WorldWideScience

Sample records for oligonucleotide dna adducts

  1. Chlorambucil-adducts in DNA analyzed at the oligonucleotide level using HPLC-ESI MS.

    Science.gov (United States)

    Mohamed, Dalia; Mowaka, Shereen; Thomale, Jürgen; Linscheid, Michael W

    2009-08-01

    Chlorambucil (N,N-bis(2-chloroethyl)-p-aminophenylbutyric acid) is a bifunctional alkylating drug belonging to the nitrogen mustard group and is widely used as an anticancer agent. As the antitumor activity of the nitrogen mustards is based on the formation of adducts with genomic DNA, calf thymus DNA-Chlorambucil adducts were the major target in this study. Calf thymus DNA was incubated with Chlorambucil to induce the formation of a wide variety of adducts. Subsequently, enzymatic digestion of the DNA was performed using Benzonase and Nuclease S1 aiming at the production of oligonucleotides. Separation and structure elucidation of the individual DNA-Chlorambucil adducts was achieved using HPLC interfaced to electrospray ionization ion trap mass spectrometry. Both trinucleotide and tetranucleotide Chlorambucil adducts were detected. The majority of the detected trinucleotide adducts involved monofunctional alkylation with guanine being the hotspot for alkylation. Only a few bifunctional trinucleotide adducts both intra- and interstrand cross-links were found. On the contrary, cross-linked adducts were the major detected tetranucleotides in which the intrastrand cross-links predominated over the interstrand cross-links. To a lesser extent, monofunctional guanine alkylated tetranucleotides were detected as well. With MS(n) experiments, the detailed structures of Chlorambucil adducts of the tri- and tetranucleotides were determined.

  2. Use of ion mobility mass spectrometry and a collision cross-section algorithm to study an organometallic ruthenium anticancer complex and its adducts with a DNA oligonucleotide.

    Science.gov (United States)

    Williams, Jonathan P; Lough, Julie Ann; Campuzano, Iain; Richardson, Keith; Sadler, Peter J

    2009-11-01

    We report the development of an enhanced algorithm for the calculation of collision cross-sections in combination with Travelling-Wave ion mobility mass spectrometry technology and its optimisation and evaluation through the analysis of an organoruthenium anticancer complex [(eta6-biphenyl)Ru(II)(en)Cl]+. Excellent agreement was obtained between the experimentally determined and theoretically determined collision cross-sections of the complex and its major product ion formed via collision-induced dissociation. Collision cross-sections were also experimentally determined for adducts of this ruthenium complex with the single-stranded oligonucleotide hexamer d(CACGTG). Ion mobility tandem mass spectrometry measurements have allowed the binding sites for ruthenium on the oligonucleotide to be determined.

  3. DNA adducts-chemical addons

    Directory of Open Access Journals (Sweden)

    T R Rajalakshmi

    2015-01-01

    Full Text Available DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde. This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could be carried out for early detection of cancer. When scanning tunneling microscope is used, the DNA results can be obtained earlier. DNA adducts in scientific experiments are used as biomarkers.

  4. DNA adducts-chemical addons

    Science.gov (United States)

    Rajalakshmi, T. R.; AravindhaBabu, N.; Shanmugam, K. T.; Masthan, K. M. K.

    2015-01-01

    DNA adduct is a piece of DNA covalently bond to a chemical (safrole, benzopyrenediol epoxide, acetaldehyde). This process could be the start of a cancerous cell. When a chemical binds to DNA, it gets damaged resulting in abnormal replication. This could be the start of a mutation and without proper DNA repair, this can lead to cancer. It is this chemical that binds with the DNA is our prime area of concern. Instead of performing the whole body analysis for diagnosing cancer, this test could be carried out for early detection of cancer. When scanning tunneling microscope is used, the DNA results can be obtained earlier. DNA adducts in scientific experiments are used as biomarkers. PMID:26015708

  5. Sperm DNA oxidative damage and DNA adducts

    Science.gov (United States)

    Jeng, Hueiwang Anna; Pan, Chih-Hong; Chao, Mu-Rong; Lin, Wen-Yi

    2015-01-01

    The objective of this study was to investigate DNA damage and adducts in sperm from coke oven workers who have been exposed to polycyclic aromatic hydrocarbons. A longitudinal study was conducted with repeated measurements during spermatogenesis. Coke-oven workers (n=112) from a coke-oven plant served the PAH-exposed group, while administrators and security personnel (n=67) served the control. Routine semen parameters (concentration, motility, vitality, and morphology) were analyzed simultaneously; the assessment of sperm DNA integrity endpoints included DNA fragmentation, bulky DNA adducts, and 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxo-dGuo). The degree of sperm DNA fragmentation was measured using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and sperm chromatin structure assay (SCSA). The PAH-exposed group had a significant increase in bulky DNA adducts and 8-oxo-dGuo compared to the control subjects (Ps = 0.002 and 0.045, respectively). Coke oven workers' percentages of DNA fragmentation and denaturation from the PAH-exposed group were not significantly different from those of the control subjects (Ps = 0.232 and 0.245, respectively). Routine semen parameters and DNA integrity endpoints were not correlated. Concentrations of 8-oxo-dGuo were positively correlated with percentages of DNA fragmentation measured by both TUNEL and SCSA (Ps = 0.045 and 0.034, respectively). However, the concentrations of 8-oxo-dGuo and percentages of DNA fragmentation did not correlate with concentrations of bulky DNA adducts. In summary, coke oven workers with chronic exposure to PAHs experienced decreased sperm DNA integrity. Oxidative stress could contribute to the degree of DNA fragmentation. Bulky DNA adducts may be independent of the formation of DNA fragmentation and oxidative adducts in sperm. Monitoring sperm DNA integrity is recommended as a part of the process of assessing the impact of occupational and environmental toxins on

  6. Single-stranded oligonucleotide adducts formed by Pt complexes favoring left-handed base canting: steric effect of flanking residues and relevance to DNA adducts formed by Pt anticancer drugs.

    Science.gov (United States)

    Saad, Jamil S; Marzilli, Patricia A; Intini, Francesco P; Natile, Giovanni; Marzilli, Luigi G

    2011-09-01

    Platinum anticancer drug binding to DNA creates large distortions in the cross-link (G*G*) and the adjacent XG* base pair (bp) steps (G* = N7-platinated G). These distortions, which are responsible for anticancer activity, depend on features of the duplex (e.g., base pairing) and of the cross-link moiety (e.g., the position and canting of the G* bases). The duplex structure stabilizes the head-to-head (HH) over the head-to-tail (HT) orientation and right-handed (R) over left-handed (L) canting of the G* bases. To provide fundamental chemical information relevant to the assessment of such duplex effects, we examine (S,R,R,S)-BipPt(oligo) adducts (Bip = 2,2'-bipiperidine with S,R,R,S chiral centers at the N, C, C, and N chelate ring atoms, respectively; oligo = d(G*pG*) with 3'- and/or 5'-substituents). The moderately bulky (S,R,R,S)-Bip ligand favors L canting and slows rotation about the Pt-G* bonds, and the (S,R,R,S)-BipPt(oligo) models provide more useful data than do dynamic models derived from active Pt drugs. All 5'-substituents in (S,R,R,S)-BipPt(oligo) adducts favor the normal HH conformer (∼97%) by destabilizing the HT conformer through clashes with the 3'-G* residue rather than through favorable H-bonding interactions with the carrier ligand in the HH conformer. For all (S,R,R,S)-BipPt(oligo) adducts, the S pucker of the 5'-X residue is retained. For these adducts, a 5'-substituent had only modest effects on the degree of L canting for the (S,R,R,S)-BipPt(oligo) HH conformer. This small flanking 5'-substituent effect on an L-canted HH conformer contrasts with the significant decrease in the degree of R canting previously observed for flanking 5'-substituents in the R-canted (R,S,S,R)-BipPt(oligo) analogues. The present data support our earlier hypothesis that the distortion distinctive to the XG* bp step (S to N pucker change and movement of the X residue) is required for normal stacking and X·X' WC H bonding and to prevent XG* residue clashes.

  7. A mitomycin-N6-deoxyadenosine adduct isolated from DNA.

    Science.gov (United States)

    Palom, Y; Lipman, R; Musser, S M; Tomasz, M

    1998-03-01

    A minor N6-deoxyadenosine adduct of mitomycin C (MC) was isolated from synthetic oligonucleotides and calf thymus DNA, representing the first adduct of MC and a DNA base other than guanine. The structure of the adduct (8) was elucidated using submilligram quantities of total available material. UV difference spectroscopy, circular dichroism, and electrospray mass spectroscopy as well as chemical transformations were utilized in deriving the structure of 8. A series of synthetic oligonucleotides was designed to probe the specificities of the alkylation of adenine by MC. The nature and frequency of the oligonucleotide-MC adducts formed under conditions of reductive activation of MC were determined by their enzymatic digestion to the nucleoside level followed by quantitative analysis of the products by HPLC. The analyses indicated the following: (i) (A)n sequence is favored over (AT)n for adduct formation; (ii) the alkylation favors the duplex structure; (iii) at adenine sites only monofunctional alkylation occurs; (iv) the adenine-to-alkylation frequency in the model oligonucleotides was 0.3-0.6 relative to guanine alkylation at the 5'-ApG sequence but only 0.02-0.1 relative to guanine alkylation at 5'-CpG. The 5'-phosphodiester linkage of the MC-adenine adduct is resistant to snake venom diesterase. The overall ratio of adenine to guanine alkylation in calf thymus DNA was 0.03, indicating that 8 is a minor MC-DNA adduct relative to MC-DNA adducts at guanine residues in the present experimental residues in the present experimental system. However, the HPLC elution time of 8 coincides with that of a major, unknown MC adduct detected previously in mouse mammary tumor cells treated with radiolabeled MC [Bizanek, R., Chowdary, D., Arai, H., Kasai, M., Hughes, C. S., Sartorelli, A. C., Rockwell, S., and Tomasz, M. (1993) Cancer Res. 53, 5127-5134]. Thus, 8 may be identical or closely related to this major adduct formed in vivo. This possibility can now be tested by

  8. Line narrowing spectroscopic studies of DNA-carcinogen adducts and DNA-dye complexes

    Energy Technology Data Exchange (ETDEWEB)

    Suh, Myungkoo

    1995-12-06

    Laser-induced fluorescence line narrowing and non-line narrowing spectroscopic methods were applied to conformational studies of stable DNA adducts of the 7{beta}, 8{alpha}-dihydoxy-9{alpha}, l0{alpha}-epoxy-7,8,9, 10-tetrahydrobenzo[{alpha}]pyrene (anti-BPDE). Stereochemically distinct (+)-trans-, ({minus})-trans-, (+)-cis- and ({minus})-cis adducts of anti-BPDE bound to exocyclic amino group of the central guanine in an 11-mer oligonucleotide, exist in a mixture of conformations in frozen aqueous buffer matrices. The (+)-trans adduct adopts primarily an external conformation with a smaller fraction ( {approximately} 25 %) exists in a partially base-stacked conformation. Both cis adducts were found to be intercalated with significant {pi}-{pi} stacking interactions between the pyrenyl residues and the bases. Conformations of the trans-adduct of (+)-anti -BPDE in 11-mer oligonucleotides were studied as a function of flanking bases. In single stranded form the adduct at G{sub 2} or G{sub 3} (5 ft-flanking, base guanine) adopts a conformation with strong, interaction with the bases. In contrast, the adduct with a 5ft-flanking, thymine exists in a primarily helixexternal conformation. Similar differences were observed in the double stranded oligonucleotides. The nature of the 3ft-flanking base has little influence on the conformational equilibrium of the (+)-trans-anti BPDE-dG adduct. The formation and repair of BPDE-N{sup 2}-dG in DNA isolated from the skin of mice treated topically with benzo[{alpha}]pyrene (BP) was studied. Low-temperature fluorescence spectroscopy of the intact DNA identified the major adduct as (+)-trans-anti-BPDE-N-dG, and the minor adduct fraction consisted mainly of (+)-cis-anti-BPDE-N{sup 2}-dG.

  9. Line narrowing spectroscopic studies of DNA-carcinogen adducts and DNA-dye complexes

    Energy Technology Data Exchange (ETDEWEB)

    Suh, Myungkoo [Iowa State Univ., Ames, IA (United States)

    1995-12-06

    Laser-induced fluorescence line narrowing and non-line narrowing spectroscopic methods were applied to conformational studies of stable DNA adducts of the 7β, 8α-dihydoxy-9α, l0α-epoxy-7,8,9, 10-tetrahydrobenzo[α]pyrene (anti-BPDE). Stereochemically distinct (+)-trans-, (-)-trans-, (+)-cis- and (-)-cis adducts of anti-BPDE bound to exocyclic amino group of the central guanine in an 11-mer oligonucleotide, exist in a mixture of conformations in frozen aqueous buffer matrices. The (+)-trans adduct adopts primarily an external conformation with a smaller fraction ( ~25 %) exists in a partially base-stacked conformation. Both cis adducts were found to be intercalated with significant π-π stacking interactions between the pyrenyl residues and the bases. Conformations of the trans-adduct of (+)-anti -BPDE in 11-mer oligonucleotides were studied as a function of flanking bases. In single stranded form the adduct at G2 or G3 (5 ft-flanking, base guanine) adopts a conformation with strong, interaction with the bases. In contrast, the adduct with a 5ft-flanking, thymine exists in a primarily helixexternal conformation. Similar differences were observed in the double stranded oligonucleotides. The nature of the 3ft-flanking base has little influence on the conformational equilibrium of the (+)-trans-anti BPDE-dG adduct. The formation and repair of BPDE-N2-dG in DNA isolated from the skin of mice treated topically with benzo[α]pyrene (BP) was studied. Low-temperature fluorescence spectroscopy of the intact DNA identified the major adduct as (+)-trans-anti-BPDE-N-dG, and the minor adduct fraction consisted mainly of (+)-cis-anti-BPDE-N2-dG.

  10. Detection of DNA adducts by bioluminescence

    Science.gov (United States)

    Xu, Shunqing; Tan, Xianglin; Yao, Qunfeng; He, Min; Zhou, Yikai; Chen, Jian

    2001-09-01

    Luminescent assay for detection ATP is very sensitive with limitation of 10-17 moles. ATP using styrene oxide as a model carcinogen we currently apply a luminescence technique to detect the very low levels of carcinogen-DNA adducts in vitro and in vivo. The bioluminescent assay of DNA adducts entails three consecutive steps: digestion of modified DNA to adducted dinucleoside monophosphate and normal nucleotide are hydrolyzed to nucleosides (N) by nuclease P1 and prostatic acid phosphomonesterase (PAP); incorporation of (gamma) -P of ATP into normal nucleoside(N); detection of consumption of ATP by luminescence. This assay does not require separate manipulation because of the selective property of nuclease P1. One fmol of carcinogen- DNA adducts was detected by luminescent assay. A good correlation between results of luminescent assay and 32P-postlabeling procedures has been observed. We detect 1 adduct in 108 nucleotides for 10(mu) g DNA sample. The procedures of luminescent method is very simple and low- cost. IT appears applicable to the ultra sensitive detection of low levels of DNA adducts without radioactive isotope.

  11. New DNA adducts of crotonaldehyde and acetaldehyde.

    Science.gov (United States)

    Hecht, S S; McIntee, E J; Wang, M

    2001-09-14

    This paper summarizes our recent studies on adducts produced in the reactions of the carcinogens crotonaldehyde (2-butenal) and acetaldehyde with deoxyguanosine (dG) and DNA. Human exposure to these carcinogens can be considerable, from both exogenous and endogenous sources. Crotonaldehyde reacts with DNA to form Michael addition products, a pathway that has been well described. We describe a second major pathway, in which 3-hydroxybutanal, formed by addition of H(2)O to crotonaldehyde, reacts with DNA to produce the Schiff base N(2)-(3-hydroxybut-1-ylidene)dG as well as several diastereomers of N(2)-paraldol-dG. Acetaldehyde reacts with DNA and dG giving a major Schiff base adduct, N(2)-ethylidene-dG. A cross-linked adduct of acetaldehyde has been characterized for the first time, and other adducts resulting from the reaction of two and three molecules of acetaldehyde with dG have been observed. The results of these studies demonstrate that some structurally unique adducts are formed from these carcinogenic aldehydes and suggest some new directions for research on the potential role of aldehydes in human cancer.

  12. STUDY ON GMA-DNA ADDUCTS

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    Objective. DNA modification fixed as mutations in the cells may be an essential factor in the initiation step of chemical carcinogenesis. In order to explore the mechanism of gene mutation and cell transformation induced by glycidyl methacrylate (GMA), the current test studied the characteristics of GMA-DNA adducts formation in vitro.Methods. In vitro test, dAMP, dCMP, dGMP, dTMP and calf thymus DNA were allowed to react with GMA (Glycidyl Methacrylate). After the reaction, the mixtures were detected by UV and subjected to reversed-phase HPLC on ultrasphere ODS reversed-phase column, the reaction products were eluted with a linear gradients of methanol (solvent A) and 10mmol/L ammonium formate, pH5.0 (solvent B). The synthesized adducts were then characterized by UV spectroscopy in acid (pH1.0), neutral (pH7.2), alkaline (pH11.0) and by mass spectroscopy.Results. The results showed that GMA could bind with dAMP, dCMP, dGMP and calf thymus DNA by covalent bond, and the binding sites were specific (N6 of adenine, N3 of cytosine). Meanwhile, a main GMA-DNA adduct in the reaction of GMA with calf thymus DNA was confirmed as N3-methacrylate-2-hydroxypropy1-dCMP.Conclusions. GMA can react with DNA and /or deoxynucleotide monophosphate and generate some adducts such as N6-methacrylate-2-hydroxypropyl-dAMP and N3-methacrylate-2-hydroxypropyl-dCMP, ets. Formation of GMA-DNA adducts is an important molecular event in gene mutation and cell transformation induced by GMA.

  13. An oligonucleotide hybridization approach to DNA sequencing.

    Science.gov (United States)

    Khrapko, K R; Lysov YuP; Khorlyn, A A; Shick, V V; Florentiev, V L; Mirzabekov, A D

    1989-10-09

    We have proposed a DNA sequencing method based on hybridization of a DNA fragment to be sequenced with the complete set of fixed-length oligonucleotides (e.g., 4(8) = 65,536 possible 8-mers) immobilized individually as dots of a 2-D matrix [(1989) Dokl. Akad. Nauk SSSR 303, 1508-1511]. It was shown that the list of hybridizing octanucleotides is sufficient for the computer-assisted reconstruction of the structures for 80% of random-sequence fragments up to 200 bases long, based on the analysis of the octanucleotide overlapping. Here a refinement of the method and some experimental data are presented. We have performed hybridizations with oligonucleotides immobilized on a glass plate, and obtained their dissociation curves down to heptanucleotides. Other approaches, e.g., an additional hybridization of short oligonucleotides which continuously extend duplexes formed between the fragment and immobilized oligonucleotides, should considerably increase either the probability of unambiguous reconstruction, or the length of reconstructed sequences, or decrease the size of immobilized oligonucleotides.

  14. The modulation of topoisomerase I-mediated DNA cleavage and the induction of DNA–topoisomerase I crosslinks by crotonaldehyde-derived DNA adducts

    OpenAIRE

    2008-01-01

    Crotonaldehyde is a representative α,β-unsaturated aldehyde endowed of mutagenic and carcinogenic properties related to its propensity to react with DNA. Cyclic crotonaldehyde-derived deoxyguanosine (CrA-PdG) adducts can undergo ring opening in duplex DNA to yield a highly reactive aldehydic moiety. Here, we demonstrate that site-specifically modified DNA oligonucleotides containing a single CrA-PdG adduct can form crosslinks with topoisomerase I (Top1), both directly and indirectly. Direct c...

  15. Conjugation of fluorescent proteins with DNA oligonucleotides.

    Science.gov (United States)

    Lapiene, Vidmantas; Kukolka, Florian; Kiko, Kathrin; Arndt, Andreas; Niemeyer, Christof M

    2010-05-19

    This work describes the synthesis of covalent ssDNA conjugates of six fluorescent proteins, ECFP, EGFP, E(2)GFP, mDsRed, Dronpa, and mCherry, which were cloned with an accessible C-terminal cystein residue to enable site-selective coupling using a heterobispecific cross-linker. The resulting conjugates revealed similar fluorescence emission intensity to the unconjugated proteins, and the functionality of the tethered oligonucleotide was proven by specific Watson-Crick base pairing to cDNA-modified gold nanoparticles. Fluorescence spectroscopy analysis indicated that the fluorescence of the FP is quenched by the gold particle, and the extent of quenching varied with the intrinsic spectroscopic properties of FP as well as with the configuration of surface attachment. Since this study demonstrates that biological fluorophores can be selectively incorporated into and optically coupled with nanoparticle-based devices, applications in DNA-based nanofabrication can be foreseen.

  16. Optical Characterization of Oligonucleotide DNA Influenced by Magnetic Fields

    Directory of Open Access Journals (Sweden)

    Seyedeh Maryam Banihashemian

    2013-09-01

    Full Text Available UV-VIS spectroscopic analysis of oligonucleotide DNA exposed to different magnetic fields was performed in order to investigate the relationship between DNA extinction coefficients and optical parameters according to magnetic-field strength. The results with the oligonucleotides adenine-thymine 100 mer (AT-100 DNA and cytosine-guanine 100 mer (CG-100 DNA indicate that the magnetic field influences DNA molar extinction coefficients and refractive indexes. The imaginary parts of the refractive index and molar extinction coefficients of the AT-100 and CG-100 DNA decreased after exposure to a magnetic field of 750 mT due to cleavage of the DNA oligonucleotides into smaller segments.

  17. Oligonucleotide and Long Polymeric DNA Encoding

    Energy Technology Data Exchange (ETDEWEB)

    Miller, E; Mariella Jr., R P; Christian, A T; Gardner, S N; Williams, J M

    2003-11-24

    This report summarizes the work done at Lawrence Livermore National Laboratory for the Oligonucleotide and Long Polymeric DNA Encoding project, part of the Microelectronic Bioprocesses Program at DARPA. The goal of the project was to develop a process by which long (circa 10,000 base-pair) synthetic DNA molecules could be synthesized in a timely and economic manner. During construction of the long molecule, errors in DNA sequence occur during hybridization and/or the subsequent enzymatic process. The work done on this project has resulted in a novel synthesis scheme that we call the parallel pyramid synthesis protocol, the development of a suit of computational tools to minimize and quantify errors in the synthesized DNA sequence, and experimental proof of this technique. The modeling consists of three interrelated modules: the bioinformatics code which determines the specifics of parallel pyramid synthesis for a given chain of long DNA, the thermodynamics code which tracks the products of DNA hybridization and polymerase extension during the later steps in the process, and the kinetics model which examines the temporal and spatial processes during one thermocycle. Most importantly, we conducted the first successful syntheses of a gene using small starting oligomers (tetramers). The synthesized sequence, 813 base pairs long, contained a 725 base pair gene, modified green fluorescent protein (mGFP), which has been shown to be a functional gene by cloning into cells and observing its green fluorescent product.

  18. Diet-related DNA adduct formation in relation to carcinogenesis.

    Science.gov (United States)

    Hemeryck, Lieselot Y; Vanhaecke, Lynn

    2016-08-01

    The human diet contributes significantly to the initiation and promotion of carcinogenesis. It has become clear that the human diet contains several groups of natural foodborne chemicals that are at least in part responsible for the genotoxic, mutagenic, and carcinogenic potential of certain foodstuffs. Electrophilic chemicals are prone to attack nucleophilic sites in DNA, resulting in the formation of altered nucleobases, also known as DNA adducts. Since DNA adduct formation is believed to signal the onset of chemically induced carcinogenesis, the DNA adduct-inducing potential of certain foodstuffs has been investigated to gain more insight into diet-related pathways of carcinogenesis. Many studies have investigated diet-related DNA adduct formation. This review summarizes work on known or suspected dietary carcinogens and the role of DNA adduct formation in hypothesized carcinogenesis pathways.

  19. DNA adduct formation by o-phenylphenol metabolite in vivo and in vitro.

    Science.gov (United States)

    Ushiyama, K; Nagai, F; Nakagawa, A; Kano, I

    1992-08-01

    [U-14C]o-Phenylphenol (OPP) was found to bind covalently to calf thymus DNA during a 60 min incubation in the presence of microsomes, but not in their absence, indicating that metabolic conversion of the parent compound, OPP, to an activated form is essential. Postlabeling analysis with bladder DNA of rats fed a diet containing 2% OPP for 13 weeks revealed one major adduct on TLC. In an in vitro postlabeling experiment with calf thymus DNA, both of the major metabolites of OPP, phenylhydroquinone (PHQ) and phenylbenzoquinone (PBQ), formed adducts, but no adducts were observed with OPP. The chemical structure responsible for adduct formation is thought to be the PHQ semiquinone radical intermediate formed during interconversion between PHQ and PBQ. When the oligonucleotides, pd(A)12-18, pd(C)12-18, pd(G)12-18 and pd(T)12-18, were used in vitro, only pd(G)12-18 gave TLC-detectable adducts on treatment with PHQ and PBQ. The covalent binding appears to be rather specific to guanine residues. These results suggest that covalent binding of the OPP metabolite is one of the underlying events in OPP-induced carcinogenesis in rats.

  20. Photochemistry of psoralen-DNA adducts, biological effects of psoralen-DNA adducts, applications of psoralen-DNA photochemistry

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Yun-bo

    1988-03-01

    This thesis consists of three main parts and totally eight chapters. In Part I, The author will present studies on the photochemistry of psoralen-DNA adducts, specifically, the wavelength dependencies for the photoreversals of thymidine-HMT (4'-hydroxymethyl-4, 5', 8-trimenthylpsoralen) monoadducts and diadduct and the same adducts incorporated in DNA helices and the wavelength dependecies for the photocrossslinking of thymidine-HMT monoadducts in double-stranded helices. In Part II, The author will report some biological effects of psoralen-DNA adducts, i.e., the effects on double-stranded DNA stability, DNA structure, and transcription by E. coli and T7 RNA polymerases. Finally, The author will focus on the applications of psoralen-DNA photochemistry to investigation of protein-DNA interaction during transcription, which includes the interaction of E. coli and T7 RNA polymerases with DNA in elongation complexes arrested at specific psoralen-DNA adduct sites as revealed by DNase I footprinting experiments. 123 refs., 52 figs., 12 tabs.

  1. Human DNA polymerases catalyze lesion bypass across benzo[a]pyrene-derived DNA adduct clustered with an abasic site.

    Science.gov (United States)

    Starostenko, Lidia V; Rechkunova, Nadejda I; Lebedeva, Natalia A; Kolbanovskiy, Alexander; Geacintov, Nicholas E; Lavrik, Olga I

    2014-12-01

    The combined action of oxidative stress and genotoxic polycyclic aromatic hydrocarbons derivatives can lead to cluster-type DNA damage that includes both a modified nucleotide and a bulky lesion. As an example, we investigated the possibility of repair of an AP site located opposite a minor groove-positioned (+)-trans-BPDE-dG or a base-displaced intercalated (+)-cis-BPDE-dG adduct (BP lesion) by a BER system. Oligonucleotides with single uracil residue in the certain position were annealed with complementary oligonucleotides bearing either a cis- or trans-BP adduct. Digestion with uracil DNA glycosylase was utilized to generate an AP site which was then hydrolyzed by APE1, and the resulting gap was processed by X-family DNA polymerases β (Polβ) and λ (Polλ), or Y-family polymerase ι (Polι). By varying reaction conditions, namely, Mg2+/Mn2+ replacement/combination and ionic strength decrease, we found that under certain conditions both Polβ and Polι can catalyze lesion bypass across both cis- and trans-BP adducts in the presence of physiological dNTP concentrations. Polβ and Polι catalyze gap filling trans-lesion synthesis in an error prone manner. By contrast, Polλ selectively introduced the correct dCTP opposite the modified dG in the case of cis-BP-dG adduct only, and did not bypass the stereoisomeric trans-adduct under any of the conditions examined. The results suggest that Polλ is a specialized polymerase that can process these kinds of lesions.

  2. Near-infrared silver cluster optically signaling oligonucleotide hybridization and assembling two DNA hosts.

    Science.gov (United States)

    Petty, Jeffrey T; Nicholson, David A; Sergev, Orlin O; Graham, Stuart K

    2014-09-16

    Silver clusters with ~10 atoms form within DNA strands, and the conjugates are chemical sensors. The DNA host hybridizes with short oligonucleotides, and the cluster moieties optically respond to these analytes. Our studies focus on how the cluster adducts perturb the structure of their DNA hosts. Our sensor is comprised of an oligonucleotide with two components: a 5'-cluster domain that complexes silver clusters and a 3'-recognition site that hybridizes with a target oligonucleotide. The single-stranded sensor encapsulates an ~11 silver atom cluster with violet absorption at 400 nm and with minimal emission. The recognition site hybridizes with complementary oligonucleotides, and the violet cluster converts to an emissive near-infrared cluster with absorption at 730 nm. Our key finding is that the near-infrared cluster coordinates two of its hybridized hosts. The resulting tertiary structure was investigated using intermolecular and intramolecular variants of the same dimer. The intermolecular dimer assembles in concentrated (~5 μM) DNA solutions. Strand stoichiometries and orientations were chromatographically determined using thymine-modified complements that increase the overall conjugate size. The intramolecular dimer develops within a DNA scaffold that is founded on three linked duplexes. The high local cluster concentrations and relative strand arrangements again favor the antiparallel dimer for the near-infrared cluster. When the two monomeric DNA/violet cluster conjugates transform to one dimeric DNA/near-infrared conjugate, the DNA strands accumulate silver. We propose that these correlated changes in DNA structure and silver stoichiometry underlie the violet to near-infrared cluster transformation.

  3. Detection of adriamycin-DNA adducts by accelerator mass spectrometry.

    Science.gov (United States)

    Coldwell, Kate; Cutts, Suzanne M; Ognibene, Ted J; Henderson, Paul T; Phillips, Don R

    2010-01-01

    There have been many attempts in the past to determine whether significant levels of Adriamycin-DNA adducts form in cells and contribute to the anticancer activity of this agent. Supraclincal drug levels have been required to study drug-DNA adducts because of the lack of sensitivity associated with many of the techniques employed, including liquid scintillation counting of radiolabeled drug. The use of accelerator mass spectrometry (AMS) has provided the first direct evidence of Adriamycin-DNA adduct formation in cells at clinically relevant Adriamycin concentrations. The exceedingly sensitive nature of AMS has enabled over three orders of magnitude increased sensitivity of Adriamycin-DNA adduct detection (compared to liquid scintillation counting) and has revealed adduct formation within an hour of drug treatment. The rigorous protocol required for this approach, together with many notes on the precautions and procedures required in order to ensure that absolute levels of Adriamycin-DNA adducts can be determined with good reproducibility, is outlined in this chapter.

  4. Organocatalytic removal of formaldehyde adducts from RNA and DNA bases

    Science.gov (United States)

    Karmakar, Saswata; Harcourt, Emily M.; Hewings, David S.; Lovejoy, Alexander F.; Kurtz, David M.; Ehrenschwender, Thomas; Barandun, Luzi J.; Roost, Caroline; Alizadeh, Ash A.; Kool, Eric T.

    2015-09-01

    Formaldehyde is universally used to fix tissue specimens, where it forms hemiaminal and aminal adducts with biomolecules, hindering the ability to retrieve molecular information. Common methods for removing these adducts involve extended heating, which can cause extensive degradation of nucleic acids, particularly RNA. Here, we show that water-soluble bifunctional catalysts (anthranilates and phosphanilates) speed the reversal of formaldehyde adducts of mononucleotides over standard buffers. Studies with formaldehyde-treated RNA oligonucleotides show that the catalysts enhance adduct removal, restoring unmodified RNA at 37 °C even when extensively modified, while avoiding the high temperatures that promote RNA degradation. Experiments with formalin-fixed, paraffin-embedded cell samples show that the catalysis is compatible with common RNA extraction protocols, with detectable RNA yields increased by 1.5-2.4-fold using a catalyst under optimized conditions and by 7-25-fold compared with a commercial kit. Such catalytic strategies show promise for general use in reversing formaldehyde adducts in clinical specimens.

  5. Analysis of Structural Flexibility of Damaged DNA Using Thiol-Tethered Oligonucleotide Duplexes.

    Directory of Open Access Journals (Sweden)

    Masashi Fujita

    Full Text Available Bent structures are formed in DNA by the binding of small molecules or proteins. We developed a chemical method to detect bent DNA structures. Oligonucleotide duplexes in which two mercaptoalkyl groups were attached to the positions facing each other across the major groove were prepared. When the duplex contained the cisplatin adduct, which was proved to induce static helix bending, interstrand disulfide bond formation under an oxygen atmosphere was detected by HPLC analyses, but not in the non-adducted duplex, when the two thiol-tethered nucleosides were separated by six base pairs. When the insert was five and seven base pairs, the disulfide bond was formed and was not formed, respectively, regardless of the cisplatin adduct formation. The same reaction was observed in the duplexes containing an abasic site analog and the (6–4 photoproduct. Compared with the cisplatin case, the disulfide bond formation was slower in these duplexes, but the reaction rate was nearly independent of the linker length. These results indicate that dynamic structural changes of the abasic site- and (6–4 photoproduct-containing duplexes could be detected by our method. It is strongly suggested that the UV-damaged DNA-binding protein, which specifically binds these duplexes and functions at the first step of global-genome nucleotide excision repair, recognizes the easily bendable nature of damaged DNA.

  6. Quantitation of DNA Adducts Induced by 1,3-Butadiene

    Science.gov (United States)

    Sangaraju, Dewakar; Villalta, Peter W.; Wickramaratne, Susith; Swenberg, James; Tretyakova, Natalia

    2014-07-01

    Human exposure to 1,3-butadiene (BD) present in automobile exhaust, cigarette smoke, and forest fires is of great concern because of its potent carcinogenicity. The adverse health effects of BD are mediated by its epoxide metabolites such as 3,4-epoxy-1-butene (EB), which covalently modify genomic DNA to form promutagenic nucleobase adducts. Because of their direct role in cancer, BD-DNA adducts can be used as mechanism-based biomarkers of BD exposure. In the present work, a mass spectrometry-based methodology was developed for accurate, sensitive, and precise quantification of EB-induced N-7-(1-hydroxy-3-buten-2-yl) guanine (EB-GII) DNA adducts in vivo. In our approach, EB-GII adducts are selectively released from DNA backbone by neutral thermal hydrolysis, followed by ultrafiltration, offline HPLC purification, and isotope dilution nanoLC/ESI+-HRMS3 analysis on an Orbitrap Velos mass spectrometer. Following method validation, EB-GII lesions were quantified in human fibrosarcoma (HT1080) cells treated with micromolar concentrations of EB and in liver tissues of rats exposed to sub-ppm concentrations of BD (0.5-1.5 ppm). EB-GII concentrations increased linearly from 1.15 ± 0.23 to 10.11 ± 0.45 adducts per 106 nucleotides in HT1080 cells treated with 0.5-10 μM DEB. EB-GII concentrations in DNA of laboratory rats exposed to 0.5, 1.0, and 1.5 ppm BD were 0.17 ± 0.05, 0.33 ± 0.08, and 0.50 ± 0.04 adducts per 106 nucleotides, respectively. We also used the new method to determine the in vivo half-life of EB-GII adducts in rat liver DNA (2.20 ± 0.12 d) and to detect EB-GII in human blood DNA. To our knowledge, this is the first application of nanoLC/ESI+-HRMS3 Orbitrap methodology to quantitative analysis of DNA adducts in vivo.

  7. Short Oligonucleotides Aligned in Stretched Humid Matrix: Secondary DNA Structure in Poly(vinyl alcohol) Environment

    KAUST Repository

    Hanczyc, Piotr

    2012-04-24

    We report that short, synthetic, double- as well as single-stranded DNA can be aligned in stretched humid poly(vinyl alcohol) (PVA) matrix, and the secondary structure (nucleobase orientation) can be characterized with linear dichroism (LD) spectroscopy. Oligonucleotides of lengths varying between 10 (3.4 nm) and 60 bases (20.4 nm) were investigated with respect to structural properties in the gel-like polymer environment. The DNA conformation as a function of relative humidity reveals a strong dependence of helical structure of DNA on PVA hydration level, results of relevance for nanotechnical studies of DNA-based supramolecular systems. Also, the PVA gel could provide possibilities to test models for nucleic acid interactions and distribution in cell contexts, including structural stability of genetic material in the cell and PVA-packaging for gene delivery. A method by which duplex oligonucleotides, with sequences designed to provide specific binding sites, become amenable to polarized-light spectroscopy opens up new possibilities for studying structure in DNA complexes with small adduct molecules as well as proteins. © 2012 American Chemical Society.

  8. Tissue distribution of DNA adducts and their persistence in blood of mice exposed to benzene

    Energy Technology Data Exchange (ETDEWEB)

    Guilan Li; Wang Chunguang; Songnian Yin [Institute of Occupational Medicine Chinese Academy of Preventive Medicine, Beijing (China); Weidong Xin [Medical College of Qingdao, Shandong Province (China)

    1996-12-01

    Chemicals combine with DNA, resulting in DNA damage, which could initiate carcinogenesis. To study whether benzene or benzene metabolites bind to DNA, DNA adducts in various tissues and their persistence in leukocytes were examined using the {sup 32}P-postlabeling assay. LACA mice were dosed in with benzene at 500 mg/kg bw twice daily for 5 days. Two additional spots of DNA adducts are formed in bone marrow cells, liver cells, and peripheral blood compared with control mice. The relative adduct labeling values are 10.39, 11.32, and 13.77 adducts; x 10{sup -8} nucleotides in these tissues, respectively. DNA adducts in blood leukocytes were observed at 1, 4, 7, 14, and 21 days after exposure to benzene, but adduct levels decreased as a function of time. Relative adduct labeling of {open_quotes}adduct B{close_quotes} declined linearly but mildly, while {open_quotes}adduct C{close_quotes} displayed a stepwise decrease. The relative adduct labeling values of both these adducts at day 14 were 50% of those at day 1 after the last treatment. Both adducts were still detectable at day 21 after benzene exposure. These studies demonstrate that benzene could induce DNA adducts; in bone marrow, liver, and white blood cells of mice dosed with benzene and that measurement of adducts in white blood cells may be useful as a biomarker to predict carcinogenic risk of benzene to workers exposed to benzene. 9 refs., 3 figs.

  9. Recursive construction of perfect DNA molecules from imperfect oligonucleotides.

    Science.gov (United States)

    Linshiz, Gregory; Yehezkel, Tuval Ben; Kaplan, Shai; Gronau, Ilan; Ravid, Sivan; Adar, Rivka; Shapiro, Ehud

    2008-01-01

    Making faultless complex objects from potentially faulty building blocks is a fundamental challenge in computer engineering, nanotechnology and synthetic biology. Here, we show for the first time how recursion can be used to address this challenge and demonstrate a recursive procedure that constructs error-free DNA molecules and their libraries from error-prone oligonucleotides. Divide and Conquer (D&C), the quintessential recursive problem-solving technique, is applied in silico to divide the target DNA sequence into overlapping oligonucleotides short enough to be synthesized directly, albeit with errors; error-prone oligonucleotides are recursively combined in vitro, forming error-prone DNA molecules; error-free fragments of these molecules are then identified, extracted and used as new, typically longer and more accurate, inputs to another iteration of the recursive construction procedure; the entire process repeats until an error-free target molecule is formed. Our recursive construction procedure surpasses existing methods for de novo DNA synthesis in speed, precision, amenability to automation, ease of combining synthetic and natural DNA fragments, and ability to construct designer DNA libraries. It thus provides a novel and robust foundation for the design and construction of synthetic biological molecules and organisms.

  10. Characterization of self-assembled DNA concatemers from synthetic oligonucleotides

    Directory of Open Access Journals (Sweden)

    Lu Sun

    2014-08-01

    Full Text Available Studies of DNA–ligand interaction on a single molecule level provide opportunities to understand individual behavior of molecules. Construction of DNA molecules with repetitive copies of the same segments of sequences linked in series could be helpful for enhancing the interaction possibility for sequence-specific binding ligand to DNA. Here we report on the use of synthetic oligonucleotides to self-assembly into duplex DNA concatemeric molecules. Two strands of synthetic oligonucleotides used here were designed with 50-mer in length and the sequences are semi-complimentary so to hybridize spontaneously into concatemers of double stranded DNA. In order to optimize the length of the concatemers the oligonucleotides were incubated at different oligomer concentrations, ionic strengths and temperatures for different durations. Increasing the salt concentration to 200 mM NaCl was found to be the major optimizing factor because at this enhanced ionic strength the concatemers formed most quickly and the other parameters had no detectable effect. The size and shape of formed DNA concatemers were studied by gel electrophoresis in agarose, polyacrylamide gels and by AFM. Our results show that linear DNA constructs up to several hundred base pairs were formed and could be separated from a substantial fraction of non-linear constructs.

  11. Specific incorporation of an artificial nucleotide opposite a mutagenic DNA adduct by a DNA polymerase.

    Science.gov (United States)

    Wyss, Laura A; Nilforoushan, Arman; Eichenseher, Fritz; Suter, Ursina; Blatter, Nina; Marx, Andreas; Sturla, Shana J

    2015-01-14

    The ability to detect DNA modification sites at single base resolution could significantly advance studies regarding DNA adduct levels, which are extremely difficult to determine. Artificial nucleotides that are specifically incorporated opposite a modified DNA site offer a potential strategy for detection of such sites by DNA polymerase-based systems. Here we investigate the action of newly synthesized base-modified benzimidazole-derived 2'-deoxynucleoside-5'-O-triphosphates on DNA polymerases when performing translesion DNA synthesis past the pro-mutagenic DNA adduct O(6)-benzylguanine (O(6)-BnG). We found that a mutated form of KlenTaq DNA polymerase, i.e., KTqM747K, catalyzed O(6)-BnG adduct-specific processing of the artificial BenziTP in favor of the natural dNTPs. Steady-state kinetic parameters revealed that KTqM747K catalysis of BenziTP is 25-fold more efficient for template O(6)-BnG than G, and 5-fold more efficient than natural dTMP misincorporation in adduct bypass. Furthermore, the nucleotide analogue BenziTP is required for full-length product formation in O(6)-BnG bypass, as without BenziTP the polymerase stalls at the adduct site. By combining the KTqM747K polymerase and BenziTP, a first round of DNA synthesis enabled subsequent amplification of Benzi-containing DNA. These results advance the development of technologies for detecting DNA adducts.

  12. Chemistry and Biology of Aflatoxin-DNA Adducts

    Energy Technology Data Exchange (ETDEWEB)

    Stone, Michael P.; Banerjee, Surajit; Brown, Kyle L.; Egli, Martin (Vanderbilt)

    2012-03-27

    Aspergillus flavus is a fungal contaminant of stored rice, wheat, corn, and other grainstuffs, and peanuts. This is of concern to human health because it produces the mycotoxin aflatoxin B{sub 1} (AFB{sub 1}), which is genotoxic and is implicated in the etiology of liver cancer. AFB{sub 1} is oxidized in vivo by cytochrome P450 to form aflatoxin B{sub 1} epoxide, which forms an N7-dG adduct (AFB{sub 1}-N7-dG) in DNA. The latter rearranges to a formamidopyrimidine (AFB{sub 1}-FAPY) derivative that equilibrates between {alpha} and {beta} anomers of the deoxyribose. In DNA, both the AFB{sub 1}-N7-dG and AFB{sub 1}-{beta}-FAPY adducts intercalate above the 5'-face of the damaged guanine. Each produces G {yields} T transversions in Escherichia coli, but the AFB{sub 1}-{beta}-FAPY adduct is more mutagenic. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) provides a model for understanding error-prone bypass of the AFB{sub 1}-N7-dG and AFB{sub 1}-{beta}-FAPY adducts. It bypasses the AFB{sub 1}-N7-dG adduct, but it conducts error-prone replication past the AFB{sub 1}-FAPY adduct, including mis-insertion of dATP, consistent with the G {yields} T mutations characteristic of AFB{sub 1} mutagenesis in E. coli. Crystallographic analyses of a series of binary and ternary complexes with the Dpo4 polymerase revealed differing orientations of the N7-C8 bond of the AFB{sub 1}-N7-dG adduct as compared to the N{sup 5}-C8 bond in the AFB{sub 1}-{beta}-FAPY adduct, and differential accommodation of the intercalated AFB{sub 1} moieties within the active site. These may modulate AFB{sub 1} lesion bypass by this polymerase.

  13. Electrochemical uranyl cation biosensor with DNA oligonucleotides as receptor layer.

    Science.gov (United States)

    Jarczewska, Marta; Ziółkowski, Robert; Górski, Łukasz; Malinowska, Elżbieta

    2014-04-01

    The present study aims at the further development of the uranyl oligonucleotide-based voltammetric biosensor, which takes advantage of strong interaction between UO2(2+) and phosphate DNA backbone. Herein we report the optimization of working parameters of previously elaborated electrochemical DNA biosensor. It is shown that the sensor sensitivity is highly dependent on the oligonucleotide probe length and the incubation time of sensor in a sample solution. Consequently, the highest sensitivity was obtained for 10-nucleotide sequence and 60 min incubation time. The lower detection limit towards uranyl cation for developed biosensor was 30 nM. The influence of mixed monolayers and the possibility of developing a non-calibration device were also investigated. The selectivity of the proposed biosensor was significantly improved via elimination of adenine nucleobases from the DNA probe. Moreover, the regeneration procedure was elaborated and tested to prolong the use of the same biosensor for 4 subsequent determinations of UO2(2+).

  14. Benzene-derived N2-(4-hydroxyphenyl)-deoxyguanosine adduct: UvrABC incision and its conformation in DNA

    Energy Technology Data Exchange (ETDEWEB)

    Hang, Bo; Rodriguez, Ben; Yang, Yanu; Guliaev, Anton B.; Chenna, Ahmed

    2010-06-14

    Benzene, a ubiquitous human carcinogen, forms DNA adducts through its metabolites such as p-benzoquinone (p-BQ) and hydroquinone (HQ). N(2)-(4-Hydroxyphenyl)-2'-deoxyguanosine (N(2)-4-HOPh-dG) is the principal adduct identified in vivo by (32)P-postlabeling in cells or animals treated with p-BQ or HQ. To study its effect on repair specificity and replication fidelity, we recently synthesized defined oligonucleotides containing a site-specific adduct using phosphoramidite chemistry. We here report the repair of this adduct by Escherichia coli UvrABC complex, which performs the initial damage recognition and incision steps in the nucleotide excision repair (NER) pathway. We first showed that the p-BQ-treated plasmid was efficiently cleaved by the complex, indicating the formation of DNA lesions that are substrates for NER. Using a 40-mer substrate, we found that UvrABC incises the DNA strand containing N(2)-4-HOPh-dG in a dose- and time-dependent manner. The specificity of such repair was also compared with that of DNA glycosylases and damage-specific endonucleases of E. coli, both of which were found to have no detectable activity toward N(2)-4-HOPh-dG. To understand why this adduct is specifically recognized and processed by UvrABC, molecular modeling studies were performed. Analysis of molecular dynamics trajectories showed that stable G:C-like hydrogen bonding patterns of all three Watson-Crick hydrogen bonds are present within the N(2)-4-HOPh-G:C base pair, with the hydroxyphenyl ring at an almost planar position. In addition, N(2)-4-HOPh-dG has a tendency to form more stable stacking interactions than a normal G in B-type DNA. These conformational properties may be critical in differential recognition of this adduct by specific repair enzymes.

  15. Theoretical investigations on the formation of nitrobenzanthrone-DNA adducts.

    Science.gov (United States)

    Arlt, Volker M; Phillips, David H; Reynisson, Jóhannes

    2011-09-07

    3-Nitrobenzanthrone (3-NBA) is a potent mutagen and suspected human carcinogen identified in diesel exhaust. The thermochemical formation cascades were calculated for six 3-NBA-derived DNA adducts employing its arylnitrenium ion as precursor using density functional theory (DFT). Clear exothermic pathways were found for four adducts, i.e., 2-(2'-deoxyadenosin-N(6)-yl)-3-aminobenzanthrone, 2-(2'-deoxyguanosin-N(2)-yl)-3-aminobenzanthrone, N-(2'-deoxyguanosin-8-yl)-3-aminobenzanthrone and 2-(2'-deoxyguanosin-8-yl)-3-aminobenzanthrone. All four have been observed to be formed in cell-free experimental systems. The formation of N-(2'-deoxyadenosin-8-yl)-3-aminobenzanthrone is predicted to be not thermochemically viable explaining its absence in either in vitro or in vivo model systems. However, 2-(2'-deoxyadenosin-8-yl)-3-aminobenzanthrone, can be formed, albeit not as a major product, and is a viable candidate for an unknown adenine adduct observed experimentally. 2-nitrobenzanthrone (2-NBA), an isomer of 3-NBA, was also included in the calculations; it has a higher abundance in ambient air than 3-NBA, but a much lower genotoxic potency. Similar thermochemical profiles were obtained for the calculated 2-NBA-derived DNA adducts. This leads to the conclusion that enzymatic activation as well as the stability of its arylnitrenium ion are important determinants of 2-NBA genotoxicity.

  16. Tissue distribution of DNA adducts and their persistence in blood of mice exposed to benzene.

    OpenAIRE

    Li, G.; Wang, C.; Xin, W. (Weidong); Yin, S

    1996-01-01

    Chemicals combine with DNA, resulting in DNA damage, which could initiate carcinogenesis. To study whether benzene or benzene metabolites bind to DNA, DNA adducts in various tissues and their persistence in leukocytes were examined using the 32P-postlabeling assay. LACA mice were dosed ip with benzene at 500 mg/kg bw twice for 5 days. Two additional spots of DNA adducts are formed in bone marrow cells, liver cells, and peripheral blood compared with control mice. The relative adduct labeling ...

  17. Photolysis and thermolysis of platinum(IV) 2,2'-bipyridine complexes lead to identical platinum(II)-DNA adducts.

    Science.gov (United States)

    Loup, Christophe; Tesouro Vallina, Ana; Coppel, Yannick; Létinois, Ulla; Nakabayashi, Yasuo; Meunier, Bernard; Lippert, Bernhard; Pratviel, Geneviève

    2010-10-04

    Two Pt(IV) and two Pt(II) complexes containing a 2,2'-bipyridine ligand were treated with a short DNA oligonucleotide under light irradiation at 37°C or in the dark at 37 and 50°C. Photolysis and thermolysis of the Pt(IV) complexes led to spontaneous reduction of the Pt(IV) to the corresponding Pt(II) complexes and to binding of Pt(II) 2,2'-bipyridine complexes to N7 of guanine. When the reduction product was [Pt(bpy)Cl(2)], formation of bis-oligonucleotide adducts was observed, whereas [Pt(bpy)(MeNH(2))Cl](+) gave monoadducts, with chloride ligands substituted in both cases. Neither in the dark nor under light irradiation was the reductive elimination process of these Pt(IV) complexes accompanied by oxidative DNA damage. This work raises the question of the stability of photoactivatable Pt(IV) complexes toward moderate heating conditions.

  18. Detection of Adriamycin-DNA adducts by accelerator mass spectrometry at clinically relevant Adriamycin concentrations.

    Science.gov (United States)

    Coldwell, Kate E; Cutts, Suzanne M; Ognibene, Ted J; Henderson, Paul T; Phillips, Don R

    2008-09-01

    Limited sensitivity of existing assays has prevented investigation of whether Adriamycin-DNA adducts are involved in the anti-tumour potential of Adriamycin. Previous detection has achieved a sensitivity of a few Adriamycin-DNA adducts/10(4) bp DNA, but has required the use of supra-clinical drug concentrations. This work sought to measure Adriamycin-DNA adducts at sub-micromolar doses using accelerator mass spectrometry (AMS), a technique with origins in geochemistry for radiocarbon dating. We have used conditions previously validated (by less sensitive decay counting) to extract [(14)C]Adriamycin-DNA adducts from cells and adapted the methodology to AMS detection. Here we show the first direct evidence of Adriamycin-DNA adducts at clinically-relevant Adriamycin concentrations. [(14)C]Adriamycin treatment (25 nM) resulted in 4.4 +/- 1.0 adducts/10(7) bp ( approximately 1300 adducts/cell) in MCF-7 breast cancer cells, representing the best sensitivity and precision reported to date for the covalent binding of Adriamycin to DNA. The exceedingly sensitive nature of AMS has enabled over three orders of magnitude increased sensitivity of Adriamycin-DNA adduct detection and revealed adduct formation within an hour of drug treatment. This method has been shown to be highly reproducible for the measurement of Adriamycin-DNA adducts in tumour cells in culture and can now be applied to the detection of these adducts in human tissues.

  19. Translesion synthesis past acrolein-derived DNA adducts by human mitochondrial DNA polymerase γ.

    Science.gov (United States)

    Kasiviswanathan, Rajesh; Minko, Irina G; Lloyd, R Stephen; Copeland, William C

    2013-05-17

    Acrolein, a mutagenic aldehyde, is produced endogenously by lipid peroxidation and exogenously by combustion of organic materials, including tobacco products. Acrolein reacts with DNA bases forming exocyclic DNA adducts, such as γ-hydroxy-1,N(2)-propano-2'-deoxyguanosine (γ-HOPdG) and γ-hydroxy-1,N(6)-propano-2'-deoxyadenosine (γ-HOPdA). The bulky γ-HOPdG adduct blocks DNA synthesis by replicative polymerases but can be bypassed by translesion synthesis polymerases in the nucleus. Although acrolein-induced adducts are likely to be formed and persist in mitochondrial DNA, animal cell mitochondria lack specialized translesion DNA synthesis polymerases to tolerate these lesions. Thus, it is important to understand how pol γ, the sole mitochondrial DNA polymerase in human cells, acts on acrolein-adducted DNA. To address this question, we investigated the ability of pol γ to bypass the minor groove γ-HOPdG and major groove γ-HOPdA adducts using single nucleotide incorporation and primer extension analyses. The efficiency of pol γ-catalyzed bypass of γ-HOPdG was low, and surprisingly, pol γ preferred to incorporate purine nucleotides opposite the adduct. Pol γ also exhibited ∼2-fold lower rates of excision of the misincorporated purine nucleotides opposite γ-HOPdG compared with the corresponding nucleotides opposite dG. Extension of primers from the termini opposite γ-HOPdG was accomplished only following error-prone purine nucleotide incorporation. However, pol γ preferentially incorporated dT opposite the γ-HOPdA adduct and efficiently extended primers from the correctly paired terminus, indicating that γ-HOPdA is probably nonmutagenic. In summary, our data suggest that acrolein-induced exocyclic DNA lesions can be bypassed by mitochondrial DNA polymerase but, in the case of the minor groove γ-HOPdG adduct, at the cost of unprecedented high mutation rates.

  20. DNA and protein adducts in human tissues resulting from exposure to tobacco smoke

    OpenAIRE

    Phillips, David H.; Venitt, Stan

    2012-01-01

    Tobacco smoke contains a variety of genotoxic carcinogens that form adducts with DNA and protein in the tissues of smokers. Not only are these biochemical events relevant to the carcinogenic process, but the detection of adducts provides a means of monitoring exposure to tobacco smoke. Characterization of smoking-related adducts has shed light on the mechanisms of smoking-related diseases and many different types of smoking-derived DNA and protein adducts have been identified. Such approaches...

  1. DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

    Science.gov (United States)

    Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

    2015-01-01

    Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

  2. Ultrathin oligonucleotide layers for fluorescence-based DNA sensors

    Science.gov (United States)

    Furch, M.; Ueberfeld, J.; Hartmann, Andreas; Bock, Daniel; Seeger, Stefan

    1996-11-01

    Preliminary investigations into the design of an affinity sensor using evanescent wave technology concentrate upon the means of immobilization of the receptor molecules. In this work DNA served as the selective recognition element. The molecular principle of a sequence-selective biosensor for DNA is based on a sandwich-hybridization assay wherein the analyte, a single-stranded (ss)DNA, bound specifically to both an immobilized capture probe and a dye-labeled oligonucleotide in free solution. The efficiency of the capture array depends on the density of highly organized oligonucleotides on the waveguide surface and correlates therefore directly with the specificity and the sensitivity of the sensor. In the present approach using the Langmuir- Blodgett technique cinnamoylbutylether-cellulose monolayers were transferred onto optical fibers or planar waveguides. These films served as matrices for the immobilization of biotinylated oligonucleotides via streptavidin. For the first time streptavidin was immobilized by that manner. The specificity of the streptavidin layer or the following bounded nucleic acid molecules were controlled by an enzyme- linked immunosorbent assay (ELISA). Finally, this application has also shown to be suitable for the detection of Salmonella, which is an important pathogen associated with acute gastroenteritidis and food borne diseases.

  3. Miscoding properties of 1,N{sup 6}-ethanoadenine, a DNA adduct derived from reaction with antitumor agent 1,3-bis(2-chloroethyl)-1-nitrosourea

    Energy Technology Data Exchange (ETDEWEB)

    Hang, Bo; Guliaev, Anton B.; Chenna, Ahmed; Singer, B.

    2003-03-05

    1,N{sup 6}-Ethanoadenine (EA) is an exocyclic adduct formed from DNA reaction with the antitumor agent, 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU). To understand the role of this adduct in the mechanism of mutagenicity or carcinogenicity by BCNU, an oligonucleotide with a site-specific EA was synthesized using phosphoramidite chemistry. We now report the in vitro miscoding properties of EA in translesion DNA synthesis catalyzed by mammalian DNA polymerases (pols) {alpha}, {beta}, {eta} and {iota}. These data were also compared with those obtained for the structurally related exocyclic adduct, 1,N{sup 6}-ethenoadenine ({var_epsilon}A). Using a primer extension assay, both pols {alpha} and {beta} were primarily blocked by EA or {var_epsilon}A with very minor extension. Pol {eta} a member of the Y family of polymerases, was capable of catalyzing a significant amount of bypass across both adducts. Pol {eta} incorporated all four nucleotides opposite EA and {var_epsilon}A, but with differential preferences and mainly in an error-prone manner. Human pol {iota}, a paralog of human pol {eta}, was blocked by both adducts with a very small amount of synthesis past {var_epsilon}A. It incorporated C and, to a much lesser extent, T, opposite either adduct. In addition, the presence of an A adduct, e.g. {var_epsilon}A, could affect the specificity of pol {iota} toward the template T immediately 3 feet to the adduct. In conclusion, the four polymerases assayed on templates containing an EA or {var_epsilon}A showed differential bypass capacity and nucleotide incorporation specificity, with the two adducts not completely identical in influencing these properties. Although there was a measurable extent of error-free nucleotide incorporation, all these polymerases primarily misincorporated opposite EA, indicating that the adduct, similar to {var_epsilon}A, is a miscoding lesion.

  4. Tetrahedron-structured DNA and functional oligonucleotide for construction of an electrochemical DNA-based biosensor.

    Science.gov (United States)

    Bu, Nan-Nan; Tang, Chun-Xia; He, Xi-Wen; Yin, Xue-Bo

    2011-07-21

    Tetrahedron-structured DNA (ts-DNA) in combination with a functionalized oligonucleotide was used to develop a "turn-on" biosensor for Hg(2+) ions. The ts-DNA provided an improved sensitivity and was used to block the active sites.

  5. Environmental, Dietary, Maternal, and Fetal Predictors of Bulky DNA Adducts in Cord Blood

    DEFF Research Database (Denmark)

    Pedersen, Marie; Mendez, Michelle A; Schoket, Bernadette

    2015-01-01

    BACKGROUND: Bulky DNA adducts reflect genotoxic exposures, have been associated with lower birth weight, and may predict cancer risk. OBJECTIVE: We selected factors known or hypothesized to affect in utero adduct formation and repair and examined their associations with adduct levels in neonates....

  6. Environmental, Dietary, Maternal, and Fetal Predictors of Bulky DNA Adducts in Cord Blood

    DEFF Research Database (Denmark)

    Pedersen, Marie; Mendez, Michelle A; Schoket, Bernadette

    2015-01-01

    BACKGROUND: Bulky DNA adducts reflect genotoxic exposures, have been associated with lower birth weight, and may predict cancer risk. OBJECTIVE: We selected factors known or hypothesized to affect in utero adduct formation and repair and examined their associations with adduct levels in neonates....

  7. A study of oligonucleotide occurrence distributions in DNA coding segments.

    Science.gov (United States)

    Castrignanò, T; Colosimo, A; Morante, S; Parisi, V; Rossi, G C

    1997-02-21

    In this paper we present a general strategy designed to study the occurrence frequency distributions of oligonucleotides in DNA coding segments and to deal with the problem of detecting possible patterns of genomic compositional inhomogeneities and disuniformities. Identifying specific tendencies or peculiar deviations in the distributions of the effective occurrence frequencies of oligonucleotides, with respect to what can be a priori expected, is of the greatest importance in biology. Differences between expected and actual distributions may in fact suggest or confirm the existence of specific biological mechanisms related to them. Similarly, a marked deviation in the occurrence frequency of an oligonucleotide may suggest that it belongs to the class of so-called "DNA signal (target) sequences". The approach we have elaborated is innovative in various aspects. Firstly, the analysis of the genomic data is carried out in the light of the observation that the distribution of the four nucleotides along the coding regions of the genoma is biased by the existence of a well-defined "reading frame". Secondly, the "experimental" numbers found by counting the occurrences of the various oligonucleotide sequences are appropriately corrected for the many kinds of mistakes and redundancies present in the available genetic Data Bases. A methodologically significant further improvement of our approach over the existing searching strategies is represented by the fact that, in order to decide whether or not the (corrected) "experimental" value of the occurrence frequency of a given oligonucleotide is within statistical expectations, a measure of the strength of the selective pressure, having acted on it in the course of the evolution, is assigned to the sequence, in a way that takes into account both the value of the "experimental" occurrence frequency of the sequence and the magnitude of the probability that this number might be the result of statistical fluctuations. If the

  8. Temporal and spatial features of the formation of DNA adducts in sulfur mustard-exposed skin

    Energy Technology Data Exchange (ETDEWEB)

    Batal, Mohamed [Laboratoire «Lésions des Acides Nucléiques», Université Joseph Fourier – Grenoble 1, CEA/Institut Nanoscience et Cryogénie/SCIB, UMR-E3, Grenoble (France); Département de Toxicologie et Risques Chimiques, Unité de Brûlure Chimique, Institut de Recherche Biomédicale des Armées, Antenne de La Tronche (France); Boudry, Isabelle; Mouret, Stéphane; Wartelle, Julien; Emorine, Sandy; Bertoni, Marine [Département de Toxicologie et Risques Chimiques, Unité de Brûlure Chimique, Institut de Recherche Biomédicale des Armées, Antenne de La Tronche (France); Bérard, Izabel [Laboratoire «Lésions des Acides Nucléiques», Université Joseph Fourier – Grenoble 1, CEA/Institut Nanoscience et Cryogénie/SCIB, UMR-E3, Grenoble (France); Cléry-Barraud, Cécile [Département de Toxicologie et Risques Chimiques, Unité de Brûlure Chimique, Institut de Recherche Biomédicale des Armées, Antenne de La Tronche (France); and others

    2013-12-15

    Sulfur mustard (SM) is a chemical warfare agent that targets skin where it induces large blisters. DNA alkylation is a critical step to explain SM-induced cutaneous symptoms. We determined the kinetics of formation of main SM–DNA adducts and compare it with the development of the SM-induced pathogenesis in skin. SKH-1 mice were exposed to 2, 6 and 60 mg/kg of SM and treated skin was biopsied between 6 h and 21 days. Formation of SM DNA adducts was dose-dependent with a maximum immediately after exposure. However, adducts were persistent and still detectable 21 days post-exposure. The time-dependent formation of DNA adducts was also found to be correlated with the appearance of apoptotic cells. This temporal correlation suggests that these two early events are responsible for the severity of the damage to the skin. Besides, SM–DNA adducts were also detected in areas located next to contaminated zone, thus suggesting that SM diffuses in skin. Altogether, this work provides for the first time a clear picture of SM-induced genotoxicity using DNA adducts as a marker. - Highlights: • Sulfur mustard adducts are formed in DNA after skin exposure. • DNA damage formation is an early event in the pathological process of skin burn. • The amount of SM–DNA adducts is maximal at the earliest time point investigated. • Adducts are still detected 3 weeks after exposure. • Sulfur mustard diffuses in skin especially when large doses are applied.

  9. Exposure-route-dependent DNA adduct formation by polycyclic aromatic hydrocarbons

    NARCIS (Netherlands)

    Godschalk, R.W.L.; Moonen, E.J.C.; Schilderman, A.E.L.; Broekmans, W.M.R.; Kleinjans, J.C.S.; Schooten, F.J. van

    2000-01-01

    Understanding the kinetics of aromatic-DNA adducts in target tissues and white blood cells (WBC) would enhance the applicability of DNA adducts in WBC as surrogate source of DNA in biomonitoring studies. In the present study, rats were acutely exposed to benzo[a]pyrene (B[a]P; 10 mg/kg body wt) via

  10. Exposure of bus and taxi drivers to urban air pollutants as measured by DNA and protein adducts

    DEFF Research Database (Denmark)

    Hemminki, K.; Zhang, L.F.; Krüger, J.;

    1994-01-01

    Urinary 1-hydroxypyrene, lymphocyte DNA adducts, serum protein-bound PAH and hemoglobin-bound alkene adducts were analysed from 4 groups of non-smoking men: urban and suburban bus drivers, taxi drivers and suburban controls. The only differences between the groups were in DNA adducts between...... suburban bus drivers and controls, and in DNA adduct and plasma protein PAH-adducts between taxi drivers and controls....

  11. Coal tar residues produce both DNA adducts and oxidative DNA damage in human mammary epithelial cells.

    Science.gov (United States)

    Leadon, S A; Sumerel, J; Minton, T A; Tischler, A

    1995-12-01

    In the present study we compare the metabolic activation of coal tar, as measured by the production of both DNA adducts and oxidative DNA damage, with that of a single carcinogen that is a constituent of this complex mixture in human mammary epithelial cells (HMEC). We find that a significant level of DNA adducts, detected by 32P-postlabeling, are formed in HMEC following exposure to coal tar residues. This treatment also results in the generation of high levels of oxidative DNA damage, as measured by the production of one type of oxidative base modification, thymine glycols. The amounts of both DNA adducts and thymine varied considerably between the various coal tar residues and did not correlate with either the total amount of polycyclic aromatic hydrocarbons (PAH) or the amount of benzo[a]pyrene (B[a]P) present in the residue. Fractionating the residue from one of the sites by sequential extraction with organic solvents indicated that while the ability to produce both types of DNA damage was contained mostly in a hexane-soluble fraction, a benzene-soluble fraction produced high levels of reactive oxygens relative to the number of total DNA adducts. We find that the total amount of PAH or B[a]P present in the coal tars from the various sites was not a predictor of the level of total DNA damage formed.

  12. Detection of Riddelliine-Derived DNA Adducts in Blood of Rats Fed Riddelliine

    Directory of Open Access Journals (Sweden)

    Ming W. Chou

    2002-09-01

    Full Text Available Abstract: We have previously shown that riddelliine, a naturally occurring genotoxic pyrrolizidine alkaloid, induces liver tumors in rats and mice through a genotoxic mechanism mediated by the formation of a set of eight 6,7-dihydro-7-hydroxy-1-hydroxymethyl-5Hpyrrolizine ( DHP-derived DNA adducts. In this study we report the formation of these DHP-derived DNA adducts in blood DNA of rats fed riddelliine. In an adduct formation and removal experiment, male and female F344 rats (8 weeks of age were administered riddelliine by gavage at a single dose of 10.0 mg/kg body weight in 0.1 M phosphate buffer. At 8, 24, 48, and 168 hrs after dosing, the levels of DHP-derived DNA adduct in blood and liver were determined by 32P-postlabeling/HPLC. Maximum DNA adduct formation occurred at 48 hr after treatment. From 48 to 168 hours, the adduct levels in female rat blood were 4-fold greater than those in male rats. In a dose response experiment, female rats were gavaged 0.1 and 1.0 mg/kg doses of riddelliine for three consecutive days and the DHPderived DNA adducts in blood DNA were assayed. The levels of the DHP-derived DNA adducts in blood of rats receiving 0.1 and 1.0 mg/kg doses were 12.9 and 51.8 adducts/107 nucleotides. These results suggest that: (i leucocyte DNA can bind with DHP to form a set of DHP-derived DNA adducts generated in liver; (ii DHP-derived DNA adducts in blood can serve as a potential non-invasive biomarkers for assessing the exposure to riddelliine.

  13. Empirical evaluation of oligonucleotide probe selection for DNA microarrays.

    Directory of Open Access Journals (Sweden)

    Jennifer G Mulle

    Full Text Available DNA-based microarrays are increasingly central to biomedical research. Selecting oligonucleotide sequences that will behave consistently across experiments is essential to the design, production and performance of DNA microarrays. Here our aim was to improve on probe design parameters by empirically and systematically evaluating probe performance in a multivariate context. We used experimental data from 19 array CGH hybridizations to assess the probe performance of 385,474 probes tiled in the Duchenne muscular dystrophy (DMD region of the X chromosome. Our results demonstrate that probe melting temperature, single nucleotide polymorphisms (SNPs, and homocytosine motifs all have a strong effect on probe behavior. These findings, when incorporated into future microarray probe selection algorithms, may improve microarray performance for a wide variety of applications.

  14. Empirical evaluation of oligonucleotide probe selection for DNA microarrays.

    Science.gov (United States)

    Mulle, Jennifer G; Patel, Viren C; Warren, Stephen T; Hegde, Madhuri R; Cutler, David J; Zwick, Michael E

    2010-03-29

    DNA-based microarrays are increasingly central to biomedical research. Selecting oligonucleotide sequences that will behave consistently across experiments is essential to the design, production and performance of DNA microarrays. Here our aim was to improve on probe design parameters by empirically and systematically evaluating probe performance in a multivariate context. We used experimental data from 19 array CGH hybridizations to assess the probe performance of 385,474 probes tiled in the Duchenne muscular dystrophy (DMD) region of the X chromosome. Our results demonstrate that probe melting temperature, single nucleotide polymorphisms (SNPs), and homocytosine motifs all have a strong effect on probe behavior. These findings, when incorporated into future microarray probe selection algorithms, may improve microarray performance for a wide variety of applications.

  15. Detection and quantification of 4-ABP adducts in DNA from bladder cancer patients.

    Science.gov (United States)

    Zayas, Beatriz; Stillwell, Sara W; Wishnok, John S; Trudel, Laura J; Skipper, Paul; Yu, Mimi C; Tannenbaum, Steven R; Wogan, Gerald N

    2007-02-01

    We analyzed bladder DNA from 27 cancer patients for dG-C8-4-aminobiphenyl (dG-C8-ABP) adducts using the liquid chromatography tandem mass spectrometry method with a 700 attomol (1 adduct in 10(9) bases) detection limit. Hemoglobin (Hb) 4-aminobiphenyl (4-ABP) adduct levels were measured by gas chromatography-mass spectrometry. After isolation of dG-C8-ABP by immunoaffinity chromatography and further purification, deuterated (d9) dG-C8-ABP (MW=443 Da) was added to each sample. Structural evidence and adduct quantification were determined by selected reaction monitoring, based on the expected adduct ion [M+H+]+1, at m/z 435 with fragmentation to the product ion at m/z 319, and monitoring of the transition for the internal standard, m/z 444-->328. The method was validated by analysis of DNA (100 microg each) from calf thymus; livers from ABP-treated and untreated rats; human placentas; and TK6 lymphoblastoid cells. Adduct was detected at femtomol levels in DNA from livers of ABP-treated rats and calf thymus, but not in other controls. The method was applied to 41 DNA samples (200 microg each) from 27 human bladders; 28 from tumor and 14 from surrounding non-tumor tissue. Of 27 tissues analyzed, 44% (12) contained 5-80 dG-C8-ABP adducts per 10(9) bases; only 1 out of 27 (4%) contained adduct in both tumor and surrounding tissues. The Hb adduct was detected in samples from all patients, at levels of 12-1960 pg per gram Hb. There was no correlation between levels of DNA and Hb adducts. The presence of DNA adducts in 44% of the subjects and high levels of Hb adducts in these non-smokers indicate environmental sources of exposure to 4-ABP.

  16. Liquid chromatography-thermospray mass spectrometry of DNA adducts formed with mitomycin C, porfiromycin and thiotepa.

    Science.gov (United States)

    Musser, S M; Pan, S S; Callery, P S

    1989-07-14

    High-performance liquid chromatography (HPLC) and thermospray mass spectrometry were combined for the analysis of DNA adducts formed from the interaction of the anticancer drugs mitomycin C, porfiromycin and thiotepa with calf thymus DNA. The adducts formed from reaction of mitomycin C and porfiromycin with DNA were separated from unmodified nucleosides by HPLC on a C18 column and identified by thermospray mass spectrometry. Thiotepa DNA adducts readily depurinated from DNA and were chromatographed and identified by thermospray liquid chromatography-mass spectrometry as the modified bases without the ribose moiety attached. The utility of thermospray mass spectrometry for the identification of microgram quantities of nucleoside adducts and depurinated base adducts of these anticancer drugs was demonstrated.

  17. Efficient assembly of very short oligonucleotides using T4 DNA Ligase

    Directory of Open Access Journals (Sweden)

    Holt Robert A

    2010-11-01

    Full Text Available Abstract Background In principle, a pre-constructed library of all possible short oligonucleotides could be used to construct many distinct gene sequences. In order to assess the feasibility of such an approach, we characterized T4 DNA Ligase activity on short oligonucleotide substrates and defined conditions suitable for assembly of a plurality of oligonucleotides. Findings Ligation by T4 DNA Ligase was found to be dependent on the formation of a double stranded DNA duplex of at least five base pairs surrounding the site of ligation. However, ligations could be performed effectively with overhangs smaller than five base pairs and oligonucleotides as small as octamers, in the presence of a second, complementary oligonucleotide. We demonstrate the feasibility of simultaneous oligonucleotide phosphorylation and ligation and, as a proof of principle for DNA synthesis through the assembly of short oligonucleotides, we performed a hierarchical ligation procedure whereby octamers were combined to construct a target 128-bp segment of the beta-actin gene. Conclusions Oligonucleotides as short as 8 nucleotides can be efficiently assembled using T4 DNA Ligase. Thus, the construction of synthetic genes, without the need for custom oligonucleotide synthesis, appears feasible.

  18. Immunochemical detection of sulfur mustard-adducts with DNA and proteins: Exploratory research on adducts with proteins

    NARCIS (Netherlands)

    Schans, G.P. van der; Noort, D.; Mars-Groenendijk, R.H.; Dijk-Knijnenburg, H.C.M. van; Fidder, A.; Jong, L.P.A. de; Benschop, H.P.

    2000-01-01

    We have developed two modes of a standard operating procedure (SOP) for immunochemical detection of sulfur mustard adducts to DNA in human blood and skin. In the shortened mode data could be generated within 9 h after in vitro exposure of human blood to > 1 μM sulfur mustard. The sensitive mode allo

  19. Synthesis of triazole-linked oligonucleotides with high affinity to DNA complements and an analysis of their compatibility with biosystems.

    Science.gov (United States)

    Varizhuk, Anna M; Kaluzhny, Dmitry N; Novikov, Roman A; Chizhov, Alexandr O; Smirnov, Igor P; Chuvilin, Andrey N; Tatarinova, Olga N; Fisunov, Gleb Y; Pozmogova, Galina E; Florentiev, Vladimir L

    2013-06-21

    New oligonucleotide analogues with triazole internucleotide linkages were synthesized, and their hybridization properties were studied. The analogues demonstrated DNA binding affinities similar to those of unmodified oligonucleotides. The modification was shown to protect the oligonucleotides from nuclease hydrolysis. The modified oligonucleotides were tested as PCR primers. Modifications remote from the 3'-terminus were tolerated by polymerases. Our results suggest that these new oligonucleotide analogues are among the most promising triazole DNA mimics characterized to date.

