
Sample records for oligodeoxyribonucleotides protect mice

  1. CpG oligodeoxyribonucleotides protect mice from Burholderia pseudomallei but not Francisella tularensis Schu 54 aersols (United States)


    CpG ODN 10103 performs comparably in mice to CpG ODN 7909 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’), which was previously reported to protect the BALB/c mice...SHORT REPORT Open Access CpG oligodeoxyribonucleotides protect mice from Burkholderia pseudomallei but not Francisella tularensis Schu S4 aerosols...that CpG oligodeoxyribonucleotides (ODN) protect mice from various bacterial pathogens, including Burkholderia pseudomallei and Francisella tularensis

  2. Antihepatoma effect of alpha-fetoprotein antisense phosphorothioate oligodeoxyribonucleotides in vitro and in mice

    Institute of Scientific and Technical Information of China (English)

    Xing Wang Wang; Jin Hui Yuan; Ru Gang Zhang; Li Xia Guo; Yong Xie; Hong Xie


    AIM To evaluate antihepatoma effect ofantisense phosphorothioate oligodeo-xyribonucleotides (S-ODNs) targeted to alpha-fetoprotein (AFP) genes in vitro and in nudemice.METHODS AFP gene expression was examinedby immunocytochemical method or enzyme-linked immunosorbent assay. Effect of S-ODNson SMMC-7721 human hepatoma cell growth invitro was determined using microculturetetrazolium assay. In vivo antitumor activitiesof S-ODNs were monitored by measuring tumorweight differences in treated and control micebearing SMMC-7721 xenografts. Induction of cellapoptosis was evaluated by fluorescence-activated cell sorter (FACS) analysis.RESULTS Antisense S-ODN treatment led toreduced AFP gene expression. Specificantisense S-ODNs, but not control S-ODNs,inhibited the growth of heaptoma cells in vitro.In vivo. only antisense S-ODNs exhibitedobvious antitumor activities. FACS analysisrevealed that the growth inhibition by antisenseS. ODNs was associated with their cell apoptosisinduction.CONCLUSION Antisense S-ODNs targeted toAFP genes inhibit the growth of human hepatomacells and solid hepatoma, which is related totheir cell apoptosis induction.

  3. Computer programming for nucleic acid studies. III. Calculated ultraviolet absorption spectra of protected oligodeoxyribonucleotides. (United States)

    Kan, L; Kettell, R W; Miller, P S


    A computer program called UV. FOR was written in FORTRAN. This program primarily utilizes the digitized UV absorption spectra of 8 protected deoxyribonucleosides in 95% ethanol solution to compose the UV spectrum of a oligodeoxynucleotide of any sequence. Both calculated and observed UV spectra of 2 protected oligodeoxynucleotides are carefully compared. The results show that the calculated UV spectrum is virtually identical to the observed spectrum. Thus, the calculated spectra provide rapid confirmation of oligonucleotide compositions during the course of oligonucleotide synthesis by the phosphotriester method.

  4. The 4-methylthio-1-butyl group for phosphate/thiophosphate protection in oligodeoxyribonucleotide synthesis. (United States)

    Cieślak, Jacek; Grajkowski, Andrzej; Livengood, Victor; Beaucage, Serge L


    The detailed preparation of deoxyribonucleoside phosphoramidites functionalized with a 4-methylthio-1-butyl group for P(III) protection is described, along with the incorporation of these phosphoramidites into DNA oligonucleotides via solid-phase techniques. The versatility of the thermolabile 4-methylthio-1-butyl phosphate/thiophosphate-protecting group is exemplified through its facile removal from oligonucleotides under neutral conditions or under standard basic conditions. The sulfonium salt that is produced during the thermolytic deprotection of oligonucleotides did not alter DNA nucleobases or desulfurize phosphorothioate diesters to a significant extent.

  5. Cleavage of oligodeoxyribonucleotides from controlled-pore glass supports and their rapid deprotection by gaseous amines. (United States)

    Boal, J H; Wilk, A; Harindranath, N; Max, E E; Kempe, T; Beaucage, S L


    A novel method for the deprotection of oligodeoxyribonucleotides has been developed. Gaseous amines such as ammonia or methylamine were employed under pressure to achieve mild and rapid deprotection conditions. For example, oligodeoxyribonucleotides having a (tert-butyl)phenoxyacetyl group for the protection of the exocyclic amino function of cytosine, adenine and guanine were released from controlled-pore glass supports and fully deprotected by ammonia or methylamine under gas phase conditions, at room temperature, within 35 or 2 min respectively.

  6. 3-(N-tert-butylcarboxamido)-1-propyl and 4-oxopentyl groups for phosphate/thiophosphate protection in oligodeoxyribonucleotide synthesis. (United States)

    Wilk, Andrzej; Chmielewski, Marcin K; Grajkowski, Andrzej; Beaucage, Serge L; Phillips, Lawrence R


    This unit provides procedures for the preparation of deoxyribonucleoside phosphoramidites and appropriate phosphordiamidite precursors with P(III) protecting groups different than the standard 2-cyanoethyl group. Specifically, these phosphoramidites are functionalized with the 3-(N-tert-butylcarboxamido)-1-propyl or 4-oxopentyl groups. The usefulness of these novel deoxyribonucleoside phosphoramidites in the solid-phase synthesis of a 20-mer DNA oligonucleotide and its phosphorothioated analog is demonstrated. It is also shown that removal of the 3-(N-tert-butylcarboxamido)-1-propyl phosphate/thiophosphate-protecting group from these oligonucleotides is rapidly effected under thermolytic conditions at neutral pH, whereas the 4-oxopentyl group is preferably removed by treatment with pressurized ammonia gas or concentrated ammonium hydroxide at ambient temperature. These detailed methods constitute an economical and alkylation-free approach to large-scale preparations of therapeutic oligonucleotides.

  7. Optimized synthesis of phosphorothioate oligodeoxyribonucleotides substituted with a 5'-protected thiol function and a 3'-amino group. (United States)

    Aubert, Y; Bourgerie, S; Meunier, L; Mayer, R; Roche, A C; Monsigny, M; Thuong, N T; Asseline, U


    A new deprotection procedure enables a medium scale preparation of phosphodiester and phosphor-othioate oligonucleotides substituted with a protected thiol function at their 5'-ends and an amino group at their 3'-ends in good yield (up to 72 OD units/micromol for a 19mer phosphorothioate). Syntheses of 3'-amino-substituted oligonucleotides were carried out on a modified support. A linker containing the thioacetyl moiety was manually coupled in two steps by first adding its phosphor-amidite derivative in the presence of tetrazole followed by either oxidation or sulfurization to afford the bis-derivatized oligonucleotide bound to the support. Deprotection was achieved by treating the fully protected oligonucleotide with a mixture of 2,2'-dithiodipyridine and concentrated aqueous ammonia in the presence of phenol and methanol. This proced-ure enables (i) cleavage of the oligonucleotide from the support, releasing the oligonucleotide with a free amino group at its 3'-end, (ii) deprotection of the phosphate groups and the amino functions of the nucleic bases, as well as (iii) transformation of the 5'-terminal S -acetyl function into a dithiopyridyl group. The bis-derivatized phosphorothioate oligomer was further substituted through a two-step procedure: first, the 3'-amino group was reacted with fluorescein isothiocyanate to yield a fluoresceinylated oligo-nucleotide; the 5'-dithio-pyridyl group was then -quantitatively reduced to give a free thiol group which was then substituted by reaction with an N alpha-bromoacetyl derivative of a signal peptide containing a KDEL sequence to afford a fluoresceinylated peptide-oligonucleotide conjugate.

  8. The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis. (United States)

    Wilk, Andrzej; Chmielewski, Marcin K; Grajkowski, Andrzej; Phillips, Lawrence R; Beaucage, Serge L


    Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.

  9. Preparation of a disulfide-linked precipitative soluble support for solution-phase synthesis of trimeric oligodeoxyribonucleotide 3´-(2-chlorophenylphosphate building blocks

    Directory of Open Access Journals (Sweden)

    Amit M. Jabgunde


    Full Text Available The preparation of a disulfide-tethered precipitative soluble support and its use for solution-phase synthesis of trimeric oligodeoxyribonucleotide 3´-(2-chlorophenylphosphate building blocks is described. To obtain the building blocks, N-acyl protected 2´-deoxy-5´-O-(4,4´-dimethoxytritylribonucleosides were phosphorylated with bis(benzotriazol-1-yl 2-chlorophenyl phosphate. The “outdated” phosphotriester strategy, based on coupling of PV building blocks in conjunction with quantitative precipitation of the oligodeoxyribonucleotide with MeOH is applied. Subsequent release of the resulting phosphate and base-protected oligodeoxyribonucleotide trimer 3’-pTpdCBzpdGibu-5’ as its 3’-(2-chlorophenyl phosphate was achieved by reductive cleavage of the disulfide bond.

  10. Preparation of a disulfide-linked precipitative soluble support for solution-phase synthesis of trimeric oligodeoxyribonucleotide 3´-(2-chlorophenylphosphate) building blocks (United States)

    Molina, Alejandro Gimenez; Virta, Pasi; Lönnberg, Harri


    Summary The preparation of a disulfide-tethered precipitative soluble support and its use for solution-phase synthesis of trimeric oligodeoxyribonucleotide 3´-(2-chlorophenylphosphate) building blocks is described. To obtain the building blocks, N-acyl protected 2´-deoxy-5´-O-(4,4´-dimethoxytrityl)ribonucleosides were phosphorylated with bis(benzotriazol-1-yl) 2-chlorophenyl phosphate. The “outdated” phosphotriester strategy, based on coupling of PV building blocks in conjunction with quantitative precipitation of the oligodeoxyribonucleotide with MeOH is applied. Subsequent release of the resulting phosphate and base-protected oligodeoxyribonucleotide trimer 3’-pTpdCBzpdGibu-5’ as its 3’-(2-chlorophenyl phosphate) was achieved by reductive cleavage of the disulfide bond. PMID:26664575

  11. Frontiers and Approaches to Chemical Synthesis of Oligodeoxyribonucleotides



    The advantages and disadvantages of existing approaches to the synthesis of oligodeoxyribonucleotides (ODN) are discussed focusing on large-scale methods. The liquid phase and solid supported synthesis and the synthesis on soluble polymers are discussed. Different problems concerning the methods and implementation of the ODN synthesis are outlined depending on goals of using target oligomers.

  12. Pure paraflagellar rod protein protects mice against Trypanosoma cruzi infection. (United States)

    Wrightsman, R A; Miller, M J; Saborio, J L; Manning, J E


    The paraflagellar rod proteins (PAR) purified from Trypanosoma cruzi epimastigotes were shown to protect mice against an otherwise lethal challenge inoculum of 10(3) bloodstream-form trypomastigotes. The injection route used for immunization was shown to have a marked impact on the development of protective immunity. Mice receiving subcutaneous (s.c.) injections of PAR proteins had reduced bloodstream parasitemias and showed 100% survival following challenge. In contrast, mice immunized via the intraperitoneal (i.p.) route developed parasitemia levels equivalent to those of unimmunized controls and did not survive infection. Western blotting (immunoblotting) demonstrated that sera from both i.p. and s.c. immunized mice reacted specifically with PAR proteins; however, the antibody titer of the i.p. immunized mice was approximately 64-fold greater than that of the s.c. immunized mice, suggesting that the protective response in the s.c. immunized mice is cell mediated rather than humoral.

  13. Pure paraflagellar rod protein protects mice against Trypanosoma cruzi infection.



    The paraflagellar rod proteins (PAR) purified from Trypanosoma cruzi epimastigotes were shown to protect mice against an otherwise lethal challenge inoculum of 10(3) bloodstream-form trypomastigotes. The injection route used for immunization was shown to have a marked impact on the development of protective immunity. Mice receiving subcutaneous (s.c.) injections of PAR proteins had reduced bloodstream parasitemias and showed 100% survival following challenge. In contrast, mice immunized via t...

  14. Thermolytic properties of 3-(2-pyridyl)-1-propyl and 2-[N-methyl-N-(2-pyridyl)]aminoethyl phosphate/thiophosphate protecting groups in solid-phase synthesis of oligodeoxyribonucleotides. (United States)

    Cieślak, Jacek; Beaucage, Serge L


    Thermolytic groups may serve as alternatives to the conventional 2-cyanoethyl group for phosphate/thiophosphate protection in solid-phase oligonucleotide synthesis to prevent DNA alkylation by acrylonitrile generated under the basic conditions used for oligonucleotide deprotection. Additionally, thermolytic groups are attractive in the context of engineering a "heat-driven" process for the synthesis of oligonucleotides on diagnostic microarrays. In these regards, the potential application of pyridine derivatives as thermolytic phosphate/thiophosphate protecting groups has been investigated. Specifically, 2-pyridinepropanol and 2-[N-methyl-N-(2-pyridyl)]aminoethanol were incorporated into deoxyribonucleoside phosphoramidites 7a-d and 9, which were found as efficient as 2-cyanoethyl deoxyribonucleoside phosphoramidites in solid-phase oligonucleotide synthesis. Whereas the removal of 3-(2-pyridyl)-1-propyl phosphate/thiophosphate protecting groups from oligonucleotides is effected within 30 min upon heating at 55 degrees C in concentrated NH4OH or in an aqueous buffer at pH 7.0, cleavage of 2-[N-methyl-N-(2-pyridyl)]aminoethyl groups occurs spontaneously when their phosphate or phosphorothioate esters are formed during oligonucleotide synthesis. The deprotection of these groups follows a cyclodeesterification process generating the bicyclic salts 13 and 14 as side products. These salts do not alkylate or otherwise modify any DNA nucleobases and do not desulfurize a phosphorothioate diester model under conditions mimicking large-scale oligonucleotide deprotection.

  15. Oral lactoferrin protects against experimental candidiasis in mice. (United States)

    Velliyagounder, K; Alsaedi, W; Alabdulmohsen, W; Markowitz, K; Fine, D H


    To determine the role of human lactoferrin (hLF) in protecting the oral cavities of mice against Candida albicans infection in lactoferrin knockout (LFKO(-/-)) mice was compared to wild-type (WT) mice. We also aim to determine the protective role of hLF in LFKO(-/-) mice. Antibiotic-treated immunosuppressed mice were inoculated with C. albicans (or sham infection) by oral swab and evaluated for the severity of infection after 7 days of infection. To determine the protective role of hLF, we added 0·3% solution of hLF to the drinking water given to some of the mice. CFU count, scoring of lesions and microscopic observations were carried out to determine the severity of infection. LFKO(-/-) I mice showed a 2 log (P = 0·001) higher CFUs of C. albicans in the oral cavity compared to the WT mice infected with C. albicans (WTI). LFKO(-/-) I mice given hLF had a 3 log (P = 0·001) reduction in CFUs in the oral cavity compared to untreated LFKO(-/-) I mice. The severity of infection, observed by light microscopy, revealed that the tongue of the LFKO(-/-) I mice showed more white patches compared to WTI and LFKO(-/-) I + hLF mice. Scanning electron microscopic observations revealed that more filiform papillae were destroyed in LFKO(-/-) I mice when compared to WTI or LFKO(-/-) I + hLF mice. Human LF is important in protecting mice from oral C. albicans infection. Administered hLF may be used to prevent C. albicans infection. Human LF, a multifunctional iron-binding glycoprotein can be used as a therapeutic active ingredient in oral healthcare products against C. albicans. © 2014 The Society for Applied Microbiology.

  16. Defective interfering virus protects elderly mice from influenza

    Directory of Open Access Journals (Sweden)

    Easton Andrew J


    Full Text Available Abstract Background We have identified and characterised a defective-interfering (DI influenza A virus particles containing a highly deleted segment 1 RNA that has broad-spectrum antiviral activity. In young adult mice it exerts protection against several different subtypes of influenza A virus (defined here as homologous or genetically compatible protection and against a paramyxovirus and an influenza B virus (heterologous or genetically unrelated protection. Homologous protection is mediated by replication competition between the deleted and full-length genomes, and heterologous protection occurs through stimulation of innate immunity, especially interferon type I. Methods A single dose of the protective DI virus was administered intranasally to elderly mice at -7, -1 and +1 days relative to intranasal challenge with influenza A virus. Results A single dose of the DI virus given 1 or 7 days protected elderly mice, reducing a severe, sometimes fatal disease to a subclinical or mild infection. In contrast, all members of control groups treated with inactivated DI virus before challenge became extremely ill and most died. Despite the subclinical/mild nature of their infection, protected mice developed solid immunity to a second infectious challenge. Conclusions The defective interfering virus is effective in preventing severe influenza A in elderly mice and may offer a new approach to protection of the human population.

  17. Lovastatin protects against experimental plague in mice.

    Directory of Open Access Journals (Sweden)

    Saravanan Ayyadurai

    Full Text Available BACKGROUND: Plague is an ectoparasite-borne deadly infection caused by Yersinia pestis, a bacterium classified among the group A bioterrorism agents. Thousands of deaths are reported every year in some African countries. Tetracyclines and cotrimoxazole are used in the secondary prophylaxis of plague in the case of potential exposure to Y. pestis, but cotrimoxazole-resistant isolates have been reported. There is a need for additional prophylactic measures. We aimed to study the effectiveness of lovastatin, a cholesterol-lowering drug known to alleviate the symptoms of sepsis, for plague prophylaxis in an experimental model. METHODOLOGY: Lovastatin dissolved in Endolipide was intraperitoneally administered to mice (20 mg/kg every day for 6 days prior to a Y. pestis Orientalis biotype challenge. Non-challenged, lovastatin-treated and challenged, untreated mice were also used as control groups in the study. Body weight, physical behavior and death were recorded both prior to infection and for 10 days post-infection. Samples of the blood, lungs and spleen were collected from dead mice for direct microbiological examination, histopathology and culture. The potential antibiotic effect of lovastatin was tested on blood agar plates. CONCLUSIONS/SIGNIFICANCE: Lovastatin had no in-vitro antibiotic effect against Y. pestis. The difference in the mortality between control mice (11/15; 73.5% and lovastatin-treated mice (3/15; 20% was significant (P<0.004; Mantel-Haenszel test. Dead mice exhibited Y. pestis septicemia and inflammatory destruction of lung and spleen tissues not seen in lovastatin-treated surviving mice. These data suggest that lovastatin may help prevent the deadly effects of plague. Field observations are warranted to assess the role of lovastatin in the prophylaxis of human plague.

  18. Protection of irradiated mice by dipyridamole

    Energy Technology Data Exchange (ETDEWEB)

    Moritani, Toshio (Showa Univ., Tokyo (Japan). School of Medicine)


    Dipyridamole (Persantin), a vasodilatory drug with antiplatelet activity, has been recently reported to inhibit lipid peroxidation and scavenge oxygen radicals. The radioprotective effects of dipyridamole were studied in ddy mice. When the mice were irradiated to 8.0 Gy, 30 days-lethality was reduced from 89% (control group) to 56% (0.5 mg/mouse and 1.0 mg/mouse i.p. injection of dipyridamole), and to 33% (2.0 mg/mouse and 4.0 mg/mouse i.p. injection). The dose required to kill 50% of the dipyridamole-tested mice within 30 days (LD{sub 50/30}) was 7.56 Gy compared to 6.63 Gy for the control mice. The results suggested that dipyridamole has significant radioprotective effect, so we clinically studied on its radioprotective effects using white-cell counts and platelet counts of 12 patients with breast cancer. Dipyridamole (150 mg/day) was administered to 6 of patients during radiation therapy. There was no statistically significant difference between these two groups. These results suggest the other factor than radioprotective effects on bone marrow. (author).

  19. Context-specific protection of TGFα null mice from osteoarthritis. (United States)

    Usmani, Shirine E; Ulici, Veronica; Pest, Michael A; Hill, Tracy L; Welch, Ian D; Beier, Frank


    Transforming growth factor alpha (TGFα) is a growth factor involved in osteoarthritis (OA). TGFα induces an OA-like phenotype in articular chondrocytes, by inhibiting matrix synthesis and promoting catabolic factor expression. To better understand TGFα's potential as a therapeutic target, we employed two in vivo OA models: (1) post-traumatic and (2) aging related OA. Ten-week old and six-month old male Tgfa null mice and their heterozygous (control) littermates underwent destabilization of the medial meniscus (DMM) surgery. Disease progression was assessed histologically using the Osteoarthritis Research Society International (OARSI) scoring system. As well, spontaneous disease progression was analyzed in eighteen-month-old Tgfa null and heterozygous mice. Ten-week old Tgfa null mice were protected from OA progression at both seven and fourteen weeks post-surgery. No protection was seen however in six-month old null mice after DMM surgery, and no differences were observed between genotypes in the aging model. Thus, young Tgfa null mice are protected from OA progression in the DMM model, while older mice are not. In addition, Tgfa null mice are equally susceptible to spontaneous OA development during aging. Thus, TGFα might be a valuable therapeutic target in some post-traumatic forms of OA, however its role in idiopathic disease is less clear.

  20. Macrophages in protective immunity to Hymenolepis nana in mice. (United States)

    Asano, K; Muramatsu, K; Ito, A; Okamoto, K


    When mice were treated with carrageenan just before infection with eggs of Hymenolepis nana, they failed to exhibit sterile immunity to the egg challenge, with evidence of a decrease in the number of peripheral macrophages (Mø) and the rate of carbon clearance. Although there were high levels of interleukin-1 (IL-1) released into the intestinal tracts of the parasitized mice at challenge infection, there was almost no release of IL-1 in those treated with carrageenan just before challenge. These results strongly suggest that Mø have an important role in protective immunity to H. nana in mice.

  1. Probiotics protect mice from ovariectomy-induced cortical bone loss. (United States)

    Ohlsson, Claes; Engdahl, Cecilia; Fåk, Frida; Andersson, Annica; Windahl, Sara H; Farman, Helen H; Movérare-Skrtic, Sofia; Islander, Ulrika; Sjögren, Klara


    The gut microbiota (GM) modulates the hosts metabolism and immune system. Probiotic bacteria are defined as live microorganisms which when administered in adequate amounts confer a health benefit on the host and can alter the composition of the GM. Germ-free mice have increased bone mass associated with reduced bone resorption indicating that the GM also regulates bone mass. Ovariectomy (ovx) results in bone loss associated with altered immune status. The purpose of this study was to determine if probiotic treatment protects mice from ovx-induced bone loss. Mice were treated with either a single Lactobacillus (L) strain, L. paracasei DSM13434 (L. para) or a mixture of three strains, L. paracasei DSM13434, L. plantarum DSM 15312 and DSM 15313 (L. mix) given in the drinking water during 6 weeks, starting two weeks before ovx. Both the L. para and the L. mix treatment protected mice from ovx-induced cortical bone loss and bone resorption. Cortical bone mineral content was higher in both L. para and L. mix treated ovx mice compared to vehicle (veh) treated ovx mice. Serum levels of the resorption marker C-terminal telopeptides and the urinary fractional excretion of calcium were increased by ovx in the veh treated but not in the L. para or the L. mix treated mice. Probiotic treatment reduced the expression of the two inflammatory cytokines, TNFα and IL-1β, and increased the expression of OPG, a potent inhibitor of osteoclastogenesis, in cortical bone of ovx mice. In addition, ovx decreased the frequency of regulatory T cells in bone marrow of veh treated but not probiotic treated mice. In conclusion, treatment with L. para or the L. mix prevents ovx-induced cortical bone loss. Our findings indicate that these probiotic treatments alter the immune status in bone resulting in attenuated bone resorption in ovx mice.

  2. Probiotics protect mice from ovariectomy-induced cortical bone loss.

    Directory of Open Access Journals (Sweden)

    Claes Ohlsson

    Full Text Available The gut microbiota (GM modulates the hosts metabolism and immune system. Probiotic bacteria are defined as live microorganisms which when administered in adequate amounts confer a health benefit on the host and can alter the composition of the GM. Germ-free mice have increased bone mass associated with reduced bone resorption indicating that the GM also regulates bone mass. Ovariectomy (ovx results in bone loss associated with altered immune status. The purpose of this study was to determine if probiotic treatment protects mice from ovx-induced bone loss. Mice were treated with either a single Lactobacillus (L strain, L. paracasei DSM13434 (L. para or a mixture of three strains, L. paracasei DSM13434, L. plantarum DSM 15312 and DSM 15313 (L. mix given in the drinking water during 6 weeks, starting two weeks before ovx. Both the L. para and the L. mix treatment protected mice from ovx-induced cortical bone loss and bone resorption. Cortical bone mineral content was higher in both L. para and L. mix treated ovx mice compared to vehicle (veh treated ovx mice. Serum levels of the resorption marker C-terminal telopeptides and the urinary fractional excretion of calcium were increased by ovx in the veh treated but not in the L. para or the L. mix treated mice. Probiotic treatment reduced the expression of the two inflammatory cytokines, TNFα and IL-1β, and increased the expression of OPG, a potent inhibitor of osteoclastogenesis, in cortical bone of ovx mice. In addition, ovx decreased the frequency of regulatory T cells in bone marrow of veh treated but not probiotic treated mice. In conclusion, treatment with L. para or the L. mix prevents ovx-induced cortical bone loss. Our findings indicate that these probiotic treatments alter the immune status in bone resulting in attenuated bone resorption in ovx mice.

  3. Synthesis of an oligodeoxyribonucleotide adduct of mitomycin C by the postoligomerization method via a triamino mitosene. (United States)

    Champeil, Elise; Paz, Manuel M; Ladwa, Sweta; Clement, Cristina C; Zatorski, Andrzej; Tomasz, Maria


    The cancer chemotherapeutic agent mitomycin C (MC) alkylates and cross-links DNA monofunctionally and bifunctionally in vivo and in vitro, forming six major MC-deoxyguanosine adducts of known structures. The synthesis of one of the monoadducts (8) by the postoligomerization method was accomplished both on the nucleoside and oligonucleotide levels, the latter resulting in the site-specific placement of 8 in a 12-mer oligodeoxyribonucleotide 26. This is the first application of this method to the synthesis of a DNA adduct of a complex natural product. Preparation of the requisite selectively protected triaminomitosenes 14 and 24 commenced with removal of the 10-carbamoyl group from MC, followed by reductive conversion to 10-decarbamoyl-2,7-diaminomitosene 10. This substance was transformed to 14 or 24 in several steps. Both were successfully coupled to the 2-fluoro-O(6)-(2-trimethylsilylethyl)deoxyinosine residue of the 12-mer oligonucleotide. The N(2)-phenylacetyl protecting group of 14 after its coupling to the 12-mer oligonucleotide could not be removed by penicillinamidase as expected. Nevertheless, the Teoc protecting group of 24 after coupling to the 12-mer oligonucleotide was removed by treatment with ZnBr2 to give the adducted oligonucleotide 26. However, phenylacetyl group removal was successful on the nucleoside-level synthesis of adduct 8. Proof of the structure of the synthetic nucleoside adduct included HPLC coelution and identical spectral properties with a natural sample, and (1)H NMR. Structure proof of the adducted oligonucleotide 26 was provided by enzymatic digestion to nucleosides and authentic adduct 8, as well as MS and MS/MS analysis.

  4. Perilipin overexpression in mice protects against diet-induced obesity (United States)

    Miyoshi, Hideaki; Souza, Sandra C.; Endo, Mikiko; Sawada, Takashi; Perfield, James W.; Shimizu, Chikara; Stancheva, Zlatina; Nagai, So; Strissel, Katherine J.; Yoshioka, Narihito; Obin, Martin S.; Koike, Takao; Greenberg, Andrew S.


    Perilipin A is the most abundant phosphoprotein on adipocyte lipid droplets and is essential for lipid storage and lipolysis. Perilipin null mice exhibit diminished adipose tissue, elevated basal lipolysis, reduced catecholamine-stimulated lipolysis, and increased insulin resistance. To understand the physiological consequences of increased perilipin expression in vivo, we generated transgenic mice that overexpressed either human or mouse perilipin using the adipocyte-specific aP2 promoter/enhancer. Phenotypes of female transgenic and wild-type mice were characterized on chow and high-fat diets (HFDs). When challenged with an HFD, transgenic mice exhibited lower body weight, fat mass, and adipocyte size than wild-type mice. Expression of oxidative genes was increased and lipogenic genes decreased in brown adipose tissue of transgenic mice. Basal and catecholamine-stimulated lipolysis was decreased and glucose tolerance significantly improved in transgenic mice fed a HFD. Perilipin overexpression in adipose tissue protects against HFD-induced adipocyte hypertrophy, obesity, and glucose intolerance. Alterations in brown adipose tissue metabolism may mediate the effects of perilipin overexpression on body fat, although the mechanisms by which perilipin overexpression alters brown adipose tissue metabolism remain to be determined. Our findings demonstrate a novel role for perilipin expression in adipose tissue metabolism and regulation of obesity and its metabolic complications. PMID:19797618

  5. Recombinant raccoon pox vaccine protects mice against lethal plague (United States)

    Osorio, J.E.; Powell, T.D.; Frank, R.S.; Moss, K.; Haanes, E.J.; Smith, S.R.; Rocke, T.E.; Stinchcomb, D.T.


    Using a raccoon poxvirus (RCN) expression system, we have developed new recombinant vaccines that can protect mice against lethal plague infection. We tested the effects of a translation enhancer (EMCV-IRES) in combination with a secretory (tPA) signal or secretory (tPA) and membrane anchoring (CHV-gG) signals on in vitro antigen expression of F1 antigen in tissue culture and the induction of antibody responses and protection against Yersinia pestis challenge in mice. The RCN vector successfully expressed the F1 protein of Y. pestis in vitro. In addition, the level of expression was increased by the insertion of the EMCV-IRES and combinations of this and the secretory signal or secretory and anchoring signals. These recombinant viruses generated protective immune responses that resulted in survival of 80% of vaccinated mice upon challenge with Y. pestis. Of the RCN-based vaccines we tested, the RCN-IRES-tPA-YpF1 recombinant construct was the most efficacious. Mice vaccinated with this construct withstood challenge with as many as 1.5 million colony forming units of Y. pestis (7.7??104LD50). Interestingly, vaccination with F1 fused to the anchoring signal (RCN-IRES-tPA-YpF1-gG) elicited significant anti-F1 antibody titers, but failed to protect mice from plague challenge. Our studies demonstrate, in vitro and in vivo, the potential importance of the EMCV-IRES and secretory signals in vaccine design. These molecular tools provide a new approach for improving the efficacy of vaccines. In addition, these novel recombinant vaccines could have human, veterinary, and wildlife applications in the prevention of plague. ?? 2002 Elsevier Science Ltd. All rights reserved.

  6. Doxorubicin-induced cardiotoxicity in mice; protection by silymarin

    Directory of Open Access Journals (Sweden)

    Heba Abdelnasser Aniss a, Ashraf El Metwally Said b, Ibrahim Helmy El Sayed c, Camelia AdLy


    Full Text Available Background: despite its vast utility in clinical oncology, the use of doxorubicin is limited by a potentially fatal cardiomyopathy and congestive heart failure. Free radical formation and antioxidants depletion are mechanisms proposed for this cardiomyopathy. The aim of this study is to compare the potential antioxidative protective effect of silymarin on doxorubicin-induced cardiotoxicity in experimental mice. Materials and methods: four groups (ten animals in each group of experimental mice were used as follows: Group 1, mice received only saline (intraperitoneally and served as a negative control group; Group 2, mice received doxorubicin (intraperitoneally, 5 mg/kg body weight in three equal injections over a period of two weeks for a cumulative dose of 15 mg/kg body weight; Group 3, mice orally administrated silymarin (200 mg/day/kg body weight respectively, through an intragastric feeding tube over a period of three weeks; Group 4, mice treated orally with silymarin plus intraperitoneally doxorubicin administration with the same protocol of groups 3 and 4. Serum lactate dehydrogenase (LDH, creatine phosphokinase (CPK, aspartate aminotransferase (ASAT, alanine aminotransferase (ALAT, malondialdehyde (MDA, total nitric oxide (NO, cardiac reduced glutathione (GSH, superoxide dismutase (SOD, glutathione peroxidase (GPx and catalase (CAT were measured in all tested groups. Results: doxorubicin elevated the activities of LDH, CPK, AST, ALT, MDA and NO in the cardiac tissue. Cardiac antioxidant enzymes activities SOD and CAT also increased while GPx activity was decreased. Pre-co-treatment with silymarin prevented the changes induced by doxorubicin administration. These findings demonstrate the cardio-protective effect of silymarin on cardiac antioxidant status during doxorubicin induced cardiac damage in mice. Conclusion: silymarin could be recommended for further investigation as potentially new indication for clinical application.

  7. Dose-effect relationship of CpG oligodeoxyribonucleotide 1826 in murine Lewis lung cancer treated with irradiation

    Directory of Open Access Journals (Sweden)

    Zhuang XB


    Full Text Available Xibing Zhuang,1 Tiankui Qiao,1 Sujuan Yuan,1 Wei Chen,1 Lin Zha,2 Li Yan11Department of Oncology, Jinshan Hospital, Medical Center of Fudan University, Shanghai, People's Republic of China; 2Department of Oncology, Tongling People's Hospital, Tongling, Anhui, People's Republic of ChinaBackground: Cytosine-phosphate-guanine (CpG oligodeoxyribonucleotides (ODNs, which induce signaling via Toll-like receptor 9, have recently been suggested to enhance sensitivity to traditional therapies, including chemotherapy, in certain cancer cell lines. This study aimed to define the dose-effect relationship for CpG ODN 1826 in increasing radiosensitivity and its impact on immune function in a mouse model of Lewis lung cancer.Methods: The tumor-bearing mouse model was induced by injecting Lewis lung cancer cells into the right anterior leg subcutaneously. Sixty-four C57BL/6 J mice were evenly randomized into eight groups, comprising: a control group; an irradiation group; a CpG ODN 0.15 group; a CpG ODN 0.3 group; a CpG ODN 0.45 group; a CpG 0.15 + irradiation group; a CpG 0.3 + irradiation group; and a CpG 0.45 + irradiation group. Tumor growth, serum tumor necrosis factor-alpha and interleukin-12 concentrations, spleen and thymus exponents, and effect of CpG on the secondary immune response were measured, and apoptosis of tumor cells was investigated using TdT-mediated dUTP nick end labeling (TUNEL after treatment.Results: Tumor volumes in the treated groups were smaller than in the control group, with those of the CpG 0.45 + irradiation group being the smallest. TUNEL showed that the apoptosis rate in all the active treatment groups was higher than in the control group. CpG ODN apoptosis rate, serum tumor necrosis factor-alpha and interleukin-12 levels, and the spleen and thymus exponent showed greater improvement in the groups receiving combination therapy of CpG ODN and irradiation than the control group or the group receiving irradiation alone. With the

  8. Vaccine Protection of Leukopenic Mice against Staphylococcus aureus Bloodstream Infection (United States)

    Rauch, Sabine; Gough, Portia; Kim, Hwan Keun; Schneewind, Olaf


    The risk for Staphylococcus aureus bloodstream infection (BSI) is increased in immunocompromised individuals, including patients with hematologic malignancy and/or chemotherapy. Due to the emergence of antibiotic-resistant strains, designated methicillin-resistant S. aureus (MRSA), staphylococcal BSI in cancer patients is associated with high mortality; however, neither a protective vaccine nor pathogen-specific immunotherapy is currently available. Here, we modeled staphylococcal BSI in leukopenic CD-1 mice that had been treated with cyclophosphamide, a drug for leukemia and lymphoma patients. Cyclophosphamide-treated mice were highly sensitive to S. aureus BSI and developed infectious lesions lacking immune cell infiltrates. Virulence factors of S. aureus that are key for disease establishment in immunocompetent hosts—α-hemolysin (Hla), iron-regulated surface determinants (IsdA and IsdB), coagulase (Coa), and von Willebrand factor binding protein (vWbp)—are dispensable for the pathogenesis of BSI in leukopenic mice. In contrast, sortase A mutants, which cannot assemble surface proteins, display delayed time to death and increased survival in this model. A vaccine with four surface antigens (ClfA, FnBPB, SdrD, and SpAKKAA), which was identified by genetic vaccinology using sortase A mutants, raised antigen-specific immune responses that protected leukopenic mice against staphylococcal BSI. PMID:25183728

  9. Partial purification of protective antigens from Nippostrongylus brasiliensis in mice. (United States)

    Rhalem, A; Bourdieu, C; Luffau, G; Pery, P


    The purification of antigens from Nippostrongylus brasiliensis, through their ability to provoke cellular proliferation of immune cells and through their recognition by antibodies, led to an antigenic preparation which was extracted from adult worms and which contained only two proteins (MW 14 and 43 Kd). Mice which were vaccinated by the oral route after the entrapment of these two proteins in liposomes were strongly protected.

