these (∼13%) affect pre-mRNA splicing for which novel therapies have been somewhat neglected. We have previously described the effect of the CFTR splicing mutation c.2657+5G>A in IVS16, showing that it originates transcripts lacking exon 16 as well as wild-type transcripts. Here, we tested an RNA-based antisense oligonucleotide (AON) strategy to correct the aberrant splicing caused by this mutation. Two AONs (AON1/2) complementary to the pre-mRNA IVS16 mutant region were designed and their effect on splicing was assessed at the RNA and protein levels, on intracellular protein localization and function. To this end, we used the 2657+5G>A mutant CFTR minigene stably expressed in HEK293 Flp-In cells that express a single copy of the transgene. RNA data from AON1-treated mutant cells show that exon 16 inclusion was almost completely restored (to 95%), also resulting in increased levels of correctly localized CFTR protein at the plasma membrane (PM) and with increased function. A novel two-color CFTR splicing reporter minigene developed here allowed the quantitative monitoring of splicing by automated microscopy localization of CFTR at the PM. The AON strategy is thus a promising therapeutic approach for the specific correction of alternative splicing.

  1. Workflows for microarray data processing in the Kepler environment

    Directory of Open Access Journals (Sweden)

    Stropp Thomas

    2012-05-01

    traditional shell scripting or R/BioConductor scripting approaches to pipeline design. Finally, we suggest that microarray data processing task workflows may provide a basis for future example-based comparison of different workflow systems. Conclusions We provide a set of tools and complete workflows for microarray data analysis in the Kepler environment, which has the advantages of offering graphical, clear display of conceptual steps and parameters and the ability to easily integrate other resources such as remote data and web services.

  2. High quality protein microarray using in situ protein purification

    Directory of Open Access Journals (Sweden)

    Fleischmann Robert D

    2009-08-01

    protein solubility and denaturation problems caused by buffer exchange steps and freeze-thaw cycles, which are associated with resin-based purification, intermittent protein storage and deposition on microarrays. Conclusion An optimized platform for in situ protein purification on microarray slides using His-tagged recombinant proteins is a desirable tool for the screening of novel protein functions and protein-protein interactions. In the context of immunoproteomics, such protein microarrays are complimentary to approaches using non-recombinant methods to discover and characterize bacterial antigens.

  3. Meta-analysis of breast cancer microarray studies in conjunction with conserved cis-elements suggest patterns for coordinate regulation

    Directory of Open Access Journals (Sweden)

    Lundberg Cathryn

    2008-01-01

    Full Text Available Abstract Background Gene expression measurements from breast cancer (BrCa tumors are established clinical predictive tools to identify tumor subtypes, identify patients showing poor/good prognosis, and identify patients likely to have disease recurrence. However, diverse breast cancer datasets in conjunction with diagnostic clinical arrays show little overlap in the sets of genes identified. One approach to identify a set of consistently dysregulated candidate genes in these tumors is to employ meta-analysis of multiple independent microarray datasets. This allows one to compare expression data from a diverse collection of breast tumor array datasets generated on either cDNA or oligonucleotide arrays. Results We gathered expression data from 9 published microarray studies examining estrogen receptor positive (ER+ and estrogen receptor negative (ER- BrCa tumor cases from the Oncomine database. We performed a meta-analysis and identified genes that were universally up or down regulated with respect to ER+ versus ER- tumor status. We surveyed both the proximal promoter and 3' untranslated regions (3'UTR of our top-ranking genes in each expression group to test whether common sequence elements may contribute to the observed expression patterns. Utilizing a combination of known transcription factor binding sites (TFBS, evolutionarily conserved mammalian promoter and 3'UTR motifs, and microRNA (miRNA seed sequences, we identified numerous motifs that were disproportionately represented between the two gene classes suggesting a common regulatory network for the observed gene expression patterns. Conclusion Some of the genes we identified distinguish key transcripts previously seen in array studies, while others are newly defined. Many of the genes identified as overexpressed in ER- tumors were previously identified as expression markers for neoplastic transformation in multiple human cancers. Moreover, our motif analysis identified a collection of

  4. Anti sense and sensibility : renal and skin effects of (antisense) oligonucleotides

    NARCIS (Netherlands)

    Meer, van L.

    2017-01-01

    This thesis describes the clinical investigation of a novel treatment strategy for type 2 diabetes mellitus (t2dm) using an antisense oligonucleotide(aon)to inhibit the sglt2 receptor. Furthermore it describes skin effects of oligonucleotides

  5. Delivery of antisense oligonucleotides using cholesterol-modified sense dendrimers and cationic lipids

    NARCIS (Netherlands)

    Chaltin, Patrick; Margineanu, Anca; Marchand, Damien; Aerschot, Arthur Van; Rozenski, Jef; Schryver, Frans De; Herrmann, Andreas; Müllen, Klaus; Juliano, Rudolph; Fisher, Michael H.; Kang, Hyunmin; Feyter, Steven De; Herdewijn, Piet

    2005-01-01

    Cholesterol modified mono-, di-, and tetrameric oligonucleotides were synthesized and hybridized with antisense oligonucleotides to study their incorporation in cationic liposomes together with the influence of this dendrimeric delivery system on biological activity. Electrostatic interactions seem

  6. Hybridization of different antisense oligonucleotides on the surface of gold nanoparticles to silence zinc metalloproteinase gene after uptake by Leishmania major.

    Science.gov (United States)

    Jebali, Ali; Anvari-Tafti, Mohammad Hosssein

    2015-05-01

    The use of antisense oligonucleotides is a novel strategy to treat infectious diseases. In this approach, vital mRNAs are targeted by antisense oligonucleotides. The aim of this study was to evaluate the effects of gold nanoparticles hybridized with different antisense oligonucleotides on Leishmania (L) major. In this project, gold nanoparticles were first synthesized, and then conjugated with primary oligonucleotides, 3'-AAA-5'. Next, conjugated gold nanoparticles (NP1) were separately hybridized with three types of antisense oligonucleotide from coding reign of GP63 gene (NP2), non-coding reign of GP63 gene (NP3), and both coding and non-coding reigns of GP63 (NP4). Then, 1mL of L. major suspension was separately added to 1mL of different hybridized gold nanoparticles at serial concentrations (1-200μg/mL), and incubated for 24, 48, and 72h at 37°C. Next, the uptake of each nanoparticle was separately measured by atomic absorption spectroscopy. After incubation, the cell viability was separately evaluated by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide assay. Also, the expression of GP63 gene was read out by quantitative-real-time PCR. This study showed that NP2 and NP3 had higher (5-fold) uptake than NP1 and NP4. Moreover, NP2 and NP3 led to less cell viability and gene expression, compared with NP1 and NP4. It could be concluded that both sequence and size of antisense oligonucleotide were important for transfection of L. major. Importantly, these antisense oligonucleotides can be obtained from both coding and non-coding reign of GP63 gene. Moreover,