  20. Aromatic DNA adducts in human white blood cells and skin after dermal application of coal tar

    Energy Technology Data Exchange (ETDEWEB)

    Godschalk, R.W.L.; Ostertag, J.U.; Moonen, E.J.C.; Neumann, H.A.M.; Kleinjans, J.C.S.; Schooten, F.J. van [University of Maastricht, Maastricht (Netherlands). Dept. of Health Risk Analysis and Toxicology

    1998-09-01

    A group of eczema patients topically treated with coal tar (CT) ointments was used as a model population to examine the applicability of DNA adducts in white blood cell (WBC) subpopulations as a measure of dermal exposure to polycyclic aromatic hydrocarbons (PAHs). Aromatic DNA adducts were examined by {sup 32}P-postlabeling in exposed skin and WBC subsets, and urinary excretion of PAH metabolites was determined to assess the whole-body burden. The median urinary excretion of 1-hydroxypyrene and 3-hydroxybenzo(a)pyrene was 0.39 and 0.01 {mu}mol/mol creatinine respectively, before the dermal application of CT ointments. After treatment for 1 week, these levels increased to 139.7 and 1.18 {mu}mol/mol creatinine respectively, indicating that considerable amounts of PAHs were absorbed. Median aromatic DNA adduct levels were significantly increased in skin from 2.9 adduct/10{sup 8} nucleotides before treatment to 63.3 adducts/10{sup 8} nt after treatment with CT, in monocytes from 0.28 to 0.86 adducts/10{sup 8} nt, in lymphocytes from 0.33 to 0.89 adducts/10{sup 8} nt and in granulocytes from 0.28 to 0.54 adducts/10{sup 8} nt. A week after stopping the CT treatment, the DNA adduct levels in monocytes and granulocytes were reduced to 0.38 and 0.38 adducts/10{sup 8} nt respectively, whereas the adduct levels in lymphocytes remained enhanced. Total DNA adduct levels in skin correlated with the adduct levels in monocytes and lymphocytes. Excretion of urinary metabolites during the first week of treatment was correlated with the percentage of the skin surface treated with CT ointment and decreased within a week after the cessation of treatment. 3-Hydroxybenzo(a)pyrene excretion, correlated with the levels of DNA adducts in skin that comigrated with benzo(a)pyrene-diol-epoxide-DNA. This study indicates that the DNA adduct levels in mononuclear WBCs can possibly be used as a surrogate for skin DNA after dermal exposure to PAHs. 34 refs., 4 figs., 1 tab.

  1. Specific plant DNA adducts as molecular biomarkers of genotoxic atmospheric environments.

    Science.gov (United States)

    Weber-Lotfi, F; Obrecht-Pflumio, S; Guillemaut, P; Kleinpeter, J; Dietrich, A

    2005-03-01

    The general purpose of this study was to determine whether the formation of DNA addition products ('adducts') in plants could be a valuable biomarker of genotoxic air pollution. Plants from several species were exposed to ambient atmosphere at urban and suburban sites representative of different environmental conditions. The levels of NO2 and of the quantitatively major genotoxic air pollutants benzene, toluene, and xylene were monitored in parallel with plant exposure. DNA adducts were measured in bean (Phaseolus vulgaris), rye-grass (Lolium perenne), and tobacco (Nicotiana tabacum) seedlings by means of the [32P]-postlabeling method. Whereas, no correlation was found between the levels of the major genotoxic air pollutants and the total amounts of DNA adducts, individual analyses revealed site-specific and plant species-specific adduct responses, both at the qualitative and quantitative level. Among these, the amount of a specific rye-grass DNA adduct (rgs1) correlated with benzene/toluene/xylene levels above a threshold. For further characterization, rye-grass seedlings were treated in controlled conditions with benzene, toluene, xylene or their derivatives. On the other hand, in vitro DNA adduct formation assays were developed involving benzene, toluene, xylene, or their derivatives, and plant microsomes or purified peroxidase. Although in some cases, these approaches produced specific adduct responses, they failed to generate the rgs1 DNA adduct, which appeared to be characteristic for on-site test-plant exposure. Our studies have thus identified an interesting candidate for further analysis of environmental biomarkers of genotoxicity.

  2. Polycyclic Aromatic Hydrocarbon (PAH Exposure and DNA Adduct Semi-Quantitation in Archived Human Tissues

    Directory of Open Access Journals (Sweden)

    M. Margaret Pratt

    2011-06-01

    Full Text Available Polycyclic aromatic hydrocarbons (PAHs are combustion products of organic materials, mixtures of which contain multiple known and probable human carcinogens. PAHs occur in indoor and outdoor air, as well as in char-broiled meats and fish. Human exposure to PAHs occurs by inhalation, ingestion and topical absorption, and subsequently formed metabolites are either rendered hydrophilic and excreted, or bioactivated and bound to cellular macromolecules. The formation of PAH-DNA adducts (DNA binding products, considered a necessary step in PAH-initiated carcinogenesis, has been widely studied in experimental models and has been documented in human tissues. This review describes immunohistochemistry (IHC studies, which reveal localization of PAH-DNA adducts in human tissues, and semi-quantify PAH-DNA adduct levels using the Automated Cellular Imaging System (ACIS. These studies have shown that PAH-DNA adducts concentrate in: basal and supra-basal epithelium of the esophagus, cervix and vulva; glandular epithelium of the prostate; and cytotrophoblast cells and syncitiotrophoblast knots of the placenta. The IHC photomicrographs reveal the ubiquitous nature of PAH-DNA adduct formation in human tissues as well as PAH-DNA adduct accumulation in specific, vulnerable, cell types. This semi-quantative method for PAH-DNA adduct measurement could potentially see widespread use in molecular epidemiology studies.

  3. Priming DNA Replication from Triple Helix Oligonucleotides: Possible Threestranded DNA in DNA Polymerases

    Directory of Open Access Journals (Sweden)

    Patrick P. Lestienne

    2011-01-01

    Full Text Available Triplex associate with a duplex DNA presenting the same polypurine or polypyrimidine-rich sequence in an antiparallel orientation. So far, triplex forming oligonucleotides (TFOs are known to inhibit transcription, replication, and to induce mutations. A new property of TFO is reviewed here upon analysis of DNA breakpoint yielding DNA rearrangements; the synthesized sequence of the first direct repeat displays a skewed polypurine- rich sequence. This synthesized sequence can bind the second homologous duplex sequence through the formation of a triple helix, which is able to prime further DNA replication. In these case, the d(G-rich Triple Helix Primers (THP bind the homologous strand in a parallel manner, possibly via a RecA-like mechanism. This novel property is shared by all tested DNA polymerases: phage, retrovirus, bacteria, and human. These features may account for illegitimate initiation of replication upon single-strand breakage and annealing to a homologous sequence where priming may occur. Our experiments suggest that DNA polymerases can bind three instead of two polynucleotide strands in their catalytic centre.

  4. Therapy-induced carboplatin-DNA adduct levels in human ovarian tumours in relation to assessment of adduct measurement in mouse tissues.

    Science.gov (United States)

    Jarvis, Ian W H; Meczes, Emma L; Thomas, Huw D; Edmondson, Richard J; Veal, Gareth J; Boddy, Alan V; Ottley, Christopher J; Pearson, D Graham; Tilby, Michael J

    2012-01-01

    Despite an increasing understanding of the molecular mechanisms by which platinum drug DNA adducts interact with cellular processes, the relationship between adduct formation in tumours and clinical response remains unclear. We have determined carboplatin-DNA adduct levels in biopsies removed from ovarian cancer patients following treatment. Reliability of DNA adduct measurements in tissues samples were assessed using experimental animals. Platinum-DNA adduct levels were measured using inductively coupled plasma mass spectrometry (ICP-MS) and plasma drug concentrations determined by atomic absorption spectrometry (AAS). Adduct levels in tissues and plasma pharmacokinetics were determined in Balb/c mice exposed to platinum drugs. Comparisons of adduct levels in tumour and normal tissue were made in nu/nu mice carrying human neuroblastoma xenografts. At 30 min post-cisplatin administration, adduct levels in DNA from kidney and liver were approximately 10- and 6-fold higher than spleen or tumour. By 60 min, levels in liver and kidney, but not spleen or tumour, had fallen considerably. Carboplatin showed high adduct levels only in kidney. Adduct levels in tumour xenografts were comparable to those induced in vitro with similar drug exposures. In clinical samples removed 6h after drug administration, adduct levels ranged from 1.9 to 4.3 and 0.2 to 3.6 nmol Pt/g DNA for tumour biopsies and peripheral blood mononuclear cells, respectively. No correlation was apparent between these two data sets. The present results demonstrate that reliable measurements of adducts in clinical tumours are feasible. Future results should provide insight into drug resistance.

  5. Organocatalytic Removal of Formaldehyde Adducts from RNA and DNA Bases

    OpenAIRE

    2015-01-01

    Formaldehyde is universally employed to fix tissue specimens, where it forms hemiaminal and aminal adducts with biomolecules, hindering the ability to retrieve molecular information. Common methods for removing these adducts involve extended heating, which can cause extensive degradation of nucleic acids, particularly RNA. Here we show that water-soluble bifunctional catalysts (anthranilates and phosphanilates) speed the reversal of formaldehyde adducts of mononucleotides over standard buffer...

  6. Bulky DNA adducts in white blood cells: a pooled analysis of 3,600 subjects

    DEFF Research Database (Denmark)

    Ricceri, Fulvio; Godschalk, Roger W; Peluso, Marco;

    2010-01-01

    Bulky DNA adducts are markers of exposure to genotoxic aromatic compounds, which reflect the ability of an individual to metabolically activate carcinogens and to repair DNA damage. Polycyclic aromatic hydrocarbons (PAHs) represent a major class of carcinogens that are capable of forming such add......Bulky DNA adducts are markers of exposure to genotoxic aromatic compounds, which reflect the ability of an individual to metabolically activate carcinogens and to repair DNA damage. Polycyclic aromatic hydrocarbons (PAHs) represent a major class of carcinogens that are capable of forming...... such adducts. Factors that have been reported to be related to DNA adduct levels include smoking, diet, body mass index (BMI), genetic polymorphisms, the season of collection of biologic material, and air pollutants....

  7. Complex conformational heterogeneity of the highly flexible O6-benzyl-guanine DNA adduct.

    Science.gov (United States)

    Wilson, Katie A; Wetmore, Stacey D

    2014-07-21

    The conformational preference of the O6-benzyl-guanine (BzG) adduct was computationally examined using nucleoside, nucleotide, and DNA models, which provided critical information about the potential mutagenic consequences and toxicity of the BzG adduct in our cells. Substantial conformational flexibility of the BzG moiety, including rotation of the bulky group with respect to the base and the internal conformation of the bulk moiety, is seen in the nucleoside and nucleotide models. This large conformational flexibility suggests the conformation adopted by BzG is dependent on the local environment of the BzG adduct. Upon incorporation of the adduct into the DNA helix, the BzG conformational flexibility is maintained. The range of BzG conformations adopted in DNA likely arises due to a combination of the long and flexible (-CH2-) linker, the small adduct size, and the lack of discrete interactions between the bulky moiety and G. Because of the conformational flexibility of the adduct, many DNA conformations are observed for BzG adducted DNA, including those not previously reported in the literature, and thus, a modified nomenclature for adducted DNA conformations is presented. Furthermore, the preferred conformation of BzG adducted DNA is greatly dependent on a number of factors, including the pairing nucleotide, the discrete interactions in the helix, and the solvation of the benzyl moiety. These factors in turn lead to a complicated mutagenic and toxic profile that may invoke pairing with natural C, mispairs, or deletion mutations, which is supported by previously reported experimental biochemical studies. Despite this complex mutagenic profile, pairing with C leads to the most stable helical structure, which is the first combined structural and energetic explanation for experimental studies reporting a higher rate of C incorporation than any other nucleobase upon BzG replication.

  8. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    Energy Technology Data Exchange (ETDEWEB)

    Ganesan, Shanthi, E-mail: shanthig@iastate.edu; Keating, Aileen F., E-mail: akeating@iastate.edu

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  9. Quantitative comparison between in vivo DNA adduct formation from exposure to selected DNA-reactive carcinogens, natural background levels of DNA adduct formation and tumour incidence in rodent bioassays.

    Science.gov (United States)

    Paini, Alicia; Scholz, Gabriele; Marin-Kuan, Maricel; Schilter, Benoît; O'Brien, John; van Bladeren, Peter J; Rietjens, Ivonne M C M

    2011-09-01

    This study aimed at quantitatively comparing the occurrence/formation of DNA adducts with the carcinogenicity induced by a selection of DNA-reactive genotoxic carcinogens. Contrary to previous efforts, we used a very uniform set of data, limited to in vivo rat liver studies in order to investigate whether a correlation can be obtained, using a benchmark dose (BMD) approach. Dose-response data on both carcinogenicity and in vivo DNA adduct formation were available for six compounds, i.e. 2-acetylaminofluorene, aflatoxin B1, methyleugenol, safrole, 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline and tamoxifen. BMD(10) values for liver carcinogenicity were calculated using the US Environmental Protection Agency BMD software. DNA adduct levels at this dose were extrapolated assuming linearity of the DNA adduct dose response. In addition, the levels of DNA adducts at the BMD(10) were compared to available data on endogenous background DNA damage in the target organ. Although for an individual carcinogen the tumour response increases when adduct levels increase, our results demonstrate that when comparing different carcinogens, no quantitative correlation exists between the level of DNA adduct formation and carcinogenicity. These data confirm that the quantity of DNA adducts formed by a DNA-reactive compound is not a carcinogenicity predictor but that other factors such as type of adduct and mutagenic potential may be equally relevant. Moreover, comparison to background DNA damage supports the notion that the mere occurrence of DNA adducts above or below the level of endogenous DNA damage is neither correlated to development of cancer. These data strongly emphasise the need to apply the mode of action framework to understand the contribution of other biological effect markers playing a role in carcinogenicity.

  10. Tamoxifen-DNA adduct formation in monkey and human reproductive organs.

    Science.gov (United States)

    Hernandez-Ramon, Elena E; Sandoval, Nicole A; John, Kaarthik; Cline, J Mark; Wood, Charles E; Woodward, Ruth A; Poirier, Miriam C

    2014-05-01

    The estrogen analog tamoxifen (TAM), used for adjuvant therapy of breast cancer, induces endometrial and uterine tumors in breast cancer patients. Proliferation stimulus of the uterine endometrium is likely involved in tumor induction, but genotoxicity may also play a role. Formation of TAM-DNA adducts in human tissues has been reported but remains controversial. To address this issue, we examined TAM-DNA adducts in uteri from two species of monkeys, Erythrocebus patas (patas) and Macaca fascicularis (macaque), and in human endometrium and myometrium. Monkeys were given 3-4 months of chronic TAM dosing scaled to be equivalent to the daily human dose. In the uteri, livers and brains from the patas (n = 3), and endometrium from the macaques (n = 4), TAM-DNA adducts were measurable by TAM-DNA chemiluminescence immunoassay. Average TAM-DNA adduct values for the patas uteri (23 adducts/10(8) nucleotides) were similar to those found in endometrium of the macaques (19 adducts/10(8) nucleotides). Endometrium of macaques exposed to both TAM and low-dose estradiol (n = 5) averaged 34 adducts/10(8) nucleotides. To examine TAM-DNA persistence in the patas, females (n = 3) were exposed to TAM for 3 months and to no drug for an additional month, resulting in low or non-detectable TAM-DNA in livers and uteri. Human endometrial and myometrial samples from women receiving (n = 8) and not receiving (n = 8) TAM therapy were also evaluated. Women receiving TAM therapy averaged 10.3 TAM-DNA adducts/10(8) nucleotides, whereas unexposed women showed no detectable TAM-DNA. The data indicate that genotoxicity, in addition to estrogen agonist effects, may contribute to TAM-induced human endometrial cancer.

  11. Sperm DNA adducts impair fertilization during ICSI but not during IVF.

    Directory of Open Access Journals (Sweden)

    Piotr Widłak

    2008-04-01

    Full Text Available Many studies emphasize the influence of the status of spermatozoal nucleus on fertilization, mainly with regard to DNA fragmentation. This study was undertaken to analyze the influence of DNA adducts content in spermatozoa on fertilization during assisted reproduction. Ovarian hyperstimulation, oocyte retrieval and laboratory work-up in 61 IVF (in vitro fertilization and 118 ICSI (intracytoplasmic sperm injection first cycles were performed according to the same protocol. Semen analysis was made according to WHO Manual (1999. DNA adducts assay in spermatozoa was performed by 32Ppostlabeling method. In total 331 fertilizable oocytes were obtained during IVF and 659 during ICSI. Both groups differed significantly by sperm count, motility and morphology but not by the concentration of DNA adducts in spermatozoa (0.0306 +/- 0.0217 in IVF versus 0.0373 +/- 0.0321 in ICSI. The fertilization rate during IVF was significantly influenced by sperm count (p=0.0002 and motility (p=0.0037 but not by DNA adducts concentration (p=0.30528, whereas during ICSI was positively influenced by sperm motility (p=0.04669 and negatively by DNA adducts concentration (p=0.00796. DNA adducts concentration in spermatozoa significantly negatively influences fertilization rate during ICSI, but not during IVF.

  12. Recent progress in quantitative analysis of DNA adducts of nephrotoxin aristolochic acid

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Aristolochic acid (AA), a mixture of structure-related nitrophenanthrene carboxylic acid derivatives derived from Aristolochia spp, is associated with nephrotoxin and carcinogen. AA-DNA adducts induced by reductive metabolic activation of AA were detected in tissues of animals and in patients exposed to AA. The DNA adducts were generally used as biomarkers in toxicological study of AA. In this short review, quantitative analysis of AA-DNA adducts in various in vitro and in vivo systems by using 32P-postlabelling assay, HPLC-UV, HPLC-radiation monitor, HPLC-FLD, HPLC-ESI/MS and UPLC-MS/MS methods is discussed. The distribution of AA-DNA adducts in various tissues is also summarized.

  13. A simple and rapid method for the preparation of homologous DNA oligonucleotide hybridization probes from heterologous gene sequences and probes.

    Science.gov (United States)

    Maxwell, E S; Sarge, K D

    1988-11-30

    We describe a simple and rapid method for the preparation of homologous DNA oligonucleotide probes for hybridization analysis and/or cDNA/genomic library screening. With this method, a synthetic DNA oligonucleotide derived from a known heterologous DNA/RNA/protein sequence is annealed to an RNA preparation containing the gene transcript of interest. Any unpaired 3'-terminal oligonucleotides of the heterologous DNA primer are then removed using the 3' exonuclease activity of the DNA Polymerase I Klenow fragment before primer extension/dideoxynucleotide sequencing of the annealed RNA species with AMV reverse transcriptase. From the determined RNA sequence, a completely homologous DNA oligonucleotide probe is then prepared. This approach has been used to prepare a homologous DNA oligonucleotide probe for the successful library screening of the yeast hybRNA gene starting with a heterologous mouse hybRNA DNA oligonucleotide probe.

  14. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells.

    Science.gov (United States)

    Ganesan, Shanthi; Keating, Aileen F

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6μM) for 24 or 48h. Cell viability was reduced (Padduct was detected after 24h of 6μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response.

  15. Sequence selective naked-eye detection of DNA harnessing extension of oligonucleotide-modified nucleotides.

    Science.gov (United States)

    Verga, Daniela; Welter, Moritz; Marx, Andreas

    2016-02-01

    DNA polymerases can efficiently and sequence selectively incorporate oligonucleotide (ODN)-modified nucleotides and the incorporated oligonucleotide strand can be employed as primer in rolling circle amplification (RCA). The effective amplification of the DNA primer by Φ29 DNA polymerase allows the sequence-selective hybridisation of the amplified strand with a G-quadruplex DNA sequence that has horse radish peroxidase-like activity. Based on these findings we develop a system that allows DNA detection with single-base resolution by naked eye.

  16. DNA adducts and cancer risk in prospective studies: a pooled analysis and a meta-analysis

    DEFF Research Database (Denmark)

    Veglia, Fabrizio; Loft, Steffen; Matullo, Giuseppe;

    2008-01-01

    Bulky DNA adducts are biomarkers of exposure to aromatic compounds and of the ability of the individual to metabolically activate carcinogens and to repair DNA damage. Their ability to predict cancer onset is uncertain. We have performed a pooled analysis of three prospective studies on cancer risk...... in which bulky DNA adducts have been measured in blood samples collected from healthy subjects (N = 1947; average follow-up 51-137 months). In addition, we have performed a meta-analysis by identifying all articles on the same subject published up to the end of 2006, including case-control studies....... In the pooled analysis, a weakly statistically significant increase in the risk of lung cancer was apparent (14% per unit standard deviation change in adduct levels, 95% confidence interval 1-28%; using the weighted mean difference method, 0.15 SD, units higher adducts in cases than in controls...

  17. Release of DNA oligonucleotides and their conjugates from controlled-pore glass under thermolytic conditions.

    Science.gov (United States)

    Grajkowski, Andrzej; Cieślak, Jacek; Norris, Scott; Freedberg, Darón I; Kauffman, Jon S; Duff, Robert J; Beaucage, Serge L

    2008-12-01

    The sequential functionalization of long-chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and a dinucleoside phosphorotetrazolide leads to a uniquely engineered support for solid-phase synthesis. Unlike conventional succinylated-CPG supports, this support is designed to allow oligonucleotide deprotection and elimination of deprotection side-products to proceed without release of the oligonucleotide. When needed, the DNA oligonucleotide can be thermolytically released in 2 hr under essentially neutral conditions. The modified CPG support has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. On the basis of reversed-phase HPLC and electrophoretic analyses, the purity of the released oligonucleotides is comparable to that of identical oligonucleotides synthesized from succinylated-CPG supports, in terms of both shorter-than-full-length oligonucleotide contaminants and overall yields. The detailed preparation of DNA oligonucleotides conjugated with exemplary reporter or functional groups, either at the 3'-terminus or at both 3'- and 5'-termini, is also described.

  18. DNA isolation and sample preparation for quantification of adduct levels by accelerator mass spectrometry.

    Science.gov (United States)

    Dingley, Karen H; Ubick, Esther A; Vogel, John S; Ognibene, Ted J; Malfatti, Michael A; Kulp, Kristen; Haack, Kurt W

    2014-01-01

    Accelerator mass spectrometry (AMS) is a highly sensitive technique used for the quantification of adducts following exposure to carbon-14- or tritium-labeled chemicals, with detection limits in the range of one adduct per 10(11)-10(12) nucleotides. The protocol described in this chapter provides an optimal method for isolating and preparing DNA samples to measure isotope-labeled DNA adducts by AMS. When preparing samples, special precautions must be taken to avoid cross-contamination of isotope among samples and produce a sample that is compatible with AMS. The DNA isolation method described is based upon digestion of tissue with proteinase K, followed by extraction of DNA using Qiagen isolation columns. The extracted DNA is precipitated with isopropanol, washed repeatedly with 70 % ethanol to remove salt, and then dissolved in water. DNA samples are then converted to graphite or titanium hydride and the isotope content measured by AMS to quantify adduct levels. This method has been used to reliably generate good yields of uncontaminated, pure DNA from animal and human tissues for analysis of adduct levels.

  19. Strategies in the preparation of DNA oligonucleotide arrays for diagnostic applications.

    Science.gov (United States)

    Beaucage, S L

    2001-08-01

    This report emphasizes the interfacial chemistry that is required to ensure proper attachment of oligonucleotides onto the surface of microarrays. For example, strategies for the covalent attachment of pre-synthesized oligonucleotides to glass slides, gold films, polyacrylamide gel pads, polypyrrole films, and optical fibers are surveyed in an attempt to better define the parameters for optimal formation and detection of DNA hybrids. These parameters include among others, the nature and length of the linkers attaching oligonucleotides to the arrays, and the surface density of oligonucleotides required for unhindered hybridization with DNA targets. Sensitive detection methods such as the use of light-scattering techniques, molecular beacons, surface plasmon resonance, attenuated total internal reflection-FTIR, and the evanescent field excitation of fluorescence from surface-bound fluorophores have been developed to study the kinetics and specificity of hybridization events. Finally, the synthesis of oligonucleotides directly on glass surfaces and polypropylene sheets has been investigated to enable DNA sequencing by hybridization and achieve oligonucleotide densities of ca. 10(6) sequences per cm(2) on DNA chips.

  20. Environmental air pollution and DNA adducts in Copenhagen bus drivers - effect of GSTM1 and NAT2 genotypes on adduct level

    DEFF Research Database (Denmark)

    Nielsen, Per Sabro; de Pater, Nettie; Okkels, Henrik

    1996-01-01

    The lymphocyte bulky PAH-DNA adduct levels have been studied in persons occupationally exposed to ambient air pollution. The exposure group consisted of 90 healthy, nonsmoking bus drivers from the Copenhagen area, divided into three exposure groups according to driving area, and 60 rural controls...... to levels of exposure to urban air pollution and indicated that these adducts might be helpful as a means of classifying better different exposure groups for epidemiological studies. Furthermore, it demonstrated the ability of 32P-postlabelling to discern small differences in low exposure to ambient air...... pollution and suggested a possible effect of GSTM1*0/0 on DNA adduct levels....

  1. DNA adducts in human tissues:biomarkers of exposure to carcinogens in tobacco smoke

    OpenAIRE

    Phillips, D.H.

    1996-01-01

    Tobacco smoking causes millions of cancer deaths annually. Tobacco smoke is a complex mixture of thousands of chemicals including many known animal carcinogens. Because many carcinogens from DNA adducts in target animal or human tissues, the detection of the formation of adducts using such methods as postlabeling, immunoassay, fluorescence spectroscopy, and mass spectrometry is a means of monitoring human exposure to tobacco carcinogens. Smokers are at increased risk of cancer in many organs,...

  2. DNA sequence analysis by hybridization with oligonucleotide microchips : MALDI mass spectrometry identification of 5mers contiguously stacked to microchip oligonucleotides.

    Energy Technology Data Exchange (ETDEWEB)

    Stomakhin, A. A.; Vasiliskov, V. A.; Timofeev, E.; Schulga, D.; Cotter, R. J.; Mirzabekov, A. D.; Biochip Technology Center; Engelhardt Inst. of Molecular Biology; Moscow Inst. of Physics and Technology; Middle Atlantic Mass Spectrometry Lab.; Johns Hopkins Univ. School of Medicine

    2000-01-01

    Matrix-assisted laser desorption ionization mass spectrometry (MALDI MS) has been applied to increase the informational output from DNA sequence analysis. It has been used to analyze DNA by hybridization with microarrays of gel-immobilized oligonucleotides extended with stacked 5mers. In model experiments, a 28 nt long DNA fragment was hybridized with 10 immobilized, overlapping 8mers. Then, in a second round of hybridization DNA-8mer duplexes were hybridized with a mixture of 10 5mers. The stability of the 5mer complex with DNA was increased to raise the melting temperature of the duplex by 10-15{sup o}C as a result of stacking interaction with 8mers. Contiguous 13 bp duplexes containing an internal break were formed. MALDI MS identified one or, in some cases, two 5mers contiguously stacked to each DNA-8mer duplex formed on the microchip. Incorporating a mass label into 5mers optimized MALDI MS monitoring. This procedure enabled us to reconstitute the sequence of a model DNA fragment and identify polymorphic nucleotides. The application of MALDI MS identification of contiguously stacked 5mers to increase the length of DNA for sequence analysis is discussed.

  3. Chemical phosphorylation of deoxyribonucleosides and thermolytic DNA oligonucleotides.

    Science.gov (United States)

    Ausín, Cristina; Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L

    2006-10-01

    The phosphorylating reagent bis[S-(4,4'-dimethoxytrityl)-2-mercaptoethyl]-N,N-diisopropylphosphoramidite is prepared in three steps from commercial methyl thioglycolate and diisopropylphosphoramidous dichloride. The phosphorylating reagent has been used successfully in the solid-phase synthesis of deoxyribonucleoside 5'-/3'-phosphate or -thiophosphate monoesters and oligonucleotide 5'-phosphate/-thiophosphate monoesters. Bis[S-(4,4'-dimethoxytrityl)-2-mercaptoethyl]-N,N-diisopropylphosphoramidite has also been employed in the construction of a thermolytic dinucleotide prodrug model to evaluate the ability of the reagent to produce thermosentive oligonucleotide prodrugs under mild temperature conditions ( approximately 25 degrees C) for potential therapeutic applications.

  4. The N(2)-Furfuryl-deoxyguanosine Adduct Does Not Alter the Structure of B-DNA.

    Science.gov (United States)

    Ghodke, Pratibha P; Gore, Kiran R; Harikrishna, S; Samanta, Biswajit; Kottur, Jithesh; Nair, Deepak T; Pradeepkumar, P I

    2016-01-15

    N(2)-Furfuryl-deoxyguanosine (fdG) is carcinogenic DNA adduct that originates from furfuryl alcohol. It is also a stable structural mimic of the damage induced by the nitrofurazone family of antibiotics. For the structural and functional studies of this model N(2)-dG adduct, reliable and rapid access to fdG-modified DNAs are warranted. Toward this end, here we report the synthesis of fdG-modified DNAs using phosphoramidite chemistry involving only three steps. The functional integrity of the modified DNA has been verified by primer extension studies with DNA polymerases I and IV from E. coli. Introduction of fdG into a DNA duplex decreases the Tm by ∼1.6 °C/modification. Molecular dynamics simulations of a DNA duplex bearing the fdG adduct revealed that though the overall B-DNA structure is maintained, this lesion can disrupt W-C H-bonding, stacking interactions, and minor groove hydrations to some extent at the modified site, and these effects lead to slight variations in the local base pair parameters. Overall, our studies show that fdG is tolerated at the minor groove of the DNA to a better extent compared with other bulky DNA damages, and this property will make it difficult for the DNA repair pathways to detect this adduct.

  5. Oral Cell DNA Adducts as Potential Biomarkers for Lung Cancer Susceptibility in Cigarette Smokers

    Science.gov (United States)

    Hecht, Stephen S.

    2017-01-01

    This perspective considers the use of oral cell DNA adducts, together with exposure and genetic information, to potentially identify those cigarette smokers at highest risk for lung cancer, so that appropriate preventive measures could be initiated at a relatively young age before too much damage has been done. There are now well established and validated analytical methods for the quantitation of urinary and serum metabolites of tobacco smoke toxicants and carcinogens. These metabolites provide a profile of exposure and in some cases lung cancer risk. But they do not yield information on the critical DNA damage parameter that leads to mutations in cancer growth control genes such as KRAS and TP53. Studies demonstrate a correlation between changes in the oral cavity and lung in cigarette smokers, due to the field effect of tobacco smoke. Oral cell DNA is readily obtained in contrast to DNA samples from the lung. Studies in which oral cell DNA and salivary DNA have been analyzed for specific DNA adducts are reviewed; some of the adducts identified have also been previously reported in lung DNA from smokers. The multiple challenges of developing a panel of oral cell DNA adducts that could be routinely quantified by mass spectrometry are discussed. PMID:28092948

  6. Detection and characterization of DNA adducts formed from metabolites of the fungicide ortho-phenylphenol.

    Science.gov (United States)

    Zhao, Shouxun; Narang, Amarjit; Gierthy, John; Eadon, George

    2002-05-22

    The significance of DNA adduction in ortho-phenylphenol-induced carcinogenesis remains unclear. Establishing adduct structures may contribute to resolving this issue. The chemical structures of the DNA adduction products resulting from the in vitro reaction of phenylbenzoquinone, the putative ultimate carcinogenic metabolite of the fungicide/disinfectant ortho-phenylphenol, are reported here. Three isomeric adducts that resulted from reaction of deoxyguanosine were characterized by UV, LC-ESI-MS, and MS/MS, and 1D and 2D COSY-NMR spectroscopy. The proposed mechanism of product formation is nucleophilic attack by the deoxyguanosine exocyclic amine nitrogen on an electrophilic quinone carbon, followed by stabilization through enolization. Another nucleophilic attack forms a five-membered ring, which aromatizes by dehydration to form the final product. Adducts were also characterized from deoxyadenosine and deoxycytidine, although conversions were at least 10 times lower. Structures are also proposed for these products. Cell culture studies confirmed that HepG2 cells incubated with phenylbenzoquinone at concentrations associated with cytotoxicity form the same DNA adducts.

  7. Pyrrolizidine alkaloid-derived DNA adducts are common toxicological biomarkers of pyrrolizidine alkaloid N-oxides.

    Science.gov (United States)

    He, Xiaobo; Xia, Qingsu; Woodling, Kellie; Lin, Ge; Fu, Peter P

    2017-10-01

    There are 660 pyrrolizidine alkaloids (PAs) and PA N-oxides present in the plants, with approximately half being possible carcinogens. We previously reported that a set of four PA-derived DNA adducts is formed in the liver of rats administered a series of hepatocarcinogenic PAs and a PA N-oxide. Based on our findings, we hypothesized that this set of DNA adducts is a common biological biomarker of PA-induced liver tumor formation. In this study, we determined that rat liver microsomal metabolism of five hepatocarcinogenic PAs (lasiocarpine, retrorsine, riddelliine, monocrotaline, and heliotrine) and their corresponding PA N-oxides produced the same set of DNA adducts. Among these compounds, lasiocarpine N-oxide, retrorsine N-oxide, monocrotaline N-oxide, and heliotrine N-oxide are for first time shown to be able to produce these DNA adducts. These results further support the role of these DNA adducts as potential common biomarkers of PA-induced liver tumor initiation. Copyright © 2017. Published by Elsevier B.V.

  8. Conjugates of Phthalocyanines With Oligonucleotides as Reagents for Sensitized or Catalytic DNA Modification

    Directory of Open Access Journals (Sweden)

    2006-01-01

    Full Text Available Several conjugates of metallophthalocyanines with deoxyribooligonucleotides were synthesized to investigate sequence-specific modification of DNA by them. Oligonucleotide parts of these conjugates were responsible for the recognition of selected complementary sequences on the DNA target. Metallophthalocyanines were able to induce the DNA modification: phthalocyanines of Zn(II and Al(III were active as photosensitizers in the generation of singlet oxygen 1 O 2 , while phthalocyanine of Co(II promoted DNA oxidation by molecular oxygen through the catalysis of formation of reactive oxygen species ( ⋅ O 2 − , O 2 H 2 , OH. Irradiation of the reaction mixture containing either Zn(II- or Al(III-tetracarboxyphthalocyanine conjugates of oligonucleotide pd(TCTTCCCA with light of > 340 nm wavelength (Hg lamp or He/Ne laser resulted in the modification of the 22-nucleotide target d(TGAATGGGAAGAGGGTCAGGTT. A conjugate of Co(II-tetracarboxyphthalocyanine with the oligonucleotide was found to modify the DNA target in the presence of O 2 and 2-mercaptoethanol or in the presence of O 2 H 2 . Under both sensitized and catalyzed conditions, the nucleotides G 13 – G 15 were mainly modified, providing evidence that the reaction proceeded in the double-stranded oligonucleotide. These results suggest the possible use of phthalocyanine-oligonucleotide conjugates as novel artificial regulators of gene expression and therapeutic agents for treatment of cancer.

  9. GSTM1 and XRCC3 Polymorphisms: Effects on Levels of Aflatoxin B1-DNA Adducts

    Institute of Scientific and Technical Information of China (English)

    Xi-dai Long; Yun Ma; Zhou-lin Deng

    2009-01-01

    Objective: Aflatoxin B1 (AFB1), which can cause the formation of AFB1-DNA adducts, is a known human carcinogen. AFB1-exposure individuals with inherited susceptible carcinogen-metabolizing or repairing genotypes may experience an increased risk of genotoxicity. This study was designed to investigate whether the polymorphisms of two genes, the metabolic gene Glutathione S-transferase M1 (GSTM1) and DNA repair gene x-ray repair cross-complementing group 3 (XRCC3), can affect the levels of AFB1-DNA adducts in Guangxi Population (n= 966) from an AFB1-exposure area.Methods: AFB1-DNA adducts were measured by ELISA, and GSTM1 and XRCC3 codon 241 genotypes were identified by PCR-RFLP.Results: The GSTM1-null genotype [adjusted odds ratio (OR) = 2.09; 95% confidence interval (CI) = 1.61(2.71] and XRCC3 genotypes with 241 Met alleles [i.e., XRCC3-TM and -MM, adjusted ORs (95% CI) were 1.43 (1.08(1.89) and 2.42 (1.13(5.22), respectively] were significantly associated with higher levels of AFB1-DNA adducts. Compared with those individuals who did not express any putative risk genotypes as reference (OR = 1), individuals featuring all of the putative risk genotypes did experience a significantly higher DNA-adduct levels (adjusted ORs were 2.87 for GSTM1-null and XRCC3-TM; 5.83 for GSTM1-null and XRCC3-MM). Additionally, there was a positive joint effect between XRCC3 genotypes and long-term AFB1 exposure in the formation of AFB1-DNA adducts.Conclusion: These results suggest that individuals with susceptible genotypes GSTM1-null, XRCC3-TM, or XRCC3-MM may experience an increased risk of DNA damage elicited by AFB1 exposure.

  10. Acridine adduct of [60]fullerene with enhanced DNA-cleaving activity

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Yoko Nakajima; Yagami, Takeshi; Sueyoshi, Shoko; Miyata, Naoki [National Institute of Health Sciences, Tokyo (Japan)

    1996-10-18

    Photochemical cleavage of DNA in the presence of C{sub 60} and a C{sub 60} acridine derivative is reported. It is found that the intercalator-linked C{sub 60} is more effective in photochemical DNA cleavage. Structural simulations of the adducted nucleotides are reported.

  11. Cisplatin-DNA adduct formation in rat spermatozoa and its effect on fetal development

    NARCIS (Netherlands)

    Hooser, S.T.; Dijk-Knijnenburg, C.M. van; Waalkens-Berendsen, I.D.H.; Smits-van Prooije, A.E.; Snoeij, N.J.; Baan, R.A.; Fichtinger-Schepman, M.J.

    2000-01-01

    Exposure of males to some genotoxic chemicals causes DNA damage in spermatozoa resulting in embryotoxicity and developmental defects in their offspring. This study demonstrates that cisplatin-DNA adducts could be measured in spermatozoa following treatment with the antineoplastic drug, cisplatin. Th

  12. Formation of DNA adduct 8-hydroxy-2'-deoxyguanosine induced by man-made mineral fibres.

    Science.gov (United States)

    Leanderson, P; Söderkvist, P; Tagesson, C; Axelson, O

    1988-01-01

    Two man-made mineral fibres, rockwool and glasswool, were found to mediate hydroxylation of deoxyguanosine and calf thymus DNA to form the DNA adduct 8-hydroxy-2'-deoxyguanosine. The modification of the nucleoside is probably mediated by hydroxyl radicals and may play a role in fibre-induced carcinogenesis.

  13. PAH-DNA adducts in environmentally exposed population in relation to metabolic and DNA repair gene polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Binkova, Blanka [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Chvatalova, Irena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Lnenickova, Zdena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Milcova, Alena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Tulupova, Elena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Cancer Biomarkers and Prevention Group, Biocentre, University of Leicester (United Kingdom); Farmer, Peter B. [Cancer Biomarkers and Prevention Group, Biocentre, University of Leicester (United Kingdom); Sram, Radim J. [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic)]. E-mail: sram@biomed.cas.cz

    2007-07-01

    Epidemiologic studies indicate that prolonged exposure to particulate air pollution may be associated with increased risk of cardiovascular diseases and cancer in general population. These effects may be attributable to polycyclic aromatic hydrocarbons (PAHs) adsorbed to respirable air particles. It is expected that metabolic and DNA repair gene polymorphisms may modulate individual susceptibility to PAH exposure. This study investigates relationships between exposure to PAHs, polymorphisms of these genes and DNA adducts in group of occupationally exposed policemen (EXP, N = 53, males, aged 22-50 years) working outdoors in the downtown area of Prague and in matched 'unexposed' controls (CON, N = 52). Personal exposure to eight carcinogenic PAHs (c-PAHs) was evaluated by personal samplers during working shift prior to collection of biological samples. Bulky-aromatic DNA adducts were analyzed in lymphocytes by {sup 32}P-postlabeling assay. Polymorphisms of metabolizing (GSTM1, GSTP1, GSTT1, EPHX1, CYP1A1-MspI) and DNA repair (XRCC1, XPD) genes were determined by PCR-based RFLP assays. As potential modifiers and/or cofounders, urinary cotinine levels were analyzed by radioimmunoassay, plasma levels of vitamins A, C, E and folates by HPLC, cholesterol and triglycerides using commercial kits. During the sampling period ambient particulate air pollution was as follows: PM10 32-55 {mu}g/m{sup 3}, PM2.5 27-38 {mu}g/m{sup 3}, c-PAHs 18-22 ng/m{sup 3}; personal exposure to c-PAHs: 9.7 ng/m{sup 3} versus 5.8 ng/m{sup 3} (P < 0.01) for EXP and CON groups, respectively. The total DNA adduct levels did not significantly differ between EXP and CON groups (0.92 {+-} 0.28 adducts/10{sup 8} nucleotides versus 0.82 {+-} 0.23 adducts/10{sup 8} nucleotides, P = 0.065), whereas the level of the B[a]P-'like' adduct was significantly higher in exposed group (0.122 {+-} 0.036 adducts/10{sup 8} nucleotides versus 0.099 {+-} 0.035 adducts/10{sup 8} nucleotides, P = 0

  14. Screening for DNA Alkylation Mono and Cross-Linked Adducts with a Comprehensive LC-MS(3) Adductomic Approach.

    Science.gov (United States)

    Stornetta, Alessia; Villalta, Peter W; Hecht, Stephen S; Sturla, Shana J; Balbo, Silvia

    2015-12-01

    A high-resolution/accurate-mass DNA adductomic approach was developed to investigate anticipated and unknown DNA adducts induced by DNA alkylating agents in biological samples. Two new features were added to a previously developed approach to significantly broaden its scope, versatility, and selectivity. First, the neutral loss of a base (guanine, adenine, thymine, or cytosine) was added to the original methodology's neutral loss of the 2'-deoxyribose moiety to allow for the detection of all DNA base adducts. Second, targeted detection of anticipated DNA adducts based on the reactivity of the DNA alkylating agent was demonstrated by inclusion of an ion mass list for data dependent triggering of MS(2) fragmentation events and subsequent MS(3) fragmentation. Additionally, untargeted screening of the samples, based on triggering of an MS(2) fragmentation event for the most intense ions of the full scan, was included for detecting unknown DNA adducts. The approach was tested by screening for DNA mono and cross-linked adducts in purified DNA and in DNA extracted from cells treated with PR104A, an experimental DNA alkylating nitrogen mustard prodrug currently under investigation for the treatment of leukemia. The results revealed the ability of this new DNA adductomic approach to detect anticipated and unknown PR104A-induced mono and cross-linked DNA adducts in biological samples. This methodology is expected to be a powerful tool for screening for DNA adducts induced by endogenous or exogenous exposures.

  15. Purine DNA adducts of 4,5-dioxovaleric acid and 2,4-decadienal.

    Science.gov (United States)

    Cadet, J; Carvalho, V M; Onuki, J; Douki, T; Medeiros, M H; Di Mascio, P D

    1999-01-01

    The present overview describes recent findings on the formation of cyclic adducts of purine DNA bases after reaction with two aldehyde compounds, 4,5-dioxovaleric acid (DOVA) and 2,4-decadlenal (DDE), which are involved in 5-aminolaevulinic acid (ALA) accumulation and lipid peroxidation, respectively. ALA accumulates under pathological conditions and is associated with an increased incidence of liver cancer. The final oxidation product of ALA, DOVA, is an efficient alkylating agent of the guanine moieties in both nucleoside and isolated DNA. Adducts were produced through the formation of a Schiff base involving the N2-amino group of 2'-deoxyguanosine and the ketone function of DOVA, respectively. DDE is an important breakdown product of lipid peroxidation. It is cytotoxic to mammalian cells and is known to be implicated in DNA damage. It can bind to 2'-deoxyadenosine, yielding highly fluorescent products, including 1,N6-etheno-2'-deoxyadenosine and two other, related adducts. The reaction mechanism for the formation of DDE-2'-deoxyadenosine adducts involves epoxidation of DDE and subsequent addition of the resulting reactive intermediates to the N6 amino group of 2'-deoxyadenosine, followed by cyclization at the N1 site. Formation of endogenous DNA adducts may contribute to the genotoxic potential of ALA and DDE.

  16. Formation of DNA Adducts by Ellipticine and Its Micellar Form in Rats — A Comparative Study

    Directory of Open Access Journals (Sweden)

    Marie Stiborova

    2014-12-01

    Full Text Available The requirements for early diagnostics as well as effective treatment of cancer diseases have increased the pressure on development of efficient methods for targeted drug delivery as well as imaging of the treatment success. One of the most recent approaches covering the drug delivery aspects is benefitting from the unique properties of nanomaterials. Ellipticine and its derivatives are efficient anticancer compounds that function through multiple mechanisms. Formation of covalent DNA adducts after ellipticine enzymatic activation is one of the most important mechanisms of its pharmacological action. In this study, we investigated whether ellipticine might be released from its micellar (encapsulated form to generate covalent adducts analogous to those formed by free ellipticine. The 32P-postlabeling technique was used as a useful imaging method to detect and quantify covalent ellipticine-derived DNA adducts. We compared the efficiencies of free ellipticine and its micellar form (the poly(ethylene oxide-block-poly(allyl glycidyl ether (PAGE-PEO block copolymer, P 119 nanoparticles to form ellipticine-DNA adducts in rats in vivo. Here, we demonstrate for the first time that treatment of rats with ellipticine in micelles resulted in formation of ellipticine-derived DNA adducts in vivo and suggest that a gradual release of ellipticine from its micellar form might produce the enhanced permeation and retention effect of this ellipticine-micellar delivery system.

  17. Conceptual "Heat-Driven" approach to the synthesis of DNA oligonucleotides on microarrays.

    Science.gov (United States)

    Grajkowski, A; Cieślak, J; Chmielewski, M K; Marchán, V; Phillips, L R; Wilk, A; Beaucage, S L

    2003-12-01

    The discovery of deoxyribonucleoside cyclic N-acylphosphoramidites, a novel class of phosphoramidite monomers for solid-phase oligonucleotide synthesis, has led to the development of a number of phosphate protecting groups that can be cleaved from DNA oligonucleotides under thermolytic neutral conditions. These include the 2-(N-formyl-N-methyl)aminoethyl, 4-oxopentyl, 3-(N-tert-butyl)carboxamido-1-propyl, 3-(2-pyridyl)-1-propyl, 2-[N-methyl-N-(2-pyridyl)]aminoethyl, and 4-methythiobutyl groups. When used for 5'-hydroxyl protection of nucleosides, the analogous 1-phenyl-2-[N-methyl-N-(2-pyridyl)]aminoethyloxycarbonyl group exhibited excellent thermolytic properties, which may permit an iterative "heat-driven" synthesis of DNA oligonucleotides on microarrays. In this regard, progress has been made toward the use of deoxyribonucleoside cyclic N-acylphosphoramidites in solid-phase oligonucleotide syntheses without nucleobase protection. Given that deoxyribonucleoside cyclic N-acylphosphoramidites produce oligonucleotides with heat-sensitive phosphate protecting groups, blocking the 5'-hydroxyl of these monomers with, for example, the thermolabile 1-phenyl-2-[N-methyl-N-(2-pyridyl)]aminoethyloxycarbonyl group may provide a convenient thermo-controlled method for the synthesis of oligonucleotides on microarrays.

  18. Quantitation of cis-diamminedichloroplatinum II (cisplatin)-DNA-intrastrand adducts in testicular and ovarian cancer patients receiving cisplatin chemotherapy.

    Science.gov (United States)

    Reed, E; Yuspa, S H; Zwelling, L A; Ozols, R F; Poirier, M C

    1986-02-01

    The antitumor activity of cis-diamminedichloroplatinum II (cisplatin) is believed to be related to its covalent interaction with DNA where a major DNA binding product is an intrastrand N7-bidentate adduct on adjacent deoxyguanosines. A novel immunoassay was used to quantitate this adduct in buffy coat DNA from testicular and ovarian cancer patients undergoing cisplatin therapy. 44 out of 120 samples taken from 45 cisplatin patients had detectable cisplatin-DNA adducts. No adducts were detected in 18 samples of DNA taken from normal controls, patients on other chemotherapy, or patients before treatment. The quantity of measurable adducts increased as a function of cumulative dose of cisplatin. This was observed both during repeated daily infusion of the drug and over long-term, repeated 21-28 d cycles of administration. These results suggested that adduct removal is slow even though the tissue has a relatively rapid turnover. Patients receiving cisplatin for the first time on 56-d cycles, and those given high doses of cisplatin as a "salvage" regimen, did not accumulate adducts as rapidly as patients on first time chemotherapy on 21- or 28-d cycles. Disease response data, evaluated for 33 cisplatin-treated patients, showed a positive correlation between the formation of DNA adducts and response to drug therapy. However, more data will be required to confirm this relationship. These data show that specific immunological probes can readily be applied to quantitate DNA adducts in patients undergoing cancer chemotherapy.

  19. Safrole-DNA adduct in hepatocellular carcinoma associated with betel quid chewing.

    Science.gov (United States)

    Chung, Yu-Ting; Chen, Chiu-Lan; Wu, Cheng-Chung; Chan, Shan-An; Chi, Chin-Wen; Liu, Tsung-Yun

    2008-12-15

    Betel quid chewing, which contributes high concentration of safrole in saliva, is a popular oral habit in Taiwan. Safrole is a documented rodent hepatocarcinogen, yet its hepatocarcinogenic potential in human is not known. Here, we used LC/ESI-ITMS(n) and LC/QTOF-MS confirmed safrole-dGMP as reference standard to detect the safrole-DNA adduct in hepatic tissues from HBsAg-/HCV-seronegative hepatocellular carcinoma patients by (32)P-postlabeling. We first synthesized and confirmed safrole-dGMP by LC/MS. Two isomeric safrole-dGMPs were characterized as N(2)-(trans-isosafrol-3'-yl) deoxyguanosine and N(2)-(safrol-1'-yl) deoxyguanosine. This technique was able to detect hepatic safrole-DNA adduct in mice that were treated with safrole but not sensitive enough to detect safrole-DNA adduct in human samples. Using the nuclease P1 version of the (32)P-postlabeling technique, we detected the presence of safrole-DNA adduct in two out of 28 hepatic tissues from hepatocellular carcinoma patients, and only these two patients had a history of betel quid chewing lasting more than 10 years. From co-chromatography with the mass confirmed safrole-dGMPs, this safrole-DNA adduct was identified as N(2)-(trans-isosafrol-3'-yl) deoxyguanosine. These results suggest that betel quid-containing safrole might be involved in the pathogenesis of hepatocellular carcinoma in human beings and LC/MS has the potential to identify DNA adducts in clinical samples.

  20. Insights into the conformation of aminofluorene-deoxyguanine adduct in a DNA polymerase active site.

    Science.gov (United States)

    Vaidyanathan, Vaidyanathan G; Liang, Fengting; Beard, William A; Shock, David D; Wilson, Samuel H; Cho, Bongsup P

    2013-08-09

    The active site conformation of the mutagenic fluoroaminofluorene-deoxyguanine adduct (dG-FAF, N-(2'-deoxyguanosin-8-yl)-7-fluoro-2-aminofluorene) has been investigated in the presence of Klenow fragment of Escherichia coli DNA polymerase I (Kfexo(-)) and DNA polymerase β (pol β) using (19)F NMR, insertion assay, and surface plasmon resonance. In a single nucleotide gap, the dG-FAF adduct adopts both a major-groove- oriented and base-displaced stacked conformation, and this heterogeneity is retained upon binding pol β. The addition of a non-hydrolysable 2'-deoxycytosine-5'-[(α,β)-methyleno]triphosphate (dCMPcPP) nucleotide analog to the binary complex results in an increase of the major groove conformation of the adduct at the expense of the stacked conformation. Similar results were obtained with the addition of an incorrect dAMPcPP analog but with formation of the minor groove binding conformer. In contrast, dG-FAF adduct at the replication fork for the Kfexo(-) complex adopts a mix of the major and minor groove conformers with minimal effect upon the addition of non-hydrolysable nucleotides. For pol β, the insertion of dCTP was preferred opposite the dG-FAF adduct in a single nucleotide gap assay consistent with (19)F NMR data. Surface plasmon resonance binding kinetics revealed that pol β binds tightly with DNA in the presence of correct dCTP, but the adduct weakens binding with no nucleotide specificity. These results provide molecular insights into the DNA binding characteristics of FAF in the active site of DNA polymerases and the role of DNA structure and sequence on its coding potential.

  1. Base-Displaced Intercalated Structure of the N-(2'-Deoxyguanosin-8-yl)-3-aminobenzanthrone DNA Adduct.

    Science.gov (United States)

    Politica, Dustin A; Malik, Chanchal K; Basu, Ashis K; Stone, Michael P

    2015-12-21

    3-Nitrobenzanthrone (3-NBA), an environmental mutagen found in diesel exhaust and a suspected carcinogen, undergoes metabolic reduction followed by reaction with DNA to form aminobenzanthrone (ABA) adducts, with the major alkylation product being N-(2'-deoxyguanosin-8-yl)-3-aminobenzanthrone (C8-dG-ABA). Site-specific synthesis of the C8-dG-ABA adduct in the oligodeoxynucleotide 5'-d(GTGCXTGTTTGT)-3':5'-d(ACAAACACGCAC)-3'; X = C8-dG-ABA adduct, including codons 272-275 of the p53 gene, has allowed for investigation into the structural and thermodynamic properties of this adduct. The conformation of the C8-dG-ABA adduct was determined using NMR spectroscopy and was refined using molecular dynamics (MD) calculations restrained by experimentally determined interproton distance restraints obtained from NOE experiments. The refined structure revealed that the C8-dG-ABA adduct formed a base-displaced intercalated conformation. The adducted guanine was shifted into the syn conformation about the glycosidic bond. The 5'- and 3'-neighboring base pairs remained intact. While this facilitated π-stacking interactions between the ABA moiety and neighboring bases, the thermal melting temperature (Tm) of the adduct-containing duplex showed a decrease of 11 °C as compared to the corresponding unmodified oligodeoxynucleotide duplex. Overall, in this sequence, the base-displaced intercalated conformation of the C8-dG-ABA lesion bears similarity to structures of other arylamine C8-dG adducts. However, in this sequence, the base-displaced intercalated conformation for the C8-dG-ABA adduct differs from the conformation of the N(2)-dG-ABA adduct reported by de los Santos and co-workers, in which it is oriented in the minor groove toward the 5' end of the duplex, with the modified guanine remaining in the anti conformation about the glyosidic torsion angle, and the complementary base remaining within the duplex. The results are discussed in relationship to differences between the C8-d

  2. 7-glutathione pyrrole adduct: a potential DNA reactive metabolite of pyrrolizidine alkaloids.

    Science.gov (United States)

    Xia, Qingsu; Ma, Liang; He, Xiaobo; Cai, Lining; Fu, Peter P

    2015-04-20

    Pyrrolizidine alkaloid (PA)-containing plants are the most common poisonous plants affecting livestock, wildlife, and humans. PAs require metabolic activation to form pyrrolic metabolites to exert cytotoxicity and tumorigenicity. We previously determined that metabolism of tumorigenic PAs produced four DNA adducts, designated as DHP-dG-3, DHP-dG-4, DHP-dA-3, and DHP-dA-4, that are responsible for liver tumor initiation. 7-Glutathione-(±)-6,7-dihydro-1-hydroxymethyl-5H-pyrrolizine (7-GS-DHP), formed in vivo and in vitro, and 7,9-di-GS-DHP, formed in vitro, are both considered detoxified metabolites. However, in this study we determined that incubation of 7-GS-DHP with 2'-deoxyguanosine (dG) and 2'-deoxyadenosine (dA) yields DHP-dG-3, DHP-dG-4, DHP-dA-3, and DHP-dA-4 adducts as well as the reactive metabolite DHP. Furthermore, reaction of 7-GS-DHP with calf thymus DNA in aqueous solution at 37 °C for 4, 8, 16, 24, 48, or 72 h, followed by enzymatic hydrolysis yielded DHP-dG-3, DHP-dG-4, DHP-dA-3, and DHP-dA-4 adducts. Under our current experimental conditions, DHP-dA-3 and DHP-dA-4 adducts were formed in a trace amount from the reaction of 7,9-di-GS-DHP with dA. No DHP-dG-3 or DHP-dG-4 adducts were detected from the reaction of 7,9-di-GS-DHP with dG. This study represents the first report that the 7-GS-DHP adduct can be a potential reactive metabolite of PAs leading to DNA adduct formation.

  3. Inhibition of nicotine-DNA adduct formation by polyphenolic compounds in vitro

    Institute of Scientific and Technical Information of China (English)

    CHENG Yan; WANG Hai-Fang; SUN Hong-Fang; LI Hong-Li

    2004-01-01

    Nicotine [3-(1-methyl-2-pyrrolidinyl)-pyridine], a major alkaloid in tobacco products, has proven to be a potential genotoxic compound. Some polyphenolic compounds can suppress the DNA adduction, and hence act as the potential inhibitors of carcinogenesis. In this study, the inhibitory effects of three polyphenolic compounds, curcumin (diferuloylmethane), resveratrol (trans-3, 5, 4-trihydroxystilbene) and tea polyphenols, on the nicotine-DNA adduction have been investigated in vitro using radiolabelled nicotine and liquid scintillation counting (LSC) technique. Also, the inhibition mechanism of these chemopreventive agents in regard to the activity of the biotransformation enzymes, including cytochrome P450 (CYP450), cytochrome b5 (CYb5) and glutathione S-transferase (GST), has been studied. The results demonstrated that these three polyphenols induced marked dose-dependent decrease in nicotine-DNA adducts as compared with the controls. The elimination rate of adducts reached above 46% at the highest dose for all the three agents with 51.6% for resveratrol. Correspondingly, three polyphenols all suppressed CYP450 and CYb5, whereas curcumin and resveratrol induced GST. We may arrive at a point that the three polyphenols are beneficial to prevent the nicotine adduct formation, and thus may be used to block the potential carcinogenesis induced by nicotine.

  4. Formation of Hydroxymethyl DNA Adducts in Rats Orally Exposed to Stable Isotope Labeled Methanol

    Science.gov (United States)

    Lu, Kun; Gul, Husamettin; Upton, Patricia B.; Moeller, Benjamin C.; Swenberg, James A.

    2012-01-01

    Methanol is a large volume industrial chemical and widely used solvent and fuel additive. Methanol’s well known toxicity and use in a wide spectrum of applications has raised long-standing environmental issues over its safety, including its carcinogenicity. Methanol has not been listed as a carcinogen by any regulatory agency; however, there are debates about its carcinogenic potential. Formaldehyde, a metabolite of methanol, has been proposed to be responsible for the carcinogenesis of methanol. Formaldehyde is a known carcinogen and actively targets DNA and protein, causing diverse DNA and protein damage. However, formaldehyde-induced DNA adducts arising from the metabolism of methanol have not been reported previously, largely due to the absence of suitable DNA biomarkers and the inability to differentiate what was due to methanol compared with the substantial background of endogenous formaldehyde. Recently, we developed a unique approach combining highly sensitive liquid chromatography-mass spectrometry methods and exposure to stable isotope labeled chemicals to simultaneously quantify formaldehyde-specific endogenous and exogenous DNA adducts. In this study, rats were exposed daily to 500 or 2000 mg/kg [13CD4]-methanol by gavage for 5 days. Our data demonstrate that labeled formaldehyde arising from [13CD4]-methanol induced hydroxymethyl DNA adducts in multiple tissues in a dose-dependent manner. The results also demonstrated that the number of exogenous DNA adducts was lower than the number of endogenous hydroxymethyl DNA adducts in all tissues of rats administered 500 mg/kg per day for 5 days, a lethal dose to humans, even after incorporating an average factor of 4 for reduced metabolism due to isotope effects of deuterium-labeled methanol into account. PMID:22157354

  5. Lifestyle, Environmental, and Genetic Predictors of Bulky DNA Adducts in a Study Population Nested within a Prospective Danish Cohort

    DEFF Research Database (Denmark)

    Eriksen, K. T.; Sørensen, M.; Autrup, H.

    2010-01-01

    Bulky DNA adducts are considered a potential biomarker of cancer risk. In this study, the association between various lifestyle, environmental, and genetic factors and the levels of bulky DNA adducts in peripheral leukocytes was examined in a study group nested within a population-based prospecti...

  6. Cigarette Smoking, BPDE-DNA Adducts, and Aberrant Promoter Methylations of Tumor Suppressor Genes (TSGs) in NSCLC from Chinese Population.

    Science.gov (United States)

    Jin, Yongtang; Xu, Peiwei; Liu, Xinneng; Zhang, Chunye; Tan, Cong; Chen, Chunmei; Sun, Xiaoyu; Xu, Yingchun

    2016-01-01

    Non-small cell lung cancer (NSCLC) is related to the genetic and epigenetic factors. The goal of this study was to determine association of cigarette smoking and BPDE-DNA adducts with promoter methylations of several genes in NSCLC. Methylation of the promoters of p16, RARβ, DAPK, MGMT, and TIMP-3 genes of tumor tissues from 199 lung cancer patients was analyzed with methylation-specific PCR (MSP), and BPDE-DNA adduct level in lung cancer tissue was obtained by ELISA. Level of BPDE-DNA adduct increased significantly in males, aged people (over 60 years), and smokers; however, no significant difference was found while comparing the BPDE-DNA adduct levels among different tumor types, locations, and stages. Cigarette smoking was also associated with increased BPDE-DNA adducts level (OR = 2.43, p > .05) and increased methylation level in at least 1 gene (OR = 5.22, p smoking also significantly increase the risk of p16 or DAPK methylation (OR = 3.02, p smoking for more than 40 pack-years (OR = 4.21, p smoking is significantly associated with the increase of BPDE-DNA adduct level, promoter hypermethylation of p16 and DAPK genes, while BPDE-DNA adduct was not significantly related to abnormal promoter hypermethylation in TSGs, suggesting that BPDE-DNA adducts and TSGs methylations play independent roles in NSCLC.

  7. Recursive construction of perfect DNA molecules and libraries from imperfect oligonucleotides.

    Science.gov (United States)

    Linshiz, Gregory; Yehezkel, Tuval Ben; Shapiro, Ehud

    2012-01-01

    Making faultless complex objects from potentially faulty building blocks is a fundamental challenge in computer engineering, nanotechnology, and synthetic biology. We developed an error-correcting recursive construction procedure that attempts to address this challenge. Making DNA molecules from synthetic oligonucleotides using the procedure described here surpasses existing methods for de novo DNA synthesis in speed, precision, and amenability to automation. It provides for the first time a unified DNA construction platform for combining synthetic and natural DNA fragments, for constructing designer DNA libraries, and for making the faultless long synthetic DNA building blocks needed for de novo genome construction.

  8. Comprehensive DNA Adduct Analysis Reveals Pulmonary Inflammatory Response Contributes to Genotoxic Action of Magnetite Nanoparticles

    Directory of Open Access Journals (Sweden)

    Kousuke Ishino

    2015-02-01

    Full Text Available Nanosized-magnetite (MGT is widely utilized in medicinal and industrial fields; however, its toxicological properties are not well documented. In our previous report, MGT showed genotoxicity in both in vitro and in vivo assay systems, and it was suggested that inflammatory responses exist behind the genotoxicity. To further clarify mechanisms underlying the genotoxicity, a comprehensive DNA adduct (DNA adductome analysis was conducted using DNA samples derived from the lungs of mice exposed to MGT. In total, 30 and 42 types of DNA adducts were detected in the vehicle control and MGT-treated groups, respectively. Principal component analysis (PCA against a subset of DNA adducts was applied and several adducts, which are deduced to be formed by inflammation or oxidative stress, as the case of etheno-deoxycytidine (εdC, revealed higher contributions to MGT exposure. By quantitative-LC-MS/MS analysis, εdC levels were significantly higher in MGT-treated mice than those of the vehicle control. Taken together with our previous data, it is suggested that inflammatory responses might be involved in the genotoxicity induced by MGT in the lungs of mice.

  9. Role of CYP1B1 in PAH-DNA adduct formation and breast cancer risk

    Energy Technology Data Exchange (ETDEWEB)

    Goth-Goldstein, Regine; Russell, Marion L.; Muller, A.P.; Caleffi, M.; Eschiletti, J.; Graudenz, M.; Sohn, Michael D.

    2010-04-01

    This study investigated the hypothesis that increased exposure to polycyclic aromatic hydrocarbons (PAHs) increases breast cancer risk. PAHs are products of incomplete burning of organic matter and are present in cigarette smoke, ambient air, drinking water, and diet. PAHs require metabolic transformation to bind to DNA, causing DNA adducts, which can lead to mutations and are thought to be an important pre-cancer marker. In breast tissue, PAHs appear to be metabolized to their cancer-causing form primarily by the cytochrome P450 enzyme CYP1B1. Because the genotoxic impact of PAH depends on their metabolism, we hypothesized that high CYP1B1 enzyme levels result in increased formation of PAH-DNA adducts in breast tissue, leading to increased development of breast cancer. We have investigated molecular mechanisms of the relationship between PAH exposure, CYP1B1 expression and breast cancer risk in a clinic-based case-control study. We collected histologically normal breast tissue from 56 women (43 cases and 13 controls) undergoing breast surgery and analyzed these specimens for CYP1B1 genotype, PAH-DNA adducts and CYP1B1 gene expression. We did not detect any difference in aromatic DNA adduct levels of cases and controls, only between smokers and non-smokers. CYP1B1 transcript levels were slightly lower in controls than cases, but the difference was not statistically significant. We found no correlation between the levels of CYP1B1 expression and DNA adducts. If CYP1B1 has any role in breast cancer etiology it might be through its metabolism of estrogen rather than its metabolism of PAHs. However, due to the lack of statistical power these results should be interpreted with caution.

  10. Creating Context for the Use of DNA Adduct Data in Risk Assessment

    Science.gov (United States)

    Assessments of human cancer risk require the integration of diverse types of data. Advancing technologies for quantitative measurements at the sub-cellular domain raise the critical issue of interpretation and use of DNA adduct data in context with current understanding of cancer...

  11. DNA adducts induced by in vitro activation of extracts of diesel and biodiesel exhaust particles

    Science.gov (United States)

    AbstractContext: Biodiesel and biodiesel-blend fuels offer a renewable alternative to petroleum diesel, but few data are available concerning the carcinogenic potential of biodiesel exhausts. Objectives: We compared the formation of covalent DNA adducts by the in vitro metabol...

  12. DNA adducts induced by in vitro activation of extracts of diesel and biodiesel exhaust particles

    Science.gov (United States)

    AbstractContext: Biodiesel and biodiesel-blend fuels offer a renewable alternative to petroleum diesel, but few data are available concerning the carcinogenic potential of biodiesel exhausts. Objectives: We compared the formation of covalent DNA adducts by the in vitro metabol...

  13. Identification and characterization of the major DNA adduct formed chemically and in vitro from the environmental genotoxin 3-nitrofluoranthene.

    Science.gov (United States)

    Dietrich, A M; Guenat, C R; Tomer, K B; Ball, L M

    1988-11-01

    The genotoxic environmental pollutant 3-nitrofluoranthene (3-NFA) was reduced chemically and allowed to react with calf thymus DNA, yielding one major adduct which was determined to be N-(deoxyguanosin-8-yl)-3-amino-fluoranthene based on Fast Atom Bombardment Mass Spectrometry (FAB-MS), proton nuclear magnetic resonance, ultraviolet-visible wavelength light spectroscopy (UV-VIS), and fluorescence data. Extensive characterization of the isolated adduct by tandem mass spectrometry (MS/MS) was necessary to demonstrate definitively that the adduct isolated was the dG:C8 adduct, and not the isomeric dG:N2 adduct. The extent of modification of the initial calf thymus DNA by chemically reduced 3-NFA was 0.12% (1.2 adducts/10(3) nucleosides), which was sufficient to allow several hundred micrograms of the adduct to be isolated and purified. The chemically synthesized adduct was utilized as a reference standard for comparison to the major adduct isolated from xanthine-oxidase-catalyzed reduction of 3-NFA in vitro. The yield from the in vitro biological system was 2.4 adducts/10(5) nucleosides; the adduct isolated possessed the same mass spectrometric, UV-VIS, and fluorescence characteristics as the purified standard, and co-eluted with the standard on HPLC. No evidence for other adducts was found, either in vitro or in the chemical synthesis, based on FAB-MS examination of whole extracts of the reaction mixture for the presence of ions related to other possible adducts. Therefore, if minor adducts were present they were formed in substantially lesser amounts than N-(deoxyguanosin-8-yl)-3-aminofluoranthene.

  14. On the complexity and dynamics of in vivo Cisplatin-DNA adduct formation using HPLC/ICP-MS.

    Science.gov (United States)

    Ziehe, Matthias; Esteban-Fernández, Diego; Hochkirch, Ulrike; Thomale, Jürgen; Linscheid, Michael W

    2012-10-01

    In this work we present a methodology to measure the complex adduct spectrum caused by the interaction of Cisplatin with DNA. By using an optimized DNA digestion procedure we were able to show that the adduct spectrum in in vivo duplex DNA is much more complex than described so far. For the first time a high abundance of interstrand adducts has been detected by using HPLC/ESI-MS. These adducts could play a key role in the DNA repair mechanisms and the development of cellular resistance to Cisplatin. By species-unspecific isotope dilution analysis HPLC/ICP-MS measurements, we were able to study the kinetics of adduct formation. With these experiments we proved that after the initial formation of adducts a rearrangement occurs on the DNA-strands leading to significant changes in adduct patterns over time. Furthermore, the parameters of the species-unspecific isotope dilution analysis were optimized to allow measurements of specific adducts in the DNA of Cisplatin exposed cells.

  15. Design and development of thermolytic DNA oligonucleotide prodrugs.

    Science.gov (United States)

    Grajkowski, Andrzej; Pedras-Vasconcelos, Joao; Ausín, Cristina; Verthelyi, Daniela; Beaucage, Serge L

    2005-11-01

    Deoxyribonucleoside phosphoramidites functionalized with the thermolytic 2-(N-formyl-N-methyl)aminoethyl group for phosphorus protection (1a-d) have been prepared and employed in the solid-phase synthesis of CpG ODN fma1555. Given that this modified oligonucleotide can be converted to the immunomodulatory CpG ODN 1555 under neutral conditions at 37 degrees C, its biologic activity was demonstrated in vivo by studies showing that intraperitoneal administration of CpG ODN fma1555 in mice resulted in the activation of cytokine-secreting splenocytes. Furthermore, administration of CpG ODN fma1555 to mice that were challenged intradermally in the ear with live L. major metacyclic promastigotes, reduced the severity of Leishmania skin lesions over time to an extent similar to that obtained with CpG ODN 1555. In another infectious model experiment, CpG ODN fma1555 protected newborn mice from death (65% survival) when administered 3 days before infection with the aggressive Tacaribe (TCRV) virus. A comparable immunoprotection was obtained by treatment of TCRV-infected mice with CpG ODN 1555 administered on the same day of infection (45% survival). However, when TCRV-infected mice were treated with CpG ODN fma1555 on the day of infection, they died as a consequence of the relatively slow conversion of the oligonucleotide prodrug to the bioactive CpG ODN 1555. Co-administration of both CpG ODN 1555 and CpG ODN fma1555 to mice 3 days prior to TCRV infection or on the day of infection provided protection from death (45-65% survival) and thus widened the immunoprotection window against TCRV-infection.

  16. 1,N(2)-propanodeoxyguanosine adduct formation in aortic DNA following inhalation of acrolein.

    Science.gov (United States)

    Penn, A; Nath, R; Pan, J; Chen, L; Widmer, K; Henk, W; Chung, F L

    2001-03-01

    Recent reports indicate that many of the cytotoxic and health-threatening components of environmental tobacco smoke (ETS) reside in the vapor phase of the smoke. We have reported previously that inhalation of 1,3-butadiene, a prominent vapor phase component of ETS, accelerates arteriosclerotic plaque development in cockerels. In this study we asked whether inhaled acrolein, a reactive aldehyde that is also a prominent vapor-phase component of ETS, damages artery-wall DNA and accelerates plaque development. Cockerels inhaled 0, 1, or 10 ppm acrolein mixed with HEPA-filtered air for 6 hr. Half were killed immediately (day 1 group) for detection of the stable, premutagenic 1,N(2)-propanodeoxyguanosine acrolein adduct (AdG3) in aortic DNA via a (32)P-postlabeling/HPLC method, and half were killed after 10 days (day 10 group) for indirect assessment of adduct repair. In the day 1 group, acrolein-DNA adducts were 5 times higher in the 1 and 10 ppm groups than in HEPA-filtered air controls. However, in the day 10 group, adduct levels in the 1 and 10 ppm acrolein groups were reduced to the control adduct level. For the plaque studies, cockerels inhaled 1 ppm acrolein (6 hr/day, 8 weeks), mixed with the same HEPA-filtered air inhaled by controls. Plaque development was measured blind by computerized morphometry. Unlike butadiene inhalation, acrolein inhalation did not accelerate plaque development. Thus, even though repeated exposure to acrolein alone has no effect on plaque size under the exposure conditions described here, a single, brief inhalation exposure to acrolein elicits repairable DNA damage to the artery wall. These results suggest that frequent exposure to ETS may lead to persistent artery-wall DNA damage and thus provide sites on which other ETS plaque accelerants can act.

  17. Base sequence effects on DNA replication influenced by bulky adducts. Final report, March 1, 1995--February 28, 1997

    Energy Technology Data Exchange (ETDEWEB)

    Geacintov, N.E.

    1997-05-31

    Polycyclic aromatic hydrocarbons (PAH) are environmental pollutants that are present in air, food, and water. While PAH compounds are chemically inert and are sparingly soluble in aqueous solutions, in living cells they are metabolized to a variety of oxygenated derivatives, including the high mutagenic and tumorigenic diol epoxide derivatives. The diol epoxides of the sterically hindered fjord region compound benzo[c]phenanthrene (B[c]PhDE) are among the most powerful tumorigenic compounds in animal model test systems. In this project, site-specifically modified oligonucleotides containing single B[c]PhDE-N{sup 6}-dA lesions derived from the reactions of the 1S,2R,3R,4S and 1R,2S,3S,4R diol epoxides of B[c]PhDE with dA residues were synthesized. The replication of DNA catalyzed by a prokaryotic DNA polymerase (the exonuclease-free Klenow fragment E. Coli Po1 I) in the vicinity of the lesion at base-specific sites on B[c]PhDE-modified template strands was investigated in detail. The Michaelis-Menten parameters for the insertion of single deoxynucleotide triphosphates into growing DNA (primer) strands using the modified dA* and the bases just before and after the dA* residue as templates, depend markedly on the stereochemistry of the B[c]PhDE-modified dA residues. These observations provide novel insights into the mechanisms by which bulky PAH-DNA adducts affect normal DNA replication.