  10. Kinetic analysis of oligodeoxyribonucleotide-directed triple-helix formation on DNA. (United States)

    Maher, L J; Dervan, P B; Wold, B J


    Pyrimidine oligonucleotides recognize extended purine sequences in the major groove of double-helical DNA by triple-helix formation. The resulting local triple helices are relatively stable and can block DNA recognition by sequence-specific DNA binding proteins such as restriction endonucleases. Association and dissociation kinetics for the oligodeoxyribonucleotide 5'-CTCTTTCCTCTCTTTTTCCCC (bold C's indicate 5-methylcytosine residues) are now measured with a restriction endonuclease protection assay. When oligonucleotides are present in greater than 10-fold excess over the DNA target site, the binding reaction kinetics are pseudo first order in oligonucleotide concentration. Under our standard conditions (37 degrees C, 25 mM Tris-acetate, pH 6.8, 70 mM sodium chloride, 20 mM magnesium chloride, 0.4 mM spermine tetrahydrochloride, 10 mM beta-mercaptoethanol, 0.1 mg/mL bovine serum albumin) the value of the observed pseudo-first-order association rate constant, k2obs, is 1.8 x 10(3) +/- 1.9 x 10(2) L.(mol of oligomer-1.s-1. Measurement of the dissociation rate constant yields an equilibrium dissociation constant of approximately 10 nM. Increasing sodium ion concentration slightly decreased the association rate, substantially increased the dissociation rate, and thereby reduced the equilibrium binding constant. This effect was reversible by increasing multivalent cation concentration, confirming the significant role of multivalent cations in oligonucleotide-directed triple-helix formation under these conditions. Finally, a small reduction in association rate, a large increase in dissociation rate, and a resulting reduction in the equilibrium binding constant were observed upon increasing the pH between 6.8 and 7.2.

  11. Recombinant thrombomodulin protects mice against histone-induced lethal thromboembolism.

    Directory of Open Access Journals (Sweden)

    Mayumi Nakahara

    Full Text Available INTRODUCTION: Recent studies have shown that histones, the chief protein component of chromatin, are released into the extracellular space during sepsis, trauma, and ischemia-reperfusion injury, and act as major mediators of the death of an organism. This study was designed to elucidate the cellular and molecular basis of histone-induced lethality and to assess the protective effects of recombinant thrombomodulin (rTM. rTM has been approved for the treatment of disseminated intravascular coagulation (DIC in Japan, and is currently undergoing a phase III clinical trial in the United States. METHODS: Histone H3 levels in plasma of healthy volunteers and patients with sepsis and DIC were measured using enzyme-linked immunosorbent assay. Male C57BL/6 mice were injected intravenously with purified histones, and pathological examinations were performed. The protective effects of rTM against histone toxicity were analyzed both in vitro and in mice. RESULTS: Histone H3 was not detectable in plasma of healthy volunteers, but significant levels were observed in patients with sepsis and DIC. These levels were higher in non-survivors than in survivors. Extracellular histones triggered platelet aggregation, leading to thrombotic occlusion of pulmonary capillaries and subsequent right-sided heart failure in mice. These mice displayed symptoms of DIC, including thrombocytopenia, prolonged prothrombin time, decreased fibrinogen, fibrin deposition in capillaries, and bleeding. Platelet depletion protected mice from histone-induced death in the first 30 minutes, suggesting that vessel occlusion by platelet-rich thrombi might be responsible for death during the early phase. Furthermore, rTM bound to extracellular histones, suppressed histone-induced platelet aggregation, thrombotic occlusion of pulmonary capillaries, and dilatation of the right ventricle, and rescued mice from lethal thromboembolism. CONCLUSIONS: Extracellular histones cause massive

  12. Maresin 1 Mitigates Inflammatory Response and Protects Mice from Sepsis

    Directory of Open Access Journals (Sweden)

    Ruidong Li


    Full Text Available Sepsis, frequently caused by infection of bacteria, is considered as an uncontrollable systematic inflammation response syndrome (SIRS. Maresin 1 (Mar1 is a new proresolving mediator with potent anti-inflammatory effect in several animal models. However, its effect in sepsis is still not investigated. To address this question, we developed sepsis model in BALB/c mice by cecal ligation and puncture (CLP with or without Mar1 treatment. Our data showed that Mar1 markedly improved survival rate and decreased the levels of proinflammatory cytokines in CLP mice such as interleukin-6 (IL-6, tumor necrosis factor-α (TNF-α, and interleukin-1β (IL-1β. Furthermore, Mar1 reduced serum level of lipopolysaccharide (LPS and enhanced the bacteria clearance in mice sepsis model. Moreover, Mar1 attenuated lung injury and decreased level of alanine transaminase (ALT, aspartate transaminase (AST, creatinine (Cre, and blood urea nitrogen (BUN in serum in mice after CLP surgery. Treatment with Mar1 inhibited activation of nuclear factor kappa B (NF-κb pathway. In conclusion, Mar1 exhibited protective effect in sepsis by reducing LPS, bacteria burden in serum, inhibiting inflammation response, and improving vital organ function. The possible mechanism is partly involved in inhibition of NF-κb activation.

  13. Thalidomide protects mice against LPS-induced shock

    Directory of Open Access Journals (Sweden)

    Moreira A.L.


    Full Text Available Thalidomide has been shown to selectively inhibit TNF-a production in vitro by lipopolysaccharide (LPS-stimulated monocytes. TNF-a has been shown to play a pivotal role in the pathophysiology of endotoxic shock. Using a mouse model of LPS-induced shock, we investigated the effects of thalidomide on the production of TNF-a and other cytokines and on animal survival. After injection of 100-350 µg LPS into mice, cytokines including TNF-a, IL-6, IL-10, IL-1ß, GM-CSF and IFN-g were measured in the serum. Administration of 200 mg/kg thalidomide to mice before LPS challenge modified the profile of LPS-induced cytokine secretion. Serum TNF-a levels were reduced by 93%, in a dose-dependent manner, and TNF-a mRNA expression in the spleens of mice was reduced by 70%. Serum IL-6 levels were also inhibited by 50%. Thalidomide induced a two-fold increase in serum IL-10 levels. Thalidomide treatment did not interfere with the production of GM-CSF, IL-1ß or IFN-g. The LD50 of LPS in this model was increased by thalidomide pre-treatment from 150 µg to 300 µg in 72 h. Thus, at otherwise lethal doses of LPS, thalidomide treatment was found to protect animals from death

  14. Protective effect of corticosteroids on radiation pneumonitis in mice

    Energy Technology Data Exchange (ETDEWEB)

    Gross, N.J.; Narine, K.R.; Wade, R.


    We explored the protective effect of corticosteroids on the mortality of mice that received thoracic irradiation. Methylprednisolone, 100 mg/kg/week, given from 11 weeks after gamma irradiation of the thorax resulted in an increase in the LD50 (11-26 weeks) from 14.3 +/- 0.3 (mean +/- SE) Gy to 17.6 +/- 0.4 Gy, P less than 0.001, a protection factor of 1.2. Withdrawal of steroids at various times during the period of radiation pneumonitis resulted in accelerated mortality in the next 2-4 weeks, so that the cumulative mortality caught up with that of control animals by 4 weeks after steroid withdrawal. However, after the end of the usual period of pneumonitis withdrawal of steroids did not result in accelerated mortality, suggesting that the time when steroids are protective corresponds to the duration of pneumonitis. A smaller dose of steroids, 25 mg/kg/week, was found to be as protective as the larger dose used in the above experiments. The possibility that corticosteroids reduce mortality, even when given many weeks after radiation, may have important practical and theoretical implications.

  15. Synthesis of an oligodeoxyribonucleotide adduct of mitomycin C by the postoligomerization method via a triamino mitosene


    Champeil, Elise; Paz, Manuel M.; Ladwa, Sweta; Cristina C. Clement; ZATORSKI, ANDRZEJ; Tomasz, Maria


    The cancer chemotherapeutic agent mitomycin C (MC) alkylates and cross-links DNA monofunctionally and bifunctionally in vivo and in vitro, forming six major MC-deoxyguanosine adducts of known structures. The synthesis of one of the monoadducts (8) by the postoligomerization method was accomplished both on the nucleoside and oligonucleotide levels, the latter resulting in the site-specific placement of 8 in a 12-mer oligodeoxyribonucleotide 26. This is the first application of this method to t...

  16. Synthetic strategies and parameters involved in the synthesis of oligodeoxyribonucleotides according to the phosphoramidite method. (United States)

    Beaucage, S L; Caruthers, M H


    The phosphoramidite approach has had a major impact on the synthesis of oligonucleotides. This unit describes parameters that affect the performance of this method for preparing oligodeoxyribonucleotides, as well as a number of compatible strategies. Milestones that led to the discovery of the approach are chronologically reported. Alternate strategies are also described to underscore the versatility by which these synthons can be obtained. Mechanisms of deoxyribonucleoside phosphoramidite activation, factors affecting condensation, and deprotection strategies are discussed.

  17. Dendritic Cell Targeting of Bacillus anthracis Protective Antigen Expressed by Lactobacillus acidophilus Protects Mice from Lethal Challenge (United States)


    Dendritic cell targeting of Bacillus anthracis protective antigen expressed by Lactobacillus acidophilus protects mice from lethal challenge M...lethal chal- lenge. A vaccine strategy was established by using Lactobacillus acidophilus to deliver Bacillus anthracis protective antigen (PA) via...include species of Lactobacillus , Lactococcus, Leuconostoc, Pedio- coccus, and Streptococcus. It is widely accepted that Lactobacillus species play a

  18. Tenascin C protects aorta from acute dissection in mice (United States)

    Kimura, Taizo; Shiraishi, Kozoh; Furusho, Aya; Ito, Sohei; Hirakata, Saki; Nishida, Norifumi; Yoshimura, Koichi; Imanaka-Yoshida, Kyoko; Yoshida, Toshimichi; Ikeda, Yasuhiro; Miyamoto, Takanobu; Ueno, Takafumi; Hamano, Kimikazu; Hiroe, Michiaki; Aonuma, Kazutaka; Matsuzaki, Masunori; Imaizumi, Tsutomu; Aoki, Hiroki


    Acute aortic dissection (AAD) is caused by the disruption of intimomedial layer of the aortic walls, which is immediately life-threatening. Although recent studies indicate the importance of proinflammatory response in pathogenesis of AAD, the mechanism to keep the destructive inflammatory response in check is unknown. Here, we report that induction of tenascin-C (TNC) is a stress-evoked protective mechanism against the acute hemodynamic and humoral stress in aorta. Periaortic application of CaCl2 caused stiffening of abdominal aorta, which augmented the hemodynamic stress and TNC induction in suprarenal aorta by angiotensin II infusion. Deletion of Tnc gene rendered mice susceptible to AAD development upon the aortic stress, which was accompanied by impaired TGFβ signaling, insufficient induction of extracellular matrix proteins and exaggerated proinflammatory response. Thus, TNC works as a stress-evoked molecular damper to maintain the aortic integrity under the acute stress.

  19. Melanocortins protect against multiple organ dysfunction syndrome in mice (United States)

    Bitto, Alessandra; Polito, Francesca; Altavilla, Domenica; Irrera, Natasha; Giuliani, Daniela; Ottani, Alessandra; Minutoli, Letteria; Spaccapelo, Luca; Galantucci, Maria; Lodi, Renzo; Guzzo, Giuseppe; Guarini, Salvatore; Squadrito, Francesco


    BACKGROUND AND PURPOSE Melanocortins reverse circulatory shock and improve survival by counteracting the systemic inflammatory response, and through the activation of the vagus nerve-mediated cholinergic anti-inflammatory pathway. To gain insight into the potential therapeutic value of melanocortins against multiple organ damage following systemic inflammatory response, here we investigated the effects of the melanocortin analogue [Nle4, D-Phe7]α-MSH (NDP-α-MSH) in a widely used murine model of multiple organ dysfunction syndrome (MODS). EXPERIMENTAL APPROACH MODS was induced in mice by a single intraperitoneal injection of lipopolysaccharide followed, 6 days later (= day 0), by zymosan. After MODS or sham MODS induction, animals were randomized to receive intraperitoneally NDP-α-MSH (340 µg·kg−1 day) or saline for up to 16 days. Additional groups of MODS mice were concomitantly treated with the melanocortin MC4 receptor antagonist HS024, or the nicotinic acetylcholine receptor antagonist chlorisondamine, and NDP-α-MSH. KEY RESULTS At day 7, in the liver and lung NDP-α-MSH, significantly reduced mRNA expression of tumour necrosis factor-α (TNF-α), increased mRNA expression of interleukin-10 and improved the histological picture, as well as reduced TNF-α plasma levels; furthermore, NDP-α-MSH dose-dependently increased survival rate, as assessed throughout the 16 day observation period. HS024 and chlorisondamine prevented all the beneficial effects of NDP-α-MSH in MODS mice. CONCLUSIONS AND IMPLICATIONS These data indicate that NDP-α-MSH protects against experimental MODS by counteracting the systemic inflammatory response, probably through brain MC4 receptor-triggered activation of the cholinergic anti-inflammatory pathway. These findings reveal previously undescribed effects of melanocortins and could have clinical relevance in the MODS setting. PMID:21039420

  20. Mangafodipir protects against hepatic ischemia-reperfusion injury in mice.

    Directory of Open Access Journals (Sweden)

    Romain Coriat

    Full Text Available INTRODUCTION AND AIM: Mangafodipir is a contrast agent used in magnetic resonance imaging that concentrates in the liver and displays pleiotropic antioxidant properties. Since reactive oxygen species are involved in ischemia-reperfusion damages, we hypothesized that the use of mangafodipir could prevent liver lesions in a mouse model of hepatic ischemia reperfusion injury. Mangafodipir (MnDPDP was compared to ischemic preconditioning and intermittent inflow occlusion for the prevention of hepatic ischemia-reperfusion injury in the mouse. METHODS: Mice were subjected to 70% hepatic ischemia (continuous ischemia for 90 min. Thirty minutes before the ischemic period, either mangafodipir (10 mg/kg or saline was injected intraperitoneally. Those experimental groups were compared with one group of mice preconditioned by 10 minutes' ischemia followed by 15 minutes' reperfusion, and one group with intermittent inflow occlusion. Hepatic ischemia-reperfusion injury was evaluated by measurement of serum levels of aspartate aminotransferase (ASAT activity, histologic analysis of the livers, and determination of hepatocyte apoptosis (cytochrome c release, caspase 3 activity. The effect of mangafodipir on the survival rate of mice was studied in a model of total hepatic ischemia. RESULTS: Mangafodipir prevented experimental hepatic ischemia-reperfusion injuries in the mouse as indicated by a reduction in serum ASAT activity (P<0.01, in liver tissue damages, in markers of apoptosis (P<0.01, and by higher rates of survival in treated than in untreated animals (P<0.001. The level of protection by mangafodipir was similar to that observed following intermittent inflow occlusion and higher than after ischemic preconditioning. CONCLUSIONS: Mangafodipir is a potential new preventive treatment for hepatic ischemia-reperfusion injury.

  1. Melatonin protects uterus and oviduct exposed to nicotine in mice

    Directory of Open Access Journals (Sweden)

    Seyed Saadat Seyedeh Nazanin


    Full Text Available Smoking is associated with higher infertility risk. The aim of this study was to evaluate protective effects of melatonin on the uterus and oviduct in mice exposed to nicotine. Adult female mice (n=32 were divided into four groups. Group A: control animals received normal saline, Group B: injected with nicotine 40 μg/kg, Group C: injected with melatonin 10 μg, Group D: injected with nicotine 40 μg/kg and melatonin 10 μg. All animals were treated over 15 days intraperitoneally. On the 16th day, animals in the estrus phase were dissected and their uterus and oviducts were removed. Immunohistochemistry was recruited for studying apoptosis and for detection of estrogen receptor (ER alpha in luminal epithelium of the uterus and oviduct. Enzyme-linked immunosorbent assay was used for serum estradiol level determination. Nicotine in group B decreased estradiol level and ERalpha numbers both in the uterus and oviduct (p<0.05. Co-administration of melatonin-nicotine in Group D ameliorated the histology of the uterus and oviduct, increased ERalpha numbers and reduced apoptosis in the uterus and oviduct compared with the nicotine Group B (p<0.05. This study indicates that nicotine impairs the histology of the uterus and oviduct and co-administration of melatonin-nicotine ameliorates these findings, partly through alteration in ERalpha numbers and reduction of apoptosis

  2. Protective effects of asiaticoside on septic lung injury in mice. (United States)

    Zhang, Li-na; Zheng, Jia-jia; Zhang, Li; Gong, Xia; Huang, Hai; Wang, Chang-dong; Wang, Bin; Wu, Meng-jiao; Li, Xiao-hui; Sun, Wen-juan; Liu, Ying-ju; Wan, Jing-yuan


    Asiaticoside (AS), a major triterpenoid saponin component isolated from Centella asiatica, has been described to exhibit antioxidant and anti-inflammatory activities. The present study aimed to determine the protective effects and the underlying mechanisms of AS on septic lung injury induced by cecal ligation and puncture (CLP). Mice were pretreated with the AS (45 mg/kg) or AS as well as GW9662 at 1h before CLP, the survival, lung injury, inflammatory mediators and signaling molecules, and Peroxisome proliferator-activated receptor-γ (PPAR-γ) were determined 24 h after CLP. The results showed that AS significantly decreased CLP-induced the mortality, lung pathological damage, the infiltration of mononuclear, polymorphonuclear (PMN) leucocytes and total proteins. Moreover, AS inhibited CLP-induced the activation of mitogen-activated protein kinases (MAPKs) and nuclear factor-κB (NF-κB), the expression of cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS) protein in lung tissues, and the production of serum tumor necrosis factor (TNF-α) and interleukin-6 (IL-6). Interestingly, the expression of PPAR-γ protein in lung tissue was up-regulated by AS. Furthermore, GW9662 (the inhibitor of PPAR-γ) significantly reversed these beneficial effects of AS in septic mice. These findings suggest that AS could effectively protect from septic lung injury induced by CLP and the underlying mechanisms might be related to up-regulation of PPAR-γ expression to some extent, which inhibits MAPKs and NF-κB pathway.

  3. Antibody protection against botulinum neurotoxin intoxication in mice. (United States)

    Cheng, Luisa W; Stanker, Larry H; Henderson, Thomas D; Lou, Jianlong; Marks, James D


    Adulteration of food or feed with any of the seven serotypes of botulinum neurotoxin (BoNT) is a potential bioterrorism concern. Currently, there is strong interest in the development of detection reagents, vaccines, therapeutics, and other countermeasures. A sensitive immunoassay for detecting BoNT serotype A (BoNT/A), based on monoclonal antibodies (MAbs) F1-2 and F1-40, has been developed and used in complex matrices. The epitope for F1-2 has been mapped to the heavy chain of BoNT/A, and the epitope of F1-40 has been mapped to the light chain. The ability of these MAbs to provide therapeutic protection against BoNT/A intoxication in mouse intravenous and oral intoxication models was tested. High dosages of individual MAbs protected mice well both pre- and postexposure to BoNT/A holotoxin. A combination therapy consisting of antibodies against both the light and heavy chains of the toxin, however, significantly increased protection, even at a lower MAb dosage. An in vitro peptide assay for measuring toxin activity showed that pretreatment of toxin with these MAbs did not block catalytic activity but instead blocked toxin entry into primary and cultured neuronal cells. The timing of antibody rescue in the mouse intoxication models revealed windows of opportunity for antibody therapeutic treatment that correlated well with the biologic half-life of the toxin in the serum. Knowledge of BoNT intoxication and antibody clearance in these mouse models and understanding of the pharmacokinetics of BoNT are invaluable for future development of antibodies and therapeutics against intoxication by BoNT.

  4. Active protection of mice against Salmonella typhi by immunization with strain-specific porins. (United States)

    Isibasi, A; Ortiz-Navarrete, V; Paniagua, J; Pelayo, R; González, C R; García, J A; Kumate, J


    NIH mice were immunized with between 2.5 and 30 micrograms of two highly purified porins, 34 kDa and 36 kDa, isolated from the virulent strain Salmonella typhi 9,12, Vi:d. Of mice immunized with 10 micrograms of porins, 90% were protected against a challenge with up to 500 LD50 (50% lethal doses) of S. typhi 9,12,Vi:d and only 30% protection was observed in mice immunized with the same dose of porins but challenged with the heterologous strain Salmonella typhimurium. These results demonstrate the utility of porins for the induction of a protective status against S. typhi in mice.

  5. Participation of platelets in protection against larval Taenia taeniaeformis infection in mice. (United States)

    Kakuda, T; Ooi, H K; Oku, Y; Kamiya, M


    The participation of platelets in the protection against larval Taenia taeniaeformis was studied. CB-17 SCID mice, susceptible to T. taeniaeformis, were protected against a challenge infection with T. taeniaeformis by the passive transfer of platelets from T. taeniaeformis-infected normal CB-17 mice, resistant to T. taeniaeformis.

  6. Lupeol Protects Against Cerulein-Induced Acute Pancreatitis in Mice. (United States)

    Kim, Min-Jun; Bae, Gi-Sang; Choi, Sun Bok; Jo, Il-Joo; Kim, Dong-Goo; Shin, Joon-Yeon; Lee, Sung-Kon; Kim, Myoung-Jin; Song, Ho-Joon; Park, Sung-Joo


    Lupeol is a triterpenoid commonly found in fruits and vegetables and is known to exhibit a wide range of biological activities, including antiinflammatory and anti-cancer effects. However, the effects of lupeol on acute pancreatitis specifically have not been well characterized. Here, we investigated the effects of lupeol on cerulein-induced acute pancreatitis in mice. Acute pancreatitis was induced via an intraperitoneal injection of cerulein (50 µg/kg). In the lupeol treatment group, lupeol was administered intraperitoneally (10, 25, or 50 mg/kg) 1 h before the first cerulein injection. Blood samples were taken to determine serum cytokine and amylase levels. The pancreas was rapidly removed for morphological examination and used in the myeloperoxidase assay, trypsin activity assay, and real-time reverse transcription polymerase chain reaction. In addition, we isolated pancreatic acinar cells using a collagenase method to examine the acinar cell viability. Lupeol administration significantly attenuated the severity of pancreatitis, as was shown by reduced pancreatic edema, and neutrophil infiltration. In addition, lupeol inhibited elevation of digestive enzymes and cytokine levels, such as tumor necrosis factor (TNF)-α, interleukin (IL)-1, and interleukin (IL)-6. Furthermore, lupeol inhibited the cerulein-induced acinar cell death. In conclusion, these results suggest that lupeol exhibits protective effects on cerulein-induced acute pancreatitis.

  7. Caveolin-1 Protects B6129 Mice against Helicobacter pylori Gastritis (United States)

    Hitkova, Ivana; Yuan, Gang; Anderl, Florian; Gerhard, Markus; Kirchner, Thomas; Reu, Simone; Röcken, Christoph; Schäfer, Claus; Schmid, Roland M.; Vogelmann, Roger; Ebert, Matthias P. A.; Burgermeister, Elke


    Caveolin-1 (Cav1) is a scaffold protein and pathogen receptor in the mucosa of the gastrointestinal tract. Chronic infection of gastric epithelial cells by Helicobacter pylori (H. pylori) is a major risk factor for human gastric cancer (GC) where Cav1 is frequently down-regulated. However, the function of Cav1 in H. pylori infection and pathogenesis of GC remained unknown. We show here that Cav1-deficient mice, infected for 11 months with the CagA-delivery deficient H. pylori strain SS1, developed more severe gastritis and tissue damage, including loss of parietal cells and foveolar hyperplasia, and displayed lower colonisation of the gastric mucosa than wild-type B6129 littermates. Cav1-null mice showed enhanced infiltration of macrophages and B-cells and secretion of chemokines (RANTES) but had reduced levels of CD25+ regulatory T-cells. Cav1-deficient human GC cells (AGS), infected with the CagA-delivery proficient H. pylori strain G27, were more sensitive to CagA-related cytoskeletal stress morphologies (“humming bird”) compared to AGS cells stably transfected with Cav1 (AGS/Cav1). Infection of AGS/Cav1 cells triggered the recruitment of p120 RhoGTPase-activating protein/deleted in liver cancer-1 (p120RhoGAP/DLC1) to Cav1 and counteracted CagA-induced cytoskeletal rearrangements. In human GC cell lines (MKN45, N87) and mouse stomach tissue, H. pylori down-regulated endogenous expression of Cav1 independently of CagA. Mechanistically, H. pylori activated sterol-responsive element-binding protein-1 (SREBP1) to repress transcription of the human Cav1 gene from sterol-responsive elements (SREs) in the proximal Cav1 promoter. These data suggested a protective role of Cav1 against H. pylori-induced inflammation and tissue damage. We propose that H. pylori exploits down-regulation of Cav1 to subvert the host's immune response and to promote signalling of its virulence factors in host cells. PMID:23592983

  8. Caveolin-1 protects B6129 mice against Helicobacter pylori gastritis.

    Directory of Open Access Journals (Sweden)

    Ivana Hitkova

    Full Text Available Caveolin-1 (Cav1 is a scaffold protein and pathogen receptor in the mucosa of the gastrointestinal tract. Chronic infection of gastric epithelial cells by Helicobacter pylori (H. pylori is a major risk factor for human gastric cancer (GC where Cav1 is frequently down-regulated. However, the function of Cav1 in H. pylori infection and pathogenesis of GC remained unknown. We show here that Cav1-deficient mice, infected for 11 months with the CagA-delivery deficient H. pylori strain SS1, developed more severe gastritis and tissue damage, including loss of parietal cells and foveolar hyperplasia, and displayed lower colonisation of the gastric mucosa than wild-type B6129 littermates. Cav1-null mice showed enhanced infiltration of macrophages and B-cells and secretion of chemokines (RANTES but had reduced levels of CD25+ regulatory T-cells. Cav1-deficient human GC cells (AGS, infected with the CagA-delivery proficient H. pylori strain G27, were more sensitive to CagA-related cytoskeletal stress morphologies ("humming bird" compared to AGS cells stably transfected with Cav1 (AGS/Cav1. Infection of AGS/Cav1 cells triggered the recruitment of p120 RhoGTPase-activating protein/deleted in liver cancer-1 (p120RhoGAP/DLC1 to Cav1 and counteracted CagA-induced cytoskeletal rearrangements. In human GC cell lines (MKN45, N87 and mouse stomach tissue, H. pylori down-regulated endogenous expression of Cav1 independently of CagA. Mechanistically, H. pylori activated sterol-responsive element-binding protein-1 (SREBP1 to repress transcription of the human Cav1 gene from sterol-responsive elements (SREs in the proximal Cav1 promoter. These data suggested a protective role of Cav1 against H. pylori-induced inflammation and tissue damage. We propose that H. pylori exploits down-regulation of Cav1 to subvert the host's immune response and to promote signalling of its virulence factors in host cells.

  9. Protective effect of ghrelin against paraquatinduced acute lung injury in mice

    Institute of Scientific and Technical Information of China (English)



    Objective To measure the levels of ghrelin-induced expression or activation of nuclear factor erythroid 2-re-lated factor 2(Nrf2),heme oxygenase-1(HO-1),and NAD(P)H:quinone oxidoreductase 1(NQO1)in the PQ-injured lungs of mice and to evaluate the protective effect of ghrelin against paraquat(PQ)-induced acute lung injury in mice.Methods According to the random number table method,50 ICR mice of clean grade were

  10. Resveratrol Protects the Brain of Obese Mice from Oxidative Damage

    Directory of Open Access Journals (Sweden)

    Shraddha D. Rege


    Full Text Available Resveratrol (3,5,4′-trihydroxy-trans-stilbene is a polyphenolic phytoalexin that exerts cardioprotective, neuroprotective, and antioxidant effects. Recently it has been shown that obesity is associated with an increase in cerebral oxidative stress levels, which may enhance neurodegeneration. The present study evaluates the neuroprotective action of resveratrol in brain of obese (ob/ob mice. Resveratrol was administered orally at the dose of 25 mg kg−1 body weight daily for three weeks to lean and obese mice. Resveratrol had no effect on body weight or blood glucose levels in obese mice. Lipid peroxides were significantly increased in brain of obese mice. The enzymatic antioxidants superoxide dismutase, catalase, glutathione peroxidase, glutathione reductase, glucose-6-phosphate dehydrogenase and nonenzymatic antioxidants tocopherol, ascorbic acid, and glutathione were decreased in obese mice brain. Administration of resveratrol decreased lipid peroxide levels and upregulated the antioxidant activities in obese mice brain. Our findings indicate a neuroprotective effect of resveratrol by preventing oxidative damage in brain tissue of obese mice.

  11. Schistosome syntenin partially protects vaccinated mice against Schistosoma mansoni infection.

    Directory of Open Access Journals (Sweden)

    Barbara C Figueiredo


    Full Text Available Schistosomiasis is a neglected tropical disease caused by several species of trematode of the genus Schistosoma. The disease affects more than 200 million people in the world and causes up to 280,000 deaths per year, besides having high morbidity due to chronic illness that damages internal organs. Current schistosomiasis control strategies are mainly based on chemotherapy, but many researchers believe that the best long-term strategy to control disease is a combination of drug treatment and immunization with an anti-schistosome vaccine. Among the most promising molecules as vaccine candidates are the proteins present in the tegument and digestive tract of the parasite.In this study, we describe for the first time Schistosoma mansoni syntenin (SmSynt and we evaluate its potential as a recombinant vaccine. We demonstrate by real-time PCR that syntenin is mainly expressed in intravascular life stages (schistosomula and adult worms of the parasite life cycle and, by confocal microscopy, we localize it in digestive epithelia in adult worms and schistosomula. Administration of siRNAs targeting SmSynt leads to the knock-down of syntenin gene and protein levels, but this has no demonstrable impact on parasite morphology or viability, suggesting that high SmSynt gene expression is not essential for the parasites in vitro. Mice immunization with rSmSynt, formulated with Freund's adjuvant, induces a Th1-type response, as suggested by the production of IFN-γ and TNF-α by rSmSynt-stimulated cultured splenocytes. The protective effect conferred by vaccination with rSmSynt was demonstrated by 30-37% reduction of worm burden, 38-43% reduction in the number, and 35-37% reduction in the area, of liver granulomas.Our report is the first characterization of syntenin in Schistosoma mansoni and our data suggest that this protein is a potential candidate for the development of a multi-antigen vaccine to control schistosomiasis.

  12. Suspended animation-like state protects mice from lethal hypoxia. (United States)

    Blackstone, Eric; Roth, Mark B


    Joseph Priestley observed the high burn rate of candles in pure oxygen and wondered if people would "live out too fast" if we were in the same environment. We hypothesize that sulfide, a natural reducer of oxygen that is made in many cell types, acts as a buffer to prevent unrestricted oxygen consumption. To test this, we administered sulfide in the form of hydrogen sulfide (H2S) to mice (Mus musculus). As we have previously shown, H2S decreases the metabolic rate of mice by approximately 90% and induces a suspended animation-like state. Mice cannot survive for longer than 20 min when exposed to 5% oxygen. However, if mice are first put into a suspended animation-like state by a 20-min pretreatment with H2S and then are exposed to low oxygen, they can survive for more than 6.5 h in 5% oxygen with no apparent detrimental effects. In addition, if mice are exposed to a 20-min pretreatment with H2S followed by 1 h at 5% oxygen, they can then survive for several hours at oxygen tensions as low as 3%. We hypothesize that prior exposure to H2S reduces oxygen demand, therefore making it possible for the mice to survive with low oxygen supply. These results suggest that H2S may be useful to prevent damage associated with hypoxia.

  13. Mx1 gene protects mice against the highly lethal human H5N1 influenza virus. (United States)

    Salomon, Rachelle; Staeheli, Peter; Kochs, Georg; Yen, Hui-Ling; Franks, John; Rehg, Jerold E; Webster, Robert G; Hoffmann, Erich


    We investigated the importance of the host Mx1 gene in protection against highly pathogenic H5N1 avian influenza virus. Mice expressing the Mx1 gene survived infection with the lethal human H5N1 isolate A/Vietnam/1203/04 and with reassortants combining its genes with those of the non-lethal virus A/chicken/Vietnam/C58/04, while all Mx1-/- mice succumbed. Mx1-expressing mice showed lower organ virus titers, fewer lesions, and less pulmonary inflammation. Our data support the hypothesis that Mx1 expression protects mice against the high pathogenicity of H5N1 virus through inhibition of viral polymerase activity ultimately resulting in reduced viral growth and spread. Drugs that mimic this mechanism may be protective in humans.

  14. Oestrogen alters adipocyte biology and protects female mice from adipocyte inflammation and insulin resistance. (United States)

    Stubbins, R E; Najjar, K; Holcomb, V B; Hong, J; Núñez, N P


    Obesity is associated with insulin resistance, liver steatosis and low-grade inflammation. The role of oestrogen in sex differences in the above co-morbidities is not fully understood. Our aim was to assess the role oestrogen has in modulating adipocyte size, adipose tissue oxidative stress, inflammation, insulin resistance and liver steatosis. To determine the role oestrogen has in the above co-morbidities related to obesity, we randomized C57BL/6J mice into four groups (15 mice per group): (i) male, (ii) non-ovariectomized female (novx), (iii) ovariectomized female (ovx) and (iv) ovariectomized female mice supplemented with 17β estradiol (ovx-E). Mice received either a low-fat (LF) or a high-fat (HF) diet for 10 weeks. Outcomes measured were bodyweight, body fat, adipocyte diameter, adipose tissue lipolysis markers, adipose tissue oxidative stress, inflammation, insulin resistance and liver steatosis. Male and ovx-female mice consuming the HF diet had a higher propensity of gaining weight, specifically in the form of body fat. Oestrogen protected female mice from adipocyte hypertrophy and from developing adipose tissue oxidative stress and inflammation. Moreover, novx-female and ovx-female+E mice had higher phosphorylated levels of protein kinase A and hormone sensitive lipase, markers associated with lipolysis. Additionally, male and ovx female mice had a higher propensity of developing liver steatosis and insulin resistance. In contrast, oestrogen protected female mice from developing liver steatosis and from becoming insulin resistant. We show that oestrogen protects female mice from adipocyte hypertrophy and adipose tissue oxidative stress and inflammation. Furthermore, oestrogen prevented female mice from developing liver steatosis and from becoming insulin resistant. © 2011 Blackwell Publishing Ltd.

  15. Immunization with Streptococcal Heme Binding Protein (Shp) Protects Mice Against Group A Streptococcus Infection. (United States)

    Zhang, Xiaolan; Song, Yingli; Li, Yuanmeng; Cai, Minghui; Meng, Yuan; Zhu, Hui


    Streptococcal heme binding protein (Shp) is a surface protein of the heme acquisition system that is an essential iron nutrient in Group A Streptococcus (GAS). Here, we tested whether Shp immunization protects mice from subcutaneous infection. Mice were immunized subcutaneously with recombinant Shp and then challenged with GAS. The protective effects against GAS challenge were evaluated two weeks after the last immunization. Immunization with Shp elicited a robust IgG response, resulting in high anti-Shp IgG titers in the serum. Immunized mice had a higher survival rate and smaller skin lesions than adjuvant control mice. Furthermore, immunized mice had lower GAS numbers at the skin lesions and in the liver, spleen and lung. Histological analysis with Gram staining showed that GAS invaded the surrounding area of the inoculation sites in the skin in control mice, but not in immunized mice. Thus, Shp immunization enhances GAS clearance and reduces GAS skin invasion and systemic dissemination. These findings indicate that Shp is a protective antigen.

  16. Inhibition of histone deacetylation protects wildtype but not gelsolin-deficient mice from ischemic brain injury. (United States)

    Yildirim, Ferah; Gertz, Karen; Kronenberg, Golo; Harms, Christoph; Fink, Klaus B; Meisel, Andreas; Endres, Matthias


    Acetylation/deactylation of histones is an important mechanism to regulate gene expression and chromatin remodeling. We have previously demonstrated that the HDAC inhibitor trichostatin A (TSA) protects cortical neurons from oxygen/glucose deprivation in vitro which is mediated--at least in part--via the up regulation of gelsolin expression. Here, we demonstrate that TSA treatment dose-dependently enhances histone acetylation in brains of wildtype mice as evidenced by immunoblots of total brain lysates and immunocytochemical staining. Along with increased histone acetylation dose-dependent up regulation of gelsolin protein was observed. Levels of filamentous actin were largely decreased by TSA pre-treatment in brain of wildtype but not gelsolin-deficient mice. When exposed to 1 h filamentous occlusion of the middle cerebral artery followed by reperfusion TSA pre-treated wildtype mice developed significantly smaller cerebral lesion volumes and tended to have improved neurological deficit scores compared to vehicle-treated mice. These protective effects could not be explained by apparent changes in physiological parameters. In contrast to wildtype mice, TSA pre-treatment did not protect gelsolin-deficient mice against MCAo/reperfusion suggesting that enhanced gelsolin expression is an important mechanism by which TSA protects against ischemic brain injury. Our results suggest that HDAC inhibitors such as TSA are a promising therapeutic strategy for reducing brain injury following cerebral ischemia.

  17. Swim training does not protect mice from skeletal muscle oxidative damage following a maximum exercise test. (United States)

    Barreto, Tatiane Oliveira; Cleto, Lorena Sabino; Gioda, Carolina Rosa; Silva, Renata Sabino; Campi-Azevedo, Ana Carolina; de Sousa-Franco, Junia; de Magalhães, José Carlos; Penaforte, Claudia Lopes; Pinto, Kelerson Mauro de Castro; Cruz, Jader dos Santos; Rocha-Vieira, Etel


    We investigated whether swim training protects skeletal muscle from oxidative damage in response to a maximum progressive exercise. First, we investigated the effect of swim training on the activities of the antioxidant enzymes, superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPx), in the gastrocnemius muscle of C57Bl/6 mice, 48 h after the last training session. Mice swam for 90 min, twice a day, for 5 weeks at 31°C (± 1°C). The activities of SOD and CAT were increased in trained mice (P swim test. Compared to control mice (untrained, not acutely exercised), malondialdehyde (MDA) levels were increased in the skeletal muscle of both trained and untrained mice after maximum swim. The activity of GPx was increased in the skeletal muscle of both trained and untrained mice, while SOD activity was increased only in trained mice after maximum swimming. CAT activity was increased only in the untrained compared to the control group. Although the trained mice showed increased activity of citrate synthase in skeletal muscle, swim performance was not different compared to untrained mice. Our results show an imbalance in the activities of SOD, CAT and GPx in response to swim training, which could account for the oxidative damage observed in the skeletal muscle of trained mice in response to maximum swim, resulting in the absence of improved exercise performance.

  18. Tetrahydroxystilbene glucoside protects against ethanol-induced liver injury in mice by inhibition of expression of inflammatuion-related factors

    Institute of Scientific and Technical Information of China (English)



    Objective To investigate the protective effects of tetrahydroxystilbene glucoside(TSG)against acute ethanol-induced liver injury in mice and to explore the possible mechanisms involved.Methods Kunming mice were

  19. Treatment with Isorhamnetin Protects the Brain Against Ischemic Injury in Mice. (United States)

    Zhao, Jin-Jing; Song, Jin-Qing; Pan, Shu-Yi; Wang, Kai


    Ischemic stroke is a major cause of morbidity and mortality, yet lacks effective neuroprotective treatments. The aim of this work was to investigate whether treatment with isorhamnetin protected the brain against ischemic injury in mice. Experimental stroke mice underwent the filament model of middle cerebral artery occlusion with reperfusion. Treatment with isorhamnetin or vehicle was initiated immediately at the onset of reperfusion. It was found that treatment of experimental stroke mice with isorhamnetin reduced infarct volume and caspase-3 activity (a biomarker of apoptosis), and improved neurological function recovery. Treatment of experimental stroke mice with isorhamnetin attenuated cerebral edema, improved blood-brain barrier function, and upregulated gene expression of tight junction proteins including occludin, ZO-1, and claudin-5. Treatment of experimental stroke mice with isorhamnetin activated Nrf2/HO-1, suppressed iNOS/NO, and led to reduced formation of MDA and 3-NT in ipsilateral cortex. In addition, treatment of experimental stroke mice with isorhamnetin suppressed activity of MPO (a biomarker of neutrophil infiltration) and reduced protein levels of IL-1β, IL-6, and TNF-α in ipsilateral cortex. Furthermore, it was found that treatment of experimental stroke mice with isorhamnetin reduced mRNA and protein expression of NMDA receptor subunit NR1 in ipsilateral cortex. In conclusion, treatment with isorhamnetin protected the brain against ischemic injury in mice. Isorhamnetin could thus be envisaged as a countermeasure for ischemic stroke but remains to be tested in humans.

  20. Sulindac induces apoptosis and protects against colon carcinoma in mice

    Institute of Scientific and Technical Information of China (English)

    Bao-Cun Sun; Xiu-Lan Zhao; Shi-Wu Zhang; Yi-Xin Liu; Lan Wang; Xin Wang


    AIM: To study the effect of sulindac on colon cancer induction in mice.METHODS: The chemo-preventive action of 80 ppm sulindac fed during initiation and post-initiation and 100 ppm sulindac fed during progressive stages of induction of colon carcinogenesis in mice was investigated using 1,2-dimethylhydrazine (DMH). Using the terminal deoxynucleotidyltransferase-mediated dUTP nick-end labeling (TUNEL)technique and PCNA immunohistochemical staining, we observed the apoptotic and proliferative cell density changes at different carcinogenic stages and the effect of sulindac on these two phenomena.RESULTS: Dietary sulindac significantly inhibited the incidence of colonic neoplasmas in mice. Compared with the control group, feeding sulindac during initiation and post-initiation stages inhibited the incidence by 46.7-50.4%,and feeding sulindac during progressive stages inhibited the incidence by 41.1%. Animals that were fed sulindac showed less serious pathological changes than those that were fed the control diet (P<0.01, H= 33.35). There was no difference in the density of proliferating cells among those groups which were or were not fed sulindac. In the same period, feeding sulindac resulted in a higher density of apoptotic cells than feeding control diet. CONCLUSION: Sulindac has an anti-carcinogenic function in mice. Its effect on preventing colon carcinogenesis is better than its effect on treating established tumors. By inducing apoptosis, sulindac inhibited the development of colon cancer and delayed canceration. Sulindac has no effect on proliferation. The anti-carcinogenic properties of sulindac are most effective in the moderate and severe stages of dysplasia and canceration.

  1. Enzymatic amplification of synthetic oligodeoxyribonucleotides: implications for triplet repeat expansions in the human genome. (United States)

    Behn-Krappa, A; Doerfler, W


    The triplet repeat sequences (CGG)n, (GCT)n, and (CAG)n, which naturally occur in the human genome, can be autonomously expanded in human DNA by an as yet unknown mechanism. These in part excessive expansions have been causally related to human genetic diseases, the fragile X (Martin-Bell) syndrome, to myotonic dystrophy (Curschmann-Steinert), to spinal and bulbar muscular atrophy (Kennedy disease), and recently to Huntington disease. A GCC trinucleotide repeat was found to be expanded and methylated in the fragile site FRAXE on the human X chromosome. These findings were associated with mental retardation (Knight et al., 1993). In spinocerebellar ataxia type 1 (SCA1), a polymorphic CAG repeat was found to be unstable and expanded in individuals with that disease (Orr et al., 1993). We have demonstrated in in vitro experiments that the synthetic oligodeoxyribonucleotides (CGG)17, (CGG)12, (GCC)17, (CG)25, (CTG)17, or (CAG)17 plus (GTC)17, in the absence of added natural DNA, can be expanded with Taq polymerase in the polymerase chain reaction (PCR). Some expansion can already be detected after 4 PCR cycles. The E. coli Klenow DNA polymerase also functions in a similar amplification and expansion reaction performed at 37 degrees C without cycling. Other oligodeoxyribonucleotides, like, (CGG)7, (CGGT)13, or (TAA)17, are devoid of this property or have very low activity. The cytidine-methylated polymers (GCC)17 or (CG)25 yield expansion products of considerably reduced chain lengths. The expansion of the polymer (CGG)17 is affected by cytidine methylation to a lesser degree. A specific sequence and/or secondary structure and high CG content appear to be requirements for this expansion reaction by a possible slippage mechanism.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. Over-Expression of CD200 Protects Mice from Dextran Sodium Sulfate Induced Colitis (United States)

    Chen, Zhiqi; Yu, Kai; Zhu, Fang; Gorczynski, Reginald


    Background and aim CD200:CD200 receptor (CD200R) interactions lead to potent immunosuppression and inhibition of autoimmune inflammation. We investigated the effect of "knockout"of CD200 or CD200R, or over-expression of CD200, on susceptibility to dextran sodium sulfate (DSS)—induced colitis, a mouse model of inflammatory bowel disease (IBD). Methods Acute or chronic colitis was induced by administration of dextran sodium sulfate (DSS) in four groups of age-matched C57BL/6 female mice: (1) CD200-transgenic mice (CD200tg); (2) wild-type (WT) mice; (3) CD200 receptor 1-deficient (CD200R1KO) mice; and (4) CD200-deficient (CD200KO) mice. The extent of colitis was determined using a histological scoring system. Colon tissues were collected for quantitative RT-PCR and Immunohistochemical staining. Supernatants from colonic explant cultures and mononuclear cells isolated from colonic tissue were used for ELISA. Results CD200KO and CD200R1KO mice showed greater sensitivity to acute colitis than WT mice, with accelerated loss of body weight, significantly higher histological scores, more severe infiltration of macrophages, neutrophils and CD3+ cells, and greater expression of macrophage-derived inflammatory cytokines, whose production was inhibited in vitro (in WT/CD200KO mouse cells) by CD200. In contrast, CD200tg mice showed less sensitivity to DSS compared with WT mice, with attenuation of all of the features seen in other groups. In a chronic colitis model, greater infiltration of Foxp3+ regulatory T (Treg) cells was seen in the colon of CD200tg mice compared to WT mice, and anti-CD25 mAb given to these mice attenuated protection. Conclusions The CD200:CD200R axis plays an immunoregulatory role in control of DSS induced colitis in mice. PMID:26841120

  3. Rhein lysinate increases the median survival time of SAMP10 mice: protective role in the kidney

    Institute of Scientific and Technical Information of China (English)

    Gang HU; Jiang LIU; Yong-zhan ZHEN; Rong XU; Yu QIAO; Jie WEI; Ping TU


    Aim:To investigate the protective effects of rhein lysinate (RHL),a major bioactive constituent of the rhizome of rhubarb (Rheum palmatum Linn or Rheum tanguticum Maxim),against kidney impairment in senescence-prone inbred strain 10 (SAMP10) mice.Methods:SAMP10 mice were orally administered RHL (25 or 50 mg/kg) daily until 50% of the mice died.Senescence-resistant inbred strain 1 (SAMR1) mice administered no drug were taken as control.The kidneys were harvested after animal death,and examined morphologically and with immunochemical assays.The levels of MAD,SOD and GSH-px in the kidneys were measured with a photometric method.The expression of inflammatory factors and related proteins in the kidneys was analyzed using Western blotting.Results:Treatment of SAMP10 mice with RHL had no effect on the body weight or phenotype.However,RHL significantly prolonged the median survival time of SAMP10 mice by approximately 25%,as compared to untreated SAMP10 mice.Compared SAMR1 mice,SAMP10 mice had a significantly lower level of SOD in the kidneys,but had no significant difference in the MDA or GSH-px levels.Treatment of SAMP10 mice with RHL significantly reduced the MAD level,and increased the SOD and GSH-px levels in the kidneys.Glomerulonephritis was observed in SAMP10 mice but not in SAMR1 mice.RHL decreased the incidence of glomerulonephritis,and significantly decreased the levels of TNF-α,IL-6,NF-κB,collagen types Ⅰ and Ⅲ in the kidneys.Conclusion:Accelerated senescence is associated with glomerulonephritis in SAMP10 mice,and RHL prolongs their median survival time by red ucing the severity of glomeruloneph ritis.

  4. CETP Expression Protects Female Mice from Obesity-Induced Decline in Exercise Capacity.

    Directory of Open Access Journals (Sweden)

    David A Cappel

    Full Text Available Pharmacological approaches to reduce obesity have not resulted in dramatic reductions in the risk of coronary heart disease (CHD. Exercise, in contrast, reduces CHD risk even in the setting of obesity. Cholesteryl Ester Transfer Protein (CETP is a lipid transfer protein that shuttles lipids between serum lipoproteins and tissues. There are sexual-dimorphisms in the effects of CETP in humans. Mice naturally lack CETP, but we previously reported that transgenic expression of CETP increases muscle glycolysis in fasting and protects against insulin resistance with high-fat diet (HFD feeding in female but not male mice. Since glycolysis provides an important energy source for working muscle, we aimed to define if CETP expression protects against the decline in exercise capacity associated with obesity. We measured exercise capacity in female mice that were fed a chow diet and then switched to a HFD. There was no difference in exercise capacity between lean, chow-fed CETP female mice and their non-transgenic littermates. Female CETP transgenic mice were relatively protected against the decline in exercise capacity caused by obesity compared to WT. Despite gaining similar fat mass after 6 weeks of HFD-feeding, female CETP mice showed a nearly two-fold increase in run distance compared to WT. After an additional 6 weeks of HFD-feeding, mice were subjected to a final exercise bout and muscle mitochondria were isolated. We found that improved exercise capacity in CETP mice corresponded with increased muscle mitochondrial oxidative capacity, and increased expression of peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α. These results suggest that CETP can protect against the obesity-induced impairment in exercise capacity and may be a target to improve exercise capacity in the context of obesity.

  5. CETP Expression Protects Female Mice from Obesity-Induced Decline in Exercise Capacity. (United States)

    Cappel, David A; Lantier, Louise; Palmisano, Brian T; Wasserman, David H; Stafford, John M


    Pharmacological approaches to reduce obesity have not resulted in dramatic reductions in the risk of coronary heart disease (CHD). Exercise, in contrast, reduces CHD risk even in the setting of obesity. Cholesteryl Ester Transfer Protein (CETP) is a lipid transfer protein that shuttles lipids between serum lipoproteins and tissues. There are sexual-dimorphisms in the effects of CETP in humans. Mice naturally lack CETP, but we previously reported that transgenic expression of CETP increases muscle glycolysis in fasting and protects against insulin resistance with high-fat diet (HFD) feeding in female but not male mice. Since glycolysis provides an important energy source for working muscle, we aimed to define if CETP expression protects against the decline in exercise capacity associated with obesity. We measured exercise capacity in female mice that were fed a chow diet and then switched to a HFD. There was no difference in exercise capacity between lean, chow-fed CETP female mice and their non-transgenic littermates. Female CETP transgenic mice were relatively protected against the decline in exercise capacity caused by obesity compared to WT. Despite gaining similar fat mass after 6 weeks of HFD-feeding, female CETP mice showed a nearly two-fold increase in run distance compared to WT. After an additional 6 weeks of HFD-feeding, mice were subjected to a final exercise bout and muscle mitochondria were isolated. We found that improved exercise capacity in CETP mice corresponded with increased muscle mitochondrial oxidative capacity, and increased expression of peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α). These results suggest that CETP can protect against the obesity-induced impairment in exercise capacity and may be a target to improve exercise capacity in the context of obesity.

  6. Protection against Influenza Virus Infection of Mice Fed Bifidobacterium breve YIT4064



    Mice fed Bifidobacterium breve YIT4064 and immunized orally with influenza virus were more strongly protected against influenza virus infection of the lower respiratory tract than ones immunized with influenza virus only. The number of mice with enhanced anti-influenza virus immunoglobulin G (IgG) in serum upon oral administration of B. breve YIT4064 and oral immunization with influenza virus was significantly greater than that upon oral immunization with influenza...

  7. A conditionally lethal mutant of Salmonella Typhimurium induces a protective response in mice. (United States)

    Hidalgo, Alejandro A; Villagra, Nicolás A; Jerez, Sebastián A; Fuentes, Juan A; Mora, Guido C


    Here we present the design of a conditionally lethal mutant of Salmonella enterica serovar Typhimurium (S. Typhimurium) which growth depends on tetracycline (Tet). Four mutants of S. Typhimurium, with Tet-conditional growth, were created by inserting the tetRA cassette. Three of the mutants presented a conditional-lethal phenotype in vitro. One mutant in the yabB gene remained conditional inside cells and did not persisted after 24 h in cell cultures. The capacity of S. Typhimurium yabB::tetRA to invade deep organs was investigated in intraperitoneally (IP) infected mice fed with or without chlortetracycline (CTet), a Tet analog with lower antibiotic activity. The yabB::tetRA mutant was undetectable in liver or spleen of animals under normal diet, while in mice under diet including CTet, yabB::tetRA invaded at a level comparable to the WT in mice under normal diet. Moreover, yabB::tetRA produced a strong humoral-immunoresponse after one IP immunization with 10(6) bacteria, measured as serum reactivity against S. Typhimurium whole cell extract. By contrast, oral immunization with 10(6) bacteria was weaker and variable on inducing antibodies. Consistently, IP infected mice were fully protected in a challenge with 10(4) oral S. Typhimurium, while protection was partial in orally immunized mice. Our data indicate that S. Typhimurium yabB::tetRA is a conditionally attenuated strain capable of inducing a protective response in mice in non-permissive conditions.

  8. Protective effects of phyllanthus emblica leaf extract on sodium arsenite-mediated adverse effects in mice. (United States)

    Sayed, Sadia; Ahsan, Nazmul; Kato, Masashi; Ohgami, Nobutaka; Rashid, Abdur; Akhand, Anwarul Azim


    Groundwater contamination of arsenic is the major cause of a serious health hazard in Bangladesh. No specific treatment is yet available to manage the large number of individuals exposed to arsenic. In this study, we evaluated the protective effects of Phyllanthus emblica (Indian gooseberry or Amla) leaf extract (PLE) on arsenic-mediated toxicity in experimental mice. Male Swiss albino mice were divided into three different groups (n=6/group). 'Control' mice received arsenic free water together with normal feed. Mice in the remaining two groups designated 'SA' and 'SA+PLE' were exposed to sodium arsenite (SA, 10 µg/g body weight/day) through drinking water in addition to receiving normal feed and PLE-supplemented feed, respectively. The weight gain of SA-exposed mice was decreased compared with the controls; however, this decrease in body weight gain was prevented when the feed was supplemented with PLE. A secondary effect of arsenic was enlargement of the liver, kidney and spleen of SA-group mice. Deposition of arsenic in those organs was demonstrated by ICP-MS. When PLE was supplemented in the feed the enlargement of the organs was minimized; however, the deposition of arsenic was not significantly reduced. These results indicated that PLE may not block arsenic deposition in tissue directly but rather may play a protective role to reduce arsenic-induced toxicity. Therefore, co-administration of PLE in arsenic-exposed animals might have a future therapeutic application for protecting against arsenic-mediated toxicity.

  9. Total Flavonoids from Mimosa Pudica Protects Carbon Tetrachloride -Induced Acute Liver Injury in Mice

    Directory of Open Access Journals (Sweden)

    Zhen-qin QIU


    Full Text Available Objective: To observe the protective effect of total flavonoids from Mimosa pudica on carbon tetrachloride (CCl4-induced acute liver injury in mice. Methods: CCl4-induced acute liver injury model in mice was established. The activity of ALT and AST, the content of serum albumin (Alb and total antioxidant capacity (T-AOC were determined. The content of malondiadehyde (MDA was measured and the activity of superoxide dismutase (SOD was determined. The histopathological changes of liver were observed.Results: Compared with CCl4 modle group, each dose group of total flavonouida from Mimosa pudica couldreduced the activity of ALT and AST in mice obviously (P<0.01, indicating they had remarkably protective effect on CCl4-induced acute liver injury in mice. high and middle dose groups of total flavonouida from Mimosa pudica couldincrease the content of Alb in mice (P<0.01. Each dose group of total flavonouida from Mimosa pudica could enhance the level of T-AOC (P<0.01. each dose group of total flavonouida from Mimosa pudica could lower the content of liver homogenate MDA but enhance the activity of SOD in a dose-depended manner (P<0.01. Conclusion: Total flavones from Mimosa Pudica have obvious protective effect on CCl4-induced acute liver injury in mice.

  10. The androgen receptor confers protection against diet-induced atherosclerosis, obesity, and dyslipidemia in female mice. (United States)

    Fagman, Johan B; Wilhelmson, Anna S; Motta, Benedetta M; Pirazzi, Carlo; Alexanderson, Camilla; De Gendt, Karel; Verhoeven, Guido; Holmäng, Agneta; Anesten, Fredrik; Jansson, John-Olov; Levin, Malin; Borén, Jan; Ohlsson, Claes; Krettek, Alexandra; Romeo, Stefano; Tivesten, Åsa


    Androgens have important cardiometabolic actions in males, but their metabolic role in females is unclear. To determine the physiologic androgen receptor (AR)-dependent actions of androgens on atherogenesis in female mice, we generated female AR-knockout (ARKO) mice on an atherosclerosis-prone apolipoprotein E (apoE)-deficient background. After 8 weeks on a high-fat diet, but not on a normal chow diet, atherosclerosis in aorta was increased in ARKO females (+59% vs. control apoE-deficient mice with intact AR gene). They also displayed increased body weight (+18%), body fat percentage (+62%), and hepatic triglyceride levels, reduced insulin sensitivity, and a marked atherogenic dyslipidemia (serum cholesterol, +52%). Differences in atherosclerosis, body weight, and lipid levels between ARKO and control mice were abolished in mice that were ovariectomized before puberty, consistent with a protective action of ovarian androgens mediated via the AR. Furthermore, the AR agonist dihydrotestosterone reduced atherosclerosis (-41%; thoracic aorta), subcutaneous fat mass (-44%), and cholesterol levels (-35%) in ovariectomized mice, reduced hepatocyte lipid accumulation in hepatoma cells in vitro, and regulated mRNA expression of hepatic genes pivotal for lipid homeostasis. In conclusion, we demonstrate that the AR protects against diet-induced atherosclerosis in female mice and propose that this is mediated by modulation of body composition and lipid metabolism. © FASEB.

  11. Glucagon receptor knockout mice are protected against acute olanzapine-induced hyperglycemia. (United States)

    Castellani, Laura N; Peppler, Willem T; Sutton, Charles D; Whitfield, Jamie; Charron, Maureen J; Wright, David C


    To determine if glucagon is involved in mediating the increase in blood glucose levels caused by the second-generation antipsychotic drug olanzapine. Whole body glucagon receptor deficient mice (Gcgr(-/-)) or WT littermate controls were injected with olanzapine (5mg/kg BW IP) and changes in blood glucose measured over the following 120min. Separate cohorts of mice were treated with olanzapine and changes in pyruvate tolerance, insulin tolerance and whole body substrate oxidation were determined. Olanzapine treatment increased serum glucagon and lead to rapid increases in blood glucose concentrations in WT mice. Gcgr(-/-) mice were protected against olanzapine-induced increases in blood glucose but this was not explained by differences in terminal serum insulin concentrations, enhanced AKT phosphorylation in skeletal muscle, adipose tissue or liver or differences in RER. In both genotypes olanzapine induced an equivalent degree of insulin resistance as measured using an insulin tolerance test. Olanzapine treatment led to an exaggerated glucose response to a pyruvate challenge in WT but not Gcgr(-/-) mice and this was paralleled by reductions in the protein content of PEPCK and G6Pase in livers from Gcgr(-/-) mice. Gcgr(-/-) mice are protected against olanzapine-induced increases in blood glucose. This is likely a result of reductions in liver glucose output, perhaps secondary to decreases in PEPCK and G6Pase protein content. Our findings highlight the central role of the liver in mediating olanzapine-induced disturbances in glucose homeostasis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Protective vascular and cardiac effects of inducible nitric oxide synthase in mice with hyperhomocysteinemia.

    Directory of Open Access Journals (Sweden)

    Sanjana Dayal

    Full Text Available Diet-induced hyperhomocysteinemia produces endothelial and cardiac dysfunction and promotes thrombosis through a mechanism proposed to involve oxidative stress. Inducible nitric oxide synthase (iNOS is upregulated in hyperhomocysteinemia and can generate superoxide. We therefore tested the hypothesis that iNOS mediates the adverse oxidative, vascular, thrombotic, and cardiac effects of hyperhomocysteinemia. Mice deficient in iNOS (Nos2-/- and their wild-type (Nos2+/+ littermates were fed a high methionine/low folate (HM/LF diet to induce mild hyperhomocysteinemia, with a 2-fold increase in plasma total homocysteine (P<0.001 vs. control diet. Hyperhomocysteinemic Nos2+/+ mice exhibited endothelial dysfunction in cerebral arterioles, with impaired dilatation to acetylcholine but not nitroprusside, and enhanced susceptibility to carotid artery thrombosis, with shortened times to occlusion following photochemical injury (P<0.05 vs. control diet. Nos2-/- mice had decreased rather than increased dilatation responses to acetylcholine (P<0.05 vs. Nos2+/+ mice. Nos2-/- mice fed control diet also exhibited shortened times to thrombotic occlusion (P<0.05 vs. Nos2+/+ mice, and iNOS deficiency failed to protect from endothelial dysfunction or accelerated thrombosis in mice with hyperhomocysteinemia. Deficiency of iNOS did not alter myocardial infarct size in mice fed the control diet but significantly increased infarct size and cardiac superoxide production in mice fed the HM/LF diet (P<0.05 vs. Nos2+/+ mice. These findings suggest that endogenous iNOS protects from, rather than exacerbates, endothelial dysfunction, thrombosis, and hyperhomocysteinemia-associated myocardial ischemia-reperfusion injury. In the setting of mild hyperhomocysteinemia, iNOS functions to blunt cardiac oxidative stress rather than functioning as a source of superoxide.

  13. Antioxidant properties of lutein contribute to the protection against lipopolysaccharide-induced uveitis in mice


    Yao Xin-Sheng; Yao Nan; Lan Fang; Tsoi Bun; He Rong-Rong; Kurihara Hiroshi


    Abstract Background Lutein is an important eye-protective nutrient. This study investigates the protective effects and mechanisms of lutein on lipopolysaccharides (LPS)-induced uveitis in mice. Methods Lutein, suspended in drinking water at a final concentration of 12.5 and 25 mg/mL, was administered to mice at 0.1 mL/10 g body weight for five consecutive days. Control and model group received drinking water only. Uveitis was induced by injecting LPS (100 mg per mouse) into the footpad in the...

  14. Antioxidant properties of lutein contribute to the protection against lipopolysaccharide-induced uveitis in mice


    He, Rong-rong; Tsoi, Bun; Lan, Fang; Yao, Nan; Yao, Xin-Sheng; Kurihara, Hiroshi


    Background Lutein is an important eye-protective nutrient. This study investigates the protective effects and mechanisms of lutein on lipopolysaccharides (LPS)-induced uveitis in mice. Methods Lutein, suspended in drinking water at a final concentration of 12.5 and 25 mg/mL, was administered to mice at 0.1 mL/10 g body weight for five consecutive days. Control and model group received drinking water only. Uveitis was induced by injecting LPS (100 mg per mouse) into the footpad in the model an...

  15. Moxibustion Activates Macrophage Autophagy and Protects Experimental Mice against Bacterial Infection

    Directory of Open Access Journals (Sweden)

    Xiaojuan Li


    Full Text Available Moxibustion is one of main therapies in traditional Chinese medicine and uses heat stimulation on the body surface from the burning of moxa to release pain or treat diseases. Emerging studies have shown that moxibustion can generate therapeutic effects by activating a series of signaling pathways and neuroendocrine-immune activities. Here we show moxibustion promoted profound macrophage autophagy in experimental Kunming mice, with reduced Akt phosphorylation and activated eIF2α phosphorylation. Consequently, moxibustion promoted bacterial clearance by macrophages and protected mice from mortality due to bacterial infection. These results indicate that moxibustion generates a protective response by activating autophagy against bacterial infections.

  16. Genetic activation of Nrf2 protects against fasting-induced oxidative stress in livers of mice.

    Directory of Open Access Journals (Sweden)

    Yu-Kun Jennifer Zhang

    Full Text Available Acute fasting causes elevated oxidative stress. The current study investigated the effects of the nuclear factor erythoid 2-related factor 2 (Nrf2, the sensor of oxidative stress in cells, on energy homeostasis and liver pathophysiology during fasting. Feed was removed from mice possessing none (Nrf2-null, normal (wild-type, WT, enhanced (Keap1-knockdown, K1-KD, and maximum (hepatocyte-specific Keap1-knockout, K1-HKO Nrf2 activity in liver for 24 h. Body weight, blood glucose, and blood lipid profiles were similar among mice with graded Nrf2 activity under either fed or fasted conditions. Fasting reduced liver size in mice expressing Nrf2, but not in Nrf2-null mice. Nrf2-null mice accumulated more non-esterified free fatty acids and triglycerides in liver after fasting than the other genotypes of mice. Fatty acids are mainly catabolized in mitochondria, and Nrf2-null mice had lower mitochondrial content in liver under control feeding conditions, which was further reduced by fasting. In contrast, mitochondrial contents in mice with enhanced Nrf2 activity were not affected by fasting. Oxidative stress, determined by staining of free radicals and quantification of malondialdehyde equivalents, was highest in Nrf2-null and lowest in K1-HKO mice after fasting. The exacerbated oxidative stress in livers of Nrf2-null mice is predicted to lead to damages to mitochondria, and therefore diminished oxidation and increased accumulation of lipids in livers of Nrf2-null mice. In summary, the Nrf2-regulated signaling pathway is critical in protecting mitochondria from oxidative stress during feed deprivation, which ensures efficient utilization of fatty acids in livers of mice.

  17. Protective effects of fluoxetine on decompression sickness in mice.

    Directory of Open Access Journals (Sweden)

    Jean-Eric Blatteau

    Full Text Available Massive bubble formation after diving can lead to decompression sickness (DCS that can result in central nervous system disorders or even death. Bubbles alter the vascular endothelium and activate blood cells and inflammatory pathways, leading to a systemic pathophysiological process that promotes ischemic damage. Fluoxetine, a well-known antidepressant, is recognized as having anti-inflammatory properties at the systemic level, as well as in the setting of cerebral ischemia. We report a beneficial clinical effect associated with fluoxetine in experimental DCS. 91 mice were subjected to a simulated dive at 90 msw for 45 min before rapid decompression. The experimental group received 50 mg/kg of fluoxetine 18 hours before hyperbaric exposure (n = 46 while controls were not treated (n = 45. Clinical assessment took place over a period of 30 min after surfacing. At the end, blood samples were collected for blood cells counts and cytokine IL-6 detection. There were significantly fewer manifestations of DCS in the fluoxetine group than in the controls (43.5% versus 75.5%, respectively; p = 0.004. Survivors showed a better and significant neurological recovery with fluoxetine. Platelets and red cells were significantly decreased after decompression in controls but not in the treated mice. Fluoxetine reduced circulating IL-6, a relevant marker of systemic inflammation in DCS. We concluded that fluoxetine decreased the incidence of DCS and improved motor recovery, by limiting inflammation processes.

  18. Sera from patients with chronic Lyme disease protect mice from Lyme borreliosis. (United States)

    Fikrig, E; Bockenstedt, L K; Barthold, S W; Chen, M; Tao, H; Ali-Salaam, P; Telford, S R; Flavell, R A


    Sera from selected patients with Lyme disease in different stages were used to passively immunize mice against Borrelia burgdorferi challenge to determine if human antibodies could protect the animals from infection. Sera from 2 patients with late-stage Lyme disease that contained strong antibody reactivity to proteins in B. burgdorferi lysates, including antibodies to the outer surface proteins (Osps) A and B, partly protected mice from infection after challenge with a small inoculum (10(2)) of B. burgdorferi. Mice immunized with sera from either of these 2 patients developed significantly fewer infections from the borreliae (patient 1 serum, 5%; patient 2 serum, 25%) relative to control mice (patient 1 serum, 90%; patient 2 serum, 74%). In contrast, sera from 2 patients with early or late Lyme disease that lacked antibodies reactive to OspA and OspB did not confer protection. Immunity appeared to be related, at least in part, to the presence of a strong humoral response to the Osps. These results suggest that during prolonged infection, some patients develop an immune response that may be partly protective against reinfection with B. burgdorferi. Therefore, although most patients do not mount a strong humoral response to the Osps during natural infection, vaccination with an Osp may elicit protective immunity.

  19. Protective effect of berberine on serum glucose levels in non-obese diabetic mice. (United States)

    Chueh, Wei-Han; Lin, Jin-Yuarn


    Among the active components in traditional anti-diabetic herbal plants, berberine which is an isoquinoline alkaloid exhibits promising potential for its potent anti-inflammatory and hypoglycemic effects. However, the berberine effect on serum glucose levels in type 1 diabetes (T1D) subjects still remains unknown. This study investigated berberine's effects on serum glucose levels using non-obese diabetic (NOD) mice that spontaneously develop T1D. The NOD mice were randomly divided into four groups, administered water with 50, 150, and 500 mg berberine/kg bw, respectively, through 14 weeks. ICR mice were also selected as a species control group to compare with the NOD mice. Changes in body weight, oral glucose challenge, and serum glucose levels were determined to identify the protective effect of berberine on T1D. After the 14-week oral supplementation, berberine decreased fasting serum glucose levels in NOD mice close to the levels in normal ICR mice in a dose dependent manner. Serum berberine levels showed a significantly (Pberberine-administered NOD mice. Our results suggested that berberine supplemented at appropriate doses for 14 weeks did not cause toxic side effects, but improved hyperglycemia in NOD mice.

  20. Exercise does not protect against MPTP-induced neurotoxicity in BDNF haploinsufficient mice.

    Directory of Open Access Journals (Sweden)

    Kim M Gerecke

    Full Text Available Exercise has been demonstrated to potently protect substantia nigra pars compacta (SN dopaminergic neurons from 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP-induced neurotoxicity. One mechanism proposed to account for this neuroprotection is the upregulation of neurotrophic factors. Several neurotrophic factors, including Brain Derived Neurotrophic Factor (BDNF, have been shown to upregulate in response to exercise. In order to determine if exercise-induced neuroprotection is dependent upon BDNF, we compared the neuroprotective effects of voluntary exercise in mice heterozygous for the BDNF gene (BDNF+/- with strain-matched wild-type (WT mice. Stereological estimates of SNpc DA neurons from WT mice allowed 90 days exercise via unrestricted running demonstrated complete protection against the MPTP-induced neurotoxicity. However, BDNF+/- mice allowed 90 days of unrestricted exercise were not protected from MPTP-induced SNpc DA neuron loss. Proteomic analysis comparing SN and striatum from 90 day exercised WT and BDNF+/- mice showed differential expression of proteins related to energy regulation, intracellular signaling and trafficking. These results suggest that a full genetic complement of BDNF is critical for the exercise-induced neuroprotection of SNpc DA neurons.

  1. Protection against adriamycin (doxorubicin-induced toxicity in mice by several clinically used drugs.

    Directory of Open Access Journals (Sweden)



    Full Text Available Protective effects of clinically used drugs against adriamycin (ADM-induced toxicity were studied in ICR mice. The control mice, which were administered 15 mg/kg of ADM twice, survived 7.48 +/- 1.99 days (mean +/- S.D.. The survival times of mice treated with the following drugs, expressed as a percent of that of the control group, were 293.6% for coenzyme Q10 (Co Q10, 2 mg/kg, 402.2% for dextran sulfate (MDS, 300 mg/kg, 121.6% for flavin adenine dinucleotide (20 mg/kg, 236.3% for adenosine triphosphate disodium (50 mg/kg, 213.7% for reduced glutathione (100 mg/kg, 121.6% for phytonadione (50 mg/kg, 155.2% for inositol nicotinate (Ino-N, 500 mg/kg, 335.5% for nicomol (1000 mg/kg, 157.5% for nicardipine (10 mg/kg and 123.3% for dipyridamol (50 mg/kg. Anti-hyperlipemic agents such as MDS, nicomol, Ino-N and Co Q10 strongly protected against the ADM-induced toxicity, and the mice administered these drugs lived significantly longer than the control mice. The mechanism of the protective effect was discussed.