  18. Gene-diet interactions in exposure to heterocyclic aromatic amines and bulky DNA adduct levels in blood leukocytes.

    Science.gov (United States)

    Ho, Vikki; Peacock, Sarah; Massey, Thomas E; Godschalk, Roger W L; van Schooten, Frederik J; Chen, Jian; King, Will D

    2015-08-01

    Heterocyclic aromatic amines (HAAs), carcinogens produced in meat when cooked at high temperatures, are an emerging biologic explanation for the meat-colorectal cancer relationship. HAAs form DNA adducts; left unrepaired, adducts can induce mutations, which may initiate/promote carcinogenesis. The purpose of this research was to investigate the relationship between dietary HAAs, genetic susceptibility and bulky DNA adduct levels. Least squares regression was used to examine the relationship between dietary HAA exposure and bulky DNA adduct levels in blood measured using (32)P-postlabeling among 99 healthy volunteers. Gene-diet interactions between dietary HAAs and genetic factors relevant to the biotransformation of HAAs and DNA repair were also examined. No main effects of dietary HAAs on bulky DNA adduct levels was found. However, those with the putative NAT1 rapid acetylator phenotype had lower adduct levels than those with the slow acetylator phenotype (P = 0.02). Furthermore, having five or more 'at-risk' genotypes was associated with higher bulky DNA adduct levels (P = 0.03). Gene-diet interactions were observed between NAT1 polymorphisms and dietary HAAs (P adduct levels compared to lower intakes. This study provides evidence of a biologic relationship between dietary HAAs, genetic susceptibility and bulky DNA adduct formation. However, the lack of a strong main effect of HAAs suggests that dietary HAAs are not a large contributor to bulky DNA adducts in this population; future studies should consider relevant gene-diet interactions to clarify the role of HAAs in carcinogenesis.

  19. Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides

    OpenAIRE

    Pawel Bialk; Brett Sansbury; Natalia Rivera-Torres; Kevin Bloh; Dula Man; Kmiec, Eric B.

    2016-01-01

    The repair of a point mutation can be facilitated by combined activity of a single-stranded oligonucleotide and a CRISPR/Cas9 system. While the mechanism of action of combinatorial gene editing remains to be elucidated, the regulatory circuitry of nucleotide exchange executed by oligonucleotides alone has been largely defined. The presence of the appropriate CRISPR/Cas9 system leads to an enhancement in the frequency of gene editing directed by single-stranded DNA oligonucleotides. While CRIS...

  20. Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides

    OpenAIRE

    Pawel Bialk; Brett Sansbury; Natalia Rivera-Torres; Kevin Bloh; Dula Man; Kmiec, Eric B.

    2016-01-01

    The repair of a point mutation can be facilitated by combined activity of a single-stranded oligonucleotide and a CRISPR/Cas9 system. While the mechanism of action of combinatorial gene editing remains to be elucidated, the regulatory circuitry of nucleotide exchange executed by oligonucleotides alone has been largely defined. The presence of the appropriate CRISPR/Cas9 system leads to an enhancement in the frequency of gene editing directed by single-stranded DNA oligonucleotides. While CRIS...

  1. A triple-helix forming oligonucleotide targeting genomic DNA fails to induce mutation.

    Science.gov (United States)

    Reshat, Reshat; Priestley, Catherine C; Gooderham, Nigel J

    2012-11-01

    Purine tracts in duplex DNA can bind oligonucleotide strands in a sequence specific manner to form triple-helix structures. Triple-helix forming oligonucleotides (TFOs) targeting supFG1 constructs have previously been shown to be mutagenic raising safety concerns for oligonucleotide-based pharmaceuticals. We have engineered a TFO, TFO27, to target the genomic Hypoxanthine-guanine phosphoribosyltransferase (HPRT) locus to define the mutagenic potential of such structures at genomic DNA. We report that TFO27 was resistant to nuclease degradation and readily binds to its target motif in a cell free system. Contrary to previous studies using the supFG1 reporter construct, TFO27 failed to induce mutation within the genomic HPRT locus. We suggest that it is possible that previous reports of triplex-mediated mutation using the supFG1 reporter construct could be confounded by DNA quadruplex formation. Although the present study indicates that a TFO targeting a genomic locus lacks mutagenic activity, it is unclear if this finding can be generalised to all TFOs and their targets. For the present, we suggest that it is prudent to avoid large purine stretches in oligonucleotide pharmaceutical design to minimise concern regarding off-target genotoxicity.

  2. Bulky DNA adducts in human sperm associated with semen parameters and sperm DNA fragmentation in infertile men: a cross-sectional study

    Science.gov (United States)

    2013-01-01

    Background DNA adducts are widely used marker of DNA damage induced by environmental pollutants. The present study was designed to explore whether sperm polycyclic aromatic hydrocarbon-DNA adducts were associated with sperm DNA integrity and semen quality. Methods A total of 433 Han Chinese men were recruited from an infertility clinic. Immunofluorescence was applied to analyze sperm PAH-DNA adducts. Sperm DNA fragmentation was detected by terminal deoxynucleotidyl transferase (Tdt)-mediated dUTP nick end labelling (TUNEL) assay. Results After adjustment for potential confounders using linear regression, sperm PAH-DNA adducts were negatively associated with sperm concentration, total sperm count, sperm motility, and curvilinear velocity (VCL). In addition, a positive relationship between sperm PAH-DNA adducts and sperm DNA fragmentation was found. Conclusions Our findings suggested an inverse association between sperm PAH-DNA adducts and semen quality, and provided the first epidemiologic evidence of an adverse effect of PAH-DNA adducts on sperm DNA integrity. PMID:24073787

  3. 32P-postlabelling analysis of dibenz[a,j]acridine-DNA adducts in mice: identification of proximate metabolites.

    Science.gov (United States)

    Talaska, G; Roh, J; Schamer, M; Reilman, R; Xue, W; Warshawsky, D

    1995-03-30

    N-Heterocyclic polynuclear aromatics are widely-occurring environmental pollutants formed during the pyrolysis of nitrogen-containing organic chemicals. Dibenz[a,j]acridine (DBA), a member of this class, has been shown to be a skin carcinogen in mice. We undertook studies to determine the organ distribution of DBA-DNA adducts and to identify the DBA metabolites which lead to the formation of carcinogen-DNA adducts in vivo. DBA and its metabolites, trans-DBA-1,2-dihydrodiol (DBA-1,2-DHD) trans-DBA-3,4-dihydrodiol (DBA-3,4-DHD) and trans-DBA-5,6-dihydrodiol (DBA-5,6-DHD), were topically applied on mice. DNA was isolated using enzyme-solvent extraction methods, and analyzed for carcinogen-DNA adducts using 32P-postlabelling. In skin, DBA produced two distinct adducts (Adducts 1 and 2). The same two adducts were seen when DBA-3,4-DHD was applied. In addition, the total adduct level elicited by DBA-3,4-DHD was twice that of the parent compound. Two adducts (Adducts 3 and 4) were also seen in mouse skin when DBA-5,6-DHD was applied, but these differed chromatographically from adducts seen with DBA. However, when DBA-3,4-DHD was applied and analyzed using sensitive nuclease P1 32P-postlabelling, all four adducts could be detected. These results suggest that the major route of DBA activation to DNA-binding species in skin is through formation of DBA-3,4-DHD and subsequent metabolism of this compound to a bay-region diol-epoxide. However, we postulate that another activation pathway may proceed through a bis-dihydrodiol-epoxide.

  4. Triple helix-forming oligonucleotides conjugated to indolocarbazole poisons direct topoisomerase I-mediated DNA cleavage to a specific site.

    Science.gov (United States)

    Arimondo, P B; Bailly, C; Boutorine, A S; Moreau, P; Prudhomme, M; Sun, J S; Garestier, T; Hélène, C

    2001-01-01

    Topoisomerase I is an ubiquitous DNA-cleaving enzyme and an important therapeutic target in cancer chemotherapy for camptothecins as well as for indolocarbazole antibiotics such as rebeccamycin. To achieve a sequence-specific cleavage of DNA by topoisomerase I, a triple helix-forming oligonucleotide was covalently linked to indolocarbazole-type topoisomerase I poisons. The three indolocarbazole-oligonucleotide conjugates investigated were able to direct topoisomerase I cleavage at a specific site based upon sequence recognition by triplex formation. The efficacy of topoisomerase I-mediated DNA cleavage depends markedly on the intrinsic potency of the drug. We show that DNA cleavage depends also upon the length of the linker arm between the triplex-forming oligonucleotide and the drug. Based on a known structure of the DNA-topoisomerase I complex, a molecular model of the oligonucleotide conjugates bound to the DNA-topoisomerase I complex was elaborated to facilitate the design of a potent topoisomerase I inhibitor-oligonucleotide conjugate with an optimized linker between the two moieties. The resulting oligonucleotide-indolocarbazole conjugate at 10 nM induced cleavage at the triple helix site 2-fold more efficiently than 5 microM of free indolocarbazole, while the other drug-sensitive sites were not cleaved. The rational design of drug-oligonucleotide conjugates carrying a DNA topoisomerase poison may be exploited to improve the efficacy and selectivity of chemotherapeutic cancer treatments by targeting specific genes and reducing drug toxicity.

  5. Quantitative comparison between in vivo DNA adduct formation from exposure to selected DNA-reactive carcinogens, natural background levels of DNA adduct formation and tumour incidende in rodent bioassays

    NARCIS (Netherlands)

    Paini, A.; Scholz, G.; Marin-Kuan, M.; Schilter, B.; O'Brien, J.; Bladeren, van P.J.; Rietjens, I.

    2011-01-01

    This study aimed at quantitatively comparing the occurrence/formation of DNA adducts with the carcinogenicity induced by a selection of DNA-reactive genotoxic carcinogens. Contrary to previous efforts, we used a very uniform set of data, limited to in vivo rat liver studies in order to investigate w

  6. Quantitative comparison between in vivo DNA adduct formation from exposure to selected DNA-reactive carcinogens, natural background levels of DNA adduct formation and tumour incidende in rodent bioassays

    NARCIS (Netherlands)

    Paini, A.; Scholz, G.; Marin-Kuan, M.; Schilter, B.; O'Brien, J.; Bladeren, van P.J.; Rietjens, I.

    2011-01-01

    This study aimed at quantitatively comparing the occurrence/formation of DNA adducts with the carcinogenicity induced by a selection of DNA-reactive genotoxic carcinogens. Contrary to previous efforts, we used a very uniform set of data, limited to in vivo rat liver studies in order to investigate

  7. AlkB recognition of a bulky DNA base adduct stabilized by chemical cross-linking

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    E.coli AlkB is a direct DNA/RNA repair protein that oxidatively reverses N1 alkylated purines and N3 alkylated pyrimidines to regular bases.Previous crystal structures have revealed N1-methyl adenine(1-meA) recognition by AlkB and a unique base flipping mechanism,but how the AlkB active site can accommodate bulky base adducts is largely unknown.Employing a previously developed chemical cross-linking technique,we crystallized AlkB with a duplex DNA containing a caged thymine base(cagedT).The structure revealed a flexible hairpin lid and a reorganized substrate recognition loop used by AlkB to accommodate cagedT.These observations demonstrate,at the molecular level,how bulky DNA adducts may be recognized and processed by AlkB.

  8. Comparison of immunoaffinity chromatography enrichment and nuclease P1 procedures for 32P-postlabelling analysis of PAH- DNA adducts

    NARCIS (Netherlands)

    Randerath, K.; Sriram, P.; Moorthy, B.; Aston, J.P.; Baan, R.A.; Berg, P.T.M. van den; Booth, E.D.; Watson, W.P.

    1998-01-01

    32P-postlabelling analysis for detecting DNA adducts formed by polycyclic aromatic compounds is one of the most widely used techniques for assessing genotoxicity associated with these compounds. In cases where the formation of adducts is extremely low, a crucial step in the analysis is an enrichment

  9. Analysis of the polycyclic aromatic hydrocarbon content of petrol and diesel engine lubricating oils and determination of DNA adducts in topically treated mice by 32P-postlabelling.

    Science.gov (United States)

    Carmichael, P L; Jacob, J; Grimmer, G; Phillips, D H

    1990-11-01

    Engine lubricating oils are known to accumulate carcinogenic polycyclic aromatic hydrocarbons (PAHs) during engine running. Oils from nine petrol-powered and 11 diesel-powered vehicles, in addition to samples of unused oil, were analysed for PAH content and ability to form DNA adducts when applied topically to mouse skin. The levels of 19 PAHs, determined by GC, were in total, approximately 22 times higher in used oils from petrol engines than in oils from diesel engines. Male Parkes mice were treated with 50 microliters of oil daily for 4 days before they were killed and DNA isolated from skin and lung tissue. DNA samples were analysed by nuclease P1-enhanced 32P-postlabelling. Used oils from both diesel and petrol engines showed several adduct spots on PEI-cellulose plates at total adduct levels of up to 0.57 fmol/microgram DNA [approximately 60 times greater than in experiments with samples of unused oil in which adduct levels (0.01-0.02 fmol adducts/microgram DNA) were close to the limit of detection]. Higher adduct levels were generally formed by petrol engine oils than by diesel engine oils. Lung DNA contained similar total adduct levels to those in skin although the adduct maps were less complex. Total adduct levels correlated with extent of oil use in the engine, the total PAH concentration in oils and with the concentrations of certain individual PAHs present in the oils. An adduct spot that co-eluted with that of the major benzo[a]pyrene-DNA adduct accounted for 9-26% of the total adducts in skin DNA, and approximately 8% of the adducts in lung DNA, of mice treated with petrol engine oils. A major, and as yet unidentified, adduct spot comprised up to 30% of the total adducts in skin DNA, and up to 89% of the total adducts in lung DNA, of these animals.

  10. PAH-DNA adducts in cord blood and fetal and child development in a Chinese cohort

    Energy Technology Data Exchange (ETDEWEB)

    Tang, D.L.; Li, T.Y.; Liu, J.J.; Chen, Y.H.; Qu, L.R.; Perera, F. [Columbia University, New York, NY (United States). Dept. for Environmental Health Science

    2006-08-15

    Polycyclic aromatic hydrocarbons (PAHs) are an important class of toxic pollutants released by fossil fuel combustion. Other pollutants include metals and particulate matter. PAH-DNA adducts, or benzo(a)pyrene (BaP) adducts as their proxy, provide a chemical-specific measure of individual biologically effective doses that have been associated with increased risk of cancer and adverse birth outcomes. In the present study we examined the relationship between prenatal PAH exposure and fetal and child growth and development in Tongliang, China, where a seasonally operated coal-fired power plant was the major pollution source. In a cohort of 150 nonsmoking women and their newborns enrolled between 4 March 2002 and 19 June 2002, BaP-DNA adducts were measured in maternal and umbilical cord blood obtained at delivery. High PAH-DNA adduct levels (above the median of detectable adduct level) were associated with decreased birth head circumference (p = 0.057) and reduced children's weight at 18 months, 24 months, and 30 months of age (p {lt} 0.05), after controlling for potential confounders. In addition, in separate models, longer duration of prenatal exposure was associated with reduced birth length (p = 0.033) and reduced children's height at 18 (p = 0.001), 24 (p {lt} 0.001), and 30 months of age (p {lt} 0.001). The findings suggest that exposure to elevated levels of PAHS, with the Tongliang power plant being a significant source, is associated with reduced fetal and child growth in this population.

  11. Expression of PAH-DNA Adducts in Lung Tissues of Xuanwei Female Lung Cancer Patients

    Directory of Open Access Journals (Sweden)

    Kun WANG

    2010-05-01

    Full Text Available Background and objective The coal-fired pollution in Xuanwei area has been considered to be local main reason for high incidence of female lung cancer. The aim of this study is to explore the expression of PAH-DNA adducts in lung tissues of Xuanwei female lung cancer patients and to explore the relationship between the large number of coal-fired pollution PAHs materials and the high incidence of Xuanwei female lung cancer. Methods We totally collected each 20 cases of Xuanwei female lung cancer patients, Xuanwei male lung cancer patients, Non-Xuanwei female lung cancer patients and collect each 10 cases of Xuanwei, Non-Xuanwei female patients with benign lung lesions. The cancer tissues, adjacent cancer tissues and normal lung tissues were collected in lung cancer patients and only the normal tissues were collected in benign lung lesion patients. There were total 80 cases and 200 tissues. Immunofluorescence was used to detect the expression of PAHDNA adducts in each group. Image pro-plus 6.0 software was used to analyze the images and part quantified analysis. SPSS 13.0 statistical software was used to analyze the data. Results The positive expression of PAH-DNA adducts in lung cancer tissues, adjacent cancer tissues and normal lung tissues of Xuanwei female lung cancer patients were 90%, 80% and 65%. They were higher than the positive expression of PAH-DNA adducts in Xuanwei male lung cancer patients (35%, 30%, 30% and Non-Xuanwei female lung cancer patients (20%, 15%, 10%(P 0.05. Conclusion The expressions of PAHDNA adducts in lung tissues of Xuanwei female were higher than which in Xuanwei male and Non-Xuanwei female.

  12. Bypass of Aflatoxin B[subscript 1] Adducts by the Sulfolobus solfataricus DNA Polymerase IV

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Surajit; Brown, Kyle L.; Egli, Martin; Stone, Michael P. (Vanderbilt)

    2012-07-18

    Aflatoxin B{sub 1} (AFB{sub 1}) is oxidized to an epoxide in vivo, which forms an N7-dG DNA adduct (AFB{sub 1}-N7-dG). The AFB{sub 1}-N7-dG can rearrange to a formamidopyrimidine (AFB{sub 1}-FAPY) derivative. Both AFB{sub 1}-N7-dG and the {beta}-anomer of the AFB{sub 1}-FAPY adduct yield G {yields} T transversions in Escherichia coli, but the latter is more mutagenic. We show that the Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) bypasses AFB{sub 1}-N7-dG in an error-free manner but conducts error-prone replication past the AFB{sub 1}-FAPY adduct, including misinsertion of dATP, consistent with the G {yields} T mutations observed in E. coli. Three ternary (Dpo4-DNA-dNTP) structures with AFB{sub 1}-N7-dG adducted template:primers have been solved. These demonstrate insertion of dCTP opposite the AFB{sub 1}-N7-dG adduct, and correct vs incorrect insertion of dATP vs dTTP opposite the 5'-template neighbor dT from a primed AFB{sub 1}-N7-dG:dC pair. The insertion of dTTP reveals hydrogen bonding between the template N3 imino proton and the O{sup 2} oxygen of dTTP, and between the template T O{sup 4} oxygen and the N3 imino proton of dTTP, perhaps explaining why this polymerase does not efficiently catalyze phosphodiester bond formation from this mispair. The AFB{sub 1}-N7-dG maintains the 5'-intercalation of the AFB{sub 1} moiety observed in DNA. The bond between N7-dG and C8 of the AFB{sub 1} moiety remains in plane with the alkylated guanine, creating a 16{sup o} inclination of the AFB{sub 1} moiety with respect to the guanine. A binary (Dpo4-DNA) structure with an AFB{sub 1}-FAPY adducted template:primer also maintains 5'-intercalation of the AFB{sub 1} moiety. The {beta}-deoxyribose anomer is observed. Rotation about the FAPY C5-N{sup 5} bond orients the bond between N{sup 5} and C8 of the AFB{sub 1} moiety out of plane in the 5'-direction, with respect to the FAPY base. The formamide group extends in the 3'-direction. This improves

  13. Genome dynamics of short oligonucleotides: the example of bacterial DNA uptake enhancing sequences.

    Directory of Open Access Journals (Sweden)

    Mohammed Bakkali

    Full Text Available Among the many bacteria naturally competent for transformation by DNA uptake-a phenomenon with significant clinical and financial implications- Pasteurellaceae and Neisseriaceae species preferentially take up DNA containing specific short sequences. The genomic overrepresentation of these DNA uptake enhancing sequences (DUES causes preferential uptake of conspecific DNA, but the function(s behind this overrepresentation and its evolution are still a matter for discovery. Here I analyze DUES genome dynamics and evolution and test the validity of the results to other selectively constrained oligonucleotides. I use statistical methods and computer simulations to examine DUESs accumulation in Haemophilus influenzae and Neisseria gonorrhoeae genomes. I analyze DUESs sequence and nucleotide frequencies, as well as those of all their mismatched forms, and prove the dependence of DUESs genomic overrepresentation on their preferential uptake by quantifying and correlating both characteristics. I then argue that mutation, uptake bias, and weak selection against DUESs in less constrained parts of the genome combined are sufficient enough to cause DUESs accumulation in susceptible parts of the genome with no need for other DUES function. The distribution of overrepresentation values across sequences with different mismatch loads compared to the DUES suggests a gradual yet not linear molecular drive of DNA sequences depending on their similarity to the DUES. Other genomically overrepresented sequences, both pro- and eukaryotic, show similar distribution of frequencies suggesting that the molecular drive reported above applies to other frequent oligonucleotides. Rare oligonucleotides, however, seem to be gradually drawn to genomic underrepresentation, thus, suggesting a molecular drag. To my knowledge this work provides the first clear evidence of the gradual evolution of selectively constrained oligonucleotides, including repeated, palindromic and protein

  14. Mechanism of repair of 5'-topoisomerase II-DNA adducts by mammalian tyrosyl-DNA phosphodiesterase 2

    Energy Technology Data Exchange (ETDEWEB)

    Schellenberg, Matthew J; Appel, C Denise; Adhikari, Sanjay; Robertson, Patrick D; Ramsden, Dale A; Williams, R Scott [NIH; (Georgetown); (UNC)

    2012-10-28

    The topoisomerase II (topo II) DNA incision-and-ligation cycle can be poisoned (for example following treatment with cancer chemotherapeutics) to generate cytotoxic DNA double-strand breaks (DSBs) with topo II covalently conjugated to DNA. Tyrosyl-DNA phosphodiesterase 2 (Tdp2) protects genomic integrity by reversing 5'-phosphotyrosyl–linked topo II–DNA adducts. Here, X-ray structures of mouse Tdp2–DNA complexes reveal that Tdp2 β–2-helix–β DNA damage–binding 'grasp', helical 'cap' and DNA lesion–binding elements fuse to form an elongated protein-DNA conjugate substrate-interaction groove. The Tdp2 DNA-binding surface is highly tailored for engagement of 5'-adducted single-stranded DNA ends and restricts nonspecific endonucleolytic or exonucleolytic processing. Structural, mutational and functional analyses support a single–metal ion catalytic mechanism for the exonuclease-endonuclease-phosphatase (EEP) nuclease superfamily and establish a molecular framework for targeted small-molecule blockade of Tdp2-mediated resistance to anticancer topoisomerase drugs.

  15. Characterization of DNA adducts of the carcinogen N-methyl-4-aminoazobenzene in vitro and in vivo.

    Science.gov (United States)

    Beland, F A; Tullis, D L; Kadlubar, F F; Straub, K M; Evans, F E

    1980-07-01

    Since the susceptibility of specific tissues to tumor formation has been correlated with the persistence of DNA-carcinogen adducts, the identity and persistence of DNA adducts formed from the hepatocarcinogen N-methyl-4-aminoazobenzene (MAB) has been determined. The synthetic ultimate carcinogen N-benzoyloxy-N-methyl-4-aminoazobenzene (N-BxO-MAB) was reacted in vitro with either calf thymus or rat liver DNA to yield approx. 1 bound residue per 1000 nucleotides. After enzymatic hydrolysis of the DNA and high pressure liquid chromatographic analysis, at least six MAB adducts were detected. Two of the products cochromatographed with MAB-DNA adducts formed in rat liver in vivo following oral administration of the precarcinogen MAB. These two adducts were identified by mass, UV and nuclear magnetic resonance (NMR) spectroscopy as N-(deoxyguanosin-8-yl)- and 3-(deoxyguanosin-N2-yl)-MAB. The former adduct was initially the predominant product in vivo, but it could not be detected 7 days following treatment. The latter adduct remained at a constant level for 14 days and therefore appears to be a persistent lesion.

  16. Determination of DNA adducts by combining acid-catalyzed hydrolysis and chromatographic analysis of the carcinogen-modified nucleobases.

    Science.gov (United States)

    Leung, Elvis M K; Deng, Kailin; Wong, Tin-Yan; Chan, Wan

    2016-01-01

    The commonly used method of analyzing carcinogen-induced DNA adducts involves the hydrolysis of carcinogen-modified DNA samples by using a mixture of enzymes, followed by (32)P-postlabeling or liquid chromatography (LC)-based analyses of carcinogen-modified mononucleotides/nucleosides. In the present study, we report the development and application of a new approach to DNA adduct analysis by combining the H(+)/heat-catalyzed release of carcinogen-modified nucleobases and the use of LC-based methods to analyze DNA adducts. Results showed that heating the carcinogen-modified DNA samples at 70 °C for an extended period of 4 to 6 h in the presence of 0.05% HCl can efficiently induce DNA depurination, releasing the intact carcinogen-modified nucleobases for LC analyses. After optimizing the hydrolysis conditions, DNA samples with C8- and N (2) -modified 2'-deoxyguanosine, as well as N (6) -modified 2'-deoxyadenosine, were synthesized by reacting DNA with 1-nitropyrene, acetaldehyde, and aristolochic acids, respectively. These samples were then hydrolyzed, and the released nucleobase adducts were analyzed using LC-based analytical methods. Analysis results demonstrated a dose-dependent release of target DNA adducts from carcinogen-modified DNA samples, indicating that the developed H(+)/heat-catalyzed hydrolysis method was quantitative. Comparative studies with enzymatic digestion method on carcinogen-modified DNA samples revealed that the two hydrolysis methods did not yield systematically different results.

  17. Detection of acrolein-derived cyclic DNA adducts in human cells by monoclonal antibodies

    Science.gov (United States)

    Pan, Jishen; Awoyemi, Bisola; Xuan, Zhuoli; Vohra, Priya; Wang, Hsiang-Tsui; Dyba, Marcin; Greenspan, Emily; Fu, Ying; Creswell, Karen; Zhang, Lihua; Berry, Deborah; Tang, Moon-Shong; Chung, Fung-Lung

    2013-01-01

    Acrolein (Acr) is a ubiquitous environmental pollutant found in cigarette smoke and automobile exhaust. It can also be produced endogenously by oxidation of polyunsaturated fatty acids. The Acr-derived 1,N2-propanodeoxyguanosine (Acr-dG) adducts in DNA are mutagenic lesions that are potentially involved in human cancers. In this study, monoclonal antibodies were raised against Acr-dG adducts and characterized using ELISA. They showed strong reactivity and specificity towards Acr-dG, weaker reactivity towards crotonaldehyde- and trans-4-hydroxy-2-nonenal-derived 1,N2-propanodeoxyguanosines, and weak or no reactivity towards 1,N6-ethenodeoxyadenosine and 8-oxo-deoxyguanosine. Using these novel antibodies, we developed assays to detect Acr-dG in vivo: First, a simple and quick FACS-based assay for detecting these adducts directly in cells; Second, a highly sensitive direct ELISA assay for measuring Acr-dG in DNA of cells and tissues using only one μg DNA without DNA digestion and sample enrichment; And third, a competitive ELISA for better quantitative measurement of Acr-dG levels in DNA samples. The assays were validated using Acr-treated HT29 cell DNA samples or calf thymus DNA and the results were confirmed by LC-MS/MS-MRM. An immunohistochemical assay was also developed to detect and visualize Acr-dG in HT29 cells as well as in human oral cells. These antibody-based methods provide useful tools for the studies of Acr-dG as a cancer biomarker and of the molecular mechanisms by which cells respond to Acr-dG as a ubiquitous DNA lesion. PMID:23126278

  18. Synthesis of the Tellurium-Derivatized Phosphoramidites and their Incorporation into DNA Oligonucleotides

    Science.gov (United States)

    Jiang, Sibo; Sheng, Jia

    2015-01-01

    Introduction In this unit, an efficient method for the synthesis of 2’-tellerium modified phosphoramidite and its incorporation into oligonucleotide are presented. We choose 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine nucleosides (S.1, S.2) as starting materials due to their easy preparation. The 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine can be converted to corresponding the 2’-tellerium-derivatized nucleosides by treating with the telluride nucleophiles. Subsequently, the 2’-Te-nucleosides can be transformed into 3’-phosphoramidites, which are the building blocks for DNA/RNA synthesis. The DNA synthesis, purification and applications of oligonucleotides containing 2’-Te-U or 2’-Te-T are described in this protocol. PMID:22147418

  19. Metabolic Activation of the Tumorigenic Pyrrolizidine Alkaloid, Retrorsine, Leading to DNA Adduct Formation In Vivo

    Directory of Open Access Journals (Sweden)

    Ming W. Chou

    2005-04-01

    Full Text Available Pyrrolizidine alkaloids are naturally occurring genotoxic chemicals produced by a large number of plants. The high toxicity of many pyrrolizidine alkaloids has caused considerable loss of free-ranging livestock due to liver and pulmonary lesions. Chronic exposure of toxic pyrrolizidine alkaloids to laboratory animals induces cancer. This investigation studies the metabolic activation of retrorsine, a representative naturally occurring tumorigenic pyrrolizidine alkaloid, and shows that a genotoxic mechanism is correlated to the tumorigenicity of retrorsine. Metabolism of retrorsine by liver microsomes of F344 female rats produced two metabolites, 6, 7-dihydro-7-hydroxy-1-hydroxymethyl-5H-pyrrolizine (DHP, at a rate of 4.8 ± 0.1 nmol/mg/min, and retrorsine-N-oxide, at a rate of 17.6±0.5 nmol/mg/min. Metabolism was enhanced 1.7-fold by using liver microsomes prepared from dexamethasone-treated rats. DHP formation was inhibited 77% and retrorsine N-oxide formation was inhibited 29% by troleandomycin, a P450 3A enzyme inhibitor. Metabolism of retrorsine with lung, kidney, and spleen microsomes from dexamethasone-treated rats also generated DHP and the N-oxide derivative. When rat liver microsomal metabolism of retrorsine occurred in the presence of calf thymus DNA, a set of DHP-derived DNA adducts was formed; these adducts were detected and quantified by using a previously developed 32P-postlabeling/HPLC method. These same DNA adducts were also found in liver DNA of rats gavaged with retrorsine. Since DHP-derived DNA adducts are suggested to be potential biomarkers of riddelliine-induced tumorigenicity, our results indicate that (i similar to the metabolic activation of riddelliine, the mechanism of retrorsine-induced carcinogenicity in rats is also through a genotoxic mechanism involving DHP; and (ii the set of DHP-derived DNA adducts found in liver DNA of rats gavaged with retrorsine or riddelliine can serve as biomarkers for the

  20. Quantum spin model fitting the Yule distribution of oligonucleotides in DNA

    CERN Document Server

    Minichini, C

    2004-01-01

    A quantum spin chain is identified by the labels of a vector state of a Kashiwara crystal basis. The intensity of the one-spin flip is assumed to depend from the variation of the labels. The rank ordered plot of the numerically computed, averaged in time, transition probabilities is nicely fitted by a Yule distribution, which is the observed distribution of the ranked short oligonucleotides frequency in DNA.

  1. High-frequency genome editing using ssDNA oligonucleotides with zinc-finger nucleases

    DEFF Research Database (Denmark)

    Chen, Fuqiang; Pruett-Miller, Shondra M; Huang, Yuping

    2011-01-01

    Zinc-finger nucleases (ZFNs) have enabled highly efficient gene targeting in multiple cell types and organisms. Here we describe methods for using simple ssDNA oligonucleotides in tandem with ZFNs to efficiently produce human cell lines with three distinct genetic outcomes: (i) targeted point...... mutation, (ii) targeted genomic deletion of up to 100 kb and (iii) targeted insertion of small genetic elements concomitant with large genomic deletions....

  2. An efficient reagent for the phosphorylation of deoxyribonucleosides, DNA oligonucleotides, and their thermolytic analogues.

    Science.gov (United States)

    Ausín, Cristina; Grajkowski, Andrzej; Cieślak, Jacek; Beaucage, Serge L

    2005-09-15

    [reaction: see text] The phosphoramidite 11 was prepared in three steps from methyl 2-mercaptoacetate and demonstrated efficiency in the synthesis of conventional 5'-/3'-phosphate/thiophosphate monoester derivatives of 2'-deoxyribonucleosides and DNA oligonucleotides. Moreover, the use of 11 has enabled the preparation of the dinucleoside phosphorothioate analogue 26 in high yields (>95%) with minimal cleavage (<2%) of the thermolytic thiophosphate protecting group.

  3. Genotoxic Pyrrolizidine Alkaloids — Mechanisms Leading to DNA Adduct Formation and Tumorigenicity

    OpenAIRE

    2002-01-01

    Abstract: Plants that contain pyrrolizidine alkaloids are widely distributed in the world. Although pyrrolizidine alkaloids have been shown to be genotoxic and tumorigenic in experimental animals, the mechanisms of actions have not been fully understood. The results of our recent mechanistic studies suggest that pyrrolizidine alkaloids induce tumors via a genotoxic mechanism mediated by 6,7-dihydro-7-hydroxy-1-hydroxymethyl-5Hpyrrolizine (DHP)-derived DNA adduct formation. This mechanism may ...

  4. Maternal diet and dioxin-like activity, bulky DNA adducts and micronuclei in mother-newborns.

    Science.gov (United States)

    Pedersen, Marie; Halldorsson, Thorhallur I; Autrup, Herman; Brouwer, Abraham; Besselink, Harrie; Loft, Steffen; Knudsen, Lisbeth E

    2012-06-01

    Maternal diet can contribute to carcinogenic exposures and also modify effects of environmental exposures on maternal and fetal genetic stability. In this study, associations between maternal diet and the levels of dioxin-like plasma activity, bulky DNA adducts in white blood cells and micronuclei (MN) in lymphocytes from mother to newborns were examined. From 98 pregnant women living in the greater area of Copenhagen, Denmark in 2006-2007, maternal peripheral blood and umbilical cord blood were collected, together with information on health, environmental exposure and lifestyle. Maternal diet was estimated on the basis of maternal food frequency questionnaire (FFQ) completed by the end of pregnancy. Biomarkers were detected in paired blood samples through the dioxin-responsive chemical-activated luciferase expression (CALUX)(®) bioassay, (32)P-postlabelling technique and cytokinesis-block MN assay. Maternal preference for meats with dark surface were significantly associated with higher bulky DNA adducts in both maternal (β 95%CI; 0.46 (0.08, 0.84)) and cord blood (β 95%CI; 0.46 (0.05, 0.86)) before and after adjustment for potential confounders. No other significant associations between the 18 dietary variables and the biomarkers measured in maternal and fetal samples were identified. The present study suggests that maternal intake of meats with dark surface contributes to the bulky DNA adduct levels in maternal and umbilical cord blood. Relationship between food preparation and bulky DNA adducts appear to be captured by a FFQ while potential associations for other biomarkers might be more complex or need larger sample size.

  5. Maternal diet and dioxin-like activity, bulky DNA adducts and micronuclei in mother-newborns

    Energy Technology Data Exchange (ETDEWEB)

    Pedersen, Marie, E-mail: mpedersen@creal.cat [Section of Environmental Health, Department of Public Health, University of Copenhagen, CSS, Oester Farimagsgade, Copenhagen K (Denmark); Halldorsson, Thorhallur I., E-mail: lur@ssi.dk [Faculty of Food Science and Nutrition, School of Health Sciences, University of Iceland Reykjavik (Iceland); Center for Fetal Programming, Department of Epidemiology, Statens Serum Institute, Copenhagen (Denmark); Autrup, Herman, E-mail: ha@mil.au.dk [School of Public Health, Department of Environmental and Occupational Medicine, Aarhus University, Aarhus (Denmark); Brouwer, Abraham, E-mail: Bram.Brouwer@bds.nl [BioDetection Systems B.V., Amsterdam (Netherlands); Besselink, Harrie, E-mail: Harrie.Besselink@bds.nl [BioDetection Systems B.V., Amsterdam (Netherlands); Loft, Steffen, E-mail: stl@sund.ku.dk [Section of Environmental Health, Department of Public Health, University of Copenhagen, CSS, Oester Farimagsgade, Copenhagen K (Denmark); Knudsen, Lisbeth E., E-mail: liek@sund.ku.dk [Section of Environmental Health, Department of Public Health, University of Copenhagen, CSS, Oester Farimagsgade, Copenhagen K (Denmark)

    2012-06-01

    Maternal diet can contribute to carcinogenic exposures and also modify effects of environmental exposures on maternal and fetal genetic stability. In this study, associations between maternal diet and the levels of dioxin-like plasma activity, bulky DNA adducts in white blood cells and micronuclei (MN) in lymphocytes from mother to newborns were examined. From 98 pregnant women living in the greater area of Copenhagen, Denmark in 2006-2007, maternal peripheral blood and umbilical cord blood were collected, together with information on health, environmental exposure and lifestyle. Maternal diet was estimated on the basis of maternal food frequency questionnaire (FFQ) completed by the end of pregnancy. Biomarkers were detected in paired blood samples through the dioxin-responsive chemical-activated luciferase expression (CALUX){sup Registered-Sign} bioassay, {sup 32}P-postlabelling technique and cytokinesis-block MN assay. Maternal preference for meats with dark surface were significantly associated with higher bulky DNA adducts in both maternal ({beta} 95%CI; 0.46 (0.08, 0.84)) and cord blood ({beta} 95%CI; 0.46 (0.05, 0.86)) before and after adjustment for potential confounders. No other significant associations between the 18 dietary variables and the biomarkers measured in maternal and fetal samples were identified. The present study suggests that maternal intake of meats with dark surface contributes to the bulky DNA adduct levels in maternal and umbilical cord blood. Relationship between food preparation and bulky DNA adducts appear to be captured by a FFQ while potential associations for other biomarkers might be more complex or need larger sample size.

  6. Genetic spell-checking: gene editing using single-stranded DNA oligonucleotides.

    Science.gov (United States)

    Rivera-Torres, Natalia; Kmiec, Eric B

    2016-02-01

    Single-stranded oligonucleotides (ssODNs) can be used to direct the exchange of a single nucleotide or the repair of a single base within the coding region of a gene in a process that is known, generically, as gene editing. These molecules are composed of either all DNA residues or a mixture of RNA and DNA bases and utilize inherent metabolic functions to execute the genetic alteration within the context of a chromosome. The mechanism of action of gene editing is now being elucidated as well as an understanding of its regulatory circuitry, work that has been particularly important in establishing a foundation for designing effective gene editing strategies in plants. Double-strand DNA breakage and the activation of the DNA damage response pathway play key roles in determining the frequency with which gene editing activity takes place. Cellular regulators respond to such damage and their action impacts the success or failure of a particular nucleotide exchange reaction. A consequence of such activation is the natural slowing of replication fork progression, which naturally creates a more open chromatin configuration, thereby increasing access of the oligonucleotide to the DNA template. Herein, how critical reaction parameters influence the effectiveness of gene editing is discussed. Functional interrelationships between DNA damage, the activation of DNA response pathways and the stalling of replication forks are presented in detail as potential targets for increasing the frequency of gene editing by ssODNs in plants and plant cells.

  7. Detection of acrolein-derived cyclic DNA adducts in human cells by monoclonal antibodies.

    Science.gov (United States)

    Pan, Jishen; Awoyemi, Bisola; Xuan, Zhuoli; Vohra, Priya; Wang, Hsiang-Tsui; Dyba, Marcin; Greenspan, Emily; Fu, Ying; Creswell, Karen; Zhang, Lihua; Berry, Deborah; Tang, Moon-Shong; Chung, Fung-Lung

    2012-12-17

    Acrolein (Acr) is a ubiquitous environmental pollutant found in cigarette smoke and automobile exhaust. It can also be produced endogenously by oxidation of polyunsaturated fatty acids. The Acr-derived 1,N(2)-propanodeoxyguanosine (Acr-dG) adducts in DNA are mutagenic lesions that are potentially involved in human cancers. In this study, monoclonal antibodies were raised against Acr-dG adducts and characterized using ELISA. They showed strong reactivity and specificity toward Acr-dG, weaker reactivity toward crotonaldehyde- and trans-4-hydroxy-2-nonenal-derived 1,N(2)-propanodeoxyguanosines, and weak or no reactivity toward 1,N(6)-ethenodeoxyadenosine and 8-oxo-deoxyguanosine. Using these antibodies, we developed assays to detect Acr-dG in vivo: first, a simple and quick FACS-based assay for detecting these adducts directly in cells; second, a highly sensitive direct ELISA assay for measuring Acr-dG in cells and tissues using only 1 μg of DNA without DNA digestion and sample enrichment; and third, a competitive ELISA for better quantitative measurement of Acr-dG levels in DNA samples. The assays were validated using Acr-treated HT29 cell DNA samples or calf thymus DNA, and the results were confirmed by LC-MS/MS-MRM. An immunohistochemical assay was also developed to detect and visualize Acr-dG in HT29 cells as well as in human oral cells. These antibody-based methods provide useful tools for the studies of Acr-dG as a cancer biomarker and of the molecular mechanisms by which cells respond to Acr-dG as a ubiquitous DNA lesion.

  8. Synthesis of a multibranched porphyrin-oligonucleotide scaffold for the construction of DNA-based nano-architectures.

    Science.gov (United States)

    Clavé, Guillaume; Chatelain, Grégory; Filoramo, Arianna; Gasparutto, Didier; Saint-Pierre, Christine; Le Cam, Eric; Piétrement, Olivier; Guérineau, Vincent; Campidelli, Stéphane

    2014-05-01

    The interest in the functionalization of oligonucleotides with organic molecules has grown considerably over the last decade. In this work, we report on the synthesis and characterization of porphyrin-oligonucleotide hybrids containing one to four DNA strands (P1-P4). The hybrid P4, which inserts one porphyrin and four DNA fragments, was combined with gold nanoparticles and imaged by transmission electron microscopy.

  9. Amino acids attached to 2'-amino-LNA: Synthesis of DNA mixmer oligonucleotides with increased duplex stability

    DEFF Research Database (Denmark)

    Johannsen, Marie Willaing; Wengel, Jesper; Wamberg, Michael Chr.;

    2010-01-01

    The synthesis of 2'-amino-LNA (locked nucleic acid) opens up exciting possibilities for modification of nucleic acids by conjugation to the 2'-nitrogen. Incorporation of unmodified and N-functionalized 2'-amino-LNA nucleotides improve duplex stability compared to unmodified DNA. 2'-Amino......-LNA nucleosides derivatized with amino acids have been synthesized and incorporated into DNA oligonucleotides. Following oligonucleotide synthesis, peptides have been added using solid phase peptide coupling chem. Modification of oligonucleotides with pos. charged residues greatly improves thermal stability....

  10. Polycyclic aromatic hydrocarbon-DNA adducts in cervix of women infected with carcinogenic human papillomavirus types: An immunohistochemistry study

    Energy Technology Data Exchange (ETDEWEB)

    Pratt, M. Margaret [Carcinogen-DNA Interactions Section, LCBG, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, MD (United States)], E-mail: prattm@mail.nih.gov; Sirajuddin, Paul; Poirier, Miriam C. [Carcinogen-DNA Interactions Section, LCBG, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, MD (United States); Schiffman, Mark [Hormonal and Reproductive Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD (United States); Glass, Andrew G.; Scott, David R.; Rush, Brenda B. [Northwest Kaiser Permanente, Portland, OR (United States); Olivero, Ofelia A. [Carcinogen-DNA Interactions Section, LCBG, Center for Cancer Research, National Cancer Institute, NIH, Bethesda, MD (United States); Castle, Philip E. [Hormonal and Reproductive Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD (United States)

    2007-11-01

    Among women infected with carcinogenic human papillomavirus (HPV), there is a two- to five-fold increased risk of cervical precancer and cancer in women who smoke compared to those who do not smoke. Because tobacco smoke contains carcinogenic polycyclic aromatic hydrocarbons (PAHs), it was of interest to examine human cervical tissue for PAH-DNA adduct formation. Here, we measured PAH-DNA adduct formation in cervical biopsies collected in follow-up among women who tested positive for carcinogenic HPV at baseline. A semi-quantitative immunohistochemistry (IHC) method using antiserum elicited against DNA modified with r7,t8-dihydroxy-t-9,10-oxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE) was used to measure nuclear PAH-DNA adduct formation. Cultured human cervical keratinocytes exposed to 0, 0.153, or 0.331 {mu}M BPDE showed dose-dependent increases in r7,t8,t9-trihydroxy-c-10-(N{sup 2}deoxyguanosyl)-7,8,9, 10-tetrahydro-benzo[a]pyrene (BPdG) adducts. For BPdG adduct analysis, paraffin-embedded keratinocytes were stained by IHC with analysis of nuclear color intensity by Automated Cellular Imaging System (ACIS) and, in parallel cultures, extracted DNA was assayed by quantitative BPDE-DNA chemiluminescence immunoassay (CIA). For paraffin-embedded samples from carcinogenic HPV-infected women, normal-appearing cervical squamous epithelium suitable for scoring was found in samples from 75 of the 114 individuals, including 29 cases of cervical precancer or cancer and 46 controls. With a lower limit of detection of 20 adducts/10{sup 8} nucleotides, detectable PAH-DNA adduct values ranged from 25 to 191/10{sup 8} nucleotides, with a median of 75/10{sup 8} nucleotides. PAH-DNA adduct values above 150/10{sup 8} nucleotides were found in eight samples, and in three samples adducts were non-detectable. There was no correlation between PAH-DNA adduct formation and either smoking or case status. Therefore, PAH-DNA adduct formation as measured by this methodology did not appear

  11. Adducts in sperm protamine and DNA (deoxyribonuclease) vs. mutation frequency

    Energy Technology Data Exchange (ETDEWEB)

    Sega, G.A.

    1990-01-01

    In mammals, variability in the genetic sensitivity of different germ-cell stages to mutagens could be the result of how much chemical reaches the different stages, what molecular targets may be affected in the different stages and whether or not repair of lesions occurs. In the mouse, several mutagens have been found that cause their greatest genetic damage in late-spermatid and early-spermatozoa stages and that also bind very strongly to the protamine in these stages. Chemicals which are less genetically damaging to these stages have been found to have much less affinity for protamine. Furthermore, the level of chemical binding to DNA in late-spermatid and early-spermatozoa stages has not been correlated with the level of induced genetic damage, although DNA breakage in these sensitive stages has been shown to increase. This DNA damage is believed to indirectly result from chemical binding to sulfhydryl groups in protamine which prevents normal chromatin condensation within the sperm nucleus. 16 refs., 5 figs.

  12. Photochemical Reaction of 7,12-Dimethylbenz[a]anthracene (DMBA and Formation of DNA Covalent Adducts

    Directory of Open Access Journals (Sweden)

    Peter P. Fu

    2005-04-01

    Full Text Available DMBA, 7,12-dimethylbenz[a]anthracene, is a widely studied polycyclic aromatic hydrocarbon that has long been recognized as a probable human carcinogen. It has been found that DMBA is phototoxic in bacteria as well as in animal or human cells and photomutagenic in Salmonella typhimurium strain TA102. This article tempts to explain the photochemistry and photomutagenicity mechanism. Light irradiation converts DMBA into several photoproducts including benz[a]anthracene-7,12-dione, 7-hydroxy-12-keto-7-methylbenz[a]anthracene, 7,12-epidioxy-7,12-dihydro-DMBA, 7-hydroxymethyl-12-methylbenz[a]anthracene and 12-hydroxymethyl-7-methylbenz[a]anthracene. Structures of these photoproducts have been identified by either comparison with authentic samples or by NMR/MS. At least four other photoproducts need to be assigned. Photo-irradiation of DMBA in the presence of calf thymus DNA was similarly conducted and light-induced DMBA-DNA adducts were analyzed by 32P-postlabeling/TLC, which indicates that multiple DNA adducts were formed. This indicates that formation of DNA adducts might be the source of photomutagenicity of DMBA. Metabolites obtained from the metabolism of DMBA by rat liver microsomes were reacted with calf thymus DNA and the resulting DNA adducts were analyzed by 32P-postlabeling/TLC under identical conditions. Comparison of the DNA adduct profiles indicates that the DNA adducts formed from photo-irradiation are different from the DNA adducts formed due to the reaction of DMBA metabolites with DNA. These results suggest that photo-irradiation of DMBA can lead to genotoxicity through activation pathways different from those by microsomal metabolism of DMBA.

  13. In vivo validation of DNA adduct formation by estragole in rats predicted by physiologically based biodynamic modelling.

    Science.gov (United States)

    Paini, Alicia; Punt, Ans; Scholz, Gabriele; Gremaud, Eric; Spenkelink, Bert; Alink, Gerrit; Schilter, Benoît; van Bladeren, Peter J; Rietjens, Ivonne M C M

    2012-11-01

    Estragole is a naturally occurring food-borne genotoxic compound found in a variety of food sources, including spices and herbs. This results in human exposure to estragole via the regular diet. The objective of this study was to quantify the dose-dependent estragole-DNA adduct formation in rat liver and the urinary excretion of 1'-hydroxyestragole glucuronide in order to validate our recently developed physiologically based biodynamic (PBBD) model. Groups of male outbred Sprague Dawley rats (n = 10, per group) were administered estragole once by oral gavage at dose levels of 0 (vehicle control), 5, 30, 75, 150, and 300mg estragole/kg bw and sacrificed after 48h. Liver, kidney and lungs were analysed for DNA adducts by LC-MS/MS. Results obtained revealed a dose-dependent increase in DNA adduct formation in the liver. In lungs and kidneys DNA adducts were detected at lower levels than in the liver confirming the occurrence of DNA adducts preferably in the target organ, the liver. The results obtained showed that the PBBD model predictions for both urinary excretion of 1'-hydroxyestragole glucuronide and the guanosine adduct formation in the liver were comparable within less than an order of magnitude to the values actually observed in vivo. The PBBD model was refined using liver zonation to investigate whether its predictive potential could be further improved. The results obtained provide the first data set available on estragole-DNA adduct formation in rats and confirm their occurrence in metabolically active tissues, i.e. liver, lung and kidney, while the significantly higher levels found in liver are in accordance with the liver as the target organ for carcinogenicity. This opens the way towards future modelling of dose-dependent estragole liver DNA adduct formation in human.

  14. Bulky carcinogen-DNA adducts and exposure to environmental and occupational sources of polycyclic aromatic hydrocarbons. Influence of susceptibility genotypes on adduct level

    Energy Technology Data Exchange (ETDEWEB)

    Sabro Nielsen, P.

    1996-12-31

    PAH exposure, whether it is of occupational or environmental origin, is thought to result in an elevated risk of cancer especially in the lungs. DNA damage is considered an important step in the carcinogenic effect of PAH. Hence, methods that elucidate the steps in the carcinogenic process are important to understand the action of PAH. It may prove useful in the exposure assessment and in combination with classical epidemiological methods give better basis for risk estimation. The objective in this thesis was to evaluate the feasibility of the {sup 32}P-postlabeling method to detect carcinogen-DNA adducts for assessing exposure to DNA damaging compounds in different occupationally and environmentally exposed groups. The studies included groups, that have an elevated cancer risk due to occupational exposure to PAH. Exposure levels were supposed to be relatively low according to reports on occupational and environmental air quality programs. Another aim was to evaluate the influence of polymorphisms in metabolizing enzyme genes on DNA adduct levels. A third objective was to establish some kind of baseline DNA adduct level for individuals with supposed low exposure, and compare it to the more exposed groups. A fourth aim in these studies was to examine if biomarkers of genotoxic exposure could be useful in epidemiological studies to identify groups at risk and thereby contribute with better exposure estimates in the study of PAH related cancer risk. (EG).

  15. DNA adduct kinetics in reproductive tissues of DNA repair proficient and deficient male mice after oral exposure to benzo(a)pyrene.

    Science.gov (United States)

    Verhofstad, Nicole; van Oostrom, Conny Th M; van Benthem, Jan; van Schooten, Frederik J; van Steeg, Harry; Godschalk, Roger W L

    2010-03-01

    Benzo(a)pyrene (B[a]P) can induce somatic mutations, whereas its potential to induce germ cell mutations is unclear. There is circumstantial evidence that paternal exposure to B[a]P can result in germ cell mutations. Since DNA adducts are thought to be a prerequisite for B[a]P induced mutations, we studied DNA adduct kinetics by (32)P-postlabeling in sperm, testes and lung tissues of male mice after a single exposure to B[a]P (13 mg/kg bw, by gavage). To investigate DNA adduct formation at different stages of spermatogenesis, mice were sacrificed at Day 1, 4, 7, 10, 14, 21, 32, and 42 after exposure. In addition, DNA repair deficient (Xpc(-/-)) mice were used to study the contribution of nucleotide excision repair in DNA damage removal. DNA adducts were detectable with highest levels in lung followed by sperm and testis. Maximum adduct levels in the lung and testis were observed at Day 1 after exposure, while adduct levels in sperm reached maximum levels at approximately 1 week after exposure. Lung tissue and testis of Xpc(-/-) mice contained significantly higher DNA adduct levels compared to wild type (Wt) mice over the entire 42 day observation period (P adduct half-life between Xpc(-/-) and Wt mice were only observed in testis. In sperm, DNA adduct levels were significantly higher in Xpc(-/-) mice than in Wt mice only at Day 42 after exposure (P = 0.01). These results indicate that spermatogonia and testes are susceptible for the induction of DNA damage and rely on nucleotide excision repair for maintaining their genetic integrity.

  16. Detection and quantification of DNA strand breaks using the ROPS (random oligonucleotide primed synthesis) assay.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    DNA double strand breaks (DSBs) arise from spontaneous DNA damage due to metabolic activities or from direct and indirect damaging effects of stress. DSBs are also formed transiently during such processes as replication, transcription, and DNA repair. The level of DSBs positively correlates with the activities of homologous and nonhomologous DNA repair pathways, which in turn inversely correlate with methylation levels and chromatin structure. Thus, measurement of strand breaks can provide an informative picture of genome stability of a given cell. The use of random oligonucleotide-primed synthesis for the analysis of DSB levels is described. Applications of the assay for quantitative detection of 3'OH, 3'P, or DNA strand breaks at a cleavage site of the deoxyribose residue are discussed.

  17. Antibacterial Activity of DNA-Stabilized Silver Nanoclusters Tuned by Oligonucleotide Sequence.

    Science.gov (United States)

    Javani, Siamak; Lorca, Romina; Latorre, Alfonso; Flors, Cristina; Cortajarena, Aitziber L; Somoza, Álvaro

    2016-04-27

    Silver nanoclusters (AgNCs) stabilized by DNA are promising materials with tunable fluorescent properties, which have been employed in a plethora of sensing systems. In this report, we explore their antimicrobial properties in Gram-positive and Gram-negative bacteria. After testing 9 oligonucleotides with different sequence and length, we found that the antibacterial activity depends on the sequence of the oligonucleotide employed. The sequences tested yielded fluorescent AgNCs, which can be grouped in blue, yellow, and red emitters. Interestingly, blue emitters yielded poor antibacterial activity, whereas yellow and red emitters afforded an activity similar to silver nitrate. Furthermore, structural studies using circular dichroism indicate the formation of complexes with different stability and structure, which might be one of the factors that modulate their activity. Finally, we prepared a trimeric structure containing the sequence that afforded the best antimicrobial activity, which inhibited the growth of Gram-positive and negative bacteria in the submicromolar range.

  18. Ultrahigh molecular recognition specificity of competing DNA oligonucleotide strands in thermal equilibrium

    CERN Document Server

    Schenkelberger, Marc; Mai, Timo; Ott, Albrecht

    2016-01-01

    The specificity of molecular recognition is important to molecular self-organization. A prominent example is the biological cell where, within a highly crowded molecular environment, a myriad of different molecular receptor pairs recognize their binding partner with astonishing accuracy. In thermal equilibrium it is usually admitted that the affinity of recognizer pairs only depends on the nature of the two binding molecules. Accordingly, Boltzmann factors of binding energy differences relate the molecular affinities among different target molecules that compete for the same probe. Here, we consider the molecular recognition of short DNA oligonucleotide single strands. We show that a better matching oligonucleotide strand can prevail against a disproportionally more concentrated competitor that exhibits reduced affinity due to a mismatch. The magnitude of deviation from the simple picture above may reach several orders of magnitude. In our experiments the effective molecular affinity of a given strand remains...

  19. Specific detection of very low concentrations of DNA oligonucleotides with DNA-coated long-period grating biosensor

    Science.gov (United States)

    Czarnecka, Karolina H.; Dominik, Magdalena; Janczuk-Richter, Marta; Niedziółka-Jönsson, Joanna; Bock, Wojtek J.; Śmietana, Mateusz

    2017-04-01

    Label-free biosensing using optical long-period gratings (LPGs) induced in optical fiber and coated with biological compound enables for detection and monitoring the kinetics of reactions taking places on the sensor's surface. The labelfree detection effect for the LPG biosensor working near the dispersion turning point (DTP) of higher order cladding modes can be observed as resonance wavelength shift induced by binding of biomolecules to fiber surface. In this study we analyzed shift of the resonance wavelength for LPG after its functionalization with DNA layer and during DNA hybridization. It has seen found that the LPG is able to be functionalized with DNA oligonucleotide, acting as a probe and after the functionalization can selectively bind specific complementary DNA oligonucleotides in a very low concentration. DNA-coated LPG can be used as a probe capturing specific DNA sequences with wide ranges of concentrations from 0.1 to 10 pM. Hybridization of the DNA on the fiber surface has also been verified with Midorii Green florescent marker.

  20. Nuclear magnetic resonance studies of an N2-guanine adduct derived from the tumorigen dibenzo[a,l]pyrene in DNA: impact of adduct stereochemistry, size, and local DNA sequence on solution conformations.

    Science.gov (United States)

    Rodríguez, Fabián A; Liu, Zhi; Lin, Chin H; Ding, Shuang; Cai, Yuqin; Kolbanovskiy, Alexander; Kolbanovskiy, Marina; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2014-03-25

    The dimensions and arrangements of aromatic rings (topology) in adducts derived from the reactions of polycyclic aromatic hydrocarbon (PAH) diol epoxide metabolites with DNA influence the distortions and stabilities of double-stranded DNA, and hence their recognition and processing by the human nucleotide excision repair (NER) system. Dibenzo[a,l]pyrene (DB[a,l]P) is a highly tumorigenic six-ring PAH, which contains a nonplanar and aromatic fjord region that is absent in the structurally related bay region five-ring PAH benzo[a]pyrene (B[a]P). The PAH diol epoxide-DNA adducts formed include the stereoisomeric 14S and 14R trans-anti-DB[a,l]P-N(2)-dG and the stereochemically analogous 10S- and 10R-B[a]P-N(2)-dG (B[a]P-dG) guanine adducts. However, nuclear magnetic resonance (NMR) solution studies of the 14S-DB[a,l]P-N(2)-dG adduct in DNA have not yet been presented. Here we have investigated the 14S-DB[a,l]P-N(2)-dG adduct in two different sequence contexts using NMR methods with distance-restrained molecular dynamics simulations. In duplexes with dC opposite the adduct deleted, a well-resolved base-displaced intercalative adduct conformation can be observed. In full duplexes, in contrast to the intercalated 14R stereoisomeric adduct, the bulky DB[a,l]P residue in the 14S adduct is positioned in a greatly widened and distorted minor groove, with significant disruptions and distortions of base pairing at the lesion site and two 5'-side adjacent base pairs. These unique structural features are significantly different from those of the stereochemically analogous but smaller B[a]P-dG adduct. The greater size and different topology of the DB[a,l]P aromatic ring system lead to greater structurally destabilizing DNA distortions that are partially compensated by stabilizing DB[a,l]P-DNA van der Waals interactions, whose combined effects impact the NER response to the adduct. These structural results broaden our understanding of the structure-function relationship in NER.

  1. High-density functionalization and cross-linking of DNA: "click" and "bis-click" cycloadditions performed on alkynylated oligonucleotides with fluorogenic anthracene azides.

    Science.gov (United States)

    Pujari, Suresh S; Ingale, Sachin A; Seela, Frank

    2014-10-15

    High density functionalization of DNA with ethynyl and octadiynyl side chains followed by CuAAC "click labeling" with 9-azidomethylanthracene was performed. Alkynyl DNA was also cross-linked with fluorogenic 9,10-bis-azidomethylanthracene employing the "bis-click" reaction. By this means the fluorescence of the anthracene moiety was imparted to the virtually nonfluorescent DNA. Phosphoramidites of 8-aza-7-deaza-2'-deoxyadenosine with short and long linker arms in a steric nondemanding 7-position were utilized in solid phase oligodeoxynucleotide synthesis. High density alkynylated DNA-without anthracene residues-was found to be of comparable stability with both long and short linker arms. High density anthracene functionalized DNA became less stable with the short linker compared to that with the long linker connectivity. Interstrand cross-linked homodimers constructed from alkynylated oligonucleotides with fluorogenic 9,10-bis-azidomethylanthracene were hybridized with complementary strands to form double helices. They are more stable when the linker was located at a terminus than in a central position. Short linker anthracene adducts were destabilizing compared to long linker adducts. The fluorogenic anthracene residues not only have a significant effect on the duplex stability, but also impart fluorescence to the species. Fluorescence of cross-linked double helices with long linker connectivity was quenched when the cross-link was in a terminal position and was dequenched when the linker was connecting the two double helices at the center of the molecule. The fluorescence of the anthracene cross-linked double helices was strongly increased (dequenched) when the correct base pair was formed, while no change occurred upon mismatch formation.

  2. Pyrrolizidine alkaloid-derived DNA adducts as a common biological biomarker of pyrrolizidine alkaloid-induced tumorigenicity.

    Science.gov (United States)

    Xia, Qingsu; Zhao, Yuewei; Von Tungeln, Linda S; Doerge, Daniel R; Lin, Ge; Cai, Lining; Fu, Peter P

    2013-09-16

    Pyrrolizidine alkaloid-containing plants are the most common poisonous plants affecting livestock, wildlife, and humans. The U.S. National Toxicology Program (NTP) classified riddelliine, a tumorigenic pyrrolizidine alkaloid, as "reasonably anticipated to be a human carcinogen" in the NTP 12th Report on Carcinogens in 2011. We previously determined that four DNA adducts were formed in rats dosed with riddelliine. The structures of the four DNA adducts were elucidated as (i) a pair of epimers of 7-hydroxy-9-(deoxyguanosin-N(2)-yl)dehydrosupinidine adducts (termed as DHP-dG-3 and DHP-dG-4) as the predominant adducts; and (ii) a pair of epimers of 7-hydroxy-9-(deoxyadenosin-N(6)-yl)dehydrosupinidine adducts (termed as DHP-dA-3 and DHP-dA-4 adducts). In this study, we selected a nontumorigenic pyrrolizidine alkaloid, platyphylliine, a pyrrolizidine alkaloid N-oxide, riddelliine N-oxide, and nine tumorigenic pyrrolizidine alkaloids (riddelliine, retrorsine, monocrotaline, lycopsamine, retronecine, lasiocarpine, heliotrine, clivorine, and senkirkine) for study in animals. Seven of the nine tumorigenic pyrrolizidine alkaloids, with the exception of lycopsamine and retronecine, are liver carcinogens. At 8-10 weeks of age, female F344 rats were orally gavaged for 3 consecutive days with 4.5 and 24 μmol/kg body weight test article in 0.5 mL of 10% DMSO in water. Twenty-four hours after the last dose, the rats were sacrificed, livers were removed, and liver DNA was isolated for DNA adduct analysis. DHP-dG-3, DHP-dG-4, DHP-dA-3, and DHP-dA-4 adducts were formed in the liver of rats treated with the individual seven hepatocarcinogenic pyrrolizidine alkaloids and riddelliine N-oxide. These DNA adducts were not formed in the liver of rats administered retronecine, the nontumorigenic pyrrolizidine alkaloid, platyphylliine, or vehicle control. These results indicate that this set of DNA adducts, DHP-dG-3, DHP-dG-4, DHP-dA-3, and DHP-dA-4, is a common biological biomarker of

  3. Mitomycin C-DNA adducts generated by DT-diaphorase. Revised mechanism of the enzymatic reductive activation of mitomycin C.

    Science.gov (United States)

    Suresh Kumar, G; Lipman, R; Cummings, J; Tomasz, M

    1997-11-18

    Mitomycin C (MC) was reductively activated by DT-diaphorase [DTD; NAD(P)H:quinone oxidoreductase] from rat liver carcinoma cells in the presence of Micrococcus lysodeicticus DNA at pH 5.8 and 7.4. The resulting alkylated MC-DNA complexes were digested to the nucleoside level and the covalent MC-nucleoside adducts were separated, identified, and quantitatively analyzed by HPLC. In analogous experiments, two other flavoreductases, NADH-cytochrome c reductase and NADPH-cytochrome c reductase, as well as two chemical reductive activating agents Na2S2O4 and H2/PtO2 were employed as activators for the alkylation of DNA by MC. DTD as well as all the other activators generated the four known major guanine-N2-MC adducts at both pHs. In addition, at the lower pH, the guanine-N7-linked adducts of 2,7-diaminomitosene were detectable in the adduct patterns. At a given pH all the enzymatic and chemical reducing agents generated very similar adduct patterns which, however, differed dramatically at the acidic as compared to the neutral pH. Overall yield of MC adducts was 3-4-fold greater at pH 7.4 than at 5. 8 except in the case of DTD when it was 4-fold lower. Without exception, however, cross-link adduct yields were greater at the acidic pH (2-10-fold within the series). The ratio of adducts of bifunctional activation to those of monofunctional activation was 6-20-fold higher at the acidic as compared to the neutral pH. A comprehensive mechanism of the alkylation of DNA by activated MC was derived from the DNA adduct analysis which complements earlier model studies of the activation of MC. The mechanism consists of three competing activation pathways yielding three different DNA-reactive electrophiles 11, 12, and 17 which generate three unique sets of DNA adducts as endproducts. The relative amounts of these adducts are diagnostic of the relative rates of the competing pathways in vitro, and most likely, in vivo. Factors that influence the relative rates of individual pathways

  4. The potential of platinum-DNA adduct determination in ex vivo treated tumor fragments for the prediction of sensitivity to cisplatin chemotherapy

    NARCIS (Netherlands)

    Welters, M.J.P.; Braakhuis, B.J.M.; Jacobs-Bergmans, A.J.; Kegel, A.; Baan, R.A.; Vijgh, W.J.F. van der; Fichtinger-Schepman, A.M.J.

    1999-01-01

    Background: Response to cisplatin-therapy is assumed to be related to the formation of platinum (Pt)-DNA adducts. Measurement of these adducts prior to therapy could be of value to improve cisplatin based cancer therapy. Materials and methods: We determined Pt-GG and Pt-AG adduct levels by use of 32

  5. Testing the feasibility of DNA typing for human identification by PCR and an oligonucleotide ligation assay

    Energy Technology Data Exchange (ETDEWEB)

    Delahunty, C.; Ankener, W.; Deng, Qiang [Univ. of Washington, Seattle, WA (United States)] [and others

    1996-06-01

    The use of DNA typing in human genome analysis is increasing and finding widespread application in the area of forensic and paternity testing. In this report, we explore the feasibility of typing single nucleotide polymorphisms (SNPs) by using a semiautomated method for analyzing human DNA samples. In this approach, PCR is used to amplify segments of human DNA containing a common SNP. Allelic nucleotides in the amplified product are then typed by a calorimetric implementation of the oligonucleotide ligation assay (OLA). The results of the combined assay, PCR/OLA, are read directly by a spectrophotometer; the absorbances are compiled and the genotypes are automatically determined. A panel of 20 markers has been developed for DNA typing and has been tested using a sample panel from the CEPH pedigrees (CEPH parents). The results of this typing, as well as the potential to apply this method to larger populations, are discussed. 62 refs., 2 figs., 4 tabs.

  6. Simultaneous detection and subtyping of porcine endogenous retroviruses proviral DNA using the dual priming oligonucleotide system.

    Science.gov (United States)

    Moon, Hyoung Joon; Park, Seong Jun; Kim, Hye Kwon; Ann, Soo Kyung; Rho, Semi; Keum, Hyun Ok; Park, Bong Kyun

    2010-09-01

    The purpose of this study was to develop a multiplex PCR that can detect porcine endogenous retrovirus (PERV) proviral genes (pol, envA, envB, envC) and porcine mitochondrial DNA, using a dual priming oligonucleotide (DPO) system. The primer specifically detected the PERV proviral genes pol, envA, envB, envC, and porcine mitochondrial DNA only in samples of pig origin. The sensitivity of the primer was demonstrated by simultaneous amplification of all 5 target genes in as little as 10 pg of pig DNA containing PERV proviral genes and mitochondrial DNA. The multiplex PCR, when applied to field samples, simultaneously and successfully amplified PERV proviral genes from liver, blood and hair root samples. Thus, the multiplex PCR developed in the current study using DPO-based primers is a rapid, sensitive and specific assay for the detection and subtyping of PERV proviral genes.

  7. Contributions of aryl hydrocarbon receptor genetic variants to the risk of glioma and PAH-DNA adducts.

    Science.gov (United States)

    Gu, Aihua; Ji, Guixiang; Jiang, Tao; Lu, Ailin; You, Yongping; Liu, Ning; Luo, Chengzhang; Yan, Wei; Zhao, Peng

    2012-08-01

    The aryl hydrocarbon receptor (AHR) gene is involved in the response to polycyclic aromatic hydrocarbon (PAH) exposure. To investigate the hypothesis that the genetic variants in the AHR gene might be a causal genetic susceptibility to PAH-DNA adduct formation and glioma risk, we conducted a case-control study of 384 glioma cases and 384 cancer-free controls to explore the association between six common single-nucleotide polymorphisms of the AHR gene and glioma risk. Using PAH-DNA adducts as biomarkers, we then evaluated the association between PAH-DNA adduct levels and glioma risk based on a tissue microarray including 11 controls and 77 glioma patients. We further explored the contributions of the glioma risk-associated AHR polymorphisms to the levels of PAH-DNA adducts in glioma tissues based on 77 glioma patients. We found that PAH-DNA adduct staining existed in normal brain tissues and grades I-IV gliomas, and the staining intensity was significantly associated with the glioma grade. Two AHR polymorphisms (rs2066853 and rs2158041) demonstrated significant association with glioma risk. Intriguingly, we also found statistically significant associations between these two variants and PAH-DNA adduct levels in glioma tissue. These data suggest the contributions of AHR rs2066853 and rs2158041 to glioma risk and the PAH-DNA adduct levels, which shed new light on gene-environment interactions in the etiology of glioma. Further studies with a larger sample size and ethnically diverse populations are required to elucidate the potential biological mechanism for, as well as the impact of, the susceptibility to glioma due to genetic variants of AHR.

  8. Modulatory effects of essential oils from spices on the formation of DNA adduct by aflatoxin B1 in vitro.

    Science.gov (United States)

    Hashim, S; Aboobaker, V S; Madhubala, R; Bhattacharya, R K; Rao, A R

    1994-01-01

    Essential oils from common spices such as nutmeg, ginger, cardamom, celery, xanthoxylum, black pepper, cumin, and coriander were tested for their ability to suppress the formation of DNA adducts by aflatoxin B1 in vitro in a microsomal enzyme-mediated reaction. All oils were found to inhibit adduct formation very significantly and in a dose-dependent manner. The adduct formation appeared to be modulated through the action on microsomal enzymes, because an effective inhibition on the formation of activated metabolite was observed with each oil. The enzymatic modulation is perhaps due to the chemical constituents of the oils, and this could form a basis for their potential anticarcinogenic roles.

  9. Development and validation of a direct sandwich chemiluminescence immunoassay for measuring DNA adducts of benzo[a]pyrene and other polycyclic aromatic hydrocarbons

    DEFF Research Database (Denmark)

    Georgiadis, Panagiotis; Kovács, Katalin; Kaila, Stella;

    2012-01-01

    We have developed and validated a sandwich chemiluminescence immunoassay (SCIA) which measures polycyclic aromatic hydrocarbon (PAH)-DNA adducts combining high throughput and adequate sensitivity, appropriate for evaluation of adduct levels in human population studies. Fragmented DNA is incubated...... with rabbit antiserum elicited against DNA modified with r7,t8-dihydroxy-t-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE) and subsequently trapped by goat anti-rabbit IgG bound to a solid surface. Anti-single-stranded (ss) DNA antibodies binds in a quantity proportional to the adduct levels...... and is detected by chemiluminescence. The BPDE-DNA SCIA has a limit of detection of 3 adducts per 10(9) nucleotides with 5 µg DNA per well. We have validated the BPDE-DNA SCIA using DNA modified in vitro, DNA from benzo[a]pyrene (BP)-exposed cultured cells and mice. The levels of adduct measured by SCIA were...

  10. Synthesis of an oligodeoxyribonucleotide adduct of mitomycin C by the postoligomerization method via a triamino mitosene.

    Science.gov (United States)

    Champeil, Elise; Paz, Manuel M; Ladwa, Sweta; Clement, Cristina C; Zatorski, Andrzej; Tomasz, Maria

    2008-07-23

    The cancer chemotherapeutic agent mitomycin C (MC) alkylates and cross-links DNA monofunctionally and bifunctionally in vivo and in vitro, forming six major MC-deoxyguanosine adducts of known structures. The synthesis of one of the monoadducts (8) by the postoligomerization method was accomplished both on the nucleoside and oligonucleotide levels, the latter resulting in the site-specific placement of 8 in a 12-mer oligodeoxyribonucleotide 26. This is the first application of this method to the synthesis of a DNA adduct of a complex natural product. Preparation of the requisite selectively protected triaminomitosenes 14 and 24 commenced with removal of the 10-carbamoyl group from MC, followed by reductive conversion to 10-decarbamoyl-2,7-diaminomitosene 10. This substance was transformed to 14 or 24 in several steps. Both were successfully coupled to the 2-fluoro-O(6)-(2-trimethylsilylethyl)deoxyinosine residue of the 12-mer oligonucleotide. The N(2)-phenylacetyl protecting group of 14 after its coupling to the 12-mer oligonucleotide could not be removed by penicillinamidase as expected. Nevertheless, the Teoc protecting group of 24 after coupling to the 12-mer oligonucleotide was removed by treatment with ZnBr2 to give the adducted oligonucleotide 26. However, phenylacetyl group removal was successful on the nucleoside-level synthesis of adduct 8. Proof of the structure of the synthetic nucleoside adduct included HPLC coelution and identical spectral properties with a natural sample, and (1)H NMR. Structure proof of the adducted oligonucleotide 26 was provided by enzymatic digestion to nucleosides and authentic adduct 8, as well as MS and MS/MS analysis.

  11. Thermolytic CpG-containing DNA oligonucleotides as potential immunotherapeutic prodrugs.

    Science.gov (United States)

    Grajkowski, Andrzej; Pedras-Vasconcelos, Joao; Wang, Vivian; Ausín, Cristina; Hess, Sonja; Verthelyi, Daniela; Beaucage, Serge L

    2005-01-01

    A CpG-containing DNA oligonucleotide functionalized with the 2-(N-formyl-N-methyl)aminoethyl thiophosphate protecting group (CpG ODN fma1555) was prepared from phosphoramidites 1a-d using solid-phase techniques. The oligonucleotide behaved as a prodrug by virtue of its conversion to the well-studied immunomodulatory CpG ODN 1555 through thermolytic cleavage of the 2-(N-formyl-N-methyl)aminoethyl thiophosphate protecting group. Such a conversion occurred at 37 degrees C with a half-time of 73 h. The immunostimulatory properties of CpG ODN fma1555 were evaluated in two in vivo assays, one of which consisted of mice challenged in the ear with live Leishmania major metacyclic promastigotes. Local intradermal administration of CpG ODN fma1555 was as effective as that of CpG ODN 1555 in reducing the size of Leishmania lesions over time. In a different infectious model, CpG ODN 1555 prevented the death of Tacaribe-infected mice (43% survival) when administered between day 0 and 3 post infection. Administration of CpG ODN fma1555 three days before infection resulted in improved immunoprotection (60-70% survival). Moreover, co-administration of CpG ODN fma1555 and CpG ODN 1555 in this model increased the window for therapeutic treatment against Tacaribe virus infection, and thus supports the use of thermolytic oligonucleotides as prodrugs in the effective treatment of infectious diseases.