  2. Dimethylarginine dimethylaminohydrolase-1 transgenic mice are not protected from ischemic stroke.

    Directory of Open Access Journals (Sweden)

    Frank Leypoldt

    Full Text Available BACKGROUND: Methylated arginines are endogenous analogues of L-arginine, the substrate for nitric oxide (NO synthase. Asymmetric dimethylarginine (ADMA interferes with NO formation, causing endothelial dysfunction. ADMA is a predictor of cardiovascular events and mortality in humans. It is eliminated primarily by enzymatic activity of dimethylarginine dimethylaminohydrolase (DDAH. METHODOLOGY/PRINCIPAL FINDINGS: We investigated whether human DDAH-1 (hDDAH-1 transgenicity protects from ischemic tissue damage in temporary middle cerebral artery occlusion (tMCAO in mice. Infarct sizes did not significantly differ between hDDAH-1 transgenic (TG mice and wild-type littermates (WT. As expected, ADMA plasma concentrations were significantly decreased, cerebral hDDAH expression and protein significantly increased in transgenic animals. Interestingly, neither brain tissue DDAH activity nor ADMA concentrations were different between TG and WT mice. In contrast, muscular DDAH activity was generally lower than in brain but significantly increased in TG mice. CONCLUSION/SIGNIFICANCE: Our study demonstrates that hDDAH-1 transgenic mice are not protected from ischemic cerebral tissue damage in tMCAO. This lack of protection is due to high basal cerebral DDAH activity, which is not further increasable by transgenic overexpression of DDAH.

  3. Protective effect of taraxasterol against rheumatoid arthritis by the modulation of inflammatory responses in mice. (United States)

    Jiang, Shu-Hua; Ping, Li-Feng; Sun, Feng-Yan; Wang, Xiao-Lei; Sun, Zhi-Juan


    Taraxasterol is an effective component of dandelion that has anti-inflammatory effects in vivo and in vitro. The present study was performed to explore whether taraxasterol exhibits a protective effect against rheumatoid arthritis through the modulation of inflammatory responses in mice. Eight-week-old CCR9-deficient mice were injected with a collagen II monoclonal antibody cocktail to create a rheumatoid arthritis model. In the experimental group, arthritic model mice were treated with 10 mg/kg taraxasterol once per day for 5 days. Treatment with taraxasterol significantly increased the pain thresholds and reduced the clinical arthritic scores of the mice in the experimental group compared with those of the model group. Furthermore, treatment with taraxasterol significantly suppressed tumor necrosis factor-α, interleukin (IL)-1β, IL-6 and nuclear factor-κB protein expression levels compared with those in the rheumatoid arthritis model mice. Taraxasterol treatment also significantly reduced nitric oxide, prostaglandin E2 and cyclooxygenase-2 levels compared with those in the rheumatoid arthritis model group. These observations indicate that the protective effect of taraxasterol against rheumatoid arthritis is mediated via the modulation of inflammatory responses in mice.

  4. Curcumin Protects against Cadmium-Induced Vascular Dysfunction, Hypertension and Tissue Cadmium Accumulation in Mice

    Directory of Open Access Journals (Sweden)

    Upa Kukongviriyapan


    Full Text Available Curcumin from turmeric is commonly used worldwide as a spice and has been demonstrated to possess various biological activities. This study investigated the protective effect of curcumin on a mouse model of cadmium (Cd—induced hypertension, vascular dysfunction and oxidative stress. Male ICR mice were exposed to Cd (100 mg/L in drinking water for eight weeks. Curcumin (50 or 100 mg/kg was intragastrically administered in mice every other day concurrently with Cd. Cd induced hypertension and impaired vascular responses to phenylephrine, acetylcholine and sodium nitroprusside. Curcumin reduced the toxic effects of Cd and protected vascular dysfunction by increasing vascular responsiveness and normalizing the blood pressure levels. The vascular protective effect of curcumin in Cd exposed mice is associated with up-regulation of endothelial nitric oxide synthase (eNOS protein, restoration of glutathione redox ratio and alleviation of oxidative stress as indicated by decreasing superoxide production in the aortic tissues and reducing plasma malondialdehyde, plasma protein carbonyls, and urinary nitrate/nitrite levels. Curcumin also decreased Cd accumulation in the blood and various organs of Cd-intoxicated mice. These findings suggest that curcumin, due to its antioxidant and chelating properties, is a promising protective agent against hypertension and vascular dysfunction induced by Cd.

  5. Preoperative fasting protects against renal ischemia-reperfusion injury in aged and overweight mice

    NARCIS (Netherlands)

    Jongbloed, Franny; De Bruin, Ron W F; Pennings, Jeroen L A; Payán-Gómez, César; Van Den Engel, Sandra; Van Oostrom, Conny T.; De Bruin, Alain; Hoeijmakers, Jan H J; Van Steeg, Harry; IJzermans, Jan N M; Dollé, Martijn E T


    Ischemia-reperfusion injury (IRI) is inevitable during kidney transplantation leading to oxidative stress and inflammation. We previously reported that preoperative fasting in young-lean male mice protects against IRI. Since patients are generally of older age with morbidities possibly leading to a

  6. Preoperative fasting protects against renal ischemia-reperfusion injury in aged and overweight mice

    NARCIS (Netherlands)

    F. Jongbloed (Franny); R.W.F. de Bruin (Ron); J.L.A. Pennings (Jeroen); C. Payan-Gomez; S. van den Engel (Sandra); C.T.M. van Oostrom (Conny); A. de Bruin (Alain); J.H.J. Hoeijmakers (Jan); H. van Steeg (Harry); J.N.M. IJzermans (Jan); M.E.T. Dollé (Martijn)


    textabstractIschemia-reperfusion injury (IRI) is inevitable during kidney transplantation leading to oxidative stress and inflammation. We previously reported that preoperative fasting in young-lean male mice protects against IRI. Since patients are generally of older age with morbidities possibly

  7. Complement Depletion Protects Lupus-prone Mice from Ischemia-reperfusion-initiated Organ Injury (United States)


    Complement depletion protects lupus-prone mice from ischemia-reperfusion- initiated organ injury Antonis Ioannou,1,3 Linda A. Lieberman,1 Jurandir J...Thiel S, Nielsen S, Taka- hashi K, Shi L, Ezekowitz A, Jensenius JC, Gadjeva M. Mannan- binding lectin recognizes structures on ischemic reperfused mouse

  8. Adjuvanted multi-epitope vaccines protect HLA-A*1101 transgenic mice against Toxoplasma gondii (United States)

    We created and tested multi-epitope DNA or protein vaccines with TLR4 ligand emulsion adjuvant (gluco glucopyranosyl lipid adjuvant in a stable emulsion (GLA-SE)) for their ability to protect against Toxoplasma gondii in HLA transgenic mice. Our constructs each included five of our best down selecte...

  9. Preoperative fasting protects against renal ischemia-reperfusion injury in aged and overweight mice

    NARCIS (Netherlands)

    Jongbloed, Franny; De Bruin, Ron W F; Pennings, Jeroen L A; Payán-Gómez, César; Van Den Engel, Sandra; Van Oostrom, Conny T.; De Bruin, Alain; Hoeijmakers, Jan H J; Van Steeg, Harry; IJzermans, Jan N M; Dollé, Martijn E T


    Ischemia-reperfusion injury (IRI) is inevitable during kidney transplantation leading to oxidative stress and inflammation. We previously reported that preoperative fasting in young-lean male mice protects against IRI. Since patients are generally of older age with morbidities possibly leading to a

  10. Preoperative fasting protects against renal ischemia-reperfusion injury in aged and overweight mice

    NARCIS (Netherlands)

    F. Jongbloed (Franny); R.W.F. de Bruin (Ron); J.L.A. Pennings (Jeroen); C. Payan-Gomez; S. van den Engel (Sandra); C.T.M. van Oostrom (Conny); A. de Bruin (Alain); J.H.J. Hoeijmakers (Jan); H. van Steeg (Harry); J.N.M. IJzermans (Jan); M.E.T. Dollé (Martijn)


    textabstractIschemia-reperfusion injury (IRI) is inevitable during kidney transplantation leading to oxidative stress and inflammation. We previously reported that preoperative fasting in young-lean male mice protects against IRI. Since patients are generally of older age with morbidities possibly l

  11. MTBVAC vaccine is safe, immunogenic and confers protective efficacy against Mycobacterium tuberculosis in newborn mice. (United States)

    Aguilo, Nacho; Uranga, Santiago; Marinova, Dessislava; Monzon, Marta; Badiola, Juan; Martin, Carlos


    Development of novel more efficient preventive vaccines against tuberculosis (TB) is crucial to achieve TB eradication by 2050, one of the Millennium Development Goals (MDG) for the current century. MTBVAC is the first and only live attenuated vaccine based on a human isolate of Mycobacterium tuberculosis developed as BCG-replacement strategy in newborns that has entered first-in-human adult clinical trials. In this work, we characterize the safety, immunogenicity and protective efficacy of MTBVAC in a model of newborn C57/BL6 mice. Our data clearly indicate that MTBVAC is safe for newborn mice, and does not affect animal growth or organ development. In addition, MTBVAC-vaccinated mice at birth showed enhanced immunogenicity and better protection against M. tuberculosis challenge in comparison with BCG.

  12. Humoral Immunity through Immunoglobulin M Protects Mice from an Experimental Actinomycetoma Infection by Nocardia brasiliensis (United States)

    Salinas-Carmona, Mario C.; Pérez-Rivera, Isabel


    An experimental model of infection with Nocardia brasiliensis, used as an example of a facultative intracellular pathogen, was tested. N. brasiliensis was injected into the rear foot pads of BALB/c mice to establish an infection. Within 30 days, infected animals developed a chronic actinomycetoma infection. Batch cultures of N. brasiliensis were used to purify P61, P38, and P24 antigens; P61 is a catalase, and P38 is a protease with strong caseinolytic activity. Active and passive immunizations of BALB/c mice with these three purified soluble antigens were studied. Protection was demonstrated for actively immunized mice. However, immunity lasted only 30 days. Other groups of immunized mice were bled at different times, and their sera were passively transferred to naive recipients that were then infected with N. brasiliensis. Sera collected 5, 6, and 7 days after donor immunization conferred complete, long-lasting protection. The protective effect of passive immunity decreased when sera were collected 2 weeks after donor immunization. However, neither the early sera (1-, 2-, and 3-day sera) nor the later sera (30- or 45-day sera) prevented the infection. Hyperimmune sera with the highest levels of immunoglobulin G (IgG) to N. brasiliensis antigens did not protect at all. The antigens tested induced two IgM peaks. The first peak was present 3 days after immunization but was not antigen specific and did not transfer protection. The second peak was evident 7 days after immunization, was an IgM response, was antigen specific, and conferred protection. This results clearly demonstrate that IgM antibodies protect the host against a facultative intracellular bacterium. PMID:15385456

  13. Exendin-4 protected against cognitive dysfunction in hyperglycemic mice receiving an intrahippocampal lipopolysaccharide injection.

    Directory of Open Access Journals (Sweden)

    Hei-Jen Huang

    Full Text Available BACKGROUND: Chronic hyperglycemia-associated inflammation plays critical roles in disease initiation and the progression of diabetic complications, including Alzheimer's disease (AD. However, the association of chronic hyperglycemia with acute inflammation of the central nervous system in the progression of AD still needs to be elucidated. In addition, recent evidence suggests that Glucagon-like peptide-1 receptor (GLP-1R protects against neuronal damage in the brain. Therefore, the neuroprotective effects of the GLP-1R agonist exendin-4 (EX-4 against hyperglycemia/lipopolysaccharides (LPS damage were also evaluated in this study. METHODOLOGY/PRINCIPAL FINDINGS: Ten days after streptozotocin (STZ or vehicle (sodium citrate treatment in mice, EX-4 treatment (10 µg/kg/day was applied to the mice before intrahippocampal CA1 injection of LPS or vehicle (saline and continued for 28 days. This study examined the molecular alterations in these mice after LPS and EX4 application, respectively. The mouse cognitive function was evaluated during the last 6 days of EX-4 treatment. The results showed that the activation of NF-κB-related inflammatory responses induced cognitive dysfunction in both the hyperglycemic mice and the mice that received acute intrahippocampal LPS injection. Furthermore, acute intrahippocampal LPS injection exacerbated the impairment of spatial learning and memory through a strong decrease in monoaminergic neurons and increases in astrocytes activation and apoptosis in the hyperglycemic mice. However, EX-4 treatment protected against the cognitive dysfunction resulting from hyperglycemia or/and intrahippocampal LPS injection. CONCLUSIONS/SIGNIFICANCE: These findings reveal that both hyperglycemia and intrahippocampal LPS injection induced cognitive dysfunction via activation of NF-κB-related inflammatory responses. However, acute intrahippocampal LPS injection exacerbated the progression of cognitive dysfunction in the

  14. Multiple mechanisms involved in diabetes protection by lipopolysaccharide in non-obese diabetic mice

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jun [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Department of Pharmacology, College of Medicine, Wuhan University of Science and Technology, Wuhan (China); Cao, Hui [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Wang, Hongjie [Section of Neurobiology, Torrey Pines Institute for Molecular Studies, Port Saint Lucie, FL (United States); Yin, Guoxiao; Du, Jiao; Xia, Fei; Lu, Jingli [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China); Xiang, Ming, E-mail: [Department of Pharmacology, School of Pharmacy, Tongji Medical College, Huazhong University of Science and Technology, Wuhan (China)


    Toll-like receptor 4 (TLR4) activation has been proposed to be important for islet cell inflammation and eventually β cell loss in the course of type 1 diabetes (T1D) development. However, according to the “hygiene hypothesis”, bacterial endotoxin lipopolysaccharide (LPS), an agonist on TLR4, inhibits T1D progression. Here we investigated possible mechanisms for the protective effect of LPS on T1D development in non-obese diabetic (NOD) mice. We found that LPS administration to NOD mice during the prediabetic state neither prevented nor reversed insulitis, but delayed the onset and decreased the incidence of diabetes, and that a multiple-injection protocol is more effective than a single LPS intervention. Further, LPS administration suppressed spleen T lymphocyte proliferation, increased the generation of CD4{sup +}CD25{sup +}Foxp3{sup +} regulatory T cells (Tregs), reduced the synthesis of strong Th1 proinflammatory cytokines, and downregulated TLR4 and its downstream MyD88-dependent signaling pathway. Most importantly, multiple injections of LPS induced a potential tolerogenic dendritic cell (DC) subset with low TLR4 expression without influencing the DC phenotype. Explanting DCs from repeated LPS-treated NOD mice into NOD/SCID diabetic mice conferred sustained protective effects against the progression of diabetes in the recipients. Overall, these results suggest that multiple mechanisms are involved in the protective effects of LPS against the development of diabetes in NOD diabetic mice. These include Treg induction, down-regulation of TLR4 and its downstream MyD88-dependent signaling pathway, and the emergence of a potential tolerogenic DC subset. - Highlights: • Administration of lipopolysaccharide (LPS) prevented type 1 diabetes in NOD mice. • Downregulating TLR4 level and MyD88-dependent pathway contributed to protection of LPS. • LPS administration also hampered DC maturation and promoted Treg differentiation.

  15. Protective effect of carvacrol on acute lung injury induced by lipopolysaccharide in mice. (United States)

    Feng, Xiaosheng; Jia, Aiqing


    Carvacrol, the major component of Plectranthus amboinicus, has been known to exhibit anti-inflammatory activities. The aim of this study was to investigate the effects of carvacrol on lipopolysaccharide (LPS)-induced endotoxemia and acute lung injury (ALI) in mice. Mice were injected intraperitoneally (i.p.) with LPS and the mortality of mice for 7 days were observed twice a day. Meanwhile, the protective effect of carvacrol (20, 40 or 80 mg/kg) on LPS-induced endotoxemia were detected. Using an experimental model of LPS-induced ALI, we examined the effect of carvacrol in resolving lung injury. The results showed that carvacrol could improve survival during lethal endotoxemia and attenuate LPS-induced ALI in mice. The anti-inflammatory mechanisms of carvacrol may be due to its ability to inhibit NF-κB and MAPKs signaling pathways, thereby inhibiting inflammatory cytokines TNF-α, IL-6 and IL-1β production.

  16. Protective effect of humus extract against Trypanosoma brucei infection in mice. (United States)

    Kodama, Hiroshi; Denso; Okazaki, Fumi; Ishida, Saeko


    Humic substances are formed during the decomposition of organic matter in humus, and are found in many natural environments in which organic materials and microorganisms are present. Oral administration of humus extract to mice successfully induced effective protection against experimental challenge by the two subspecies, Trypanosoma brucei brucei and T. brucei gambiense. Mortality was most reduced among mice who received a 3% humus extract for 21 days in drinking water ad libitum. Spleen cells from humus-administered mice exhibited significant non-specific cytotoxic activity against L1210 mouse leukemia target cells. Also, spleen cells produced significantly higher amounts of Interferon-gamma when stimulated in vitro with Concanavalin A than cells from normal controls. These results clearly show that administration to mice of humus extract induced effective resistance against Trypanosoma infection. Enhancement of the innate immune system may be involved in host defense against trypanosomiasis.

  17. Absence of intestinal microbiota does not protect mice from diet-induced obesity. (United States)

    Fleissner, Christine K; Huebel, Nora; Abd El-Bary, Mohamed Mostafa; Loh, Gunnar; Klaus, Susanne; Blaut, Michael


    The gut microbiota has been implicated in host nutrient absorption and energy homeostasis. We studied the influence of different diets on body composition in germ-free (GF) and conventional (CV) mice. GF and CV male adult C3H mice were fed ad libitum a semi-synthetic low-fat diet (LFD; carbohydrate-protein-fat ratio: 41:42:17; 19.8 kJ/g), a high-fat diet (HFD; 41:16:43; 21.4 kJ/g) or a commercial Western diet (WD; 41:19:41; 21.5 kJ/g). There was no difference in body weight gain between GF and CV mice on the LFD. On the HFD, GF mice gained more body weight and body fat than CV mice, and had lower energy expenditure. GF mice on the WD gained significantly less body fat than GF mice on the HFD. GF mice on both HFD and WD showed increased intestinal mRNA expression of fasting-induced adipose factor/angiopoietin-like protein 4 (Fiaf/Angptl4), but they showed no major changes in circulating Fiaf/Angptl4 compared with CV mice. The faecal microbiota composition of the CV mice differed between diets: the proportion of Firmicutes increased on both HFD and WD at the expense of the Bacteroidetes. This increase in the Firmicutes was mainly due to the proliferation of one family within this phylum: the Erysipelotrichaceae. We conclude that the absence of gut microbiota does not provide a general protection from diet-induced obesity, that intestinal production of Fiaf/Angptl4 does not play a causal role in gut microbiota-mediated effects on fat storage and that diet composition affects gut microbial composition to larger extent than previously thought.

  18. Overexpression of Nrf2 protects against microcystin-induced hepatotoxicity in mice. (United States)

    Lu, Yuan-Fu; Liu, Jie; Wu, Kai Connie; Qu, Qiang; Fan, Fang; Klaassen, Curtis D


    Oxidative stress and glutathione (GSH) depletion are implicated in mycocystin hepatotoxicity. To investigate the role of nuclear factor erythroid 2-related factor 2 (Nrf2) in microcystin-induced liver injury, Nrf2-null, wild-type, and Keap1-hepatocyte knockout (Keap1-HKO) mice were treated with microcystin (50 μg/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Microcystin increased serum alanine aminotransferase and aspartate aminotransferase activities, and caused extensive inflammation and necrosis in Nrf2-null and wild-type mice, but not in Keap1-HKO mice. Oxidative stress and inflammation are implicated in microcystin-induced hepatotoxicity, as evidenced by increased lipid peroxidation and increased expression of pro-inflammatory genes, such as neutrophil-specific chemokines mKC and MIP-2, and pro-inflammatory cytokines IL-1β and IL-6. The increased expression of these pro-inflammatory genes was attenuated in Keap1-HKO mice. Nrf2 and Nqo1 mRNA and protein were higher in Keap1-HKO mice at constitutive levels and after microcystin. To further investigate the mechanism of the protection, hepatic GSH and the mRNA of GSH-related enzymes were determined. Microcystin markedly depleted liver GSH by 60-70% in Nrf2 and WT mice but only 35% in Keap1-HKO mice. The mRNAs of GSH conjugation and peroxide reduction enzymes, such as Gstα1, Gstα4, Gstμ, and Gpx2 were higher in livers of Keap1-HKO mice, together with higher expression of the rate-limiting enzyme for GSH synthesis (Gclc). Organic anion transport polypeptides were increased by microcystin with the most increase in Keap1-HKO mice. In conclusion, this study demonstrates that higher basal levels of Nrf2 and GSH-related genes in Keap1-HKO mice prevented microcystin-induced oxidative stress and liver injury.

  19. Overexpression of Nrf2 protects against microcystin-induced hepatotoxicity in mice.

    Directory of Open Access Journals (Sweden)

    Yuan-Fu Lu

    Full Text Available Oxidative stress and glutathione (GSH depletion are implicated in mycocystin hepatotoxicity. To investigate the role of nuclear factor erythroid 2-related factor 2 (Nrf2 in microcystin-induced liver injury, Nrf2-null, wild-type, and Keap1-hepatocyte knockout (Keap1-HKO mice were treated with microcystin (50 μg/kg, i.p.. Blood and liver samples were collected 8 h thereafter. Microcystin increased serum alanine aminotransferase and aspartate aminotransferase activities, and caused extensive inflammation and necrosis in Nrf2-null and wild-type mice, but not in Keap1-HKO mice. Oxidative stress and inflammation are implicated in microcystin-induced hepatotoxicity, as evidenced by increased lipid peroxidation and increased expression of pro-inflammatory genes, such as neutrophil-specific chemokines mKC and MIP-2, and pro-inflammatory cytokines IL-1β and IL-6. The increased expression of these pro-inflammatory genes was attenuated in Keap1-HKO mice. Nrf2 and Nqo1 mRNA and protein were higher in Keap1-HKO mice at constitutive levels and after microcystin. To further investigate the mechanism of the protection, hepatic GSH and the mRNA of GSH-related enzymes were determined. Microcystin markedly depleted liver GSH by 60-70% in Nrf2 and WT mice but only 35% in Keap1-HKO mice. The mRNAs of GSH conjugation and peroxide reduction enzymes, such as Gstα1, Gstα4, Gstμ, and Gpx2 were higher in livers of Keap1-HKO mice, together with higher expression of the rate-limiting enzyme for GSH synthesis (Gclc. Organic anion transport polypeptides were increased by microcystin with the most increase in Keap1-HKO mice. In conclusion, this study demonstrates that higher basal levels of Nrf2 and GSH-related genes in Keap1-HKO mice prevented microcystin-induced oxidative stress and liver injury.

  20. Prediction of T cell epitopes of Brucella abortus and evaluation of their protective role in mice. (United States)

    Afley, Prachiti; Dohre, Sudhir K; Prasad, G B K S; Kumar, Subodh


    Brucellae are Gram-negative intracellular bacteria that cause an important zoonotic disease called brucellosis. The animal vaccines are available but have disadvantage of causing abortions in a proportion of pregnant animals. The animal vaccines are also pathogenic to humans. Recent trend in vaccine design has shifted to epitope-based vaccines that are safe and specific. In this study, efforts were made to identify MHC-I- and MHC-II-restricted T cell epitopes of Brucella abortus and evaluate their vaccine potential in mice. The peptides were designed using online available immunoinformatics tools, and five MHC-I- and one MHC-II-restricted T cell peptides were selected on the basis of their ability to produce interferon gamma (IFN-γ) in in vivo studies. The selected peptides were co-administered with poly DL-lactide-co-glycolide (PLG) microparticles and evaluated for immunogenicity and protection in BALB/c mice. Mice immunized with peptides either entrapped in PLG microparticles (EPLG-Pep) or adsorbed on PLG particles (APLG-Pep) showed significantly higher splenocyte proliferation and IFN-γ generation to all selected peptides than the mice immunized with corresponding irrelevant peptides formulated PLG microparticles or phosphate-buffered saline (PBS). A significant protection compared to PBS control was also observed in EPLG-Pep and APLG-Pep groups. A plasmid DNA vaccine construct (pVaxPep) for peptides encoding DNA sequences was generated and injected to mice by in vivo electroporation. Significant protection was observed (1.66 protection units) when compared with PBS and empty vector control group animals. Overall, the MHC-I and MHC-II peptides identified in this study are immunogenic and protective in mouse model and support the feasibility of peptide-based vaccine for brucellosis.

  1. Protective Effect of Lycium ruthenicum Murr. Against Radiation Injury in Mice

    Directory of Open Access Journals (Sweden)

    Yabin Duan


    Full Text Available The protective effect of Lycium ruthenicum Murr. against radiation injury was examined in mice. Kunming mice were randomly divided into a control group, model group, positive drug group and L. ruthenicum high dose (8 g/kg, L. ruthenicum middle dose (4 g/kg, L. ruthenicum low dose (2 g/kg treatment groups, for which doses were administered the third day, seventh day and 14th day after irradiation. L. ruthenicum extract was administered orally to the mice in the three treatment groups and normal saline was administered orally to the mice in the control group and model group for 14 days. The positive group was treated with amifostine (WR-2721 at 30 min before irradiation. Except for the control group, the groups of mice received a 5 Gy quantity of X-radiation evenly over their whole body at one time. Body weight, hemogram, thymus and spleen index, DNA, caspase-3, caspase-6, and P53 contents were observed at the third day, seventh day, and 14th day after irradiation. L. ruthenicum could significantly increase the total red blood cell count, hemoglobin count and DNA contents (p < 0.05. The spleen index recovered significantly by the third day and 14th day after irradiation (p < 0.05. L. ruthenicum low dose group showed a significant reduction in caspase-3 and caspase-6 of serum in mice at the third day, seventh day, and 14th day after irradiation and L. ruthenicum middle dose group experienced a reduction in caspase-6 of serum in mice by the seventh day after irradiation. L. ruthenicum could decrease the expression of P53. The results showed that L. ruthenicum had protective effects against radiation injury in mice.

  2. Endothelial Expression of Scavenger Receptor Class B, Type I Protects against Development of Atherosclerosis in Mice

    Directory of Open Access Journals (Sweden)

    Boris L. Vaisman


    Full Text Available The role of scavenger receptor class B, type I (SR-BI in endothelial cells (EC was examined in several novel transgenic mouse models expressing SR-BI in endothelium of mice with normal C57Bl6/N, apoE-KO, or Scarb1-KO backgrounds. Mice were also created expressing SR-BI exclusively in endothelium and liver. Endothelial expression of the Tie2-Scarb1 transgene had no significant effect on plasma lipoprotein levels in mice on a normal chow diet but on an atherogenic diet, significantly decreased plasma cholesterol levels, increased plasma HDL cholesterol (HDL-C levels, and protected mice against atherosclerosis. In 8-month-old apoE-KO mice fed a normal chow diet, the Tie2-Scarb1 transgene decreased aortic lesions by 24%. Mice expressing SR-BI only in EC and liver had a 1.5 ± 0.1-fold increase in plasma cholesterol compared to mice synthesizing SR-BI only in liver. This elevation was due mostly to increased HDL-C. In EC culture studies, SR-BI was found to be present in both basolateral and apical membranes but greater cellular uptake of cholesterol from HDL was found in the basolateral compartment. In summary, enhanced expression of SR-BI in EC resulted in a less atherogenic lipoprotein profile and decreased atherosclerosis, suggesting a possible role for endothelial SR-BI in the flux of cholesterol across EC.

  3. Protection of athymic (Nu/Nu BALB/c mice against Plasmodium berghei by splenocytes from normal (Nu/ + BALB/c mice

    Directory of Open Access Journals (Sweden)

    José J. Ferraroni


    Full Text Available Athymic BALB/c (Nu/Nu mice died at 7-13 days after inoculation (DAI of Plasmodium berghei NK65, whereas their heterozygous (Nu/+ littermates died at 7-8 DAI. Nude (Nu/Nu mice, reconstituted with 2 x 10(7 splenocytes from uninfected heterozygous (Nu/+ littermates at 20 days before parasite inoculation (DBI, died about 2 days earlier than control nude mice; nude mice reconstituted at 10 or 2 DBI lived 2 to 4 days longer than control nudes; and nude mice reconstituted 2 DAI lived even longer and some survived. These findings indicate that P. berghei NK65 induces at least two T-cell dependent immune phenomena, one suppressive and the other stimulatory. Reconstitution of nude mice with T-cells from BALB/c (Nu/+ mice appeared to reduce or bypass suppressive T-cell activities which allowed the formation of a protective immune response by some of the nude mice.

  4. Protective immunity against Leishmania major induced by Leishmania tropica infection of BALB/c mice. (United States)

    Mahmoudzadeh-Niknam, Hamid; Kiaei, Simin Sadat; Iravani, Davood


    Leishmania (L.) tropica is a causative agent of human cutaneous and viscerotropic leishmaniasis. Immune response to L. tropica in humans and experimental animals are not well understood. We previously established that L. tropica infection induces partial protective immunity against subsequent challenge infection with Leishmania major in BALB/c mice. Aim of the present study was to study immunologic mechanisms of protective immunity induced by L. tropica infection, as a live parasite vaccine, in BALB/c mouse model. Mice were infected by L. tropica, and after establishment of the infection, they were challenged by L. major. Our findings shows that L. tropica infection resulted in protection against L. major challenge in BALB/c mice and this protective immunity is associated with: (1) a DTH response, (2) higher IFN-γ and lower IL-10 response at one week post-challenge, (3) lower percentage of CD4(+) lymphocyte at one month post-challenge, and (4) the source of IFN-γ and IL-10 were mainly CD4(-) lymphocyte up to one month post-challenge suggesting that CD4(-) lymphocytes may be responsible for protection induced by L. tropica infection in the studied intervals.

  5. Immunization of Mice With Vibrio cholerae Outer-Membrane Vesicles Protects Against Hyperinfectious Challenge and Blocks Transmission


    Bishop, Anne L.; Tarique, Abdullah A.; Patimalla, Bharathi; Calderwood, Stephen B.; Qadri, Firdausi; Camilli, Andrew


    Background. Vibrio cholerae excreted by cholera patients is “hyperinfectious” (HI), which can be modeled by passage through infant mice. Immunization of adult female mice with V. cholerae outer-membrane vesicles (OMVs) passively protects suckling mice from challenge. Although V. cholerae is unable to colonize protected pups, the bacteria survive passage and have the potential to be transmitted to susceptible individuals. Here, we investigated the impact of OMV immunization and the HI state on...

  6. Partial protective immunity against toxoplasmosis in mice elicited by recombinant Toxoplasma gondii malate dehydrogenase. (United States)

    Liu, Zhuanzhuan; Yuan, Fei; Yang, Yanping; Yin, Litian; Liu, Yisheng; Wang, Yanjuan; Zheng, Kuiyang; Cao, Jianping


    Toxoplasma gondii can infect humans and wildlife, sometimes causing serious clinical presentations. Currently, no viable vaccine or effective drug strategies exist to prevent and control toxoplasmosis. T. gondii malate dehydrogenase (TgMDH) is a crucial enzyme in cellular redox reactions and has been shown to be an immunogenic compound that could be a potential vaccine candidate. Here, we investigate the protective efficacy of recombinant TgMDH (rTgMDH) against T. gondii infection in BALB/c mice. All mice were vaccinated via the nasal route. We determined the optimal vaccination dose by monitoring systemic and mucosal immune responses. The results showed that mice vaccinated with 30 μg of rTgMDH produced the highest antibody titers in serum, a strong lymphoproliferative response, marked increases in their levels of IL-2 and IFN-γ, and significantly greater levels of specific secretory IgA (sIgA) in mucosal washes. In addition, the vaccinated mice were orally challenged with tachyzoites of the virulent T. gondii RH strain 2 weeks after the final vaccination. Compared to the control group, we found that vaccination with rTgMDH increased the survival rate of infected mice by 47% and also significantly reduced the tachyzoite loads in their liver (by 58%) and brain (by 41%). Therefore, the rTgMDH protein triggers a strong systemic and mucosal immune response and provides partial protection against T. gondii infection.

  7. Total Flavonoids from Mimosa Pudica Protects Carbon Tetrachloride-Induced Acute Liver Injur y in Mice

    Institute of Scientific and Technical Information of China (English)

    QIU Zhen-qin; CAI Lei; CHEN Da-shuai


    Objective:To observe the protective effect of total lfavonoids from Mimosa pudica on carbon tetrachloride (CCl4)-induced acute liver injury in mice. Methods:CCl4-induced acute liver injury model in mice was established. The activity of ALT and AST, the content of serum albumin (Alb) and total antioxidant capacity (T-AOC) were determined. The content of malondiadehyde (MDA) was measured and the activity of superoxide dismutase (SOD) was determined. The histopathological changes of liver were observed. Results:Compared with CCl4 model group, each dose group of total lfavonouida from Mimosa pudica could reduced the activity of ALT and AST in mice obviously (P<0.01), indicating they had remarkably protective effect on CCl4-induced acute liver injury in mice. High and middle dose groups of total lfavonouida from Mimosa pudica could increase the content of Alb in mice (P<0.01). Each dose group of total lfavonouida from Mimosa pudica could enhance the level of T-AOC (P<0.01), and lower the content of liver homogenate MDA, but enhance the activity of SOD in a dose-depended manner (P<0.01).

  8. Molecular Adjuvant Ag85A Enhances Protection against Influenza A Virus in Mice Following DNA Vaccination

    Directory of Open Access Journals (Sweden)

    Hong Li


    Full Text Available A novel DNA vaccine vector encoding the Mycobacterium tuberculosis secreted antigen Ag85A fused with the influenza A virus (IAV HA2 protein epitopes, pEGFP/Ag85A-sHA2 (pAg85A-sHA2, was designed to provide protection against influenza. The antigen encoded by the DNA vaccine vector was efficiently expressed in mammalian cells, as determined by reverse transcription polymerase chain reaction (RT-PCR and fluorescence analyses. Mice were immunized with the vaccine vector by intramuscular injection before challenge with A/Puerto Rico/8/34 virus (PR8 virus. Sera and the splenocyte culture IFN-γ levels were significantly higher in immunized mice compared with the control mice. The novel vaccine group showed a high neutralization antibody titer in vitro. The novel vaccine vector also reduced the viral loads, increased the survival rates in mice after the PR8 virus challenge and reduced the alveolar inflammatory cell numbers. Sera IL-4 concentrations were significantly increased in mice immunized with the novel vaccine vector on Day 12 after challenge with the PR8 virus. These results demonstrated that short HA2 (sHA2 protein epitopes may provide protection against the PR8 virus and that Ag85A could strengthen the immune response to HA2 epitopes, thus, Ag85A may be developed as a new adjuvant for influenza vaccines.

  9. Protective Effects of Baicalin on Decidua Cells of LPS-Induced Mice Abortion

    Directory of Open Access Journals (Sweden)

    Xiaodan Wang


    Full Text Available The study was carried out to investigate the protective effects of Baicalin on decidual cells of LPS-induced abortion mice. In the in vitro experiment, the decidual cells were cultured by uterus tissue mass cultivation sampled at day 6 of pregnancy, and gradient concentrations of LPS were used to determine the optimal LPS concentration of the injured decidual cells model. The injured decidual cells were treated with Baicalin (4 μg/mL to determine the protective role of Baicalin. In the in vivo experiment, lipopolysaccharide (LPS was injected intravenously via the tail vein to induce abortion at day 6 of pregnancy, and the mice were given different concentrations of Baicalin by oral gavage consecutively at days 7 to 8 of pregnancy. On day 9 of gestation, the mice were sacrificed. The TNF and progesterone contents in the serum were assayed by ELISA. The results clearly revealed that Baicalin can prevent the injury to decidual cells from LPS dose dependently, TNF was decreased significantly (P<0.01 compared to LPS group, and there was no effect on the progesterone. These findings suggest that Baicalin has protective effects on the injured decidual cells in the pregnant mice.

  10. Protective effect of Plantago major L. Pectin polysaccharide against systemic Streptococcus pneumoniae infection in mice. (United States)

    Hetland, G; Samuelsen, A B; Løvik, M; Paulsen, B S; Aaberge, I S; Groeng, E C; Michaelsen, T E


    The antibacterial effect of a soluble pectin polysaccharide, PMII, isolated from the leaves of Plantago major, was examined in inbred NIH/OlaHsd and Fox Chase SCID mice experimentally infected with Streptococcus pneumoniae serotype 6B. Serotype 6B is known to give a more protracted infection when injected intraperitoneally into susceptible mice than more virulent serotypes like type 4. PMII was administered i.p. either once 3 days before challenge or once to thrice from 3 to 48 h after challenge. The number of bacteria in blood and the mouse survival rate were recorded. Pre-challenge administration of PMII and also lipopolysaccharide (LPS), included as a control, gave a dose-dependent protective effect against S. pneumoniae type 6B infection. However, injection of PMII after establishment of the infection in NIH/OlaHsd mice had no effect. The data demonstrate that, firstly, the polysaccharide fraction PMII from P. major protects against pneumococcal infection in mice when administered systemically prechallenge, and secondly that the protective effect is owing to stimulation of the innate and not the adaptive immune system.

  11. Antioxidant properties of lutein contribute to the protection against lipopolysaccharide-induced uveitis in mice

    Directory of Open Access Journals (Sweden)

    Yao Xin-Sheng


    Full Text Available Abstract Background Lutein is an important eye-protective nutrient. This study investigates the protective effects and mechanisms of lutein on lipopolysaccharides (LPS-induced uveitis in mice. Methods Lutein, suspended in drinking water at a final concentration of 12.5 and 25 mg/mL, was administered to mice at 0.1 mL/10 g body weight for five consecutive days. Control and model group received drinking water only. Uveitis was induced by injecting LPS (100 mg per mouse into the footpad in the model and lutein groups on day 5 after the last drug administration. Eyes of the mice were collected 24 hours after the LPS injection for the detection of indicators using commercial kits and reverse transcription-polymerase chain reaction. Results LPS-induced uveitis was confirmed by significant pathological damage and increased the nitric oxide level in eye tissue of BALB/C mice 24 hours after the footpad injection. The elevated nitric oxide level was significantly reduced by oral administration of lutein (125 and 500 mg/kg/d for five days before LPS injection. Moreover, lutein decreased the malondialdehyde content, increased the oxygen radical absorbance capacity level, glutathione, the vitamin C contents and total superoxide dismutase (SOD and glutathione peroxidase (GPx activities. Lutein further increased expressions of copper-zinc SOD, manganese SOD and GPx mRNA. Conclusion The antioxidant properties of lutein contribute to the protection against LPS-induced uveitis, partially through the intervention of inflammation process.

  12. Small heterodimer partner overexpression partially protects against liver tumor development in farnesoid X receptor knockout mice

    Energy Technology Data Exchange (ETDEWEB)

    Li, Guodong [Department of Surgical Oncology, Cancer Treatment Center, The Fourth Affiliated Hospital of Harbin Medical University, Harbin (China); Kong, Bo [Department of Pharmacology and Toxicology, School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Zhu, Yan [Department of General Surgery, Xuanwu Hospital, Capital Medical University, Beijing (China); Zhan, Le [Department of Pharmacology and Toxicology, School of Pharmacy, Rutgers University, Piscataway, NJ (United States); Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Williams, Jessica A. [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Tawfik, Ossama [Department of Pathology and Laboratory Medicine, University of Kansas Medical Center, Kansas City, KS (United States); Kassel, Karen M. [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Luyendyk, James P. [Pathobiology and Diagnostic Investigation, Michigan State University, East Lansing, MI (United States); Wang, Li [Department of Medicine, Huntsman Cancer Institute, University of Utah School of Medicine, Salt Lake City, UT (United States); Guo, Grace L., E-mail: [Department of Pharmacology and Toxicology, School of Pharmacy, Rutgers University, Piscataway, NJ (United States)


    Farnesoid X receptor (FXR, Nr1h4) and small heterodimer partner (SHP, Nr0b2) are nuclear receptors that are critical to liver homeostasis. Induction of SHP serves as a major mechanism of FXR in suppressing gene expression. Both FXR{sup −/−} and SHP{sup −/−} mice develop spontaneous hepatocellular carcinoma (HCC). SHP is one of the most strongly induced genes by FXR in the liver and is a tumor suppressor, therefore, we hypothesized that deficiency of SHP contributes to HCC development in the livers of FXR{sup −/−} mice and therefore, increased SHP expression in FXR{sup −/−} mice reduces liver tumorigenesis. To test this hypothesis, we generated FXR{sup −/−} mice with overexpression of SHP in hepatocytes (FXR{sup −/−}/SHP{sup Tg}) and determined the contribution of SHP in HCC development in FXR{sup −/−} mice. Hepatocyte-specific SHP overexpression did not affect liver tumor incidence or size in FXR{sup −/−} mice. However, SHP overexpression led to a lower grade of dysplasia, reduced indicator cell proliferation and increased apoptosis. All tumor-bearing mice had increased serum bile acid levels and IL-6 levels, which was associated with activation of hepatic STAT3. In conclusion, SHP partially protects FXR{sup −/−} mice from HCC formation by reducing tumor malignancy. However, disrupted bile acid homeostasis by FXR deficiency leads to inflammation and injury, which ultimately results in uncontrolled cell proliferation and tumorigenesis in the liver. - Highlights: • SHP does not prevent HCC incidence nor size in FXR KO mice but reduces malignancy. • Increased SHP promotes apoptosis. • Bile acids and inflammation maybe critical for HCC formation with FXR deficiency.

  13. Chromatin remodeling resets the immune system to protect against autoimmune diabetes in mice. (United States)

    Patel, Tejas; Patel, Vasu; Singh, Rajvir; Jayaraman, Sundararajan


    Epigenetic alteration of the genome has been shown to provide palliative effects in mouse models of certain human autoimmune diseases. We have investigated whether chromatin remodeling could provide protection against autoimmune diabetes in NOD mice. Treatment of female mice during the transition from prediabetic to diabetic stage (18-24 weeks of age) with the well-characterized histone deacetylase inhibitor, trichostatin A effectively reduced the incidence of diabetes. However, similar treatment of overtly diabetic mice during the same time period failed to reverse the disease. Protection against diabetes was accompanied by histone hyperacetylation in pancreas and spleen, enhanced frequency of CD4(+) CD62L(+) cells in the spleen, reduction in cellular infiltration of islets, restoration of normoglycemia and glucose-induced insulin release by beta cells. Activation of splenic T lymphocytes derived from protected mice in vitro with pharmacological agents that bypass the antigen receptor or immobilized anti-CD3 antibody resulted in enhanced expression of Ifng mRNA and protein without altering the expression of Il4, Il17, Il18, Inos and Tnfa genes nor the secretion of IL-2, IL-4, IL-17 and TNF-α proteins. Consistently, expression of the transcription factor involved in Ifng transcription, Tbet/Tbx21 but not Gata3 and Rorgt, respectively, required for the transcription of Il4 and Il17, was upregulated in activated splenocytes of protected mice. These results indicate that chromatin remodeling can lead to amelioration of diabetes by using multiple mechanisms including differential gene transcription. Thus, epigenetic modulation could be a novel therapeutic approach to block the transition from benign to frank diabetes.

  14. In vivo protection against strychnine toxicity in mice by the glycine receptor agonist ivermectin. (United States)

    Maher, Ahmed; Radwan, Rasha; Breitinger, Hans-Georg


    The inhibitory glycine receptor, a ligand-gated ion channel that mediates fast synaptic inhibition in mammalian spinal cord and brainstem, is potently and selectively inhibited by the alkaloid strychnine. The anthelminthic and anticonvulsant ivermectin is a strychnine-independent agonist of spinal glycine receptors. Here we show that ivermectin is an effective antidote of strychnine toxicity in vivo and determine time course and extent of ivermectin protection. Mice received doses of 1 mg/kg and 5 mg/kg ivermectin orally or intraperitoneally, followed by an intraperitoneal strychnine challenge (2 mg/kg). Ivermectin, through both routes of application, protected mice against strychnine toxicity. Maximum protection was observed 14 hours after ivermectin administration. Combining intraperitoneal and oral dosage of ivermectin further improved protection, resulting in survival rates of up to 80% of animals and a significant delay of strychnine effects in up to 100% of tested animals. Strychnine action developed within minutes, much faster than ivermectin, which acted on a time scale of hours. The data agree with a two-compartment distribution of ivermectin, with fat deposits acting as storage compartment. The data demonstrate that toxic effects of strychnine in mice can be prevented if a basal level of glycinergic signalling is maintained through receptor activation by ivermectin.

  15. In Vivo Protection against Strychnine Toxicity in Mice by the Glycine Receptor Agonist Ivermectin

    Directory of Open Access Journals (Sweden)

    Ahmed Maher


    Full Text Available The inhibitory glycine receptor, a ligand-gated ion channel that mediates fast synaptic inhibition in mammalian spinal cord and brainstem, is potently and selectively inhibited by the alkaloid strychnine. The anthelminthic and anticonvulsant ivermectin is a strychnine-independent agonist of spinal glycine receptors. Here we show that ivermectin is an effective antidote of strychnine toxicity in vivo and determine time course and extent of ivermectin protection. Mice received doses of 1 mg/kg and 5 mg/kg ivermectin orally or intraperitoneally, followed by an intraperitoneal strychnine challenge (2 mg/kg. Ivermectin, through both routes of application, protected mice against strychnine toxicity. Maximum protection was observed 14 hours after ivermectin administration. Combining intraperitoneal and oral dosage of ivermectin further improved protection, resulting in survival rates of up to 80% of animals and a significant delay of strychnine effects in up to 100% of tested animals. Strychnine action developed within minutes, much faster than ivermectin, which acted on a time scale of hours. The data agree with a two-compartment distribution of ivermectin, with fat deposits acting as storage compartment. The data demonstrate that toxic effects of strychnine in mice can be prevented if a basal level of glycinergic signalling is maintained through receptor activation by ivermectin.

  16. Superoxide dismutase overexpression protects against glucocorticoid-induced depressive-like behavioral phenotypes in mice. (United States)

    Uchihara, Yuki; Tanaka, Ken-ichiro; Asano, Teita; Tamura, Fumiya; Mizushima, Tohru


    In the stress response, activation of the hypothalamic-pituitary-adrenal axis, and particularly the release of glucocorticoids, plays a critical role. However, dysregulation of this system and sustained high plasma levels of glucocorticoids can result in depression. Recent studies have suggested the involvement of reactive oxygen species (ROS), such as superoxide anion, in depression. However, direct evidence for a role of ROS in the pathogenesis of this disorder is lacking. In this study, using transgenic mice expressing human Cu/Zn-superoxide dismutase (SOD1), an enzyme that catalyzes the dismutation of superoxide anions, we examined the effect of SOD1 overexpression on depressive-like behavioral phenotypes in mice. Depressive-like behaviors were induced by daily subcutaneous administration of the glucocorticoid corticosterone for 4 weeks, and was monitored with the social interaction test, the sucrose preference test and the forced swim test. These tests revealed that transgenic mice overexpressing SOD1 are more resistant to glucocorticoid-induced depressive-like behavioral disorders than wild-type animals. Furthermore, compared with wild-type mice, transgenic mice showed a reduction in the number of 8-hydroxy-2'-deoxyguanosine (a marker of oxidative stress)-positive cells in the hippocampal CA3 region following corticosterone administration. These results suggest that overexpression of SOD1 protects mice against glucocorticoid-induced depressive-like behaviors by decreasing cellular ROS levels.

  17. Factors that affect the efficiency of antisense oligodeoxyribonucleotide transfection by insonated gas-filled lipid microbubbles (United States)

    Zhao, Ying-Zheng; Lu, Cui-Tao


    Objective: To investigate the factors that affect the efficiency of antisense oligodeoxyribonucleotide(AS-ODNs) transfection by insonated gas-filled lipid microbubbles. Methods: Lipid microbubbles filled with two types of gases-air and C3F8, were prepared respectively. An AS-ODNs sequence HA824 and a breast cancer cell line SK-BR-3 were used to define the various operating variables determining the transfection efficiency of insonated microbubbles. Two mixing methods, three levels of mixing speed, different mixing durations and various ultrasound initiation time after mixing were examined respectively. Transfection efficiency was detected by fluorescence microscopy. Results: C3F8 microbubbles gave higher levels of AS-ODNs transfection efficiency than air microbubbles in all test conditions. Transfection efficiency resulted from mixing method A (incubation of HA824 and microbubbles before mixing cells) did not show significant difference with that of mixing method B (without incubation of HA824 and microbubbles before mixing cells). Mixing speed, duration of mixing and ultrasound initiation time after mixing were central to determining HA824 transfection efficiency in vitro. The optimum parameters for SK-BR-3 cells were found at a mixing speed of 40-50 rpm for 30-60 s with less than 60 s delay before ultrasound. Conclusion: Ultrasound-mediated AS-ODNs transfection enhanced by C3F8-filled lipid microbubbles represents an effective avenue for AS-ODNs transfer.

  18. Factors that affect the efficiency of antisense oligodeoxyribonucleotide transfection by insonated gas-filled lipid microbubbles

    Energy Technology Data Exchange (ETDEWEB)

    Zhao Yingzheng [General Hospital of Beijing Military Command of PLA, Department of Clinical Pharmacology (China)], E-mail:; Lu Cuitao [Madam Medical Management Group (China)


    Objective: To investigate the factors that affect the efficiency of antisense oligodeoxyribonucleotide(AS-ODNs) transfection by insonated gas-filled lipid microbubbles. Methods: Lipid microbubbles filled with two types of gases-air and C{sub 3}F{sub 8}, were prepared respectively. An AS-ODNs sequence HA824 and a breast cancer cell line SK-BR-3 were used to define the various operating variables determining the transfection efficiency of insonated microbubbles. Two mixing methods, three levels of mixing speed, different mixing durations and various ultrasound initiation time after mixing were examined respectively. Transfection efficiency was detected by fluorescence microscopy. Results: C{sub 3}F{sub 8} microbubbles gave higher levels of AS-ODNs transfection efficiency than air microbubbles in all test conditions. Transfection efficiency resulted from mixing method A (incubation of HA824 and microbubbles before mixing cells) did not show significant difference with that of mixing method B (without incubation of HA824 and microbubbles before mixing cells). Mixing speed, duration of mixing and ultrasound initiation time after mixing were central to determining HA824 transfection efficiency in vitro. The optimum parameters for SK-BR-3 cells were found at a mixing speed of 40-50 rpm for 30-60 s with less than 60 s delay before ultrasound. Conclusion: Ultrasound-mediated AS-ODNs transfection enhanced by C{sub 3}F{sub 8}-filled lipid microbubbles represents an effective avenue for AS-ODNs transfer.

  19. Toll-like receptor 4-positive macrophages protect mice from Pasteurella pneumotropica-induced pneumonia (United States)

    Hart, Marcia L.; Mosier, Derek A.; Chapes, Stephen K.


    This study investigates Toll-like receptor 4 (TLR4)-positive macrophages in early recognition and clearance of pulmonary bacteria. TLR4 is a trans-membrane receptor that is the primary recognition molecule for lipopolysaccharide of gram-negative bacteria. The TLR4(Lps-del) mouse strains C57BL10/ScN (B10) and STOCK Abb(tm1) TLR4(Lps-del) Slc11a1(s)(B10 x C2D) are susceptible to pulmonary infections and develop pneumonia when naturally or experimentally infected by the opportunistic bacterium Pasteurella pneumotropica. Since these mice have the TLR4(Lps-del) genotype, we hypothesized that reconstitution of mice with TLR4-positive macrophages would provide resistance to this bacterium. A cultured macrophage cell line (C2D macrophages) and bone marrow cells from C2D mice were adoptively transferred to B10 and B10 x C2D mice by intraperitoneal injection. C2D macrophages increased B10 and B10 x C2D mouse resistance to P. pneumotropica. In C2D-recipient mice there was earlier transcription of tumor necrosis factor alpha and chemokines JE and macrophage inflammatory protein 2 (MIP-2) in the lungs of B10 and B10 x C2D mice, and there was earlier transcription of KC and MIP-1alpha in B10 x C2D mice. In addition, the course of inflammation following experimental Pasteurella challenge was altered in C2D recipients. C2D macrophages also protected B10 x C2D mice, which lack CD4(+) T cells. These data indicate that macrophages are critical for pulmonary immunity and can provide host resistance to P. pneumotropica. This study indicates that TLR4-positive macrophages are important for early recognition and clearance of pulmonary bacterial infections.

  20. Toll-like receptor 4-positive macrophages protect mice from Pasteurella pneumotropica-induced pneumonia (United States)

    Hart, Marcia L.; Mosier, Derek A.; Chapes, Stephen K.


    This study investigates Toll-like receptor 4 (TLR4)-positive macrophages in early recognition and clearance of pulmonary bacteria. TLR4 is a trans-membrane receptor that is the primary recognition molecule for lipopolysaccharide of gram-negative bacteria. The TLR4(Lps-del) mouse strains C57BL10/ScN (B10) and STOCK Abb(tm1) TLR4(Lps-del) Slc11a1(s)(B10 x C2D) are susceptible to pulmonary infections and develop pneumonia when naturally or experimentally infected by the opportunistic bacterium Pasteurella pneumotropica. Since these mice have the TLR4(Lps-del) genotype, we hypothesized that reconstitution of mice with TLR4-positive macrophages would provide resistance to this bacterium. A cultured macrophage cell line (C2D macrophages) and bone marrow cells from C2D mice were adoptively transferred to B10 and B10 x C2D mice by intraperitoneal injection. C2D macrophages increased B10 and B10 x C2D mouse resistance to P. pneumotropica. In C2D-recipient mice there was earlier transcription of tumor necrosis factor alpha and chemokines JE and macrophage inflammatory protein 2 (MIP-2) in the lungs of B10 and B10 x C2D mice, and there was earlier transcription of KC and MIP-1alpha in B10 x C2D mice. In addition, the course of inflammation following experimental Pasteurella challenge was altered in C2D recipients. C2D macrophages also protected B10 x C2D mice, which lack CD4(+) T cells. These data indicate that macrophages are critical for pulmonary immunity and can provide host resistance to P. pneumotropica. This study indicates that TLR4-positive macrophages are important for early recognition and clearance of pulmonary bacterial infections.

  1. An accompanying genetic severe deficiency of tissue factor protects mice with a protein C deficiency from lethal endotoxemia. (United States)

    Castellino, Francis J; Donahue, Deborah L; Navari, Rudolph M; Ploplis, Victoria A; Walsh, Mark


    Mice with a severe genetic deficiency of protein C (PC), PC(-/-)PC(tg4), display enhanced susceptibility to lethal effects of gram-negative endotoxemia induced by lipopolysaccharide (LPS), whereas mice severely deficient in tissue factor (TF), TF(-/-)hTF(tg), are protected from LPS-mediated lethality. In this study, we show that a simultaneous severe deficiency of TF protected low-PC mice from LPS-induced death, resulting in a survival profile similar to that experienced by wild-type (WT) mice. Plasma and whole blood coagulation assays, the latter measured by thromboelastography, demonstrated development of coagulopathies in LPS-treated mice, which were more severe in the case of the doubly deficient TF(-/-)hTF(tg)/PC(-/-)PC(tg4) mice, mainly reflecting earlier signs of disseminated intravascular coagulation in this latter cohort. Markers of inflammation were also elevated in response to LPS in both groups of mice at times just preceding death. We conclude that whereas coagulopathies are more exacerbated in LPS-treated TF(-/-)hTF(tg)/PC(-/-)PC(tg4) mice, the lowering of TF levels in mice with an accompanying severe PC deficiency confers protection against death compared with mice with a single severe PC deficiency. This suggests that proteases generated as a result of factor VIIa/TF-mediated thrombin generation play a mechanistic role in the enhanced lethality seen under very low PC conditions in an endotoxemia model in mice.

  2. Mucosal immunization with Shigella flexneri outer membrane vesicles induced protection in mice. (United States)

    Camacho, A I; de Souza, J; Sánchez-Gómez, S; Pardo-Ros, M; Irache, J M; Gamazo, C


    Vaccination appears to be the only rational prophylactic approach to control shigellosis. Unfortunately, there is still no safe and efficacious vaccine available. We investigated the protection conferred by a new vaccine containing outer membrane vesicles (OMVs) from Shigella flexneri with an adjuvant based on nanoparticles in an experimental model of shigellosis in mice. OMVs were encapsulated in poly(anhydride) nanoparticles prepared by a solvent displacement method with the copolymer PMV/MA. OMVs loaded into NPs (NP-OMVs) were homogeneous and spherical in shape, with a size of 197nm (PdI=0.06). BALB/c mice (females, 9-week-old, 20±1g) were immunized by intradermal, nasal, ocular (20μg) or oral route (100μg) with free or encapsulated OMV. Thirty-five days after administration, mice were infected intranasally with a lethal dose of S. flexneri (1×10(7)CFU). The new vaccine was able to protect fully against infection when it was administered via mucosa. By intradermal route the NP-OMVs formulation increased the protection from 20%, obtained with free extract, to 100%. Interestingly, both OMVs and OMV-NP induced full protection when administered by the nasal and conjuntival route. A strong association between the ratio of IL-12p40/IL-10 and protection was found. Moreover, low levels of IFN-γ correlate with protection. Under the experimental conditions used, the adjuvant did not induce any adverse effects. These results place OMVs among promising candidates to be used for vaccination against Shigellosis. Copyright © 2011 Elsevier Ltd. All rights reserved.

  3. Fasting protects mice from lethal DNA damage by promoting small intestinal epithelial stem cell survival. (United States)

    Tinkum, Kelsey L; Stemler, Kristina M; White, Lynn S; Loza, Andrew J; Jeter-Jones, Sabrina; Michalski, Basia M; Kuzmicki, Catherine; Pless, Robert; Stappenbeck, Thaddeus S; Piwnica-Worms, David; Piwnica-Worms, Helen


    Short-term fasting protects mice from lethal doses of chemotherapy through undetermined mechanisms. Herein, we demonstrate that fasting preserves small intestinal (SI) architecture by maintaining SI stem cell viability and SI barrier function following exposure to high-dose etoposide. Nearly all SI stem cells were lost in fed mice, whereas fasting promoted sufficient SI stem cell survival to preserve SI integrity after etoposide treatment. Lineage tracing demonstrated that multiple SI stem cell populations, marked by Lgr5, Bmi1, or HopX expression, contributed to fasting-induced survival. DNA repair and DNA damage response genes were elevated in SI stem/progenitor cells of fasted etoposide-treated mice, which importantly correlated with faster resolution of DNA double-strand breaks and less apoptosis. Thus, fasting preserved SI stem cell viability as well as SI architecture and barrier function suggesting that fasting may reduce host toxicity in patients undergoing dose intensive chemotherapy.

  4. Fasting protects mice from lethal DNA damage by promoting small intestinal epithelial stem cell survival (United States)

    Tinkum, Kelsey L.; Stemler, Kristina M.; White, Lynn S.; Loza, Andrew J.; Jeter-Jones, Sabrina; Michalski, Basia M.; Kuzmicki, Catherine; Pless, Robert; Stappenbeck, Thaddeus S.; Piwnica-Worms, David; Piwnica-Worms, Helen


    Short-term fasting protects mice from lethal doses of chemotherapy through undetermined mechanisms. Herein, we demonstrate that fasting preserves small intestinal (SI) architecture by maintaining SI stem cell viability and SI barrier function following exposure to high-dose etoposide. Nearly all SI stem cells were lost in fed mice, whereas fasting promoted sufficient SI stem cell survival to preserve SI integrity after etoposide treatment. Lineage tracing demonstrated that multiple SI stem cell populations, marked by Lgr5, Bmi1, or HopX expression, contributed to fasting-induced survival. DNA repair and DNA damage response genes were elevated in SI stem/progenitor cells of fasted etoposide-treated mice, which importantly correlated with faster resolution of DNA double-strand breaks and less apoptosis. Thus, fasting preserved SI stem cell viability as well as SI architecture and barrier function suggesting that fasting may reduce host toxicity in patients undergoing dose intensive chemotherapy. PMID:26644583


    Directory of Open Access Journals (Sweden)

    Božena Košíková


    Full Text Available The blending of polypropylene with lignin derived from chemical wood pulp manufacture makes it possible to prepare optically transparent films (thickness 50-60μm with acceptable mechanical properties in the absence of a commercial stabilizer. The lignin preparation in the concentration 1-2 wt% possessed the ability to act as a processing stabilizer and as an antioxidant during thermal aging of polypropylene films. A DNA-protective effect of lignin in mice testicular cells and mice peripheral blood lymphocytes against oxidation stress was examined using in vitro experiments. Hydrogen peroxide and visible light-excited methylene blue (MB were used as DNA damaging agents. The isolated cells were preincubated with lignin before treatment with the oxidative agents. The level of breaks in the DNA was measured by a comet assay. The results showed that preincubation with lignin significantly decreased the level of strand breaks induced by both oxidants in mice lymphocytes and testicular cells.

  6. Plasma-Mediated Gut Protection After Hemorrhagic Shock is Lessened in Syndecan-1-/- Mice. (United States)

    Ban, Kechen; Peng, Zhanglong; Pati, Shibani; Witkov, Richard B; Park, Pyong Woo; Kozar, Rosemary A


    We have shown in a rodent model of hemorrhagic shock (HS) that fresh frozen plasma (FFP) reduces lung inflammation and injury that are correlated with restitution of syndecan-1. As the gut is believed to contribute to distant organ injury and inflammation after shock, the current study sought to determine if the protective effects of plasma would extend to the gut and to elucidate the contribution of syndecan-1 to this protective effect. We also examined the potential role of TNFα, and a disintegrin and metalloproteinase (ADAM)-17, both intestinal sheddases of syndecan-1. Wild-type (WT) and syndecan-1 (KO) mice were subjected to HS followed by resuscitation with lactated Ringer's (LR) or FFP and compared with shock alone and shams. Small bowel and blood were obtained after 3  h for analysis of mucosal injury and inflammation and TNFα and ADAM-17 protein expression and activity. After HS, gut injury and inflammation were significantly increased compared with shams. Resuscitation with LR decreased both injury and inflammation that were further lessened by FFP. KO mice displayed worsened gut injury and inflammation after HS compared with WT mice, and LR and FFP equivalently inhibited injury and inflammation. Both systemic and intestinal TNFα and ADAM-17 followed similar trends, with increases after HS, reduction by LR, and a further decrease by FFP in WT but not KO mice. In conclusion, FFP decreased gut injury and inflammation after hemorrhagic shock, an effect that was abrogated in syndecan-1 mice. Plasma also decreased TNFα and ADAM-17, representing a potential mechanistic link to its protection via syndecan-1.

  7. DNA vaccination protects mice against Zika virus-induced damage to the testes (United States)

    Griffin, Bryan D.; Muthumani, Kar; Warner, Bryce M.; Majer, Anna; Hagan, Mable; Audet, Jonathan; Stein, Derek R.; Ranadheera, Charlene; Racine, Trina; De La Vega, Marc-Antoine; Piret, Jocelyne; Kucas, Stephanie; Tran, Kaylie N.; Frost, Kathy L.; De Graff, Christine; Soule, Geoff; Scharikow, Leanne; Scott, Jennifer; McTavish, Gordon; Smid, Valerie; Park, Young K.; Maslow, Joel N.; Sardesai, Niranjan Y.; Kim, J. Joseph; Yao, Xiao-jian; Bello, Alexander; Lindsay, Robbin; Boivin, Guy; Booth, Stephanie A.; Kobasa, Darwyn; Embury-Hyatt, Carissa; Safronetz, David; Weiner, David B.; Kobinger, Gary P.


    Zika virus (ZIKV) is an emerging pathogen causally associated with serious sequelae in fetuses, inducing fetal microcephaly and other neurodevelopment defects. ZIKV is primarily transmitted by mosquitoes, but can persist in human semen and sperm, and sexual transmission has been documented. Moreover, exposure of type-I interferon knockout mice to ZIKV results in severe damage to the testes, epididymis and sperm. Candidate ZIKV vaccines have shown protective efficacy in preclinical studies carried out in animal models, and several vaccines have entered clinical trials. Here, we report that administration of a synthetic DNA vaccine encoding ZIKV pre-membrane and envelope (prME) completely protects mice against ZIKV-associated damage to the testes and sperm and prevents viral persistence in the testes following challenge with a contemporary strain of ZIKV. These data suggest that DNA vaccination merits further investigation as a potential means to reduce ZIKV persistence in the male reproductive tract. PMID:28589934

  8. Lacteal immunity to enteric cryptosporidiosis in mice: immune dams do not protect their suckling pups. (United States)

    Moon, H W; Woodmansee, D B; Harp, J A; Abel, S; Ungar, B L


    The susceptibilities of passively immunized principal and nonimmunized control suckling mice to orogastric challenge with Cryptosporidium parvum oocysts were compared. Principals were suckled by dams that had recovered from C. parvum infection. Controls were suckled by dams reared free of C. parvum infection. Principals and controls were equally susceptible to challenge. Principals were susceptible even when their dams were hyperimmunized by oral and parenteral booster inoculations with C. parvum oocysts. Immune dams produced serum antibody against C. parvum, while nonimmune dams did not. Anti-cryptosporidia immunoglobulin G (IgG) and IgA were demonstrated in whey extracted from the stomachs of principals that had suckled immune dams but not in whey extracted from the stomachs of controls. It was concluded that passive lacteal immunity is not an efficient means of protection against cryptosporidiosis in mice. As in other coccidian infections, protective immunity against cryptosporidiosis may depend more on immune cells than on antibody.

  9. Protective effect of Hibiscus sabdariffa Linn. calyx extract on tetracycline induced testicular toxicity in mice

    Directory of Open Access Journals (Sweden)

    Nawaphat Taweebot


    Full Text Available Aqueous Hibiscus sabdariffa Linn. (Malvaceae calyx extract (HSE was evaluated for theprotective effect against testicular toxicity induced by tetracycline dose of 20 mg/100 gBW for 14 daysin mice. The extract doses of 20, 50 and 100 mg/100 gBW used in pretreatment by oral administrationfor 4 days and subsequent co-treatment with tetracycline for 14 days had the protective effectexhibiting significantly increasing quality of seminal fluid including an increase in total sperm count,percentage of mobile sperms and viable sperms when compared to the tetracycline treated group (p H. Sabdariffa. calyx extract may be used as protective agent againsttetracycline-induced reproductive toxicity in mice.

  10. Evaluation the protective effect of diphenhydramine against acute toxicity induced by levamisole in male mice

    Directory of Open Access Journals (Sweden)

    M.Y. Matti


    Full Text Available The aim of this study was to evaluate the protective effect of different doses of diphenhydramine against acute toxicosis with Levamisole. The Mechanism of levamisole induced acute toxicity and that of protective effect of diphenhydramine against Levamisole toxicosis also examined on the level of cholinesterase (ChE activity. Subcutanous injection of 100mg/kg levamisole in male mice with induced cholinergic over stimulation and death in 100% of animals. The Toxicosis was not related to the significantly decreased in plasma, red blood cells and brain ChE activity. Injection low dose of diphenhydramin 2.5mg/kg S.C. 15 min before levamisole produced protective effect against acute toxicity with levamisole. Significantly decreased the severity of toxicosis and increased survival rates to 100%. Diphenhydramine at low dose alone or with acute dose of levamisole did not Produced Significantly inhibition in ChE activity.The data suggested that the toxic effect of Levamisole was not related to inhibition of ChE. The low dose of diphenhydramine protected mice from Levamisole toxicity. The antidoatal effect of diphenhydramine not at the level of protection from ChE inhibition. There was no adverse interaction between two drugs.

  11. The Protective Effect of Resveratrol on Concanavalin-A-Induced Acute Hepatic Injury in Mice

    Directory of Open Access Journals (Sweden)

    Yingqun Zhou


    Full Text Available Pharmacologic Relevance. Resveratrol, an antioxidant derived from grapes, has been reported to modulate the inflammatory process. In this study, we investigated the effects of resveratrol and its mechanism of protection on concanavalin-A- (ConA- induced liver injury in mice. Materials and Methods. Acute autoimmune hepatitis was induced by ConA (20 mg/kg in Balb/C mice; mice were treated with resveratrol (10, 20, and 30 mg/kg daily by oral gavage for fourteen days prior to a single intravenous injection of ConA. Eight hours after injection, histologic grading, proinflammatory cytokine levels, and hedgehog pathway activity were determined. Results. After ConA injection, the cytokines IL-2, IL-6, and TNF-α were increased, and Sonic hedgehog (Shh, Glioblastoma- (Gli- 1, and Patched (Ptc levels significantly increased. Pretreatment with resveratrol ameliorated the pathologic effects of ConA-induced autoimmune hepatitis and significantly inhibited IL-2, IL-6, TNF-α, Shh, Gli-1, and Ptc. The effects of resveratrol on the hedgehog pathway were studied by western blotting and immunohistochemistry. Resveratrol decreased Shh expression, possibly by inhibiting Shh expression in order to reduce Gli-1 and Ptc expression. Conclusion. Resveratrol protects against ConA-induced autoimmune hepatitis by decreasing cytokines expression in mice. The decreases seen in Gli-1 and Ptc may correlate with the amelioration of hedgehog pathway activity.

  12. Protective effect of Cassia fistula fruit extract on bromobenzene-induced nephrotoxicity in mice. (United States)

    Kalantari, Heibatullah; Jalali, Mohammadtaha; Jalali, Amir; Salimi, Abobakr; Alhalvachi, Foad; Varga, Balazs; Juhasz, Bela; Jakab, Anita; Kemeny-Beke, Adam; Gesztelyi, Rudolf; Tosaki, Arpad; Zsuga, Judit


    The efficacy of a crude hydro-alcoholic extract of Cassia fistula (golden shower tree) fruit to protect the kidney against bromobenzene-induced toxicity was studied. Negative control mice received normal saline; positive control mice were given 460 mg/kg of bromobenzene; Cassia fistula treated mice received 200, 400, 600 and 800 mg/kg of Cassia fistula fruit extract followed by 460 mg/kg bromobenzene (daily by oral gavage for 10 days). On the 11th day, the mice were sacrificed, blood samples were obtained to assess blood urea nitrogen (BUN) and creatinine levels, and kidneys were removed for histological examination. We found that bromobenzene induced significant nephrotoxicity reflected by an increase in levels of BUN and creatinine that was dose dependently prevented by the Cassia fistula fruit extract. The nephroprotective effect of the Cassia fistula fruit extract was confirmed by the histological examination of the kidneys. To the best of our knowledge, this is the first study to demonstrate the protective effect of Cassia fistula in nephrotoxicity.

  13. Renal Protective Effects of 17β-Estradiol on Mice with Acute Aristolochic Acid Nephropathy. (United States)

    Shi, Min; Ma, Liang; Zhou, Li; Fu, Ping


    Aristolochic acid nephropathy (AAN) is a progressive kidney disease caused by a Chinese herb containing aristolochic acid. Excessive death of renal tubular epithelial cells (RTECs) characterized the acute phase of AAN. Therapies for acute AAN were limited, such as steroids and angiotensin-receptor blockers (ARBs)/angiotensin-converting enzyme inhibitors (ACEIs). It was interesting that, in acute AAN, female patients showed relative slower progression to renal failure than males. In a previous study, female hormone 17β-estradiol (E2) was found to attenuate renal ischemia-reperfusion injury. Thus, the aim of this study was to investigate the potential protective role of E2 in acute AAN. Compared with male C57BL/6 mice of acute AAN, lower serum creatinine (SCr) and less renal injury, together with RTEC apoptosis in females, were found. Treatment with E2 in male AAN mice reduced SCr levels and attenuated renal tubular injury and RTEC apoptosis. In the mice kidney tissue and human renal proximal tubule cells (HK-2 cells), E2 both attenuated AA-induced cell apoptosis and downregulated the expression of phosphor-p53 (Ser15), p53, and cleaved-caspase-3. This study highlights that E2 exhibited protective effects on the renal injury of acute AAN in male mice by reducing RTEC apoptosis, which might be related to inhibiting the p53 signaling pathway.

  14. Protection of Mice from Lethal Endotoxemia by Chimeric Human BPI-Fcγ1 Gene Delivery

    Institute of Scientific and Technical Information of China (English)

    Chen Li; Jing Li; Zhe Lv; Xinghua Guo; Qinghua Chen; Qingli Kong; Yunqing An


    To evaluate the potentiality of applying gene therapy to endotoxemia in high-risk patients, we investigated the effects of transferring an adeno-associated virus serotype 2 (AAV2)-mediated BPI-Fcγ1 gene on protecting mice from challenge of lethal endotoxin. The chimeric BPI-Fcγ1 gene consists of two parts, one encods functional N-terminus (1 to 199 amino acidic residues) of human BPI, which is a bactericidal/permeability-increasing protein,and the other encodes Fc segment of human immunoglobulin G1 (Fcγ1). Our results indicated that the target protein could be expressed and secreted into the serum of the gene-transferred mice. After lethal endotoxin challenge, the levels of endotoxin and TNF-α in the gene-transferred mice were decreased. The survival rate of the BPI-Fcγ1 gene-transferred mice was markedly increased. Our data suggest that AAV2-mediated chimeric BPI-Fcγ1 gene delivery can potentially be used clinically for the protection and treatment of endotoxemia and endotoxic shock in high-risk individuals.