  12. (32)P-postlabelling analysis of 1,3-butadiene-induced DNA adducts in vivo and in vitro.

    Science.gov (United States)

    Zhao, C; Koskinen, M; Hemminki, K

    2000-01-01

    Butadiene monoepoxide (BMO), epoxybutanediol (EBD) and diepoxybutane (DEB) are reactive metabolites of 1,3-butadiene (BD), an important industrial chemical classified as a probable human carcinogen. The covalent interactions of these metabolites with DNA lead to the formation of DNA adducts which may induce mutations or other types of DNA damage, resulting in tumour formation. In the present study, two pairs of diastereomeric N-1-BMO-adenine adducts were identified in the reaction of BMO with 2´-deoxyadenosine-5´-monophosphate (5´-dAMP). The major products formed by reacting EBD with 2´-deoxyguanosine-5´-monophosphate (5´-dGMP) were characterized as diastereomeric N-7-(2´,3´,4´-trihydroxybut-1´-yl)-5´-dGMP by UV and electrospray mass spectrometry. The formation of N-7-BMO-guanine adducts (1´-carbon, 60; 2´carbon, 54/10(4) nucleotides) in BMO-treated DNA was about four times higher than that of N-1-BMO-adenine adducts (1´-carbon, 20; 2´-carbon, 8.7/10(4) nucleotides). However, the recovery of N-1-BMO-adenine adducts in DNA (45 ± 5%) was two times higher than that of N-7-guanine adducts (20 ± 4%) by 32P-postlabelling analysis. Using the 32P-postlabelling/ HPLC assay, N-1-BMO-adenine, N-7-BMO-guanine and N-7-EBDguanine adducts were detected in BMO- or DEB-treated DNA and in liver DNA of rats exposed to BD by inhalation. The amount of N-7-EBD-guanine adducts (11/10(8) nucleotides) in rat liver was about three-fold higher than N-7-BMO-guanine adducts (4.0/10(8) nucleotides). The novel finding of N-1-BMO-adenine adducts formed in vivo may contribute to the understanding of the mechanisms of BD carcinogenic action.

  13. ECETOC workshop on the biological significance of DNA adducts: summary of follow-up from an expert panel meeting.

    Science.gov (United States)

    Pottenger, Lynn H; Carmichael, Neil; Banton, Marcy I; Boogaard, Peter J; Kim, James; Kirkland, David; Phillips, Richard D; van Benthem, Jan; Williams, Gary M; Castrovinci, Alexis

    2009-08-01

    This workshop on the biological significance of DNA adducts included presentations of research results in the following areas: endogenous versus exogenous adduct levels; in vitro dose-response data on adducts and mutagenesis from alkylating agents; methyltransferases and alkyl transferase-like proteins in repair of O(6)-alkylguanine adducts; mathematical modeling of threshold dose-response in mutagenesis and carcinogenesis; and the use of genomics to characterize the relationships between adducts, gene expression, and downstream adverse effects. Presentations by regulatory scientists and other authorities addressed the role of adduct and mutation data in risk characterization. Consensus statements were developed and included the following: DNA adducts should be considered as biomarkers of exposure, which may play a key role in establishing a mode of action (MOA) for cancer. Adducts themselves should not be considered as equivalent to mutations or later stage events in carcinogenesis. Although it was not possible at this time to agree on a general level of adducts below which there is no adverse biological effect, there are examples of genotoxic mutagens/carcinogens for which thresholds have been demonstrated. Evidence regarding thresholds for mutations should be considered on a case-by-case basis, in light of available MOA and mechanistic data, to build a knowledge base. Participants agreed that guidance on a recommended format for data presentation (especially agreement on units and appropriate statistical analyses) would be beneficial. Finally, for initial cases, provision of a mechanistic explanation to support a hypothesis of a threshold for mutations was essential for the eventual use of this information in risk assessment.

  14. Genotoxic Pyrrolizidine Alkaloids — Mechanisms Leading to DNA Adduct Formation and Tumorigenicity

    Directory of Open Access Journals (Sweden)

    Ming W. Chou

    2002-09-01

    Full Text Available Abstract: Plants that contain pyrrolizidine alkaloids are widely distributed in the world. Although pyrrolizidine alkaloids have been shown to be genotoxic and tumorigenic in experimental animals, the mechanisms of actions have not been fully understood. The results of our recent mechanistic studies suggest that pyrrolizidine alkaloids induce tumors via a genotoxic mechanism mediated by 6,7-dihydro-7-hydroxy-1-hydroxymethyl-5Hpyrrolizine (DHP-derived DNA adduct formation. This mechanism may be general to most carcinogenic pyrrolizidine alkaloids, including the retronecine-, heliotridine-, and otonecinetype pyrrolizidine alkaloids. It is hypothesized that these DHP-derived DNA adducts are potential biomarkers of pyrrolizidine alkaloid tumorigenicity. The mechanisms that involve the formation of DNA cross-linking and endogenous DNA adducts are also discussed.

  15. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field.

    Science.gov (United States)

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah

    2016-01-01

    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.

  16. Maternal diet and dioxin-like activity, bulky DNA adducts and micronuclei in mother newborns

    DEFF Research Database (Denmark)

    Pedersen, Marie; Halldorsson, Thorhallur I; Autrup, Herman

    2012-01-01

    Maternal diet can contribute to carcinogenic exposures and also modify effects of environmental exposures on maternal and fetal genetic stability. In this study, associations between maternal diet and the levels of dioxin-like plasma activity, bulky DNA adducts in white blood cells and micronuclei...... (MN) in lymphocytes from mother to newborns were examined. From 98 pregnant women living in the greater area of Copenhagen, Denmark in 2006-2007, maternal peripheral blood and umbilical cord blood were collected, together with information on health, environmental exposure and lifestyle. Maternal diet...

  17. Linking DNA adduct formation and human cancer risk in chemical carcinogenesis.

    Science.gov (United States)

    Poirier, Miriam C

    2016-08-01

    Over two centuries ago, Sir Percival Pott, a London surgeon, published a pioneering treatise showing that soot exposure was the cause of high incidences of scrotal cancers occurring in young men who worked as chimney sweeps. Practicing at a time when cellular pathology was not yet recognized, Sir Percival nonetheless observed that the high incidence and short latency of the chimney sweep cancers, was fundamentally different from the rare scrotal cancers typically found in elderly men. Furthermore, his diagnosis that the etiology of these cancers was related to chimney soot exposure, was absolutely accurate, conceptually novel, and initiated the field of "occupational cancer epidemiology." After many intervening years of research focused on mechanisms of chemical carcinogenesis, briefly described here, it is clear that DNA damage, or DNA adduct formation, is "necessary but not sufficient" for tumor induction, and that many additional factors contribute to carcinogenesis. This review includes a synopsis of carcinogen-induced DNA adduct formation in experimental models and in the human population, with particular attention paid to molecular dosimetry and molecular cancer epidemiology. Environ. Mol. Mutagen. 57:499-507, 2016. © 2016 Wiley Periodicals, Inc.

  18. Malabaricone C-containing mace extract inhibits safrole bioactivation and DNA adduct formation both in vitro and in vivo

    NARCIS (Netherlands)

    Martati, E.; Boonpawa, R.; Berg, van den J.H.J.; Paini, A.; Spenkelink, A.; Punt, A.; Vervoort, J.J.M.; Bladeren, van P.J.; Rietjens, I.

    2014-01-01

    Safrole, present in mace and its essential oils, causes liver tumors in rodents at high dose levels due to formation of a DNA reactive 1'-sulfooxysafrole. The present study identifies malabaricone C as a mace constituent able to inhibit safrole DNA adduct formation at the level of sulfotransferase m

  19. DNA adducts, mutant frequencies, and mutation spectra in various organs of λlacZ mice exposed to ethylating agents

    NARCIS (Netherlands)

    Mientjes, E.J.; Luiten-Schuite, A.; Wolf, E. van der; Borsboom, Y.; Bergmans, A.; Berends, F.; Lohman, P.H.M.; Baan, R.A.; Delft, J.H.M. van

    1998-01-01

    To investigate tissue-specific relations between DNA adducts and mutagenesis in vivo, λlacZ transgenic mice were treated i.p. with N-ethyl-N-nitrosourea (ENU), diethylnitrosamine (DEN), and ethyl methanesulphonate (EMS). In liver, bone marrow, and brain DNA from mice sacrificed at several time point

  20. Characterization of nitrogen mustard formamidopyrimidine adduct formation of bis(2-chloroethyl)ethylamine with calf thymus DNA and a human mammary cancer cell line.

    Science.gov (United States)

    Gruppi, Francesca; Hejazi, Leila; Christov, Plamen P; Krishnamachari, Sesha; Turesky, Robert J; Rizzo, Carmelo J

    2015-09-21

    A robust, quantitative ultraperformance liquid chromatography ion trap multistage scanning mass spectrometric (UPLC/MS(3)) method was established to characterize and measure five guanine adducts formed by reaction of the chemotherapeutic nitrogen mustard (NM) bis(2-chloroethyl)ethylamine with calf thymus (CT) DNA. In addition to the known N7-guanine (NM-G) adduct and its cross-link (G-NM-G), the ring-opened formamidopyrimidine (FapyG) monoadduct (NM-FapyG) and cross-links in which one (FapyG-NM-G) or both (FapyG-NM-FapyG) guanines underwent ring-opening to FapyG units were identified. Authentic standards of all adducts were synthesized and characterized by NMR and mass spectrometry. These adducts were quantified in CT DNA treated with NM (1 μM) as their deglycosylated bases. A two-stage neutral thermal hydrolysis was developed to mitigate the artifactual formation of ring-opened FapyG adducts involving hydrolysis of the cationic adduct at 37 °C, followed by hydrolysis of the FapyG adducts at 95 °C. The limit of quantification values ranged between 0.3 and 1.6 adducts per 10(7) DNA bases when the equivalent of 5 μg of DNA hydrolysate was assayed on column. The principal adduct formed was the G-NM-G cross-link, followed by the NM-G monoadduct; the FapyG-NM-G cross-link adduct; and the FapyG-NM-FapyG was below the limit of detection. The NM-FapyG adducts were formed in CT DNA at a level ∼20% that of the NM-G adduct. NM-FapyG has not been previously quanitified, and the FapyG-NM-G and FapyG-NM-FapyG adducts have not been previously characterized. Our validated analytical method was then applied to measure DNA adduct formation in the MDA-MB-231 mammary tumor cell line exposed to NM (100 μM) for 24 h. The major adduct formed was NM-G (970 adducts per 10(7) bases), followed by G-NM-G (240 adducts per 10(7) bases), NM-FapyG (180 adducts per 10(7) bases), and, last, the FapyG-NM-G cross-link adduct (6.0 adducts per 10(7) bases). These lesions are expected to

  1. A physiologically based in silico model for trans-2-hexenal detoxification and DNA adduct formation in rat.

    Science.gov (United States)

    Kiwamoto, Reiko; Rietjens, Ivonne M C M; Punt, Ans

    2012-12-17

    trans-2-Hexenal (2-hexenal) is an α,β-unsaturated aldehyde that occurs naturally in a wide range of fruits, vegetables, and spices. 2-Hexenal as well as other α,β-unsaturated aldehydes that are natural food constituents or flavoring agents may raise a concern for genotoxicity due to the ability of the α,β-unsaturated aldehyde moiety to react with DNA. Controversy remains, however, on whether α,β-unsaturated aldehydes result in significant DNA adduct formation in vivo at realistic dietary exposure. In this study, a rat physiologically based in silico model was developed for 2-hexenal as a model compound to examine the time- and dose-dependent detoxification and DNA adduct formation of this selected α,β-unsaturated aldehyde. The model was developed based on in vitro and literature-derived parameters, and its adequacy was evaluated by comparing predicted DNA adduct formation in the liver of rats exposed to 2-hexenal with reported in vivo data. The model revealed that at an exposure level of 0.04 mg/kg body weight, a value reflecting estimated daily human dietary intake, 2-hexenal is rapidly detoxified predominantly by conjugation with glutathione (GSH) by glutathione S-transferases. At higher dose levels, depletion of GSH results in a shift to 2-hexenal oxidation and reduction as the major pathways for detoxification. The level of DNA adduct formation at current levels of human dietary intake was predicted to be more than 3 orders of magnitude lower than endogenous DNA adduct levels. These results support that rapid detoxification of 2-hexenal reduces the risk arising from 2-hexenal exposure and that at current dietary exposure levels, DNA adduct formation is negligible.

  2. Genetic polymorphisms in catalase and CYP1B1 determine DNA adduct formation by benzo(a)pyrene ex vivo.

    Science.gov (United States)

    Schults, Marten A; Chiu, Roland K; Nagle, Peter W; Wilms, Lonneke C; Kleinjans, Jos C; van Schooten, Frederik J; Godschalk, Roger W

    2013-03-01

    Genetic polymorphisms can partially explain the large inter-individual variation in DNA adduct levels following exposure to polycyclic aromatic hydrocarbons. Effects of genetic polymorphisms on DNA adduct formation are difficult to assess in human studies because exposure misclassification attenuates underlying relationships. Conversely, ex vivo studies offer the advantage of controlled exposure settings, allowing the possibility to better elucidate genotype-phenotype relationships and gene-gene interactions. Therefore, we exposed lymphocytes of 168 non-smoking volunteers ex vivo to the environmental pollutant benzo(a)pyrene (BaP) and BaP-related DNA adducts were quantified. Thirty-four genetic polymorphisms were assessed in genes involved in carcinogen metabolism, oxidative stress and DNA repair. Polymorphisms in catalase (CAT, rs1001179) and cytochrome P450 1B1 (CYP1B1, rs1800440) were significantly associated with DNA adduct levels, especially when combined. Moreover, reverse transcription-polymerase chain reaction (RT-PCR) analysis in a subset of 30 subjects revealed that expression of catalase correlated strongly with expression of CYP1B1 (R = 0.92, P CYP1B1 and how they simultaneously affect BaP-related DNA adduct levels, catalase expression was transiently knocked down in the human lung epithelial cell line A549. Although catalase knockdown did not immediately change CYP1B1 gene expression, recovery of catalase expression 8 h after the knockdown coincided with a 2.2-fold increased expression of CYP1B1 (P polymorphism in the promoter region of CAT may determine the amount and activity of catalase, which may subsequently regulate the expression of CYP1B1. As a result, both genetic polymorphisms modulate DNA adduct levels in lymphocytes by BaP ex vivo.

  3. Protection by quercetin and quercetin-rich fruit juice against induction of oxidative DNA damage and formation of BPDE-DNA adducts in human lymphocytes

    NARCIS (Netherlands)

    Wilms, L.C.; Hollman, P.C.H.; Boots, A.W.; Kleinjans, J.C.S.

    2005-01-01

    Flavonoids are claimed to protect against cardiovascular disease, certain forms of cancer and ageing, possibly by preventing initial DNA damage. Therefore, we investigated the protective effects of the flavonoid quercetin against the formation of oxidative DNA damage and bulky DNA adducts in human l

  4. Protection by quercetin and quercetin-rich fruit juice against induction of oxidative DNA damage and formation of BPDE-DNA adducts in human lymphocytes

    NARCIS (Netherlands)

    Wilms, L.C.; Hollman, P.C.H.; Boots, A.W.; Kleinjans, J.C.S.

    2005-01-01

    Flavonoids are claimed to protect against cardiovascular disease, certain forms of cancer and ageing, possibly by preventing initial DNA damage. Therefore, we investigated the protective effects of the flavonoid quercetin against the formation of oxidative DNA damage and bulky DNA adducts in human

  5. Biomonitoring of diesel exhaust-exposed workers. DNA and hemoglobin adducts and urinary 1-hydroxypyrene as markers of exposure

    DEFF Research Database (Denmark)

    Nielsen, Per Sabro; Andreassen, Åshild; Farmer, Peter B.;

    1996-01-01

    Diesel exhaust-exposed workers have been shown to have an increased risk of lung cancer. A battery of biomarkers were evaluated for their ability to assess differences in exposure to genotoxic compounds in bus garage workers and mechanics and controls. Lymphocyte DNA adducts were analyzed using...... the 32P-postlabelling method with butanol and P1 enrichment procedures. Hydroxyethylvaline (HOEtVal) adducts in hemoglobin were measured by gas chromatography-mass spectrometry (GC-MS) and 1-hydroxypyrene (HPU) in urine determined using HPLC analysis. The exposed workers had significantly higher levels...... of all three biomarkers compared to the controls. Total DNA adduct levels were 0.84 fmol/micrograms DNA vs 0.26 in controls (butanol) and 0.65 fmol/micrograms DNA vs. 0.08 (P1 nuclease). Median HOEtVal adduct level in exposed workers was 33.3 pmol/g hemoglobin vs. 22.1 in controls. HOEtVal adducts...

  6. Thermolytic 4-methylthio-1-butyl group for phosphate/thiophosphate protection in solid-phase synthesis of DNA oligonucleotides.

    Science.gov (United States)

    Cieślak, Jacek; Grajkowski, Andrzej; Livengood, Victor; Beaucage, Serge L

    2004-04-02

    The thermolabile 4-methylthio-1-butyl phosphate/thiophosphate protecting group for DNA oligonucleotides has been investigated for its potential application to a "heat-driven" process for either oligonucleotide synthesis on diagnostic microarrays or, oppositely, to the large-scale preparation of therapeutic oligonucleotides. The preparation of phosphoramidites 10a-d is straightforward, and the incorporation of these amidites into oligonucleotides via solid-phase techniques proceeds as efficiently as that achieved with 2-cyanoethyl deoxyribonucleoside phosphoramidites. The versatility of the 4-methylthio-1-butyl phosphate/thiophosphate protecting group is exemplified by its facile removal from oligonucleotides upon heating for 30 min at 55 degrees C in an aqueous buffer under neutral conditions or within 2 h at 55 degrees C in concentrated NH(4)OH. The deprotection reaction occurs through an intramolecular cyclodeesterification mechanism leading to the formation of sulfonium salt 18. When mixed with deoxyribonucleosides and N-protected 2'-deoxyribonucleosides or with a model phosphorothioate diester under conditions approximating those of large-scale (>50 mmol) oligonucleotide deprotection reactions, the salt 18 did not significantly alter DNA nucleobases or desulfurize the phosphorothioate diester model to an appreciable extent.

  7. Aromatic DNA adducts and polymorphisms in metabolic genes in healthy adults: findings from the EPIC-Spain cohort.

    Science.gov (United States)

    Agudo, Antonio; Peluso, Marco; Sala, Núria; Capellá, Gabriel; Munnia, Armelle; Piro, Sara; Marín, Fátima; Ibáñez, Raquel; Amiano, Pilar; Tormo, M José; Ardanaz, Eva; Barricarte, Aurelio; Chirlaque, M Dolores; Dorronsoro, Miren; Larrañaga, Nerea; Martínez, Carmen; Navarro, Carmen; Quirós, J Ramón; Sánchez, M José; González, Carlos A

    2009-06-01

    Aromatic compounds such as polycyclic aromatic hydrocarbons, arylamines and heterocyclic amines require metabolic activation to form metabolites able to bind to DNA, a process mediated by polymorphic enzymes. We measured aromatic DNA adducts in white blood cells by the (32)P-post-labelling assay in a sample of 296 healthy adults (147 men and 149 women) from five regions of Spain. We also analyzed functional polymorphisms in the metabolic genes CYP1A1, CYP1A2, EPHX1, GSTM1, GSTT1, NAT2 and SULT1A1. A significant increased level of DNA aromatic adducts was found related to the fast oxidation-hydrolysis phenotype defined by the polymorphism I462V in CYP1A1, the allele A in IVS1-154C>A of CYP1A2 and the combination Tyrosine-Arginine for Y113H and H139R of EPHX1. Geometric means (adducts per 10(-9) normal nucleotides) were 2.17, 4.04 and 6.30 for slow, normal and fast phenotypes, respectively (P-trend = 0.01). Slow acetylation by NAT2 was associated with a significant decrease in adduct level; subjects with slow alleles *5A and *7A/B had in average 1.56 x 10(-9)adducts, as compared with 5.60 for those with normal NAT2 activity (P-value = 0.01). No association was seen with polymorphisms of other metabolic genes such as GSTM1, GSTT1 or SULT1A1. We concluded that the metabolic pathways of oxidation, hydrolysis and acetylation are relevant to the formation of bulky DNA adducts. This could suggest a potential involvement of aromatic compounds in the formation of such adducts; however, given lack of specificity of the post-labeling assay, a firm conclusion cannot be drawn.

  8. Myeloperoxidase - 463A variant reduces benzo(a)pyrene diol epoxide DNA adducts in skin of coal tar treated patients

    Energy Technology Data Exchange (ETDEWEB)

    Rojas, M.; Godschalk, R.; Alexandrov, K.; Cascorbi, I.; Kriek, E.; Ostertag, J.; Van Schooten, F.J.; Bartsch, H. [German Cancer Research Center, Heidelberg (Germany). Div. of Toxicology & Cancer Risk Factors

    2001-07-01

    The skin of atopic dermatitis patients provides an excellent model to study the role of inflammation in benzo(a)pyrene (BaP) activation, since these individuals are often topically treated with ointments containing high concentrations of BaP. The authors determined, by HPLC with fluorescence detection, the BaP diol epoxide (BPDE)-DNA adduct levels in human skin after topical treatment with coal tar and their modulation by the -453G into A myeloperoxidase (MPO) polymorphism, which reduces MPO mRNA expression. The data show for the first time: (i) the in vivo formation of BPDE-DNA adducts in human skin treated with coal tar; (ii) that the MPO-463AA/AG genotype reduced BPDE-DNA adduct levels in human skin.

  9. Crystallization of a member of the recFOR DNA repair pathway, RecO, with and without bound oligonucleotide

    Energy Technology Data Exchange (ETDEWEB)

    Aono, Shelly; Hartsch, Thomas; Schulze-Gahmen, Ursula

    2003-01-22

    RecFOR proteins are important for DNA repair by homologous recombination in bacteria. The RecO protein from Thermus thermophilus was cloned, purified and characterized for its binding to oligonucleotides. The protein was crystallized alone and in complex with a 14-mer oligonucleotide. Both crystal forms grow under different crystallization conditions in the same space group, P3121 or P3221, with almost identical unit cell parameters. Complete data sets were collected to 2.8 Angstrom and 2.5 Angstrom for RecO alone and the RecO-oligonucleotide complex, respectively. Visual comparison of the diffraction patterns between the two crystal forms and calculation of an Rmerge of 33.9 percent on F indicate that one of the crystal forms is indeed a complex of RecO with bound oligonucleotide.

  10. Thermolytic release of covalently linked DNA oligonucleotides and their conjugates from controlled-pore glass at near neutral pH.

    Science.gov (United States)

    Grajkowski, Andrzej; Cieślak, Jacek; Kauffman, Jon S; Duff, Robert J; Norris, Scott; Freedberg, Darón I; Beaucage, Serge L

    2008-08-01

    The functionalization of long chain alkylamine controlled-pore glass (CPG) with a 3-hydroxypropyl-(2-cyanoethyl)thiophosphoryl linker and its conversion to the support 7 has led to the synthesis of DNA oligonucleotides and their 3'- or (3',5')-conjugates. Indeed, CPG support 7 has been successfully employed in the synthesis of both native and fully phosphorothioated DNA 20-mers. Unlike conventional succinylated CPG supports, this distinctively functionalized support allows oligonucleotide deprotection and removal of the deprotection side products to proceed without releasing the oligonucleotide into the aqueous milieu. When freed from deprotection side products, the DNA oligonucleotide is thermolytically released from the support within 2 h under nearly neutral conditions (pH 7.2, 90 degrees C). The quality of these oligonucleotides is comparable to that of identical oligonucleotides synthesized from succinylated CPG supports in terms of shorter than full length oligonucleotide contaminants and overall yields. The versatility of the thermolytic CPG support 7 is further demonstrated by the synthesis of a DNA oligonucleotide (20-mer) and its conjugation with an azido and alkynyl groups at both 5'-and 3'-termini, respectively. The functionality of the (3',5')-heteroconjugated oligonucleotide 18 is verified by its circularization to the DNA oligonucleotide 19 under "click" chemistry conditions.

  11. Enzyme-Free Detection of Mutations in Cancer DNA Using Synthetic Oligonucleotide Probes and Fluorescence Microscopy

    DEFF Research Database (Denmark)

    Miotke, Laura; Maity, Arindam; Ji, Hanlee

    2015-01-01

    microscopy and nucleic acid analogues have been proposed so far. METHODS AND RESULTS: Here we report a novel enzyme-free approach to efficiently detect cancer mutations. This assay includes gene-specific target enrichment followed by annealing to oligonucleotides containing locked nucleic acids (LNAs...... 1000-fold above the potential detection limit. CONCLUSION: Overall, the novel assay we describe could become a new approach to rapid, reliable and enzyme-free diagnostics of cancer or other associated DNA targets. Importantly, stoichiometry of wild type and mutant targets is conserved in our assay...... of methods since they would allow rapid and relatively inexpensive detection of nucleic acids. Modern fluorescence microscopy is having a huge impact on detection of biomolecules at previously unachievable resolution. However, no straightforward methods to detect DNA in a non-enzymatic way using fluorescence...

  12. Time-dependent thermocontrol of the hydrophilic and lipophilic properties of DNA oligonucleotide prodrugs.

    Science.gov (United States)

    Ausín, Cristina; Grajkowski, Andrzej; Cieślak, Jacek; Gapeev, Alexei; Beaucage, Serge L

    2010-12-01

    This unit describes the preparation of alkylthioalkylated and formamidoalkylated alcohols, an amidoalkylated alcohol, a hydroxylalkylated phosphoramidate, and their phosphoramidothioate derivatives, all of which have been identified as heat-sensitive thiophosphate-protecting groups in the development of thermolytic immunostimulatory DNA prodrugs. The alcohols are converted to their deoxyribonucleoside phosphoramidite derivatives, which are then used in the preparation of thermosensitive dinucleoside phosphorothioates. The thiophosphate-protecting groups of these dinucleoside phosphorothioates presumably undergo thermolytic cyclodeesterification at elevated temperature under essentially neutral conditions to release the desired phosphorothioate diester function. On the basis of their thermolytic deprotection kinetics, one can identify those thiophosphate-protecting groups that (i) may be useful for thiophosphate protection of CpG motifs of immunostimulatory DNA oligonucleotides (CpG ODNs); (ii) are suitable for protection of phosphodiester functions flanking the CpG motifs; and (iii) offer adequate protection of terminal phosphodiester functions against ubiquitous extracellular and intracellular exonucleases that may be found in biological environments.

  13. Efficacy and Safety Profile of Tricyclo-DNA Antisense Oligonucleotides in Duchenne Muscular Dystrophy Mouse Model

    Directory of Open Access Journals (Sweden)

    Karima Relizani

    2017-09-01

    Full Text Available Antisense oligonucleotides (AONs hold promise for therapeutic splice-switching correction in many genetic diseases. However, despite advances in AON chemistry and design, systemic use of AONs is limited due to poor tissue uptake and sufficient therapeutic efficacy is still difficult to achieve. A novel class of AONs made of tricyclo-DNA (tcDNA is considered very promising for the treatment of Duchenne muscular dystrophy (DMD, a neuromuscular disease typically caused by frameshifting deletions or nonsense mutations in the gene-encoding dystrophin and characterized by progressive muscle weakness, cardiomyopathy, and respiratory failure in addition to cognitive impairment. Herein, we report the efficacy and toxicology profile of a 13-mer tcDNA in mdx mice. We show that systemic delivery of 13-mer tcDNA allows restoration of dystrophin in skeletal muscles and to a lower extent in the brain, leading to muscle function improvement and correction of behavioral features linked to the emotional/cognitive deficiency. More importantly, tcDNA treatment was generally limited to minimal glomerular changes and few cell necroses in proximal tubules, with only slight variation in serum and urinary kidney toxicity biomarker levels. These results demonstrate an encouraging safety profile for tcDNA, albeit typical of phosphorothiate AONs, and confirm its therapeutic potential for the systemic treatment of DMD patients.

  14. Base-Displaced Intercalated Structure of the N-(2′-Deoxyguanosin-8-yl)-3-aminobenzanthrone DNA Adduct

    Science.gov (United States)

    Politica, Dustin A.; Malik, Chanchal K.; Basu, Ashis K.; Stone, Michael P.

    2016-01-01

    3-Nitrobenzanthrone (3-NBA), an environmental mutagen found in diesel exhaust and a suspected carcinogen, undergoes metabolic reduction followed by reaction with DNA to form aminobenzanthrone (ABA) adducts, with the major alkylation product being N-(2′-deoxyguanosin-8-yl)-3-aminobenzanthrone (C8-dG-ABA). Site-specific synthesis of the C8-dG-ABA adduct in the oligodeoxynucleotide 5'-d(GTGCXTGTTTGT)-3':5'-d(ACAAACACGCAC)-3'; X = C8-dG-ABA adduct, including codons 272-275 of the p53 gene, has allowed for investigation into the structural and thermodynamic properties of this adduct. The conformation of the C8-dG-ABA adduct was determined using NMR spectroscopy and was refined using molecular dynamics (MD) calculations restrained by experimentally determined interproton distance restraints obtained from NOE experiments. The refined structure revealed that the C8-dG-ABA adduct formed a base-displaced intercalated conformation. The adducted guanine was shifted into the syn conformation about the glycosidic bond. The 5'- and 3'-neighboring base pairs remained intact. While this facilitated π-stacking interactions between the ABA moiety and neighboring bases, the thermal melting temperature (Tm) of the adduct-containing duplex showed a decrease of 11 °C as compared to the corresponding unmodified oligodeoxynucleotide duplex. Overall, in this sequence, the base-displaced intercalated conformation of the C8-dG-ABA lesion bears similarity to structures of other arylamine C8-dG adducts. However, in this sequence, the base-displaced intercalated conformation for the C8-dG-ABA adduct differs from the conformation of the N2-dG-ABA adduct reported by de los Santos and co-workers, which oriented in the minor groove towards the 5' end of the duplex, with the modified guanine remaining in the anti conformation about the glyosidic torsion angle, and the complementary base remaining within the duplex. The results are discussed in relationship to differences between the C8-dG-ABA and

  15. Safrole-DNA adducts in tissues from esophageal cancer patients: clues to areca-related esophageal carcinogenesis.

    Science.gov (United States)

    Lee, Jang-Ming; Liu, Tsung-Yung; Wu, Deng-Chyang; Tang, Hseau-Chung; Leh, Julie; Wu, Ming-Tsang; Hsu, Hsao-Hsun; Huang, Pei-Ming; Chen, Jin-Shing; Lee, Chun-Jean; Lee, Yung-Chie

    2005-01-01

    Epidemiological studies have demonstrated that areca quid chewing can be an independent risk factor for developing esophageal cancer. However, no studies are available to elucidate the mechanisms of how areca induces carcinogenesis in the esophagus. Since the areca nut in Taiwan contains a high concentration of safrole, a well-known carcinogenic agent, we analyzed safrole-DNA adducts by the 32P-postlabelling method in tissue specimens from esophageal cancer patients. In total, we evaluated 47 patients with esophageal cancer (16 areca chewers and 31 non-chewers) who underwent esophagectomy at the National Taiwan University Hospital between 1996 and 2002. Of the individuals with a history of habitual areca chewing (14 cigarette smokers and two non-smokers), one of the tumor tissue samples and five of the normal esophageal mucosa samples were positive for safrole-DNA adducts. All patients positive for safrole-DNA adducts were also cigarette smokers. Such adducts could not be found in patients who did not chew areca, irrespective of their habits of alcohol consumption or cigarette smoking (psafrole was also tested in vitro in three esophageal cell lines and four cultures of primary esophageal keratinocytes. In two of the esophageal keratinocyte cultures, adduct formation was increased by treatment with safrole after induction of cytochrome P450 by 3-methyl-cholanthrene. This paper provides the first observation of how areca induces esophageal carcinogenesis, i.e., through the genotoxicity of safrole, a component of the areca juice.

  16. Verification, Dosimetry and Biomonitoring of Mustard Gas Exposure via Immunochemical Detection of Mustard Gas Adducts to DNA and Proteins

    Science.gov (United States)

    1991-12-01

    11.11.2. The samples resulting from the various treatments were tested in the competitive ELISA . Treatment Vih alkli Single-stranded calf-thymus DNA...exposure, Biomonitoring, Verification, Immunochemical detection, Competitive ELISA , Interstrand DNA crossslinking, Alkaline elution. Monoclonal antibodies...material at 50 ng per well. A competitive ELISA was developed in which mustard gas adducts to DNA could be detected with a minimum detectable amount of a few

  17. Sequence-specific binding and cleavage of duplex DNA by a radioiodinated, intercalator-linked, triplex-forming oligonucleotide

    Energy Technology Data Exchange (ETDEWEB)

    Orson, Frank M.; McShan, W. Michael; Kinsey, Berma M

    1996-05-01

    Applications of oligodeoxynucleotides to modulate gene expression have been the subject of much recent research. We have sought to develop a method to permanently inactivate a gene, or potentially kill cells containing abnormal genes. In this report, we show that a DNA intercalator conjugated to a triplex-forming oligonucleotide can be labeled with an Auger electron emitting radioisotope, can cleave its duplex DNA target, and can specifically bind the target sequence contained in a total of 10 kilobases of irrelevant DNA.

  18. Biomarkers for exposure to ambient air pollution - Comparison of carcinogen-DNA adduct levels with other exposure markers and markers for oxidative stress

    DEFF Research Database (Denmark)

    Autrup, Herman; Daneshvar, Bahram; Dragsted, Lars Ove;

    1999-01-01

    Human exposure to genotoxic compounds present in ambient air has been studied using selected biomarkers in nonsmoking Danish bus drivers and postal workers. A large interindividual variation in biomarker levels was observed. Significantly higher levels of bulky carcinogen-DNA adducts (75.42 adducts.......96 nmol/ml plasma), and polycyclic aromatic hydrocarbon (PAH)-albumin adduct (3.38 fmol/mu g albumin) were observed in the suburban group. The biomarker levels in postal workers were similar to the levels in suburban bus drivers. In the combined group of bus drivers and postal workers, negative...... correlations were observed between bulky carcinogen-DNA adduct and PAM-albumin levels (p = 0.005), and between DNA adduct and gamma-glutamyl semialdehyde (GGS) in hemoglobin (p = 0.11). Highly significant correlations were found between PAM-albumin adducts and AAS in plasma (r = 0.001) and GGS in hemoglobin (p...

  19. Kinetic analysis of Yersinia pestis DNA adenine methyltransferase activity using a hemimethylated molecular break light oligonucleotide.

    Directory of Open Access Journals (Sweden)

    Robert J Wood

    Full Text Available BACKGROUND: DNA adenine methylation plays an important role in several critical bacterial processes including mismatch repair, the timing of DNA replication and the transcriptional control of gene expression. The dependence of bacterial virulence on DNA adenine methyltransferase (Dam has led to the proposal that selective Dam inhibitors might function as broad spectrum antibiotics. METHODOLOGY/PRINCIPAL FINDINGS: Herein we report the expression and purification of Yersinia pestis Dam and the development of a continuous fluorescence based assay for DNA adenine methyltransferase activity that is suitable for determining the kinetic parameters of the enzyme and for high throughput screening against potential Dam inhibitors. The assay utilised a hemimethylated break light oligonucleotide substrate containing a GATC methylation site. When this substrate was fully methylated by Dam, it became a substrate for the restriction enzyme DpnI, resulting in separation of fluorophore (fluorescein and quencher (dabcyl and therefore an increase in fluorescence. The assays were monitored in real time using a fluorescence microplate reader in 96 well format and were used for the kinetic characterisation of Yersinia pestis Dam, its substrates and the known Dam inhibitor, S-adenosylhomocysteine. The assay has been validated for high throughput screening, giving a Z-factor of 0.71+/-0.07 indicating that it is a sensitive assay for the identification of inhibitors. CONCLUSIONS/SIGNIFICANCE: The assay is therefore suitable for high throughput screening for inhibitors of DNA adenine methyltransferases and the kinetic characterisation of the inhibition.

  20. Assessment of the cellular internalization of thermolytic phosphorothioate DNA oligonucleotide prodrugs.

    Science.gov (United States)

    Jain, Harsh V; Takeda, Kazuyo; Tami, Cecilia; Verthelyi, Daniela; Beaucage, Serge L

    2013-10-15

    The bioactivity of a CpG-containing phosphorothioate DNA oligonucleotide with thermolytic 2-(N-formyl-N-methylamino)ethyl (fma) thiophosphate groups in mice led us to investigate the parameters affecting the internalization of these thermosensitive DNA prodrugs in various cell lines. Flow cytometry and confocal microscopy analyses indicate that 5'-fluoresceinated fma-phosphorothioate DNA sequences are poorly internalized in Vero, HeLa and GC-2 cells. However, when four fma-thiophosphate groups of a 15-nucleotide long oligothymidylate prodrug are replaced with 3-(N,N-dimethylamino)prop-1-yl thiophosphate functions, internalization of the positively charged prodrug, under physiological conditions, increased fourfold in HeLa and 40-fold in Vero or GC-2 cells. No cytotoxic effects are observed in Vero cells even at an extracellular prodrug concentration of 50 μM over a period of 72 h. Confocal microscopy studies show that internalization of the positively charged oligothymidylate prodrug in Vero cells is time-dependent with early trafficking of the DNA sequence through endosomal vesicles and, eventually, to the nucleus of the cells. Thus, the incorporation of four 3-(N,N-dimethylamino)prop-1-yl thiophosphate groups into thermosentive fma-phosphorothioate DNA prodrugs is an attractive strategy for efficient cellular internalization of these nucleic acid-based drugs for potential therapeutic indications.

  1. Environmental exposure of the mouse germ line: DNA adducts in spermatozoa and formation of de novo mutations during spermatogenesis.

    Directory of Open Access Journals (Sweden)

    Ann-Karin Olsen

    Full Text Available BACKGROUND: Spermatozoal DNA damage is associated with poor sperm quality, disturbed embryonic development and early embryonic loss, and some genetic diseases originate from paternal de novo mutations. We previously reported poor repair of bulky DNA-lesions in rodent testicular cells. METHODOLOGY/PRINCIPAL FINDINGS: We studied the fate of DNA lesions in the male germ line. B[a]PDE-N(2-dG adducts were determined by liquid chromatography-tandem mass spectrometry, and de novo mutations were measured in the cII-transgene, in Big Blue mice exposed to benzo[a]pyrene (B[a]P; 3 x 50 mg/kg bw, i.p.. Spermatozoa were harvested at various time-points following exposure, to study the consequences of exposure during the different stages of spermatogenesis. B[a]PDE-N(2-dG adducts induced by exposure of spermatocytes or later stages of spermatogenesis persisted at high levels in the resulting spermatozoa. Spermatozoa originating from exposed spermatogonia did not contain DNA adducts; however de novo mutations had been induced (p = 0.029, specifically GC-TA transversions, characteristic of B[a]P mutagenesis. Moreover, a specific spectrum of spontaneous mutations was consistently observed in spermatozoa. CONCLUSIONS/SIGNIFICANCE: A temporal pattern of genotoxic consequences following exposure was identified, with an initial increase in DNA adduct levels in spermatozoa, believed to influence fertility, followed by induction of germ line de novo mutations with possible consequences for the offspring.

  2. Structural and energetic characterization of the major DNA adduct formed from the food mutagen ochratoxin A in the NarI hotspot sequence: influence of adduct ionization on the conformational preferences and implications for the NER propensity.

    Science.gov (United States)

    Sharma, Purshotam; Manderville, Richard A; Wetmore, Stacey D

    2014-10-01

    The nephrotoxic food mutagen ochratoxin A (OTA) produces DNA adducts in rat kidneys, the major lesion being the C8-linked-2'-deoxyguanosine adduct (OTB-dG). Although research on other adducts stresses the importance of understanding the structure of the associated adducted DNA, site-specific incorporation of OTB-dG into DNA has yet to be attempted. The present work uses a robust computational approach to determine the conformational preferences of OTB-dG in three ionization states at three guanine positions in the NarI recognition sequence opposite cytosine. Representative adducted DNA helices were derived from over 2160 ns of simulation and ranked via free energies. For the first time, a close energetic separation between three distinct conformations is highlighted, which indicates OTA-adducted DNA likely adopts a mixture of conformations regardless of the sequence context. Nevertheless, the preferred conformation depends on the flanking bases and ionization state due to deviations in discrete local interactions at the lesion site. The structural characteristics of the lesion thus discerned have profound implications regarding its repair propensity and mutagenic outcomes, and support recent experiments suggesting the induction of double-strand breaks and deletion mutations upon OTA exposure. This combined structural and energetic characterization of the OTB-dG lesion in DNA will encourage future biochemical experiments on this potentially genotoxic lesion.

  3. DNA damage induced by the environmental carcinogen butadiene: identification of a diepoxybutane-adenine adduct and its detection by 32P-postlabelling.

    Science.gov (United States)

    Leuratti, C; Jones, N J; Marafante, E; Kostiainen, R; Peltonen, K; Waters, R

    1994-09-01

    To date only a few studies have been undertaken on DNA adducts formed by epoxybutene (EB) and diepoxybutane (DEB), the two active metabolites of 1,3-butadiene. Our interests have focused on further investigating DNA alkylation by the two epoxides, especially in relation to the development of a method for human biomonitoring. Here, following the reaction of deoxyadenosine monophosphate and poly(dA-dT)(dA-dT) with DEB and subsequent HPLC, we have identified an adenine adduct. MS analyses indicate the structure of an adenine adducted by DEB at the N6 position. A HPLC/32P-postlabelling method was developed for its measurement in DNA samples and the adduct was detected in calf thymus DNA and DNA from Chinese hamster ovary cells exposed to DEB. The 100% labelling efficiency during postlabelling, the amount of the adduct and its elution before the normal nucleotides during HPLC suggest it could be a suitable indicator of BUT exposure.

  4. Susceptibility factors and DNA adducts in peripheral blood mononuclear cells of aluminium smelter workers exposed to polycyclic aromatic hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Tuominen, Rainer; Warholm, Margareta; Rannug, Agneta [Institute of Environmental Medicine, Karolinska Institutet, Stockholm (Sweden); National Institute for Working Life, Stockholm (Sweden); Baranczewski, Pawel; Moeller, Lennart [Center for Nutrition and Toxicology, Karolinska Institutet, Huddinge (Sweden); Hagmar, Lars [Department of Occupational and Environmental Medicine, Lund University Hospital, (Sweden)

    2002-04-01

    Formation of DNA adducts as a result of exposure to polycyclic aromatic hydrocarbons (PAH) was studied in 98 potroom workers from an aluminium smelting plant and in 55 blue-collar workers without occupational PAH exposure. DNA from peripheral blood mononuclear cells (PBMC) was used for quantitation of individual PAH-DNA adducts by {sup 32}P-postlabelling/high performance liquid chromatography (HPLC) analysis. Four individual DNA adducts (denoted A, B, C and D) were quantified in 141 of a total of 153 subjects. Genetic polymorphisms for cytochrome P-4501A1 (CYP1A1), microsomal epoxide hydrolase, N-acetyltransferase 2, glutathione transferases M1, P1 and T1 (GSTM1, GSTP1 and GSTT1, respectively) and NAD(P)H: quinone oxidoreductase 1 (NQO1) were analysed. For 52 subjects, analysis of mRNA inducibility of CYP1A1 was performed. No statistically significant differences in the levels of total or individual DNA adducts A, C and D were found between potroom workers and control subjects. All potroom workers and the subgroup of potroom workers who reported to never/sometimes use personal respiratory protection (n=72) were found to have a significantly higher likelihood of having high levels of adduct B than control subjects [odds ratio (OR) =3.4 with 95% confidence interval (CI) of 1.3-9.2, and OR=4.2 with 95% CI 1.6-11.5, respectively]. In the subgroup, levels of adducts A and B were found to be significantly higher among workers with employment time of less than 6 months (n=5). Also, the levels of the individual DNA adducts were to some extent modified by genetic polymorphisms in CYP1A1, GSTM1, GSTP1 and NQO1 and by CYP1A1 inducibility. In conclusion, levels of adduct B, identified by {sup 32}P-postlabelling/HPLC methodology as an indicator of PAH exposure in aluminium production, were modified by the use of respiratory protection, length of employment and genetic polymorphisms. (orig.)

  5. Increased micronuclei and bulky DNA adducts in cord blood after maternal exposures to traffic-related air pollution

    DEFF Research Database (Denmark)

    Pedersen, M.; Wichmann, J.; Autrup, H.

    2009-01-01

    Exposure to traffic-related air pollution in urban environment is common and has been associated with adverse human health effects. In utero exposures that result in DNA damage may affect health later in life. Early effects of maternal and in utero exposures to traffic-related air pollution were...... for potential confounders and effect modifiers. For the first time increased bulky DNA adducts and MN in cord blood after maternal exposures to traffic-related air pollution are found, demonstrating that these transplacental environmental exposures induce DNA damage in newborns. Given that increased DNA damage...... umbilical cords, concurrently collected at the time of planned Caesarean section. Modeled residential traffic density, a proxy measure of traffic-related air pollution exposures, was validated by indoor levels of nitrogen dioxide and polycyclic aromatic hydrocarbons in 42 non-smoking homes. DNA adduct...

  6. Neighborhood socioeconomic status modifies the association between individual smoking status and PAH-DNA adduct levels in prostate tissue.

    Science.gov (United States)

    Rundle, Andrew; Richards, Catherine; Neslund-Dudas, Christine; Tang, Deliang; Rybicki, Benjamin A

    2012-06-01

    Interactions between smoking and neighborhood-level socioeconomic status (SES) as risk factors for higher polycyclic aromatic hydrocarbon (PAH) DNA adduct levels in prostate tissue were investigated. PAH-DNA adducts were measured by immunohistochemistry with staining intensity measured in optical density units by semiquantitative absorbance image analysis in tumor adjacent tissue from 400 prostatectomy specimens from the Henry Ford Health System in Detroit. For each subject, their U.S. Census tract of residence was classified as being of higher or lower SES using the median value of the distribution of the proportion of tract residents with a high-school education. Generalized estimating equation models were used to assess interactions between neighborhood-level SES and smoking status, adjusting for race, age, education level, tumor volume, primary Gleason grade and prostate specific antigen (PSA) at diagnosis. There was a statistical interaction (P = 0.004) between tract-level SES and smoking status. In lower SES tracts smoking status was not associated with adduct staining, but in higher SES tracts adduct staining intensity was 13% (P = 0.01) higher in ever-smokers as compared to never-smokers. Among never-smokers, living in a lower SES tract was associated with a 25% higher mean staining intensity (P adduct levels in prostate tissue.

  7. DNA Polymerases η and ζ Combine to Bypass O(2)-[4-(3-Pyridyl)-4-oxobutyl]thymine, a DNA Adduct Formed from Tobacco Carcinogens.

    Science.gov (United States)

    Gowda, A S Prakasha; Spratt, Thomas E

    2016-03-21

    4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) and N'-nitrosonornicotine (NNN) are important human carcinogens in tobacco products. They are metabolized to produce a variety 4-(3-pyridyl)-4-oxobutyl (POB) DNA adducts including O(2)-[4-(3-pyridyl)-4-oxobut-1-yl]thymidine (O(2)-POB-dT), the most abundant POB adduct in NNK- and NNN-treated rodents. To evaluate the mutagenic properties of O(2)-POB-dT, we measured the rate of insertion of dNTPs opposite and extension past O(2)-POB-dT and O(2)-Me-dT by purified human DNA polymerases η, κ, ι, and yeast polymerase ζ in vitro. Under conditions of polymerase in excess, polymerase η was most effective at the insertion of dNTPs opposite O(2)-alkyl-dTs. The time courses were biphasic suggesting the formation of inactive DNA-polymerase complexes. The kpol parameter was reduced approximately 100-fold in the presence of the adduct for pol η, κ, and ι. Pol η was the most reactive polymerase for the adducts due to a higher burst amplitude. For all three polymerases, the nucleotide preference was dATP > dTTP ≫ dGTP and dCTP. Yeast pol ζ was most effective in bypassing the adducts; the kcat/Km values were reduced only 3-fold in the presence of the adducts. The identity of the nucleotide opposite the O(2)-alkyl-dT did not significantly affect the ability of pol ζ to bypass the adducts. The data support a model in which pol η inserts ATP or dTTP opposite O(2)-POB-dT, and then, pol ζ extends past the adduct.

  8. Efficient SMN Rescue following Subcutaneous Tricyclo-DNA Antisense Oligonucleotide Treatment

    Directory of Open Access Journals (Sweden)

    Valérie Robin

    2017-06-01

    Full Text Available Spinal muscular atrophy (SMA is a recessive disease caused by mutations in the SMN1 gene, which encodes the protein survival motor neuron (SMN, whose absence dramatically affects the survival of motor neurons. In humans, the severity of the disease is lessened by the presence of a gene copy, SMN2. SMN2 differs from SMN1 by a C-to-T transition in exon 7, which modifies pre-mRNA splicing and prevents successful SMN synthesis. Splice-switching approaches using antisense oligonucleotides (AONs have already been shown to correct this SMN2 gene transition, providing a therapeutic avenue for SMA. However, AON administration to the CNS presents additional hurdles. In this study, we show that systemic delivery of tricyclo-DNA (tcDNA AONs in a type III SMA mouse augments retention of exon 7 in SMN2 mRNA both in peripheral organs and the CNS. Mild type III SMA mice were selected as opposed to the severe type I model in order to test tcDNA efficacy and their ability to enter the CNS after maturation of the blood brain barrier (BBB. Furthermore, subcutaneous treatment significantly improved the necrosis phenotype and respiratory function. In summary, our data support that tcDNA oligomers effectively cross the blood-brain barrier and offer a promising systemic alternative for treating SMA.

  9. Experimental design, modeling and optimization of polyplex formation between DNA oligonucleotides and branched polyethylenimine.

    Science.gov (United States)

    Clima, Lilia; Ursu, Elena L; Cojocaru, Corneliu; Rotaru, Alexandru; Barboiu, Mihail; Pinteala, Mariana

    2015-09-28

    The complexes formed by DNA and polycations have received great attention owing to their potential application in gene therapy. In this study, the binding efficiency between double-stranded oligonucleotides (dsDNA) and branched polyethylenimine (B-PEI) has been quantified by processing of the images captured from the gel electrophoresis assays. The central composite experimental design has been employed to investigate the effects of controllable factors on the binding efficiency. On the basis of experimental data and the response surface methodology, a multivariate regression model has been constructed and statistically validated. The model has enabled us to predict the binding efficiency depending on experimental factors, such as concentrations of dsDNA and B-PEI as well as the initial pH of solution. The optimization of the binding process has been performed using simplex and gradient methods. The optimal conditions determined for polyplex formation have yielded a maximal binding efficiency close to 100%. In order to reveal the mechanism of complex formation at the atomic-scale, a molecular dynamic simulation has been carried out. According to the computation results, B-PEI amine hydrogen atoms have interacted with oxygen atoms from dsDNA phosphate groups. These interactions have led to the formation of hydrogen bonds between macromolecules, stabilizing the polyplex structure.

  10. Assessment of Interactions between PAH Exposure and Genetic Polymorphisms on PAH-DNA Adducts in African American, Dominican, and Caucasian Mothers and Newborns

    OpenAIRE

    Wang, Shuang; Chanock, Stephen; Tang, Deliang; Li, Zhigang; Jedrychowski, Wieslaw; Perera, Frederica P

    2008-01-01

    Polycyclic aromatic hydrocarbons (PAH) are widespread pollutants commonly found in air, food, and drinking water. Benzo[a]pyrene is a well-studied representative PAH found in air from fossil fuel combustion and a transplacental carcinogen experimentally. PAHs bind covalently to DNA to form DNA adducts, an indicator of DNA damage, and an informative biomarker of potential cancer risk. Associations between PAH-DNA adduct levels and both cancer risk and developmental deficits have been seen in p...

  11. Intravenous toxicokinetics of sulfur mustard and its DNA-adducts in the hairless guinea pig and marmoset

    NARCIS (Netherlands)

    Langenberg, J.P.; Spruit, W.E.T.; Kuijpers, W.C.; Mars, R.H.; Helden, H.P.M. van; Schans, G.P. van der; Benschop, H.P.

    2009-01-01

    ln order to provide a quantitative basis for pretreatment and therapy of intoxications with sulfur mustard the toxicokinetics of this agent as well as its major DNA-adducts are being studied in male hairless guinea pigs for the intravenous, respiratory and percutaneous routes. A highly sensitive met

  12. Creating context for the use of DNA adduct data in cancer risk assessment: I. Proposed framework for data organization *

    Science.gov (United States)

    The assessment of human cancer risk from chemical exposure requires the integration of diverse types of data. Such data involve effects at the cell and tissue levels. This report focuses on the specific utility of one type of data, namely DNA adducts. Emphasis is placed on the ap...

  13. Titanium dioxide nanoparticles induce oxidative stress and DNA-adduct formation but not DNA-breakage in human lung cells

    Directory of Open Access Journals (Sweden)

    Schins Roel PF

    2009-06-01

    Full Text Available Abstract Titanium dioxide (TiO2, also known as titanium (IV oxide or anatase, is the naturally occurring oxide of titanium. It is also one of the most commercially used form. To date, no parameter has been set for the average ambient air concentration of TiO2 nanoparticles (NP by any regulatory agency. Previously conducted studies had established these nanoparticles to be mainly non-cyto- and -genotoxic, although they had been found to generate free radicals both acellularly (specially through photocatalytic activity and intracellularly. The present study determines the role of TiO2-NP (anatase, ∅ in vitro. For comparison, iron containing nanoparticles (hematite, Fe2O3, ∅ 2-NP did not induce DNA-breakage measured by the Comet-assay in both cell types. Generation of reactive oxygen species (ROS was measured acellularly (without any photocatalytic activity as well as intracellularly for both types of particles, however, the iron-containing NP needed special reducing conditions before pronounced radical generation. A high level of DNA adduct formation (8-OHdG was observed in IMR-90 cells exposed to TiO2-NP, but not in cells exposed to hematite NP. Our study demonstrates different modes of action for TiO2- and Fe2O3-NP. Whereas TiO2-NP were able to generate elevated amounts of free radicals, which induced indirect genotoxicity mainly by DNA-adduct formation, Fe2O3-NP were clastogenic (induction of DNA-breakage and required reducing conditions for radical formation.

  14. Phototriggered DNA hairpin formation in a stilbenediether-linked bis(oligonucleotide) conjugate

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, F.D.; Liu, X.

    1999-12-22

    Photochemical switches have found numerous biological applications, but have received only limited application to the control of DNA base pairing processes. The authors report here that a hairpin-forming bis(oligonucleotide) conjugate possessing a stilbenediether linker undergoes reversible trans {leftrightarrow} cis photoisomerization when both the cis and trans conjugates are in the random coil conformation, but undergoes one-way cis {r{underscore}arrow} trans isomerization when both are in hairpin conformations. Thus base-pairing inhibits trans {r{underscore}arrow} cis but not cis {r{underscore}arrow} trans isomerization. Moreover, photoisomerization of the random coil cis conjugate under conditions where the trans conjugate forms a stable hairpin results in phototriggered base pairing. The use of base pairing to effect one-way photoisomerization and of photoisomerization to effect base pairing are without precedent.

  15. Development of bis-locked nucleic acid (bisLNA) oligonucleotides for efficient invasion of supercoiled duplex DNA

    DEFF Research Database (Denmark)

    Moreno, Pedro M D; Geny, Sylvain; Pabon, Y Vladimir;

    2013-01-01

    In spite of the many developments in synthetic oligonucleotide (ON) chemistry and design, invasion into double-stranded DNA (DSI) under physiological salt and pH conditions remains a challenge. In this work, we provide a new ON tool based on locked nucleic acids (LNAs), designed for strand invasi...

  16. Polycyclic aromatic hydrocarbon-DNA adducts in beluga whales from the Arctic.

    Science.gov (United States)

    Mathieu, A; Payne, J F; Fancey, L L; Santella, R M; Young, T L

    1997-05-01

    The Arctic is still relatively pristine in nature, but it is also vulnerable to pollution because contaminants originating from midlatitudes are transported to the Arctic by atmospheric processes, ocean currents, and rivers (Muir et al., 1992). Recognition of this fact of Arctic vulnerability has resulted in a Declaration on the Protection of the Arctic Environment by eight Arctic countries. A manifest aim of this declaration is to develop an Arctic Monitoring and Assessment Program. We report here on the presence of measurable levels of polycyclic aromatic hydrocarbon-DNA adducts, including relatively high levels in Arctic beluga (Delphinapterus leucas). These results lend support to the value of developing biological assessment programs for Arctic wildlife.

  17. Increased micronuclei and bulky DNA adducts in cord blood after maternal exposures to traffic-related air pollution

    DEFF Research Database (Denmark)

    Pedersen, M.; Wichmann, J.; Autrup, H.

    2009-01-01

    umbilical cords, concurrently collected at the time of planned Caesarean section. Modeled residential traffic density, a proxy measure of traffic-related air pollution exposures, was validated by indoor levels of nitrogen dioxide and polycyclic aromatic hydrocarbons in 42 non-smoking homes. DNA adduct...... levels were similar and positively correlated in maternal and cord blood (1.40 vs. 1.37 n/10(8) nucleotides; r = 0.99; p ... for potential confounders and effect modifiers. For the first time increased bulky DNA adducts and MN in cord blood after maternal exposures to traffic-related air pollution are found, demonstrating that these transplacental environmental exposures induce DNA damage in newborns. Given that increased DNA damage...

  18. The long persistence of pyrrolizidine alkaloid-derived DNA adducts in vivo: kinetic study following single and multiple exposures in male ICR mice.

    Science.gov (United States)

    Zhu, Lin; Xue, Junyi; Xia, Qingsu; Fu, Peter P; Lin, Ge

    2017-02-01

    Pyrrolizidine alkaloid (PA)-containing plants are widespread in the world and the most common poisonous plants affecting livestock, wildlife, and humans. Our previous studies demonstrated that PA-derived DNA adducts can potentially be a common biological biomarker of PA-induced liver tumor formation. In order to validate the use of these PA-derived DNA adducts as a biomarker, it is necessary to understand the basic kinetics of the PA-derived DNA adducts formed in vivo. In this study, we studied the dose-dependent response and kinetics of PA-derived DNA adduct formation and removal in male ICR mice orally administered with a single dose (40 mg/kg) or multiple doses (10 mg/kg/day) of retrorsine, a representative carcinogenic PA. In the single-dose exposure, the PA-derived DNA adducts exhibited dose-dependent linearity and persisted for up to 4 weeks. The removal of the adducts following a single-dose exposure to retrorsine was biphasic with half-lives of 9 h (t 1/2α) and 301 h (~12.5 days, t 1/2β). In the 8-week multiple exposure study, a marked accumulation of PA-derived DNA adducts without attaining a steady state was observed. The removal of adducts after the multiple exposure also demonstrated a biphasic pattern but with much extended half-lives of 176 h (~7.33 days, t 1/2α) and 1736 h (~72.3 days, t 1/2β). The lifetime of PA-derived DNA adducts was more than 8 weeks following the multiple-dose treatment. The significant persistence of PA-derived DNA adducts in vivo supports their role in serving as a biomarker of PA exposure.

  19. Comparison of mutagenicity and calf thymus DNA adducts formed by the particulate and semivolatile fractions of vehicle exhausts.

    Science.gov (United States)

    Pohjola, Sanna K; Lappi, Maija; Honkanen, Markku; Savela, Kirsti

    2003-01-01

    In this study we compared the ability of extractable organic material from particulate and semivolatile fractions of gasoline emission to induce mutations in bacteria and form adducts with calf thymus (CT) DNA with corresponding data obtained from diesel exhaust. Exhaust particles from gasoline-powered passenger cars were collected on filters and semivolatile compounds were collected on polyurethane foam (PUF). The mutagenicity of the soluble organic fraction (SOF) was determined in Salmonella typhimurium strain TA98 and the DNA binding of aromatic compounds in the extracts was assessed by in vitro incubations with CT DNA and rat liver S9 (oxidative activation) or xanthine oxidase (reductive activation) followed by butanol-enhanced (32)P-postlabeling analysis. Semivolatile fractions of gasoline emission collected on PUF formed more CT DNA adducts than filter extracts under all reaction conditions, but showed a lower mutagenic potential than the corresponding particulate samples. This suggests that the capacity of PUF to collect exhaust particle-derived compounds and/or the efficiency of xanthine oxidase and enzymes in the rat liver S9 to activate these compounds to DNA binding metabolites was higher than expected. Gasoline extracts, benzo[a]pyrene and diesel particulate matter (SRM 1650) formed more S9-mediated DNA adducts as their dose increased, although a linear dose-response was not observed for the gasoline exhausts. Lower concentrations of gasoline and diesel extracts bound to DNA with greater efficiency than did 8-fold higher doses, suggesting complex interactions and/or an inhibition of S9 enzyme activities by the high doses. Diesel extracts formed higher levels of adducts than gasoline extracts, especially with the reductive activation system, suggesting that diesel extracts contain high levels of nitro-polycyclic aromatic hydrocarbons (nitro-PAHs). The higher direct-acting Salmonella mutagenicity in diesel extracts in comparison with gasoline extracts is

  20. Targeting duplex DNA with chimeric α,β-triplex-forming oligonucleotides

    Science.gov (United States)

    Kolganova, N. A.; Shchyolkina, A. K.; Chudinov, A. V.; Zasedatelev, A. S.; Florentiev, V. L.; Timofeev, E. N.

    2012-01-01

    Triplex-directed DNA recognition is strictly limited by polypurine sequences. In an attempt to address this problem with synthetic biology tools, we designed a panel of short chimeric α,β-triplex-forming oligonucleotides (TFOs) and studied their interaction with fluorescently labelled duplex hairpins using various techniques. The hybridization of hairpin with an array of chimeric probes suggests that recognition of double-stranded DNA follows complicated rules combining reversed Hoogsteen and non-canonical homologous hydrogen bonding. In the presence of magnesium ions, chimeric TFOs are able to form highly stable α,β-triplexes, as indicated by native gel-electrophoresis, on-array thermal denaturation and fluorescence-quenching experiments. CD spectra of chimeric triplexes exhibited features typically observed for anti-parallel purine triplexes with a GA or GT third strand. The high potential of chimeric α,β-TFOs in targeting double-stranded DNA was demonstrated in the EcoRI endonuclease protection assay. In this paper, we report, for the first time, the recognition of base pair inversions in a duplex by chimeric TFOs containing α-thymidine and α-deoxyguanosine. PMID:22641847

  1. Quantitation of the DNA Adduct of Semicarbazide in Organs of Semicarbazide-Treated Rats by Isotope-Dilution Liquid Chromatography-Tandem Mass Spectrometry: A Comparative Study with the RNA Adduct.

    Science.gov (United States)

    Wang, Yinan; Wong, Tin-Yan; Chan, Wan

    2016-09-19

    Semicarbazide is a widespread food contaminant that is produced by multiple pathways. However, the toxicity of semicarbazide to human health remains unclear. Using a highly accurate and sensitive isotope-dilution liquid chromatography-tandem mass spectrometry method, we identified and quantitated in this study for the first time the DNA and RNA adduct of semicarbazide in DNA/RNA isolated from the internal organs of semicarbazide-exposed rats. The analysis revealed a dose-dependent formation of the adducts in the internal organs of the semicarbazide-dosed rats and with the highest adduct levels identified in the stomach and small intestine. Furthermore, results showed significantly higher levels of the RNA adduct (4.1-7.0 times) than that of the DNA adducts. By analyzing DNA/RNA samples isolated from rat organs in semicarbazide-dosed rats at different time points postdosing, the adduct stability in vivo was also investigated. These findings suggest that semicarbazide could have exerted its toxicity by affecting both the transcription and translation processes of the cell.

  2. Assembly of Designed Oligonucleotides: a useful tool in synthetic biology for creating high-quality combinatorial DNA libraries.

    Science.gov (United States)

    Acevedo-Rocha, Carlos G; Reetz, Manfred T

    2014-01-01

    The method dubbed Assembly of Designed Oligonucleotides (ADO) is a powerful tool in synthetic biology to create combinatorial DNA libraries for gene, protein, metabolic, and genome engineering. In directed evolution of proteins, ADO benefits from using reduced amino acid alphabets for saturation mutagenesis and/or DNA shuffling, but all 20 canonical amino acids can be also used as building blocks. ADO is performed in a two-step reaction. The first involves a primer-free, polymerase cycling assembly or overlap extension PCR step using carefully designed overlapping oligonucleotides. The second step is a PCR amplification using the outer primers, resulting in a high-quality and bias-free double-stranded DNA library that can be assembled with other gene fragments and/or cloned into a suitable plasmid subsequently. The protocol can be performed in a few hours. In theory, neither the length of the DNA library nor the number of DNA changes has any limits. Furthermore, with the costs of synthetic DNA dropping every year, after an initial investment is made in the oligonucleotides, these can be exchanged for alternative ones with different sequences at any point in the process, fully exploiting the potential of creating highly diverse combinatorial libraries. In the example chosen here, we show the construction of a high-quality combinatorial ADO library targeting sixteen different codons simultaneously with nonredundant degenerate codons encoding various reduced alphabets of four amino acids along the heme region of the monooxygenase P450-BM3.

  3. Red wine consumption is inversely associated with 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine-DNA adduct levels in prostate.

    Science.gov (United States)

    Rybicki, Benjamin A; Neslund-Dudas, Christine; Bock, Cathryn H; Nock, Nora L; Rundle, Andrew; Jankowski, Michelle; Levin, Albert M; Beebe-Dimmer, Jennifer; Savera, Adnan T; Takahashi, Satoru; Shirai, Tomoyuki; Tang, Deliang

    2011-10-01

    In humans, genetic variation and dietary factors may alter the biological effects of exposure to 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), one of the major heterocyclic amines generated from cooking meats at high temperatures that has carcinogenic potential through the formation of DNA adducts. Previously, we reported grilled red meat consumption associated with PhIP-DNA adduct levels in human prostate. In this study, we expanded our investigation to estimate the associations between beverage consumption and PhIP-DNA adduct levels in prostate for 391 prostate cancer cases. Of the 15 beverages analyzed, red wine consumption had the strongest association with PhIP-DNA adduct levels showing an inverse correlation in both tumor (P = 0.006) and nontumor (P = 0.002) prostate cells. Red wine consumption was significantly lower in African American compared with white cases, but PhIP-DNA adduct levels in prostate did not vary by race. In African Americans compared with whites, however, associations between red wine consumption and PhIP-DNA adduct levels were not as strong as associations with specific (e.g., SULT1A1 and UGT1A10 genotypes) and nonspecific (e.g., African ancestry) genetic variation. In a multivariable model, the covariate for red wine consumption explained a comparable percentage (13%-16%) of the variation in PhIP-DNA adduct levels in prostate across the two racial groups, but the aforementioned genetic factors explained 33% of the PhIP-DNA adduct variation in African American cases, whereas only 19% of the PhIP-DNA adduct variation in whites. We conclude that red wine consumption may counteract biological effects of PhIP exposure in human prostate, but genetic factors may play an even larger role, particularly in African Americans.

  4. Screening for DNA adducts by data-dependent constant neutral loss-triple stage mass spectrometry with a linear quadrupole ion trap mass spectrometer.

    Science.gov (United States)

    Bessette, Erin E; Goodenough, Angela K; Langouët, Sophie; Yasa, Isil; Kozekov, Ivan D; Spivack, Simon D; Turesky, Robert J

    2009-01-15

    A two-dimensional linear quadrupole ion trap mass spectrometer (LIT/MS) was employed to simultaneously screen for DNA adducts of environmental, dietary, and endogenous genotoxicants, by data-dependent constant neutral loss scanning followed by triple-stage mass spectrometry (CNL-MS3). The loss of the deoxyribose (dR) from the protonated DNA adducts ([M + H - 116]+) in the MS/MS scan mode triggered the acquisition of MS3 product ion spectra of the aglycone adducts [BH2]+. Five DNA adducts of the tobacco carcinogen 4-aminobiphenyl (4-ABP) were detected in human hepatocytes treated with 4-ABP, and three DNA adducts of the cooked-meat carcinogen 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) were identified in the livers of rats exposed to MeIQx, by the CNL-MS3 scan mode. Buccal cell DNA from tobacco smokers was screened for DNA adducts of various classes of carcinogens in tobacco smoke including 4-ABP, 2-amino-9H-pyrido[2,3-b]indole (AalphaC), and benzo[a]pyrene (BaP); the cooked-meat carcinogens MeIQx, AalphaC, and 2-amino-1-methyl-6-phenylmidazo[4,5-b]pyridine (PhIP); and the lipid peroxidation products acrolein (AC) and trans-4-hydroxynonenal (HNE). The CNL-MS3 scanning technique can be used to simultaneously screen for multiple DNA adducts derived from different classes of carcinogens, at levels of adduct modification approaching 1 adduct per 108 unmodified DNA bases, when 10 microg of DNA is employed for the assay.

  5. Chlorophyllin intervention reduces aflatoxin-DNA adducts in individuals at high risk for liver cancer.

    Science.gov (United States)

    Egner, P A; Wang, J B; Zhu, Y R; Zhang, B C; Wu, Y; Zhang, Q N; Qian, G S; Kuang, S Y; Gange, S J; Jacobson, L P; Helzlsouer, K J; Bailey, G S; Groopman, J D; Kensler, T W

    2001-12-04

    Residents of Qidong, People's Republic of China, are at high risk for development of hepatocellular carcinoma, in part from consumption of foods contaminated with aflatoxins. Chlorophyllin, a mixture of semisynthetic, water-soluble derivatives of chlorophyll that is used as a food colorant and over-the-counter medicine, has been shown to be an effective inhibitor of aflatoxin hepatocarcinogenesis in animal models by blocking carcinogen bioavailability. In a randomized, double-blind, placebo-controlled chemoprevention trial, we tested whether chlorophyllin could alter the disposition of aflatoxin. One hundred and eighty healthy adults from Qidong were randomly assigned to ingest 100 mg of chlorophyllin or a placebo three times a day for 4 months. The primary endpoint was modulation of levels of aflatoxin-N(7)-guanine adducts in urine samples collected 3 months into the intervention measured by using sequential immunoaffinity chromatography and liquid chromatography-electrospray mass spectrometry. This aflatoxin-DNA adduct excretion product serves as a biomarker of the biologically effective dose of aflatoxin, and elevated levels are associated with increased risk of liver cancer. Adherence to the study protocol was outstanding, and no adverse events were reported. Aflatoxin-N(7)-guanine could be detected in 105 of 169 available samples. Chlorophyllin consumption at each meal led to an overall 55% reduction (P = 0.036) in median urinary levels of this aflatoxin biomarker compared with those taking placebo. Thus, prophylactic interventions with chlorophyllin or supplementation of diets with foods rich in chlorophylls may represent practical means to prevent the development of hepatocellular carcinoma or other environmentally induced cancers.

  6. Insights into the error bypass of 1-Nitropyrene DNA adduct by DNA polymerase ι: A QM/MM study

    Science.gov (United States)

    Li, Yanwei; Bao, Lei; Zhang, Ruiming; Tang, Xiaowen; Zhang, Qingzhu; Wang, Wenxing

    2017-10-01

    The error bypass mechanism of DNA polymerase ι toward N-(deoxyguanosin-8-yl)-1-aminopyrene adduction was studied by using quantum mechanics/molecular mechanics method. The most favorable mechanism highlights three elementary steps: proton transfer from dC to dATP, phosphoryl transfer, and deprotonation of dAMP. The phosphoryl transfer step was found to be rate-determining. The calculated average barrier (23.8 kcal mol-1) is in accordance with the experimental value (21.5 kcal mol-1). Electrostatic influence analysis indicates that residues Asp126 and Lys207 significantly suppress the error bypass while Glu127 facilitates the process. These results highlight the origins of the mutagenicity of nitrated polycyclic aromatic hydrocarbons in molecular detail.

  7. Structure of cis-[Pt(NH3)(2-picoline)]2+ and DNA adduct and its bonding characteristics

    Institute of Scientific and Technical Information of China (English)

    JIA; Muxin; LIU; Kai; YANG; Zuoyin; CHEN; Guangju

    2004-01-01

    Several methods including molecular mechanics, molecular dynamics, ONIOM that combines quantum chemistry with molecular mechanics and standard quantum chemistry are used to study the configuration and electron structures of an adduct of the DNA segment d(ATACATG*G*TACATA)·d(TATGTACCATGTAT) with cis-[Pt(NH3)(2-Picoline)]2+. The investigation shows that the configuration optimized by ONIOM is similar to that determined by NMR. Strong chemical bonds between Pt of the complex and two N7s of neighboring guanines in the DNA duplex and hydrogen bond between the NH3 of the complex and O6 of a nearby guanine have a large impact on the configuration of the adduct. Chemical bonds, the aforementioned hydrogen bond, and the interaction between a methyl of the complex and a methyl of the base in close proximity are critical for the complex to specifically recognize DNA.

  8. Cisplatin-DNA adduct formation in patients treated with cisplatin-based chemoradiation: lack of correlation between normal tissues and primary tumor.

    NARCIS (Netherlands)

    Hoebers, F.J.; Pluim, D.; Hart, A.A.M.; Verheij, M.; Balm, A.J.M.; Fons, G.; Rasch, C.R.; Schellens, J.H.M.; Stalpers, L.J.A.; Bartelink, H.; Begg, A.C.

    2008-01-01

    PURPOSE: In this study, the formation of cisplatin-DNA adducts after concurrent cisplatin-radiation and the relationship between adduct-formation in primary tumor tissue and normal tissue were investigated. METHODS: Three intravenous cisplatin-regimens, given concurrently with radiation, were studie

  9. Cisplatin-DNA adduct formation in patients treated with cisplatin-based chemoradiation: lack of correlation between normal tissues and primary tumor

    NARCIS (Netherlands)

    Hoebers, F.J.P.; Pluim, D.; Hart, A.A.M.; Verheij, M.; Balm, A.J.M.; Fons, G.; Rasch, C.R.N.; Schellens, J.H.M.; Stalpers, L.J.A.; Bartelink, H.; Begg, A.C.

    2007-01-01

    Purpose: In this study, the formation of cisplatin-DNA adducts after concurrent cisplatin-radiation and the relationship between adduct-formation in primary tumor tissue and normal tissue were investigated. Methods: Three intravenous cisplatin-regimens, given concurrently with radiation, were stu

  10. Levels of PAH-DNA adducts in placental tissue and the risk of fetal neural tube defects in a Chinese population.

    Science.gov (United States)

    Yuan, Yue; Jin, Lei; Wang, Linlin; Li, Zhiwen; Zhang, Le; Zhu, Huiping; Finnell, Richard H; Zhou, Guodong; Ren, Aiguo

    2013-06-01

    We examined the relationship between PAH-DNA adduct levels in the placental tissue, measured by a highly sensitive (32)P-postlabeling assay, and the risk of fetal neural tube defects (NTDs). We further explored the interaction between PAH-DNA adducts and placental PAHs with respect to NTD risk. Placental tissues from 80 NTD-affected pregnancies and 50 uncomplicated normal pregnancies were included in this case-control study. Levels of PAH-DNA adducts were lower in the NTD group (8.12 per 10(8) nucleotides) compared to controls (9.92 per 10(8) nucleotides). PAH-DNA adduct concentrations below the median was associated with a 3-fold increased NTD risk. Women with a low PAH-DNA adduct level in concert with a high placental PAH level resulted in a 10-fold elevated risk of having an NTD-complicated pregnancy. A low level of placental PAH-DNA adducts was associated with an increased risk of NTDs; this risk increased dramatically when a low adduct level was coupled with a high placental PAH concentration.