  15. Saccharomyces cerevisiae expressing Gp43 protects mice against Paracoccidioides brasiliensis infection.

    Directory of Open Access Journals (Sweden)

    Mariana Aprigio Assis-Marques

    Full Text Available The dimorphic fungus Paracoccidioides brasiliensis is the etiological agent of paracoccidioidomycosis (PCM. It is believed that approximately 10 million people are infected with the fungus and approximately 2% will eventually develop the disease. Unlike viral and bacterial diseases, fungal diseases are the ones against which there is no commercially available vaccine. Saccharomyces cerevisiae may be a suitable vehicle for immunization against fungal infections, as they require the stimulation of different arms of the immune response. Here we evaluated the efficacy of immunizing mice against PCM by using S. cerevisiae yeast expressing gp43. When challenged by inoculation of P. brasiliensis yeasts, immunized animals showed a protective profile in three different assays. Their lung parenchyma was significantly preserved, exhibiting fewer granulomas with fewer fungal cells than found in non-immunized mice. Fungal burden was reduced in the lung and spleen of immunized mice, and both organs contained higher levels of IL-12 and IFN-γ compared to those of non-vaccinated mice, a finding that suggests the occurrence of Th1 immunity. Taken together, our results indicate that the recombinant yeast vaccine represents a new strategy to confer protection against PCM.

  16. Renal Protective Effects of 17β-Estradiol on Mice with Acute Aristolochic Acid Nephropathy

    Directory of Open Access Journals (Sweden)

    Min Shi


    Full Text Available Aristolochic acid nephropathy (AAN is a progressive kidney disease caused by a Chinese herb containing aristolochic acid. Excessive death of renal tubular epithelial cells (RTECs characterized the acute phase of AAN. Therapies for acute AAN were limited, such as steroids and angiotensin-receptor blockers (ARBs/angiotensin-converting enzyme inhibitors (ACEIs. It was interesting that, in acute AAN, female patients showed relative slower progression to renal failure than males. In a previous study, female hormone 17β-estradiol (E2 was found to attenuate renal ischemia-reperfusion injury. Thus, the aim of this study was to investigate the potential protective role of E2 in acute AAN. Compared with male C57BL/6 mice of acute AAN, lower serum creatinine (SCr and less renal injury, together with RTEC apoptosis in females, were found. Treatment with E2 in male AAN mice reduced SCr levels and attenuated renal tubular injury and RTEC apoptosis. In the mice kidney tissue and human renal proximal tubule cells (HK-2 cells, E2 both attenuated AA-induced cell apoptosis and downregulated the expression of phosphor-p53 (Ser15, p53, and cleaved-caspase-3. This study highlights that E2 exhibited protective effects on the renal injury of acute AAN in male mice by reducing RTEC apoptosis, which might be related to inhibiting the p53 signaling pathway.

  17. Experimental Protection of Diabetic Mice against Lethal P. aeruginosa Infection by Bacteriophage

    Directory of Open Access Journals (Sweden)

    Nagaveni Shivshetty


    Full Text Available The emergence of antibiotic-resistant bacterial strains has become a global crisis and is vulnerable for the exploration of alternative antibacterial therapies. The present study emphasizes the use of bacteriophage for the treatment of multidrug resistant P. aeruginosa. P. aeruginosa was used to induce septicemia in streptozotocin (STZ induced diabetic and nondiabetic mice by intraperitoneal (i.p. injection of 3 × 108 CFU, resulting in a fatal bacteremia within 48 hrs. A single i.p. injection of 3 × 109 PFU phage GNCP showed efficient protection in both diabetic (90% and nondiabetic (100% bacteremic mice. It was further noted that the protection rate was reduced in diabetic mice when phage GNCP was administered after 4 h and 6 h of lethal bacterial challenge. In contrast, nondiabetic bacteremic mice were rescued even when treatment was delayed up to 20 h after lethal bacterial challenge. Evaluation of results confirmed that a single intraperitoneal injection of the phage dose (3 × 109 PFU/mL was more effective than the multiple doses of imipenem. These results uphold the efficacy of phage therapy against pernicious P. aeruginosa infections, especially in cases of immunocompromised host.

  18. The pharmacodynamics experiment of XinHua injection protect action of ADR-induced toxin myocarditisin mice

    Institute of Scientific and Technical Information of China (English)

    ZHANG Hong; DU Jia-lin; LI Xin-hua; XIANG Shao-jie; JIA Dong; BAO Yu-long; LI Kun


    Objective The experiment is to study the protective effects of Xinkang Injection on ADR-induced toxin myocarditisin mice. Methods The test of Xinkang Injection on ADR-induced toxin myocarditisin mice. Firstly, the animal of obnormal, weight and death rate. Secondly, the influnences of cardiogram of ADR-induced toxin myocarditisin mice. Thirdly, the influnences of lactate dehydrogenase (LDH), creatine kinase (CK) and glutamic oxaloacetic transaminasw (GOT) of ADR-induced toxin myocarditisin mice. Fouthly, the influnences of changes of cardioc pathological mechanism of ADR-induced toxin myocarditisin mice. Fifthly, the influnces of the caidioc ultrastructural of ADR-induced toxin myocarditisin mice. Results Firstly, to ADR-induced toxin myocarditisin mice, the weight of middle dose and high dose of Xinkang injection had declined obviosly which contrast with the constraction model mice team. In the mean time, the weight of Xinkang injection team had obviosly changde which contrast with contrastion mice team(P<0.01 ). Secondly, to ADR-induced toxin myocarditisin mice, the middle dose and high dose of Xinkang injection have obviosly withstand Q abnormal cardiogram, in the meantime, Xinkang injection team had obviosly changde contrast with the contrastion model mice (P<0.01 ). Thirdly, to ADR-induced toxin myocarditisin mice, The activity of lactate dehydrogenase(LDH),creatine kinase (CK) and glutamic oxaloacetic transaminasw (GOT) were differently measured. The middle dose and high dose of Xinkang injection team can obviously declined the activity of LDH and CK (P<0.01). Fouthly, to ADR-induced toxin myocarditisin mice, the low dose, the middle dose and high dose of Xinkang injection team can contrast w, ith injured on toxic myocarditisin mice cardioc. Fifthly, to ADR-induced toxin myocarditisin mice, the low dose , the middle dose and high dose of Xinkang injection team have effect of allevite the injection of the cardioc ulteasteuctural of ADR-induced toxin

  19. Ethanol extracts of Scutellaria baicalensis protect against lipopolysaccharide-induced acute liver injury in mice


    Hai Nguyen Thanh; Hue Pham Thi Minh; Tuan Anh Le; Huong Duong Thi Ly; Tung Nguyen Huu; Loi Vu Duc; Thu Dang Kim; Tung Bui Thanh


    Objective: To investigated the protective potential of ethanol extracts of Scutellaria baicalensis (S. baicalensis) against lipopolysaccharide (LPS)-induced liver injury. Methods: Dried roots of S. baicalensis were extracted with ethanol and concentrated to yield a dry residue. Mice were administered 200 mg/kg of the ethanol extracts orally once daily for one week. Animals were subsequently administered a single dose of LPS (5 mg/kg of body weight, intraperitoneal injection). Both protein ...

  20. Complete protection against lethal Toxoplasma gondii infection in mice immunized with a plasmid encoding the SAG1 gene

    DEFF Research Database (Denmark)

    Nielsen, H V; Lauemøller, S L; Christiansen, L


    gamma interferon production by CD8(+) T cells from p1tPASAG1-immunized mice was tested in an ELISPOT assay, and one new CTL epitope was identified. Adoptive transfer of CD8(+) T cells from p1tPASAG1-immunized to naïve mice showed partial protection. In conclusion, DNA vaccination with p1tPASAG1 gave...... effective protection in mice against T. gondii infection and the protection could be adoptively transferred by purified CD8(+) T cells....

  1. Synthesis of oligodeoxyribonucleotides by solid phase phosphotriester method on a reduced scale; preparation of oligonucleotides for improved promoter sequence. (United States)

    Naruto, M


    A small reaction vessel, composed of a balled sintered glass filter and a test tube with a stopcock, was designed for the solid phase phosphotriester synthesis of oligodeoxyribonucleotide. Operation of small scale synthesis (nucleoside on resin: 3-6 mumol, activated diester of dimer: 20-30 mumol) was performed under the atmosphere of argon. The yield of each coupling reaction was 60-100%. Twelve short oligonucleotides (6-16mer) were obtained in 19-78% overall yield by this method. These oligomers were prepared as a part of the control region of gene to increase the translation efficiency.

  2. Protective effect of boric acid against carbon tetrachloride-induced hepatotoxicity in mice. (United States)

    Ince, Sinan; Keles, Hikmet; Erdogan, Metin; Hazman, Omer; Kucukkurt, Ismail


    The protective effect of boric acid against liver damage was evaluated by its attenuation of carbon tetrachloride (CCl(4))-induced hepatotoxicity in mice. Male albino mice were treated intraperitoneally (i.p.) with boric acid (50, 100, and 200 mg/kg) or silymarin daily for 7 days and received 0.2% CCl(4) in olive oil (10 mL/kg, i.p.) on day 7. Results showed that administration of boric acid significantly reduced the elevation in serum levels of aspartate aminotransferase, alkaline phosphatase, alanine aminotransferase, and the level of malondialdehyde in the liver that were induced by CCl(4) in mice. Boric acid treatment significantly increased glutathione content, as well as the activities of superoxide dismutase and catalase in the liver. Boric acid treatment improved the catalytic activity of cytochrome P450 2E1 and maintained activation of nuclear factor kappa light-chain enhancer of activated B cell gene expression, with no effect on inducible nitric oxide synthase gene expression in the livers of mice. Histopathologically, clear decreases in the severity of CCl(4)-induced lesions were observed, particularly at high boric acid concentrations. Results suggest that boric acid exhibits potent hepatoprotective effects on CCl(4)-induced liver damage in mice, likely the result of both the increase in antioxidant-defense system activity and the inhibition of lipid peroxidation.

  3. Protective effect of Flt3L on organ structure during advanced multiorgan dysfunction syndrome in mice (United States)



    The present study aimed to examine whether fms-related tyrosine kinase 3 ligand (Flt3L) protects the organs of mice with multiorgan dysfunction syndrome (MODS). Male C57BL/6 mice were randomly assigned to normal control, MODS and Flt3L treatment groups. The mouse models of MODS were established using intraperitoneal zymosan injections, followed by normal saline injections. The treatment group received 5 μg/kg Flt3L for seven days, beginning on day five following zymosan injection. On day 12, the mortality rates of the Flt3L treatment and the MODS groups were 7 and 18%, respectively. Marked pathological changes were observed in the liver, lungs, kidneys and heart of the mice with MODS, including degeneration and focal necrosis of parenchyma cells. Mild pathological changes were observed in different organs of the Flt3L-treated mice. In the MODS group, the number of CD4+ T lymphocytes was significantly reduced, whereas the number of CD8+ T lymphocytes was significantly increased compared with that in the normal control group; thus, the CD4+/CD8+ ratio was reduced. In the Flt3L treatment group, the average number of CD4+ T lymphocytes was not significantly different to the average number of CD4+ T lymphocytes in the normal group. In conclusion, Flt3L administration improved the immune status and alleviated the organ damage in mice with late-phase MODS. PMID:25672780

  4. Membrane attack complex inhibitor CD59a protects against focal cerebral ischemia in mice

    Directory of Open Access Journals (Sweden)

    Nietfeld Wilfried


    Full Text Available Abstract Background The complement system is a crucial mediator of inflammation and cell lysis after cerebral ischemia. However, there is little information about the exact contribution of the membrane attack complex (MAC and its inhibitor-protein CD59. Methods Transient focal cerebral ischemia was induced by middle cerebral artery occlusion (MCAO in young male and female CD59a knockout and wild-type mice. Two models of MCAO were applied: 60 min MCAO and 48 h reperfusion, as well as 30 min MCAO and 72 h reperfusion. CD59a knockout animals were compared to wild-type animals in terms of infarct size, edema, neurological deficit, and cell death. Results and Discussion CD59a-deficiency in male mice caused significantly increased infarct volumes and brain swelling when compared to wild-type mice at 72 h after 30 min-occlusion time, whereas no significant difference was observed after 1 h-MCAO. Moreover, CD59a-deficient mice had impaired neurological function when compared to wild-type mice after 30 min MCAO. Conclusion We conclude that CD59a protects against ischemic brain damage, but depending on the gender and the stroke model used.

  5. AHNAK KO mice are protected from diet-induced obesity but are glucose intolerant. (United States)

    Ramdas, M; Harel, C; Armoni, M; Karnieli, E


    AHNAK is a 700 KD phosphoprotein primarily involved in calcium signaling in various cell types and regulating cytoskeletal organization and cell membrane architecture. AHNAK expression has also been associated with obesity. To investigate the role of AHNAK in regulating metabolic homeostasis, we studied whole body AHNAK knockout mice (KO) on either regular chow or high-fat diet (HFD). KO mice had a leaner phenotype and were resistant to high-fat diet-induced obesity (DIO), as reflected by a reduction in adipose tissue mass in conjunction with higher lean mass compared to wild-type controls (WT). However, KO mice exhibited higher fasting glucose levels, impaired glucose tolerance, and diminished serum insulin levels on either diet. Concomitantly, KO mice on HFD displayed defects in insulin signaling, as evident from reduced Akt phosphorylation and decreased cellular glucose transporter (Glut4) levels. Glucose intolerance and insulin resistance were also associated with changes in expression of genes regulating fat, glucose, and energy metabolism in adipose tissue and liver. Taken together, these data demonstrate that (a) AHNAK is involved in glucose homeostasis and weight balance (b) under normal feeding KO mice are insulin sensitive yet insulin deficient; and (c) AHNAK deletion protects against HFD-induced obesity, but not against HFD-induced insulin resistance and glucose intolerance in vivo.

  6. Defective IL-23/IL-17 Axis Protects p47phox−/− Mice from Colon Cancer (United States)

    Richter, Cornelia; Herrero San Juan, Martina; Weigmann, Benno; Bergis, Dominik; Dauber, Katrin; Muders, Michael H.; Baretton, Gustavo B.; Pfeilschifter, Josef Martin; Bonig, Halvard; Brenner, Sebastian; Radeke, Heinfried H.


    In the colon, a sophisticated balance between immune reaction and tolerance is absolutely required. Dysfunction may lead to pathologic phenotypes ranging from chronic inflammatory processes to cancer development. Two prominent modulators of colon inflammation are represented by the closely related cytokines interleukin (IL)-12 and IL-23, which initiate adaptive Th1 and Th17 immune responses, respectively. In this study, we investigated the impact of the NADPH oxidase protein p47phox, which negatively regulates IL-12 in dendritic cells, on colon cancer development in a colitis-associated colon cancer model. Initially, we found that IL-12−/− mice developed less severe colitis but are highly susceptible to colon cancer. By contrast, p47phox−/− mice showed lower tumor scores and fewer high grade tumors than wild-type (WT) littermates. Treatment with toll-like receptor 9 ligand CpG2216 significantly enhanced colitis in p47phox−/− mice, whereas tumor growth was simultaneously reduced. In tumor tissue of p47phox−/− mice, the IL-23/IL-17 axis was crucially hampered. IL-23p19 protein expression in tumor tissue correlated with tumor stage. Reconstitution of WT mice with IL-23p19−/− bone marrow protected these mice from colon cancer, whereas transplantation of WT hematopoiesis into IL-23p19−/− mice increased the susceptibility to tumor growth. Our study strengthens the divergent role of IL-12 and IL-23 in colon cancer development. With the characterization of p47phox as a novel modulator of both cytokines our investigation introduces a promising new target for antitumor strategies. PMID:28191009

  7. Uric Acid Is Protective After Cerebral Ischemia/Reperfusion in Hyperglycemic Mice. (United States)

    Justicia, Carles; Salas-Perdomo, Angélica; Pérez-de-Puig, Isabel; Deddens, Lisette H; van Tilborg, Geralda A F; Castellví, Clara; Dijkhuizen, Rick M; Chamorro, Ángel; Planas, Anna M


    Hyperglycemia at stroke onset is associated with poor long-term clinical outcome in numerous studies. Hyperglycemia induces intracellular acidosis, lipid peroxidation, and peroxynitrite production resulting in the generation of oxidative and nitrosative stress in the ischemic tissue. Here, we studied the effects of acute hyperglycemia on in vivo intercellular adhesion molecule-1 (ICAM-1) expression, neutrophil recruitment, and brain damage after ischemia/reperfusion in mice and tested whether the natural antioxidant uric acid was protective. Hyperglycemia was induced by i.p. administration of dextrose 45 min before transient occlusion of the middle cerebral artery. Magnetic resonance imaging (MRI) was performed at 24 h to measure lesion volume. A group of normoglycemic and hyperglycemic mice received an i.v. injection of micron-sized particles of iron oxide (MPIOs), conjugated with either anti-ICAM-1 antibody or control IgG, followed by T2*w MRI. Neutrophil infiltration was studied by immunofluorescence and flow cytometry. A group of hyperglycemic mice received an i.v. infusion of uric acid (16 mg/kg) or the vehicle starting after 45 min of reperfusion. ICAM-1-targeted MPIOs induced significantly larger MRI contrast-enhancing effects in the ischemic brain of hyperglycemic mice, which also showed more infiltrating neutrophils and larger lesions than normoglycemic mice. Uric acid reduced infarct volume in hyperglycemic mice but it did not prevent vascular ICAM-1 upregulation and did not significantly reduce the number of neutrophils in the ischemic brain tissue. In conclusion, hyperglycemia enhances stroke-induced vascular ICAM-1 and neutrophil infiltration and exacerbates the brain lesion. Uric acid reduces the lesion size after ischemia/reperfusion in hyperglycemic mice.

  8. Refined live attenuated Salmonella enterica serovar Typhimurium and Enteritidis vaccines mediate homologous and heterologous serogroup protection in mice. (United States)

    Tennant, Sharon M; Schmidlein, Patrick; Simon, Raphael; Pasetti, Marcela F; Galen, James E; Levine, Myron M


    Invasive nontyphoidal Salmonella (NTS) infections constitute a major health problem among infants and toddlers in sub-Saharan Africa; these infections also occur in infants and the elderly in developed countries. We genetically engineered a Salmonella enterica serovar Typhimurium strain of multilocus sequence type 313, the predominant genotype circulating in sub-Saharan Africa. We evaluated the capacities of S. Typhimurium and Salmonella enterica serovar Enteritidis ΔguaBA ΔclpX live oral vaccines to protect mice against a highly lethal challenge dose of the homologous serovar and determined protection against other group B and D serovars circulating in sub-Saharan Africa. The vaccines S. Typhimurium CVD 1931 and S. Enteritidis CVD 1944 were immunogenic and protected BALB/c mice against 10,000 50% lethal doses (LD50) of S. Typhimurium or S. Enteritidis, respectively. S. Typhimurium CVD 1931 protected mice against the group B serovar Salmonella enterica serovar Stanleyville (91% vaccine efficacy), and S. Enteritidis CVD 1944 protected mice against the group D serovar Salmonella enterica serovar Dublin (85% vaccine efficacy). High rates of survival were observed when mice were infected 12 weeks postimmunization, indicating that the vaccines elicited long-lived protective immunity. Whereas CVD 1931 did not protect against S. Enteritidis R11, CVD 1944 did mediate protection against S. Typhimurium D65 (81% efficacy). These findings suggest that a bivalent (S. Typhimurium and S. Enteritidis) vaccine would provide broad protection against the majority of invasive NTS infections in sub-Saharan Africa.

  9. Comparative Analysis of the Immunogenicity and Protective Effects of Inactivated EV71 Vaccines in Mice (United States)

    Mao, Qunying; Dong, Chenghong; Li, Xiuling; Gao, Qiang; Guo, Zengbing; Yao, Xin; Wang, Yiping; Gao, Fan; Li, Fengxiang; Xu, Miao; Yin, Weidong; Li, Qihan; Shen, Xinliang; Liang, Zhenglun; Wang, Junzhi


    Background Enterovirus 71 (EV71) is the major causative agent of hand, foot, and mouth disease (HFMD). Three inactivated EV71 whole-virus vaccines of different strains developed by different manufacturers in mainland China have recently entered clinical trials. Although several studies on these vaccines have been published, a study directly comparing the immunogenicity and protective effects among them has not been carried out, which makes evaluating their relative effectiveness difficult. Thus, properly comparing newly developed vaccines has become a priority, especially in China. Methods and Findings This comparative immunogenicity study was carried out on vaccine strains (both live and inactivated), final container products (FCPs) without adjuvant, and corresponding FCPs containing adjuvant (FCP-As) produced by three manufacturers. These vaccines were evaluated by neutralizing antibody (NAb) responses induced by the same or different dosages at one or multiple time points post-immunization. The protective efficacy of the three vaccines was also determined in one-day-old ICR mice born to immunized female mice. Survival rates were observed in these suckling mice after challenge with 20 LD50 of EV71/048M3C2. Three FCP-As, in a dose of 200 U, generated nearly 100% NAb positivity rates and similar geometric mean titers (GMTs), especially at 14–21 days post-inoculation. However, the dynamic NAb responses were different among three vaccine strains or three FCPs. The FCP-As at the lowest dose used in clinical trials (162 U) showed good protective effects in suckling mice against lethal challenge (90–100% survival), while the ED50 of NAb responses and protective effects varied among three FCP-As. Conclusions These studies establish a standard method for measuring the immunogenicity of EV71 vaccines in mice. The data generated from our mouse model study indicated a clear dose-response relationship, which is important for vaccine quality control and assessment

  10. Comparative analysis of the immunogenicity and protective effects of inactivated EV71 vaccines in mice.

    Directory of Open Access Journals (Sweden)

    Qunying Mao

    Full Text Available BACKGROUND: Enterovirus 71 (EV71 is the major causative agent of hand, foot, and mouth disease (HFMD. Three inactivated EV71 whole-virus vaccines of different strains developed by different manufacturers in mainland China have recently entered clinical trials. Although several studies on these vaccines have been published, a study directly comparing the immunogenicity and protective effects among them has not been carried out, which makes evaluating their relative effectiveness difficult. Thus, properly comparing newly developed vaccines has become a priority, especially in China. METHODS AND FINDINGS: This comparative immunogenicity study was carried out on vaccine strains (both live and inactivated, final container products (FCPs without adjuvant, and corresponding FCPs containing adjuvant (FCP-As produced by three manufacturers. These vaccines were evaluated by neutralizing antibody (NAb responses induced by the same or different dosages at one or multiple time points post-immunization. The protective efficacy of the three vaccines was also determined in one-day-old ICR mice born to immunized female mice. Survival rates were observed in these suckling mice after challenge with 20 LD(50 of EV71/048M3C2. Three FCP-As, in a dose of 200 U, generated nearly 100% NAb positivity rates and similar geometric mean titers (GMTs, especially at 14-21 days post-inoculation. However, the dynamic NAb responses were different among three vaccine strains or three FCPs. The FCP-As at the lowest dose used in clinical trials (162 U showed good protective effects in suckling mice against lethal challenge (90-100% survival, while the ED(50 of NAb responses and protective effects varied among three FCP-As. CONCLUSIONS: These studies establish a standard method for measuring the immunogenicity of EV71 vaccines in mice. The data generated from our mouse model study indicated a clear dose-response relationship, which is important for vaccine quality control and

  11. Protective effects of transplanted and mobilized bone marrow stem cells on mice with severe acute pancreatitis

    Institute of Scientific and Technical Information of China (English)

    Hui-Fei Cui; Zeng-Liang Bai


    AIM: To evaluate the protective effects of transplanted and mobilized bone marrow stem cells (BMSCs) on mice with severe acute pancreatitis (SAP) and to probe into their possible mechanisms.METHODS: A mouse model of SAP induced by intraparitoneal injections of L-arginine was employed in the present study.Two hundred female Balb/c mice weighing 18-22 g were randomly assigned into 4 groups. Group A was the stem cell mobilized group treated by injection of granulocytecolony stimulating factor (G-CSF) into mice for 4 days at a dose of 40 μg@kg-1@d-1 before induction of SAP. Group B was the group of BMSCs transplantation, in which the mice were given the isolated BMSCs via the tail vein 4 days prior to induction of SAP. Group C served as the model control and only SAP was induced. The mice without induction of SAP in group D acted as the normal control. At the time of animal sacrifice at 24, 48 and 72 h after induction of SAP, blood samples were obtained and prepared to detect serum amylase, while the abdominal viscera were examined both grossly and microscopically for the observation of pathological changes.RESULTS: The mortality of mice in the model control, groups A and B was 34%, 8% and 10% respectively within 72 h after induction of SAP. The serum level of amylase in the model control was significantly increased at all time points after induction of SAP as compared with that of the normal control (P<0.05-0.01). When the mice were pretreated with BMSCs' transplantation or G-CSF injection, their serum level of amylase was significantly reduced at 48 h and 72 h after induction of SAP in comparison with that of the model control (P<0.05-0.01). In accordance with these observations,both gross and microscopic examinations revealed that the pathological changes of SAP in mice pretreated with BMSCs transplantation or G-CSF injection were considerably attenuated as compared with those in the model control at all observed time points.CONCLUSION: Both transplanted

  12. Evidence that radio-sensitive cells are central to skin-phase protective immunity in CBA/Ca mice vaccinated with radiation-attenuated cercariae of Schistosoma mansoni as well as in naive mice protected with vaccine serum

    Energy Technology Data Exchange (ETDEWEB)

    Delgado, V.S.; McLaren, D.J. (National Inst. for Medical Research, London (UK))


    Naive CBA/Ca mice and CBA/ca mice vaccinated 4 weeks previously with radiation-attenuated cercariae of Schistosoma mansoni were subjected to 550 rad of whole body (gamma) irradiation and then challenged 3 days later with normal cercariae. The perfusion recovery data showed that this procedure reduced the primary worm burden in naive mice by 22% and the challence worm burden in vaccinated mice by 82%. Irradiation also ablated the peripheral blood leucocytes of both mouse groups by 90-100% at the time of challenge. Histological data revealed that such treatment caused a dramatic change in number, size and leucocyte composition of cutaneous inflammatory skin reactions that characterize challenged vacccinated mice and are known to entrap invading larvae; cutaneous eosinophils were preferentially abolished by this treatment. Polyvaccine mouse serum that conferred protection passively upon naive recipient mice, failed to protect naive/irradiated mice when administered by the same protocol. Distraction of macrophages by treatment of mice with silica did not affect the establishment of a primary worm burden and reduced the protection exhibited by vaccinated mice by only 16%. These data indicade that radio-sensitive cells are important to both innate and specific acquired resistance in this mouse model and that macrophages contribute only marginally to the expression of vaccine immunity. (author).

  13. Intranasal immunisation with recombinant adenovirus vaccines protects against a lethal challenge with pneumonia virus of mice. (United States)

    Maunder, Helen E; Taylor, Geraldine; Leppard, Keith N; Easton, Andrew J


    Pneumonia virus of mice (PVM) infection of BALB/c mice induces bronchiolitis leading to a fatal pneumonia in a dose-dependent manner, closely paralleling the development of severe disease during human respiratory syncytial virus infection in man, and is thus a recognised model in which to study the pathogenesis of pneumoviruses. This model system was used to investigate delivery of the internal structural proteins of PVM as a potential vaccination strategy to protect against pneumovirus disease. Replication-deficient recombinant human adenovirus serotype 5 (rAd5) vectors were constructed that expressed the M or N gene of PVM pathogenic strain J3666. Intranasal delivery of these rAd5 vectors gave protection against a lethal challenge dose of PVM in three different mouse strains, and protection lasted for at least 20 weeks post-immunisation. Whilst the PVM-specific antibody response in such animals was weak and inconsistent, rAd5N primed a strong PVM-specific CD8(+) T cell response and, to a lesser extent, a CD4(+) T cell response. These findings suggest that T-cell responses may be more important than serum IgG in the observed protection induced by rAd5N.

  14. The synthesis of alternating alpha,beta-oligodeoxyribonucleotides with alternating (3'-->3')- and (5'-->5')-internucleotic linkages as potential therapeutic agents. (United States)

    Koga, M; Geyer, S J; Regan, J B; Beaucage, S L


    A simplified synthesis of alpha-2'-deoxyribonucleoside derivatives has been developed and the solid-phase preparation of antisense alpha,beta-oligodeoxyribonucleotides with alternating (3'-->3')- and (5'-->5')-internucleotidic phosphodiester linkages, targeted against HIV-1 tat mRNA, has been accomplished. Hybridization properties of these oligonucleotide analogues have been investigated.

  15. Protective effect of mycelial polysaccharides from Cordyceps sinensis on immunological liver injury in mice

    Directory of Open Access Journals (Sweden)

    Kai-zhong DONG


    Full Text Available Objective  To explore the protective effects of mycelial polysaccharides from Cordyceps sinensis (MPCS on BCG+LPS-induced liver injury in mice. Methods  The immunological liver injury mice model was reproduced by giving bacillus Calmette-Guerin (BCG and lipopolysaccharide (LPS. Sixty NIH mice were randomly assigned into 6 groups (10 each: normal control group, model group, mycelium polysaccharide in high (100mg/kg, medium (50mg/kg and low (25mg/kg dose group, and bifendate (150mg/kg treatment group. The serum transaminase levels of alanine ALT and AST were assayed with ELISA, nitric oxide (NO in serum was measured by nitrate reductase method, and the liver homogenate was prepared for the determination of the contents of interleukin-1β(IL-1β and tumor necrosis factor-α(TNF-α. The mRNA expression levels of IL-6 and iNOS in hepatic tissue were assessed using RT-PCR . Results  In the mice of immunological liver injury, mycelial polysaccharides from Cordyceps sinensis obviously lowered the serum ALT and AST levels (P<0.01, high dose MPCS significantly reduced the serum NO and liver tissue IL-1βand TNF-αlevels (P<0.01. Compared with the model group, high and medium dose MPCS significantly reduced the expression levels of IL-6 and iNOS mRNA in hepatic tissues (P<0.01. Conclusion  MPCS shows a certain protective effect on immunological liver injury induced by BCG plus LPS in mice. DOI: 10.11855/j.issn.0577-7402.2016.04.05


    Institute of Scientific and Technical Information of China (English)

    Chun Zhang; Shi-zhen Wang; Ping-ping Zuo; Xu Cui; Jiong Cai


    Objective To explore the protective effect of tetramethylpyrazine (TMP) on the learning and memory function in D-galactose (D-gal)-lesioned mice.zine A were respectively given by intragastric administration in different groups from the third week. Learning and memory ability was tested with Morris water maze for 5 days at the sixth week. After completion of behavioral test, the mice were sacrificed by decapitation. The brain was rapidly removed, and the cortex and hippocampus were separated. The superoxide dismutase (SOD) activity and malondialdehyde (MDA) content in the cortex were determined. At the same time, the activity of choline acetyltransferase (ChAT) and acetylcholinesterase (AChE), the binding sites (Bmax) and the affinity (KD) of M-cholinergic receptor in the cortex, and Bmax and KD of N-methyl-D-aspartate (NMDA) receptor in the hippocampus were determined.Results In this model group, (1) The deficit of learning and memory ability, (2) elevated MDA content and lowered SOD activity, (3) decreased AChE activity and M-cholinergic receptor binding sites in the cortex, and (4) lowered NMDA receptor binding sites were observed in the hippocampus, as compared with the normal control. TMP could markedly (1)attenuate cognitive dysfunction, (2) lower MDA content and elevate SOD activity, (3) increase the activity of ChAT and AChE, and M-cholinergic receptor binding sites in the cortex in the mice treated with D-gal. NMDA receptor binding sites were also increased in the hippocampus in the treated mice.Conclusion TMP can significantly strengthen antioxidative function, improve central cholinergic system function, protect NMDA receptor activity, and thus enhance the learning and memory ability in D-gal-lesioned mice.

  17. Lactobacillus rhamnosus GG protects against non-alcoholic fatty liver disease in mice.

    Directory of Open Access Journals (Sweden)

    Yvonne Ritze

    Full Text Available OBJECTIVE: Experimental evidence revealed that obesity-associated non-alcoholic fatty liver disease (NAFLD is linked to changes in intestinal permeability and translocation of bacterial products to the liver. Hitherto, no reliable therapy is available except for weight reduction. Within this study, we examined the possible effect of the probiotic bacterial strain Lactobacillus rhamnosus GG (LGG as protective agent against experimental NAFLD in a mouse model. METHODS: Experimental NAFLD was induced by a high-fructose diet over eight weeks in C57BL/J6 mice. Fructose was administered via the drinking water containing 30% fructose with or without LGG at a concentration resulting in approximately 5×10(7 colony forming units/g body weight. Mice were examined for changes in small intestinal microbiota, gut barrier function, lipopolysaccharide (LPS concentrations in the portal vein, liver inflammation and fat accumulation in the liver. RESULTS: LGG increased beneficial bacteria in the distal small intestine. Moreover, LGG reduced duodenal IκB protein levels and restored the duodenal tight junction protein concentration. Portal LPS (P≤0.05 was reduced and tended to attenuate TNF-α, IL-8R and IL-1β mRNA expression in the liver feeding a high-fructose diet supplemented with LGG. Furthermore liver fat accumulation and portal alanine-aminotransferase concentrations (P≤0.05 were attenuated in mice fed the high-fructose diet and LGG. CONCLUSIONS: We show for the first time that LGG protects mice from NAFLD induced by a high-fructose diet. The underlying mechanisms of protection likely involve an increase of beneficial bacteria, restoration of gut barrier function and subsequent attenuation of liver inflammation and steatosis.

  18. Farnesoid X Receptor Protects against Kidney Injury in Uninephrectomized Obese Mice. (United States)

    Gai, Zhibo; Gui, Ting; Hiller, Christian; Kullak-Ublick, Gerd A


    Activation of the farnesoid X receptor (FXR) has indicated a therapeutic potential for this nuclear bile acid receptor in the prevention of diabetic nephropathy and obesity-induced renal damage. Here, we investigated the protective role of FXR against kidney damage induced by obesity in mice that had undergone uninephrectomy, a model resembling the clinical situation of kidney donation by obese individuals. Mice fed a high-fat diet developed the core features of metabolic syndrome, with subsequent renal lipid accumulation and renal injury, including glomerulosclerosis, interstitial fibrosis, and albuminuria. The effects were accentuated by uninephrectomy. In human renal biopsies, staining of 4-hydroxynonenal (4-HNE), glucose-regulated protein 78 (Grp78), and C/EBP-homologous protein, markers of endoplasmic reticulum stress, was more prominent in the proximal tubules of 15 obese patients compared with 16 non-obese patients. In mice treated with the FXR agonist obeticholic acid, renal injury, renal lipid accumulation, apoptosis, and changes in lipid peroxidation were attenuated. Moreover, disturbed mitochondrial function was ameliorated and the mitochondrial respiratory chain recovered following obeticholic acid treatment. Culturing renal proximal tubular cells with free fatty acid and FXR agonists showed that FXR activation protected cells from free fatty acid-induced oxidative stress and endoplasmic reticulum stress, as denoted by a reduction in the level of reactive oxygen species staining and Grp78 immunostaining, respectively. Several genes involved in glutathione metabolism were induced by FXR activation in the remnant kidney, which was consistent with a decreased glutathione disulfide/glutathione ratio. In summary, FXR activation maintains endogenous glutathione homeostasis and protects the kidney in uninephrectomized mice from obesity-induced injury.

  19. A dual drug sensitive L. major induces protection without lesion in C57BL/6 mice.

    Directory of Open Access Journals (Sweden)

    Noushin Davoudi

    Full Text Available Leishmaniasis is a major health problem in some endemic areas and yet, no vaccine is available against any form of the disease. Historically, leishmanization (LZ which is an inoculation of individual with live Leishmania, is the most effective control measure at least against cutaneous leishmaniasis (CL. Due to various reasons, LZ is not used today. Several live attenuated Leishmania have been developed but their use is limited. Previously, we developed a transgenic strain of L. major that harbors two suicide genes tk and cd genes (lmtkcd+/+ for use as a challenge strain in vaccine studies. These genes render the parasite susceptible to Ganciclovir (GCV and 5-flurocytosine (5-FC. The dual drug sensitive strain of L. major was developed using gene targeting technology using a modified Herpes Simplex Virus thymidine kinase gene (hsv-tk sensitive to Ganciclovir antibiotic and Saccharomyces cerevisae cytosine deaminase gene (cd sensitive to 5-flurocytosine that were stably introduced into L. major chromosome. BALB/c mice inoculated with lmtkcd+/+ developed lesions which upon treatment with GCV and 5-FC completely healed. In the current study, the transgenic lmtkcd+/+strain was assessed as a live vaccine model to determine the time necessary to develop a protective immune response. C57BL/6 mice were inoculated with the transgenic lmtkcd+/+strain, and treated at the time of inoculation (day 0 or at day 8 after inoculation. Immunized animals were challenged with wild-type L. major, and complete protection was induced in mice that were treated at day 8. The results show that in contrast to leishmanization, in group of mice inoculated with a dual sensitive L. major development and persistence of lesion is not necessary to induce Th1 response and protection.

  20. Targeting of rotavirus VP6 to DEC-205 induces protection against the infection in mice. (United States)

    Badillo-Godinez, O; Gutierrez-Xicotencatl, L; Plett-Torres, T; Pedroza-Saavedra, A; Gonzalez-Jaimes, A; Chihu-Amparan, L; Maldonado-Gama, M; Espino-Solis, G; Bonifaz, L C; Esquivel-Guadarrama, F


    Rotavirus (RV) is the primary etiologic agent of severe gastroenteritis in human infants. Although two attenuated RV-based vaccines have been licensed to be applied worldwide, they are not so effective in low-income countries, and the induced protection mechanisms have not been clearly established. Thus, it is important to develop new generation vaccines that induce long lasting heterotypic immunity. VP6 constitutes the middle layer protein of the RV virion. It is the most conserved protein and it is the target of protective T-cells; therefore, it is a potential candidate antigen for a new generation vaccine against the RV infection. We determined whether targeting the DEC-205 present in dendritic cells (DCs) with RV VP6 could induce protection at the intestinal level. VP6 was cross-linked to a monoclonal antibody (mAb) against murine DEC-205 (αDEC-205:VP6), and BALB/c mice were inoculated subcutaneously (s.c.) twice with the conjugated containing 1.5 μg of VP6 in the presence of polyinosinic-polycytidylic acid (Poly I:C) as adjuvant. As controls and following the same protocol, mice were immunized with ovalbumin (OVA) cross-linked to the mAb anti-DEC-205 (αDEC-205:OVA), VP6 cross-linked to a control isotype mAb (Isotype:VP6), 3 μg of VP6 alone, Poly I:C or PBS. Two weeks after the last inoculation, mice were orally challenged with a murine RV. Mice immunized with α-DEC-205:VP6 and VP6 alone presented similar levels of serum Abs to VP6 previous to the virus challenge. However, after the virus challenge, only α-DEC-205:VP6 induced up to a 45% IgA-independent protection. Memory T-helper (Th) cells from the spleen and the mesenteric lymph node (MLN) showed a Th1-type response upon antigen stimulation in vitro. These results show that when VP6 is administered parenterally targeting DEC-205, it can induce protection at the intestinal level at a very low dose, and this protection may be Th1-type cell dependent.

  1. Phosphorothioate oligodeoxyribonucleotides induce in vitro proliferation of chicken B-cells. (United States)

    Wattrang, Eva


    The study aimed to evaluate short synthetic oligodeoxyribonucleotides (ODN) as inducers of proliferation of chicken peripheral blood mononuclear cells (PBMC) and to identify the proliferating cells. A panel of different ODN; with phosphodiester and/or phosphorothioate backbone, with and without CpG-motifs, was therefore assessed for in vitro induction of proliferation. Six complete phosphorothioate ODN induced proliferation of PBMC while the complete phosphodiester or chimeric phosphodiester/phosphorohiate ODN did not. Moreover, CpG-motifs were not essential for induction of proliferation as responses to CpG-ODN were similar to those of their GpC controls. Two stimulatory phosphorothioate ODN were also used in phosphodiester form. In this comparison, only the phosphorothioate ODN were active despite the identical nucleotide sequences of their phosphodiester counterparts. In order to deliver DNA to the cytoplasm and decrease degradation of ODN by nucleases, stimulating as well as inactive ODN were treated with lipofectin prior to induction. However, proliferative responses were not influenced by lipofectin treatment and in analogy, none of the inactive ODN induced proliferation after lipofectin treatment. Among PBMC, ODN-responding cells were identified as predominantly Bu-1, immunoglobulin and major histocompatibility complex class II expressing cells, while CD3 expressing cells were not responding. Using magnetic cell separation of Bu-1 expressing cells prior to culture it was found that Bu-1 depleted cells did not proliferate upon ODN stimulation while the Bu-1 enriched cells were able to proliferate upon this stimulus. Taken together, among ODN in the present panel, only phosphorothioate ODN induced proliferation of PBMC. Responses were induced regardless of the presence of CpG-motifs and were not influenced by addition of lipofectin. Amid the chicken PBMC, predominantly cells of a B-cell phenotype proliferated in response to ODN stimulation and they were able

  2. Protective effect of topically applied olive oil against photocarcinogenesis following UVB exposure of mice. (United States)

    Budiyanto, A; Ahmed, N U; Wu, A; Bito, T; Nikaido, O; Osawa, T; Ueda, M; Ichihashi, M


    Reactive oxygen species have been shown to play a role in ultraviolet light (UV)-induced skin carcinogenesis. Vitamin E and green tea polyphenols reduce experimental skin cancers in mice mainly because of their antioxidant properties. Since olive oil has also been reported to be a potent antioxidant, we examined its effect on UVB-induced skin carcinogenesis in hairless mice. Extra-virgin olive oil was applied topically before or after repeated exposure of mice to UVB. The onset of UVB-induced skin tumors was delayed in mice painted with olive oil compared with UVB control mice. However, with increasing numbers of UVB exposures, differences in the mean number of tumors between UVB control mice and mice pretreated with olive oil before UVB exposure (pre-UVB group) were lost. In contrast, mice that received olive oil after UVB exposure (post-UVB group) showed significantly lower numbers of tumors per mouse than those in the UVB control group throughout the experimental period. The mean number of tumors per mouse in the UVB control, pre-UVB and post-UVB groups was 7.33, 6.69 and 2.64, respectively, in the first experiment, and 8.53, 9.53 and 3.36 in the second experiment. Camellia oil was also applied, using the same experimental protocol, but did not have a suppressive effect. Immunohistochemical analysis of DNA damage in the form of cyclobutane pyrimidine dimers (CPD), (6-4) photoproducts and 8-hydroxy-2'-deoxyguanosine (8-OHdG) in samples taken 30 min after a single exposure of UVB showed no significant difference between UVB-irradiated control mice and the pre-UVB group. In the post-UVB group, there were lower levels of 8-OHdG in epidermal nuclei, but the formation of CPD and (6-4) photoproducts did not differ. Exposure of olive oil to UVB before application abrogated the protective effect on 8-OHdG formation. These results indicate that olive oil topically applied after UVB exposure can effectively reduce UVB-induced murine skin tumors, possibly via its

  3. MDP: A Deinococcus Mn2+-Decapeptide Complex Protects Mice from Ionizing Radiation. (United States)

    Gupta, Paridhi; Gayen, Manoshi; Smith, Joan T; Gaidamakova, Elena K; Matrosova, Vera Y; Grichenko, Olga; Knollmann-Ritschel, Barbara; Daly, Michael J; Kiang, Juliann G; Maheshwari, Radha K


    The radioprotective capacity of a rationally-designed Mn2+-decapeptide complex (MDP), based on Mn antioxidants in the bacterium Deinococcus radiodurans, was investigated in a mouse model of radiation injury. MDP was previously reported to be extraordinarily radioprotective of proteins in the setting of vaccine development. The peptide-component (DEHGTAVMLK) of MDP applied here was selected from a group of synthetic peptides screened in vitro for their ability to protect cultured human cells and purified enzymes from extreme damage caused by ionizing radiation (IR). We show that the peptides accumulated in Jurkat T-cells and protected them from 100 Gy. MDP preserved the activity of T4 DNA ligase exposed to 60,000 Gy. In vivo, MDP was nontoxic and protected B6D2F1/J (female) mice from acute radiation syndrome. All irradiated mice treated with MDP survived exposure to 9.5 Gy (LD70/30) in comparison to the untreated mice, which displayed 63% lethality after 30 days. Our results show that MDP provides early protection of white blood cells, and attenuates IR-induced damage to bone marrow and hematopoietic stem cells via G-CSF and GM-CSF modulation. Moreover, MDP mediated the immunomodulation of several cytokine concentrations in serum including G-CSF, GM-CSF, IL-3 and IL-10 during early recovery. Our results present the necessary prelude for future efforts towards clinical application of MDP as a promising IR countermeasure. Further investigation of MDP as a pre-exposure prophylactic and post-exposure therapeutic in radiotherapy and radiation emergencies is warranted.

  4. Vaccination with Recombinant Microneme Proteins Confers Protection against Experimental Toxoplasmosis in Mice. (United States)

    Pinzan, Camila Figueiredo; Sardinha-Silva, Aline; Almeida, Fausto; Lai, Livia; Lopes, Carla Duque; Lourenço, Elaine Vicente; Panunto-Castelo, Ademilson; Matthews, Stephen; Roque-Barreira, Maria Cristina


    Toxoplasmosis, a zoonotic disease caused by Toxoplasma gondii, is an important public health problem and veterinary concern. Although there is no vaccine for human toxoplasmosis, many attempts have been made to develop one. Promising vaccine candidates utilize proteins, or their genes, from microneme organelle of T. gondii that are involved in the initial stages of host cell invasion by the parasite. In the present study, we used different recombinant microneme proteins (TgMIC1, TgMIC4, or TgMIC6) or combinations of these proteins (TgMIC1-4 and TgMIC1-4-6) to evaluate the immune response and protection against experimental toxoplasmosis in C57BL/6 mice. Vaccination with recombinant TgMIC1, TgMIC4, or TgMIC6 alone conferred partial protection, as demonstrated by reduced brain cyst burden and mortality rates after challenge. Immunization with TgMIC1-4 or TgMIC1-4-6 vaccines provided the most effective protection, since 70% and 80% of mice, respectively, survived to the acute phase of infection. In addition, these vaccinated mice, in comparison to non-vaccinated ones, showed reduced parasite burden by 59% and 68%, respectively. The protective effect was related to the cellular and humoral immune responses induced by vaccination and included the release of Th1 cytokines IFN-γ and IL-12, antigen-stimulated spleen cell proliferation, and production of antigen-specific serum antibodies. Our results demonstrate that microneme proteins are potential vaccines against T. gondii, since their inoculation prevents or decreases the deleterious effects of the infection.

  5. Vaccination with Recombinant Microneme Proteins Confers Protection against Experimental Toxoplasmosis in Mice.

    Directory of Open Access Journals (Sweden)

    Camila Figueiredo Pinzan

    Full Text Available Toxoplasmosis, a zoonotic disease caused by Toxoplasma gondii, is an important public health problem and veterinary concern. Although there is no vaccine for human toxoplasmosis, many attempts have been made to develop one. Promising vaccine candidates utilize proteins, or their genes, from microneme organelle of T. gondii that are involved in the initial stages of host cell invasion by the parasite. In the present study, we used different recombinant microneme proteins (TgMIC1, TgMIC4, or TgMIC6 or combinations of these proteins (TgMIC1-4 and TgMIC1-4-6 to evaluate the immune response and protection against experimental toxoplasmosis in C57BL/6 mice. Vaccination with recombinant TgMIC1, TgMIC4, or TgMIC6 alone conferred partial protection, as demonstrated by reduced brain cyst burden and mortality rates after challenge. Immunization with TgMIC1-4 or TgMIC1-4-6 vaccines provided the most effective protection, since 70% and 80% of mice, respectively, survived to the acute phase of infection. In addition, these vaccinated mice, in comparison to non-vaccinated ones, showed reduced parasite burden by 59% and 68%, respectively. The protective effect was related to the cellular and humoral immune responses induced by vaccination and included the release of Th1 cytokines IFN-γ and IL-12, antigen-stimulated spleen cell proliferation, and production of antigen-specific serum antibodies. Our results demonstrate that microneme proteins are potential vaccines against T. gondii, since their inoculation prevents or decreases the deleterious effects of the infection.

  6. Receptor MAS protects mice against hypothermia and mortality induced by endotoxemia. (United States)

    Souza, Laura L; Duchene, Johan; Todiras, Mihail; Azevedo, Luciano C P; Costa-Neto, Claudio M; Alenina, Natalia; Santos, Robson A; Bader, Michael


    The renin-angiotensin (Ang) system is involved in maintaining cardiovascular function by regulating blood pressure and electrolyte homeostasis. More recently, alternative pathways within the renin-angiotensin system have been described, such as the ACE-2/Ang-(1-7)/Mas axis, with opposite effects to the ones of the ACE/Ang-II/AT1 axis. Correspondingly, our previous work reported that Ang-(1-7) via its receptor Mas inhibits the mRNA expression of the proinflammatory cytokines interleukin 6 (IL-6) and tumor necrosis factor-α increased by lipopolysaccharide (LPS) in mouse peritoneal macrophages. These data led us to investigate the functional role of the Ang-(1-7)/Mas axis in an in vivo LPS model. In this work, we present evidence that Ang-(1-7) via Mas significantly reduced the LPS-increased production of circulating cytokines, such as IL-6, IL-12, and CXCL-1. This inhibitory effect was mediated by Mas because it was not detectable in Mas-deficient (Mas) mice. Accordingly, IL-6, CXCL-1, and CXCL-2 levels were higher after LPS treatment in the absence of Mas. Mas mice were less resistant to LPS-induced endotoxemia, their survival rate being 50% compared with 95% in wild-type mice. Telemetric analyses showed that Mas mice presented more pronounced LPS-induced hypothermia with a 3°C lower body temperature compared with wild-type mice. Altogether, our findings suggest that Ang-(1-7) and Mas inhibit LPS-induced cytokine production and hypothermia and thereby protect mice from the fatal consequences of endotoxemia.

  7. Protective Effects of Lemon Juice on Alcohol-Induced Liver Injury in Mice

    Directory of Open Access Journals (Sweden)

    Tong Zhou


    Full Text Available Chronic excessive alcohol consumption (more than 40–80 g/day for males and more than 20–40 g/day for females could induce serious liver injury. In this study, effects of lemon juice on chronic alcohol-induced liver injury in mice were evaluated. The serum biochemical profiles and hepatic lipid peroxidation levels, triacylglycerol (TG contents, antioxidant enzyme activities, and histopathological changes were examined for evaluating the hepatoprotective effects of lemon juice in mice. In addition, the in vitro antioxidant capacities of lemon juice were determined. The results showed that lemon juice significantly inhibited alcohol-induced increase of alanine transaminase (ALT, aspartate transaminase (AST, hepatic TG, and lipid peroxidation levels in a dose-dependent manner. Histopathological changes induced by alcohol were also remarkably improved by lemon juice treatment. These findings suggest that lemon juice has protective effects on alcohol-induced liver injury in mice. The protective effects might be related to the antioxidant capacity of lemon juice because lemon juice showed in vitro antioxidant capacity.

  8. Protective effects of 2,4-dihydroxybenzophenone against acetaminophen-induced hepatotoxicity in mice

    Institute of Scientific and Technical Information of China (English)

    Yue-Ying He; Bao-Xu Zhang; Feng-Lan Jia


    AIM: To examine the effects of 2,4-dihydroxybenzophenone (BP-1), a benzophenone derivative used as an ultraviolet light absorbent, on acetaminophen (APAP)- induced hepatotoxicity in C57BL/6J mice. METHODS: Mice were administered orally with BP-1 at doses of 200, 400 and 800 mg/kg body weight respectively every morning for 4 d before a hepatotoxic dose of APAP (350 mg/kg body weight) was given subcutaneously. Twenty four hours after APAP intoxication, the serum enzyme including serum alaine aminotransferase (ALT), aspartate aminotransferase (AST), lactate dehydrogenase (LDH) were measured and liver histopathologic changes were examined. RESULTS: BP-1 administration dramatically reduced serum ALT, AST and LDH levels. Liver histopathological examination showed that BP-1 administration antagonized APAP-induced liver pathological damage in a dose-dependent manner. Further tests showed that APAP-induced hepatic lipid peroxidation was reduced significantly by BP-1 pretreatment, and glutathione depletion was ameliorated obviously. CONCLUSION: BP-1 can effectively protect C57BL/6J mice from APAP-induced hepatotoxicity, and reduction of oxidative stress might be part of the protection mechanism.

  9. Protective effects of Moringa oleifera Lam. leaves against arsenic-induced toxicity in mice (United States)

    Sheikh, Afzal; Yeasmin, Fouzia; Agarwal, Smita; Rahman, Mashiur; Islam, Khairul; Hossain, Ekhtear; Hossain, Shakhawoat; Karim, Md Rezaul; Nikkon, Farjana; Saud, Zahangir Alam; Hossain, Khaled


    Objective To evaluate the protective role of leaves of Moringa oleifera (M. oleifera) Lam. against arsenic-induced toxicity in mice. Methods Swiss albino male mice were divided into four groups. The first group was used as non-treated control group while, the second, third, and fourth groups were treated with M. oleifera leaves (50 mg/kg body weight per day), sodium arsenite (10 mg/kg body weight per day) and sodium arsenite plus M. oleifera leaves, respectively. Serum indices related to cardiac, liver and renal functions were analyzed to evaluate the protective effect of Moringa leaves on arsenic-induced effects in mice. Results It revealed that food supplementation of M. oleifera leaves abrogated the arsenic-induced elevation of triglyceride, glucose, urea and the activities of alkaline phospatase, aspartate aminotransferase and alanine aminotransferase in serum. M. oleifera leaves also prevented the arsenic-induced perturbation of serum butyryl cholinesterase activity, total cholesterol and high density lipoprotein cholesterol. Conclusions The results indicate that the leaves of M. oleifera may be useful in reducing the effects of arsenic-induced toxicity. PMID:25183111

  10. Protective effect of δ-amyrone against ethanol-induced gastric ulcer in mice. (United States)

    Li, Weifeng; Yao, Huan; Niu, Xiaofeng; Wang, Yu; Zhang, Hailin; Li, Huani; Mu, Qingli


    The purpose of this study is to examine the protective effect of δ-amyrone on ethanol-induced gastric ulcer in mice. The mice intragastric administration 75% (0.5 mL/100g) ethanol was pretreated with δ-amyrone (4 and 8 mg/kg) and cimetidine (100 mg/kg) or vehicles in different experimental groups for a continuous three-day, and animals were euthanized 3h after ethanol ingestion. The gastric lesions were significantly attenuated by δ-amyrone (4 and 8 mg/kg) as compared to the ulcer control group. Pre-treatment with δ-amyrone prevented the myeloperoxidase (MPO) activity, production of nitric oxide (NO) in serum, expression of inducible nitric oxide synthase (iNOS) and nuclear factor kappa B (NF-κB) p65 protein expression. Analysis of cytokines in gastric tissue and serum of ethanol-induced mice showed the levels of tumor necrosis factor-alpha (TNF-α) and interleukin-6 (IL-6) were decreased by δ-amyrone in response to NF-κB p65. These results suggested that δ-amyrone exerts its protective effect on experimental gastric ulcer by inhibiting NF-κB signaling pathways, which subsequently reduces overproduction of the inducible enzymes iNOS and suppresses the release of the inflammatory factors TNF-α, IL-6 and NO. Thus, δ-amyrone shows promise as a therapeutic agent in experimental gastric ulcer.

  11. Protective effects of escin against indomethacin-induced gastric ulcer in mice. (United States)

    Wang, Tian; Zhao, Shanshan; Wang, Yucun; Yang, Yujiao; Yao, Le; Chu, Liuxiang; Du, Hanhan; Fu, Fenghua


    Escin, a natural mixture of triterpenoid saponin isolated from the seed of the horse chestnut, is reported to have a potent antiulcer activity against ethanol-induced gastric mucosal lesions. This study investigated the possible mechanisms underlying the gastroprotective effect of escin against indomethacin-induced gastric ulcer in mice. Gastric ulceration was induced by a single intragastric administration of indomethacin (18 mg/kg). The mice underwent intragastric treatment with escin at doses of 0.45, 0.9 or 1.8 mg/kg. Gastric lesion was estimated morphometrically and histopathologically 6 h after the indomethacin administration. The antioxidative parameters in gastric mucosa were measured. Moreover, the activity of myeloperoxidase and the contents of TNF-α, P-selectin and VCAM-1 in gastric tissues were determined. The results showed that escin protected gastric tissues against indomethacin-induced gastropathy as demonstrated from a reduction in the ulcer index and an attenuation of histopathologic changes. Escin caused significant reductions of the contents of malondialdehyde, TNF-α, P-selectin, VCAM-1 and myeloperoxidase activity. The altered activities of superoxide dismutase, catalase and glutathione peroxidase in the stomach tissues were also ameliorated by escin treatment. The present study demonstrated that escin had a protective effect against indomethacin-induced gastric ulcer in mice, not only by virtue of its antioxidant potential, but also due to its anti-inflammatory effect.

  12. Protective Effects of Lemon Juice on Alcohol-Induced Liver Injury in Mice. (United States)

    Zhou, Tong; Zhang, Yu-Jie; Xu, Dong-Ping; Wang, Fang; Zhou, Yue; Zheng, Jie; Li, Ya; Zhang, Jiao-Jiao; Li, Hua-Bin


    Chronic excessive alcohol consumption (more than 40-80 g/day for males and more than 20-40 g/day for females) could induce serious liver injury. In this study, effects of lemon juice on chronic alcohol-induced liver injury in mice were evaluated. The serum biochemical profiles and hepatic lipid peroxidation levels, triacylglycerol (TG) contents, antioxidant enzyme activities, and histopathological changes were examined for evaluating the hepatoprotective effects of lemon juice in mice. In addition, the in vitro antioxidant capacities of lemon juice were determined. The results showed that lemon juice significantly inhibited alcohol-induced increase of alanine transaminase (ALT), aspartate transaminase (AST), hepatic TG, and lipid peroxidation levels in a dose-dependent manner. Histopathological changes induced by alcohol were also remarkably improved by lemon juice treatment. These findings suggest that lemon juice has protective effects on alcohol-induced liver injury in mice. The protective effects might be related to the antioxidant capacity of lemon juice because lemon juice showed in vitro antioxidant capacity.

  13. Protective effect of aqueous jujube extract in Carbamazepine induced teratogenicity on Balb/c mice fetuses

    Directory of Open Access Journals (Sweden)

    Doostabadi Mohammadreza


    Full Text Available Aim: Carbamazepine (CBZ is an anticonvulsant medication that can produce congenital anomalies. This study aimed to assess protective role of aqueous jujube extract (JE on CBZ induced congenital anomalies in mice fetuses. Methods:One hundred pregnant Balb/c mice were divided into 8 experimental (E and 2 control (C groups equally. The groups (E1, E5, E6 and (E2, E7, E8 received 50 and 100 mg/kg of CBZ, respectively IP, from GD 0 to GD15. Besides, groups (E5, E7 and (E6, E8 in addition to CBZ, were treated with 200 and 400 mg/kg JE, respectively from ten days prior to gestation, till GD15. The groups E3 and E4 received only 200 and 400 mg/kg of JE respectively. The control groups (C1, C2 received normal saline and tween-20 in turn. On GD18 dams cesarianed and their fetuses assessed for skeletal anomalies by using Alizarin red-alcian blue staining. Results:CBZ induced various anomalies such as; limb defects, craniofacial malformations and etc in mice fetuses. However, these anomalies significantly decreased in groups which were co-administered with CBZ and JE. Conclusion: Co-administration of JE and CBZ significantly decrease teratogenicity of CBZ. Therefore, JE may play a protective role against those properties of CBZ inducing teratogenicity

  14. Ethanol extracts of Scutellaria baicalensis protect against lipopolysaccharide-induced acute liver injury in mice

    Institute of Scientific and Technical Information of China (English)

    Hai Nguyen Thanh; Hue Pham Thi Minh; Tuan Anh Le; Huong Duong Thi Ly; Tung Nguyen Huu; Loi Vu Duc; Thu Dang Kim; Tung Bui Thanh


    To investigated the protective potential of ethanol extracts of Scutellaria baicalensis (S. baicalensis ) against lipopolysaccharide (LPS)-induced liver injury. Methods: Dried roots of S. baicalensis were extracted with ethanol and concentrated to yield a dry residue. Mice were administered 200 mg/kg of the ethanol extracts orally once daily for one week. Animals were subsequently administered a single dose of LPS (5 mg/kg of body weight, intraperitoneal injection). Both protein and mRNA levels of cytokines, such as tumor necrosis factor alpha, interleukin-1β, and interleukin-6 in liver tissues were evaluated by ELISA assay and quantitative PCR. Cyclooxygenase-2, inducible nitric oxide synthase, and nuclear factor-κB protein levels in liver tissues were analyzed by western blotting. Results: Liver injury induced by LPS significantly increased necrosis factor alpha, interleukin-1β, interleukin-6, cyclooxygenase-2, inducible nitric oxide synthase, and nuclear factor-κB in liver tissues. Treatment with ethanol extracts of S. baicalensis prevented all of these observed changes associated with LPS-induced injury in liver mice. Conclusions: Our study showed that S. baicalensis is potentially protective against LPS-induced liver injury in mice.

  15. Protective Effects of Apigenin Against Paraquat-Induced Acute Lung Injury in Mice. (United States)

    Luan, Rui-Ling; Meng, Xiang-Xi; Jiang, Wei


    This study aimed to investigate the protective effects of apigenin against paraquat (PQ)-induced acute lung injury (ALI) in mice. Male Kunming mice were randomly divided into five groups: group 1 (control), group 2 (PQ), group 3 (PQ + apigenin 25 mg/kg), group 4 (PQ + apigenin 50 mg/kg), and group 5 (PQ + apigenin 100 mg/kg). The PQ + apigenin group received apigenin by gavage daily for consecutive 7 days, respectively, while the mice in control and PQ groups were given an equivalent volume of saline. We detected the lung wet/dry weight ratios and the histopathology of the lung. The levels of interleukin-6 (IL-6), tumor necrosis factor-alpha (TNF-α), malondialdehyde (MDA), myeloperoxidase (MPO), superoxide dismutase (SOD), and glutathione peroxidase (GSH-Px) were determined using enzyme-linked immunosorbent assay (ELISA) kits. The activity of nuclear factor (NF)-κB was also determined. The results indicated that apigenin administration decreased biochemical parameters of inflammation and oxidative stress, and improved oxygenation and lung edema in a dose-dependent manner. These protective effects of apigenin were associated with inhibition of NF-κB. In conclusion, apigenin reduces PQ-induced ALI by inhibition of inflammation and oxidative stress.

  16. Protective Effect of Silymarin against Acrolein-Induced Cardiotoxicity in Mice

    Directory of Open Access Journals (Sweden)

    Elahe Taghiabadi


    Full Text Available Reactive α,β-unsaturated aldehydes such as acrolein (ACR are major components of environmental pollutants and have been implicated in the neurodegenerative and cardiac diseases. In this study, the protective effect of silymarin (SN against cardiotoxicity induced by ACR in mice was evaluated. Studies were performed on seven groups of six animals each, including vehicle-control (normal saline + 0.5% w/v methylcellulose, ACR (7.5 mg/kg/day, gavage for 3 weeks, SN (25, 50 and 100 mg/kg/day, i.p. plus ACR, vitamin E (Vit E, 100 IU/kg, i.p. plus ACR, and SN (100 mg/kg, i.p. groups. Mice received SN 7 days before ACR and daily thereafter throughout the study. Pretreatment with SN attenuated ACR-induced increased levels of malondialdehyde (MDA, serum cardiac troponin I (cTnI, and creatine kinase-MB (CK-MB, as well as histopathological changes in cardiac tissues. Moreover, SN improved glutathione (GSH content, superoxide dismutase (SOD, and catalase (CAT activities in heart of ACR-treated mice. Western blot analysis showed that SN pretreatment inhibited apoptosis provoked by ACR through decreasing Bax/Bcl-2 ratio, cytosolic cytochrome c content, and cleaved caspase-3 level in heart. In conclusion, SN may have protective effects against cardiotoxicity of ACR by reducing lipid peroxidation, renewing the activities of antioxidant enzymes, and preventing apoptosis.

  17. Ethanol extracts of Scutellaria baicalensis protect against lipopolysaccharide-induced acute liver injury in mice

    Institute of Scientific and Technical Information of China (English)

    Hai; Nguyen; Thanh; Hue; Pham; Thi; Minh; Tuan; Anh; Le; Huong; Duong; Thi; Ly; Tung; Nguyen; Huu; Loi; Vu; Duc; Thu; Dang; Kim; Tung; Bui; Thanh


    Objective: To investigated the protective potential of ethanol extracts of Scutellaria baicalensis(S. baicalensis) against lipopolysaccharide(LPS)-induced liver injury. Methods: Dried roots of S. baicalensis were extracted with ethanol and concentrated to yield a dry residue. Mice were administered 200 mg/kg of the ethanol extracts orally once daily for one week. Animals were subsequently administered a single dose of LPS(5 mg/kg of body weight, intraperitoneal injection). Both protein and m RNA levels of cytokines, such as tumor necrosis factor alpha, interleukin-1β, and interleukin-6 in liver tissues were evaluated by ELISA assay and quantitative PCR. C yclooxygenase-2, inducible nitric oxide synthase, and nuclear factor-κB protein levels in liver tissues were analyzed by western blotting. Results: Liver injury induced by LPS signifi cantly increased necrosis factor alpha, interleukin-1β, interleukin-6, cyclooxygenase-2, inducible nitric oxide synthase, and nuclear factor-κB in liver tissues. Treatment with ethanol extracts of S. baicalensis prevented all of these observed changes associated with LPS-induced injury in liver mice.Conclusions: Our study showed that S. baicalensis is potentially protective against LPS-induced liver injury in mice.

  18. Protective effects of hydrogen sulfide anions against acetaminophen-induced hepatotoxicity in mice. (United States)

    Ishii, Isao; Kamata, Shotaro; Hagiya, Yoshifumi; Abiko, Yumi; Kasahara, Tadashi; Kumagai, Yoshito


    The key mechanism for hepatotoxicity resulting from acetaminophen (APAP) overdose is cytochrome P450-dependent formation of N-acetyl-p-benzoquinone imine (NAPQI), a potent electrophilic metabolite that forms protein adducts. The fundamental roles of glutathione in the effective conjugation/clearance of NAPQI have been established, giving a molecular basis for the clinical use of N-acetylcysteine as a sole antidote. Recent evidence from in vitro experiments suggested that sulfide anions (S(2-)) to yield hydrogen sulfide anions (HS(-)) under physiological pH could effectively react with NAPQI. This study evaluated the protective roles of HS(-) against APAP-induced hepatotoxicity in mice. We utilized cystathionine γ-lyase-deficient (Cth(-/-)) mice that are highly sensitive to acetaminophen toxicity. Intraperitoneal injection of acetaminophen (150 mg/kg) into Cth(-/-) mice resulted in highly elevated levels of serum alanine/aspartate aminotransferases and lactate dehydrogenase associated with marked increases in oncotic hepatocytes; all of which were significantly inhibited by intraperitoneal preadministration of sodium hydrosulfide (NaHS). NaHS preadministration significantly suppressed APAP-induced serum malondialdehyde level increases without abrogating APAP-induced rapid depletion of hepatic glutathione. These results suggest that exogenous HS(-) protects hepatocytes by directly scavenging reactive NAPQI rather than by increasing cystine uptake and thereby elevating intracellular glutathione levels, which provides a novel therapeutic approach against acute APAP poisoning.

  19. Direct transfer of A20 gene into pancreas protected mice from streptozotocin-induced diabetes

    Institute of Scientific and Technical Information of China (English)

    Lu-yang YU; Bo LIN; Zhen-lin ZHANG; Li-he GUO


    AIM: To investigate the efficiency of transfer of A20 gene into pancreas against STZ-induced diabetes. METHODS:PVP-plasmid mixture was directly transferred into the pancreatic parenchyma 2 d before STZ injection. The uptake of plasmid pcDNA3-LacZ or pcDNA3-A20 was detected by PCR and the expression of LacZ was confirmed by histological analysis with X-gal. A20 expression in the pancreas of pcDNA3-A20 transgenic mice was measured by RT-PCR and Westem blots. Urine amylase, NO generation, and histological examination were examined. RESULTS:Injection of PVP-plasmid mixture directly into the pancreatic parenchyma increased urine amylase concentration 16 h after operation and reversed it to nearly normal 36 h later. On d 33 LacZ expression could be found in spleen,duodenum, and islets. The development of diabetes was prevented by direct A20 gene transferring into the pancreas and A20-mediated protection was correlated with suppression of NO production. The insulitis was ameliorated in A20-treated mice. CONCLUSION: Injection of PVP-plasmid mixture directly into the pancreatic parenchyma led to target gene expression in islets. Direct transfer of A20 gene into the pancreas protected mice from STZ-induced diabetes.

  20. Protective Effect of Isorhamnetin on Lipopolysaccharide-Induced Acute Lung Injury in Mice. (United States)

    Yang, Bo; Li, Xiao-Ping; Ni, Yun-Feng; Du, Hong-Yin; Wang, Rong; Li, Ming-Jiang; Wang, Wen-Chen; Li, Ming-Ming; Wang, Xu-Hui; Li, Lei; Zhang, Wei-Dong; Jiang, Tao


    Isorhamnetin has been reported to have anti-inflammatory, anti-oxidative, and anti-proliferative effects. The aim of this study was to investigate the protective effect of isorhamnetin on lipopolysaccharide (LPS)-induced acute lung injury (ALI) in mice by inhibiting the expression of cyclooxygenase-2 (COX-2). The effects of isorhamnetin on LPS-induced lung pathological damage, wet/dry ratios and the total protein level in bronchoalveolar lavage fluid (BALF), inflammatory cytokine release, myeloperoxidase (MPO) and superoxide dismutase (SOD) activities, and malondialdehyde (MDA) level were examined. In addition, the COX-2 activation in lung tissues was detected by Western blot. Isorhamnetin pretreatment improved the mice survival rates. Moreover, isorhamnetin pretreatment significantly attenuated edema and the pathological changes in the lung and inhibited protein extravasation in BALF. Isorhamnetin also significantly decreased the levels of inflammatory cytokines in BALF. In addition, isorhamnetin markedly prevented LPS-induced oxidative stress. Furthermore, isorhamnetin pretreatment significantly suppressed LPS-induced activation of COX-2. Isorhamnetin has been demonstrated to protect mice from LPS-induced ALI by inhibiting the expression of COX-2.

  1. Protective effects of Moringa oleifera Lam. leaves against arsenic-induced toxicity in mice

    Institute of Scientific and Technical Information of China (English)

    Afzal Sheikh; Zahangir Alam Saud; Khaled Hossain; Fouzia Yeasmin; Smita Agarwal; Mashiur Rahman; Khairul Islam; Ekhtear Hossain; Shakhawoat Hossain; Md Rezaul Karim; Farjana Nikkon


    Objective: To evaluate the protective role of leaves of Moringa oleifera (M. oleifera) Lam. against arsenic-induced toxicity in mice.Methods:non-treated control group while, the second, third, and fourth groups were treated with M.oleifera leaves (50 mg/kg body weight per day), sodium arsenite (10 mg/kg body weight per day) and sodium arsenite plus M. oleifera leaves, respectively. Serum indices related to cardiac, liver and renal functions were analyzed to evaluate the protective effect of Moringa leaves on arsenic-induced effects in mice.Results:Swiss albino male mice were divided into four groups. The first group was used as induced elevation of triglyceride, glucose, urea and the activities of alkaline phospatase, aspartate aminotransferase and alanine aminotransferase in serum. M. oleifera leaves also prevented the arsenic-induced perturbation of serum butyryl cholinesterase activity, total cholesterol and high density lipoprotein cholesterol.Conclusions:The results indicate that the leaves of M. oleifera may be useful in reducing the It revealed that food supplementation of M. oleifera leaves abrogated the arsenic-effects of arsenic-induced toxicity.