  11. 32P-postlabelling analysis of DNA adducts in the skin of mice treated with petrol and diesel engine lubricating oils and exhaust condensates.

    Science.gov (United States)

    Schoket, B; Hewer, A; Grover, P L; Phillips, D H

    1989-08-01

    Samples of unused or used petrol and diesel engine lubricating oils were applied to the shaved dorsal skin of 4- to 6-week-old male Parkes mice, either as a single treatment (50 microliters/mouse) or as four consecutive daily treatments (50 microliters/application). DNA isolated from the skin 24 h after the final treatment was digested to 3'-mononucleotides and analysed by 32P-postlabelling for the presence of aromatic adducts. Enhancement of sensitivity using butanol extraction or nuclease P1 digestion of the DNA hydrolysates led to the detection of up to eight adduct spots on polyethyleneimine-cellulose thin-layer chromatograms with samples of DNA from skin treated with used engine oils, at levels of 40-150 amol total adducts/micrograms DNA. Multiple treatments with the used oils gave rise to similar patterns of adducts in lung DNA. A single treatment of mouse skin with petrol engine exhaust condensate (50 microliters), or diesel engine exhaust condensate (50 microliters), containing 20 and 46 micrograms benzo[a]pyrene (BaP)/g respectively, gave rise to approximately 75 amol total adducts/micrograms DNA in skin. A significant proportion, 31 and 48% respectively, of the adducts formed by the petrol and diesel engine exhaust condensates co-chromatographed with the major BaP-DNA adduct, but with the used engine oils, only petrol engine oil, and not diesel engine oil, produced significant amounts of an adduct (22% of total) that corresponded to the BaP-DNA adduct.

  12. Formation of a major DNA adduct of the mitomycin metabolite 2,7-diaminomitosene in EMT6 mouse mammary tumor cells treated with mitomycin C.

    Science.gov (United States)

    Palom, Y; Belcourt, M F; Kumar, G S; Arai, H; Kasai, M; Sartorelli, A C; Rockwell, S; Tomasz, M

    1998-01-01

    Treatment of EMT6 mouse mammary tumor cells with [3H]mitomycin C (MC) results in the formation of six major DNA adducts, as described earlier using an HPLC assay of 3H-labeled products of enzymatic hydrolysis of DNA isolated from MC-treated cells. Four of these adducts were identified as monofunctional and bifunctional guanine-N2 adducts in the minor groove of DNA. In order to establish relationships between individual types of MC-DNA adducts and biological responses it is necessary to identify all of the adducts formed in cells. To this end we have now identified a predominant, previously unknown adduct formed in MC-treated EMT6 cells as a derivative not of MC, but of 2,7-diaminomitosene (2,7-DAM), the major bioreductive metabolite of MC. Rigorous proof demonstrates that it is a DNA major groove, guanine-N7 adduct of 2,7-DAM, linked at C-10 to DNA. The adduct is relatively stable at ambient temperature, but is readily depurinated upon heating. Its isolation from MC-treated cells indicates that MC is reductively metabolized to 2,7-DAM, which then undergoes further reductive activation to alkylate DNA, along with the parent MC. Low MC:DNA ratios were identified as a critical factor promoting 2,7-DAM adduct formation in an in vitro model calf thymus DNA/ MC/reductase model system, as well as in MC-treated EMT6 cells. The 2,7-DAM-guanine-N7 DNA adduct appears to be relatively noncytotoxic, as indicated by the dramatically lower cytotoxicity of 2,7-DAM in comparison with MC in EMT6 cells. Like MC, 2,7-DAM exhibited slightly greater cytotoxicity to cells treated under hypoxic as compared to aerobic conditions. However, 2,7-DAM was markedly less cytotoxic than MC under both aerobic and hypoxic conditions. Thus, metabolic reduction of MC to 2,7-DAM represents a detoxification process. The differential effects of MC-DNA and 2,7-DAM-DNA adducts support the concept that specific structural features of the DNA damage may play a critical role in the cytotoxic response to a DNA

  13. DNA adducts, benzo(a)pyrene monooxygenase activity, and lysosomal membrane stability in Mytilus galloprovincialis from different areas in Taranto coastal waters (Italy).

    Science.gov (United States)

    Pisoni, M; Cogotzi, L; Frigeri, A; Corsi, I; Bonacci, S; Iacocca, A; Lancini, L; Mastrototaro, F; Focardi, S; Svelto, M

    2004-10-01

    The aim of this study was to investigate the impact of environmental pollution at different stations along the Taranto coastline (Ionian Sea, Puglia, Italy) using several biomarkers of exposure and the effect on mussels, Mytilus galloprovincialis, collected in October 2001 and October 2002. Five sampling sites were compared with a "cleaner" reference site in the Aeronautics Area. In this study we also investigated the differences between adduct levels in gills and digestive gland. This Taranto area is the most significant industrial settlement on the Ionian Sea known to be contaminated by polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls, heavy metals, etc. Exposure to PAHs was evaluated by measuring DNA adduct levels and benzo(a)pyrene monooxygenase activity (B(a)PMO); DNA adducts were analyzed by 32P-postlabeling with nuclease P1 enhancement in both gills and digestive glands to evaluate differences between DNA adduct levels in the two tissues. B(a)PMO was assayed in the microsomal fraction of the digestive glands as a result of the high expression of P450-metabolizing enzymes in this tissue. Lysosomal membrane stability, a potential biomarker of anthropogenic stress, was also evaluated in the digestive glands of mussels, by measuring the latent activity of beta-N-acetylhexosaminidase. Induction of DNA adducts was evident in both tissues, although the results revealed large tissue differences in DNA adduct formation. In fact, gills showed higher DNA adduct levels than did digestive gland. No significant differences were found in DNA adduct levels over time, with both tissues providing similar results in both years. DNA adduct levels were correlated with B(a)PMO activity in digestive gland in both years (r = 0.60 in 2001; r = 0.73 in 2002). Increases were observed in B(a)PMO activity and DNA adduct levels at different stations; no statistical difference was observed in B(a)PMO activity over the two monitoring campaigns. The membrane labilization

  14. Noncovalent interactions of a benzo[a]pyrene diol epoxide with DNA base pairs: insight into the formation of adducts of (+)-BaP DE-2 with DNA.

    Science.gov (United States)

    Hargis, Jacqueline C; Schaefer, Henry F; Houk, K N; Wheeler, Steven E

    2010-02-01

    Noncovalent complexes of a tumorigenic benzo[a]pyrene diol epoxide with the guanine-cytosine (GC) and adenine-thymine (AT) base pairs have been examined computationally. (+)-BaP DE-2 forms covalent adducts with DNA via nucleophilic attack on the (+)-BaP DE-2 epoxide. Computational results predict five thermodynamically accessible complexes of AT with (+)-BaP DE-2 that are compatible with intact DNA. Among these, two are expected to lead to adenine adducts. In the lowest energy AT...(+)-BaP DE-2 complex, which has a gas-phase interaction energy of -20.9 kcal mol(-1), the exocyclic NH(2) of adenine is positioned for backside epoxide attack and formation of a trans adduct. The most energetically favorable complex leading to formation of a cis ring-opened adduct lies only 0.6 kcal mol(-1) higher in energy. For GC...(+)-BaP DE-2, there are only two thermodynamically accessible complexes. The higher-lying complex, bound in the gas phase by 24.4 kcal mol(-1) relative to separated GC and (+)-BaP DE-2, would lead to a trans ring-opened N(2)-guanine adduct. In the global minimum energy GC...(+)-BaP DE-2 complex, bound by 27.3 kcal mol(-1), the exocyclic NH(2) group of cytosine is positioned for cis epoxide addition. However, adducts of (+)-BaP DE-2 with cytosine are rarely observed experimentally. The paucity of cytosine adducts, despite the predicted thermodynamic stability of this GC...(+)-BaP DE-2 complex, is attributed to the electrostatic destabilization of the benzylic cation intermediate thought to precede cis addition.

  15. Sustained systemic delivery of green tea polyphenols by polymeric implants significantly diminishes benzo[a]pyrene-induced DNA adducts.

    Science.gov (United States)

    Cao, Pengxiao; Vadhanam, Manicka V; Spencer, Wendy A; Cai, Jian; Gupta, Ramesh C

    2011-06-20

    The polyphenolics in green tea are believed to be the bioactive components. However, poor bioavailability following ingestion limits their efficacy in vivo. In this study, polyphenon E (poly E), a standardized green tea extract, was administered by sustained-release polycaprolactone implants (two, 2-cm implants; 20% drug load) grafted subcutaneously or via drinking water (0.8% w/v) to female S/D rats. Animals were treated with continuous low dose of benzo[a]pyrene (BP) via subcutaneous polymeric implants (2 cm; 10% load) and euthanized after 1 and 4 weeks. Analysis of lung DNA by (32)P-postlabeling resulted in a statistically significant reduction (50%; p = 0.023) of BP-induced DNA adducts in the implant group; however, only a modest (34%) but statistically insignificant reduction occurred in the drinking water group at 1 week. The implant delivery system also showed significant reduction (35%; p = 0.044) of the known BP diolepoxide-derived DNA adduct after 4 weeks. Notably, the total dose of poly E administered was >100-fold lower in the implant group than the drinking water group (15.7 versus 1,632 mg, respectively). Analysis of selected phase I, phase II, and nucleotide excision repair enzymes at both mRNA and protein levels showed no significant modulation by poly E, suggesting that the reduction in the BP-induced DNA adducts occurred presumably due to known scavenging of the antidiolepoxide of BP by the poly E catechins. In conclusion, our study demonstrated that sustained systemic delivery of poly E significantly reduced BP-induced DNA adducts in spite of its poor bioavailability following oral administration.

  16. Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides.

    Science.gov (United States)

    Bialk, Pawel; Sansbury, Brett; Rivera-Torres, Natalia; Bloh, Kevin; Man, Dula; Kmiec, Eric B

    2016-09-09

    The repair of a point mutation can be facilitated by combined activity of a single-stranded oligonucleotide and a CRISPR/Cas9 system. While the mechanism of action of combinatorial gene editing remains to be elucidated, the regulatory circuitry of nucleotide exchange executed by oligonucleotides alone has been largely defined. The presence of the appropriate CRISPR/Cas9 system leads to an enhancement in the frequency of gene editing directed by single-stranded DNA oligonucleotides. While CRISPR/Cas9 executes double-stranded DNA cleavage efficiently, closure of the broken chromosomes is dynamic, as varying degrees of heterogeneity of the cleavage products appear to accompany the emergence of the corrected base pair. We provide a detailed analysis of allelic variance at and surrounding the target site. In one particular case, we report sequence alteration directed by a distinct member of the same gene family. Our data suggests that single-stranded DNA molecules may influence DNA junction heterogeneity created by CRISPR/Cas9.

  17. Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

    Science.gov (United States)

    Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Ahmad, Haslina; Heng, Lee Yook; Karim, Nurul Huda Abd; Harun, Siti Norain

    2014-09-01

    A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy)2(PIP)]2+, (bpy = 2,2'bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy)2(PIP)]2+ was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulse voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy)2(PIP)]2+ with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.

  18. Smoking, DNA Adducts and Number of Risk DNA Repair Alleles in Lung Cancer Cases, in Subjects with Benign Lung Diseases and in Controls

    Directory of Open Access Journals (Sweden)

    Marco Peluso

    2010-01-01

    Full Text Available Smoke constituents can induce DNA adducts that cause mutations and lead to lung cancer. We have analyzed DNA adducts and polymorphisms in two DNA repair genes, for example, XRCC1 Arg194Trp and Arg399Gln genes and XRCC3 Thr241Met gene, in 34 lung cancer cases in respect to 30 subjects with benign lung cancer disease and 40 healthy controls. When the study population was categorized in base to the number of risk alleles, adducts were significantly increased in individuals bearing 3-4 risk alleles (OR=4.1 95% C.I. 1.28–13.09, P=.009. A significant association with smoking was noticed in smokers for more than 40 years carrying 3-4 risk alleles (OR=36.38, 95% C.I. 1.17–1132.84, P=.040. A not statistically significant increment of lung cancer risk was observed in the same group (OR=4.54, 95% C.I. 0.33–62.93, P=.259. Our results suggest that the analysis of the number of risk alleles predicts the interindividual variation in DNA adducts of smokers and lung cancer cases.

  19. Aberrant repair of etheno-DNA adducts in leukocytes and colon tissue of colon cancer patients.

    Science.gov (United States)

    Obtułowicz, Tomasz; Winczura, Alicja; Speina, Elzbieta; Swoboda, Maja; Janik, Justyna; Janowska, Beata; Cieśla, Jarosław M; Kowalczyk, Paweł; Jawien, Arkadiusz; Gackowski, Daniel; Banaszkiewicz, Zbigniew; Krasnodebski, Ireneusz; Chaber, Andrzej; Olinski, Ryszard; Nair, Jagadesaan; Bartsch, Helmut; Douki, Thierry; Cadet, Jean; Tudek, Barbara

    2010-09-15

    To assess the role of lipid peroxidation-induced DNA damage and repair in colon carcinogenesis, the excision rates and levels of 1,N(6)-etheno-2'-deoxyadenosine (epsilondA), 3,N(4)-etheno-2'-deoxycytidine (epsilondC), and 1,N(2)-etheno-2'-deoxyguanosine (1,N(2)-epsilondG) were analyzed in polymorphic blood leukocytes (PBL) and resected colon tissues of 54 colorectal carcinoma (CRC) patients and PBL of 56 healthy individuals. In PBL the excision rates of 1,N(6)-ethenoadenine (epsilonAde) and 3,N(4)-ethenocytosine (epsilonCyt), measured by the nicking of oligodeoxynucleotide duplexes with single lesions, and unexpectedly also the levels of epsilondA and 1,N(2)-epsilondG, measured by LC/MS/MS, were lower in CRC patients than in controls. In contrast the mRNA levels of repair enzymes, alkylpurine- and thymine-DNA glycosylases and abasic site endonuclease (APE1), were higher in PBL of CRC patients than in those of controls, as measured by QPCR. In the target colon tissues epsilonAde and epsilonCyt excision rates were higher, whereas the epsilondA and epsilondC levels in DNA, measured by (32)P-postlabeling, were lower in tumor than in adjacent colon tissue, although a higher mRNA level was observed only for APE1. This suggests that during the onset of carcinogenesis, etheno adduct repair in the colon seems to be under a complex transcriptional and posttranscriptional control, whereby deregulation may act as a driving force for malignancy.

  20. Dynamic and Progressive Control of DNA Origami Conformation by Modulating DNA Helicity with Chemical Adducts.

    Science.gov (United States)

    Chen, Haorong; Zhang, Hanyu; Pan, Jing; Cha, Tae-Gon; Li, Shiming; Andréasson, Joakim; Choi, Jong Hyun

    2016-05-24

    DNA origami has received enormous attention for its ability to program complex nanostructures with a few nanometer precision. Dynamic origami structures that change conformation in response to environmental cues or external signals hold great promises in sensing and actuation at the nanoscale. The reconfiguration mechanism of existing dynamic origami structures is mostly limited to single-stranded hinges and relies almost exclusively on DNA hybridization or strand displacement. Here, we show an alternative approach by demonstrating on-demand conformation changes with DNA-binding molecules, which intercalate between base pairs and unwind DNA double helices. The unwinding effect modulates the helicity mismatch in DNA origami, which significantly influences the internal stress and the global conformation of the origami structure. We demonstrate the switching of a polymerized origami nanoribbon between different twisting states and a well-constrained torsional deformation in a monomeric origami shaft. The structural transformation is shown to be reversible, and binding isotherms confirm the reconfiguration mechanism. This approach provides a rapid and reversible means to change DNA origami conformation, which can be used for dynamic and progressive control at the nanoscale.

  1. Investigation of the DNA adducts formed in B6C3F1 mice treated with benzene: Implications for molecular dosimetry

    Energy Technology Data Exchange (ETDEWEB)

    Bodell, W.J.; Pathak, D.N.; Levay, G. [Univ. of California, San Francisco, CA (United States)] [and others

    1996-12-01

    We have investigated the formation of DNA adducts in the bone marrow and white blood cells of male B6C3F1 mice treated with benzene using P1-enhanced {sup 32}P-postlabeling. No adducts were detected in the bone marrow of controls or mice treated with various doses of benzene once a day. After twice-daily treatment for 1 to 7 days with benzene, 440 mg/kg, one major (no. 1) and UP to two minor DNA adducts were detected in both the bone marrow and white blood cells. The relative adduct levels in these cells ranged from 0.06 to 1.46 x 10{sup -7}. A significant correlation (r 0.95) between levels of adducts in bone marrow and white blood cells was observed. After a 7-day treatment with benzene, 440 mg/kg twice a day, the number of cells per femur decreased from 1.6 x 10{sup 7} to 0.85 X 10{sup 7}, indicating myelotoxicity. In contrast, administration of benzene once a day produced only a small decrease in bone marrow cellularity. The observed induction of toxicity in bone marrow was paralleled by formation of DNA adducts. In vitro treatment of bone marrow with hydroquinone (HQ) for 24 hr produced the same DNA adducts as found after treatment of mice with benzene, suggesting that HQ is the principal metabolite of benzene leading to DNA adduct formation in vivo. Using {sup 32}P-postlabeling the principal DNA adduct formed in vivo was compared with N{sup 2}-(4-hydroxyphenyl)-2-deoxyguanosine-3-phosphate. The results of this comparison demonstrates that the DNA adduct formed in vivo co-chromatographs with N{sup 2}-(4-hydroxyphenyl)-2-deoxyguanosine-3{prime}-phosphate. These studies indicate that metabolic activation of benzene leads to the formation of DNA adducts in bone marrow and white blood cells and suggest that measurement of DNA adducts in white blood cells may be an indicator of biological effect following benzene exposure. 34 refs., 4 figs., 2 tabs.

  2. SEPARATION AND CHARACTERIZATION OF TETROL METABOLITES OF BENZO[A]PYRENE-DNA ADDUCTS USING HPLC AND SOLID-MATRIX ROOM TEMPERATURE LUMINESCENCE. (R824100)

    Science.gov (United States)

    AbstractFour tetrols of benzo[a]pyrene-DNA adducts were separated using reversed-phase high performance liquid chromatography. Chromatographic fractions containing a given tetrol were readily characterized with solid-matrix room temperature luminescence techniques. So...

  3. MUTAGENICITY AND DNA ADDUCT FORMATION OF PAH, NITRO-PAH, AND OXY-PAH FRACTIONS OF ATMOSPHERIC PARTICULATE MATTER FROM SAO PAULO, BRAZIL

    Science.gov (United States)

    Summary What is the study? Near roadway and immediate roadway exposures to transportation emissions gave very similar results in the Salmonella mutagenicity assay and in an assay for DNA adducts indicating that near roadway genotoxicity is not altered significantly over...

  4. Replication past the butadiene diepoxide-derived DNA adduct S-[4-(N(6)-deoxyadenosinyl)-2,3-dihydroxybutyl]glutathione by DNA polymerases.

    Science.gov (United States)

    Cho, Sung-Hee; Guengerich, F Peter

    2013-06-17

    1,2,3,4-Diepoxybutane (DEB), a metabolite of the carcinogen butadiene, has been shown to cause glutathione (GSH)-dependent base substitution mutations, especially A:T to G:C mutations in Salmonella typhimurium TA1535 [Cho, S. H., et al. (2010) Chem. Res. Toxicol. 23, 1544] and Escherichia coli TRG8 cells [Cho, S. H., and Guengerich, F. P. (2012) Chem. Res. Toxicol. 25, 1522]. We previously identified S-[4-(N(6)-deoxyadenosinyl)-2,3-dihydroxybutyl]GSH [N(6)dA-(OH)2butyl-GSH] as a major adduct in the reaction of S-(2-hydroxy-3,4-epoxybutyl)glutathione (DEB-GSH conjugate) with nucleosides and calf thymus DNA and in vivo in livers of mice and rats treated with DEB [Cho, S. H., and Guengerich, F. P. (2012) Chem. Res. Toxicol. 25, 706]. For investigation of the miscoding potential of the major DEB-GSH conjugate-derived DNA adduct [N(6)dA-(OH)2butyl-GSH] and the effect of GSH conjugation on replication of DEB, extension studies were performed in duplex DNA substrates containing the site-specifically incorporated N(6)dA-(OH)2butyl-GSH adduct, N(6)-(2,3,4-trihydroxybutyl)deoxyadenosine adduct (N(6)dA-butanetriol), or unmodified deoxyadenosine (dA) by human DNA polymerases (Pol) η, ι, and κ, bacteriophage polymerase T7, and Sulfolobus solfataricus polymerase Dpo4. Although dTTP incorporation was the most preferred addition opposite the N(6)dA-(OH)2butyl-GSH adduct, N(6)dA-butanetriol adduct, or unmodified dA for all polymerases, the dCTP misincorporation frequency opposite N(6)dA-(OH)2butyl-GSH was significantly higher than that opposite the N(6)dA-butanetriol adduct or unmodified dA with Pol κ or Pol T7. LC-MS/MS analysis of full-length primer extension products confirmed that Pol κ or Pol T7 incorporated the incorrect base C opposite the N(6)dA-(OH)2butyl-GSH lesion. These results indicate the relevance of GSH-containing adducts for the A:T to G:C mutations produced by DEB.

  5. Binding and NMR structural studies on indoloquinoline-oligonucleotide conjugates targeting duplex DNA.

    Science.gov (United States)

    Eick, Andrea; Riechert-Krause, Fanny; Weisz, Klaus

    2012-06-20

    An 11-phenyl-indolo[3,2-b]quinoline (PIQ) was tethered through an aminoalkyl linker to the 5'-end of four pyrimidine oligonucleotides with T/C scrambled sequences at their two 5'-terminal positions. Binding to different double-helical DNA targets formed parallel triple helices with a PIQ-mediated stabilization that strongly depends on pH and the terminal base triad at the 5'-triplex-duplex junction. The most effective stabilization was observed with a TAT triplet at the 5'-junction under low pH conditions, pointing to a protonated ligand with a high triplex binding affinity and unfavorable charge repulsions in the case of a terminal C(+)GC triplet at the junction. The latter preference of the PIQ ligand for TAT over CGC is alleviated yet still preserved at higher pH. Intercalation of PIQ at the 5'-triplex-duplex junction as suggested by the triplex melting experiments was confirmed by homonuclear and heteronuclear NMR structural studies on a specifically isotope-labeled triplex. The NMR analysis revealed two coexisting species that only differ by a 180° rotation of the indoloquinoline within the intercalation pocket. NOE-derived molecular models indicate extensive stacking interactions of the indoloquinoline moiety with the TAT base triplet and CG base pair at the junction and a phenyl substituent that is positioned in the major groove and oriented almost perpendicular to the plane of the indoloquinoline.

  6. Induction of somatic mutations but not methylated DNA adducts in λlacZ transgenic mice by dichlorvos

    NARCIS (Netherlands)

    Pletsa, V.; Steenwinkel, M.-J.S.T.; Delft, J.H.M. van; Baan, R.A.; Kyrtopoulos, S.A.

    1999-01-01

    In order to examine the in vivo genotoxic activity of dichlorvos, λlacZ transgenic mice (Muta(TM)Mouse) were treated i.p. with single (4.4 or 11 mg/kg) or multiple (5x11 mg/kg) doses of this agent and sacrificed 4 h or 14 days post-treatment for DNA adduct measurement or mutant frequency analysis, r

  7. Mechanisms of the different DNA adduct forming potentials of the urban air pollutants 2-nitrobenzanthrone and carcinogenic 3-nitrobenzanthrone.

    Science.gov (United States)

    Stiborová, Marie; Martínek, Václav; Svobodová, Martina; Sístková, Jana; Dvorák, Zdenek; Ulrichová, Jitka; Simánek, Vilím; Frei, Eva; Schmeiser, Heinz H; Phillips, David H; Arlt, Volker M

    2010-07-19

    2-Nitrobenzanthrone (2-NBA) has recently been detected in ambient air particulate matter. Its isomer 3-nitrobenzanthrone (3-NBA) is a potent mutagen and suspected human carcinogen identified in diesel exhaust. We compared the efficiencies of human enzymatic systems [hepatic microsomes and cytosols, NAD(P)H:quinone oxidoreductase 1 (NQO1), xanthine oxidase, NADPH:cytochrome P450 reductase, N,O-acetyltransferases, and sulfotransferases] and human primary hepatocytes to activate 2-NBA and its isomer 3-NBA to species forming DNA adducts. In contrast to 3-NBA, 2-NBA was not metabolized at detectable levels by the tested human enzymatic systems and enzymes expressed in human hepatocytes, and no DNA adducts detectable by (32)P-postlabeling were generated by 2-NBA. Even NQO1, the most efficient human enzyme to bioactive 3-NBA, did not activate 2-NBA. Molecular docking of 2-NBA and 3-NBA to the active site of NQO1 showed similar binding affinities; however, the binding orientation of 2-NBA does not favor the reduction of the nitro group. This was in line with the inhibition of 3-NBA-DNA adduct formation by 2-NBA, indicating that 2-NBA can compete with 3-NBA for binding to NQO1, thereby decreasing the metabolic activation of 3-NBA. In addition, the predicted equilibrium conditions favor a 3 orders of magnitude higher dissociation of N-OH-3-ABA in comparison to N-OH-2-ABA. These findings explain the very different genotoxicity, mutagenicity, and DNA adduct forming potential of the two compounds. Collectively, our results suggest that 2-NBA possesses a relatively lower risk to humans than 3-NBA.

  8. Two food-borne heterocyclic amines: Metabolism and DNA adduct formation of amino-alpha-carbolines

    DEFF Research Database (Denmark)

    Frederiksen, Hanne

    2005-01-01

    The amino-alpha-carbolines 2-amino-9H-pyrido[2,3-b]indole (A alpha C) and 2-amino-3-methyl-9H-pyrido-[2,3-b]indole (MeA alpha C) are two mutagenic and carcinogenic heterocyclic amines formed during ordinary cooking. Amino-alpha-carbolines can be formed in model systems by pyrolyzing tryptophan...... or proteins of animal or vegetable origin, furthermore they are found in many cooked foods, such as fish, meat, and chicken. The specific mutagenicity of the amino-a-carbolines are lower in the Ames Salmonella assay than other heterocyclic amines, but in rodent studies the carcinogenicity of the aminoa, alpha......-carbolines are comparable to other heterocyclic amines. The metabolic pathways of the amino-alpha-carbolines have been studied in vitro and in vivo, and the detoxified phase I and phase II metabolites characterized and quantified. The metabolic activation of the amino-a-carbolines and the formation of DNA-adducts have also...

  9. Biomarkers for exposure to ambient air pollution--comparison of carcinogen-DNA adduct levels with other exposure markers and markers for oxidative stress

    DEFF Research Database (Denmark)

    Autrup, H; Daneshvar, B; Dragsted, L O

    1999-01-01

    correlations were observed between bulky carcinogen-DNA adduct and PAH-albumin levels (p = 0.005), and between DNA adduct and [gamma]-glutamyl semialdehyde (GGS) in hemoglobin (p = 0.11). Highly significant correlations were found between PAH-albumin adducts and AAS in plasma (p = 0.001) and GGS in hemoglobin...... (p = 0.001). Significant correlations were also observed between urinary 8-oxo-7, 8-dihydro-2'-deoxyguanosine and AAS in plasma (p = 0.001) and PAH-albumin adducts (p = 0.002). The influence of the glutatione S-transferase (GST) M1 deletion on the correlation between the biomarkers was studied...... in the combined group. A significant negative correlation was only observed between bulky carcinogen-DNA adducts and PAH-albumin adducts (p = 0.02) and between DNA adduct and urinary mutagenic activity (p = 0.02) in the GSTM1 null group, but not in the workers who were homozygotes or heterozygotes for GSTM1. Our...

  10. Bulky DNA Adducts in Cord Blood, Maternal Fruit-and-Vegetable Consumption, and Birth Weight in a European Mother–Child Study (NewGeneris)

    OpenAIRE

    Pedersen, Marie; Schoket, Bernadette; Godschalk, Roger W.; Wright, John; von Stedingk, Hans; Törnqvist, Margareta; Sunyer, Jordi; Nielsen, Jeanette K.; Merlo, Domenico Franco; Mendez, Michelle A.; Meltzer, Helle Margrete; Lukacs, Viktoria; Landström, Anette; Kyrtopoulos, Soterios A; Kovacs, Katalin

    2013-01-01

    Background: Tobacco-smoke, airborne, and dietary exposures to polycyclic aromatic hydrocarbons (PAHs) have been associated with reduced prenatal growth. Evidence from biomarker-based studies of low-exposed populations is limited. Bulky DNA adducts in cord blood reflect the prenatal effective dose to several genotoxic agents including PAHs. Objectives: We estimated the association between bulky DNA adduct levels and birth weight in a multicenter study and examined modification of this associat...

  11. Error-prone replication bypass of the primary aflatoxin B1 DNA adduct, AFB1-N7-Gua.

    Science.gov (United States)

    Lin, Ying-Chih; Li, Liang; Makarova, Alena V; Burgers, Peter M; Stone, Michael P; Lloyd, R Stephen

    2014-06-27

    Hepatocellular carcinomas (HCCs) are the third leading cause of cancer deaths worldwide. The highest rates of early onset HCCs occur in geographical regions with high aflatoxin B1 (AFB1) exposure, concomitant with hepatitis B infection. Although the carcinogenic basis of AFB1 has been ascribed to its mutagenic effects, the mutagenic property of the primary AFB1-DNA adduct, AFB1-N7-Gua, in mammalian cells has not been studied extensively. Taking advantage of the ability to create vectors containing a site-specific DNA adduct, the mutagenic potential was determined in primate cells. This adduct was highly mutagenic following replication in COS-7 cells, with a mutation frequency of 45%. The spectrum of mutations was predominantly G to T base substitutions, a result that is consistent with previous mutation data derived from aflatoxin-associated HCCs. To assess which DNA polymerases (pol) might contribute to the mutational outcome, in vitro replication studies were performed. Unexpectedly, replicative pol δ and the error-prone translesion synthesis pol ζ were able to accurately bypass AFB1-N7-Gua. In contrast, replication bypass using pol κ was shown to occur with low fidelity and could account for the commonly detected G to T transversions.

  12. Association between mutation spectra and stable and unstable DNA adduct profiles in Salmonella for benzo[a]pyrene and dibenzo[a,l]pyrene

    Energy Technology Data Exchange (ETDEWEB)

    DeMarini, David M., E-mail: demarini.david@epa.gov [Integrated Systems Toxicology Division, U.S. Environmental Protection Agency, Research Triangle Park, NC 27711 (United States); Hanley, Nancy M.; Warren, Sarah H.; Adams, Linda D.; King, Leon C. [Integrated Systems Toxicology Division, U.S. Environmental Protection Agency, Research Triangle Park, NC 27711 (United States)

    2011-09-01

    Highlights: {yields} Benzo[a]pyrene (BP) induces stable DNA adducts and mutations primarily at guanine. {yields} Dibenzo[a,l]pyrene (DBP) induces them primarily at adenine. {yields} BP induces abasic sites, but DBP does not in the Salmonella mutagenicity assay. {yields} Stable DNA adducts alone appear to account for the mutation spectrum of DBP. {yields} Stable DNA adducts and possibly abasic sites account for the mutation spectrum of BP. - Abstract: Benzo[a]pyrene (BP) and dibenzo[a,l]pyrene (DBP) are two polycyclic aromatic hydrocarbons (PAHs) that exhibit distinctly different mutagenicity and carcinogenicity profiles. Although some studies show that these PAHs produce unstable DNA adducts, conflicting data and arguments have been presented regarding the relative roles of these unstable adducts versus stable adducts, as well as oxidative damage, in the mutagenesis and tumor-mutation spectra of these PAHs. However, no study has determined the mutation spectra along with the stable and unstable DNA adducts in the same system with both PAHs. Thus, we determined the mutagenic potencies and mutation spectra of BP and DBP in strains TA98, TA100 and TA104 of Salmonella, and we also measured the levels of abasic sites (aldehydic-site assay) and characterized the stable DNA adducts ({sup 32}P-postlabeling/HPLC) induced by these PAHs in TA104. Our results for the mutation spectra and site specificity of stable adducts were consistent with those from other systems, showing that DBP was more mutagenic than BP in TA98 and TA100. The mutation spectra of DBP and BP were significantly different in TA98 and TA104, with 24% of the mutations induced by BP in TA98 being complex frameshifts, whereas DBP produced hardly any of these mutations. In TA104, BP produced primarily GC to TA transversions, whereas DBP produced primarily AT to TA transversions. The majority (96%) of stable adducts induced by BP were at guanine, whereas the majority (80%) induced by DBP were at adenine

  13. Identification of chromosomal errors in human preimplantation embryos with oligonucleotide DNA microarray.

    Directory of Open Access Journals (Sweden)

    Lifeng Liang

    Full Text Available A previous study comparing the performance of different platforms for DNA microarray found that the oligonucleotide (oligo microarray platform containing 385K isothermal probes had the best performance when evaluating dosage sensitivity, precision, specificity, sensitivity and copy number variations border definition. Although oligo microarray platform has been used in some research fields and clinics, it has not been used for aneuploidy screening in human embryos. The present study was designed to use this new microarray platform for preimplantation genetic screening in the human. A total of 383 blastocysts from 72 infertility patients with either advanced maternal age or with previous miscarriage were analyzed after biopsy and microarray. Euploid blastocysts were transferred to patients and clinical pregnancy and implantation rates were measured. Chromosomes in some aneuploid blastocysts were further analyzed by fluorescence in-situ hybridization (FISH to evaluate accuracy of the results. We found that most (58.1% of the blastocysts had chromosomal abnormalities that included single or multiple gains and/or losses of chromosome(s, partial chromosome deletions and/or duplications in both euploid and aneuploid embryos. Transfer of normal euploid blastocysts in 34 cycles resulted in 58.8% clinical pregnancy and 54.4% implantation rates. Examination of abnormal blastocysts by FISH showed that all embryos had matching results comparing microarray and FISH analysis. The present study indicates that oligo microarray conducted with a higher resolution and a greater number of probes is able to detect not only aneuploidy, but also minor chromosomal abnormalities, such as partial chromosome deletion and/or duplication in human embryos. Preimplantation genetic screening of the aneuploidy by DNA microarray is an advanced technology used to select embryos for transfer and improved embryo implantation can be obtained after transfer of the screened normal

  14. Defining the sequence specificity of DNA-binding proteins by selecting binding sites from random-sequence oligonucleotides: analysis of yeast GCN4 protein.

    OpenAIRE

    Oliphant, A R; Brandl, C J; Struhl, K

    1989-01-01

    We describe a new method for accurately defining the sequence recognition properties of DNA-binding proteins by selecting high-affinity binding sites from random-sequence DNA. The yeast transcriptional activator protein GCN4 was coupled to a Sepharose column, and binding sites were isolated by passing short, random-sequence oligonucleotides over the column and eluting them with increasing salt concentrations. Of 43 specifically bound oligonucleotides, 40 contained the symmetric sequence TGA(C...

  15. SYNTHESIS OF THE FULLY PROTECTED PHOSPHORAMIDITE OF THE BENZENE-DNA ADDUCT, N2- (4-HYDROXYPHENYL)-2'-DEOXYGUANOSINE AND INCORPORATION OF THE LATER INTO DNA OLIGOMERS

    Energy Technology Data Exchange (ETDEWEB)

    Chenna, Ahmed; Gupta, Ramesh C.; Bonala, Radha R.; Johnson, Francis; Huang, Bo

    2008-06-09

    N2-(4-Hydroxyphenyl)-2'-deoxyguanosine-5'-O-DMT-3'-phosphoramidite has been synthesized and used to incorporate the N2-(4-hydroxyphenyl)-2'-dG (N2-4-HOPh-dG) into DNA, using solid-state synthesis technology. The key step to obtaining the xenonucleoside is a palladium (Xantphos-chelated) catalyzed N2-arylation (Buchwald-Hartwig reaction) of a fully protected 2'-deoxyguanosine derivative by 4-isobutyryloxybromobenzene. The reaction proceeded in good yield and the adduct was converted to the required 5'-O-DMT-3'-O-phosphoramidite by standard methods. The latter was used to synthesize oligodeoxynucleotides in which the N2-4-HOPh-dG adduct was incorporated site-specifically. The oligomers were purified by reverse-phase HPLC. Enzymatic hydrolysis and HPLC analysis confirmed the presence of this adduct in the oligomers.

  16. Reactivity of monofunctional cis-platinum adducts as a function of DNA sequence.

    Science.gov (United States)

    Malinge, J M; Leng, M

    1988-08-11

    The purpose of this work was to study the chemical reactivity of monofunctional cis-platinum-nucleic acid adducts as a function of nucleic acid sequence. The first part of the paper deals with the formation of these adducts. It is shown that the ternary nucleic acid-cis-platinum-ethidium bromide complexes in which ethidium bromide and nucleotide residues are cross-linked by cis-platinum, are relatively unstable at 37 degrees C. In the presence of acridine, ethidium bromide (but not cis-platinum) is slowly released which leads to the formation of monofunctional cis-platinum-nucleic acid adducts. After removal of acridine, the monofunctional adducts react further to become bifunctional. The second part of the paper deals with the kinetics of disappearance of the monofunctional adducts in several polynucleotides but not in poly(dG).poly(dC). When the adducts possess a chloride ligand, the limiting step in the cross-linking is the rate of aquation reaction of the chloride ligand. The rate constants are an order of magnitude larger when the monofunctional adducts do not possess a chloride ligand. In both the cases, the rate constants are apparently independent of the nucleic acid sequence.

  17. Synthetic oligonucleotides with particular base sequences from the cDNA encoding proteins of Mycobacterium bovis BCG induce interferons and activate natural killer cells.

    Science.gov (United States)

    Tokunaga, T; Yano, O; Kuramoto, E; Kimura, Y; Yamamoto, T; Kataoka, T; Yamamoto, S

    1992-01-01

    Thirteen kinds of 45-mer single-stranded oligonucleotide, having sequence randomly selected from the known cDNA encoding BCG proteins, were tested for their capability to augment natural killer (NK) cell activity of mouse spleen cells in vitro. Six out of the 13 oligonucleotides showed the activity, while the others did not. In order to know the minimal and essential sequence(s) responsible for the biological activity, 2 kinds of 30-mer and 5 kinds of 15-mer oligonucleotide fragments of an active 45-mer nucleotide were tested for their activity. One of the 30-mer oligonucleotides, designated BCG-A4a, was active, but the other 30-mer was inactive. All of the 15-mer oligonucleotide fragments were inactive. The BCG-A4a also stimulated the spleen cells to produce interferon (IFN)-alpha and -gamma. An experiment using anti-IFN antisera showed that the NK cell activation by the oligonucleotide was ascribed to the IFN-alpha produced. It was noticed that all of the biologically active oligonucleotides possessed one or more palindrome sequence(s), and the inactive ones did not, with an exception of a 45-mer inactive oligonucleotide containing overlapping palindrome sequences (GGGCCCGGG). These findings strongly suggest that certain palindrome sequences, like GACGTC, GGCGCC and TGCGCA, are essential for 30-mer oligonucleotides, like BCG-A4a, to induce IFNs.

  18. An integrated QSAR-PBK/D modelling approach for predicting detoxification and DNA adduct formation of 18 acyclic food-borne α,β-unsaturated aldehydes.

    Science.gov (United States)

    Kiwamoto, R; Spenkelink, A; Rietjens, I M C M; Punt, A

    2015-01-01

    Acyclic α,β-unsaturated aldehydes present in food raise a concern because the α,β-unsaturated aldehyde moiety is considered a structural alert for genotoxicity. However, controversy remains on whether in vivo at realistic dietary exposure DNA adduct formation is significant. The aim of the present study was to develop physiologically based kinetic/dynamic (PBK/D) models to examine dose-dependent detoxification and DNA adduct formation of a group of 18 food-borne acyclic α,β-unsaturated aldehydes without 2- or 3-alkylation, and with no more than one conjugated double bond. Parameters for the PBK/D models were obtained using quantitative structure-activity relationships (QSARs) defined with a training set of six selected aldehydes. Using the QSARs, PBK/D models for the other 12 aldehydes were defined. Results revealed that DNA adduct formation in the liver increases with decreasing bulkiness of the molecule especially due to less efficient detoxification. 2-Propenal (acrolein) was identified to induce the highest DNA adduct levels. At realistic dietary intake, the predicted DNA adduct levels for all aldehydes were two orders of magnitude lower than endogenous background levels observed in disease free human liver, suggesting that for all 18 aldehydes DNA adduct formation is negligible at the relevant levels of dietary intake. The present study provides a proof of principle for the use of QSAR-based PBK/D modelling to facilitate group evaluations and read-across in risk assessment.

  19. Complex relationships between occupation, environment, DNA adducts, genetic polymorphisms and bladder cancer in a case-control study using a structural equation modeling.

    Science.gov (United States)

    Porru, Stefano; Pavanello, Sofia; Carta, Angela; Arici, Cecilia; Simeone, Claudio; Izzotti, Alberto; Mastrangelo, Giuseppe

    2014-01-01

    DNA adducts are considered an integrate measure of carcinogen exposure and the initial step of carcinogenesis. Their levels in more accessible peripheral blood lymphocytes (PBLs) mirror that in the bladder tissue. In this study we explore whether the formation of PBL DNA adducts may be associated with bladder cancer (BC) risk, and how this relationship is modulated by genetic polymorphisms, environmental and occupational risk factors for BC. These complex interrelationships, including direct and indirect effects of each variable, were appraised using the structural equation modeling (SEM) analysis. Within the framework of a hospital-based case/control study, study population included 199 BC cases and 213 non-cancer controls, all Caucasian males. Data were collected on lifetime smoking, coffee drinking, dietary habits and lifetime occupation, with particular reference to exposure to aromatic amines (AAs) and polycyclic aromatic hydrocarbons (PAHs). No indirect paths were found, disproving hypothesis on association between PBL DNA adducts and BC risk. DNA adducts were instead positively associated with occupational cumulative exposure to AAs (p = 0.028), whereas XRCC1 Arg 399 (poccupational cumulative exposure to AAs with DNA adducts and BC risk, strengthening the central role of AAs in bladder carcinogenesis. However the lack of an association between PBL DNA adducts and BC risk advises that these snapshot measurements are not representative of relevant exposures. This would envisage new scenarios for biomarker discovery and new challenges such as repeated measurements at different critical life stages.

  20. Evaluation of Interindividual Human Variation in Bioactivation and DNA Adduct Formation of Estragole in Liver Predicted by Physiologically Based Kinetic/Dynamic and Monte Carlo Modeling.

    Science.gov (United States)

    Punt, Ans; Paini, Alicia; Spenkelink, Albertus; Scholz, Gabriele; Schilter, Benoit; van Bladeren, Peter J; Rietjens, Ivonne M C M

    2016-04-18

    Estragole is a known hepatocarcinogen in rodents at high doses following metabolic conversion to the DNA-reactive metabolite 1'-sulfooxyestragole. The aim of the present study was to model possible levels of DNA adduct formation in (individual) humans upon exposure to estragole. This was done by extending a previously defined PBK model for estragole in humans to include (i) new data on interindividual variation in the kinetics for the major PBK model parameters influencing the formation of 1'-sulfooxyestragole, (ii) an equation describing the relationship between 1'-sulfooxyestragole and DNA adduct formation, (iii) Monte Carlo modeling to simulate interindividual human variation in DNA adduct formation in the population, and (iv) a comparison of the predictions made to human data on DNA adduct formation for the related alkenylbenzene methyleugenol. Adequate model predictions could be made, with the predicted DNA adduct levels at the estimated daily intake of estragole of 0.01 mg/kg bw ranging between 1.6 and 8.8 adducts in 10(8) nucleotides (nts) (50th and 99th percentiles, respectively). This is somewhat lower than values reported in the literature for the related alkenylbenzene methyleugenol in surgical human liver samples. The predicted levels seem to be below DNA adduct levels that are linked with tumor formation by alkenylbenzenes in rodents, which were estimated to amount to 188-500 adducts per 10(8) nts at the BMD10 values of estragole and methyleugenol. Although this does not seem to point to a significant health concern for human dietary exposure, drawing firm conclusions may have to await further validation of the model's predictions.

  1. Fibre-induced lipid peroxidation leads to DNA adduct formation in Salmonella typhimurium TA104 and rat lung fibroblasts.

    Science.gov (United States)

    Howden, P J; Faux, S P

    1996-03-01

    Certain end-products of lipid peroxidation bind to DNA forming a fluorescent chromophore. Incubation of both Salmonella typhimurium TA104 and a rat lung fibroblast cell line, RFL-6, with various types of mineral fibre resulted in a time- and dose-dependent increase in DNA fluorescence. The increase in DNA fluorescence was shown to be directly related to the amount of iron that could be mobilized from the fibre surface using in vitro studies in the absence of cells or bacteria. Crocidolite and man-made vitreous fibre-21 (MMVF-21) mobilized significant quantities of iron and were significantly more active than chrysotile and refactory ceramic fibre-1 (RCF-1). Fibre-induced malondialdehyde-DNA adduct formation, the fluorescent product, was increased by incubating cells with buthionine sulfoximine and ameliorated by co-treatment with N-acetylcysteine, indicating a protective role for glutathione. Similarly, vitamin E was also shown to inhibit DNA adduct formation. These results suggest that mineral fibre-induced lipid peroxidation produced genotoxic products which can diffuse into nucleus and interact with cellular DNA. In conclusion, fibre-induced lipid peroxidation may be a possible mechanism in the genotoxic action of fibrous materials.

  2. Interfacing click chemistry with automated oligonucleotide synthesis for the preparation of fluorescent DNA probes containing internal xanthene and cyanine dyes.

    Science.gov (United States)

    Astakhova, I Kira; Wengel, Jesper

    2013-01-14

    Double-labeled oligonucleotide probes containing fluorophores interacting by energy-transfer mechanisms are essential for modern bioanalysis, molecular diagnostics, and in vivo imaging techniques. Although bright xanthene and cyanine dyes are gaining increased prominence within these fields, little attention has thus far been paid to probes containing these dyes internally attached, a fact which is mainly due to the quite challenging synthesis of such oligonucleotide probes. Herein, by using 2'-O-propargyl uridine phosphoramidite and a series of xanthenes and cyanine azide derivatives, we have for the first time performed solid-phase copper(I)-catalyzed azide-alkyne cycloaddition (CuAAC) click labeling during the automated phosphoramidite oligonucleotide synthesis followed by postsynthetic click reactions in solution. We demonstrate that our novel strategy is rapid and efficient for the preparation of novel oligonucleotide probes containing internally positioned xanthene and cyanine dye pairs and thus represents a significant step forward for the preparation of advanced fluorescent oligonucleotide probes. Furthermore, we demonstrate that the novel xanthene and cyanine labeled probes display unusual and very promising photophysical properties resulting from energy-transfer interactions between the fluorophores controlled by nucleic acid assembly. Potential benefits of using these novel fluorescent probes within, for example, molecular diagnostics and fluorescence microscopy include: Considerable Stokes shifts (40-110 nm), quenched fluorescence of single-stranded probes accompanied by up to 7.7-fold light-up effect of emission upon target DNA/RNA binding, remarkable sensitivity to single-nucleotide mismatches, generally high fluorescence brightness values (FB up to 26), and hence low limit of target detection values (LOD down to <5 nM).

  3. Increased levels of the acetaldehyde-derived DNA adduct N 2-ethyldeoxyguanosine in oral mucosa DNA from Rhesus monkeys exposed to alcohol.

    Science.gov (United States)

    Balbo, Silvia; Juanes, Rita Cervera; Khariwala, Samir; Baker, Erich J; Daunais, James B; Grant, Kathleen A

    2016-09-01

    Alcohol is a human carcinogen. A causal link has been established between alcohol drinking and cancers of the upper aerodigestive tract, colon, liver and breast. Despite this established association, the underlying mechanisms of alcohol-induced carcinogenesis remain unclear. Various mechanisms may come into play depending on the type of cancer; however, convincing evidence supports the concept that ethanol's major metabolite acetaldehyde may play a major role. Acetaldehyde can react with DNA forming adducts which can serve as biomarkers of carcinogen exposure and potentially of cancer risk. The major DNA adduct formed from this reaction is N (2)-ethylidenedeoxyguanosine, which can be quantified as its reduced form N (2)-ethyl-dG by LC-ESI-MS/MS. To investigate the potential use of N (2)-ethyl-dG as a biomarker of alcohol-induced DNA damage, we quantified this adduct in DNA from the oral, oesophageal and mammary gland tissues from rhesus monkeys exposed to alcohol drinking over their lifetimes and compared it to controls. N (2)-Ethyl-dG levels were significantly higher in the oral mucosa DNA of the exposed animals. Levels of the DNA adduct measured in the oesophageal mucosa of exposed animals were not significantly different from controls. A correlation between the levels measured in the oral and oesophageal DNA, however, was observed, suggesting a common source of formation of the DNA adducts. N (2) -Ethyl-dG was measured in mammary gland DNA from a small cohort of female animals, but no difference was observed between exposed animals and controls. These results support the hypothesis that acetaldehyde induces DNA damage in the oral mucosa of alcohol-exposed animals and that it may play role in the alcohol-induced carcinogenic process. The decrease of N (2)-ethyl-dG levels in exposed tissues further removed from the mouth also suggests a role of alcohol metabolism in the oral cavity, which may be considered separately from ethanol liver metabolism in the

  4. A physiologically based in silico model for trans-2-hexenal detoxification and DNA adduct formation in human including interindividual variation indicates efficient detoxification and a negligible genotoxicity risk.

    Science.gov (United States)

    Kiwamoto, R; Spenkelink, A; Rietjens, I M C M; Punt, A

    2013-09-01

    A number of α,β-unsaturated aldehydes are present in food both as natural constituents and as flavouring agents. Their reaction with DNA due to their electrophilic α,β-unsaturated aldehyde moiety may result in genotoxicity as observed in some in vitro models, thereby raising a safety concern. A question that remains is whether in vivo detoxification would be efficient enough to prevent DNA adduct formation and genotoxicity. In this study, a human physiologically based kinetic/dynamic (PBK/D) model of trans-2-hexenal (2-hexenal), a selected model α,β-unsaturated aldehyde, was developed to examine dose-dependent detoxification and DNA adduct formation in humans upon dietary exposure. The kinetic model parameters for detoxification were quantified using relevant pooled human tissue fractions as well as tissue fractions from 11 different individual subjects. In addition, a Monte Carlo simulation was performed so that the impact of interindividual variation in 2-hexenal detoxification on the DNA adduct formation in the population as a whole could be examined. The PBK/D model revealed that DNA adduct formation due to 2-hexenal exposure was 0.039 adducts/10⁸ nucleotides (nt) at the estimated average 2-hexenal dietary intake (0.04 mg 2-hexenal/kg bw) and 0.18 adducts/10⁸ nt at the 95th percentile of the dietary intake (0.178 mg 2-hexenal/kg bw) in the most sensitive people. These levels are three orders of magnitude lower than natural background DNA adduct levels that have been reported in disease-free humans (6.8-110 adducts/10⁸ nt), suggesting that the genotoxicity risk for the human population at realistic dietary daily intakes of 2-hexenal may be negligible.

  5. Ultraviolet cross-linking of helical oligonucleotides to two monoclonal MRL-1pr/1pr anti-DNA autoantibodies. Variations in H and L chain binding to DNA

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Y.J.; Stollar, B.D. (Tufts Univ., Boston, MA (USA))

    1990-11-15

    Experiments were performed to determine whether both H and L chains of different anti-native DNA autoantibodies are uniformly involved in binding to DNA. Two purified monoclonal mouse (MRL-1pr/1pr) IgG autoantibodies, H241 and 2C10, were tested. They both bound synthetic helical oligonucleotides of 10 to 20 base pairs in a gel electrophoresis retardation assay but differed in their preferences for given base sequences. Exposure of antibody-radiolabeled oligonucleotide mixtures to UV light (254 nm) for 10 min led to specific covalent cross-linking of oligonucleotide to both the H and the L chains of H241 but only to the H chain of 2C10. Single labeling events were detected without higher aggregation. The oligonucleotides were not cross-linked to unrelated IgG, even after 2 h of irradiation. Cross-linked (radioactively labeled) H and L chains of H241 and 2C10 were isolated from denaturing electrophoresis gels and digested with lysyl endopeptidase and/or staphylococcal V8 protease. H241 and 2C10 H chains each yielded a major labeled peptide fragment, but the peptides from the two antibodies were different. These experiments measured only some of the antibody-DNA interactions, probably with bases in the major groove of the DNA. They indicated that two MRL-1pr/1pr IgG anti-native DNA antibodies differ in their H and L chain contacts with DNA and provide an approach to identifying affinity-labeled binding sites in the antibodies.

  6. Bulky DNA Adducts in Cord Blood, Maternal Fruit-and-Vegetable Consumption, and Birth Weight in a European Mother-Child Study (NewGeneris)

    DEFF Research Database (Denmark)

    Pedersen, Marie; Schoket, Bernadette; Godschalk, Roger W

    2013-01-01

    , Greece, Norway, and Spain were recruited in 2006-2010. Adduct levels were measured by the 32P-postlabeling technique in white blood cells from 229 mothers and 612 newborns. Maternal diet was examined through questionnaires.Results: Adduct levels in maternal and cord blood samples were similar...... versus lowest tertile of adducts. The negative association with birth weight was limited to births in Norway, Denmark, and England, the countries with the lowest adduct levels, and was more pronounced in births to mothers with low intake of fruits and vegetables (-248 g; 95% CI: -405, -92 g) compared......, Kleinjans JC, Segerbäck D, Kogevinas M. 2013. Bulky DNA adducts in cord blood, maternal fruit-and-vegetable consumption, and birth weight in a European mother-child study (NewGeneris). Environ Health Perspect 121:1200-1206; http://dx.doi.org/10.1289/ehp.1206333....

  7. Spectroscopic studies on the formation and thermal stability of DNA triplexes with a benzoannulated delta-carboline-oligonucleotide conjugate.

    Science.gov (United States)

    Eick, Andrea; Xiao, Zhou; Langer, Peter; Weisz, Klaus

    2008-10-15

    A benzoannulated delta-carboline with a phenyl substituent has been covalently tethered to the 3'-end of a triplex-forming oligonucleotide and its ability to bind and stabilize DNA triple helices has been examined by various spectroscopic methods. UV thermal melting experiments were conducted with different hairpin duplexes and with a complementary single-stranded oligonucleotide as targets for the conjugate. The delta-carboline ligand preferentially binds triplexes over duplexes and leads to a temperature increase of the triplex-to-duplex transition by up to 23 degrees C. The results obtained from UV, CD and fluorescence measurements suggest that the delta-carboline ligand exhibits specific interactions with a triplex and favors binding by intercalation at the triplex-duplex junction.

  8. 乙烯基DNA加合物检测技术研究%Analytical Method for Etheno DNA Adducts

    Institute of Scientific and Technical Information of China (English)

    田永峰; 侯宏卫; 刘勇; 胡清源; 王安

    2012-01-01

    In order to deeply study etheno-DNA adducts, The variety of DNA oxidative damages, repair mechanisms, and their products are summarized. The generative mechanism in vivo and analytical method of etheno-DNA adducts, including 1, N6-ethenoadenine (eAde), 1, N2- ethenoguanine (εGua), and 3, N4-ethenocytosine (εCyt) are reviewed. The current analytical methods of etheno-DNA adducts have been discussed, which include lmmunoaffinity Chromatography/32p-postlabelling technique (IC-32P), Gas Chromatogeraph-Mass Spectrometer (GC-MS). and liquid Chromatography-tandem Mass Spectrometer (LC-MS/MS). IC-32phas the excellent performance on the sensibility, but when determining etheno-DNA adducts, complex operations and many steps have been involved. As analytical devices, the characteristics of mass spectrometer make the device obtain ideal sensibility and specificity. GC-MS method has the lower limit of determination than that for IX-MS/MS method. As sample derivatization is needed, the sample usually cost more for the method of GC-MS during the pre-handling; LC-MS/MS method offers many practical advantages on the pre-handing, stability, selectivity, and sensibility. These advantages could enhance the efficiency of samples analysis. IX-MS/MS is the ideal analytical method for the research on etheno-DNA adducts. The mechanism of DNA oxidative damage is inconclusive. As the biomarkers of DNA oxidative damages, etheno-DNA adducts possess significant meanings on the risk evaluation of lipid peroxidation.%为了深入的研究乙烯基DNA加台物,本文综述了DNA氧化损伤的种类、修复机制和产物以及3种乙烯基DNA加台物:乙烯基腺嘌呤(1,N6-ethenoadenine,εAde)、乙烯基鸟嘌呤(1.N2-ethenoguanine,εGua)和乙烯基胞嘧啶(3,N4-ethenocytosine,εcyt)的体内生成机制.讨论了目前检测乙烯基DNA加合物的方法,如32P-标记法,气相色谱-质谱法,液相色谱-串联质谱法等.32P-标记法在检测灵敏度方面表现

  9. DNA adducts induced by food mutagen PhIP in a mouse model expressing human sulfotransferases 1A1 and 1A2.

    Science.gov (United States)

    Høie, Anja Hortemo; Monien, Bernhard Hans; Glatt, Hansruedi; Hjertholm, Hege; Husøy, Trine

    2016-04-25

    Food processing contaminant 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) has previously been shown to induce formation of DNA adducts in vivo. In a previous study the adduct levels were found to increase in a mouse model expressing human (h) sulfotransferases (SULTs) 1A1 and 1A2 after PhIP exposure, detected by (32)P-postlabelling. Isotope dilution ultra performance liquid chromatography coupled with tandem mass spectrometry (UPLC-MS/MS) is emerging as the method of choice for selective and reproducible detection of known DNA adducts. In the present study we investigated the level and distribution of PhIP induced DNA adducts in male FVB mice 9-11 weeks of age with hSULT mice or wild-type mice (wt) using UPLC-MS/MS. Mice received a single administration of 75 mg/kg bw PhIP by oral gavage, and DNA was analysed 3h after exposure. C8-(2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine- N(2)-yl)-2'-deoxyguanosine (C8-PhIP-dG) adduct levels are significantly higher in PhIP exposed hSULT mice compared with PhIP exposed wt mice. The liver was the least affected organ in wild-type mice, whereas it was the most affected organ in hSULT mice with a 14-fold higher adduct level.

  10. A High-Fidelity Codon Set for the T4 DNA Ligase-Catalyzed Polymerization of Modified Oligonucleotides.

    Science.gov (United States)

    Lei, Yi; Kong, Dehui; Hili, Ryan

    2015-12-14

    In vitro selection of nucleic acid polymers can readily deliver highly specific receptors and catalysts for a variety of applications; however, it is suspected that the functional group deficit of nucleic acids has limited their potential with respect to proteinogenic polymers. This has stimulated research toward expanding their chemical diversity to bridge the functional gap between nucleic acids and proteins to develop a superior biopolymer. In this study, we investigate the effect of codon library size and composition on the sequence specificity of T4 DNA ligase in the DNA-templated polymerization of both unmodified and modified oligonucleotides. Using high-throughput DNA sequencing of duplex pairs, we have uncovered a 256-membered codon set that yields sequence-defined modified ssDNA polymers in high yield and with high fidelity.

  11. Transfer of Two-Dimensional Oligonucleotide Patterns onto Stereocontrolled Plasmonic Nanostructures through DNA-Origami-Based Nanoimprinting Lithography.

    Science.gov (United States)

    Zhang, Yinan; Chao, Jie; Liu, Huajie; Wang, Fei; Su, Shao; Liu, Bing; Zhang, Lan; Shi, Jiye; Wang, Lihua; Huang, Wei; Wang, Lianhui; Fan, Chunhai

    2016-07-04

    The precise functionalization of self-assembled nanostructures with spatial and stereocontrol is a major objective of nanotechnology and holds great promise for many applications. Herein, the nanoscale addressability of DNA origami was exploited to develop a precise copy-machine-like platform that can transfer two-dimensional oligonucleotide patterns onto the surface of gold nanoparticles (AuNPs) through a deliberately designed toehold-initiated DNA displacement reaction. This strategy of DNA-origami-based nanoimprinting lithography (DONIL) demonstrates high precision in controlling the valence and valence angles of AuNPs. These DNA-decorated AuNPs act as precursors in the construction of discrete AuNP clusters with desired chirality.

  12. Tamoxifen Forms DNA Adducts In Human Colon After Administration Of A Single [14C]-Labeled Therapeutic Dose.

    Energy Technology Data Exchange (ETDEWEB)

    Brown, K; Tompkins, E M; Boocock, D J; Martin, E A; Farmer, P B; Turteltaub, K W; Ubick, E; Hemingway, D; Horner-Glister, E; White, I H

    2007-05-23

    Tamoxifen is widely prescribed for the treatment of breast cancer and is also licensed in the U.S. for the prevention of this disease. However, tamoxifen therapy is associated with an increased occurrence of endometrial cancer in women and there is also evidence that it may elevate the risk of colorectal cancer. The underlying mechanisms responsible for tamoxifen-induced carcinogenesis in women have not yet been elucidated but much interest has focussed on the role of DNA adduct formation. We investigated the propensity of tamoxifen to bind irreversibly to colorectal DNA when given to ten women as a single [{sup 14}C]-labeled therapeutic (20 mg) dose, {approx}18 h prior to undergoing colon resections. Using the sensitive technique of accelerator mass spectrometry, coupled with HPLC separation of enzymatically digested DNA, a peak corresponding to authentic dG-N{sup 2}-tamoxifen adduct was detected in samples from three patients, at levels ranging from 1-7 adducts/10{sup 9} nucleotides. No [{sup 14}C]-radiolabel associated with tamoxifen or its major metabolites was detected. The presence of detectable CYP3A4 protein in all colon samples suggests this tissue has the potential to activate tamoxifen to {alpha}-hydroxytamoxifen, in addition to that occurring in the systemic circulation, and direct interaction of this metabolite with DNA could account for the binding observed. Although the level of tamoxifeninduced damage displayed a degree of inter-individual variability, when present it was {approx}10-100 times higher than that reported for other suspect human colon carcinogens such as PhIP. These findings provide a mechanistic basis through which tamoxifen could increase the incidence of colon cancers in women.

  13. An integrated QSAR-PBK/D modelling approach for predicting detoxification and DNA adduct formation of 18 acyclic food-borne α,β-unsaturated aldehydes

    Energy Technology Data Exchange (ETDEWEB)

    Kiwamoto, R., E-mail: reiko.kiwamoto@wur.nl; Spenkelink, A.; Rietjens, I.M.C.M.; Punt, A.

    2015-01-01

    Acyclic α,β-unsaturated aldehydes present in food raise a concern because the α,β-unsaturated aldehyde moiety is considered a structural alert for genotoxicity. However, controversy remains on whether in vivo at realistic dietary exposure DNA adduct formation is significant. The aim of the present study was to develop physiologically based kinetic/dynamic (PBK/D) models to examine dose-dependent detoxification and DNA adduct formation of a group of 18 food-borne acyclic α,β-unsaturated aldehydes without 2- or 3-alkylation, and with no more than one conjugated double bond. Parameters for the PBK/D models were obtained using quantitative structure–activity relationships (QSARs) defined with a training set of six selected aldehydes. Using the QSARs, PBK/D models for the other 12 aldehydes were defined. Results revealed that DNA adduct formation in the liver increases with decreasing bulkiness of the molecule especially due to less efficient detoxification. 2-Propenal (acrolein) was identified to induce the highest DNA adduct levels. At realistic dietary intake, the predicted DNA adduct levels for all aldehydes were two orders of magnitude lower than endogenous background levels observed in disease free human liver, suggesting that for all 18 aldehydes DNA adduct formation is negligible at the relevant levels of dietary intake. The present study provides a proof of principle for the use of QSAR-based PBK/D modelling to facilitate group evaluations and read-across in risk assessment. - Highlights: • Physiologically based in silico models were made for 18 α,β-unsaturated aldehydes. • Kinetic parameters were determined by in vitro incubations and a QSAR approach. • DNA adduct formation was negligible at levels relevant for dietary intake. • The use of QSAR-based PBK/D modelling facilitates group evaluations and read-across.

  14. Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags.

    Science.gov (United States)

    Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

    2014-01-01

    The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method "relay primer-dependent bypass" utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3'-terminus prior to ligation to adjacent oligonucleotides. The second reading method "repeat-dependent bypass" utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3'-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries.

  15. Characterization of Thioether-Linked Protein Adducts of DNA Using a Raney-Ni Mediated Desulfurization Method and Liquid Chromatography-Electrospray-Tandem Mass Spectrometry

    Science.gov (United States)

    Chowdhury, Goutam; Guengerich, F. Peter

    2015-01-01

    This unit contains a complete procedure for the detection and structural characterization of DNA protein crosslinks (DPCs). The procedure also describes an approach for the quantitation of the various structurally distinct DPCs. Although various methods have been described in the literature for labile DPCs, characterization of non-labile adducts remain a challenge. Here we present a novel approach for characterization of both labile and non-labile adducts by the use of a combination of chemical, enzymatic, and mass spectrometric approaches. A Raney Ni-catalyzed reductive desulfurization method was used for removal of the bulky peptide adducts, enzymatic digestion was used to digest the protein to smaller peptides and DNA to nucleosides, and finally LC-ESI-tandem mass spectrometry (MS) was utilized for detection and characterization of nucleoside adducts. PMID:25754888

  16. Acrolein- and 4-Aminobiphenyl-DNA adducts in human bladder mucosa and tumor tissue and their mutagenicity in human urothelial cells.

    Science.gov (United States)

    Lee, Hyun-Wook; Wang, Hsiang-Tsui; Weng, Mao-wen; Hu, Yu; Chen, Wei-sheng; Chou, David; Liu, Yan; Donin, Nicholas; Huang, William C; Lepor, Herbert; Wu, Xue-Ru; Wang, Hailin; Beland, Frederick A; Tang, Moon-shong

    2014-06-15

    Tobacco smoke (TS) is a major cause of human bladder cancer (BC). Two components in TS, 4-aminobiphenyl (4-ABP) and acrolein, which also are environmental contaminants, can cause bladder tumor in rat models. Their role in TS related BC has not been forthcoming. To establish the relationship between acrolein and 4-ABP exposure and BC, we analyzed acrolein-deoxyguanosine (dG) and 4-ABP-DNA adducts in normal human urothelial mucosa (NHUM) and bladder tumor tissues (BTT), and measured their mutagenicity in human urothelial cells. We found that the acrolein-dG levels in NHUM and BTT are 10-30 fold higher than 4-ABP-DNA adduct levels and that the acrolein-dG levels in BTT are 2 fold higher than in NHUM. Both acrolein-dG and 4-ABP-DNA adducts are mutagenic; however, the former are 5 fold more mutagenic than the latter. These two types of DNA adducts induce different mutational signatures and spectra. We found that acrolein inhibits nucleotide excision and base excision repair and induces repair protein degradation in urothelial cells. Since acrolein is abundant in TS, inhaled acrolein is excreted into urine and accumulates in the bladder and because acrolein inhibits DNA repair and acrolein-dG DNA adducts are mutagenic, we propose that acrolein is a major bladder carcinogen in TS.

  17. The role of reactive oxygen species (ROS and cytochrome P-450 2E1 in the generation of carcinogenic etheno-DNA adducts

    Directory of Open Access Journals (Sweden)

    Kirsten Linhart

    2014-01-01

    Full Text Available Exocyclic etheno-DNA adducts are mutagenic and carcinogenic and are formed by the reaction of lipidperoxidation (LPO products such as 4-hydoxynonenal or malondialdehyde with DNA bases. LPO products are generated either via inflammation driven oxidative stress or via the induction of cytochrome P-450 2E1 (CYP2E1. In the liver CYP2E1 is induced by various compounds including free fatty acids, acetone and ethanol. Increased levels of CYP2E1 and thus, oxidative stress are observed in the liver of patients with non-alcoholic steatohepatitis (NASH as well as in the chronic alcoholic. In addition, chronic ethanol ingestion also increases CYP2E1 in the mucosa of the oesophagus and colon. In all these tissues CYP2E1 correlates significantly with the levels of carcinogenic etheno-DNA adducts. In contrast, in patients with non-alcoholic steatohepatitis (NASH hepatic etheno-DNA adducts do not correlate with CYP2E1 indicating that in NASH etheno-DNA adducts formation is predominately driven by inflammation rather than by CYP2E1 induction. Since etheno-DNA adducts are strong mutagens producing various types of base pair substitution mutations as well as other types of genetic damage, it is strongly believed that they are involved in ethanol mediated carcinogenesis primarily driven by the induction of CYP2E1.

  18. Effect of Increased Water Intake on Urinary DNA Adduct Levels and Mutagenicity in Smokers: A Randomized Study

    Directory of Open Access Journals (Sweden)

    Inmaculada Buendia Jimenez

    2015-01-01

    Full Text Available The association between fluid intake and bladder cancer risk remains controversial. Very little is known about to which extent the amount of water intake influences the action of excreting toxics upon the urinary system. This proof of concept trial investigates the effect of water intake on mutagenesis in smokers, a high risk population for bladder cancer. Methods. Monocentric randomized controlled trial. Inclusion Criteria. Male subjects aged 2045–45 y/o, smokers, and small drinkers (24-hour urinary volume 700 mOsmol/kg. Outcomes. 4-ABP DNA adducts formation in exfoliated bladder cells in 24-hour urine collection and urinary mutagenicity in 24-hour urine. Test Group. Subjects consumed 1.5 L daily of the study product (EVIAN on top of their usual water intake for 50 days. Control Group. Subjects continued their usual lifestyle habits. Results. 65 subjects were randomized. Mean age was 30 y/o and mean cigarettes per day were 20. A slight decrease in adducts formation was observed between baseline and last visit but no statistically significant difference was demonstrated between the groups. Urinary mutagenicity significantly decreased. The study shows that increasing water intake decreases urinary mutagenicity. It is not confirmed by urinary adducts formation. Further research would be necessary.

  19. Variation in PAH-related DNA adduct levels among non-smokers: the role of multiple genetic polymorphisms and nucleotide excision repair phenotype.

    Science.gov (United States)

    Etemadi, Arash; Islami, Farhad; Phillips, David H; Godschalk, Roger; Golozar, Asieh; Kamangar, Farin; Malekshah, Akbar Fazel-Tabar; Pourshams, Akram; Elahi, Seerat; Ghojaghi, Farhad; Strickland, Paul T; Taylor, Philip R; Boffetta, Paolo; Abnet, Christian C; Dawsey, Sanford M; Malekzadeh, Reza; van Schooten, Frederik J

    2013-06-15

    Polycyclic aromatic hydrocarbons (PAHs) likely play a role in many cancers even in never-smokers. We tried to find a model to explain the relationship between variation in PAH-related DNA adduct levels among people with similar exposures, multiple genetic polymorphisms in genes related to metabolic and repair pathways, and nucleotide excision repair (NER) capacity. In 111 randomly selected female never-smokers from the Golestan Cohort Study in Iran, we evaluated 21 SNPs in 14 genes related to xenobiotic metabolism and 12 SNPs in eight DNA repair genes. NER capacity was evaluated by a modified comet assay, and aromatic DNA adduct levels were measured in blood by32P-postlabeling. Multivariable regression models were compared by Akaike's information criterion (AIC). Aromatic DNA adduct levels ranged between 1.7 and 18.6 per 10(8) nucleotides (mean: 5.8 ± 3.1). DNA adduct level was significantly lower in homozygotes for NAT2 slow alleles and ERCC5 non-risk-allele genotype, and was higher in the MPO homozygote risk-allele genotype. The sum of risk alleles in these genes significantly correlated with the log-adduct level (r = 0.4, p adduct levels. NER capacity was affected by polymorphisms in the MTHFR and ERCC1 genes. Female non-smokers in this population had PAH-related DNA adduct levels three to four times higher than smokers and occupationally-exposed groups in previous studies, with large inter-individual variation which could best be explained by a combination of Phase I genes and NER capacity.

  20. Complex relationships between occupation, environment, DNA adducts, genetic polymorphisms and bladder cancer in a case-control study using a structural equation modeling.

    Directory of Open Access Journals (Sweden)

    Stefano Porru

    Full Text Available DNA adducts are considered an integrate measure of carcinogen exposure and the initial step of carcinogenesis. Their levels in more accessible peripheral blood lymphocytes (PBLs mirror that in the bladder tissue. In this study we explore whether the formation of PBL DNA adducts may be associated with bladder cancer (BC risk, and how this relationship is modulated by genetic polymorphisms, environmental and occupational risk factors for BC. These complex interrelationships, including direct and indirect effects of each variable, were appraised using the structural equation modeling (SEM analysis. Within the framework of a hospital-based case/control study, study population included 199 BC cases and 213 non-cancer controls, all Caucasian males. Data were collected on lifetime smoking, coffee drinking, dietary habits and lifetime occupation, with particular reference to exposure to aromatic amines (AAs and polycyclic aromatic hydrocarbons (PAHs. No indirect paths were found, disproving hypothesis on association between PBL DNA adducts and BC risk. DNA adducts were instead positively associated with occupational cumulative exposure to AAs (p = 0.028, whereas XRCC1 Arg 399 (p<0.006 was related with a decreased adduct levels, but with no impact on BC risk. Previous findings on increased BC risk by packyears (p<0.001, coffee (p<0.001, cumulative AAs exposure (p = 0.041 and MnSOD (p = 0.009 and a decreased risk by MPO (p<0.008 were also confirmed by SEM analysis. Our results for the first time make evident an association between occupational cumulative exposure to AAs with DNA adducts and BC risk, strengthening the central role of AAs in bladder carcinogenesis. However the lack of an association between PBL DNA adducts and BC risk advises that these snapshot measurements are not representative of relevant exposures. This would envisage new scenarios for biomarker discovery and new challenges such as repeated measurements at different

  1. Reactivity of monofunctional cis-platinum adducts as a function of DNA sequence.

    OpenAIRE

    Malinge, J M; Leng, M

    1988-01-01

    The purpose of this work was to study the chemical reactivity of monofunctional cis-platinum-nucleic acid adducts as a function of nucleic acid sequence. The first part of the paper deals with the formation of these adducts. It is shown that the ternary nucleic acid-cis-platinum-ethidium bromide complexes in which ethidium bromide and nucleotide residues are cross-linked by cis-platinum, are relatively unstable at 37 degrees C. In the presence of acridine, ethidium bromide (but not cis-platin...

  2. Metabolomic profiling unravels DNA adducts in human breast that are formed from peroxidase mediated activation of estrogens to quinone methides.

    Directory of Open Access Journals (Sweden)

    Nilesh W Gaikwad

    Full Text Available Currently there are three major hypotheses that have been proposed for estrogen induced carcinogenicity, however exact etiology remains unknown. Based on the chemical logic, studies were undertaken to investigate if estrogens could generate quinone methides in an oxidative environment which then could cause DNA damage in humans. In presence of MnO2 estrogens were oxidized to quinone methides. Surprisingly quinone methides were found to be stable with t1/2 of 20.8 and 4.5 min respectively. Incubation of estrogens with lactoperoxidase (LPO and H2O2 resulted in formation of respective quinone methides (E1(E2-QM. Subsequent addition of adenine to the assay mixture lead to trapping of E1(E2-QM, resulting in formation of adenine adducts of estrogens, E1(E2-9-N-Ade. Targeted ultra-performance liquid chromatography tandem mass spectrometry (UPLC-MS/MS based metabolomic analysis of the breast tissue extracts showed the presence of adenine adducts of estrogens, E1(E2-9-N-Ade, along with other estrogen related metabolites. Identity of E1(E2-N-Ade in LPO assay extracts and breast tissue extracts were confirmed by comparing them to pure synthesized E1(E2-9-N-Ade standards. From these results, it is evident that peroxidase enzymes or peroxidase-like activity in human breast tissue could oxidize estrogens to electrophilic and stable quinone methides in a single step that covalently bind to DNA to form adducts. The error prone repair of the damaged DNA can result in mutation of critical genes and subsequently cancer. This article reports evidence for hitherto unknown estrogen metabolic pathway in human breast, catalyzed by peroxidase, which could initiate cancer.

  3. Typical signature of DNA damage in white blood cells: a pilot study on etheno adducts in Danish mother-newborn child pairs

    DEFF Research Database (Denmark)

    Arab, K; Pedersen, Marie; Nair, J

    2009-01-01

    The impact of DNA damage commonly thought to be involved in chronic degenerative disease causation is particularly detrimental during fetal development. Within a multicenter study, we analyzed 77 white blood cell (WBC) samples from mother-newborn child pairs to see if imprinting of DNA damage...... in mother and newborn shows a similar pattern. Two adducts 1,N(6)-ethenodeoxyadenosine (epsilondA) and 3,N(4)-ethenodeoxycytidine (epsilondC) were measured by our ultrasensitive immunoaffinity (32)P-post-labeling method. These miscoding etheno-DNA adducts are generated by the reaction of lipid peroxidation...... arising from endogenous reactive aldehydes in WBC of both mother and newborn can be reliably assessed by epsilondA and epsilondC as biomarkers. The high correlation of etheno adduct levels in mother and child WBC suggests that a typical signature of DNA damage is induced similarly in fetus and mother...

  4. Detection and quantitation of benzo(a)pyrene-DNA adducts in brain and liver tissues of Beluga whales (Delphinapterus leucas) from the St. Lawrence and Mackenzie Estuaries

    Energy Technology Data Exchange (ETDEWEB)

    Shugart, L.R.

    1988-01-01

    It should be noted that there are few analytical techniques available for the detection and quantitation of chemical adducts in the DNA of living organisms. The reasons for this are: the analytical technique often has to accommodate the unique chemical and/or physical properties of the individual chemical or its metabolite; the percentage of total chemical that becomes most of the parent compound is usually detoxified and excreted; not all adducts that form between the genotoxic agent and DNA are stable or are involved in the development of subsequent deleterious events in the organism; and the amount of DNA available for analysis is often quite limited. 16 refs., 1 tab.

  5. New Concepts of Fluorescent Probes for Specific Detection of DNA Sequences: Bis-Modified Oligonucleotides in Excimer and Exciplex Detection

    Directory of Open Access Journals (Sweden)

    Gbaj A

    2009-01-01

    Full Text Available The detection of single base mismatches in DNA is important for diagnostics, treatment of genetic diseases, and identification of single nucleotide polymorphisms. Highly sensitive, specific assays are needed to investigate genetic samples from patients. The use of a simple fluorescent nucleoside analogue in detection of DNA sequence and point mutations by hybridisation in solution is described in this study. The 5’-bispyrene and 3’-naphthalene oligonucleotide probes form an exciplex on hybridisation to target in water and the 5’-bispyrene oligonucleotide alone is an adequate probe to determine concentration of target present. It was also indicated that this system has a potential to identify mismatches and insertions. The aim of this work was to investigate experimental structures and conditions that permit strong exciplex emission for nucleic acid detectors, and show how such exciplexes can register the presence of mismatches as required in SNP analysis. This study revealed that the hybridisation of 5'-bispyrenyl fluorophore to a DNA target results in formation of a fluorescent probe with high signal intensity change and specificity for detecting a complementary target in a homogeneous system. Detection of SNP mutations using this split-probe system is a highly specific, simple, and accessible method to meet the rigorous requirements of pharmacogenomic studies. Thus, it is possible for the system to act as SNP detectors and it shows promise for future applications in genetic testing.

  6. Malabaricone C-containing mace extract inhibits safrole bioactivation and DNA adduct formation both in vitro and in vivo.

    Science.gov (United States)

    Martati, Erryana; Boonpawa, Rungnapa; van den Berg, Johannes H J; Paini, Alicia; Spenkelink, Albertus; Punt, Ans; Vervoort, Jacques; van Bladeren, Peter J; Rietjens, Ivonne M C M

    2014-04-01

    Safrole, present in mace and its essential oils, causes liver tumors in rodents at high dose levels due to formation of a DNA reactive 1'-sulfooxysafrole. The present study identifies malabaricone C as a mace constituent able to inhibit safrole DNA adduct formation at the level of sulfotransferase mediated bioactivation. This inhibition was incorporated into physiologically based biokinetic rat and human models. Dosing safrole at 50mg/kg body weight and malabaricone C-containing mace extract at a ratio reflecting the relative presence in mace, and assuming 100% or 1% uptake of malabaricone C-containing mace extract, the model predicted inhibition of 1'-sulfooxysafrole formation for rats and humans by 90% and 100% or 61% and 91%, respectively. To validate the model, mace extract and safrole were co-administered orally to Sprague-Dawley rats. LC-ECI-MS/MS based quantification of DNA adduct levels revealed a significant (padduct formation by malabaricone C-containing mace extract in the liver of rats exposed to safrole. The data obtained were used to perform a refined risk assessment of safrole. Overall, the results suggest a lower tumor incidence when safrole would be tested within a relevant food matrix containing sulfotransferase inhibitors compared to dosing pure safrole.

  7. Chloroethyinitrosourea-derived ethano cytosine and adenine adducts are substrates for escherichia coli glycosylases excising analogous etheno adducts

    Energy Technology Data Exchange (ETDEWEB)

    Guliaev, Anton B.; Singer, B.; Hang, Bo

    2004-05-05

    Exocyclic ethano DNA adducts are saturated etheno ring derivatives formed mainly by therapeutic chloroethylnitrosoureas (CNUs), which are also mutagenic and carcinogenic. In this work, we report that two of the ethano adducts, 3,N{sup 4}-ethanocytosine (EC) and 1,N{sup 6}-ethanoadenine (EA), are novel substrates for the Escherichia coli mismatch-specific uracil-DNA glycosylase (Mug) and 3-methyladenine DNA glycosylase II (AlkA), respectively. It has been shown previously that Mug excises 3,N{sup 4}-ethenocytosine ({var_epsilon}C) and AlkA releases 1,N{sup 6}-ethenoadenine ({var_epsilon}A). Using synthetic oligonucleotides containing a single ethano or etheno adduct, we found that both glycosylases had a {approx}20-fold lower excision activity toward EC or EA than that toward their structurally analogous {var_epsilon}C or {var_epsilon}A adduct. Both enzymes were capable of excising the ethano base paired with any of the four natural bases, but with varying efficiencies. The Mug activity toward EC could be stimulated by E. coli endonuclease IV and, more efficiently, by exonuclease III. Molecular dynamics (MD) simulations showed similar structural features of the etheno and ethano derivatives when present in DNA duplexes. However, also as shown by MD, the stacking interaction between the EC base and Phe 30 in the Mug active site is reduced as compared to the {var_epsilon}C base, which could account for the lower EC activity observed in this study.

  8. An in vitro DNA double-strand break repair assay based on end-joining of defined duplex oligonucleotides.

    Science.gov (United States)

    Datta, Kamal; Purkayastha, Shubhadeep; Neumann, Ronald D; Winters, Thomas A

    2012-01-01

    DNA double-strand breaks (DSBs) are caused by endogenous cellular processes such as oxidative metabolism, or by exogenous events like exposure to ionizing radiation or other genotoxic agents. Repair of these DSBs is essential for the maintenance of cellular genomic integrity. In human cells, and cells of other higher eukaryotes, DSBs are primarily repaired by the nonhomologous end-joining (NHEJ) DSB repair pathway. Most in vitro assays that have been designed to measure NHEJ activity employ linear plasmid DNA as end-joining substrates, and such assays have made significant contributions to our understanding of the biochemical mechanisms of NHEJ. Here we describe an in vitro end-joining assay employing linear oligonucleotides that has distinct advantages over plasmid-based assays for the study of structure-function relationships between the proteins of the NHEJ pathway and synthetic DNA end-joining substrates possessing predetermined DSB configurations and chemistries.

  9. DNA adducts in human and mouse skin maintained in short-term culture and treated with petrol and diesel engine lubricating oils.

    Science.gov (United States)

    Carmichael, P L; Ni Shé, M; Phillips, D H

    1991-05-24

    Human and mouse skin samples maintained in short-term organ culture were treated topically with used engine oils from petrol- and diesel-powered vehicles. Mice were also treated topically in vivo for comparison. DNA was isolated and analysed by 32P-postlabelling and the labeled DNA digests were resolved on polyethyleneimine-cellulose tlc sheets. A large number of radioactive adduct spots were observed in DNA from skin treated with the used petrol-engine oil, indicating the formation of adducts by many components of the complex oil mixture. Total adduct levels were similar in mouse skin (both in vivo and in vitro) and in human skin, although qualitative differences in the adduct maps were apparent between the human and mouse skin DNA. Treatment with the used diesel engine oil produced adduct levels no greater than that of control samples in mouse skin (in vivo and in vitro), although significant levels were found in human skin DNA from one donor. The results correlate well with the carcinogenic activity of these oils in experimental animals, helping to substantiate the conclusion that petrol engine oils (but not diesel engine oils) may present a carcinogenic risk to man if appropriate measures to minimise skin contact are not observed.

  10. The use of nano-sized acicular material, sliding friction, and antisense DNA oligonucleotides to silence bacterial genes.

    Science.gov (United States)

    Mitsudome, Yuya; Takahama, Mamiko; Hirose, Jun; Yoshida, Naoto

    2014-01-01

    Viable bacterial cells impaled with a single particle of a nano-sized acicular material formed when a mixture containing the cells and the material was exposed to a sliding friction field between polystyrene and agar gel; hereafter, we refer to these impaled cells as penetrons. We have used nano-sized acicular material to establish a novel method for bacterial transformation. Here, we generated penetrons that carried antisense DNA adsorbed on nano-sized acicular material (α-sepiolite) by providing sliding friction onto the surface of agar gel; we then investigated whether penetron formation was applicable to gene silencing techniques. Antisense DNA was artificially synthesized as 15 or 90mer DNA oligonucleotides based on the sequences around the translation start codon of target mRNAs. Mixtures of bacterial cells with antisense DNA adsorbed on α-sepiolite were stimulated by sliding friction on the surface of agar gel for 60 s. Upon formation of Escherichia coli penetrons, β-lactamase and β-galactosidase expression was evaluated by counting the numbers of colonies formed on LB agar containing ampicillin and by measuring β-galactosidase activity respectively. The numbers of ampicillin resistant colonies and the β-galactosidase activity derived from penetrons bearing antisense DNA (90mer) was repressed to 15% and 25%, respectively, of that of control penetrons which lacked antisense DNA. Biphenyl metabolite, ring cleavage yellow compound produced by Pseudomonas pseudoalcaligenes penetron treated with antisense oligonucleotide DNA targeted to bphD increased higher than that lacking antisense DNA. This result indicated that expression of bphD in P. pseudoalcaligenes penetrons was repressed by antisense DNA that targeted bphD mRNA. Sporulation rates of Bacillus subtilis penetrons treated with antisense DNA (15mer) targeted to spo0A decreased to 24.4% relative to penetrons lacking antisense DNA. This novel method of gene silencing has substantial promise for

  11. The use of nano-sized acicular material, sliding friction, and antisense DNA oligonucleotides to silence bacterial genes

    Science.gov (United States)

    2014-01-01

    Viable bacterial cells impaled with a single particle of a nano-sized acicular material formed when a mixture containing the cells and the material was exposed to a sliding friction field between polystyrene and agar gel; hereafter, we refer to these impaled cells as penetrons. We have used nano-sized acicular material to establish a novel method for bacterial transformation. Here, we generated penetrons that carried antisense DNA adsorbed on nano-sized acicular material (α-sepiolite) by providing sliding friction onto the surface of agar gel; we then investigated whether penetron formation was applicable to gene silencing techniques. Antisense DNA was artificially synthesized as 15 or 90mer DNA oligonucleotides based on the sequences around the translation start codon of target mRNAs. Mixtures of bacterial cells with antisense DNA adsorbed on α-sepiolite were stimulated by sliding friction on the surface of agar gel for 60 s. Upon formation of Escherichia coli penetrons, β-lactamase and β-galactosidase expression was evaluated by counting the numbers of colonies formed on LB agar containing ampicillin and by measuring β-galactosidase activity respectively. The numbers of ampicillin resistant colonies and the β-galactosidase activity derived from penetrons bearing antisense DNA (90mer) was repressed to 15% and 25%, respectively, of that of control penetrons which lacked antisense DNA. Biphenyl metabolite, ring cleavage yellow compound produced by Pseudomonas pseudoalcaligenes penetron treated with antisense oligonucleotide DNA targeted to bphD increased higher than that lacking antisense DNA. This result indicated that expression of bphD in P. pseudoalcaligenes penetrons was repressed by antisense DNA that targeted bphD mRNA. Sporulation rates of Bacillus subtilis penetrons treated with antisense DNA (15mer) targeted to spo0A decreased to 24.4% relative to penetrons lacking antisense DNA. This novel method of gene silencing has substantial promise for

  12. Structure and mechanism of error-free replication past the major benzo[a]pyrene adduct by human DNA polymerase κ.

    Science.gov (United States)

    Jha, Vikash; Bian, Chuanbing; Xing, Guangxin; Ling, Hong

    2016-06-02

    Benzo[a]pyrene (BP) is a well-known and frequently encountered carcinogen which generates a bulky DNA adduct (+)-trans-10S-BP-N(2)-dG (BP-dG) in cells. DNA polymerase kappa (polκ) is the only known Y-family polymerase that bypasses BP-dG accurately and thus protects cells from genotoxic BP. Here, we report the structures of human polκ in complex with DNA containing either a normal guanine (G) base or a BP-dG adduct at the active site and a correct deoxycytidine. The structures and supporting biochemical data reveal a unique mechanism for accurate replication by translesion synthesis past the major bulky adduct. The active site of polκ opens at the minor groove side of the DNA substrate to accommodate the bulky BP-dG that is attached there. More importantly, polκ stabilizes the lesion DNA substrate in the same active conformation as for regular B-form DNA substrates and the bulky BPDE ring in a 5' end pointing conformation. The BP-dG adducted DNA substrate maintains a Watson-Crick (BP-dG:dC) base pair within the active site, governing correct nucleotide insertion opposite the bulky adduct. In addition, polκ's unique N-clasp domain supports the open conformation of the enzyme and the extended conformation of the single-stranded template to allow bypass of the bulky lesion. This work illustrates the first molecular mechanism for how a bulky major adduct is replicated accurately without strand misalignment and mis-insertion.

  13. Quantification of DNA adducts formed in liver, lungs, and isolated lung cells of rats and mice exposed to (14)C-styrene by nose-only inhalation.

    Science.gov (United States)

    Boogaard, P J; de Kloe, K P; Wong, B A; Sumner, S C; Watson, W P; van Sittert, N J

    2000-10-01

    Bronchiolo-alveolar tumors were observed in mice exposed chronically to 160 ppm styrene, whereas no tumors were seen in rats up to concentrations of 1000 ppm. Clara cells, which are predominant in the bronchiolo-alveolar region in mouse lungs but less numerous in rat and human lung, contain various cytochrome P450s, which may oxidize styrene to the rodent carcinogen styrene-7,8-oxide (SO) and other reactive metabolites. Reactive metabolites may form specific DNA adducts and induce the tumors observed in mice. To determine DNA adducts in specific tissues and cell types, rats and mice were exposed to 160 ppm [ring-U-(14)C]styrene by nose-only inhalation for 6 h in a recirculating exposure system. Liver and lungs were isolated 0 and 42 h after exposure. Fractions enriched in Type II cells and Clara cells were isolated from rat and mouse lung, respectively. DNA adduct profiles differed quantitatively and qualitatively in liver, total lung, and enriched lung cell fractions. At 0 and 42 h after exposure, the two isomeric N:7-guanine adducts of SO (measured together, HPEG) were present in liver at 3.0 +/- 0.2 and 1.9 +/- 0.3 (rat) and 1.2 +/- 0.2 and 3.2 +/- 0.5 (mouse) per 10(8) bases. Several other, unidentified adducts were present at two to three times higher concentrations in mouse, but not in rat liver. In both rat and mouse lung, HPEG was the major adduct at approximately 1 per 10(8) bases at 0 h, and these levels halved at 42 h. In both rat Type II and non-Type II cells, HPEG was the major adduct and was about three times higher in Type II cells than in total lung. For mice, DNA adduct levels in Clara cells and non-Clara cells were similar to total lung. The hepatic covalent binding index (CBI) at 0 and 42 h was 0.19 +/- 0.06 and 0.14 +/- 0.03 (rat) and 0. 25 +/- 0.11 and 0.44 +/- 0.23 (mouse), respectively. The pulmonary CBIs, based on tissues combined for 0 and 42 h, were 0.17 +/- 0.04 (rat) and 0.24 +/- 0.04 (mouse). Compared with CBIs for other genotoxicants

  14. Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

    Energy Technology Data Exchange (ETDEWEB)

    Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook; Karim, Nurul Huda Abd [School of Chemical Sciences and Food Technology, Universiti Kebangsaan Malaysia, 43600 UKM Bangi, Selangor Darul Ehsan (Malaysia); Ahmad, Haslina; Harun, Siti Norain [Chemistry Department, Faculty of Science, Universiti Putra Malaysia, 43400, Serdang, Selangor (Malaysia)

    2014-09-03

    A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulse voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.

  15. Synthesis of an oligodeoxyribonucleotide adduct of mitomycin C by the postoligomerization method via a triamino mitosene

    OpenAIRE

    Champeil, Elise; Paz, Manuel M.; Ladwa, Sweta; Cristina C. Clement; ZATORSKI, ANDRZEJ; Tomasz, Maria

    2008-01-01

    The cancer chemotherapeutic agent mitomycin C (MC) alkylates and cross-links DNA monofunctionally and bifunctionally in vivo and in vitro, forming six major MC-deoxyguanosine adducts of known structures. The synthesis of one of the monoadducts (8) by the postoligomerization method was accomplished both on the nucleoside and oligonucleotide levels, the latter resulting in the site-specific placement of 8 in a 12-mer oligodeoxyribonucleotide 26. This is the first application of this method to t...

  16. DNA polymerase eta participates in the mutagenic bypass of adducts induced by benzo[a]pyrene diol epoxide in mammalian cells.

    Directory of Open Access Journals (Sweden)

    Alden C Klarer

    Full Text Available Y-family DNA-polymerases have larger active sites that can accommodate bulky DNA adducts allowing them to bypass these lesions during replication. One member, polymerase eta (pol eta, is specialized for the bypass of UV-induced thymidine-thymidine dimers, correctly inserting two adenines. Loss of pol eta function is the molecular basis for xeroderma pigmentosum (XP variant where the accumulation of mutations results in a dramatic increase in UV-induced skin cancers. Less is known about the role of pol eta in the bypass of other DNA adducts. A commonly encountered DNA adduct is that caused by benzo[a]pyrene diol epoxide (BPDE, the ultimate carcinogenic metabolite of the environmental chemical benzo[a]pyrene. Here, treatment of pol eta-deficient fibroblasts from humans and mice with BPDE resulted in a significant decrease in Hprt gene mutations. These studies in mammalian cells support a number of in vitro reports that purified pol eta has error-prone activity on plasmids with site-directed BPDE adducts. Sequencing the Hprt gene from this work shows that the majority of mutations are G>T transversions. These data suggest that pol eta has error-prone activity when bypassing BPDE-adducts. Understanding the basis of environmental carcinogen-derived mutations may enable prevention strategies to reduce such mutations with the intent to reduce the number of environmentally relevant cancers.

  17. In vivo formation of N7-guanine DNA adduct by safrole 2',3'-oxide in mice.

    Science.gov (United States)

    Shen, Li-Ching; Chiang, Su-Yin; Lin, Ming-Huan; Chung, Wen-Sheng; Wu, Kuen-Yuh

    2012-09-18

    Safrole, a naturally occurring product derived from spices and herbs, has been shown to be associated with the development of hepatocellular carcinoma in rodents. Safrole 2',3'-oxide (SFO), an electrophilic metabolite of safrole, was shown to react with DNA bases to form detectable DNA adducts in vitro, but not detected in vivo. Therefore, the objective of this study was to investigate the formation of N7-(3-benzo[1,3]dioxol-5-yl-2-hydroxypropyl)guanine (N7γ-SFO-Gua) resulting from the reaction of SFO with the most nucleophilic site of guanine in vitro and in vivo with a newly developed isotope-dilution high performance liquid chromatography electrospray ionization tandem mass spectrometry (HPLC-ESI-MS/MS) method. N7γ-SFO-Gua and [(15)N(5)]-N7-(3-benzo[1,3]dioxol-5-yl-2-hydroxypropyl)guanine ([(15)N(5)]-N7γ-SFO-Gua) were first synthesized, purified, and characterized. The HPLC-ESI-MS/MS method was developed to measure N7γ-SFO-Gua in calf thymus DNA treated with 60 μmol of SFO for 72 h and in urine samples of mice treated with a single dose of SFO (30 mg/kg body weight, intraperitoneally). In calf thymus DNA, the level of N7γ-SFO-Gua was 2670 adducts per 10(6)nucleotides. In urine of SFO-treated mice, the levels of N7γ-SFO-Gua were 1.02±0.14 ng/mg creatinine (n=4) on day 1, 0.73±0.68 ng/mg creatinine (n=4) on day 2, and below the limit of quantitation on day 3. These results suggest that SFO can cause in vivo formation of N7γ-SFO-Gua, which may then be rapidly depurinated from the DNA backbone and excreted through urine.

  18. DNA adducts and PM(10) exposure in traffic-exposed workers and urban residents from the EPIC-Florence City study.

    Science.gov (United States)

    Palli, Domenico; Saieva, Calogero; Munnia, Armelle; Peluso, Marco; Grechi, Daniele; Zanna, Ines; Caini, Saverio; Decarli, Adriano; Sera, Francesco; Masala, Giovanna

    2008-09-15

    Air pollution and particulate matter in urban areas have been associated with increased mortality from cardiovascular and respiratory diseases and increased cancer risk. Carcinogenic effects of particulate matter have been related to the contents of specific compounds, such as polycyclic aromatic hydrocarbons. The latter may form bulky DNA adducts, that may be considered as candidate markers of cancer risk. We have recently shown that traffic-exposed workers and the general population in Florence have divergent levels of DNA adducts, possibly related to different levels of exposure to genotoxic agents from vehicle emissions. In the current study, in a series of 214 Florence City healthy adults enrolled in a prospective study in the period 1993-1998 (152 residents / 62 traffic-exposed workers), we investigated the correlation between individual levels of DNA bulky adducts and PM(10) exposure scores based on daily environmental measures provided by the local Environmental Protection Agency for the whole study period, by two types of urban monitoring stations (high- and low-traffic). We found that PM(10) cumulative scores from high-traffic stations over the last 1-2 weeks prior to blood drawing significantly correlated (r=0.58, p=0.02) with DNA adduct levels among non-smoking traffic-exposed workers (but not among residents with no occupational exposure to vehicle emissions). A multivariate regression analysis adjusted for possible confounders confirmed these findings. PM(10) scores from low-traffic stations did not show any correlation. These results show that DNA adduct levels in non-smoking workers reflect the average levels of exposure to PM(10) in high-traffic urban areas experienced over a time period of 1-2 weeks. Since DNA adduct levels have been found predictive of lung cancer risk, our findings provide clues relevant to the reduction of genotoxic damage and possibly cancer risk among traffic-exposed urban workers.

  19. Novel photodynamic effect of a psoralen-conjugated oligonucleotide for the discrimination of the methylation of cytosine in DNA.

    Science.gov (United States)

    Yamayoshi, Asako; Matsuyama, Yohei; Kushida, Mikihiko; Kobori, Akio; Murakami, Akira

    2014-01-01

    DNA methylation and demethylation significantly affect the deactivation and activation processes of gene expression significantly. In particular, C-5-methylation of cytosine in the CpG islands is important for the epigenetic modification in genes, which plays a key role in regulating gene expression. The determination of the location and frequency of DNA methylation is important for the elucidation of the mechanisms of cell differentiation and carcinogenesis. Here we designed a psoralen-conjugated oligonucleotide (PS-oligo) for the discrimination of 5-methylcytosine (5-mC) in DNA. The cross-linking behavior of psoralen derivatives with pyrimidine bases, such as thymine, uracil and cytosine has been well discussed, but there are no reports which have examined whether cross-linking efficiency of psoralen with cytosine would be changed with or without C-5 methylation. We found that the cross-linking efficiency of PS-oligo with target-DNA containing 5-mC was greatly increased compared to the case of target-DNA without 5-mC, approximately seven-fold higher. Here we report a new aspect of the photocross-linking behavior of psoralen with 5-mC that is applicable to a simple, sequence-specific and quantitative analysis for the discrimination of 5-mC in DNA, which can be applicable to study the epigenetic behavior of gene expressions.

  20. Oxidative Stress Induced Lipid Peroxidation And DNA Adduct Formation In The Pathogenesis Of Multiple Myeloma And Lymphoma

    Directory of Open Access Journals (Sweden)

    Tandon, Ravi

    2013-02-01

    Full Text Available Objective: To access the oxidative stress status by quantification of byproducts generated during lipid peroxidation and DNA breakdown products generated during DNA damage in the blood serum of multiple myeloma and lymphoma patients.Material & Methods: Case control study comprised of 40 patients of multiple myeloma and 20 patients of lymphoma along with 20 age and sex-matched healthy subjects as controls. Levels of Malondialdehyde and 8-hydroxy-2-deoxy-Guanosine were measured to study the oxidative stress status in the study subjects.Results: The level of markers of DNA damage and lipid peroxidation were found to be raised significantly in the study subjects in comparison to healthy controls. The results indicate oxidative stress and DNA damage activity increase progressively with the progression of disease.Conclusion: Oxidative stress causes DNA damage and Lipid peroxidation which results in the formation of DNA adducts leading to mutations thereby indicate the role of oxidative stress in the pathogenesis of multiple myeloma and lymphoma.

  1. Towards biomarker-dependent individualized chemotherapy: exploring cell-specific differences in oxaliplatin-DNA adduct distribution using accelerator mass spectrometry.

    Science.gov (United States)

    Hah, Sang Soo; Henderson, Paul T; Turteltaub, Kenneth W

    2010-04-15

    Oxaliplatin is a third-generation platinum-based anticancer drug that is currently used in the treatment of metastatic colorectal cancer. Oxaliplatin, like other platinum-based anticancer drugs such as cisplatin and carboplatin, is known to induce apoptosis in tumor cells by binding to nuclear DNA, forming monoadducts, and intra- and interstrand diadducts. Previously, we reported an accelerator mass spectrometry (AMS) assay to measure the kinetics of oxaliplatin-induced DNA damage and repair [Hah, S. S.; Sumbad, R. A.; de Vere White, R. W.; Turteltaub, K. W.; Henderson, P. T. Chem. Res. Toxicol.2007, 20, 1745]. Here, we describe another application of AMS to the measurement of oxaliplatin-DNA adduct distribution in cultured platinum-sensitive testicular (833K) and platinum-resistant breast (MDA-MB-231) cancer cells, which resulted in elucidation of cell-dependent differentiation of oxaliplatin-DNA adduct formation, implying that differential adduction and/or accumulation of the drug in cellular DNA may be responsible for the sensitivity of cancer cells to platinum treatment. Ultimately, we hope to use this method to measure the intrinsic platinated DNA adduct repair capacity in cancer patients for use as a biomarker for diagnostics or a predictor of patient outcome.

  2. No effects of chlorophyllin on IQ (2-amino-3-methylimidazo[4,5-f]-quinoline)-genotoxicity and -DNA adduct formation in Drosophila.

    Science.gov (United States)

    Negishi, Tomoe; Shinoda, Aki; Ishizaki, Nao; Hayatsu, Hikoya; Sugiyama, Chitose

    2004-02-01

    Previously we demonstrated that chlorophyllin suppressed the genotoxicities of many carcinogens. However, the genotoxicity of IQ (2-amino-3-methylimidazo[4,5-f]quinoline), a carcinogenic heterocyclic amine, was not suppressed in Drosophila. On the contrary, it has been reported that chrolophyllin suppressed the genotoxicity of IQ in rodents, rainbow trout and Salmonella. We demonstrated that the chlorophyllin-induced suppression of MeIQx (2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline)-genotoxicity was associated with a decrease in MeIQx-DNA adduct formation in Drosophila larval DNA. MeIQx represents another type of heterocyclic amine and is similar to IQ in structure. In this study we utilized (32)P-postlabeling to examine whether chlorophyllin reduced IQ-DNA adduct formation in Drosophila DNA in the same way as MeIQx. The results revealed that the formation of IQ-DNA adducts was unaffected by treatment with chlorophyllin. This was consistent with the absence of any inhibitory effect on genotoxicity as observed in the Drosophila repair test. These results suggest that IQ-behavior in Drosophila is not affected by chlorophyllin, indicating that the process of IQ-DNA adduct formation followed by expression of genotoxicity in Drosophila may be different from that in other organisms.

  3. Study of DNA adduct 8 hydroxy-2’-deoxyguanosine (8-OHdG) formation through fenton reaction with tert-butylhydroquinone (TBHQ) and butyl hydroxy toluene (BHT)

    Science.gov (United States)

    Handayani, S.; Dani, I. C.; Budiawan; Pakuanisa, D.

    2017-05-01

    The research of DNA adduct formation 8-hydroxy-2’-Deoxyguanosine (8-OHdG) as a biomarker of DNA damage due to oxidative stress was carried out by reacting the DNA base 2’-deoxyguanosine-5’-monophosphate with TBHQ and BHT. The formationof 8-OHdG was carried out in various conditions, at temperature of 37° C and 60° C, pH 7.4 and pH 8.4, within 5 hours of incubation time and in the addition of FeSO4. The formation of DNA adducts profile were analyzed using reversed phase HPLC with UV detector at a wavelength of 254 nm. The results of the study showed that TBHQ and BHT can trigger the formation of 8-OHdG from the reaction of 2’-hydroxy Deoxyguanosine-5’-monophosphate in the presence of Fe (II). Meanwhile, in the addition of hydrogen peroxide, the formation of DNA adducts only occur in the test substance TBHQ. The results showed that the condition of higher temperature at 60°C and pH 8,4 affects the higher formation of DNA adducts.

  4. Effects of the co-carcinogen catechol on benzo(a)pyrene metabolism and DNA adduct formation in mouse skin

    Energy Technology Data Exchange (ETDEWEB)

    Melikian, A.A.; Leszczynska, J.M.; Hecht, S.S.; Hoffmann, D.

    1986-01-01

    We have studied the effects of the co-carcinogen catechol (1,2-dihydroxybenzene) on the metabolic activation of (/sup 3/H) benzo(a)pyrene (BaP) in mouse skin, in vivo and on the binding of BaP metabolites to DNA and protein at intervals from 0.5-24 h. Upon topical application of 0.015 mg (/sup 3/H)BaP and 0.25 or 0.5 mg catechol per mouse, catechol had little effect on the total amount of (/sup 3/H)BaP metabolized in mouse skin, but it affected the relative proportions of (/sup 3/H)BaP metabolites. Catechol (0.5 mg/mouse) decreased the proportion of water-soluble (/sup 3/H)BaP metabolites, ethyl acetate-soluble polar metabolites and quinones, but doubled the levels of unconjugated 3-hydroxy-BaP at all measured intervals after treatment. Catechol also caused a small increase in the levels of trans-7,8-dihydroxy-7,8-dihydroBaP and trans-9,10-dihydroxy-9,10-dihydroBaP 0.5 h after treatment. Two hours after treatment, the levels of these metabolites subsided to those of the controls. Catechol did not affect the levels of glutathione conjugates of BaP. However, it caused a decrease in glucuronide and sulphate conjugate formation from BaP. Catechol caused an approximately 2-fold increase in the formation of anti-7,8-dihydroxy-9,10-epoxy-7,8,9,10-tetrahydroBaP (BPDE) DNA adducts and elevated the ratio of anti-syn-BPDE-DNA adducts 1.6 to 2.9-fold. Catechol treatment increased the radioactivity associated with epidermal proteins after (/sup 3/H)BaP application. Because catechol increased levels of 3-hydroxyBaP, we considered the possibility that 3-hydroxyBaP might enhance the tumor initiating activities of BaP or BPDE in mouse skin; a bioassay demonstrated that this was not the case. The results of this study indicate that one important effect of catechol related to its co-carcinogenicity is its ability to enhance formation of anti-BPDE-DNA adducts in mouse skin.

  5. Interactive effects of ultraviolet-B radiation and pesticide exposure on DNA photo-adduct accumulation and expression of DNA damage and repair genes in Xenopus laevis embryos

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Shuangying, E-mail: shuangying.yu@ttu.edu [Department of Environmental Toxicology, The Institute of Environmental and Human Health, Texas Tech University, 1207 S. Gilbert Dr., Lubbock, TX 79416 (United States); Tang, Song, E-mail: song.tang@usask.ca [Department of Environmental Toxicology, The Institute of Environmental and Human Health, Texas Tech University, 1207 S. Gilbert Dr., Lubbock, TX 79416 (United States); Mayer, Gregory D., E-mail: greg.mayer@ttu.edu [Department of Environmental Toxicology, The Institute of Environmental and Human Health, Texas Tech University, 1207 S. Gilbert Dr., Lubbock, TX 79416 (United States); Cobb, George P., E-mail: george_cobb@baylor.edu [Department of Environmental Science, Baylor University, One Bear Place #97266, Waco, TX 76798 (United States); Maul, Jonathan D., E-mail: jonathan.maul@ttu.edu [Department of Environmental Toxicology, The Institute of Environmental and Human Health, Texas Tech University, 1207 S. Gilbert Dr., Lubbock, TX 79416 (United States)

    2015-02-15

    Highlights: • Interactive effects of UVB radiation-pesticide co-exposures were examined in frogs. • Responses included induction of DNA photo-adducts and DNA damage and repair genes. • Elevated DNA adduct levels occurred for co-exposures compared to UVB alone. • One mechanism is that pesticides may alter nuclear excision repair gene expression. - Abstract: Pesticide use and ultraviolet-B (UVB) radiation have both been suggested to adversely affect amphibians; however, little is known about their interactive effects. One potential adverse interaction could involve pesticide-induced dysregulation of DNA repair pathways, resulting in greater numbers of DNA photo-adducts from UVB exposure. In the present study, we investigated the interactive effects of UVB radiation and two common pesticides (endosulfan and α-cypermethrin) on induction of DNA photo-adducts and expression of DNA damage and repair related genes in African clawed frog (Xenopus laevis) embryos. We examined 13 genes that are, collectively, involved in stress defense, cell cycle arrest, nucleotide excision repair (NER), base excision repair, mismatch repair, DNA repair regulation, and apoptosis. We exposed X. laevis embryos to 0, 25, and 50 μg/L endosulfan or 0, 2.5, and 5.0 μg/L α-cypermethrin for 96 h, with environmentally relevant exposures of UVB radiation during the last 7 h of the 96 h exposure. We measured the amount of cyclobutane pyrimidine dimers (CPDs) and mRNA abundance of the 13 genes among treatments including control, pesticide only, UVB only, and UVB and pesticide co-exposures. Each of the co-exposure scenarios resulted in elevated CPD levels compared to UVB exposure alone, suggesting an inhibitory effect of endosulfan and α-cypermethrin on CPD repair. This is attributed to results indicating that α-cypermethrin and endosulfan reduced mRNA abundance of XPA and HR23B, respectively, to levels that may affect the initial recognition of DNA lesions. In contrast, both pesticides

  6. Mutations Induced by Benzo[a]pyrene and Dibenzo[a,l]pyrene in lacI Transgenic B6C3F1 Mouse Lung Result from Stable DNA Adducts

    Science.gov (United States)

    Dibenzo[a,l]pyrene (DB[a,l]P) and benzo[a]pyrene (B[a]P) are carcinogenic polycyclic aromatic hydrocarbons (PAH) that are each capable of forming a variety of covalent adducts with DNA. Some of the DNA adducts formed by these PAHs have been demonstrated to spontaneously depurina...

  7. Screening the Single Nucleotide Polymorphisms in Patients with Internal Carotid Artery Stenosis by Oligonucleotide-Based Custom DNA Array

    Directory of Open Access Journals (Sweden)

    Kenji Nakai

    2007-01-01

    Full Text Available Early screening of individuals considered to be at risk for severe internal carotid artery (ICA stenosis is an important strategy for preventing ischemic cerebral stroke. The purpose of this study is to screening candidate single nucleotide polymorphisms (SNPs associated with severe ICA stenosis using a newly developed oligonucleotide-based custom DNA array. The subjects consisted of 47 controls and 46 patients with severe ICA stenosis (70% who underwent carotid endarterectomy (CEA. Subjects gave informed consent and we obtained samples of blood and genomic DNA. We studied 8 candidate genes: renin-angiotensin system [angiotensinogen (AGT, angiotensin II receptor type 1 (AGTR1, nitric oxide synthase 3 (NOS3]; growth factor [hepatocyte growth factor (HGF]; transgelin (SM22; cytokine [chemokine receptor 2 (CCR2]; coagulation-fibrinolysis system [5,10-methylenetetrahydrofolate reductase (MTHFR]; and plasminogen activator inhibitor 1 (PAI-1. Genotyping of candidate SNPs was done with a line probe assay (LiPA based on an oligonucleotide-based DNA array. Results: The allele frequency of PAI-1 –1965 delG (odds ratio (OR, 0.3; 95% confidence interval (CI, 0.2–0.6 and MTHFR (OR 1.3, 95% CI, 1.0–1.5 were significantly different between controls and cases with ICA stenosis by Fisher’s exact test. Multiple logistic analysis revealed that diabetes mellitus (DM, SNPs in PAI-1 –1965 delG and MTHFR were an independent risk for ICA stenosis. In conclusion, genetic factors of coagulation-fibrinolysis as well as diabetes mellitus (DM were relevant in ICA stenosis.

  8. Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

    Directory of Open Access Journals (Sweden)

    Kristen K. Merritt

    2014-10-01

    Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes

  9. Alcohol, Aldehydes, Adducts and Airways.

    Science.gov (United States)

    Sapkota, Muna; Wyatt, Todd A

    2015-11-05

    Drinking alcohol and smoking cigarettes results in the formation of reactive aldehydes in the lung, which are capable of forming adducts with several proteins and DNA. Acetaldehyde and malondialdehyde are the major aldehydes generated in high levels in the lung of subjects with alcohol use disorder who smoke cigarettes. In addition to the above aldehydes, several other aldehydes like 4-hydroxynonenal, formaldehyde and acrolein are also detected in the lung due to exposure to toxic gases, vapors and chemicals. These aldehydes react with nucleophilic targets in cells such as DNA, lipids and proteins to form both stable and unstable adducts. This adduction may disturb cellular functions as well as damage proteins, nucleic acids and lipids. Among several adducts formed in the lung, malondialdehyde DNA (MDA-DNA) adduct and hybrid malondialdehyde-acetaldehyde (MAA) protein adducts have been shown to initiate several pathological conditions in the lung. MDA-DNA adducts are pre-mutagenic in mammalian cells and induce frame shift and base-pair substitution mutations, whereas MAA protein adducts have been shown to induce inflammation and inhibit wound healing. This review provides an insight into different reactive aldehyde adducts and their role in the pathogenesis of lung disease.

  10. Photoelectrochemical competitive DNA hybridization assay using semiconductor quantum dot conjugated oligonucleotides.

    Science.gov (United States)

    Baş, Deniz; Boyaci, Ismail Hakki

    2011-05-01

    A competitive DNA hybridization assay based on the photoelectrochemistry of the semiconductor quantum dot-single stranded DNA conjugates (QD-ssDNA) was developed. Hybridization of QD-ssDNA with the capture probe DNA immobilized on the indium-tin oxide electrodes enables photocurrent generation when the electrochemical cell was illuminated with a light source. Upon the competition between QD-ssDNA and single-stranded target DNA, the photocurrent response decreased with the increase in the target DNA concentration. A linear relationship between the photocurrent and the target DNA concentration was obtained (R(2) = 0.991). The selectivity of system towards the target DNA was also demonstrated using non-complementary sample.

  11. Interactive effects of ultraviolet-B radiation and pesticide exposure on DNA photo-adduct accumulation and expression of DNA damage and repair genes in Xenopus laevis embryos.

    Science.gov (United States)

    Yu, Shuangying; Tang, Song; Mayer, Gregory D; Cobb, George P; Maul, Jonathan D

    2015-02-01

    Pesticide use and ultraviolet-B (UVB) radiation have both been suggested to adversely affect amphibians; however, little is known about their interactive effects. One potential adverse interaction could involve pesticide-induced dysregulation of DNA repair pathways, resulting in greater numbers of DNA photo-adducts from UVB exposure. In the present study, we investigated the interactive effects of UVB radiation and two common pesticides (endosulfan and α-cypermethrin) on induction of DNA photo-adducts and expression of DNA damage and repair related genes in African clawed frog (Xenopus laevis) embryos. We examined 13 genes that are, collectively, involved in stress defense, cell cycle arrest, nucleotide excision repair (NER), base excision repair, mismatch repair, DNA repair regulation, and apoptosis. We exposed X. laevis embryos to 0, 25, and 50 μg/L endosulfan or 0, 2.5, and 5.0 μg/L α-cypermethrin for 96 h, with environmentally relevant exposures of UVB radiation during the last 7 h of the 96 h exposure. We measured the amount of cyclobutane pyrimidine dimers (CPDs) and mRNA abundance of the 13 genes among treatments including control, pesticide only, UVB only, and UVB and pesticide co-exposures. Each of the co-exposure scenarios resulted in elevated CPD levels compared to UVB exposure alone, suggesting an inhibitory effect of endosulfan and α-cypermethrin on CPD repair. This is attributed to results indicating that α-cypermethrin and endosulfan reduced mRNA abundance of XPA and HR23B, respectively, to levels that may affect the initial recognition of DNA lesions. In contrast, both pesticides increased transcript abundance of CSA and MUTL. In addition, mRNA abundance of HSP70 and GADD45α were increased by endosulfan and mRNA abundance of XPG was increased by α-cypermethrin. XPC, HR23B, XPG, and GADD45α exhibited elevated mRNA concentrations whereas there was a reduction in MUTL transcript concentrations in UVB-alone treatments. It appeared that even

  12. Solid-phase synthesis of thermolytic DNA oligonucleotides functionalized with a single 4-hydroxy-1-butyl or 4-phosphato-/thiophosphato-1-butyl thiophosphate protecting group.

    Science.gov (United States)

    Grajkowski, Andrzej; Ausín, Cristina; Kauffman, Jon S; Snyder, John; Hess, Sonja; Lloyd, John R; Beaucage, Serge L

    2007-02-02

    Several thermolytic CpG-containing DNA oligonucleotides analogous to 1 have been synthesized to serve as potential immunotherapeutic oligonucleotide prodrug formulations for the treatment of infectious diseases in animal models. Specifically, the CpG motif (GACGTT) of each DNA oligonucleotide has been functionalized with either the thermolabile 4-hydroxy-1-butyl or the 4-phosphato-/thiophosphato-1-butyl thiophosphate protecting group. This functionalization was achieved through incorporation of activated deoxyribonucleoside phosphoramidite 8b into the oligonucleotide chain during solid-phase synthesis and, optionally, through subsequent phosphorylation effected by phosphoramidite 9. Complete conversion of CpG ODNs hbu1555, psb1555, and pob1555 to CpG ODN 1555 (homologous to 2) occurred under elevated temperature conditions, thereby validating the function of these diastereomeric oligonucleotides as prodrugs in vitro. Noteworthy is the significant increase in solubility of CpG ODN psb1555 and CpG pob1555 in water when compared to that of neutral CpG ODN fma1555 (homologous to 1).

  13. Circular DNA by "Bis-Click" Ligation: Template-Independent Intramolecular Circularization of Oligonucleotides with Terminal Alkynyl Groups Utilizing Bifunctional Azides.

    Science.gov (United States)

    Yang, Haozhe; Seela, Frank

    2016-01-22

    A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides.

  14. Urinary Metabolites of the Dietary Carcinogen PhIP are Predictive of Colon DNA Adducts After a Low Dose Exposure in Humans

    Energy Technology Data Exchange (ETDEWEB)

    Malfatti, M; Dingley, K; Nowell, S; Ubick, E; Mulakken, N; Nelson, D; Lang, N; Felton, J; Turteltaub, K

    2006-04-28

    Epidemiologic evidence indicates that exposure to heterocyclic amines (HAs) in the diet is an important risk factor for the development of colon cancer. Well-done cooked meats contain significant levels of HAs which have been shown to cause cancer in laboratory animals. To better understand the mechanisms of HA bioactivation in humans, the most mass abundant HA, 2-amino-l-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), was used to assess the relationship between PhIP metabolism and DNA adduct formation. Ten human volunteers were administered a dietary relevant dose of [{sup 14}C]PhIP 48-72 h prior to surgery to remove colon tumors. Urine was collected for 24 h after dosing for metabolite analysis, and DNA was extracted from colon tissue and analyzed by accelerator mass spectrometry for DNA adducts. All ten subjects were phenotyped for CYP1A2, NAT2, and SULT1A1 enzyme activity. Twelve PhIP metabolites were detected in the urine samples. The most abundant metabolite in all volunteers was N-hydroxy-PhIP-N{sup 2}-glucuronide. Metabolite levels varied significantly between the volunteers. Interindividual differences in colon DNA adducts levels were observed between each individual. The data showed that individuals with a rapid CYP1A2 phenotype and high levels of urinary N-hydroxy-PhIP-N{sup 2}-glucuronide, had the lowest level of colon PhIP-DNA adducts. This suggests that glucuronidation plays a significant role in detoxifying N-hydroxy-PhIP. The levels of urinary N-hydroxy-PhIP-N{sup 2}-glucuronide were negatively correlated to colon DNA adduct levels. Although it is difficult to make definite conclusions from a small data set, the results from this pilot study have encouraged further investigations using a much larger study group.

  15. 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides.

    Science.gov (United States)

    Marchán, Vicente; Cieślak, Jacek; Livengood, Victor; Beaucage, Serge L

    2004-08-11

    Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.

  16. Association between Mutation Spectra and Stable and Unstable DNA Adduct Profiles in Salmonella for Benzo[a]pyrene and Dibenzo[a.l]pyrene

    Science.gov (United States)

    Benzo[a]pyrene (BP) and dibenzo[a,l]pyrene (DBP) are two polycyclic aromatic hydrocarbons (PAHs) that exhibit distinctly different mutagenicity and carcinogenicity profiles. Although some studies show that these PAHs produce unstable DNA adducts, conflicting data and arguments ha...

  17. Inhibition of HIV-1 reverse transcriptase-catalyzed synthesis by intercalated DNA Benzo[a]Pyrene 7,8-Dihydrodiol-9,10-Epoxide adducts.

    Directory of Open Access Journals (Sweden)

    Parvathi Chary

    Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.

  18. Pharmacodynamics of cisplatin in human head and neck cancer : correlation between platinum content, DNA adduct levels and drug sensitivity in vitro and in vivo

    NARCIS (Netherlands)

    Welters, M.J.P.; Fichtinger-Schepman, A.M.J.; Baan, R.A.; Jacobs-Bergmans, A.J.; Kegel, A.; Vijgh, W.J.F. van der; Braakhuis, B.J.M.

    1999-01-01

    Total platinum contents and cisplatin-DNA adduct levels were determined in vivo in xenografted tumour tissues in mice and in vitro in cultured tumour cells of head and neck squamous cell carcinoma (HNSCC), and correlated with sensitivity to cisplatin. In vivo, a panel of five HNSCC tumour lines grow

  19. Metabolism of aflatoxin B1 and identification of the major aflatoxin B1-DNA adducts formed in cultured human bronchus and colon

    DEFF Research Database (Denmark)

    1979-01-01

    ) with the guanyl group and hydroxy group in trans-position and an adduct which has been tentatively identified by other investigators as 2,3-dihydro-2-(N5-formyl-2',5',6'-triamino-4'-oxo-N5-pyrimidyl)-3-hydroxyaflatoxin B1 (Structure 11). Seventy % of the radioactivity associated with bronchial DNA was found...

  20. An integrated QSAR-PBK/D modelling approach for predicting detoxification and DNA adduct formation of 18 acyclic food-borne a,ß-unsaturated aldehydes.

    NARCIS (Netherlands)

    Kiwamoto, R.; Spenkelink, A.; Rietjens, I.M.C.M.; Punt, A.

    2015-01-01

    Acyclic a,ß-unsaturated aldehydes present in food raise a concern because the a,ß-unsaturated aldehyde moiety is considered a structural alert for genotoxicity. However, controversy remains on whether in vivo at realistic dietary exposure DNA adduct formation is significant. The aim of the present s

  1. INDUCTION OF DNA ADDUCTS, TUMORS, AND KI-RAS ONCOGENE MUTATIONS IN STRAIN A/J MOUSE LUNG BY IP. ADMINISTRATION OF DIBENZ[A,H]ANTHRACENE

    Science.gov (United States)

    Induction of DNA adducts, tumors, and Ki-ras oncogene mutations in strain AlJ mouse lung by ip. administration of dibenz[a,h]anthracene Previous studies of polycyclic aromatic hydrocarbon (P AH) induced lung tumors in the strain NJ mouse model system have demonstrated qua...

  2. Pharmacodynamics of cisplatin in human head and neck cancer : correlation between platinum content, DNA adduct levels and drug sensitivity in vitro and in vivo

    NARCIS (Netherlands)

    Welters, M.J.P.; Fichtinger-Schepman, A.M.J.; Baan, R.A.; Jacobs-Bergmans, A.J.; Kegel, A.; Vijgh, W.J.F. van der; Braakhuis, B.J.M.

    1999-01-01

    Total platinum contents and cisplatin-DNA adduct levels were determined in vivo in xenografted tumour tissues in mice and in vitro in cultured tumour cells of head and neck squamous cell carcinoma (HNSCC), and correlated with sensitivity to cisplatin. In vivo, a panel of five HNSCC tumour lines grow

  3. Possible Mechanisms of Ethanol-Mediated Colorectal Carcinogenesis: The Role of Cytochrome P4502E1, Etheno-DNA Adducts, and the Anti-Apoptotic Protein Mcl-1.

    Science.gov (United States)

    Koehler, Bruno Christian; Arslic-Schmitt, Tatjana; Peccerella, Theresa; Scherr, Anna-Lena; Schulze-Bergkamen, Henning; Bruckner, Thomas; Gdynia, Georg; Jäger, Dirk; Mueller, Sebastian; Bartsch, Helmut; Seitz, Helmut K

    2016-10-01

    Chronic alcohol consumption is a risk factor for colorectal cancer. The mechanisms by which ethanol (EtOH) exerts its carcinogenic effect on the colorectal mucosa are not clear and may include oxidative stress with the action of reactive oxygen species (ROS) generated through EtOH metabolism via cytochrome P4502E1 (CYP2E1) leading to carcinogenic etheno-DNA adducts. ROS may also induce apoptosis. However, the effect of chronic EtOH consumption on CYP2E1, etheno-DNA adducts as well as anti-apoptotic proteins in the colorectal mucosa of heavy drinkers without colorectal inflammation is still not known. Rectal biopsies from 32 alcoholics (>60 g EtOH/d) and from 12 controls (alcoholics and control patients. However, CYP2E1 and etheno-DNA adducts correlated significantly when both groups were combined (p colorectal CYP2E1 was not found to be significantly increased in alcoholics, CYP2E1 correlated overall with the level of etheno-DNA adducts in the colorectal mucosa, which identifies CYP2E1 as an important factor in colorectal carcinogenesis. Most importantly, however, is the up-regulation of the anti-apoptotic protein Mcl-1 in heavy drinkers counteracting apoptosis and possibly stimulating cancer development. Copyright © 2016 by the Research Society on Alcoholism.

  4. Comparative synchronous fluorescence spectrophotometry and 32P-postlabeling analysis of PAH-DNA adducts in human lung and the relationship to TP53 mutations

    DEFF Research Database (Denmark)

    Andreassen, Åshild; Kure, Elin H.; Nielsen, Per Sabro

    1996-01-01

    Polycyclic aromatic hydrocarbon (PAH)-DNA adducts were studied in human lung from 39 lung cancer patients by synchronous fluorescence spectrophotometric (SFS) and 32P-postlabeling assays. Regression analysis of the samples failed to detect any correlation between benzo[a]pyrene-diolepoxide (BPDE)...

  5. Biomarkers for Exposure to Ambient Air Pollution - Comparison of Carcinogen-DNA Adduct Levels with Other Exposure Markers and Markers for Oxidative Stress

    DEFF Research Database (Denmark)

    Autrup, Herman; Daneshvar, Bahram; Dragsted, Lars Ove;

    1999-01-01

    Human exposure to genotoxic compounds present in ambient air has been studied using selected biomarkers in nonsmoking Danish bus drivers and postal workers. A large interindividual variation in biomarker levels was observed. Significantly higher levels of bulky carcinogen-DNA adducts (75.42 adduc...

  6. Lack of contribution of covalent benzo[a]pyrene-7,8-quinone-DNA adducts in benzo[a]pyrene-induced mouse lung tumorigenesis

    Science.gov (United States)

    Benzo[a]pyrene (B[a]P) is a potent human and rodent lung carcinogen. This activity has been ascribed in part to the formation of anti-trans-B[a]P-7,8-diol-9,10-epoxide (BPDE)-DNA adducts. Other carcinogenic mechanisms have been proposed: 1.] The induction of apurinic sites from r...

  7. Nucleic acid chemistry in the organic phase: from functionalized oligonucleotides to DNA side chain polymers.

    Science.gov (United States)

    Liu, Kai; Zheng, Lifei; Liu, Qing; de Vries, Jan Willem; Gerasimov, Jennifer Y; Herrmann, Andreas

    2014-10-08

    DNA-incorporating hydrophobic moieties can be synthesized by either solid-phase or solution-phase coupling. On a solid support the DNA is protected, and hydrophobic units are usually attached employing phosphoramidite chemistry involving a DNA synthesizer. On the other hand, solution coupling in aqueous medium results in low yields due to the solvent incompatibility of DNA and hydrophobic compounds. Hence, the development of a general coupling method for producing amphiphilic DNA conjugates with high yield in solution remains a major challenge. Here, we report an organic-phase coupling strategy for nucleic acid modification and polymerization by introducing a hydrophobic DNA-surfactant complex as a reactive scaffold. A remarkable range of amphiphile-DNA structures (DNA-pyrene, DNA-triphenylphosphine, DNA-hydrocarbon, and DNA block copolymers) and a series of new brush-type DNA side-chain homopolymers with high DNA grafting density are produced efficiently. We believe that this method is an important breakthrough in developing a generalized approach to synthesizing functional DNA molecules for self-assembly and related technological applications.

  8. DNA adducts and strand breaks in workers exposed to vapours and aerosols of bitumen: associations between exposure and effect.

    Science.gov (United States)

    Marczynski, Boleslaw; Raulf-Heimsoth, Monika; Spickenheuer, Anne; Pesch, Beate; Kendzia, Benjamin; Mensing, Thomas; Engelhardt, Beate; Lee, Eun-Hyun; Schindler, Birgit K; Heinze, Evelyn; Welge, Peter; Bramer, Rainer; Angerer, Jürgen; Breuer, Dietmar; Käfferlein, Heiko U; Brüning, Thomas

    2011-06-01

    To study the associations between exposure to vapours and aerosols of bitumen and genotoxic effects, a cross-sectional and cross-shift study was conducted in 320 exposed workers and 118 non-exposed construction workers. Ambient air measurements were carried out to assess external exposure to vapours and aerosols of bitumen. Hydroxylated metabolites of naphthalene, phenanthrene and pyrene were measured in urine, whereas (+)-anti-benzo[a]pyrene-7,8-diol-9,10-epoxide ((+)-anti-BPDE), 8-oxo-7,8-dihydro-2'-deoxyguanosine (8oxodGuo) and DNA strand breaks were determined in blood. Significantly higher levels of 8-oxodGuo adducts and DNA strand breaks were found in both pre- and post-shift blood samples of exposed workers compared to those of the referents. No differences between exposed workers and referents were observed for (+)-anti-BPDE. Moreover, no positive associations between DNA damage and magnitude of airborne exposure to vapours and aerosols of bitumen could be observed in our study. Additionally, no relevant association between the urinary metabolites of PAH and the DNA damage in blood was observed. Overall, our results indicate increased oxidative DNA damage in workers exposed to vapours and aerosols of bitumen compared to non-exposed referents at the group level. However, increased DNA strand breaks in bitumen workers were still within the range of those found in non-exposed and healthy persons as reported earlier. Due to the lack of an association between oxidative DNA damage and exposure levels at the workplaces under study, the observed increase in genotoxic effects in bitumen workers cannot be attributed to vapours and aerosols of bitumen.

  9. The tetramethylammonium chloride method for screening of cDNA libraries using highly degenerate oligonucleotides obtained by backtranslation of amino-acid sequences

    DEFF Research Database (Denmark)

    Honoré, B; Madsen, Peder; Leffers, H

    1993-01-01

    We describe a method for screening of cDNA libraries with highly degenerate oligonucleotides using tetramethylammonium chloride (TMAC). This method is a convenient alternative to using probes generated by the polymerase chain reaction (PCR), especially when these cannot easily be made. Nylon filt...

  10. Replication bypass of the trans-4-Hydroxynonenal-derived (6S,8R,11S)-1,N(2)-deoxyguanosine DNA adduct by the sulfolobus solfataricus DNA polymerase IV.

    Science.gov (United States)

    Banerjee, Surajit; Christov, Plamen P; Kozekova, Albena; Rizzo, Carmelo J; Egli, Martin; Stone, Michael P

    2012-02-20

    trans-4-Hydroxynonenal (HNE) is the major peroxidation product of ω-6 polyunsaturated fatty acids in vivo. Michael addition of the N(2)-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N(2)-dGuo (1,N(2)-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N(2)-dGuo adduct was incorporated into the 18-mer templates 5'-d(TCATXGAATCCTTCCCCC)-3' and d(TCACXGAATCCTTCCCCC)-3', where X = (6S,8R,11S)-HNE-1,N(2)-dGuo adduct. These differed in the identity of the template 5'-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5'-d(GGGGGAAGGATTC)-3' or a 14-mer primer 5'-d(GGGGGAAGGATTCC)-3'. The addition of dNTPs to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N(2)-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N(2)-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N(2)-dGuo adduct in a sequence-specific manner. If the template 5'-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5'-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua → Thy mutations during replication bypass when the template 5'-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N(2)-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N(2)-dGuo adduct, the (6S,8R,11S)-1,N(2)-dGuo lesion remained in the ring-closed conformation at the active site. The incoming dNTP, either d

  11. Breaking the dogma: PCB-derived semiquinone free radicals do not form covalent adducts with DNA, GSH, and amino acids.

    Science.gov (United States)

    Wangpradit, Orarat; Rahaman, Asif; Mariappan, S V Santhana; Buettner, Garry R; Robertson, Larry W; Luthe, Gregor

    2016-02-01

    Covalent bond formations of free radical metabolites with biomolecules like DNA and proteins are thought to constitute a major mechanism of toxicity and carcinogenesis. Glutathione (GSH) is generally accepted as a radical scavenger protecting the cell. In the present study, we investigated a semiquinone radical (SQ(●-)) metabolite of the semivolatile 4-chlorobiphenyl, using electron paramagnetic resonance spectroscopy, and oxygen consumption. Proton nuclear magnetic resonance ((1)H NMR) and liquid chromatography-mass spectrometry (LC-MS) were also employed to elucidate the radical interaction with DNA, amino acids, and GSH. We found that DNA and oligonucleotides stabilized SQ(●-) by electron delocalization in the π-stacking system, resulting in persistent radical intercalated, rather than forming a covalent bond with SQ(●-). This finding was strongly supported by the semiempirical calculation of the semioccupied molecular orbital and the linear combination of the atomic orbitals, indicating 9.8 kcal mol(-1) energy gain. The insertion of SQ(●-) into the DNA strand may result in DNA strand breaks and interruption of DNA replication process or even activate radical mediated secondary reactions. The presence of amino acids resulted in a decrease of the electron paramagnetic resonance (EPR) signal of SQ(●-) and correlated with their isoelectric points. The pH shifts the equilibrium of the dianions of hydroquinone and influenced indirectly the formation of SQ(●-). Similar findings were observed with GSH and Cys. GSH and Cys functioned as indirect radical scavengers; their activities depend on their chemical equilibria with the corresponding quinones, and their further reaction via Michael addition. The generally accepted role of GSH as radical scavenger in biological systems should be reconsidered based upon these findings, questioning the generally accepted view of radical interaction of semiquinones with biologically active compounds, like DNA, amino acids

  12. An acellular assay to assess the genotoxicity of complex mixtures of organic pollutants bound on size segregated aerosol. Part I: DNA adducts.

    Science.gov (United States)

    Topinka, Jan; Hovorka, Jan; Milcova, Alena; Schmuczerova, Jana; Krouzek, Jiri; Rossner, Pavel; Sram, Radim J

    2010-10-20

    An acellular assay consisting of calf thymus DNA with/without rat liver microsomal S9 fraction was used to study the genotoxicity of complex mixtures of organic air pollutants bound to size segregated aerosols by means of DNA adduct analysis. We compared the genotoxicity of the organic extracts (EOMs) from three size fractions of aerosol ranging from 0.17μm to 10μm that were collected by high volume cascade impactors in four localities of the Czech Republic differing in the extent of the environmental pollution: (1) small village in proximity of a strip mine, (2) highway, (3) city center of Prague and (4) background station. The total DNA adduct levels induced by 100μg/ml of EOMs were analyzed by (32)P-postlabelling analysis with a nuclease P1 method for adduct enrichment. The main finding of the study was most of the observed genotoxicity was connected with a fine particulate matter fraction (<1μm). The concentrations of carcinogenic polycyclic aromatic hydrocarbons (c-PAHs) in EOMs indicate that fine fractions (0.5-1μm) bound the highest amount of c-PAHs in all aerosol sampling sites, which might be related to the higher specific surface of this fraction as compared with a course fraction (1-10μm) and higher mass as compared with a condensational fraction (0.17-0.5μm). As for aerosol mass, both fine and condensational fractions are effective carriers of c-PAHs. Similarly, the DNA adduct levels per m(3) of air were highest for the fine fraction, while the condensational fraction (strip mine site and city center) revealed the highest DNA adduct levels in cases where aerosol mass is taken into consideration. A strong correlation was found between the c-PAHs and DNA adduct levels induced by EOMs in all the localities and for various size fractions (R(2)=0.98, p<0.001). It may be concluded that the analysis of total DNA adducts induced in an acellular assay with/without metabolic activation represents a relatively simple method to assess the genotoxic potential

  13. Formation of DNA adducts and induction of mutagenic effects in rats following 4 weeks inhalation exposure to ethylene oxide as a basis for cancer risk assessment.

    Science.gov (United States)

    van Sittert, N J; Boogaard, P J; Natarajan, A T; Tates, A D; Ehrenberg, L G; Törnqvist, M A

    2000-01-17

    Ethylene oxide (EO) is mutagenic in various in vitro and in vivo test systems and carcinogenic in rodents. EO forms different adducts upon reaction with DNA, N7-(2-hydroxyethyl)guanine (N7-HEG) being the main adduct. The major objectives of this study were: (a) to determine the formation and persistence of N7-HEG adducts in liver DNA of adult male rats exposed to 0, 50, 100 and 200 ppm by inhalation (4 weeks, 5 days/week, 6 h/day) and (b) to assess dose-response relationships for Hprt gene mutations and various types of chromosomal changes in splenic lymphocytes.N7-HEG adducts were measured 5, 21, 35 and 49 days after cessation of exposure. By extrapolation, the mean concentrations of N7-HEG immediately after cessation of exposure ('day 0') to 50, 100 and 200 ppm were calculated as 310, 558 and 1202 adducts/10(8) nucleotides, respectively, while the mean concentration in control rats was 2.6 adducts/10(8) nucleotides. At 49 days, N7-HEG values had returned close to background levels. The mean levels of N-(2-hydroxyethylvaline) adducts in haemoglobin were also determined and amounted 61.7, 114 and 247 nmol/g globin, respectively. Statistically significant linear relationships were found between mean N7-HEG levels ('day 0') and Hprt mutant frequencies at expression times 21/22 and 49/50 days and between mean N7-HEG ('day 0') and sister-chromatid exchanges (SCEs) or high frequency cells (HFC) measured 5 days post-exposure. At day 21 post-exposure, SCEs and HFCs in-part persisted and were significantly correlated with persistent N7-HEG adducts. No statistically significant dose effect relationships were observed for induction of micronuclei, nor for chromosome breaks or translocations. In conclusion, this study indicates that following sub-chronic exposure, EO is only weakly mutagenic in adult rats. Using the data of this study to predict cancer risk in man resulting from low level EO exposures in conjunction with other published data, i.e., those on (a) genotoxic

  14. Chimeric RNA/DNA oligonucleotide-based site-specific modification of the tobacco acetolactate syntase gene.

    Science.gov (United States)

    Kochevenko, Andrej; Willmitzer, Lothar

    2003-05-01

    Single amino acid substitutions at either of two crucial positions in acetolactate synthase (ALS) result in a chlorsulfuron-insensitive form of this enzyme and, as a consequence, a herbicide-resistant phenotype. Here, we describe the successful in vivo targeting of endogenous tobacco (Nicotiana tabacum) ALS genes using chimeric RNA/DNA and all-DNA oligonucleotides at two different locations. Similar number of conversion events with two different chimeras indicates the absence of restricting influence of genomic target sequence on the gene repair in tobacco. Chlorsulfuron-resistant plants were regenerated from calli after mesophyll protoplast electroporation or leaf tissue particle bombardment with these specifically constructed chimeras. Sequence analysis and enzyme assays proved the resulting alterations to ALS at both DNA and protein levels. Furthermore, foliar application of chlorsulfuron confirmed the development of resistant phenotypes. Lines with proline-196-alanine, threonine, glutamine, or serine substitutions or with tryptophan-573-leucine substitutions were highly resistant at both cellular and whole plant levels, whereas lines with proline-196-leucine substitutions were less resistant. The stability of these modifications was demonstrated by the continuous growth of calli on chlorsulfuron-containing medium and by the transmission of herbicide resistance to progeny in a Mendelian manner. Ability of haploid state to promote chimera-mediated conversions is discussed.

  15. Electrochemiluminescent biosensor of ATP using tetrahedron structured DNA and a functional oligonucleotide for Ru(phen)3(2+) intercalation and target identification.

    Science.gov (United States)

    Bu, Nan-Nan; Gao, Ai; He, Xi-Wen; Yin, Xue-Bo

    2013-05-15

    Restricted target accessibility and surface-induced perturbation of the aptamer structure are the main limitations in single-stranded DNA aptamer-based electrochemical sensors. Chemical labeling of the aptamer with a probe at the end of aptamer is inefficient and time-consuming. In this work, tetrahedron-structured DNA (ts-DNA) and a functionalized oligonucleotide (FO) were used to develop an electrochemiluminescence (ECL) aptasensor with adenosine triphosphate (ATP) as a model target. The ts-DNA was formed with three thiolated oligonucleotides and one oligonucleotide containing anti-ATP aptamer. The FO contained a complementary strand to the anti-ATP aptamer and an intermolecular duplex for Ru(phen)3(2+) intercalation. After the ts-DNA was immobilized on the electrode surface through gold-thiol interactions, hybridization between the anti-ATP aptamer and its complementary strand introduced the intercalated Ru(phen)3(2+) to the electrode. ECL emission from Ru(phen)3(2+) was observed with tripropylamine as a co-reactant. Once ATP reacted with its aptamer, the aptamer-complimentary strand duplex dissociated and the intermolecular duplex containing Ru(phen)3(2+) was released. The difference in emission before and after reaction with ATP was used to quantify ATP with a detection limit of 0.2nM. The ts-DNA increased the sensitivity compared to conventional methods, and the intercalation strategy avoided a complex chemical labeling procedure.

  16. Biological significance of DNA adducts investigated by simultaneous analysis of different endpoints of genotoxicity in L5178Y mouse lymphoma cells treated with methyl methanesulfonate.

    Science.gov (United States)

    Brink, Andreas; Schulz, Berta; Stopper, Helga; Lutz, Werner K

    2007-12-01

    The biological significance of DNA adducts is under continuous discussion because analytical developments allow determination of adducts at ever lower levels. Central questions refer to the biological consequences of adducts and to the relationship between background DNA damage and exposure-related increments. These questions were addressed by measuring the two DNA adducts 7-methylguanine (7-mG) and O(6)-methyl-2'-deoxyguanosine (O(6)-mdGuo) by LC-MS/MS in parallel to two biological endpoints of genotoxicity (comet assay and in vitro micronucleus test), using large batches of L5178Y mouse lymphoma cells treated with methyl methanesulfonate (MMS). The background level of 7-mG was 1440 adducts per 10(9) nucleotides while O(6)-mdGuo was almost 50-fold lower (32 adducts per 10(9) nucleotides). In the comet assay and the micronucleus test, background was in the usual range seen with smaller batches of cells (2.1% Tail DNA and 12 micronuclei-containing cells per 1000 binucleated cells, respectively). For the comparison of the four endpoints for dose-related increments above background in the low-response region we assumed linearity at low dose and used the concept of the "doubling dose", i.e., we estimated the concentration of MMS necessary to double the background measures. Doubling doses of 4.3 and 8.7microM MMS were deduced for 7-mG and O(6)-mdGuo, respectively. For doubling the background measures in the comet assay and the micronucleus test, 5 to 15-fold higher concentrations of MMS were necessary (45 and 66microM, respectively). This means that the contribution of an increase in DNA methylation to biological endpoints of genotoxicity is overestimated. For xenobiotics that generate adducts without background, the difference is even more pronounced because the dose-response curve starts at zero and the limit of detection of an increase is not affected by background variation. Consequences for the question of thresholds in dose-response relationships and for the

  17. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

    Science.gov (United States)

    Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and

  18. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides

    Science.gov (United States)

    Rivera-Torres, Natalia; Bialk, Pawel; Bloh, Kevin M.; Kmiec, Eric B.

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and

  19. Sequence-specific Hydrolysis of Single-stranded DNA by PNA-Cerium (Ⅳ) Adduct

    Institute of Scientific and Technical Information of China (English)

    He Bai SHEN; Feng WANG; Yong Tao YANG

    2005-01-01

    A novel artificial site specific cleavage reagent, with peptide nucleic acid (PNA) as sequence-recognizing moiety and cerium (Ⅳ) ions as "scissors" for cleaving target DNA, was synthesized. Subsequently, it was employed in the cleavage of target 26-mer single-stranded DNA (ssDNA), which has 10-mer sequence complementary with PNA recognizer in the hybrids,under physiological conditions. Reversed-phase high-performance liquid chromatogram (RPHPLC) experiments indicated that the artificial site specific cleavage reagent could cleave the target DNA specifically.

  20. Cockayne syndrome: varied requirement of transcription-coupled nucleotide excision repair for the removal of three structurally different adducts from transcribed DNA.

    Directory of Open Access Journals (Sweden)

    Nataliya Kitsera

    Full Text Available Hereditary defects in the transcription-coupled nucleotide excision repair (TC-NER pathway of damaged DNA cause severe neurodegenerative disease Cockayne syndrome (CS, however the origin and chemical nature of the underlying DNA damage had remained unknown. To find out, to which degree the structural properties of DNA lesions determine the extent of transcription arrest in human CS cells, we performed quantitative host cell reactivation analyses of expression vectors containing various synthetic adducts. We found that a single 3-(deoxyguanosin-N2-yl-2-acetylaminofluorene adduct (dG(N2-AAF constitutes an unsurmountable obstacle to transcription in both CS-A and CS-B cells and is removed exclusively by the CSA- and CSB-dependent pathway. In contrast, contribution of the CS proteins to the removal of two other transcription-blocking DNA lesions - N-(deoxyguanosin-8-yl-2-acetylaminofluorene (dG(C8-AAF and cyclobutane thymine-thymine (TT dimer - is only minor (TT dimer or none (dG(C8-AAF. The unique properties of dG(N2-AAF identify this adduct as a prototype for a new class of DNA lesions that escape the alternative global genome repair and could be critical for the CS pathogenesis.

  1. Metabolism of aflatoxin B1 and identification of the major aflatoxin B1-DNA adducts formed in cultured human bronchus and colon

    DEFF Research Database (Denmark)

    1979-01-01

    compared to aflatoxin B1, the binding level of benzo(a)pyrene to both bronchial and colonic DNA was generally higher. The major adducts formed in both tissues by the interaction of aflatoxin B1 and DNA were chromatographically identical to 2,3-dihydro-2-(N7-guanyl)-3-hydroxyaflatoxin B1 (Structure 1......) with the guanyl group and hydroxy group in trans-position and an adduct which has been tentatively identified by other investigators as 2,3-dihydro-2-(N5-formyl-2',5',6'-triamino-4'-oxo-N5-pyrimidyl)-3-hydroxyaflatoxin B1 (Structure 11). Seventy % of the radioactivity associated with bronchial DNA was found...... in these two peaks, and the ratio of radioactivity between the peaks was nearly 1. In colonic DNA, the ratio between Structures 1 and 11 was approximately 2. These observations add aflatoxin B1 to the list of chemical procarcinogens metabolized by cultured human tissues and in which the carcinogen-DNA adducts...

  2. Application of DNA fingerprinting with digoxigenated oligonucleotide probe (CAC)5 to analysis of the genetic variation within Taenia taeniaeformis.

    Science.gov (United States)

    Okamoto, M; Ueda, H; Hayashi, M; Oku, Y; Kurosawa, T; Kamiya, M

    1995-04-01

    DNA from T. taeniaeformis digested with the restriction endonuclease was hybridized with digoxigenated oligonucleotide probe (CAC)5. Metacestode and adult showed same clear multibanding patterns, which were characteristic of multilocus DNA fingerprinting. The fingerprinting patterns were quite different from those of the rodent hosts. Genetic variations in 4 laboratory-reared isolates of T. taeniaeformis, including 3 isolates which have been reported to be indistinguishable by infectivity, morphology and protein composition of metacestode, were investigated using this technique. Each of the 4 isolates exhibited isolate-specific fingerprinting patterns and were easily distinguished from one another, thus it was considered that (CAC)5 was a highly resolvable and informative probe for cestodes. However, it was also indicated that (CAC)5 was so sensitive that applying fingerprinting with (CAC)5 to taxonomical or phylogenetic analysis was limited where habitat of the host was restricted to the small area. In comparison to fingerprinting with 32P-labeled (CAC)5, fingerprinting with digoxigenated (CAC)5 represented more and sharper bands. It was considered that a digoxigenated probe was more useful for genetic analysis of cestodes.

  3. Benzo[a]pyrene (BP) DNA adduct formation in DNA repair-deficient p53 haploinsufficient [Xpa(-/-)p53(+/-)] and wild-type mice fed BP and BP plus chlorophyllin for 28 days.

    Science.gov (United States)

    John, Kaarthik; Pratt, M Margaret; Beland, Frederick A; Churchwell, Mona I; McMullen, Gail; Olivero, Ofelia A; Pogribny, Igor P; Poirier, Miriam C

    2012-11-01

    We have evaluated DNA damage (DNA adduct formation) after feeding benzo[a]pyrene (BP) to wild-type (WT) and cancer-susceptible Xpa(-/-)p53(+/-) mice deficient in nucleotide excision repair and haploinsufficient for the tumor suppressor p53. DNA damage was evaluated by high-performance liquid chromatography/electrospray ionization tandem mass spectrometry (HPLC/ES-MS/MS), which measures r7,t8,t9-trihydroxy-c-10-(N (2)-deoxyguanosyl)-7,8,9,10-tetrahydrobenzo[a]pyrene (BPdG), and a chemiluminescence immunoassay (CIA), using anti-r7,t8-dihydroxy-t-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE)-DNA antiserum, which measures both BPdG and the other stable BP-DNA adducts. When mice were fed 100 ppm BP for 28 days, BP-induced DNA damage measured in esophagus, liver and lung was typically higher in Xpa(-/-)p53(+/-) mice, compared with WT mice. This result is consistent with the previously observed tumor susceptibility of Xpa(-/-)p53(+/-) mice. BPdG, the major DNA adduct associated with tumorigenicity, was the primary DNA adduct formed in esophagus (a target tissue in the mouse), whereas total BP-DNA adducts predominated in higher levels in the liver (a non-target tissue in the mouse). In an attempt to lower BP-induced DNA damage, we fed the WT and Xpa(-/-)p53(+/-) mice 0.3% chlorophyllin (CHL) in the BP-containing diet for 28 days. The addition of CHL resulted in an increase of BP-DNA adducts in esophagus, liver and lung of WT mice, a lowering of BPdG in esophagi of WT mice and livers of Xpa(-/-)p53(+/-) mice and an increase of BPdG in livers of WT mice. Therefore, the addition of CHL to a BP-containing diet showed a lack of consistent chemoprotective effect, indicating that oral CHL administration may not reduce PAH-DNA adduct levels consistently in human organs.

  4. APE1, the DNA base excision repair protein, regulates the removal of platinum adducts in sensory neuronal cultures by NER

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Hyun-Suk [Department of Biochemistry and Molecular Biology, Indianapolis, IN 46202 (United States); Guo, Chunlu; Thompson, Eric L. [Department of Pharmacology and Toxicology, Indianapolis, IN 46202 (United States); Jiang, Yanlin [Department of Pediatrics and Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Kelley, Mark R. [Department of Biochemistry and Molecular Biology, Indianapolis, IN 46202 (United States); Department of Pharmacology and Toxicology, Indianapolis, IN 46202 (United States); Department of Pediatrics and Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Vasko, Michael R. [Department of Pharmacology and Toxicology, Indianapolis, IN 46202 (United States); Lee, Suk-Hee, E-mail: slee@iu.edu [Department of Biochemistry and Molecular Biology, Indianapolis, IN 46202 (United States)

    2015-09-15

    Peripheral neuropathy is one of the major side effects of treatment with the anticancer drug, cisplatin. One proposed mechanism for this neurotoxicity is the formation of platinum adducts in sensory neurons that could contribute to DNA damage. Although this damage is largely repaired by nuclear excision repair (NER), our previous findings suggest that augmenting the base excision repair pathway (BER) by overexpressing the repair protein APE1 protects sensory neurons from cisplatin-induced neurotoxicity. The question remains whether APE1 contributes to the ability of the NER pathway to repair platinum-damage in neuronal cells. To examine this, we manipulated APE1 expression in sensory neuronal cultures and measured Pt-removal after exposure to cisplatin. When neuronal cultures were treated with increasing concentrations of cisplatin for two or three hours, there was a concentration-dependent increase in Pt-damage that peaked at four hours and returned to near baseline levels after 24 h. In cultures where APE1 expression was reduced by ∼80% using siRNA directed at APE1, there was a significant inhibition of Pt-removal over eight hours which was reversed by overexpressing APE1 using a lentiviral construct for human wtAPE1. Overexpressing a mutant APE1 (C65 APE1), which only has DNA repair activity, but not its other significant redox-signaling function, mimicked the effects of wtAPE1. Overexpressing DNA repair activity mutant APE1 (226 + 177APE1), with only redox activity was ineffective suggesting it is the DNA repair function of APE1 and not its redox-signaling, that restores the Pt-damage removal. Together, these data provide the first evidence that a critical BER enzyme, APE1, helps regulate the NER pathway in the repair of cisplatin damage in sensory neurons.

  5. Dataset on characterization of hemin-azide derivative and DNA oligonucleotide-hemin conjugate

    Directory of Open Access Journals (Sweden)

    J. Kosman

    2017-08-01

    Full Text Available In this article newly synthesized azide derivative of hemin and DNA-hemin conjugate are characterized. Hemin-azide was purified using HPLC and characterized using elemental analysis, IR and NMR. The DNA-hemin conjugate was obtained via click chemistry [1] and click reaction was carried out using traditional Cu-catalyzed and Cu-free approaches. The final product was successfully obtained using Cu-free cycloaddition. The identity of product was confirmed using Maldi TOF spectrometry. Obtained hemin-DNA conjugate exhibited peroxidase-like activity.

  6. Diazido mixed-amine platinum(IV) anticancer complexes activatable by visible-light form novel DNA adducts.

    Science.gov (United States)

    Zhao, Yao; Woods, Julie A; Farrer, Nicola J; Robinson, Kim S; Pracharova, Jitka; Kasparkova, Jana; Novakova, Olga; Li, Huilin; Salassa, Luca; Pizarro, Ana M; Clarkson, Guy J; Song, Lijiang; Brabec, Viktor; Sadler, Peter J

    2013-07-15

    Platinum diam(m)ine complexes, such as cisplatin, are successful anticancer drugs, but suffer from problems of resistance and side-effects. Photoactivatable Pt(IV) prodrugs offer the potential of targeted drug release and new mechanisms of action. We report the synthesis, X-ray crystallographic and spectroscopic properties of photoactivatable diazido complexes trans,trans,trans-[Pt(N3)2(OH)2(MA)(Py)] (1; MA=methylamine, Py=pyridine) and trans,trans,trans-[Pt(N3)2(OH)2(MA)(Tz)] (2; Tz=thiazole), and interpret their photophysical properties by TD-DFT modelling. The orientation of the azido groups is highly dependent on H bonding and crystal packing, as shown by polymorphs 1p and 1q. Complexes 1 and 2 are stable in the dark towards hydrolysis and glutathione reduction, but undergo rapid photoreduction with UVA or blue light with minimal amine photodissociation. They are over an order of magnitude more potent towards HaCaT keratinocytes, A2780 ovarian, and OE19 oesophageal carcinoma cells than cisplatin and show particular potency towards cisplatin-resistant human ovarian cancer cells (A2780cis). Analysis of binding to calf-thymus (CT), plasmids, oligonucleotide DNA and individual nucleotides reveals that photoactivated 1 and 2 form both mono- and bifunctional DNA lesions, with preference for G and C, similar to transplatin, but with significantly larger unwinding angles and a higher percentage of interstrand cross-links, with evidence for DNA strand cross-linking further supported by a comet assay. DNA lesions of 1 and 2 on a 50 bp duplex were not recognised by HMGB1 protein, in contrast to cisplatin-type lesions. The photo-induced platination reactions of DNA by 1 and 2 show similarities with the products of the dark reactions of the Pt(II) compounds trans-[PtCl2(MA)(Py)] (5) and trans-[PtCl2(MA)(Tz)] (6). Following photoactivation, complex 2 reacted most rapidly with CT DNA, followed by 1, whereas the dark reactions of 5 and 6 with DNA were comparatively slow

  7. Dual function of Ixr1 in transcriptional regulation and recognition of cisplatin-DNA adducts is caused by differential binding through its two HMG-boxes.

    Science.gov (United States)

    Vizoso-Vázquez, A; Lamas-Maceiras, M; Fernández-Leiro, R; Rico-Díaz, A; Becerra, M; Cerdán, M E

    2017-02-01

    Ixr1 is a transcriptional factor involved in the response to hypoxia, which is also related to DNA repair. It binds to DNA through its two in-tandem high mobility group box (HMG-box) domains. Each function depends on recognition of different DNA structures, B-form DNA at specific consensus sequences for transcriptional regulation, or distorted DNA, like cisplatin-DNA adducts, for DNA repair. However, the contribution of the HMG-box domains in the Ixr1 protein to the formation of different protein-DNA complexes is poorly understood. We have biophysically and biochemically characterized these interactions with specific DNA sequences from the promoters regulated by Ixr1, or with cisplatin-DNA adducts. Both HMG-boxes are necessary for transcriptional regulation, and they are not functionally interchangeable. The in-tandem arrangement of their HMG-boxes is necessary for functional folding and causes sequential cooperative binding to specific DNA sequences, with HMG-box A showing a higher contribution to DNA binding and bending than the HMG-box B. Binding of Ixr1 HMG boxes to specific DNA sequences is entropy driven, whereas binding to platinated DNA is enthalpy driven for HMG-box A and entropy driven for HMG-box B. This is the first proof that HMG-box binding to different DNA structures is associated with predictable thermodynamic differences. Based on our study, we present a model to explain the dual function of Ixr1 in the regulation of gene expression and recognition of distorted DNA structures caused by cisplatin treatment.

  8. Serum Level of Antibody against Benzo[a]pyrene-7,8-diol-9,10-epoxide-DNA Adducts in People Dermally Exposed to PAHs

    Directory of Open Access Journals (Sweden)

    Lenka Borska

    2014-01-01

    Full Text Available Some specific antibodies indicate the presence of antigenic structures on DNA (DNA adducts that can play an important role in the process of mutagenesis and/or carcinogenesis. They indicate the presence of increased genotoxic potential (hazard prior to the formation of disease (primary prevention. The present study was focused on the serum level of benzo[a]pyrene 7,8-diol-9,10-epoxide-DNA adducts antibodies (anti-BPDE-DNA in psoriatic patients (n=55 dermally exposed to different levels of polycyclic aromatic hydrocarbons (PAHs. The general goal of the study was to contribute to better understanding of the value of the assumed biomarker (anti-BPDE-DNA for evaluation of the organism's answer to genotoxic exposure to PAHs. Elevated level of exposure to PAHs resulted in the increased level of anti-BPDE-DNA. However, almost all levels of anti-BPDE-DNA ranged within the field of low values. Both variants of GT (CCT-3% and CCT-5% induced higher expression of anti-BPDE-DNA in the group of nonsmokers. Significant relations between the level of anti-BPDE-DNA and PASI score, total duration of the therapy, or time of UVR exposure were not found. Further studies are needed to reduce interpretation uncertainty of this promising bioindicator.

  9. Spectroscopic and structural studies on the interaction of an anticancer β-carboline alkaloid, harmine with GC and AT specific DNA oligonucleotides.

    Science.gov (United States)

    Sharma, Shweta; Yadav, Monika; Gupta, Surendra P; Pandav, Kumud; Kumar, Surat

    2016-12-25

    Harmine, a tricyclic β-carboline alkaloid possesses anticancer properties. Thus, its binding studies with DNA are considerably important because mechanism of action of anticancer drug involves DNA binding. On the other hand, the DNA binding study is also useful in drug designing and synthesis of new compounds with enhanced biological properties. Hence, the binding of harmine with sequence specific DNA oligonucleotides has been studied using various biophysical techniques i.e. absorption, fluorescence and molecular docking techniques. UV absorption study, Fluorescence quenching and Iodide quenching experiments revealed intercalation type of binding of harmine with short sequence specific DNA oligonucleotides. Fluorescence and absorption studies also concluded binding constants of harmine with GC rich DNA sequence in the order of 10(5) M(-1) while with AT rich sequences it was in the order of 10(3) M(-1) which clearly indicated that harmine showed greater intercalation with GC rich sequences as compared to AT rich sequences. From thermodynamic studies, it was concluded that harmine-DNA complex formation was spontaneous, exothermic and energetically favorable process. Molecular docking studies confirmed that harmine intercalates between the base pairs of DNA structure but energetically prefers intercalation between GC base pairs. Molecular docking studies and the calculated thermodynamic parameters, i.e. Gibbs free energy (ΔG), Enthalpy change (ΔH) and Entropy change (ΔS) indicated that H-bonds, van der Waals interactions and hydrophobic interactions play a major role in the binding of harmine to DNA oligomers.

  10. Structural perturbations induced by the alpha-anomer of the aflatoxin B(1) formamidopyrimidine adduct in duplex and single-strand DNA.

    Science.gov (United States)

    Brown, Kyle L; Voehler, Markus W; Magee, Shane M; Harris, Constance M; Harris, Thomas M; Stone, Michael P

    2009-11-11

    The guanine N7 adduct of aflatoxin B(1) exo-8,9-epoxide hydrolyzes to form the formamidopyrimidine (AFB-FAPY) adduct, which interconverts between alpha and beta anomers. The beta anomer is highly mutagenic in Escherichia coli, producing G --> T transversions; it thermally stabilizes the DNA duplex. The AFB-alpha-FAPY adduct blocks replication; it destabilizes the DNA duplex. Herein, the structure of the AFB-alpha-FAPY adduct has been elucidated in 5'-d(C(1)T(2)A(3)T(4)X(5)A(6)T(7)T(8)C(9)A(10))-3'.5'-d(T(11)G(12)A(13)A(14)T(15)C(16)A(17)T(18)A(19)G(20))-3' (X = AFB-alpha-FAPY) using molecular dynamics calculations restrained by NMR-derived distances and torsion angles. The AFB moiety intercalates on the 5' face of the pyrimidine moiety at the damaged nucleotide between base pairs T(4).A(17) and X(5).C(16), placing the FAPY C5-N(5) bond in the R(a) axial conformation. Large perturbations of the epsilon and zeta backbone torsion angles are observed, and the base stacking register of the duplex is perturbed. The deoxyribose orientation shifts to become parallel to the FAPY base and displaced toward the minor groove. Intrastrand stacking between the AFB moiety and the 5' neighbor thymine remains, but strong interstrand stacking is not observed. A hydrogen bond between the formyl group and the exocyclic amine of the 3'-neighbor adenine stabilizes the E conformation of the formamide moiety. NMR studies reveal a similar 5'-intercalation of the AFB moiety for the AFB-alpha-FAPY adduct in the tetramer 5'-d(C(1)T(2)X(3)A(4))-3', involving the R(a) axial conformation of the FAPY C5-N(5) bond and the E conformation of the formamide moiety. Since in duplex DNA the AFB moiety of the AFB-beta-FAPY adduct also intercalates on the 5' side of the pyrimidine moiety at the damaged nucleotide, we conclude that favorable 5'-stacking leads to the R(a) conformational preference about the C5-N(5) bond; the same conformational preference about this bond is also observed at the nucleoside

  11. Synthesis of Mitomycin C and Decarbamoylmitomycin C N(2) deoxyguanosine-adducts.

    Science.gov (United States)

    Champeil, Elise; Cheng, Shu-Yuan; Huang, Bik Tzu; Conchero-Guisan, Marta; Martinez, Thibaut; Paz, Manuel M; Sapse, Anne-Marie

    2016-04-01

    Mitomycin C (MC) and Decarbamoylmitomycin C (DMC) - a derivative of MC lacking the carbamate on C10 - are DNA alkylating agents. Their cytotoxicity is attributed to their ability to generate DNA monoadducts as well as intrastrand and interstrand cross-links (ICLs). The major monoadducts generated by MC and DMC in tumor cells have opposite stereochemistry at carbon one of the guanine-mitosene bond: trans (or alpha) for MC and cis (or beta) for DMC. We hypothesize that local disruptions of DNA structure from trans or cis adducts are responsible for the different biochemical responses produced by MC and DMC. Access to DNA substrates bearing cis and trans MC/DMC lesions is essential to verify this hypothesis. Synthetic oligonucleotides bearing trans lesions can be obtained by bio-mimetic methods. However, this approach does not yield cis adducts. This report presents the first chemical synthesis of a cis mitosene DNA adduct. We also examined the stereopreference exhibited by the two drugs at the mononucleotide level by analyzing the formation of cis and trans adducts in the reaction of deoxyguanosine with MC or DMC using a variety of activation conditions. In addition, we performed Density Functional Theory calculations to evaluate the energies of these reactions. Direct alkylation under autocatalytic or bifunctional conditions yielded preferentially alpha adducts with both MC and DMC. DFT calculations showed that under bifunctional activation, the thermodynamically favored adducts are alpha, trans, for MC and beta, cis, for DMC. This suggests that the duplex DNA structure may stabilize/oriente the activated pro-drugs so that, with DMC, formation of the thermodynamically favored beta products are possible in a cellular environment.

  12. Mutagenicity of 2-amino-3-methylimidazo[4,5-f]quinoline in colon and liver of Big Blue rats: role of DNA adducts, strand breaks, DNA repair and oxidative stress

    DEFF Research Database (Denmark)

    Moller, P.; Wallin, H.; Vogel, U.

    2002-01-01

    The contribution of oxidative stress, different types of DNA damage and expression of DNA repair enzymes in colon and liver mutagenesis induced by 2-amino-3-methylimidazo [4,5-f]quinoline (IQ) was investigated in four groups of six Big Blue rats fed diets with 0, 20, 70, and 200 mg IQ/kg for 3...... weeks. There were dose-response relationships of DNA adducts (P-32-postlabeling) and DNA strand breaks (comet assay) in colon and liver tissues, with the highest levels of DNA adducts and strand breaks in the colon. There was dose-dependent induction of mutations in both the colon and the liver....... Investigations of oxidative stress biomarkers produced inconclusive results. Oxidative DNA damage detected by the endonuclease III enzyme and 7-hydro-8-oxo-2'-deoxyguanosine in colon, liver and/or urine was unaltered by IQ. However, there was increased level of gamma-glutamyl semialdehyde in liver proteins...

  13. Real-time detection of TDP1 activity using a fluorophore-quencher coupled DNA-biosensor

    DEFF Research Database (Denmark)

    Jensen, Pia Wrensted; Falconi, Mattia; Kristoffersen, Emil Laust

    2013-01-01

    such as biopsies. TDP1 removes covalent 3′DNA adducts in DNA single-strand break repair. This enzymatic activity forms the basis of the design of the TDP1-biosensor, which consists of a short hairpin-forming oligonucleotide having a 5′fluorophore and a 3′quencher brought in close proximity by the secondary...

  14. Charge density and particle size effects on oligonucleotide and plasmid DNA binding to nanosized hydrotalcite.

    Science.gov (United States)

    Sanderson, Brian A; Sowersby, Drew S; Crosby, Sergio; Goss, Marcus; Lewis, L Kevin; Beall, Gary W

    2013-12-01

    Hydrotalcite (HT) and other layered double metal hydroxides are of great interest as gene delivery and timed release drug delivery systems and as enteric vehicles for biologically active molecules that are sensitive to gastric fluids. HT is a naturally occurring double metal hydroxide that can be synthesized as a nanomaterial consisting of a brucite structure with isomorphous substitution of aluminum ions. These positively charged nanoparticles exhibit plate-like morphology with very high aspect ratios. Biomolecules such as nucleic acids and proteins form strong associations with HT because they can associate with the positively charged layers. The binding of nucleic acids with HT and other nanomaterials is currently being investigated for potential use in gene therapy; however, the binding of specific nucleic acid forms, such as single- and double-stranded DNA, has been little explored. In addition, the effects of charge density and particle size on DNA adsorption has not been studied. In this paper, the binding of different forms of DNA to a series of HTs prepared at different temperatures and with different anion exchange capacities has been investigated. Experiments demonstrated that HTs synthesized at higher temperatures associate with both single- and double-stranded oligomers and circular plasmid DNA more tightly than HTs synthesized at room temperature, likely due to the hydrothermal conditions promoting larger particle sizes. HT with an anion exchange capacity of 300 meq/100 g demonstrated the highest binding of DNA, likely due to the closer match of charge densities between the HT and DNA. The details of the interaction of various forms of DNA with HT as a function of charge density, particle size, and concentration are discussed.

  15. Direct reduction of N-acetoxy-PhIP by tea polyphenols: a possible mechanism for chemoprevention against PhIP-DNA adduct formation.

    Science.gov (United States)

    Lin, Dong-Xin; Thompson, Patricia A; Teitel, Candee; Chen, Jun-Shi; Kadlubar, Fred F

    2003-01-01

    The chemopreventive effect of tea against 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP)-DNA adduct formation and its mechanism were studied. Rats were exposed to freshly prepared aqueous extracts of green tea (3% (w/v)) as the sole source of drinking water for 10 days prior to administration with a single dose of PhIP (10 mg/kg body weight) by oral gavage. PhIP-DNA adducts in the liver, colon, heart, and lung were measured using the 32P-postlabelling technique. Rats pre-treated with tea and given PhIP 20 h before sacrifice had significantly reduced levels of PhIP-DNA adducts as compared with controls given PhIP alone. The possible mechanism of protective effect of tea on PhIP-DNA adduct formation was then examined in vitro. It was found that an aqueous extract of green and black tea, mixtures of green and black tea polyphenols, as well as purified polyphenols could strongly inhibit the DNA binding of N-acetoxy-PhIP, a putative ultimate carcinogen of PhIP formed in vivo via metabolic activation. Among these, epigallocatechin gallate was exceptionally potent. HPLC analyses of these incubation mixtures containing N-acetoxy-PhIP and the tea polyphenols each revealed the production of the parent amine, PhIP, indicating the involvement of a redox mechanism. In view of the presence of relatively high levels of tea polyphenols in rat and human plasma after ingestion of tea, this study suggests that direct reduction of the ultimate carcinogen N-acetoxy-PhIP by tea polyphenols is likely to be involved in the mechanism of chemoprotection of tea against this carcinogen.

  16. Direct reduction of N-acetoxy-PhIP by tea polyphenols: a possible mechanism for chemoprevention against PhIP-DNA adduct formation

    Energy Technology Data Exchange (ETDEWEB)

    Lin Dongxin; Thompson, Patricia A.; Teitel, Candee; Chen Junshi; Kadlubar, Fred F

    2003-03-01

    The chemopreventive effect of tea against 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP)-DNA adduct formation and its mechanism were studied. Rats were exposed to freshly prepared aqueous extracts of green tea (3% (w/v)) as the sole source of drinking water for 10 days prior to administration with a single dose of PhIP (10 mg/kg body weight) by oral gavage. PhIP-DNA adducts in the liver, colon, heart, and lung were measured using the {sup 32}P-postlabelling technique. Rats pre-treated with tea and given PhIP 20 h before sacrifice had significantly reduced levels of PhIP-DNA adducts as compared with controls given PhIP alone. The possible mechanism of protective effect of tea on PhIP-DNA adduct formation was then examined in vitro. It was found that an aqueous extract of green and black tea, mixtures of green and black tea polyphenols, as well as purified polyphenols could strongly inhibit the DNA binding of N-acetoxy-PhIP, a putative ultimate carcinogen of PhIP formed in vivo via metabolic activation. Among these, epigallocatechin gallate was exceptionally potent. HPLC analyses of these incubation mixtures containing N-acetoxy-PhIP and the tea polyphenols each revealed the production of the parent amine, PhIP, indicating the involvement of a redox mechanism. In view of the presence of relatively high levels of tea polyphenols in rat and human plasma after ingestion of tea, this study suggests that direct reduction of the ultimate carcinogen N-acetoxy-PhIP by tea polyphenols is likely to be involved in the mechanism of chemoprotection of tea against this carcinogen.

  17. Effect of increased intake of dietary animal fat and fat energy on oxidative damage, mutation frequency, DNA adduct level and DNA repair in rat colon and liver

    DEFF Research Database (Denmark)

    Vogel, Ulla; Daneshvar, Bahram; Autrup, Herman;

    2003-01-01

    was observed. Intake of lard fat resulted in increased ascorbate synthesis and affected markers of oxidative damage to proteins in liver cytosol, but not in plasma. The effect was observed at all lard doses and was not dose-dependent. However, no evidence of increased oxidative DNA damage was found in liver...... supplemented with 0, 3, 10 or 30% w/w lard. After 3 weeks, the mutation frequency, DNA repair gene expression, DNA damage and oxidative markers were determined in liver, colon and plasma. The mutation frequency of the lambda gene cII did not increase with increased fat or energy intake in colon or liver....... The DNA-adduct level measured by 32P-postlabelling decreased in both liver and colon with increased fat intake. In liver, this was accompanied by a 2-fold increase of the mRNA level of nucleotide excision repair (NER) gene ERCC1. In colon, a non-statistically significant increase in the ERCC1 mRNA levels...

  18. Effect of increased intake of dietary animal fat and fat energy on oxidative damage, mutation frequency, DNA adduct level and DNA repair in rat colon and liver

    DEFF Research Database (Denmark)

    Vogel, Ulla Birgitte; Danesvar, B.; Autrup, H.;

    2003-01-01

    was observed. Intake of lard fat resulted in increased ascorbate synthesis and affected markers of oxidative damage to proteins in liver cytosol, but not in plasma. The effect was observed at all lard doses and was not dose-dependent. However, no evidence of increased oxidative DNA damage was found in liver...... supplemented with 0, 3, 10 or 30% w/w lard. After 3 weeks, the mutation frequency, DNA repair gene expression, DNA damage and oxidative markers were determined in liver, colon and plasma. The mutation frequency of the lambda gene cII did not increase with increased fat or energy intake in colon or liver....... The DNA-adduct level measured by P-32-postlabelling decreased in both liver and colon with increased fat intake. In liver, this was accompanied by a 2-fold increase of the mRNA level of nucleotide excision repair (NER) gene ERCC1. In colon, a non-statistically significant increase in the ERCC1 mRNA levels...

  19. Sequence dependent structure and thermodynamics of DNA oligonucleotides and polynucleotides: uv melting and NMR (nuclear magnetic resonance) studies

    Energy Technology Data Exchange (ETDEWEB)

    Aboul-ela, F.M.

    1987-12-01

    Thermodynamic parameters for double strand formation have been measured for the twenty-five DNA double helices made by mixing deoxyoligonucleotides of the sequence dCA/sub 3/XA/sub 3/G with the complement dCT/sub 3/YT/sub 3/G. Each of the bases A, C, G, T, and I (I = hypoxanthine) have been substituted at the positions labeled X and Y. The results are analyzed in terms of nearest neighbors. At higher temperatures the sequences containing a G)centerreverse arrowdot)C base pair become more stable than those containing only A)centerreverse arrowdot)T. All molecules containing mismatcher are destabilized with respect to those with only Watson-Crick pairing, but there is a wide range of destabilization. Large neighboring base effects upon stability were observed. For example, when (X, Y) = (I, A), the duplex is eightfold more stable than when (X, Y) = (A, I). Independent of sequence effects the order of stabilities is: I)centerreverse arrowdot)C )succ) I)centerreverse arrowdot) A)succ) I)centerreverse arrowdot)T approx. I)centerreverse arrowdot)G. All of these results are discussed within the context of models for sequence dependent DNA secondary structure, replication fidelity and mechanisms of mismatch repair, and implications for probe design. The duplex deoxyoligonucleotide d(GGATGGGAG))centerreverse arrowdot)d(CTCCCATCC) is a portion of the gene recognition sequence of the protein transcription factor IIIA. The crystal structure of this oligonucleotide was shown to be A-form The present study employs Nuclear Magnetic Resonance, optical, chemical and enzymatic techniques to investigate the solution structure of this DNA 9-mer. (157 refs., 19 figs., 10 tabs.

  20. Sequence dependent structure and thermodynamics of DNA oligonucleotides and polynucleotides: uv melting and NMR (nuclear magnetic resonance) studies

    Energy Technology Data Exchange (ETDEWEB)

    Aboul-ela, F.M.

    1987-12-01

    Thermodynamic parameters for double strand formation have been measured for the twenty-five DNA double helices made by mixing deoxyoligonucleotides of the sequence dCA/sub 3/XA/sub 3/G with the complement dCT/sub 3/YT/sub 3/G. Each of the bases A, C, G, T, and I (I = hypoxanthine) have been substituted at the positions labeled X and Y. The results are analyzed in terms of nearest neighbors. At higher temperatures the sequences containing a G)centerreverse arrowdot)C base pair become more stable than those containing only A)centerreverse arrowdot)T. All molecules containing mismatcher are destabilized with respect to those with only Watson-Crick pairing, but there is a wide range of destabilization. Large neighboring base effects upon stability were observed. For example, when (X, Y) = (I, A), the duplex is eightfold more stable than when (X, Y) = (A, I). Independent of sequence effects the order of stabilities is: I)centerreverse arrowdot)C )succ) I)centerreverse arrowdot) A)succ) I)centerreverse arrowdot)T approx. I)centerreverse arrowdot)G. All of these results are discussed within the context of models for sequence dependent DNA secondary structure, replication fidelity and mechanisms of mismatch repair, and implications for probe design. The duplex deoxyoligonucleotide d(GGATGGGAG))centerreverse arrowdot)d(CTCCCATCC) is a portion of the gene recognition sequence of the protein transcription factor IIIA. The crystal structure of this oligonucleotide was shown to be A-form The present study employs Nuclear Magnetic Resonance, optical, chemical and enzymatic techniques to investigate the solution structure of this DNA 9-mer. (157 refs., 19 figs., 10 tabs.

  1. Detection of Aeromonas hydrophila DNA oligonucleotide sequence using a biosensor design based on Ceria nanoparticles decorated reduced graphene oxide and Fast Fourier transform square wave voltammetry.

    Science.gov (United States)

    Jafari, Safiye; Faridbod, Farnoush; Norouzi, Parviz; Dezfuli, Amin Shiralizadeh; Ajloo, Davood; Mohammadipanah, Fatemeh; Ganjali, Mohammad Reza

    2015-10-01

    A new strategy was introduced for ssDNA immobilization on a modified glassy carbon electrode. The electrode surface was modified using polyaniline and chemically reduced graphene oxide decorated cerium oxide nanoparticles (CeO2NPs-RGO). A single-stranded DNA (ssDNA) probe was immobilized on the modified electrode surface. Fast Fourier transform square wave voltammetry (FFT-SWV) was applied as detection technique and [Ru(bpy)3](2+/3+) redox signal was used as electrochemical marker. The hybridization of ssDNA with its complementary target caused a dramatic decrease in [Ru(bpy)3](2+/3+) FFT-SW signal. The proposed electrochemical biosensor was able to detect Aeromonas hydrophila DNA oligonucleotide sequence encoding aerolysin protein. Under optimal conditions, the biosensor showed excellent selectivity toward complementary sequence in comparison with noncomplementary and two-base mismatch sequences. The dynamic linear range of this electrochemical DNA biosensor for detecting 20-mer oligonucleotide sequence of A. hydrophila was from 1 × 10(-15) to 1 × 10(-8) mol L(-1). The proposed biosensor was successfully applied for the detection of DNA extracted from A. hydrophila in fish pond water up to 0.01 μg mL(-1) with RSD of 5%. Besides, molecular docking was applied to consider the [Ru(bpy)3](2+/3+) interaction with ssDNA before and after hybridization.

  2. Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

    Science.gov (United States)

    Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

    2017-04-05

    Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

  3. Effects of ethylene oxide and ethylene inhalation on DNA adducts, apurinic/apyrimidinic sites and expression of base excision DNA repair genes in rat brain, spleen, and liver.

    Science.gov (United States)

    Rusyn, Ivan; Asakura, Shoji; Li, Yutai; Kosyk, Oksana; Koc, Hasan; Nakamura, Jun; Upton, Patricia B; Swenberg, James A

    2005-09-28

    Ethylene oxide (EO) is an important industrial chemical that is classified as a known human carcinogen (IARC, Group 1). It is also a metabolite of ethylene (ET), a compound that is ubiquitous in the environment and is the most used petrochemical. ET has not produced evidence of cancer in laboratory animals and is "not classifiable as to its carcinogenicity to humans" (IARC, Group 3). The mechanism of carcinogenicity of EO is not well characterized, but is thought to involve the formation of DNA adducts. EO is mutagenic in a variety of in vitro and in vivo systems, whereas ET is not. Apurinic/apyrimidinic sites (AP) that result from chemical or glycosylase-mediated depurination of EO-induced DNA adducts could be an additional mechanism leading to mutations and chromosomal aberrations. This study tested the hypothesis that EO exposure results in the accumulation of AP sites and induces changes in expression of genes for base excision DNA repair (BER). Male Fisher 344 rats were exposed to EO (100 ppm) or ET (40 or 3000 ppm) by inhalation for 1, 3 or 20 days (6h/day, 5 days a week). Animals were sacrificed 2h after exposure for 1, 3 or 20 days as well as 6, 24 and 72 h after a single-day exposure. Experiments were performed with tissues from brain and spleen, target sites for EO-induced carcinogenesis, and liver, a non-target organ. Exposure to EO resulted in time-dependent increases in N7-(2-hydroxyethyl)guanine (7-HEG) in brain, spleen, and liver and N7-(2-hydroxyethyl)valine (7-HEVal) in globin. Ethylene exposure also induced 7-HEG and 7-HEVal, but the numbers of adducts were much lower. No increase in the number of aldehydic DNA lesions, an indicator of AP sites, was detected in any of the tissues between controls and EO-, or ET-exposed animals, regardless of the duration or strength of exposure. EO exposure led to a 3-7-fold decrease in expression of 3-methyladenine-DNA glycosylase (Mpg) in brain and spleen in rats exposed to EO for 1 day. Expression of 8

  4. Specific targeted gene repair using single-stranded DNA oligonucleotides at an endogenous locus in mammalian cells uses homologous recombination.

    Science.gov (United States)

    McLachlan, Jennifer; Fernandez, Serena; Helleday, Thomas; Bryant, Helen E

    2009-12-03

    The feasibility of introducing point mutations in vivo using single-stranded DNA oligonucleotides (ssON) has been demonstrated but the efficiency and mechanism remain elusive and potential side effects have not been fully evaluated. Understanding the mechanism behind this potential therapy may help its development. Here, we demonstrate the specific repair of an endogenous non-functional hprt gene by a ssON in mammalian cells, and show that the frequency of such an event is enhanced when cells are in S-phase of the cell cycle. A potential barrier in using ssONs as gene therapy could be non-targeted mutations or gene rearrangements triggered by the ssON. Both the non-specific mutation frequencies and the frequency of gene rearrangements were largely unaffected by ssONs. Furthermore, we find that the introduction of a mutation causing the loss of a functional endogenous hprt gene by a ssON occurred at a similarly low but statistically significant frequency in wild type cells and in cells deficient in single strand break repair, nucleotide excision repair and mismatch repair. However, this mutation was not induced in XRCC3 mutant cells deficient in homologous recombination. Thus, our data suggest ssON-mediated targeted gene repair is more efficient in S-phase and involves homologous recombination.

  5. Targeting DNA with "light-up" pyrimidine triple-helical forming oligonucleotides conjugated to stabilizing fluorophores (LU-TFOs).

    Science.gov (United States)

    Renard, Brice-Loïc; Lartia, Rémy; Asseline, Ulysse

    2008-12-07

    The synthesis of triple-helix-forming oligonucleotides (TFOs) linked to a series of cyanine monomethines has been performed. Eight cyanines including one thiocyanine, four thiazole orange analogues, and three quinocyanines were attached to the 5'-end of 10-mer pyrimidine TFOs. The binding properties of these modified TFOs with their double-stranded DNA target were studied by absorption and steady-state fluorescence spectroscopy. The stability of the triplex structures depended on the cyanine structure and the linker size used to connect both entities. The most efficient cyanines able to stabilize the triplex structures, when attached at the 5'-end of the TFO, have been incorporated at both ends and provided triplex structures with increased stability. Fluorescence studies have shown that for the TFOs involving one cyanine, an important intensity increase (up to 37-fold) in the fluorescent signal was observed upon their hybridization with the double-stranded target, proving hybridization. The conjugates involving thiazole orange attached by the benzothiazole ring provided the most balanced properties in terms of triplex stabilization, fluorescence intensity and fluorescence enhancement upon hybridization with the double-stranded target. In order to test the influence of different parameters such as the TFO sequence and length, thiazole orange was used to label 17-mer TFOs. Hybridizations of these TFOs with different duplexes, designed to study the influence of mismatches at both internal and terminal positions on the triplex structures, confirmed the possibility of triplex formation without loss of specificity together with a strong fluorescence enhancement (up to 13-fold).

  6. Assessment and integration of publicly available SAGE, cDNA microarray, and oligonucleotide microarray expression data for global coexpression analyses.

    Science.gov (United States)

    Griffith, Obi L; Pleasance, Erin D; Fulton, Debra L; Oveisi, Mehrdad; Ester, Martin; Siddiqui, Asim S; Jones, Steven J M

    2005-10-01

    Large amounts of gene expression data from several different technologies are becoming available to the scientific community. A common practice is to use these data to calculate global gene coexpression for validation or integration of other "omic" data. To assess the utility of publicly available datasets for this purpose we have analyzed Homo sapiens data from 1202 cDNA microarray experiments, 242 SAGE libraries, and 667 Affymetrix oligonucleotide microarray experiments. The three datasets compared demonstrate significant but low levels of global concordance (rc<0.11). Assessment against Gene Ontology (GO) revealed that all three platforms identify more coexpressed gene pairs with common biological processes than expected by chance. As the Pearson correlation for a gene pair increased it was more likely to be confirmed by GO. The Affymetrix dataset performed best individually with gene pairs of correlation 0.9-1.0 confirmed by GO in 74% of cases. However, in all cases, gene pairs confirmed by multiple platforms were more likely to be confirmed by GO. We show that combining results from different expression platforms increases reliability of coexpression. A comparison with other recently published coexpression studies found similar results in terms of performance against GO but with each method producing distinctly different gene pair lists.

  7. Cassava (Manihot esculenta) transcriptome analysis in response to infection by the fungus Colletotrichum gloeosporioides using an oligonucleotide-DNA microarray.

    Science.gov (United States)

    Utsumi, Yoshinori; Tanaka, Maho; Kurotani, Atsushi; Yoshida, Takuhiro; Mochida, Keiichi; Matsui, Akihiro; Ishitani, Manabu; Sraphet, Supajit; Whankaew, Sukhuman; Asvarak, Thipa; Narangajavana, Jarunya; Triwitayakorn, Kanokporn; Sakurai, Tetsuya; Seki, Motoaki

    2016-07-01

    Cassava anthracnose disease (CAD), caused by the fungus Colletotrichum gloeosporioides f. sp. Manihotis, is a serious disease of cassava (Manihot esculenta) worldwide. In this study, we established a cassava oligonucleotide-DNA microarray representing 59,079 probes corresponding to approximately 30,000 genes based on original expressed sequence tags and RNA-seq information from cassava, and applied it to investigate the molecular mechanisms of resistance to fungal infection using two cassava cultivars, Huay Bong 60 (HB60, resistant to CAD) and Hanatee (HN, sensitive to CAD). Based on quantitative real-time reverse transcription PCR and expression profiling by the microarray, we showed that the expressions of various plant defense-related genes, such as pathogenesis-related (PR) genes, cell wall-related genes, detoxification enzyme, genes related to the response to bacterium, mitogen-activated protein kinase (MAPK), genes related to salicylic acid, jasmonic acid and ethylene pathways were higher in HB60 compared with HN. Our results indicated that the induction of PR genes in HB60 by fungal infection and the higher expressions of defense response-related genes in HB60 compared with HN are likely responsible for the fungal resistance in HB60. We also showed that the use of our cassava oligo microarray could improve our understanding of cassava molecular mechanisms related to environmental responses and development, and advance the molecular breeding of useful cassava plants.

  8. DNA Adduct Formation from Metabolic 5'-Hydroxylation of the Tobacco-Specific Carcinogen N'-Nitrosonornicotine in Human Enzyme Systems and in Rats.

    Science.gov (United States)

    Zarth, Adam T; Upadhyaya, Pramod; Yang, Jing; Hecht, Stephen S

    2016-03-21

    N'-Nitrosonornicotine (NNN) is carcinogenic in multiple animal models and has been evaluated as a human carcinogen. NNN can be metabolized by cytochrome P450s through two activation pathways: 2'-hydroxylation and 5'-hydroxylation. While most previous studies have focused on 2'-hydroxylation in target tissues of rats, available evidence suggests that 5'-hydroxylation is a major activation pathway in human enzyme systems, in nonhuman primates, and in target tissues of some other rodent carcinogenicity models. In the study reported here, we investigated DNA damage resulting from NNN 5'-hydroxylation by quantifying the adduct 2-(2-(3-pyridyl)-N-pyrrolidinyl)-2'-deoxyinosine (py-py-dI). In rats treated with NNN in the drinking water (7-500 ppm), py-py-dI was the major DNA adduct resulting from 5'-hydroxylation of NNN in vivo. Levels of py-py-dI in the lung and nasal cavity were the highest, consistent with the tissue distribution of CYP2A3. In rats treated with (S)-NNN or (R)-NNN, the ratios of formation of (R)-py-py-dI to (S)-py-py-dI were not the expected mirror image, suggesting that there may be a carrier for one of the unstable intermediates formed upon 5'-hydroxylation of NNN. Rat hepatocytes treated with (S)- or (R)-NNN or (2'S)- or (2'R)-5'-acetoxyNNN exhibited a pattern of adduct formation similar to that of live rats. In vitro studies with human liver S9 fraction or human hepatocytes incubated with NNN (2-500 μM) demonstrated that py-py-dI formation was greater than the formation of pyridyloxobutyl-DNA adducts resulting from 2'-hydroxylation of NNN. (S)-NNN formed more total py-py-dI adducts than (R)-NNN in human liver enzyme systems, which is consistent with the critical role of CYP2A6 in the 5'-hydroxylation of NNN in human liver. The results of this study demonstrate that the major DNA adduct resulting from NNN metabolism by human enzymes is py-py-dI and provide potentially important new insights into the metabolic activation of NNN in rodents and humans.

  9. DNA adducts induced by in vitro activation of diesel and biodiesel exhaust extracts

    Science.gov (United States)

    The abstract reports the results of studies assessing the relative DNA damage potential of extracts of exhaust particles resulting from the combustion of petroleum diesel, biodiesel, and petroleum diesel-biodiesel blends. Results indicate that the commercially available B20 petr...

  10. Characterization of rat brain NCAM mRNA using DNA oligonucleotide probes

    DEFF Research Database (Denmark)

    1990-01-01

    A number of different isoforms of the neural cell adhesion molecule (NCAM) have been identified. The difference between these is due to alternative splicing of a single NCAM gene. In rat brain NCAM mRNAs with sizes of 7.4, 6.7, 5.2, 4.3 and 2.9 kb have been reported. We have synthesized six DNA...... the five NCAM mRNAs in rat brain....

  11. Peptide-LNA oligonucleotide conjugates

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Hansen, Lykke Haastrup; Vester, Birte

    2013-01-01

    properties, peptides were introduced into oligonucleotides via a 2'-alkyne-2'-amino-LNA scaffold. Derivatives of methionine- and leucine-enkephalins were chosen as model peptides of mixed amino acid content, which were singly and doubly incorporated into LNA/DNA strands using highly efficient copper......Although peptide-oligonucleotide conjugates (POCs) are well-known for nucleic acids delivery and therapy, reports on internal attachment of peptides to oligonucleotides are limited in number. To develop a convenient route for preparation of internally labeled POCs with improved biomedical......(i)-catalyzed azide-alkyne cycloaddition (CuAAC) "click" chemistry. DNA/RNA target binding affinity and selectivity of the resulting POCs were improved in comparison to LNA/DNA mixmers and unmodified DNA controls. This clearly demonstrates that internal attachment of peptides to oligonucleotides can significantly...

  12. Astragalin from Cassia alata induces DNA adducts in vitro and repairable DNA damage in the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Saito, Samuel; Silva, Givaldo; Santos, Regineide Xavier; Gosmann, Grace; Pungartnik, Cristina; Brendel, Martin

    2012-01-01

    Reverse phase-solid phase extraction from Cassia alata leaves (CaRP) was used to obtain a refined extract. Higher than wild-type sensitivity to CaRP was exhibited by 16 haploid Saccharomyces cerevisiae mutants with defects in DNA repair and membrane transport. CaRP had a strong DPPH free radical scavenging activity with an IC(50) value of 2.27 μg mL(-1) and showed no pro-oxidant activity in yeast. CaRP compounds were separated by HPLC and the three major components were shown to bind to DNA in vitro. The major HPLC peak was identified as kampferol-3-O-β-d-glucoside (astragalin), which showed high affinity to DNA as seen by HPLC-UV measurement after using centrifugal ultrafiltration of astragalin-DNA mixtures. Astragalin-DNA interaction was further studied by spectroscopic methods and its interaction with DNA was evaluated using solid-state FTIR. These and computational (in silico) docking studies revealed that astragalin-DNA binding occurs through interaction with G-C base pairs, possibly by intercalation stabilized by H-bond formation.

  13. Synthesis, characterization and DNA cleavage activity of nickel(II adducts with aromatic heterocyclic bases

    Directory of Open Access Journals (Sweden)

    G. H. PHILIP

    2010-01-01

    Full Text Available Mixed ligand complexes of nickel(II with 2,4-dihydroxyaceto-phenone oxime (DAPO and 2,4-dihydroxybenzophenone oxime (DBPO as primary ligands, and pyridine (Py and imidazole (Im as secondary ligands were synthesized and characterized by molar conductivity, magnetic moments measurements, as well as by electronic, IR, and 1H-NMR spectroscopy. Electrochemical studies were performed by cyclic voltammetry. The active signals are assignable to the NiIII/II and NiII/I redox couples. The binding interactions between the metal complexes and calf thymus DNA were investigated by absorption and thermal denaturation. The cleavage activity of the complexes was determined using double-stranded pBR322 circular plasmid DNA by gel electrophoresis. All complexes showed increased nuclease activity in the presence of the oxidant H2O2. The nuclease activities of mixed ligand complexes were compared with those of the parent copper(II complexes.

  14. Estrogen-DNA Adducts as Novel Biomarkers for Ovarian Cancer Risk and for Use in Prevention

    Science.gov (United States)

    2013-03-01

    urine samples [4] and genetic polymorphisms in four selected estrogen- metabolizing enzymes in DNA saliva samples from 50 women diagnosed with ovarian...The views, opinions and/or findings contained in this report are those of the author( s ) and should not be construed...5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) 5d. PROJECT NUMBER 5e. TASK NUMBER E-Mail: 5f. WORK UNIT

  15. 1,N(2)-propanodeoxyguanosine adduct formation in aortic DNA following inhalation of acrolein.

    OpenAIRE

    2001-01-01

    Recent reports indicate that many of the cytotoxic and health-threatening components of environmental tobacco smoke (ETS) reside in the vapor phase of the smoke. We have reported previously that inhalation of 1,3-butadiene, a prominent vapor phase component of ETS, accelerates arteriosclerotic plaque development in cockerels. In this study we asked whether inhaled acrolein, a reactive aldehyde that is also a prominent vapor-phase component of ETS, damages artery-wall DNA and accelerates plaqu...

  16. Combination of DNA ligase reaction and gold nanoparticle-quenched fluorescent oligonucleotides: a simple and efficient approach for fluorescent assaying of single-nucleotide polymorphisms.

    Science.gov (United States)

    Wang, Hao; Li, Jishan; Wang, Yongxiang; Jin, Jiangyu; Yang, Ronghua; Wang, Kemin; Tan, Weihong

    2010-09-15

    A new fluorescent sensing approach for detection of single-nucleotide polymorphisms (SNPs) is proposed based on the ligase reaction and gold nanoparticle (AuNPs)-quenched fluorescent oligonucleotides. The design exploits the strong fluorescence quenching of AuNPs for organic dyes and the difference in noncovalent interactions of the nanoparticles with single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), where ssDNA can be adsorbed onto the surface of AuNPs while dsDNA cannot be. In the assay, two half primer DNA probes, one being labeled with a dye and the other being phosphorylated, were first incubated with a target DNA template. In the presence of DNA ligase, the two captured ssDNAs are linked for the perfectly matched DNA target to form a stable duplex, but the duplex could not be formed by the single-base mismatched DNA template. After addition of AuNPs, the fluorescence of dye-tagged DNA probe will be efficiently quenched unless the perfectly matched DNA target is present. To demonstrate the feasibility of this design, the performance of SNP detection using two different DNA ligases, T4 DNA ligase and Escherichia coli DNA ligase, were investigated. In the case of T4 DNA ligase, the signal enhancement of the dye-tagged DNA for perfectly matched DNA target is 4.6-fold higher than that for the single-base mismatched DNA. While in the presence of E. coli DNA ligase, the value raises to be 30.2, suggesting excellent capability for SNP discrimination.

  17. Oligonucleotide indexing of DNA barcodes: identification of tuna and other scombrid species in food products

    Directory of Open Access Journals (Sweden)

    Botti Sara

    2010-08-01

    Full Text Available Abstract Background DNA barcodes are a global standard for species identification and have countless applications in the medical, forensic and alimentary fields, but few barcoding methods work efficiently in samples in which DNA is degraded, e.g. foods and archival specimens. This limits the choice of target regions harbouring a sufficient number of diagnostic polymorphisms. The method described here uses existing PCR and sequencing methodologies to detect mitochondrial DNA polymorphisms in complex matrices such as foods. The reported application allowed the discrimination among 17 fish species of the Scombridae family with high commercial interest such as mackerels, bonitos and tunas which are often present in processed seafood. The approach can be easily upgraded with the release of new genetic diversity information to increase the range of detected species. Results Cocktail of primers are designed for PCR using publicly available sequences of the target sequence. They are composed of a fixed 5' region and of variable 3' cocktail portions that allow amplification of any member of a group of species of interest. The population of short amplicons is directly sequenced and indexed using primers containing a longer 5' region and the non polymorphic portion of the cocktail portion. A 226 bp region of CytB was selected as target after collection and screening of 148 online sequences; 85 SNPs were found, of which 75 were present in at least two sequences. Primers were also designed for two shorter sub-fragments that could be amplified from highly degraded samples. The test was used on 103 samples of seafood (canned tuna and scomber, tuna salad, tuna sauce and could successfully detect the presence of different or additional species that were not identified on the labelling of canned tuna, tuna salad and sauce samples. Conclusions The described method is largely independent of the degree of degradation of DNA source and can thus be applied to

  18. Interaction between a cationic bolaamphiphile and DNA: The route towards nanovectors for oligonucleotide antimicrobials.

    Science.gov (United States)

    Mamusa, Marianna; Resta, Claudio; Barbero, Francesco; Carta, Davide; Codoni, Doroty; Hatzixanthis, Kostas; McArthur, Michael; Berti, Debora

    2016-07-01

    Bacterial resistance to antimicrobials is a global threat that requires development of innovative therapeutics that circumvent its onset. The use of Transcription Factor Decoys (TFDs), DNA fragments that act by blocking essential transcription factors in microbes, represents a very promising approach. TFDs require appropriate carriers to protect them from degradation in biological fluids and transfect them through the bacterial cell wall into the cytoplasm, their site of action. Here we report on a bolaform cationic surfactant, [12-bis-THA]Cl2, with proven transfection activity in vivo. By studying the physical-chemical properties of its aqueous solutions with light scattering, cryo-TEM, ζ-potential, absorption and fluorescence spectroscopies, we prove that the bolaamphiphiles associate into transient vesicles which convert into one-dimensional elongated structures over time. These surfactant assemblies complex TFDs with extremely high efficiency, if compared to common cationic amphiphiles. At Z+/-=11, the nanoplexes are stable and have a size of 120nm, and they form independently of the original morphology of the [12-bis-THA]Cl2 aggregate. DNA is compacted in the nanoplexes, as shown through CD spectroscopy and fluorescence, but is readily released in its native form if sodium taurocholate is added.

  19. DNA adduct formation and oxidative stress in colon and liver of Big Blue (R) rats after dietary exposure to diesel particles

    DEFF Research Database (Denmark)

    Dybdahl, M.; Risom, L.; Møller, P.

    2003-01-01

    in liver accompanied by enhanced vitamin C levels. In plasma, we found no significant effects on oxidative damage to proteins and lipids, antioxidant enzymes or vitamin C levels. Our data indicate that gastrointestinal exposure to DEP induces DNA adducts and oxidative stress resulting in DNA strand breaks...... on oxidative DNA damage (8-oxodG) in colon or liver DNA or in the urine. However, the mRNA expression of OGG1, encoding an enzyme involved in repair of 8-oxodG, was increased by DEP in both liver and colon. DNA adduct levels measured by P-32-post-labelling were elevated in colon and liver, and the expression...... and lipids, and antioxidative defence mechanisms in colon mucosa cells, liver tissue and the blood compartment. Seven groups of rats were fed a diet with 0, 0.2, 0.8, 2, 8, 20 or 80 mg DEP/kg feed for 21 days. DEP induced a significant increase in DNA strand breaks in colon and liver. There was no effect...

  20. Detection of Aeromonas hydrophila DNA oligonucleotide sequence using a biosensor design based on Ceria nanoparticles decorated reduced graphene oxide and Fast Fourier transform square wave voltammetry

    Energy Technology Data Exchange (ETDEWEB)

    Jafari, Safiye [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Faridbod, Farnoush, E-mail: faridbodf@khayam.ut.ac.ir [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular and Cellular Research Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Norouzi, Parviz [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular and Cellular Research Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of); Dezfuli, Amin Shiralizadeh [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Ajloo, Davood [School of Chemistry, Damghan University, Damghan (Iran, Islamic Republic of); Mohammadipanah, Fatemeh [Department of Microbial Biotechnology, School of Biology and Center of Excellence in Phylogeny of Living Organisms, College of Science, University of Tehran, 14155-6455 Tehran (Iran, Islamic Republic of); Ganjali, Mohammad Reza [Center of Excellence in Electrochemistry, University of Tehran, Tehran (Iran, Islamic Republic of); Biosensor Research Center, Endocrinology & Metabolism Molecular and Cellular Research Institute, Tehran University of Medical Sciences, Tehran (Iran, Islamic Republic of)

    2015-10-01

    A new strategy was introduced for ssDNA immobilization on a modified glassy carbon electrode. The electrode surface was modified using polyaniline and chemically reduced graphene oxide decorated cerium oxide nanoparticles (CeO{sub 2}NPs-RGO). A single-stranded DNA (ssDNA) probe was immobilized on the modified electrode surface. Fast Fourier transform square wave voltammetry (FFT-SWV) was applied as detection technique and [Ru(bpy){sub 3}]{sup 2+/3+} redox signal was used as electrochemical marker. The hybridization of ssDNA with its complementary target caused a dramatic decrease in [Ru(bpy){sub 3}]{sup 2+/3+} FFT-SW signal. The proposed electrochemical biosensor was able to detect Aeromonas hydrophila DNA oligonucleotide sequence encoding aerolysin protein. Under optimal conditions, the biosensor showed excellent selectivity toward complementary sequence in comparison with noncomplementary and two-base mismatch sequences. The dynamic linear range of this electrochemical DNA biosensor for detecting 20-mer oligonucleotide sequence of A. hydrophila was from 1 × 10{sup −15} to 1 × 10{sup −8} mol L{sup −1}. The proposed biosensor was successfully applied for the detection of DNA extracted from A. hydrophila in fish pond water up to 0.01 μg mL{sup −1} with RSD of 5%. Besides, molecular docking was applied to consider the [Ru(bpy){sub 3}]{sup 2+/3+} interaction with ssDNA before and after hybridization. - Highlights: • New DNA biosensor is designed for sub-femtomolar detection of Aeromonas hydrophila DNA sequence. • Reduced graphene oxide decorated Ceria nanoparticles was used as a new immobilization platform. • Biosensor was successfully used to detect A. hydrophila DNA sequence in fish pond water.

  1. Insertion of dNTPs Opposite the 1,N[superscript 2]-Propanodeoxyguanosine Adduct by Sulfolobus solfataricus P2 DNA Polymerase IV

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yazhen; Musser, Sarah K.; Saleh, Sam; Marnett, Lawrence J.; Egli, Martin; Stone, Michael P. (Vanderbilt)

    2008-08-04

    1,N{sup 2}-Propanodeoxyguanosine (PdG) is a stable structural analogue for the 3-(2'-deoxy-{beta}-d-erythro-pentofuranosyl)pyrimido[1,2-?]purin-10(3H)-one (M{sub 1}dG) adduct derived from exposure of DNA to base propenals and to malondialdehyde. The structures of ternary polymerase-DNA-dNTP complexes for three template-primer DNA sequences were determined, with the Y-family Sulfolobus solfataricus DNA polymerase IV (Dpo4), at resolutions between 2.4 and 2.7 {angstrom}. Three template 18-mer-primer 13-mer sequences, 5'-d(TCACXAAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTT)-3' (template I), 5'-d(TCACXGAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTC)-3' (template II), and 5'-d(TCATXGAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTC)-3' (template III), where X is PdG, were analyzed. With templates I and II, diffracting ternary complexes including dGTP were obtained. The dGTP did not pair with PdG, but instead with the 5'-neighboring template dC, utilizing Watson-Crick geometry. Replication bypass experiments with the template-primer 5?-TCACXAAATCCTTACGAGCATCGCCCCC-3'{center_dot}5'-GGGGGCGATGCTCGTAAGGATTT-3', where X is PdG, which includes PdG in the 5'-CXA-3' template sequence as in template I, showed that the Dpo4 polymerase inserted dGTP and dATP when challenged by the PdG adduct. For template III, in which the template sequence was 5'-TXG-3', a diffracting ternary complex including dATP was obtained. The dATP did not pair with PdG, but instead with the 5'-neighboring T, utilizing Watson-Crick geometry. Thus, all three ternary complexes were of the 'type II' structure described for ternary complexes with native DNA [Ling, H., Boudsocq, F., Woodgate, R., and Yang, W. (2001) Cell 107, 91--102]. The PdG adduct remained in the anti conformation about the glycosyl bond in each of these threee ternary complexes. These results provide insight into how -1

  2. Comparative effect of dietary butylated hydroxyanisole and beta-naphthoflavone on aflatoxin B1 metabolism, DNA adduct formation, and carcinogenesis in rainbow trout.

    Science.gov (United States)

    Goeger, D E; Shelton, D W; Hendricks, J D; Pereira, C; Bailey, G S

    1988-10-01

    Butylated hydroxyanisole (BHA) and beta-naphthoflavone (BNF), both chemicals with anti-carcinogenic properties in some experimental animals, were compared for effects on aflatoxin B1 (AFB1) metabolism, hepatic DNA adduct formation and carcinogenesis in the rainbow trout. Dietary BHA had no effect on the hepatic tumor incidence when fed at 0.03 or 0.3% 4 weeks prior to and during a 4 week dietary exposure of 10 p.p.b. AFB1. BNF, when fed at 0.005 or 0.05% under similar conditions, significantly reduced tumor response, which confirms previous results in trout (Nixon et al., Carcinogenesis, 5, 615-619, 1984). BHA fed at either 0.03 or 0.3% for 8 weeks had no post-initiation effect on the 52 week hepatic tumor incidence of trout exposed to a 0.5 p.p.m. AFB1 solution as embryos. A similar post-initiation exposure to 0.05% BNF significantly enhanced AFB1 tumor response. The influence of dietary BHA and BNF on AFB1 metabolism and DNA adduct formation and persistence in trout were examined. A 3 week pre-treatment with 0.3% dietary BHA had no effect on in vivo hepatic nuclear AFB1-DNA adduct formation at 0.5, 1, 2 and 7 days after AFB1 i.p. injection. By contrast 0.05% dietary BNF reduced hepatic AFB1-DNA adducts to 33-60% of control levels at 0.5, 1, 2 and 4 days after AFB1 exposure. This was accompanied by significantly lower blood and liver levels of AFB1 during the first 24 h after i.p. injection. Livers of BNF trout also contained 4-fold more of the less carcinogenic metabolite, aflatoxin M1, and 50% less aflatoxicol (AFL), a metabolite with similar carcinogenicity as AFB1. Bile AFL-glucuronide levels were significantly decreased in BNF-fed trout, but total bile glucuronides were significantly increased due to a 15-fold increase in aflatoxicol-M1 glucuronide. Freshly isolated hepatocytes from BHA-fed fish, when incubated with AFB1 for 1 h, showed no difference in levels of AFB1-DNA adducts or ratios of AFB1 metabolites when compared to hepatocytes isolated from fish

  3. Cytochrome P450 system expression and DNA adduct formation in the liver of Zacco platypus following waterborne benzo(a)pyrene exposure: implications for biomarker determination.

    Science.gov (United States)

    Lee, Jin Wuk; Kim, Yong Hwa; Yoon, Seokjoo; Lee, Sung Kyu

    2014-09-01

    Benzo(a)pyrene (BaP) is a polycyclic aromatic hydrocarbon that causes mutations and tumor formation. Zacco platypus is a sentinel species that is suitable for monitoring aquatic environments. We studied cytochrome P450 system (CYP system) expression and DNA adduct formation in the liver of Z. platypus following waterborne exposure to BaP. The results showed both dose and time dependency. The significant induction levels of CYP system mRNA and protein reached maximums at 2 days and 14 days, respectively, and hepatosomatic index was maximally induced at 4 days during 14 days BaP exposure. DNA adduct formation was significantly induced compared to corresponding controls (t-test, p adduct formation was a useful biomarker in risk assessment of waterborne BaP exposure at 4 days. CYP1A was a more sensitive biomarker than CYP reductase for BaP exposure when considering both the mRNA and protein level. Furthermore, our results show that Z. platypus is a useful species for assessing the risk of waterborne BaP exposure.

  4. LNA/DNA mixmer-based antisense oligonucleotides correct alternative splicing of the SMN2 gene and restore SMN protein expression in type 1 SMA fibroblasts.

    Science.gov (United States)

    Touznik, Aleksander; Maruyama, Rika; Hosoki, Kana; Echigoya, Yusuke; Yokota, Toshifumi

    2017-06-16

    Spinal muscular atrophy (SMA) is an autosomal recessive disorder affecting motor neurons, and is currently the most frequent genetic cause of infant mortality. SMA is caused by a loss-of-function mutation in the survival motor neuron 1 (SMN1) gene. SMN2 is an SMN1 paralogue, but cannot compensate for the loss of SMN1 since exon 7 in SMN2 mRNA is excluded (spliced out) due to a single C-to-T nucleotide transition in the exon 7. One of the most promising strategies to treat SMA is antisense oligonucleotide (AON)-mediated therapy. AONs are utilized to block intronic splicing silencer number 1 (ISS-N1) on intron 7 of SMN2, which causes exon 7 inclusion of the mRNA and the recovery of the expression of functional SMN protein from the endogenous SMN2 gene. We developed novel locked nucleic acid (LNA)-based antisense oligonucleotides (LNA/DNA mixmers), which efficiently induce exon 7 inclusion in SMN2 and restore the SMN protein production in SMA patient fibroblasts. The mixmers are highly specific to the targeted sequence, and showed significantly higher efficacy than an all-LNA oligonucleotide with the equivalent sequence. These data suggest that use of LNA/DNA mixmer-based AONs may be an attractive therapeutic strategy to treat SMA.

  5. Sequence-specific intercalating agents: intercalation at specific sequences on duplex DNA via major groove recognition by oligonucleotide-intercalator conjugates.

    Science.gov (United States)

    Sun, J S; François, J C; Montenay-Garestier, T; Saison-Behmoaras, T; Roig, V; Thuong, N T; Hélène, C

    1989-01-01

    An acridine derivative was covalently linked to the 5' end of a homopyrimidine oligonucleotide. Specific binding to a homopurine-homopyrimidine sequence of duplex DNA was demonstrated by spectroscopic studies (absorption and fluorescence) and by "footprinting" experiments with a copper phenanthroline chelate used as an artificial nuclease. A hypochromism and a red shift of the acridine absorption were observed. Triple-helix formation was also accompanied by a hypochromism in the ultraviolet range. The fluorescence of the acridine ring was quenched by a stacking interaction with a G.C base pair adjacent to the homopurine-homopyrimidine target sequence. The intercalating agent strongly stabilized the complex formed by the oligopyrimidine with its target duplex sequence. Cytosine methylation further increased the stability of the complexes. Footprinting studies revealed that the oligopyrimidine binds in a parallel orientation with respect to the homopurine-containing strand of the duplex. The intercalated acridine extended by 2 base pairs the region of the duplex protected by the oligopyrimidine against degradation by the nuclease activity of the copper phenanthroline chelate. Random intercalation of the acridine ring was lost due to the repulsive effect of the negatively charged oligonucleotide tail. Intercalation occurred only at those double-stranded sequences where the homopyrimidine oligonucleotide recognized the major groove of duplex DNA. Images PMID:2594761

  6. Assessment of interactions between PAH exposure and genetic polymorphisms on PAH-DNA adducts in African American, Dominican, and Caucasian mothers and newborns.

    Science.gov (United States)

    Wang, Shuang; Chanock, Stephen; Tang, Deliang; Li, Zhigang; Jedrychowski, Wieslaw; Perera, Frederica P

    2008-02-01

    Polycyclic aromatic hydrocarbons (PAH) are widespread pollutants commonly found in air, food, and drinking water. Benzo[a]pyrene is a well-studied representative PAH found in air from fossil fuel combustion and a transplacental carcinogen experimentally. PAHs bind covalently to DNA to form DNA adducts, an indicator of DNA damage, and an informative biomarker of potential cancer risk. Associations between PAH-DNA adduct levels and both cancer risk and developmental deficits have been seen in previous experimental and epidemiologic studies. Several genes have been shown to play an important role in the metabolic activation or detoxification of PAHs, including the cytochrome P450 genes CYP1A1 and CYP1B1 and the glutathione S-transferase (GST) genes GSTM1, and GSTT2. Genetic variation in these genes could influence susceptibility to adverse effects of PAHs in polluted air. Here, we have explored interactions between prenatal PAH exposure and 17 polymorphisms in these genes (rs2198843, rs1456432, rs4646903, rs4646421, rs2606345, rs7495708, rs2472299, rs162549, rs1056837, rs1056836, rs162560, rs10012, rs2617266, rs2719, rs1622002, rs140194, and gene deletion GSTM1-02) and haplotypes on PAH-DNA adducts in cord blood of 547 newborns and in maternal blood of 806 mothers from three different self-described ethnic groups: African Americans, Dominicans, and Caucasians. PAHs were measured by personal air monitoring of mothers during pregnancy. Significant interactions (p < 0.05) were observed between certain genetic polymorphisms and CYP1A1 haplotype and PAHs in mothers and their newborns in the three ethnic groups. However, with our limited sample size, the current findings are suggestive only, warranting further study.

  7. Effect of green tea catechins and hydrolyzable tannins on benzo[a]pyrene-induced DNA adducts and structure-activity relationship.

    Science.gov (United States)

    Cao, Pengxiao; Cai, Jian; Gupta, Ramesh C

    2010-04-19

    Green tea catechins and hydrolyzable tannins are gaining increasing attention as chemopreventive agents. However, their mechanism of action is poorly understood. We investigated the effects of four green tea catechins and two hydrolyzable tannins on microsome-induced benzo[a]pyrene (BP)-DNA adducts and the possible structure-activity relationship. BP (1 microM) was incubated with rat liver microsomes and DNA in the presence of the test compound (1-200 microM) or vehicle. The purified DNA was analyzed by (32)P-postlabeling. The inhibitory activity of the catechins was in the following descending order: epigallocatechin gallate (IC(50) = 16 microM) > epicatechin gallate (24 microM) > epigallocatechin (146 microM) > epicatechin (462 microM), suggesting a correlation between the number of adjacent aromatic hydroxyl groups in the molecular structure and their potencies. Tannic acid (IC(50) = 4 microM) and pentagalloglucose (IC(50) = 26 microM) elicited as much DNA adduct inhibitory activity as the catechins or higher presumably due to the presence of more functional hydroxyl groups. To determine if the activity of these compounds was due to direct interaction of phenolic groups with electrophilic metabolite(s) of BP, DNA was incubated with anti-benzo[a]pyrene-7,8-diol-9,10-epoxide (anti-BPDE) (0.5 microM) in the presence of test compounds (200 microM) or vehicle. Significant inhibition of DNA adduct formation was found (tannic acid > pentagalloglucose > epigallocatechin gallate > epicatechin gallate). This notion was confirmed by analysis of the reaction products of anti-BPDE with the catechins and pentagalloglucose by electrospray ionization mass spectrometry and liquid chromatography-mass spectrometry. In conclusion, our data demonstrate that green tea catechins and the hydrolyzable tannins are highly effective in inhibiting BP-DNA adduct formation at least, in part, due to direct interaction of adjacent hydroxyl groups in their structures and that the activity is

  8. Synthesis of C-5, C-2' and C-4'-neomycin-conjugated triplex forming oligonucleotides and their affinity to DNA-duplexes.

    Science.gov (United States)

    Tähtinen, Ville; Granqvist, Lotta; Virta, Pasi

    2015-08-01

    Neomycin-conjugated homopyrimidine oligo 2'-deoxyribonucleotides have been synthesized on a solid phase and their potential as triplex forming oligonucleotides (TFOs) with DNA-duplexes has been studied. For the synthesis of the conjugates, C-5, C-2' and C-4'-tethered alkyne-modified nucleoside derivatives were used as an integral part of the standard automated oligonucleotide chain elongation. An azide-derived neomycin was then conjugated to the incorporated terminal alkynes by Cu(I)-catalyzed 1,3-dipolar cycloaddition (the click chemistry). Concentrated ammonia released the desired conjugates in acceptable purity and yields. The site of conjugation was expectedly important for the Hoogsteen-face recognition: C-5-conjugation showed a notable positive effect, whereas the influence of the C-2' and C-4'-modification remained marginal. In addition to conventional characterization methods (UV- and CD-spectroscopy), (19)F NMR spectroscopy was applied for the monitoring of triplex/duplex/single strand-conversions.

  9. Complete protection against aflatoxin B(1)-induced liver cancer with a triterpenoid: DNA adduct dosimetry, molecular signature, and genotoxicity threshold.

    Science.gov (United States)

    Johnson, Natalie M; Egner, Patricia A; Baxter, Victoria K; Sporn, Michael B; Wible, Ryan S; Sutter, Thomas R; Groopman, John D; Kensler, Thomas W; Roebuck, Bill D

    2014-07-01

    In experimental animals and humans, aflatoxin B1 (AFB1) is a potent hepatic toxin and carcinogen. The synthetic oleanane triterpenoid 1-[2-cyano-3-,12-dioxooleana-1,9(11)-dien-28-oyl]imidazole (CDDO-Im), a powerful activator of Keap1-Nrf2 signaling, protects against AFB1-induced toxicity and preneoplastic lesion formation (GST-P-positive foci). This study assessed and mechanistically characterized the chemoprotective efficacy of CDDO-Im against AFB1-induced hepatocellular carcinoma (HCC). A lifetime cancer bioassay was undertaken in F344 rats dosed with AFB1 (200 μg/kg rat/day) for four weeks and receiving either vehicle or CDDO-Im (three times weekly), one week before and throughout the exposure period. Weekly, 24-hour urine samples were collected for analysis of AFB1 metabolites. In a subset of rats, livers were analyzed for GST-P foci. The comparative response of a toxicogenomic RNA expression signature for AFB1 was examined. CDDO-Im completely protected (0/20) against AFB1-induced liver cancer compared with a 96% incidence (22/23) observed in the AFB1 group. With CDDO-Im treatment, integrated level of urinary AFB1-N(7)-guanine was significantly reduced (66%) and aflatoxin-N-acetylcysteine, a detoxication product, was consistently elevated (300%) after the first AFB1 dose. In AFB1-treated rats, the hepatic burden of GST-P-positive foci increased substantially (0%-13.8%) over the four weeks, but was largely absent with CDDO-Im intervention. The toxicogenomic RNA expression signature characteristic of AFB1 was absent in the AFB1 + CDDO-Im-treated rats. The remarkable efficacy of CDDO-Im as an anticarcinogen is established even in the face of a significant aflatoxin adduct burden. Consequently, the absence of cancer requires a concept of a threshold for DNA damage for cancer development.

  10. Biological significance of DNA adducts: comparison of increments over background for various biomarkers of genotoxicity in L5178Y tk(+/-) mouse lymphoma cells treated with hydrogen peroxide and cumene hydroperoxide.

    Science.gov (United States)

    Brink, Andreas; Richter, Ingrid; Lutz, Ursula; Wanek, Paul; Stopper, Helga; Lutz, Werner K

    2009-08-01

    DNA is affected by background damage of the order of one lesion per one hundred thousand nucleotides, with depurination and oxidative damage accounting for a major part. This damage contributes to spontaneous mutation and cancer. DNA adducts can be measured with high sensitivity, with limits of detection lower than one adduct per one billion nucleotides. Minute exposures to an exogenous DNA-reactive agent may therefore result in measurable adduct formation, although, as an increment over total DNA damage, a small increment in mutation cannot be measured and would be considered negligible. Here, we investigated whether this discrepancy also holds for adducts that are present as background induced by oxidative stress. L5178Y tk(+/-) mouse lymphoma cells were incubated for 4h with hydrogen peroxide (0, 0.8, 4, 20, 100, 500muM) or cumene hydroperoxide (0, 0.37, 1.1, 3.3, 10muM). Five endpoints of genotoxicity were measured in parallel from aliquots of three replicates of large batches of cells: Two DNA adducts, 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo) and 1,N(6)-etheno-2'-deoxyadenosine (varepsilondAdo) measured by LC-MS/MS, as well as strand breaks assessed with the comet assay and in vitro micronucleus test, and gene mutation as assessed using the thymidine kinase gene mutation assay. Background measures of 8-oxodGuo and varepsilondAdo were 500-1000 and 50-90 adducts per 10(9) nucleotides. Upon treatment, neither hydrogen peroxide nor cumene hydroperoxide significantly increased the DNA adduct levels above control. In contrast, dose-related increases above background were observed with both oxidants in the comet assay, the micronucleus test and the gene mutation assay. Differences in sensitivity of the assays were quantified by estimating the concentration of oxidant that resulted in a doubling of the background measure. We conclude that the increase in DNA breakage and mutation induced by hydrogen peroxide and cumene hydroperoxide observed in our in vitro

  11. The importance of carcinogen dose in chemoprevention studies: quantitative interrelationships between, dibenzo[a,l]pyrene dose, chlorophyllin dose, target organ DNA adduct biomarkers and final tumor outcome.

    Science.gov (United States)

    Pratt, M Margaret; Reddy, Ashok P; Hendricks, Jerry D; Pereira, Cliff; Kensler, Thomas W; Bailey, George S

    2007-03-01

    Chlorophyllin (CHL) is a potent antimutagen in vitro, an effective anti-carcinogen in several animal models, and significantly reduced urinary biomarkers of aflatoxin B(1) (AFB(1)) exposure in a human population. Here we report an expanded analysis of CHL chemoprevention using the potent environmental hydrocarbon dibenzo[a,l]pyrene (DBP). A dose-dose matrix design employed over 12 000 rainbow trout to evaluate the interrelationships among dietary carcinogen dose, anti-carcinogen dose, carcinogen-DNA adduct levels at exposure and eventual tumor outcome in two target organs. Included was an evaluation of the pharmaceutical CHL preparation (Derifil), used previously in a study of individuals chronically exposed to AFB(1). CHL was pre-, co- and post-fed at doses of 0-6000 p.p.m. and co-fed with DBP at doses of 0-371.5 p.p.m. for 4 weeks. This protocol generated a total of 21 dose-dose treatment groups, each evaluated with three or more replicates of 100 animals. The DBP-only treatment produced dose-responsive increases in liver and stomach DBP-DNA adducts, whereas increasing CHL co-treatment doses produced successive inhibition in liver (49-83%) and stomach (47-75%) adduct levels at each DBP dose examined. The remaining 8711 trout were necropsied, 10 months later. DBP treatment alone produced a logit incidence versus log [DBP] dose-response curve in stomach that was linear; CHL co-treatment provided dose-dependent tumor inhibition which ranged from 30 to 68% and was predictable from the adduct response. The Derifil CHL preparation was also found to effectively reduce DNA adduction and final tumor incidence in stomach (as well as liver), with a potency compatible with its total chlorin content. Liver tumor incidence in the DBP-only groups appeared to plateau near 60%. At DBP doses of DNA adducts as biomarkers. At 225 p.p.m. DBP, however, very high CHL doses were

  12. Urinary physiologic and chemical metabolic effects on the urothelial cytotoxicity and potential DNA adducts of o-phenylphenol in male rats.

    Science.gov (United States)

    Smith, R A; Christenson, W R; Bartels, M J; Arnold, L L; St John, M K; Cano, M; Garland, E M; Lake, S G; Wahle, B S; McNett, D A; Cohen, S M

    1998-06-01

    ortho-Phenylphenol (OPP), a fungicide and antibacterial agent with food residues, is carcinogenic to rat bladder. The present studies provide information on changes in urinary composition and urinary metabolites, urothelial cytotoxicity and regenerative hyperplasia, and DNA adducts in male F344 rats fed OPP. An initial experiment evaluated dietary doses of 0, 1,000, 4,000, and 12,500 ppm OPP fed for 13 weeks. There was no evidence of urinary calculi, microcrystalluria, or calcium phosphate-containing precipitate, but urothelial cytotoxicity and hyperplasia occurred at the highest dose only. In a second experiment, rats were fed dietary OPP levels of 0, 800, 4,000, 8,000, and 12,500 ppm. Urinary pH was > 7 in all groups. Urinary volume was increased at the 2 highest doses with consequent decreases in osmolality, creatinine, and other solutes. Total urinary OPP metabolite excretions were increased, mostly excreted as conjugates of OPP and of phenylhydroquinone. Free OPP or free metabolites accounted for less than 2% excreted in the urine without a dose response. Urothelial toxicity and hyperplasia occurred only at doses of 8,000 and 12,500 ppm. OPP-DNA adducts were not detected in the urothelium at any dose. In summary, OPP produces cytotoxicity and proliferation of the urothelium at dietary doses > or = 8,000 ppm without formation of urinary solids. The paucity of unconjugated metabolites and the lack of OPP-DNA adducts suggests that OPP is acting as a bladder carcinogen in male rats by inducing cytotoxicity and hyperplasia without it or its metabolites directly binding to DNA.

  13. Genetic polymorphisms in biotransformation enzymes for benzo[a]pyrene and related levels of benzo[a]pyrene-7,8-diol-9,10-epoxide-DNA adducts in Goeckerman therapy.

    Science.gov (United States)

    Beranek, Martin; Fiala, Zdenek; Kremlacek, Jan; Andrys, Ctirad; Hamakova, Kvetoslava; Chmelarova, Marcela; Palicka, Vladimir; Borska, Lenka

    2016-07-25

    Goeckerman therapy (GT) for psoriasis combines the therapeutic effect of crude coal tar (CCT) and ultraviolet radiation (UVR). CCT contains polycyclic aromatic hydrocarbons, some of which can form DNA adducts that may induce mutations and contribute to carcinogenesis. The aim of our work was to evaluate the relationship between concentrations of benzo[a]pyrene-7,8-diol-9,10-epoxide-DNA adducts (BPDE-DNA adducts) and rs4646903 (CYP1A1 gene), rs1048943 (CYP1A1), rs1056836 (CYP1B1), rs1051740 (EPHX1), rs2234922 (EPHX1) and rs8175347 (UGT1A1) polymorphic sites, and GSTM1 null polymorphism in 46 patients with chronic stable plaque psoriasis who underwent GT. The level of BPDE-DNA adducts was determined using the OxiSelect BPDE-DNA Adduct ELISA Kit. Polymerase chain reaction (PCR) and restriction fragment length polymorphism analysis (rs4646903, rs1048943, rs1051740, and rs2234922), fragment analysis (rs8175347), real-time PCR (rs1056836), and digital droplet PCR polymorphism (GSTM1) were used. CYP1B1*1/*1 wild-type subjects and CYP1B1*3/*1 heterozygotes for rs1056836 formed significantly higher amounts of BPDE-DNA adducts than CYP1B1*3/*3 homozygotes (p=0.031 and p=0.005, respectively). Regarding rs1051740, individuals with EPHX1*3/*1 heterozygosity revealed fewer adducts than EPHX1*1/*1 wild-type subjects (p=0.026). Our data suggest that CYP1B1/EPHX1 genotyping could help to predict the risk of DNA damage and to optimize doses of coal tar and UVR exposure in psoriatic patients in whom GT was applied.

  14. Technical aspects of typing for HLA-DP alleles using allele-specific DNA in vitro amplification and sequence-specific oligonucleotide probes. Detection of single base mismatches

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells ...... mismatches may be detected in the PCR and typing for HLA-DP gene variants, which differ for only one base, may be performed.......The polymerase chain reaction (PCR) is an effective method for in vitro DNA amplification which combined with probing with synthetic oligonucleotides can be used for, e.g., HLA-typing. We have studied the technical aspects of HLA-DP typing with the technique. DNA from mononuclear nucleated cells...... was extracted with either a simple salting out method or phenol/chloroform. Both DNAs could be readily used for PCR. The MgC2 concentration of the PCR buffer and the annealing temperature of the thermal cycle of the PCR were the two most important variables. The MgCl2 concentration and the temperature must...

  15. Defining the sequence specificity of DNA-binding proteins by selecting binding sites from random-sequence oligonucleotides: analysis of yeast GCN4 protein.

    Science.gov (United States)

    Oliphant, A R; Brandl, C J; Struhl, K

    1989-07-01

    We describe a new method for accurately defining the sequence recognition properties of DNA-binding proteins by selecting high-affinity binding sites from random-sequence DNA. The yeast transcriptional activator protein GCN4 was coupled to a Sepharose column, and binding sites were isolated by passing short, random-sequence oligonucleotides over the column and eluting them with increasing salt concentrations. Of 43 specifically bound oligonucleotides, 40 contained the symmetric sequence TGA(C/G)TCA, whereas the other 3 contained sequences matching six of these seven bases. The extreme preference for this 7-base-pair sequence suggests that each position directly contacts GCN4. The three nucleotide positions on each side of this core heptanucleotide also showed sequence preferences, indicating their effect on GCN4 binding. Interestingly, deviations in the core and a stronger sequence preference in the flanking region were found on one side of the central C . G base pair. Although GCN4 binds as a dimer, this asymmetry supports a model in which interactions on each side of the binding site are not equivalent. The random selection method should prove generally useful for defining the specificities of other DNA-binding proteins and for identifying putative target sequences from genomic DNA.

  16. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    Science.gov (United States)

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  17. DNA adducts of the tobacco carcinogens 2-amino-9H-pyrido[2,3-b]indole and 4-aminobiphenyl are formed at environmental exposure levels and persist in human hepatocytes.

    Science.gov (United States)

    Nauwelaërs, Gwendoline; Bellamri, Medjda; Fessard, Valérie; Turesky, Robert J; Langouët, Sophie

    2013-09-16

    Aromatic amines and structurally related heterocyclic aromatic amines (HAAs) are produced during the combustion of tobacco or during the high-temperature cooking of meat. Exposure to some of these chemicals may contribute to the etiology of several common types of human cancers. 2-Amino-9H-pyrido[2,3-b]indole (AαC) is the most abundant HAA formed in mainstream tobacco smoke: it arises in amounts that are 25-100 times greater than the levels of the arylamine, 4-aminobiphenyl (4-ABP), a human carcinogen. 2-Amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx) is a prevalent HAA formed in cooked meats. AαC and MeIQx are rodent carcinogens; however, their carcinogenic potency in humans is unknown. A preliminary assessment of the carcinogenic potential of these HAAs in humans was conducted by examining the capacity of primary human hepatocytes to form DNA adducts of AαC and MeIQx, in comparison to 4-ABP, followed by the kinetics of DNA adduct removal by cellular enzyme repair systems. The principal DNA adducts formed were N-(deoxyguanosin-8-yl) (dG-C8) adducts. Comparable levels of DNA adducts were formed with AαC and 4-ABP, whereas adduct formation was ∼5-fold lower for MeIQx. dG-C8-AαC and dG-C8-4-ABP were formed at comparable levels in a concentration-dependent manner in human hepatocytes treated with procarcinogens over a 10,000-fold concentration range (1 nM-10 μM). Pretreatment of hepatocytes with furafylline, a selective inhibitor of cytochrome P450 1A2, resulted in a strong diminution of DNA adducts signifying that P450 1A2 is a major P450 isoform involved in bioactivation of these procarcinogens. The kinetics of adduct removal varied for each hepatocyte donor. Approximately half of the DNA adducts were removed within 24 h of treatment; however, the remaining lesions persisted over 5 days. The high levels of AαC present in tobacco smoke and its propensity to form persistent DNA adducts in human hepatocytes suggest that AαC can contribute to DNA damage

  18. Levuglandin forms adducts with histone h4 in a cyclooxygenase-2-dependent manner, altering its interaction with DNA.

    Science.gov (United States)

    Carrier, Erica J; Zagol-Ikapitte, Irene; Amarnath, Venkataraman; Boutaud, Olivier; Oates, John A

    2014-04-22

    Inflammation and subsequent cyclooxygenase-2 (COX-2) activity has long been linked with the development of cancer, although little is known about any epigenetic effects of COX-2. A product of COX-2 activation, levuglandin (LG) quickly forms covalent bonds with nearby primary amines, such as those in lysine, which leads to LG-protein adducts. Here, we demonstrate that COX-2 activity causes LG-histone adducts in cultured cells and liver tissue, detectable through LC-MS, with the highest incidence in histone H4. Adduction is blocked by a γ-ketoaldehyde scavenger, which has no effect on COX-2 activity as measured by PGE2 production. Formation of the LG-histone adduct is associated with an increased histone solubility in NaCl, indicating destabilization of the nucleosome structure; this is also reversed with scavenger treatment. These data demonstrate that COX-2 activity can cause histone adduction and loosening of the nucleosome complex, which could lead to altered transcription and contribute to carcinogenesis.

  19. In vitro studies of the genotoxic effects of bitumen and coal-tar fume condensates: comparison of data obtained by mutagenicity testing and DNA adduct analysis by 32P-postlabelling.

    Science.gov (United States)

    De Méo, M; Genevois, C; Brandt, H; Laget, M; Bartsch, H; Castegnaro, M

    1996-08-14

    Bitumens contain traces of polycyclic aromatic compounds (PACs), a part of which will end up in the fumes emitted during hot handling of bitumen-containing products, e.g. during roadpaving. Although exposure of workers to these fumes is low, it might lead to health problems. Studies on bitumen fume condensates (BFCs) showed weak to moderate mutagenic activities, but studies on DNA adduct formation have not been reported. Therefore, a study was initiated in which fumes were generated from two road grade bitumens, in such a way that they were representative of the fumes produced in the field. The combined vapour/particulates were tested in vitro for their ability to produce DNA adducts and in modified Ames mutation assays, using a number of different strains. An attempt was made to relate the results to chemical data, such as the content of a number of individual polycyclic aromatic hydrocarbons (PAHs) and with a measure for the total PAC content. As a reference material fume condensate from coal-tar (coal-tar pitch volatiles; CTPV) were subjected to the same tests. All fume condensates tested were mutagenic to all strains and induced the formation of DNA adducts. The patterns of DNA adducts, obtained by 32P-postlabelling, arising from the BFCs were qualitatively different from the patterns of adducts obtained from the CTPVs, implying qualitative differences in the nature of the compounds responsible for the formation of these adducts. This is corroborated by the observation that for BFCs quantitative adduct levels are higher than would be expected based on the PAH content. These data thus indicate that the PAHs analysed are not the sole components responsible for adduct formation from BFCs, but that an important contribution comes from other (hetero- and/or substituted-) PACs.

  20. Mechanism of Error-Free Bypass of the Environmental Carcinogen N-(2'-Deoxyguanosin-8-yl)-3-aminobenzanthrone Adduct by Human DNA Polymerase η.

    Science.gov (United States)

    Patra, Amritraj; Politica, Dustin A; Chatterjee, Arindom; Tokarsky, E John; Suo, Zucai; Basu, Ashis K; Stone, Michael P; Egli, Martin

    2016-11-03

    The environmental pollutant 3-nitrobenzanthrone produces bulky aminobenzanthrone (ABA) DNA adducts with both guanine and adenine nucleobases. A major product occurs at the C8 position of guanine (C8-dG-ABA). These adducts present a strong block to replicative polymerases but, remarkably, can be bypassed in a largely error-free manner by the human Y-family polymerase η (hPol η). Here, we report the crystal structure of a ternary Pol⋅DNA⋅dCTP complex between a C8-dG-ABA-containing template:primer duplex and hPol η. The complex was captured at the insertion stage and provides crucial insight into the mechanism of error-free bypass of this bulky lesion. Specifically, bypass involves accommodation of the ABA moiety inside a hydrophobic cleft to the side of the enzyme active site and formation of an intra-nucleotide hydrogen bond between the phosphate and ABA amino moiety, allowing the adducted guanine to form a standard Watson-Crick pair with the incoming dCTP. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Formation of DNA adducts in the skin of psoriasis patients, in human skin in organ culture, and in mouse skin and lung following topical application of coal-tar and juniper tar.

    Science.gov (United States)

    Schoket, B; Horkay, I; Kósa, A; Páldeák, L; Hewer, A; Grover, P L; Phillips, D H

    1990-02-01

    Preparations of coal-tar and juniper tar (cade oil) that are used in the treatment of psoriasis are known to contain numerous potentially carcinogenic polycyclic aromatic hydrocarbons (PAH). Evidence of covalent binding to DNA by components of these mixtures was sought in a) human skin biopsy samples from 12 psoriasis patients receiving therapy with these agents, b) human skin explants maintained in organ culture and treated topically with the tars, and c) the skin and lungs of mice treated with repeated doses of the formulations following the regimen used in the clinic. DNA was isolated from the human and mouse tissues and digested enzymically to mononucleotides. 32P-Post-labeling analysis revealed the presence of aromatic DNA adducts in the biopsy samples at levels of up to 0.4 fmol total adducts/microgram DNA. Treatment of human skin in organ culture produced similar levels of adducts, while treatment with dithranol, a non-mutagenic therapeutic agent, resulted in chromatograms indistinguishable from those from untreated controls. In mouse skin, coal-tar ointment and juniper tar gave similar DNA adduct levels, with a similar time-course of removal: maximum levels (0.5 fmol/microgram DNA) at 24 h after the final treatment declined rapidly to 0.05 fmol/microgram at 7 d, thereafter declining slowly over the succeeding 25 d. However, while coal-tar ointment produced only very low levels of adducts in mouse lung (less than 0.03 fmol/microgram DNA), juniper tar produced adducts at a high level (0.7 fmol/microgram DNA) that were persistent in this tissue. These results provide direct evidence for the formation of potentially carcinogenic DNA damage in human and mouse tissue by components of these therapeutic tar preparations.

  2. Carcinogenicity and DNA adduct formation of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone and enantiomers of its metabolite 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol in F-344 rats.

    Science.gov (United States)

    Balbo, Silvia; Johnson, Charles S; Kovi, Ramesh C; James-Yi, Sandra A; O'Sullivan, M Gerard; Wang, Mingyao; Le, Chap T; Khariwala, Samir S; Upadhyaya, Pramod; Hecht, Stephen S

    2014-12-01

    4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK) is metabolized to enantiomers of 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanol (NNAL), found in the urine of virtually all people exposed to tobacco products. We assessed the carcinogenicity in male F-344 rats of (R)-NNAL (5 ppm in drinking water), (S)-NNAL (5 ppm), NNK (5 ppm) and racemic NNAL (10 ppm) and analyzed DNA adduct formation in lung and pancreas of these rats after 10, 30, 50 and 70 weeks of treatment. All test compounds induced a high incidence of lung tumors, both adenomas and carcinomas. NNK and racemic NNAL were most potent; (R)-NNAL and (S)-NNAL had equivalent activity. Metastasis was observed from primary pulmonary carcinomas to the pancreas, particularly in the racemic NNAL group. DNA adducts analyzed were O (2)-[4-(3-pyridyl)-4-oxobut-1-yl]thymidine (O (2)-POB-dThd), 7-[4-(3-pyridyl)-4-oxobut-1-yl]guanine(7-POB-Gua),O (6)-[4-(3-pyridyl)-4-oxobut-1-yl]deoxyguanosine(O (6)-POB-dGuo),the 4-(3-pyridyl)-4-hydroxybut-1-yl(PHB)adductsO (2)-PHB-dThd and 7-PHB-Gua, O (6)-methylguanine (O (6)-Me-Gua) and 4-hydroxy-1-(3-pyridyl)-1-butanone (HPB)-releasing adducts. Adduct levels significantly decreased with time in the lungs of rats treated with NNK. Pulmonary POB-DNA adducts and O (6)-Me-Gua were similar in rats treated with NNK and (S)-NNAL; both were significantly greater than in the (R)-NNAL rats. In contrast, pulmonary PHB-DNA adduct levels were greatest in the rats treated with (R)-NNAL. Total pulmonary DNA adduct levels were similar in (S)-NNAL and (R)-NNAL rats. Similar trends were observed for DNA adducts in the pancreas, but adduct levels were significantly lower than in the lung. The results of this study clearly demonstrate the potent pulmonary carcinogenicity of both enantiomers of NNAL in rats and provide important new information regarding DNA damage by these compounds in lung and pancreas.

  3. A feasibility study of the use of saliva as an alternative to leukocytes as a source of DNA for the study of Pt-DNA adducts in cancer patients receiving platinum-based chemotherapy.

    Science.gov (United States)

    Taylor, Sarah E; Wood, Joanna P; Thomas, Anne L; Jones, George D D; Reid, Helen J; Sharp, Barry L

    2014-12-01

    This note presents a comparison of the use of saliva versus leukocytes for the determination of Pt-DNA adducts obtained from patients undergoing platinum-based chemotherapy. Samples of both blood and saliva were taken pre- and post-treatment and were analysed via sector-field inductively coupled plasma mass spectrometry (SF-ICP-MS) to determine the level of Pt-DNA adducts formed. As expected, significant inter-patient variability was seen; however, a lack of correlation between the levels of adducts observed in saliva and blood samples was also observed (Pearson correlation coefficient r = -0.2598). A high yield of DNA was obtained from saliva samples, but significant difficulties were experienced in obtaining patient adherence to the saliva sampling procedure. In both leukocyte and saliva samples, not only was Pt from previous chemotherapy cycles detected, but the rapid appearance of Pt in the DNA was noted in both sample types 1 h after treatment.

  4. Electrochemistry and in situ scanning tunnelling microscopy of pure and redox-marked DNA- and UNA-based oligonucleotides on Au(111)-electrode surfaces

    DEFF Research Database (Denmark)

    Hansen, Allan Glargaard; Salvatore, Princia; Karlsen, K.

    2013-01-01

    We have studied adsorption and electrochemical electron transfer of several 13- and 15-base DNA and UNA (unlocked nucleic acids) oligonucleotides (ONs) linked to Au(111)-electrode surfaces via a 50-C6-SH group using cyclic voltammetry (CV) and scanning tunnelling microscopy in aqueous buffer under...... electrochemical potential control (in situ STM). 2,20,60,200-Terpyridine (terpy) onto which the transition metal ions Fe2+/3+, Os2+/3+ and Ru2+/3+ could be coordinated after UNA monolayer formation was attached to UNA via a flexible linker. The metal centres offer CV probes and in situ STM contrast markers...

  5. Self-Assembly of G-Rich Oligonucleotides Incorporating a 3'-3' Inversion of Polarity Site: A New Route Towards G-Wire DNA Nanostructures.

    Science.gov (United States)

    Oliviero, Giorgia; D'Errico, Stefano; Pinto, Brunella; Nici, Fabrizia; Dardano, Principia; Rea, Ilaria; De Stefano, Luca; Mayol, Luciano; Piccialli, Gennaro; Borbone, Nicola

    2017-08-01

    Obtaining DNA nanostructures with potential applications in drug discovery, diagnostics, and electronics in a simple and affordable way represents one of the hottest topics in nanotechnological and medical sciences. Herein, we report a novel strategy to obtain structurally homogeneous DNA G-wire nanostructures of known length, starting from the short unmodified G-rich oligonucleotide d(5'-CGGT-3'-3'-GGC-5') (1) incorporating a 3'-3' inversion of polarity site. The reported approach allowed us to obtain long G-wire assemblies through 5'-5' π-π stacking interactions in between the tetramolecular G-quadruplex building blocks that form when 1 is annealed in the presence of potassium ions. Our results expand the repertoire of synthetic methodologies to obtain new tailored DNA G-wire nanostructures.

  6. Analysis of DNA adducts formed in vivo in rats and mice from 1,2-dibromoethane, 1,2-dichloroethane, dibromomethane, and dichloromethane using HPLC/accelerator mass spectrometry and relevance to risk estimates.

    Science.gov (United States)

    Watanabe, Kengo; Liberman, Rosa G; Skipper, Paul L; Tannenbaum, Steven R; Guengerich, F Peter

    2007-11-01

    Dihaloalkanes are of toxicological interest because of their high-volume use in industry and their abilities to cause tumors in rodents, particularly dichloromethane and 1,2-dichloroethane. The brominated analogues are not used as extensively but are known to produce more toxicity in some systems. Rats and mice were treated i.p. with (14)C-dichloromethane, -dibromomethane, -1,2-dichloroethane, or -1,2-dibromoethane [5 mg (kg body weight)(-1)], and livers and kidneys were collected to rapidly isolate DNA. The DNA was digested using a procedure designed to minimize processing time, because some of the potential dihalomethane-derived DNA-glutathione (GSH) adducts are known to be unstable, and the HPLC fractions corresponding to major adduct standards were separated and analyzed for (14)C using accelerator mass spectrometry. The level of liver or kidney S-[2-(N(7)-guanyl)ethyl]GSH in rats treated with 1,2-dibromoethane was approximately 1 adduct/10(5) DNA bases; in male or female mice, the level was approximately one-half of this. The levels of 1,2-dichloroethane adducts were 10-50-fold lower. None of four known (in vitro) GSH-DNA adducts was detected at a level of >2/10(8) DNA bases from dibromomethane or dichloromethane. These results provide parameters for risk assessment of these compounds: DNA binding occurs with 1,2-dichloroethane but is considerably less than from 1,2-dibromoethane in vivo, and low exposure to dihalomethanes does not produce appreciable DNA adduct levels in rat or mouse liver and kidney of the doses used. The results may be used to address issues in human risk assessment.

  7. 32P-postlabeling analysis of DNA adduction in mice by synthetic metabolites of the environmental carcinogen, 7H-dibenzo[c,g]carbazole: chromatographic evidence for 3-hydroxy-7H-dibenzo[c,g]carbazole being a proximate genotoxicant in liver but not skin.

    Science.gov (United States)

    Schurdak, M E; Stong, D B; Warshawsky, D; Randerath, K

    1987-04-01

    The DNA adduction by the environmental carcinogen 7H-dibenzo[c,g]carbazole (DBC) and chemically synthesized 2-OH, 3-OH, and 4-OH metabolites of DBC was investigated in liver and skin of female CD-1 mice. After topical application to the skin of 37 mumol/kg of DBC or the phenolic metabolites, DNA adducts were measured by a 32P-post-labeling assay employing carrier-free [gamma-32P]ATP and ATP-deficient conditions. In liver, DBC produced four major and several minor chromatographically distinct adducts of as yet undetermined chemical structure. The adduct pattern elicited by 3-OH-DBC was qualitatively similar to the DBC adduct pattern, while this was not the case for 2-OH-DBC and 4-OH-DBC. On the basis of co-chromatography experiments under various conditions, the DBC and 3-OH-DBC adducts appeared identical, and the total of adduction elicited by these compounds in liver was substantial. Similar results were observed when DBC or 3-OH-DBC were administered i.p. As a major difference between the two compounds, one 3-OH-DBC adduct (no. 3) was 4.4- and 7.0-fold lower than the corresponding DBC adduct after i.p. and topical dosing, respectively. In skin, DBC produced two major adduct fractions after topical application, one of which could be chromatographically resolved into three subcomponents. Prominent adducts produced in skin DNA by each of the three metabolites were different from those elicited by DBC, and the level of adduction by the metabolites was significantly lower than that by DBC. Comparison of the skin and liver DBC-DNA adduct patterns after topical application of DBC showed that only one of the four major chromatographically resolved skin adducts corresponded to a major liver adduct (no. 3), and that total adduction in liver was 13.5-fold higher than in skin. These results suggested that activation of DBC to DNA-binding compounds in liver occurs through at least two pathways with 3-OH-DBC being a proximate carcinogen involved in the formation of most of the

  8. Interfacing click chemistry with automated oligonucleotide synthesis for the preparation of fluorescent DNA probes containing internal xanthene and cyanine dyes

    DEFF Research Database (Denmark)

    Astakhova, I Kira; Wengel, Jesper

    2013-01-01

    for the first time performed solid-phase copper(I)-catalyzed azide-alkyne cycloaddition (CuAAC) click labeling during the automated phosphoramidite oligonucleotide synthesis followed by postsynthetic click reactions in solution. We demonstrate that our novel strategy is rapid and efficient for the preparation...

  9. Typing for HLA-DPB1*03 and HLA-DPB1*06 using allele-specific DNA in vitro amplification and allele-specific oligonucleotide probes. Detection of "new" DPB1*06 variants

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P;

    1989-01-01

    DP gene typing using in vitro DNA amplification combined with sequence-specific oligonucleotide probes has recently been reported. The resulting DNA amplification was specific for the HLA-DPB locus. Typing for the individual DPB alleles was exclusively dependent on the hybridizations of the probe...

  10. Simultaneous measurement of benzo[a]pyrene-induced Pig-a and lacZ mutations, micronuclei and DNA adducts in Muta™ Mouse.

    Science.gov (United States)

    Lemieux, Christine L; Douglas, George R; Gingerich, John; Phonethepswath, Souk; Torous, Dorothea K; Dertinger, Stephen D; Phillips, David H; Arlt, Volker M; White, Paul A

    2011-12-01

    In this study we compared the response of the Pig-a gene mutation assay to that of the lacZ transgenic rodent mutation assay, and demonstrated that multiple endpoints can be measured in a 28-day repeat dose study. Muta™Mouse were dosed daily for 28 days with benzo[a]pyrene (BaP; 0, 25, 50 and 75 mg/kg body weight/day) by oral gavage. Micronucleus (MN) frequency was determined in reticulocytes (RETs) 48 hr following the last dose. 72 h following the last dose, mice were euthanized, and tissues (glandular stomach, small intestine, bone marrow and liver) were collected for lacZ mutation and DNA adduct analysis, and blood was evaluated for Pig-a mutants. BaP-derived DNA adducts were detected in all tissues examined and significant dose-dependent increases in mutant Pig-a phenotypes (i.e., RET(CD24-) and RBC (CD24-)) and lacZ mutants were observed. We estimate that mutagenic efficiency (i.e., rate of conversion of adducts into mutations) was much lower for Pig-a compared to lacZ, and speculate that this difference is likely explained by differences in repair capacity between the gene targets, and differences in the cell populations sampled for Pig-a versus lacZ. The BaP doubling doses for both gene targets, however, were comparable, suggesting that similar mechanisms are involved in the accumulation of gene mutations. Significant dose-related increases in % MN were also observed; however, the doubling dose was considerably higher for this endpoint. The similarity in dose response kinetics of Pig-a and lacZ provides further evidence for the mutational origin of glycosylphosphatidylinositol (GPI)-anchor deficiencies detected in the Pig-a assay.

  11. A Simple Oligonucleotide Biochip Capable of Rapidly Detecting Known Mitochondrial DNA Mutations in Chinese Patients with Leber’S Hereditary Optic Neuropathy (LHON

    Directory of Open Access Journals (Sweden)

    Wei-Dong Du

    2011-01-01

    Full Text Available Leber's hereditary optic neuropathy (LHON is a maternally transmitted disease. Clinically, no efficient assay protocols have been available. In this study, we aimed to develop an oligonucleotide biochip specialized for detection of known base substitution mutations in mitochondrial DNA causing LHON and to investigate frequencies of LHON relevant variants in Anhui region of China. Thirty-two pairs of oligonucleotide probes matched with the mutations potentially linked to LHON were covalently immobilized. Cy5-lablled targets were amplified from blood DNA samples by a multiplex PCR method. Two kinds of primary mutations 11778 G > A and 14484 T > C from six confirmed LHON patients were interrogated to validate this biochip format. Further, fourteen Chinese LHON pedigrees and twenty-five unrelated healthy individuals were investigated by the LHON biochip, direct sequencing and pyrosequencing, respectively. The biochip was found to be able efficiently to discriminate homoplasmic and heteroplasmic mtDNA mutations in LHON. Biochip analysis revealed that twelve of eighteen LHON symptomatic cases from the 14 Chinese pedigree harbored the mutations either 11778G > A, 14484T > C or 3460G > A, respectively, accounting for 66.7%. The mutation 11778G > A in these patients was homoplasmic and prevalent (55.5%, 10 of 18 cases. The mutations 3460G > A and 3394T > C were found to co-exist in one LHON case. The mutation 13708G > A appeared in one LHON pedigree. Smaller amount of sampling and reaction volume, easier target preparation, fast and high-throughput were the main advantages of the biochip over direct DNA sequencing and pyrosequencing. Our findings suggested that primary mutations of 11778G > A, 14484T > C or 3460G > A are main variants of mtDNA gene leading to LHON in China. The biochip would easily be implemented in clinical diagnosis.

  12. A simple oligonucleotide biochip capable of rapidly detecting known mitochondrial DNA mutations in Chinese patients with Leber's hereditary optic neuropathy (LHON).

    Science.gov (United States)

    Du, Wei-Dong; Chen, Gang; Cao, Hui-Min; Jin, Qing-Hui; Liao, Rong-Feng; He, Xiang-Cheng; Chen, Da-Ben; Huang, Shu-Ren; Zhao, Hui; Lv, Yong-Mei; Tang, Hua-Yang; Tang, Xian-Fa; Wang, Yong-Qing; Sun, Song; Zhao, Jian-Long; Zhang, Xue-Jun

    2011-01-01

    Leber's hereditary optic neuropathy (LHON) is a maternally transmitted disease. Clinically, no efficient assay protocols have been available. In this study, we aimed to develop an oligonucleotide biochip specialized for detection of known base substitution mutations in mitochondrial DNA causing LHON and to investigate frequencies of LHON relevant variants in Anhui region of China. Thirty-two pairs of oligonucleotide probes matched with the mutations potentially linked to LHON were covalently immobilized. Cy5-lablled targets were amplified from blood DNA samples by a multiplex PCR method. Two kinds of primary mutations 11778 G > A and 14484 T > C from six confirmed LHON patients were interrogated to validate this biochip format. Further, fourteen Chinese LHON pedigrees and twenty-five unrelated healthy individuals were investigated by the LHON biochip, direct sequencing and pyrosequencing, respectively. The biochip was found to be able efficiently to discriminate homoplasmic and heteroplasmic mtDNA mutations in LHON. Biochip analysis revealed that twelve of eighteen LHON symptomatic cases from the 14 Chinese pedigree harbored the mutations either 11778G > A, 14484T > C or 3460G A, respectively, accounting for 66.7%. The mutation 11778G > A in these patients was homoplasmic and prevalent (55.5%, 10 of 18 cases). The mutations 3460G > A and 3394T > C were found to co-exist in one LHON case. The mutation 13708G > A appeared in one LHON pedigree. Smaller amount of sampling and reaction volume, easier target preparation, fast and high-throughput were the main advantages of the biochip over direct DNA sequencing and pyrosequencing. Our findings suggested that primary mutations of 11778G > A, 14484T > C or 3460G > A are main variants of mtDNA gene leading to LHON in China. The biochip would easily be implemented in clinical diagnosis.

  13. Modulations of benzo[a]pyrene-induced DNA adduct, cyclin D1 and PCNA in oral tissue by 1,4-phenylenebis(methylene)selenocyanate

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Kun-Ming [Department of Biochemistry and Molecular Biology, Penn State College of Medicine, 500 University Drive, Hershey, PA 17033 (United States); Sacks, Peter G. [Department of Basic Sciences, College of Dentistry, New York University, New York, NY 10010 (United States); Spratt, Thomas E.; Lin, Jyh-Ming; Boyiri, Telih [Department of Biochemistry and Molecular Biology, Penn State College of Medicine, 500 University Drive, Hershey, PA 17033 (United States); Schwartz, Joel [University of Illinois, College of Dentistry, Chicago, IL 60612 (United States); Richie, John P.; Calcagnotto, Ana [Department of Public Health Sciences, Penn State College of Medicine, Hershey, PA 17033 (United States); Das, Arunangshu; Bortner, James [Department of Biochemistry and Molecular Biology, Penn State College of Medicine, 500 University Drive, Hershey, PA 17033 (United States); Zhao, Zonglin [Department of Basic Sciences, College of Dentistry, New York University, New York, NY 10010 (United States); Department of Environmental Medicine, School of Medicine, New York University, New York, NY 10010 (United States); Amin, Shantu [Department of Pharmacology, Penn State College of Medicine, Hershey, PA 17033 (United States); Guttenplan, Joseph [Department of Basic Sciences, College of Dentistry, New York University, New York, NY 10010 (United States); Department of Environmental Medicine, School of Medicine, New York University, New York, NY 10010 (United States); El-Bayoumy, Karam, E-mail: kee2@psu.edu [Department of Biochemistry and Molecular Biology, Penn State College of Medicine, 500 University Drive, Hershey, PA 17033 (United States)

    2009-05-22

    Tobacco smoking is an important cause of human oral squamous cell carcinoma (SCC). Tobacco smoke contains multiple carcinogens include polycyclic aromatic hydrocarbons typified by benzo[a]pyrene (B[a]P). Surgery is the conventional treatment approach for SCC, but it remains imperfect. However, chemoprevention is a plausible strategy and we had previously demonstrated that 1,4-phenylenebis(methylene)selenocyanate (p-XSC) significantly inhibited tongue tumors-induced by the synthetic 4-nitroquinoline-N-oxide (not present in tobacco smoke). In this study, we demonstrated that p-XSC is capable of inhibiting B[a]P-DNA adduct formation, cell proliferation, cyclin D1 expression in human oral cells in vitro. In addition, we showed that dietary p-XSC inhibits B[a]P-DNA adduct formation, cell proliferation and cyclin D1 protein expression in the mouse tongue in vivo. The results of this study are encouraging to further evaluate the chemopreventive efficacy of p-XSC initially against B[a]P-induced tongue tumors in mice and ultimately in the clinic.

  14. DNA microarray synthesis by using PDMS molecular stamp (II) -- Oligonucleotide on-chip synthesis using PDMS stamp

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Based on the standard phosphoramidites chemistry protocol, two oligonucleotides synthetic routes were studied by contact stamping reactants to a modified glass slide. Route A was a contact coupling reaction, in which a nucleoside monomer was transferred and coupled to reactive groups (OH) on a substrate by spreading the nucleoside activated with tetrazole on a polydimethylsiloxane (PDMS) stamp. Route B was a contact detritylation, in which one nucleoside was fixed on the desired synthesis regions where dimethoxytrityl (DMT) protecting groups on the 5′-hydroxyl of the support-bound nucleoside were removed by stamping trichloroacetic acid (TCA) distributed on features on a PDMS stamp. Experiments showed that the synthetic yield and the reaction speed of route A were higher than those of route B. It was shown that 20 mer oligonucleotide arrays immobilized on the glass slide were successfully synthesized using the PDMS stamps, and the coupling efficiency showed no difference between the PDMS stamping and the conventional synthesis methods.

  15. 丙烯醛-DNA加合物的研究进展%REVIEW:THE FORMATION AND MUTAGENESIS OF ACROLEIN-DNA ADDUCTS

    Institute of Scientific and Technical Information of China (English)

    尹瑞川; 汪海林

    2011-01-01

    丙烯醛是一种活泼的a,β不饱和醛,在环境中广泛存在,香烟烟气和厨房油烟是人体丙烯醛暴露的主要环境来源.另一方面机体内丙烯醛可以通过脂质过氧化、氨基酸氧化等多种途径自发生成.进入人体后,丙烯醛和DNA发生加合生成丙烯醛-DNA加合物,目前研究最多的是丙烯醛-dG加合物,包括a-OH-PdG和γ-OH-PdG,其中γ-OH-PdG是主要dG加合物,可引起基因突变(约1%),以G→T突变为主,而次要加合物a-OH-PdG的突变概率高于γ-OH-PdG(约8%),同样以G→T突变为主,并且这些加合物与一些癌症密切相关,如吸烟相关肺癌和膀胱癌等.此外,丙烯醛可以与其它碱基发生加合,生成其它类型的DNA加合物,包括丙烯醛-dA、dC和dT加合物,其中一些加合物的结构已表征,并在体外反应中存在.%Acrolein, one of the most reactive α,β unsaturated aldehydes, is an ubiquitous environmental pollutant and is found in cigarette smoking and cooking. On the other hand, acrolein can also be endogenously released during lipid peroxidation, myeloperoxidase-mediated degradation of amino acids, and so on. Acrolein can directly react with DNA without metabolic activation. As a result several types of DNA adducts could be produced. Currently, most of studies focus on Acrolein-dG adduct, including α-OH-PdG and γ-OH-PdG. The measured amount of γ-OH-PdG is higher than α-OH-PdG in human body and it can generate about 1% gene mutation, while gene mutation frequency is 8% for α-OH-PdG. Both adducts mainly induce G→T mutation.In addition, other base adducts may also be generated in vitro, including Aerolein-dA, dC, and dT adducts.But their metabolism and genotoxicity are unknown. To unbiasedly judge the genotoxicity of acrolein, the formation, metabolism and genotoxicity of non-dG adducts should be considered.

  16. Fast, single-step, and surfactant-free oligonucleotide modification of gold nanoparticles using DNA with a positively charged tail

    NARCIS (Netherlands)

    Gill, R.; Goeken, K.; Subramaniam, V.

    2013-01-01

    Fast modification of large gold nanoparticles with DNA is achieved by using DNA with a polycationic tail. The conjugated DNA is available for specific hybridization, and therefore can be used for DNA-based assays or for constructing nanoparticle superstructures based on DNA hybridization.

  17. Fast, single-step, and surfactant-free oligonucleotide modification of gold nanoparticles using DNA with a positively charged tail

    NARCIS (Netherlands)

    Gill, Ron; Göeken, Kristian; Subramaniam, Vinod

    2013-01-01

    Fast modification of large gold nanoparticles with DNA is achieved by using DNA with a polycationic tail. The conjugated DNA is available for specific hybridization, and therefore can be used for DNA-based assays or for constructing nanoparticle superstructures based on DNA hybridization

  18. Fast, single-step, and surfactant-free oligonucleotide modification of gold nanoparticles using DNA with a positively charged tail

    NARCIS (Netherlands)

    Gill, R.; Goeken, K.; Subramaniam, V.

    2013-01-01

    Fast modification of large gold nanoparticles with DNA is achieved by using DNA with a polycationic tail. The conjugated DNA is available for specific hybridization, and therefore can be used for DNA-based assays or for constructing nanoparticle superstructures based on DNA hybridization.

  19. Fast, single-step, and surfactant-free oligonucleotide modification of gold nanoparticles using DNA with a positively charged tail

    NARCIS (Netherlands)

    Gill, R.; Goeken, K.L.; Subramaniam, V.

    2013-01-01

    Fast modification of large gold nanoparticles with DNA is achieved by using DNA with a polycationic tail. The conjugated DNA is available for specific hybridization, and therefore can be used for DNA-based assays or for constructing nanoparticle superstructures based on DNA hybridization

  20. Nucleotide excision repair and recombination are engaged in repair of trans-4-hydroxy-2-nonenal adducts to DNA bases in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Beata Janowska, Marek Komisarski, Paulina Prorok, Beata Sokołowska, Jarosław Kuśmierek, Celina Janion, Barbara Tudek

    2009-01-01

    Full Text Available One of the major products of lipid peroxidation is trans-4-hydroxy-2-nonenal (HNE. HNE forms highly mutagenic and genotoxic adducts to all DNA bases. Using M13 phage lacZ system, we studied the mutagenesis and repair of HNE treated phage DNA in E. coli wild-type or uvrA, recA, and mutL mutants. These studies revealed that: (i nucleotide excision and recombination, but not mismatch repair, are engaged in repair of HNE adducts when present in phage DNA replicating in E. coli strains; (ii in the single uvrA mutant, phage survival was drastically decreased while mutation frequency increased, and recombination events constituted 48 % of all mutations; (iii in the single recA mutant, the survival and mutation frequency of HNE-modified M13 phage was slightly elevated in comparison to that in the wild-type bacteria. The majority of mutations in recA- strain were G:C → T:A transversions, occurring within the sequence which in recA+ strains underwent RecA-mediated recombination, and the entire sequence was deleted; (iv in the double uvrA recA mutant, phage survival was the same as in the wild-type although the mutation frequency was higher than in the wild-type and recA single mutant, but lower than in the single uvrA mutant. The majority of mutations found in the latter strain were base substitutions, with G:C → A:T transitions prevailing. These transitions could have resulted from high reactivity of HNE with G and C, and induction of SOS-independent mutations.

  1. Chemoprevention of 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine-induced carcinogen-DNA adducts by Chinese cabbage in rats

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    AIM The food-borne carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) induces colon and mammary gland tumors in rats and has been implicated in the etiology of human colorectal cancer. This study was conducted to examine the potentially preventive effect of Chinese cabbage (Brassica chinensis), a brassica vegetable most commonly consumed in China, against this carcinogen-induced DNA adduct formation in rats and its possible mechanisms.METHODS Sprague-Dawley rats were maintained for 10 days on basal diet or diet containing 20% (w/ w) freeze-dried cabbage powder prior to administration of a single dose of PhIP (10 mg/ kg) by oral gavage. Rats were sacrificed at 20 h after PhIP treatment and PhIP-DNA adducts in the colon, heart, lung and liver were analyzed using 32P-postlabeling technique. Levels of hepatic cytochrome P450 (CYP) 1A1 and 1A2, as indicated by 7-ethoxyresorufin O-deethylase and 7-methlxyresorufin O-demethylase activity, and cytosolic glutathione S-transferases (GSTs) towards 1-chloro-2, 4-dinitrobenzene (CDNB) in the liver, lung and colon were measured.RESULTS Rats pre-treated with Chinese cabbage and given a single dose of PhIP had reduced levels of PhIP-DNA adducts in the colon, heart, lung and liver, with inhibition rates of 82.3%, 60.6%, 48.4% and 48.9%, respectively (P<0.01). The enzyme assays revealed that Chinese cabbage induced both CYP1A1 and 1A2 activity, but the induction was preferential for CYP1A1 over 1A2 (81% vs 51%). GST activity towards CDNB in the liver and lung, but not colon, was also significantly increased by cabbage treatment.CONCLUSION The results indicate that Chinese cabbage has a preventive effect on PhIP-initiated carcinogenesis in rats and the mechanism is likely to involve the induction of detoxification enzymes.

  2. Serum Level of Antibodies (IgG, IgM Against Benzo[a]pyrene-7,8-diol-9,10-epoxide-DNA Adducts in Children Dermatologically Exposed to Coal Tar

    Directory of Open Access Journals (Sweden)

    Pavel Borský

    2017-06-01

    Full Text Available Crude coal tar (CCT contains polycyclic aromatic hydrocarbons (PAHs. Benzo[a]pyrene (BaP is metabolized into a highly reactive metabolite benzo[a]pyrene-7,8-diol-9,10-epoxide (BPDE that is able to bind to DNA and creates BPDE-DNA adducts. Adducted DNA becomes immunogenic and induces immune response by production of antibodies against BPDE-DNA adducts (Ab-BPDE-DNA. Circulating Ab-BPDE-DNA was proposed as potential biomarker of genotoxic exposure to BaP (PAHs. Goeckerman therapy (GT of psoriasis uses dermal application of CCT ointment (PAHs. In presented study (children with psoriasis treated by GT; n = 19 the therapy significantly increased the level of Ab-BPDE-DNA (EI = 0.29/0.19–0.34 vs. 0.31/0.25–0.40; median/lower–upper quartile; p < 0.01. The results support the idea of Ab-BPDE-DNA level as a possible tentative indicator of exposure, effects and susceptibility of the organism to the exposure of BaP (PAHs.

  3. Metabolism of benzo(a)pyrene and identification of the major benzo(a)pyrene-DNA adducts in cultured human colon

    DEFF Research Database (Denmark)

    1978-01-01

    ]benzo(a)pyrene for another 24 hr and the binding to cellular DMA and protein was measured. Two adducts, formed between benzo(a)pyrene and DMA, have been isolated. The major adduct (72 to 100%) was formed between the 10-position of benzo(a)pyrene diol-epoxide I and the 2-amino group of guanine, and the minor adduct...

  4. Molecular Dynamics Investigations of the Local Structural Characteristics of DNA Oligonucleotides: Studies of Helical Axis Deformations, Conformational Sequence Dependence and Modified Nucleoside Perturbations.

    Science.gov (United States)

    Louise-May, Shirley

    The present DNA studies investigate the local structure of DNA oligonucleotides in order to characterize helical axis deformations, sequence dependent fine structure and modified nucleoside perturbations of selected oligonucleotide sequences. The molecular dynamics method is used to generate an ensemble of energetically feasible DNA conformations which can then be analyzed for dynamical conformational properties, some of which can be compared to experimentally derived values. A theory and graphical presentation for the analysis of helical deformations of DNA based on the configurational statistics of polymers, called "Persistence Analysis", was designed. The results of the analysis on prototype forms, static crystal structures and two solvated MD simulations of the sequence d(CGCGAATTCGCG) indicate that all of the expected features of bending can be sensitively and systematically identified by this approach. Comparison of the relative performance of three molecular dynamics potential functions commonly used for dynamical modeling of biological macromolecules; CHARMm, AMBER and GROMOS was investigated via in vacuo MD simulations on the dodecamer sequence d(CGCGAATTCGCG)_2 with respect to the conformational properties of each dynamical model and their ability to support A and B families of DNA. Vacuum molecular dynamics simulations using the CHARMm force field carried out on simple homo- and heteropolymers of DNA led to the conclusion that sequence dependent fine structure appears to be well defined for adenine-thymine rich sequences both at the base pair and base step level whereas much of the the fine structure found in cytosine -guanine rich sequences appears to be context dependent. The local conformational properties of the homopolymer poly (dA) -poly (dT) revealed one dynamical model which was found in general agreement with fiber models currently available. Investigation of the relative structural static and dynamical effect of the misincorporation of

  5. Real-time study of interactions between cytosine-cytosine pairs in DNA oligonucleotides and silver ions using dual polarization interferometry.

    Science.gov (United States)

    Zheng, Yu; Yang, Cheng; Yang, Fan; Yang, Xiurong

    2014-04-15

    The real-time conformational changes of cytosine (C)-rich ssDNA oligonucleotides upon binding with silver ions (Ag(+)) were studied using dual polarization interferometry (DPI). Upon the addition of Ag(+), Ag(+) selectively bound to cytosine-cytosine mismatches and formed C-Ag(+)-C complexes, inducing change of the structure of the C-rich ssDNA from random coil conformation to duplex conformation, whereas the control ssDNA without cytosine-cytosine mismatches had no such signal, which was consistent with circular dichroism (CD) characterization. The conformational change of DNA was reflected on the changes of the mass, thickness, and density values resolved by DPI. The calibration curves showed that as the concentration of Ag(+) increased from 10 nM to 8 μM, the thickness and mass values increased linearly while the density values decreased linearly. Other metal ions such as K(+), Ca(2+), Na(+), Mg(2+), Zn(2+), Mn(2+), Ni(2+), and Pb(2+) did not interfere with the interaction between Ag(+) and C-rich ssDNA, indicating that this method had a good selectivity. The practical application of this biosensor was also investigated in real samples such as drinking water. Besides, cysteine could specifically capture Ag(+) from C-Ag(+)-C complexes and transformed the structure of the C-rich DNA back from rigid double-stranded conformation to random coil conformation, which allowed cysteine to be detected selectively as well. It is expected that this biosensing strategy may be utilized to study the interaction of DNA with other molecules.

  6. In vivo validation and physiologically based biokinetic modeling of the inhibition of SULT-mediated estragole DNA adduct formation in the liver of male Sprague-Dawley rats by the basil flavonoid nevadensin

    NARCIS (Netherlands)

    Alhusainy, W.; Paini, A.; Berg, van den J.H.J.; Punt, A.; Scholz, G.; Schilter, B.; Bladeren, van P.J.; Taylor, S.; Adams, T.B.; Rietjens, I.

    2013-01-01

    ScopeThe present work investigates whether the previous observation that the basil flavonoid nevadensin is able to inhibit sulfotransferase (SULT)-mediated estragole DNA adduct formation in primary rat hepatocytes could be validated in vivo. Methods and resultsEstragole and nevadensin were co-admini

  7. Basil extract inhibits the sulfotransferase mediated formation of DNA adducts of the procarcinogen 1'-hydroxyestragole by rat and human liver S9 homogenates and in HepG2 human hepatoma cells

    NARCIS (Netherlands)

    Jeurissen, S.M.F.; Punt, A.; Delatour, T.; Rietjens, I.M.C.M.

    2008-01-01

    The effects of a basil extract on the sulfation and concomitant DNA adduct formation of the proximate carcinogen 1¿-hydroxyestragole were studied using rat and human liver S9 homogenates and the human hepatoma cell line HepG2. Basil was chosen since it contains the procarcinogen estragole that can b

  8. JM216-, JM118-, and cisplatin-induced cytotoxicity in relation to platinum-DNA adduct formation, glutathione levels and p53 status in human tumour cell lines with different sensitivities to cisplatin

    NARCIS (Netherlands)

    Fokkema, E; Groen, HJM; Helder, MN; de Vries, EGE; Meijer, C

    2002-01-01

    The aim of this study is to establish anti-tumour potency of the new oral platinum drug JM216 and its metabolite JM118 in relation to the platinum (Pt)-DNA adduct formation, glutathione (GSH)-levels, and p53 status in human cancer cell lines with different sensitivities to cisplatin (CDDP). These pa

  9. Prediction of treatment outcome by cisplatin-DNA adduct formation in patients with stage III/IV head and neck squamous cell carcinoma, treated by concurrent cisplatin-radiation (RADPLAT).

    NARCIS (Netherlands)

    Hoebers, F.J.; Pluim, D.; Verheij, M.; Balm, A.J.M.; Bartelink, H.; Schellens, J.H.M.; Begg, A.C.

    2006-01-01

    The purpose of our study was to test the predictive value of cisplatin-DNA adduct levels in head and neck squamous cell carcinoma (HNSCC) patients treated with cisplatin-radiation. Patients with advanced-stage HNSCC were treated within a randomized trial, investigating the optimal route of cisplatin

  10. Isolation of a human anti-haemophilic factor IX cDNA clone using a unique 52-base synthetic oligonucleotide probe deduced from the amino acid sequence of bovine factor IX.

    Science.gov (United States)

    Jaye, M; de la Salle, H; Schamber, F; Balland, A; Kohli, V; Findeli, A; Tolstoshev, P; Lecocq, J P

    1983-04-25

    A unique 52mer oligonucleotide deduced from the amino acid sequence of bovine Factor IX was synthesized and used as a probe to screen a human liver cDNA bank. The Factor IX clone isolated shows 5 differences in nucleotide and deduced amino acid sequence as compared to a previously isolated clone. In addition, precisely one codon has been deleted.Images

  11. Identification of single-nucleotide polymorphisms by the oligonucleotide ligation reaction: a DNA biosensor for simultaneous visual detection of both alleles.

    Science.gov (United States)

    Toubanaki, Dimitra K; Christopoulos, Theodore K; Ioannou, Penelope C; Flordellis, Christodoulos S

    2009-01-01

    Although single nucleotide polymorphisms (SNPs) can be identified by direct hybridization with allele-specific oligonucleotide probes, enzyme-based genotyping methods offer much higher specificity and robustness. Among enzymatic methods, the oligonucleotide ligation reaction (OLR) offers the highest specificity for allele discrimination because two hybridization events are required for ligation. We report the development of a DNA biosensor that offers significant advantages over currently available methods for detection of OLR products: It allows simultaneous visual discrimination of both alleles using a single ligation reaction. Detection is complete within minutes without the need for any specialized instruments. It does not involve multiple cycles of incubation and washing. The dry-reagent format minimizes the pipetting steps. The need for qualified personnel is much lower than current methods. The principle of the assay is as follows: Following PCR amplification, a single OLR is performed using a biotinylated common probe and two allele-specific probes labeled with the haptens digoxigenin and fluorescein. Ligation products corresponding to the normal and mutant allele are double-labeled with biotin and either digoxigenin or fluorescein, respectively. The products are captured by antidigoxigenin or antifluorescein antibodies, or both, that are immobilized at the two test zones of the biosensor and react with antibiotin-functionalized gold nanoparticle reporters. The excess nanoparticles bind to biotinylated albumin that is immobilized at the control zone of the biosensor. The genotype is assigned by the characteristic red lines that appear at the two test zones. The proposed DNA biosensor constitutes a significant step toward point-of-care SNP genotyping.

  12. Nucleotide excision repair deficiency increases levels of acrolein-derived cyclic DNA adduct and sensitizes cells to apoptosis induced by docosahexaenoic acid and acrolein.

    Science.gov (United States)

    Pan, Jishen; Sinclair, Elizabeth; Xuan, Zhuoli; Dyba, Marcin; Fu, Ying; Sen, Supti; Berry, Deborah; Creswell, Karen; Hu, Jiaxi; Roy, Rabindra; Chung, Fung-Lung

    2016-07-01

    The acrolein derived cyclic 1,N(2)-propanodeoxyguanosine adduct (Acr-dG), formed primarily from ω-3 polyunsaturated fatty acids such as docosahexaenoic acid (DHA) under oxidative conditions, while proven to be mutagenic, is potentially involved in DHA-induced apoptosis. The latter may contribute to the chemopreventive effects of DHA. Previous studies have shown that the levels of Acr-dG are correlated with apoptosis induction in HT29 cells treated with DHA. Because Acr-dG is shown to be repaired by the nucleotide excision repair (NER) pathway, to further investigate the role of Acr-dG in apoptosis, in this study, NER-deficient XPA and its isogenic NER-proficient XAN1 cells were treated with DHA. The Acr-dG levels and apoptosis were sharply increased in XPA cells, but not in XAN1 cells when treated with 125μM of DHA. Because DHA can induce formation of various DNA damage, to specifically investigate the role of Acr-dG in apoptosis induction, we treated XPA knockdown HCT116+ch3 cells with acrolein. The levels of both Acr-dG and apoptosis induction increased significantly in the XPA knockdown cells. These results clearly demonstrate that NER deficiency induces higher levels of Acr-dG in cells treated with DHA or acrolein and sensitizes cells to undergo apoptosis in a correlative manner. Collectively, these results support that Acr-dG, a ubiquitously formed mutagenic oxidative DNA adduct, plays a role in DHA-induced apoptosis and suggest that it could serve as a biomarker for the cancer preventive effects of DHA.

  13. Using genomic DNA-based probe-selection to improve the sensitivity of high-density oligonucleotide arrays when applied to heterologous species

    Directory of Open Access Journals (Sweden)

    Townsend Henrik J

    2005-11-01

    Full Text Available Abstract High-density oligonucleotide (oligo arrays are a powerful tool for transcript profiling. Arrays based on GeneChip® technology are amongst the most widely used, although GeneChip® arrays are currently available for only a small number of plant and animal species. Thus, we have developed a method to improve the sensitivity of high-density oligonucleotide arrays when applied to heterologous species and tested the method by analysing the transcriptome of Brassica oleracea L., a species for which no GeneChip® array is available, using a GeneChip® array designed for Arabidopsis thaliana (L. Heynh. Genomic DNA from B. oleracea was labelled and hybridised to the ATH1-121501 GeneChip® array. Arabidopsis thaliana probe-pairs that hybridised to the B. oleracea genomic DNA on the basis of the perfect-match (PM probe signal were then selected for subsequent B. oleracea transcriptome analysis using a .cel file parser script to generate probe mask files. The transcriptional response of B. oleracea to a mineral nutrient (phosphorus; P stress was quantified using probe mask files generated for a wide range of gDNA hybridisation intensity thresholds. An example probe mask file generated with a gDNA hybridisation intensity threshold of 400 removed > 68 % of the available PM probes from the analysis but retained >96 % of available A. thaliana probe-sets. Ninety-nine of these genes were then identified as significantly regulated under P stress in B. oleracea, including the homologues of P stress responsive genes in A. thaliana. Increasing the gDNA hybridisation intensity thresholds up to 500 for probe-selection increased the sensitivity of the GeneChip® array to detect regulation of gene expression in B. oleracea under P stress by up to 13-fold. Our open-source software to create probe mask files is freely available http://affymetrix.arabidopsis.info/xspecies/ and may be used to facilitate transcriptomic analyses of a wide range of plant and animal

  14. Development of a Fluorescence Resonance Energy Transfer (FRET-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    Directory of Open Access Journals (Sweden)

    Noremylia Mohd Bakhori

    2013-12-01

    Full Text Available An optical DNA biosensor based on fluorescence resonance energy transfer (FRET utilizing synthesized quantum dot (QD has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  15. NADH:Cytochrome b5 Reductase and Cytochrome b5 Can Act as Sole Electron Donors to Human Cytochrome P450 1A1-Mediated Oxidation and DNA Adduct Formation by Benzo[a]pyrene.

    Science.gov (United States)

    Stiborová, Marie; Indra, Radek; Moserová, Michaela; Frei, Eva; Schmeiser, Heinz H; Kopka, Klaus; Philips, David H; Arlt, Volker M

    2016-08-15

    Benzo[a]pyrene (BaP) is a human carcinogen that covalently binds to DNA after activation by cytochrome P450 (P450). Here, we investigated whether NADH:cytochrome b5 reductase (CBR) in the presence of cytochrome b5 can act as sole electron donor to human P450 1A1 during BaP oxidation and replace the canonical NADPH:cytochrome P450 reductase (POR) system. We also studied the efficiencies of the coenzymes of these reductases, NADPH as a coenzyme of POR, and NADH as a coenzyme of CBR, to mediate BaP oxidation. Two systems containing human P450 1A1 were utilized: human recombinant P450 1A1 expressed with POR, CBR, epoxide hydrolase, and cytochrome b5 in Supersomes and human recombinant P450 1A1 reconstituted with POR and/or with CBR and cytochrome b5 in liposomes. BaP-9,10-dihydrodiol, BaP-7,8-dihydrodiol, BaP-1,6-dione, BaP-3,6-dione, BaP-9-ol, BaP-3-ol, a metabolite of unknown structure, and two BaP-DNA adducts were generated by the P450 1A1-Supersomes system, both in the presence of NADPH and in the presence of NADH. The major BaP-DNA adduct detected by (32)P-postlabeling was characterized as 10-(deoxyguanosin-N(2)-yl)-7,8,9-trihydroxy-7,8,9,10-tetrahydro-BaP (assigned adduct 1), while the minor adduct is probably a guanine adduct derived from 9-hydroxy-BaP-4,5-epoxide (assigned adduct 2). BaP-3-ol as the major metabolite, BaP-9-ol, BaP-1,6-dione, BaP-3,6-dione, an unknown metabolite, and adduct 2 were observed in the system using P450 1A1 reconstituted with POR plus NADPH. When P450 1A1 was reconstituted with CBR and cytochrome b5 plus NADH, BaP-3-ol was the predominant metabolite too, and an adduct 2 was also generated. Our results demonstrate that the NADH/cytochrome b5/CBR system can act as the sole electron donor both for the first and second reduction of P450 1A1 during the oxidation of BaP in vitro. They suggest that NADH-dependent CBR can replace NADPH-dependent POR in the P450 1A1-catalyzed metabolism of BaP.

  16. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.

    Science.gov (United States)

    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E

    2012-12-04

    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  17. Effect of hepatic cytochrome P450 (P450) oxidoreductase deficiency on 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine-DNA adduct formation in P450 reductase conditional null mice.

    Science.gov (United States)

    Arlt, Volker M; Singh, Rajinder; Stiborová, Marie; Gamboa da Costa, Gonçalo; Frei, Eva; Evans, James D; Farmer, Peter B; Wolf, C Roland; Henderson, Colin J; Phillips, David H

    2011-12-01

    2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP), formed during the cooking of foods, induces colon cancer in rodents. PhIP is metabolically activated by cytochromes P450 (P450s). To evaluate the role of hepatic P450s in the bioactivation of PhIP, we used Reductase Conditional Null (RCN) mice, in which cytochrome P450 oxidoreductase (POR), the unique electron donor to P450s, can be specifically deleted in hepatocytes by pretreatment with 3-methylcholanthrene (3-MC), resulting in the loss of essentially all hepatic P450 function. RCN mice were treated orally with 50 mg/kg b.wt. PhIP daily for 5 days, with and without 3-MC pretreatment. PhIP-DNA adducts (i.e., N-(deoxyguanosin-8-yl)-2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine [dG-C8-PhIP]), measured by liquid chromatography-tandem mass spectrometry, were highest in colon (1362 adducts/10(8) deoxynucleosides), whereas adduct levels in liver were ∼3.5-fold lower. Whereas no differences in PhIP-DNA adduct levels were found in livers with active POR versus inactivated POR, adduct levels were on average ∼2-fold lower in extrahepatic tissues of mice lacking hepatic POR. Hepatic microsomes from RCN mice with or without 3-MC pretreatment were also incubated with PhIP and DNA in vitro. PhIP-DNA adduct formation was ∼8-fold lower with hepatic microsomes from POR-inactivated mice than with those with active POR. Most of the hepatic microsomal activation of PhIP in vitro was attributable to CYP1A. Our results show that PhIP-DNA adduct formation in colon involves hepatic N-oxidation, circulation of activated metabolites via the bloodstream to extrahepatic tissues, and further activation, resulting in the formation of dG-C8-PhIP. Besides hepatic P450s, PhIP may be metabolically activated mainly by a non-P450 pathway in liver.

  18. Replication Bypass of the trans-4-Hydroxynonenal-Derived (6S,8R,11S)-1,N[superscript 2]-Deoxyguanosine DNA Adduct by the Sulfolobus solfataricus DNA Polymerase IV

    Energy Technology Data Exchange (ETDEWEB)

    Banerjee, Surajit; Christov, Plamen P.; Kozekova, Albena; Rizzo, Carmelo J.; Egli, Martin; Stone, Michael P. (Vanderbilt)

    2014-10-02

    trans-4-Hydroxynonenal (HNE) is the major peroxidation product of {omega}-6 polyunsaturated fatty acids in vivo. Michael addition of the N{sub 2}-amino group of dGuo to HNE followed by ring closure of N1 onto the aldehyde results in four diastereomeric 1,N{sub 2}-dGuo (1,N{sub 2}-HNE-dGuo) adducts. The (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct was incorporated into the 18-mer templates 5'-d(TCATXGAATCCTTCCCCC)-3' and d(TCACXGAATCCTTCCCCC)-3', where X = (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct. These differed in the identity of the template 5'-neighbor base, which was either Thy or Cyt, respectively. Each of these templates was annealed with either a 13-mer primer 5'-d(GGGGGAAGGATTC)-3' or a 14-mer primer 5'-d(GGGGGAAGGATTCC)-3'. The addition of dNTPs to the 13-mer primer allowed analysis of dNTP insertion opposite to the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, whereas the 14-mer primer allowed analysis of dNTP extension past a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair. The Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) belongs to the Y-family of error-prone polymerases. Replication bypass studies in vitro reveal that this polymerase inserted dNTPs opposite the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct in a sequence-specific manner. If the template 5'-neighbor base was dCyt, the polymerase inserted primarily dGTP, whereas if the template 5'-neighbor base was dThy, the polymerase inserted primarily dATP. The latter event would predict low levels of Gua {yields} Thy mutations during replication bypass when the template 5'-neighbor base is dThy. When presented with a primed (6S,8R,11S)-HNE-1,N{sub 2}-dGuo:dCyd pair, the polymerase conducted full-length primer extension. Structures for ternary (Dpo4-DNA-dNTP) complexes with all four template-primers were obtained. For the 18-mer:13-mer template-primers in which the polymerase was confronted with the (6S,8R,11S)-HNE-1,N{sub 2}-dGuo adduct, the (6S,8R,11S)-1,N

  19. DNA polymerases κ and ζ cooperatively perform mutagenic translesion synthesis of the C8-2'-deoxyguanosine adduct of the dietary mutagen IQ in human cells.

    Science.gov (United States)

    Bose, Arindam; Pande, Paritosh; Jasti, Vijay P; Millsap, Amy D; Hawkins, Edward K; Rizzo, Carmelo J; Basu, Ashis K

    2015-09-30

    The roles of translesion synthesis (TLS) DNA polymerases in bypassing the C8-2'-deoxyguanosine adduct (dG-C8-IQ) formed by 2-amino-3-methylimidazo[4,5-f]quinoline (IQ), a highly mutagenic and carcinogenic heterocyclic amine found in cooked meats, were investigated. Three plasmid vectors containing the dG-C8-IQ adduct at the G1-, G2- or G3-positions of the NarI site (5'-G1G2CG3CC-3') were replicated in HEK293T cells. Fifty percent of the progeny from the G3 construct were mutants, largely G→T, compared to 18% and 24% from the G1 and G2 constructs, respectively. Mutation frequency (MF) of dG-C8-IQ was reduced by 38-67% upon siRNA knockdown of pol κ, whereas it was increased by 10-24% in pol η knockdown cells. When pol κ and pol ζ were simultaneously knocked down, MF of the G1 and G3 constructs was reduced from 18% and 50%, respectively, to <3%, whereas it was reduced from 24% to <1% in the G2 construct. In vitro TLS using yeast pol ζ showed that it can extend G3*:A pair more efficiently than G3*:C pair, but it is inefficient at nucleotide incorporation opposite dG-C8-IQ. We conclude that pol κ and pol ζ cooperatively carry out the majority of the error-prone TLS of dG-C8-IQ, whereas pol η is involved primarily in its error-free bypass.

  20. Oxidative Damage to Nucleic Acids and Benzo(apyrene-7,8-diol-9,10-epoxide-DNA Adducts and Chromosomal Aberration in Children with Psoriasis Repeatedly Exposed to Crude Coal Tar Ointment and UV Radiation

    Directory of Open Access Journals (Sweden)

    Lenka Borska

    2014-01-01

    Full Text Available The paper presents a prospective cohort study. Observed group was formed of children with plaque psoriasis (n=19 treated by Goeckerman therapy (GT. The study describes adverse (side effects associated with application of GT (combined exposure of 3% crude coal tar ointment and UV radiation. After GT we found significantly increased markers of oxidative stress (8-hydroxy-2′-deoxyguanosine, 8-hydroxyguanosine, and 8-hydroxyguanine, significantly increased levels of benzo[a]pyrene-7,8-diol-9,10-epoxide (BPDE DNA adducts (BPDE-DNA, and significantly increased levels of total number of chromosomal aberrations in peripheral lymphocytes. We found significant relationship between (1 time of UV exposure and total number of aberrated cells and (2 daily topical application of 3% crude coal tar ointment (% of body surface and level of BPDE-DNA adducts. The findings indicated increased hazard of oxidative stress and genotoxic effects related to the treatment. However, it must be noted that the oxidized guanine species and BPDE-DNA adducts also reflect individual variations in metabolic enzyme activity (different extent of bioactivation of benzo[a]pyrene to BPDE and overall efficiency of DNA/RNA repair system. The study confirmed good effectiveness of the GT (significantly decreased PASI score.

  1. [mRNA expression analysis and classification of colonic biopsy samples using oligonucleotide and cDNA microarray techniques].

    Science.gov (United States)

    Galamb, Orsolya

    2008-07-20

    Despite tremendous progress in the past few decades, certain important aspects regarding the diagnosis, therapy, and follow-up of colorectal cancer still remain unsolved. In our work we searched for biomarkers of the development of colorectal carcinoma, and performed gene expression analysis for colorectal disease classification. We have established that the oligonucleotide microarray analyses of biopsy samples wholly fulfil the Affymetrix quality requirements, are highly standard and reproducible and the Taqman microfluidic card system is suitable for high-throughput, quick and cost efficient real-time-PCR validation of gene expression changes. We have shown that the sequential overexpression of osteopontin and osteonectin mRNAs and proteins significantly correlates with the progression of the colorectal adenoma-dysplasia-carcinoma sequence. We have identified and validated ten novel markers with continuously increasing mRNA expression in line with the adenoma-dysplasia-carcinoma transition. We have identified the top 27, 13 and 10 genes associated with adenoma, colorectal cancer, and inflammatory bowel diseases.

  2. G4-DNA formation in the HRAS promoter and rational design of decoy oligonucleotides for cancer therapy.

    Directory of Open Access Journals (Sweden)

    Alexandro Membrino

    Full Text Available HRAS is a proto-oncogene involved in the tumorigenesis of urinary bladder cancer. In the HRAS promoter we identified two G-rich elements, hras-1 and hras-2, that fold, respectively, into an antiparallel and a parallel quadruplex (qhras-1, qhras-2. When we introduced in sequence hras-1 or hras-2 two point mutations that block quadruplex formation, transcription increased 5-fold, but when we stabilized the G-quadruplexes by guanidinium phthalocyanines, transcription decreased to 20% of control. By ChIP we found that sequence hras-1 is bound only by MAZ, while hras-2 is bound by MAZ and Sp1: two transcription factors recognizing guanine boxes. We also discovered by EMSA that recombinant MAZ-GST binds to both HRAS quadruplexes, while Sp1-GST only binds to qhras-1. The over-expression of MAZ and Sp1 synergistically activates HRAS transcription, while silencing each gene by RNAi results in a strong down-regulation of transcription. All these data indicate that the HRAS G-quadruplexes behave as transcription repressors. Finally, we designed decoy oligonucleotides mimicking the HRAS quadruplexes, bearing (R-1-O-[4-(1-Pyrenylethynyl phenylmethyl] glycerol and LNA modifications to increase their stability and nuclease resistance (G4-decoys. The G4-decoys repressed HRAS transcription and caused a strong antiproliferative effect, mediated by apoptosis, in T24 bladder cancer cells where HRAS is mutated.

  3. Dendrimer-encapsulated copper as a novel oligonucleotides label for sensitive electrochemical stripping detection of DNA hybridization.

    Science.gov (United States)

    Gao, Huan; Jiang, Xue; Dong, Yang-Jun; Tang, Wan-Xin; Hou, Cong; Zhu, Ning-Ning

    2013-10-15

    This paper describes the synthesis and characterization of a novel electrochemical label for sensitive electrochemical stripping detection of DNA hybridization based on dendrimer-encapsulated copper. The generation 4.5 (G 4.5) carboxyl-terminated poly(amidoamine) dendrimer with a trimesyl core was used as a template for synthesis of Cu²⁺/dendrimer nanocomposites (Cu-DNCs). Ratios of Cu²⁺/dendrimer were optimized in order to obtain stable nanocomposites with maximal copper loading in the interior of a polymeric shell. Cu-DNCs labeled DNA probe was employed for determining a target ssDNA immobilized on multi-walled carbon nanotubes-modified glassy carbon electrode (GCE) based on a specific hybridization reaction. The hybridization events were monitored by electrochemical detection of Cu anchored on the hybrids after the release in a diluted nitric acid by anodic stripping differential pulse voltammetry (ASDPV). The results showed that only a complementary sequence could form a dsDNA with the Cu-DNCs DNA probe and give an obvious electrochemical signal. The non-complementary sequence exhibited negligible signal change compared with the blank measurement (means: the electrode containing no target DNA incubating in hybridization buffer solution containing Cu-DNCs DNA probe for a certain time). The use of Cu encapsulated-dendrimer as tags and ASDPV for the detection of the released Cu ions could enhance the hybridization signal, and result in the increase of the sensitivity for the target DNA. Under the conditions employed here, the detection limit for measuring the full complementary sequence is down to pM level. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Combination of ICP-MS, capillary electrophoresis, and their hyphenation for probing Ru(III) metallodrug-DNA interactions.

    Science.gov (United States)

    Foteeva, Lidia S; Matczuk, Magdalena; Pawlak, Katarzyna; Aleksenko, Svetlana S; Nosenko, Sergey V; Karandashev, Vasily K; Jarosz, Maciej; Timerbaev, Andrei R

    2017-03-01

    Determination of the DNA-binding reactivity and affinity is an important part of a successful program for the selection of metallodrug candidates. For such assaying, a range of complementary analytical techniques was proposed and tested here using one of few anticancer metal-based drugs that are currently in clinical trials, indazolium trans-[tetrachloridobis(1H-indazole)ruthenate(III), and a DNA oligonucleotide. A high reactivity of the Ru drug was confirmed in affinity capillary electrophoresis (CE) mode, where adduct formation takes place in situ (i.e., in the capillary filled with an oligonucleotide-containing electrolyte). To further characterize the binding kinetics, a drug-oligonucleotide mixture was incubated for a different period of time, followed by ultrafiltration separation into two different in molecular weight fractions (>3 and ICP-MS), revealing that at least two DNA adducts exist at equilibrium conditions. Using standalone ICP-MS, dominant equilibrium amount of the bound ruthenium was found to occur in a fraction of 5-10 kDa, which includes the oligonucleotide (ca. 6 kDa). Importantly, in all three assays, the drug was used for the first time in in-vitro studies, not in the intact form but as its active species released from the transferrin adduct at simulated cancer cytosolic conditions. This circumstance makes the established analytical platform promising to provide a detailed view on metallodrug targeting, including other possible biomolecules and ex vivo samples.

  5. DNA adducts, mutant frequencies and mutation spectra in λlacZ transgenic mice treated with N-nitrosodimethylamine

    NARCIS (Netherlands)

    Souliotis, V.L.; Delft, J.H.M. van; Steenwinkel, M.-J.S.T.; Baan, R.A.; Kyrtopoulos, S.A.

    1998-01-01

    Groups of λlacZ transgenic mice were treated i.p. with N-nitrosodimethylamine (NDMA) as single doses of 5 mg/kg or 10 mg/kg or as 10 daily doses of 1 mg/kg and changes in DNA N7- or O6-methylguanine or the repair enzyme O6-alkylguanine-DNA alkyltransferase (AGT) were followed for up to 14 days in va

  6. DNA adducts, mutant frequencies and mutation spectra in λlacZ transgenic mice treated with N-nitrosodimethylamine

    NARCIS (Netherlands)

    Souliotis, V.L.; Delft, J.H.M. van; Steenwinkel, M.-J.S.T.; Baan, R.A.; Kyrtopoulos, S.A.

    1998-01-01

    Groups of λlacZ transgenic mice were treated i.p. with N-nitrosodimethylamine (NDMA) as single doses of 5 mg/kg or 10 mg/kg or as 10 daily doses of 1 mg/kg and changes in DNA N7- or O6-methylguanine or the repair enzyme O6-alkylguanine-DNA alkyltransferase (AGT) were followed for up to 14 days in

  7. Gene editing by co-transformation of TALEN and chimeric RNA/DNA oligonucleotides on the rice OsEPSPS