  2. Active immunizations with peptide-DC vaccines and passive transfer with antibodies protect neutropenic mice against disseminated candidiasis. (United States)

    Xin, Hong


    We previously report that peptide-pulsed dendritic cell (DC) vaccination, which targeting two peptides (Fba and Met6) expressed on the cell surface of Candida albicans, can induce high degree of protection against disseminated candidiasis in immunocompetent mice. Passive transfer of immune sera from the peptide immunized mice or peptide-related monoclonal antibodies demonstrated that protection was medicated by peptide-specific antibodies. In this study the efficacy of active and passive immunization against disseminated candidiasis was tested in mice with cyclophosphamide-induced neutropenia. Peptide-DC vaccines were given to mice prior to induction of neutropenia. We show active immunization with either Fba or Met6 peptide-DC vaccine significantly improved the survival and reduced the fungal burden of disseminated candidiasis in those immunocompromised mice. Importantly, we show that administration of two protective monoclonal antibodies also protect neutropenic mice against the disease, implying possibility of developing a successful passive immunotherapy strategy to treat the disease and protect against disseminated candidiasis. The results of this study are crucial as they address the fundamental questions as to whether the synthetic peptide vaccine induced immunity protects the host during a neutropenic episode. We anticipate that this peptide-vaccine study will serve as the foundation of future investigations into new peptide vaccines comprised of cell surface peptides from other medically important Candida species, as well as other fungi.

  3. Glutathione reductase targeted to type II cells does not protect mice from hyperoxic lung injury. (United States)

    Heyob, Kathryn M; Rogers, Lynette K; Welty, Stephen E


    Exposure of the lung epithelium to reactive oxygen species without adequate antioxidant defenses leads to airway inflammation, and may contribute to lung injury. Glutathione peroxidase catalyzes the reduction of peroxides by oxidation of glutathione (GSH) to glutathione disulfide (GSSG), which can in turn be reduced by glutathione reductase (GR). Increased levels of GSSG have been shown to correlate negatively with outcome after oxidant exposure, and increased GR activity has been protective against hyperoxia in lung epithelial cells in vitro. We tested the hypothesis that increased GR expression targeted to type II alveolar epithelial cells would improve outcome in hyperoxia-induced lung injury. Human GR with a mitochondrial targeting sequence was targeted to mouse type II cells using the SPC promoter. Two transgenic lines were identified, with Line 2 having higher lung GR activities than Line 1. Both transgenic lines had lower lung GSSG levels and higher GSH/GSSG ratios than wild-type. Six-week-old wild-type and transgenic mice were exposed to greater than 95% O2 or room air (RA) for 84 hours. After exposure, Line 2 mice had higher right lung/body weight ratios and lavage protein concentrations than wild-type mice, and both lines 1 and 2 had lower GSSG levels than wild-type mice. These findings suggest that GSSG accumulation in the lung may not play a significant role in the development of hyperoxic lung injury, or that compensatory responses to unregulated GR expression render animals more susceptible to hyperoxic lung injury.

  4. Protective effect of mango (Mangifera indica L.) against UVB-induced skin aging in hairless mice. (United States)

    Song, Jae Hyoung; Bae, Eun Young; Choi, Goya; Hyun, Jin Won; Lee, Mi Young; Lee, Hye Won; Chae, Sungwook


    Mangifera indica L. (Anacardiaceae) is a medicinal plant whose extracts have been described as an antioxidant with anti-inflammatory and immunomodulatory activities. Skin aging is a consequence of chronic sun exposure to the sun and therefore ultraviolet (UV) radiation. Naturally occurring antioxidants are known to reduce skin aging. Therefore, the aim of the present study was to evaluate the protective role of mango extract against UVB-induced skin aging in hairless mice. HR-1 hairless male mice (6 weeks old) were divided into three groups: control (n = 5), UVB-treated vehicle (n = 5), and UVB-treated mango extract (n = 5) groups. UVB-irradiated mice from the mango extract group were orally administered 0.1 ml of water containing 100 mg of mango extract/kg body weight per day. The inhibitory activity of mango extract on wrinkle formation was determined by the analysis of the skin replica, epidermal thickness based on histological examination, and damage to collagen fiber. The mean length of wrinkles in UVB-treated vehicle group significantly improved after the oral administration of mango extract, which significantly inhibited the increase in epidermal thickness and epidermal hypertrophy (P mango extract by Masson's trichrome staining. These results indicate that mango extract showed anti-photoaging activity in UVB-irradiated hairless mice. © 2013 John Wiley & Sons A/S.

  5. Protective effect of alpha-linolenic acid on gentamicin-induced ototoxicity in mice. (United States)

    Kaplan, Halil Mahir; Şingirik, Ergin; Erdoğan, Kıvılcım Eren; Doran, Figen


    Alpha-linolenic acid is one of the fatty acids known as omega 3. Previous studies have shown the antioxidant and anti-inflammatory effects of alpha-linolenic acid, which prevented cell damage by inhibiting apoptotic pathway. Also, it is known that gentamicin activates apoptotic mediators and causes necrosis in the kidney. Due to this reason, we planned a study to evaluate the protective effects of alpha-linolenic acid on gentamicin induced ototoxicity by evaluating inflammation and apoptotic mediators. For this purpose, 100 mg/kg gentamicin (i.p; intraperitoneally) and 200 mg/kg alpha-linolenic acid (gavage) are administered to mice for 9 days. On 9th and 10th days, rotarod performance was assessed to test the effect of gentamicin and alpha-linolenic acid treatment on the motor coordination of mice. Gentamicin treatment decreased fall latency of mice and gentamicin treatment together with alpha-linolenic acid increased fall latency of mice. Gentamicin treatment also increased expression of phospholipase A2(plA2), cyclooxygenase-2(COX-2) and inducible nitric oxide syntheses (iNOS). Furthermore, it increased Bax and caspase-3, which are proapoptotic proteins and decreased bcl-2 that is an antiapoptotic protein. Gentamicin treatment together alpha-linolenic acid recovered the change of expression of these enzymes. In conclusion, this study showed that alpha-linolenic acid will be useful to prevent gentamicin-induced ototoxicity by inhibiting apoptosis and inflammation.

  6. Protection of zonisamide induced memory impairment by tulsi extract and piracetam on mice

    Directory of Open Access Journals (Sweden)

    Shraddha J Bennadi


    Full Text Available Background: Memory impairment is the major adverse effects associated with antiepileptic drug therapy. This study was designed to assess the memory impairment activity of zonisamide (ZNS, an antiepileptic drug, in mice. Memory deficit potential of ZNS was compared with phenytoin (PHT, a standard antiepileptic known for its memory impairment activity. The protective effect of Ocimum sanctum extract (OS and piracetam (PIR on memory impairment induced by ZNS was also assessed. Materials and Methods: ZNS was administered orally for 29 days and the extent of memory deficit was evaluated by Morris water maze (MWM test on maximal electro shock-induced epileptic mice. The animals were observed for escape latency time (ELT and time spent in target quadrant (TSTQ on MWM test. The brain acetylcholinesterase level was estimated to determine the brain acetylcholine concentration. Result: Chronic administration of ZNS has shown memory deficit in mice and this was significantly restored by co-administration of OS extract and PIR. PIR showed best nootropic activity, whereas OS showed good nootropic as well as synergistic anti-convulsant activity. Conclusion: This study reveals that chronic administration of ZNS produces memory impairment in mice, which can be significantly minimized by co-administration of OS extract and PIR without compromising on ZNS antiepileptic potency. These results provide evidence for potential corrective effect of nootropics in cognitive deficit associated with ZNS.

  7. Extract of Rhus verniciflua stokes protects the diet-induced hyperlipidemia in mice. (United States)

    Jeong, Se-Jin; Park, Jong-Gil; Kim, Sinai; Kweon, Hyae Yon; Seo, Seungwoon; Na, Dae-Seung; Lee, Dongho; Hong, Cheol Yi; Na, Chun-Soo; Dong, Mi-Sook; Oh, Goo Taeg


    Rhus verniciflua stokes (RVS) is a popular medicinal plant in oriental medicines which is commonly used to resolve extravasated blood. To elucidate the molecular mechanism of the role of RVS extracts on the regulation of lipid and cholesterol biosynthesis, we investigated whether RVS extract protect the hyperlipidemia in western diet-induced C57BL6/J mice. Mice fed a western diet and additionally RVS extracts was administered orally at a dose of 0.1 or 1 g/kg/day for 2 weeks respectively. Group with higher dose of RVS extract showed a significantly decreased body weight compared with western diet fed mice groups. And total cholesterol, LDL-cholesterol levels and fatty liver formation were also improved especially in group of mice fed western diet supplemented high dose RVS extracts. Next, synthesis of hepatic bile acids were significantly increased in RVS extract fed groups. Furthermore, RVS extracts significantly increase promoter activity of Cyp7a1 via up-regulate the transcriptional expression level of LXRα. Our data suggest that RVS extracts could be a potent therapeutic ingredient for prevent a hyperlipidemia via increase of bile acids biosynthesis.

  8. Fisetin protects against hepatosteatosis in mice by inhibiting miR-378. (United States)

    Jeon, Tae-Il; Park, Jin Wook; Ahn, Jiyun; Jung, Chang Hwa; Ha, Tae Youl


    Lipid homeostasis in vertebrates is regulated at many levels including synthesis, degradation, and distribution. MicroRNAs (miRNAs) are key regulators of lipid homeostasis. The use of phytochemicals to target miRNA (miR) could provide new therapeutic approaches to human diseases. Thus, we investigated the regulation of lipid metabolism by the flavonoid fisetin during experimental analysis of hepatic miRs in mice. Mice were separated into three groups. One group was maintained on the normal diet and the other two groups were fed either a high-fat (HF) diet or HF supplemented with fisetin. We found that fisetin lowered hepatic fat accumulation in HF mice and reversed abnormal expressions of lipid metabolism genes. The co-expression of miR-378 and its host gene PGC-1β was significantly induced by HF, whereas fisetin prevented the induction of both genes. We also identified nuclear respiratory factor-1 (NRF-1), a critical regulator of the mitochondrial function, as a direct target of miR-378. Dietary fisetin protects against hepatosteatosis in association with modulation of lipid metabolism genes and miR-378 in mice. These observations suggest that the use of fisetin to target miRs could be an effective prevention or intervention against metabolic diseases. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Electromagnetic field treatment protects against and reverses cognitive impairment in Alzheimer's disease mice. (United States)

    Arendash, Gary W; Sanchez-Ramos, Juan; Mori, Takashi; Mamcarz, Malgorzata; Lin, Xiaoyang; Runfeldt, Melissa; Wang, Li; Zhang, Guixin; Sava, Vasyl; Tan, Jun; Cao, Chuanhai


    Despite numerous studies, there is no definitive evidence that high-frequency electromagnetic field (EMF) exposure is a risk to human health. To the contrary, this report presents the first evidence that long-term EMF exposure directly associated with cell phone use (918 MHz; 0.25 w/kg) provides cognitive benefits. Both cognitive-protective and cognitive-enhancing effects of EMF exposure were discovered for both normal mice and transgenic mice destined to develop Alzheimer's-like cognitive impairment. The cognitive interference task utilized in this study was designed from, and measure-for-measure analogous to, a human cognitive interference task. In Alzheimer's disease mice, long-term EMF exposure reduced brain amyloid-beta (Abeta) deposition through Abeta anti-aggregation actions and increased brain temperature during exposure periods. Several inter-related mechanisms of EMF action are proposed, including increased Abeta clearance from the brains of Alzheimer's disease mice, increased neuronal activity, and increased cerebral blood flow. Although caution should be taken in extrapolating these mouse studies to humans, we conclude that EMF exposure may represent a non-invasive, non-pharmacologic therapeutic against Alzheimer's disease and an effective memory-enhancing approach in general.

  10. Protective effect of speman on cisplatin-induced testicular and epididymal toxicity in mice

    Directory of Open Access Journals (Sweden)

    S B Sainath


    Full Text Available Testicular cancer is the most common cancer affecting men of reproductive age. Advances in treatment of the disease, which includes the administration of cisplatin, have brought the 5-year survival rate to over 90%. This high cure rate, coupled with young age of patients, makes elucidation of the impact of the treatment on reproduction become increasingly important. The objective of the present study was to investigate the protective effect of speman, a non-hormonal herbal formulation, on cisplatin-induced suppressed male reproductive health in mice. Male mice were treated with cisplatin or speman alone or in combination and assessed for spermatogenesis and steroidogenesis. Significant decrease in the weights of testes and epididymis was observed in cisplatin treated animals. Injection of cisplatin significantly decreased epididymal sperm count, viable sperms, motile sperms and hypo-osmotic swelling (HOS-tail coiled sperms with a significant reduction in the testicular steroidogenic enzyme activities and serum testosterone levels, whereas co-administration of speman with cisplatin showed a significant improvement in the selected reproductive parameters over cisplatin alone treated mice indicating the beneficial effect of speman to combat cisplatin-induced suppressed reproduction in male mice.

  11. Administration of kefir-fermented milk protects mice against Giardia intestinalis infection. (United States)

    Franco, Mariana Correa; Golowczyc, Marina A; De Antoni, Graciela L; Pérez, Pablo F; Humen, Martín; Serradell, María de los Angeles


    Giardiasis, caused by the protozoan Giardia intestinalis, is one of the most common intestinal diseases worldwide and constitutes an important problem for the public health systems of various countries. Kefir is a probiotic drink obtained by fermenting milk with 'kefir grains', which consist mainly of bacteria and yeasts that coexist in a complex symbiotic association. In this work, we studied the ability of kefir to protect mice from G. intestinalis infection, and characterized the host immune response to this probiotic in the context of the intestinal infection. Six- to 8-week-old C75BL/6 mice were separated into four groups: controls, kefir mice (receiving 1 : 100 dilution of kefir in drinking water for 14 days), Giardia mice (infected orally with 4×10(7) trophozoites of G. intestinalis at day 7) and Giardia-kefir mice (kefir-treated G. intestinalis-infected mice), and killed at 2 or 7 days post-infection. Kefir administration was able to significantly reduce the intensity of Giardia infection at 7 days post-infection. An increase in the percentage of CD4(+) T cells at 2 days post-infection was observed in the Peyer's patches (PP) of mice belonging to the Giardia group compared with the control and kefir groups, while the percentage of CD4(+) T cells in PP in the Giardia-kefir group was similar to that of controls. At 2 days post-infection, a reduction in the percentage of B220-positive major histocompatibility complex class II medium cells in PP was observed in infected mice compared with the other groups. At 7 days post-infection, Giardia-infected mice showed a reduction in RcFcε-positive cells compared with the control group, suggesting a downregulation of the inflammatory response. However, the percentages of RcFcε-positive cells did not differ from controls in the kefir and Giardia-kefir groups. An increase in IgA-positive cells was observed in the lamina propria of the kefir group compared with controls at 2 days post-infection. Interestingly, the

  12. Sustained protection in mice immunized with fractional doses of Salmonella Enteritidis core and O polysaccharide-flagellin glycoconjugates.

    Directory of Open Access Journals (Sweden)

    Raphael Simon

    Full Text Available Non-typhoidal Salmonella (NTS serovars S. Enteritidis and S. Typhimurium are a major cause of invasive bacterial disease (e.g., bacteremia, meningitis in infants and young children in sub-Saharan Africa and also occasionally cause invasive disease in highly susceptible hosts (young infants, the elderly, and immunocompromised subjects in industrialized countries. No licensed vaccines exist against human NTS infections. NTS core and O polysaccharide (COPS and FliC (Phase 1 flagellin subunits each constitute protective antigens in murine models. S. Enteritidis COPS conjugated to FliC represents a promising vaccine approach that elicits binding and opsonophagocytic antibodies and protects mice against lethal challenge with virulent S. Enteritidis. We examined the protective efficacy of fractional dosages of S. Enteritidis COPS:FliC conjugate vaccines in mice, and also established that protection can be passively transferred to naïve mice by administering sera from mice immunized with conjugate. Mice were immunized with three doses of either 10 µg, 2.5 µg (full dose, 0.25 µg, or 0.025 µg S. Enteritidis COPS:FliC conjugate at 28 day intervals. Antibody titers to COPS and FliC measured by ELISA fell consonant with progressively smaller vaccine dosage levels; anti-FliC IgG responses remained robust at fractional dosages for which anti-COPS serum IgG titers were decreased. Nevertheless, >90% protection against intraperitoneal challenge was observed in mice immunized with fractional dosages of conjugate that elicited diminished titers to both FliC and COPS. Passive transfer of immune sera from mice immunized with the highest dose of COPS:FliC to naïve mice was also protective, demonstrating the role of antibodies in mediating protection. These results provide important insights regarding the potency of Salmonella glycoconjugate vaccines that use flagellin as a carrier protein.

  13. Protective effects ofCuminum cyminum L. essential oil on ethylene glycol induced nephrolithiasis in mice

    Institute of Scientific and Technical Information of China (English)

    Ehsanollah Sakhaee; Reza Kheirandish; Sepideh Eshaghi


    Objective:To investigate the protective effect ofCuminum cyminum (C. cyminum) essential oil on ethylene glycol induced nephrolithiasis in mice. Methods:The study comprised of the following four different groups of six mice: ethylene glycol group,C. cyminum group, treatment group and normal group. The levels of blood urea nitrogen and creatinine were analyzed and the kidney samples from all the animals of each group were stained with haematoxylin and eosin. Results: Treatment group revealed mild tubular degeneration without formation of calcium oxalate crystals and protein deposition. There were no significant differences between serum levels of blood urea nitrogen and creatinine in treatment and normal groups. Conclusions:It seems thatC. cyminum essential oil significantly decreased formation of calcium oxalate crystals and the growth of renal calculi in different parts of the tubules.

  14. Protective effects of Cuminum cyminum L. essential oil on ethylene glycol induced nephrolithiasis in mice

    Directory of Open Access Journals (Sweden)

    Ehsanollah Sakhaee


    Full Text Available Objective: To investigate the protective effect of Cuminum cyminum (C. cyminum essential oil on ethylene glycol induced nephrolithiasis in mice. Methods: The study comprised of the following four different groups of six mice: ethylene glycol group, C. cyminum group, treatment group and normal group. The levels of blood urea nitrogen and creatinine were analyzed and the kidney samples from all the animals of each group were stained with haematoxylin and eosin. Results: Treatment group revealed mild tubular degeneration without formation of calcium oxalate crystals and protein deposition. There were no significant differences between serum levels of blood urea nitrogen and creatinine in treatment and normal groups. Conclusions: It seems that C. cyminum essential oil significantly decreased formation of calcium oxalate crystals and the growth of renal calculi in different parts of the tubules.

  15. Protective Effect of Salidroside from Rhodiolae Radix on Diabetes-Induced Oxidative Stress in Mice

    Directory of Open Access Journals (Sweden)

    Yong Peng


    Full Text Available It has been confirmed that diabetes mellitus (DM carries increased oxidative stress. This study evaluated the effects of salidroside from Rhodiolae Radix on diabetes-induced oxidative stress in mice. After induction of diabetes, diabetic mice were administered daily doses of 50, 100 and 200 mg/kg salidroside for 28 days. Body weights, fasting blood glucose (FBG, serum insulin, TC (total cholesterol, TG (triglyceride, malondialdehyde (MDA, superoxide dismutase (SOD, glutathione peroxidase (GPx and catalase (CAT were measured. Results showed that salidroside possessed hypoglycemic activity and protective effects against diabetes-induced oxidative stress, which could significantly reduce FBG, TC, TG and MDA levels, and at same time increase serum insulin levels, SOD, GPx and CAT activities. Therefore, salidroside should be considered as a candidate for future studies on diabetes.

  16. Irsogladine maleate, a gastric mucosal protectant, suppresses intestinal polyp development in Apc-mutant mice (United States)

    Onuma, Wakana; Tomono, Susumu; Miyamoto, Shinngo; Fujii, Gen; Hamoya, Takahiro; Fujimoto, Kyoko; Miyoshi, Noriyuki; Fukai, Fumio; Wakabayashi, Keiji; Mutoh, Michihiro


    This study aimed to identify gastric mucosal protectants that suppress intestinal tumorigenesis in a mouse model. We chose six gastric mucosal protectants (ecabet sodium hydrate, irsogladine maleate, rebamipide, sofalcone, teprenone and troxipide) and examined their effects on the activity of oxidative stress-related transcriptional factors, including AP-1, NF-jB, NRF2, p53 and STAT3, in Caco-2 cells using a luciferase reporter gene assay. Among the six protectants, irsogladine maleate clearly inhibited NF-jB and AP-1 transcriptional activity. Furthermore, the chemopreventive property of irsogladine maleate was examined in a Min mouse model of familial adenomatous polyposis. Treatment with irsogladine maleate at doses of 5 and 50 ppm significantly reduced the number of intestinal polyps to 69% and 66% of the untreated control value, respectively. In these polyps, mRNA levels of the downstream targets of NF-jB, such as IL-1β and IL-6, were decreased by irsogladine maleate treatment. Moreover, the levels of oxidative stress-related markers, reactive carbonyl species, in the livers of Min mice were clearly decreased following the administration of irsogladine maleate. This study demonstrated that irsogladine maleate suppresses intestinal polyp formation in Min mice partly through the NF-jB signaling pathway, thus reducing oxidative stress. PMID:26840084

  17. Irsogladine maleate, a gastric mucosal protectant, suppresses intestinal polyp development in Apc-mutant mice. (United States)

    Onuma, Wakana; Tomono, Susumu; Miyamoto, Shinngo; Fujii, Gen; Hamoya, Takahiro; Fujimoto, Kyoko; Miyoshi, Noriyuki; Fukai, Fumio; Wakabayashi, Keiji; Mutoh, Michihiro


    This study aimed to identify gastric mucosal protectants that suppress intestinal tumorigenesis in a mouse model. We chose six gastric mucosal protectants (ecabet sodium hydrate, irsogladine maleate, rebamipide, sofalcone, teprenone and troxipide) and examined their effects on the activity of oxidative stress-related transcriptional factors, including AP-1, NF-jB, NRF2, p53 and STAT3, in Caco-2 cells using a luciferase reporter gene assay. Among the six protectants, irsogladine maleate clearly inhibited NF-jB and AP-1 transcriptional activity. Furthermore, the chemopreventive property of irsogladine maleate was examined in a Min mouse model of familial adenomatous polyposis. Treatment with irsogladine maleate at doses of 5 and 50 ppm significantly reduced the number of intestinal polyps to 69% and 66% of the untreated control value, respectively. In these polyps, mRNA levels of the downstream targets of NF-jB, such as IL-1β and IL-6, were decreased by irsogladine maleate treatment. Moreover, the levels of oxidative stress-related markers, reactive carbonyl species, in the livers of Min mice were clearly decreased following the administration of irsogladine maleate. This study demonstrated that irsogladine maleate suppresses intestinal polyp formation in Min mice partly through the NF-jB signaling pathway, thus reducing oxidative stress.

  18. Thymosin Beta 4 protects mice from monocrotaline-induced pulmonary hypertension and right ventricular hypertrophy.

    Directory of Open Access Journals (Sweden)

    Chuanyu Wei

    Full Text Available Pulmonary hypertension (PH is a progressive vascular disease of pulmonary arteries that impedes ejection of blood by the right ventricle. As a result there is an increase in pulmonary vascular resistance and pulmonary arterial pressure causing right ventricular hypertrophy (RVH and RV failure. The pathology of PAH involves vascular cell remodeling including pulmonary arterial endothelial cell (PAEC dysfunction and pulmonary arterial smooth muscle cell (PASMC proliferation. Current therapies are limited to reverse the vascular remodeling. Investigating a key molecule is required for development of new therapeutic intervention. Thymosin beta-4 (Tβ4 is a ubiquitous G-actin sequestering protein with diverse biological function and promotes wound healing and modulates inflammatory responses. However, it remains unknown whether Tβ4 has any protective role in PH. The purpose of this study is to evaluate the whether Tβ4 can be used as a vascular-protective agent. In monocrotaline (MCT-induced PH mouse model, we showed that mice treated with Tβ4 significantly attenuated the systolic pressure and RVH, compared to the MCT treated mice. Our data revealed for the first time that Tβ4 selectively targets Notch3-Col 3A-CTGF gene axis in preventing MCT-induced PH and RVH. Our study may provide pre-clinical evidence for Tβ4 and may consider as vasculo-protective agent for the treatment of PH induced RVH.

  19. The protective and therapeutic effects of alpha-solanine on mice breast cancer. (United States)

    Mohsenikia, Maryam; Alizadeh, Ali Mohammad; Khodayari, Saeed; Khodayari, Hamid; Kouhpayeh, Seyed Amin; Karimi, Aliasghar; Zamani, Mina; Azizian, Saleh; Mohagheghi, Mohammad Ali


    Alpha-solanine, a naturally steroidal glycoalkaloid, is found in leaves and fruits of plants as a defensive agent against fungi, bacteria and insects. Herein, we investigated solanine toxicity in vitro and in vivo, and assessed its protective and the therapeutic effects on a typical animal model of breast cancer. The study conducted in three series of experiments to obtain (i) solanine effects on cell viability of mammary carcinoma cells, (ii) in vivo toxicity of solanine, and (iv) the protective and therapeutic effects of solanine on animal model of breast cancer. Alpha-solanine significantly suppressed proliferation of mouse mammary carcinoma cells both in vitro and in vivo (Psolanine has been chosen for assessing its protective and therapeutic effects in mice breast cancer. Tumor take rate in the solanine-treated group was zero compared with a 75% rate in its respective control group (Psolanine-treated animals than its respective control ones (Psolanine compared with its respective control group (Psolanine-treated animals (Psolanine-treated mice (Psolanine exerts a significant chemoprotective and chemotherapeutic effects on an animal model of breast cancer through apoptosis induction, cell proliferation and angiogenesis inhibition. These findings reveal a new therapeutic potential for solanine in cancer.

  20. Differential protective effects of immune lymphoid cells against transplanted line Ib leukemia and immune polioencephalomyelitis. [X radiation, mice

    Energy Technology Data Exchange (ETDEWEB)

    Duffey, P.S.; Lukasewycz, O.A.; Olson, D.S.; Murphy, W.H.


    The capacity of immune cells obtained from the major lymphoid compartments to protect C58 mice from transplanted line Ib leukemia, and from an age-dependent autoimmune CNS disease (immune polioencephalomyelitis = IPE) elicited by immunizing old C58 mice with inactivated Ib cells was quantified. Cells used for comparative adoptive protection tests were harvested from the major lymphoid compartments 14 to 15 days after young C58 mice were immunized with inactivated Ib cell preparations. Regression curves were plotted from survival data and the log/sub 10/PD/sub 50/ values were determined. Immune spleen (ISC) and peritoneal cells (IPEC) were significantly more protective against transplanted Ib cells than immune lymph node (ILNC), thymic (ITC), and marrow cells (IMC). In contrast, IPEC and IMC were not protective against IPE and ITC were only marginally protective. ILNC afforded significant protection to transplantable leukemia but were only marginally protective to IPE. When ISC were treated with anti-thy 1.2 serum and complement, protection against transplanted leukemia and IPE was reduced > 99%. When donors of immune lymphoid cells were treated with 12.5 mg of cortisone acetate daily for 2 days before lymphoid cells were harvested, protection against transplanted Ib cells by ISC was reduced by approximately 90% whereas protection against IPE was totally eliminated. Considered together, these results indicate that the protective mechanisms to transplantable leukemia and IPE differ significantly in the same indicator mouse strain.

  1. Protective effects of cimetidine on micronucleated polychromatic erythrocytes in mice irradiated with 0.7Gy

    Directory of Open Access Journals (Sweden)

    Jun-ling ZHANG


    Full Text Available Objective  To study the radioprotective effect of cimetidine on single low-dose irradiated mice with radiosensitive detection indexes. Methods  Forty-eight healthy male C57BL/6 mice were randomly divided into normal control group, model control group, positive group (200mg/kg WR2721 and cimetidine groups (7.5mg/kg, 15mg/kg and 30mg/kg. The mice were given intraperitoneal injection of cimetidine 2h before irradiation in cimetidine groups and WR2721 before irradiation once a day for two days in positive group. All the mice except those in normal control group were irradiated with 0.7Gy 60Co γ-ray at 5.83mGy/min rate. Peripheral blood cells, superoxide dismutase (SOD activity and malondialdehyde (MDA content both in serum and liver, bone marrow DNA content and frequency of micronucleated polychromatic erythrocytes (fMPEs were determined 24h after irradiation. Results  Compared with normal control group, the peripheral white blood cells (WBCs of irradiated mice decreased significantly (P<0.01, and fMPEs increased significantly (P<0.01 after irradiation. Except for 15mg/kg cimetidine group, the bone marrow DNA content was decreased significantly after irradiation (P<0.01, P<0.05. The SOD activity and MDA content in irradiated mice showed no significant difference compared with that of normal mice. Compared with model control group, peripheral WBCs and bone marrow DNA content showed no significant changes in treatment groups. The f MPE of 7.5mg/kg cimetidine group was 0.027‰, which was decreased significantly compared with that of model control group (P<0.01, and the dose reduction factor (DRF of 7.5mg/kg cimetidine group was 3.338. Conclusion  Cimetidine has good protective effect on micronucleated polychromatic erythrocytes (MPEs in mice irradiated by 0.7Gy in single low-dose. DOI: 10.11855/j.issn.0577-7402.2015.12.03

  2. Protection of rabbits and immunodeficient mice against lethal poxvirus infections by human monoclonal antibodies.

    Directory of Open Access Journals (Sweden)

    Lindsay Crickard

    Full Text Available Smallpox (variola virus is a bioweapon concern. Monkeypox is a growing zoonotic poxvirus threat. These problems have resulted in extensive efforts to develop potential therapeutics that can prevent or treat potentially lethal poxvirus infections in humans. Monoclonal antibodies (mAbs against smallpox are a conservative approach to this problem, as the licensed human smallpox vaccine (vaccinia virus, VACV primarily works on the basis of protective antibody responses against smallpox. Fully human mAbs (hmAbs against vaccinia H3 (H3L and B5 (B5R, targeting both the mature virion (MV and extracellular enveloped virion (EV forms, have been developed as potential therapeutics for use in humans. Post-exposure prophylaxis was assessed in both murine and rabbit animal models. Therapeutic efficacy of the mAbs was assessed in three good laboratory practices (GLP studies examining severe combined immunodeficiency mice (SCID given a lethal VACV infection. Pre-exposure combination hmAb therapy provided significantly better protection against disease and death than either single hmAb or vaccinia immune globulin (VIG. Post-exposure combination mAb therapy provided significant protection against disease and death, and appeared to fully cure the VACV infection in ≥50% of SCID mice. Therapeutic efficacy was then assessed in two rabbit studies examining post-exposure hmAb prophylaxis against rabbitpox (RPXV. In the first study, rabbits were infected with RPVX and then provided hmAbs at 48 hrs post-infection, or 1 hr and 72 hrs post-infection. Rabbits in both groups receiving hmAbs were 100% protected from death. In the second rabbitpox study, 100% of animal treated with combination hmAb therapy and 100% of animals treated with anti-B5 hmAb were protected. These findings suggest that combination hmAb treatment may be effective at controlling smallpox disease in immunocompetent or immunodeficient humans.

  3. G-CSF protects motoneurons against axotomy-induced apoptotic death in neonatal mice

    Directory of Open Access Journals (Sweden)

    Pitzer Claudia


    Full Text Available Abstract Background Granulocyte colony stimulating factor (G-CSF is a growth factor essential for generation of neutrophilic granulocytes. Apart from this hematopoietic function, we have recently uncovered potent neuroprotective and regenerative properties of G-CSF in the central nervous system (CNS. The G-CSF receptor and G-CSF itself are expressed in α motoneurons, G-CSF protects motoneurons, and improves outcome in the SOD1(G93A transgenic mouse model for amyotrophic lateral sclerosis (ALS. In vitro, G-CSF acts anti-apoptotically on motoneuronal cells. Due to the pleiotrophic effects of G-CSF and the complexity of the SOD1 transgenic ALS models it was however not possible to clearly distinguish between directly mediated anti-apoptotic and indirectly protective effects on motoneurons. Here we studied whether G-CSF is able to protect motoneurons from purely apoptotic cell death induced by a monocausal paradigm, neonatal sciatic nerve axotomy. Results We performed sciatic nerve axotomy in neonatal mice overexpressing G-CSF in the CNS and found that G-CSF transgenic mice displayed significantly higher numbers of surviving lumbar motoneurons 4 days following axotomy than their littermate controls. Also, surviving motoneurons in G-CSF overexpressing animals were larger, suggesting additional trophic effects of this growth factor. Conclusions In this model of pure apoptotic cell death the protective effects of G-CSF indicate direct actions of G-CSF on motoneurons in vivo. This shows that G-CSF exerts potent anti-apoptotic activities towards motoneurons in vivo and suggests that the protection offered by G-CSF in ALS mouse models is due to its direct neuroprotective activity.

  4. Protective effect of salidroside on cardiac apoptosis in mice with chronic intermittent hypoxia. (United States)

    Lai, Mei-Chih; Lin, Jaung-Geng; Pai, Pei-Ying; Lai, Mei-Hsin; Lin, Yueh-Min; Yeh, Yu-Lan; Cheng, Shiu-Min; Liu, Yi-fan; Huang, Chih-Yang; Lee, Shin-Da


    The goal of this study is to determine if salidroside has protective effects on hypoxia-induced cardiac widely dispersed apoptosis in mice with severe sleep apnea model. Sixty-four C57BL/6J mice 5-6 months of age were divided into four groups, i.e. Control group (21% O2, 24h per day, 8 weeks, n=16); Hypoxia group (Hypoxia: 7% O2 60s, 20% O2 alternating 60s, 8h per day, 8 weeks, n=16); and Hypoxia+S10 and Hypoxia+S 30 groups (Hypoxia for 1st 4 weeks, hypoxia pretreated 10mg/kg and 30 mg/kg salidroside by oral gavage per day for 2nd 4 weeks, n=16 and 16). The excised hearts from four groups were measured by the heart weight index, H&E staining, TUNEL-positive assays and Western blotting. TUNEL-positive apoptotic cells in mice heart were less in Hypoxia+S10 and Hypoxia+S30 than those in the Hypoxia group. Compared with Hypoxia, the protein levels of Fas ligand, Fas death receptors, Fas-Associated Death Domain (FADD), activated caspase 8, and activated caspase 3 (Fas pathways) were decreased in Hypoxia+S10 and Hypoxia+S30. In the mitochondria pathway, the protein levels of BcLx, Bcl2, and Bid (anti-apoptotic Bcl2 family) in Hypoxia+S10 and Hypoxia+S30 were more than those in Hypoxia. The protein levels of Bax, t-Bid, activated caspase 9, and activated caspase 3 were less in Hypoxia+S10 and Hypoxia+S30 than those in hypoxia. Our findings suggest that salidroside has protective effects on chronic intermittent hypoxia-induced Fas-dependent and mitochondria-dependent apoptotic pathways in mice hearts. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. Inhaled hydrogen sulfide protects against lipopolysaccharide-induced acute lung injury in mice

    Directory of Open Access Journals (Sweden)

    Faller Simone


    Full Text Available Abstract Background Local pulmonary and systemic infections can lead to acute lung injury (ALI. The resulting lung damage can evoke lung failure and multiple organ dysfunction associated with increased mortality. Hydrogen sulfide (H2S appears to represent a new therapeutic approach to ALI. The gas has been shown to mediate potent anti-inflammatory and organ protective effects in vivo. This study was designed to define its potentially protective role in sepsis-induced lung injury. Methods C57BL/6 N mice received lipopolysaccharide (LPS intranasally in the absence or presence of 80 parts per million H2S. After 6 h, acute lung injury was determined by comparative histology. Bronchoalveolar lavage (BAL fluid was analyzed for total protein content and differential cell counting. BAL and serum were further analyzed for interleukin-1β, macrophage inflammatory protein-2, and/or myeloperoxidase glycoprotein levels by enzyme-linked immunosorbent assays. Differences between groups were analyzed by one way analysis of variance. Results Histological analysis revealed that LPS instillation led to increased alveolar wall thickening, cellular infiltration, and to an elevated ALI score. In the presence of H2S these changes were not observed despite LPS treatment. Moreover, neutrophil influx, and pro-inflammatory cytokine release were enhanced in BAL fluid of LPS-treated mice, but comparable to control levels in H2S treated mice. In addition, myeloperoxidase levels were increased in serum after LPS challenge and this was prevented by H2S inhalation. Conclusion Inhalation of hydrogen sulfide protects against LPS-induced acute lung injury by attenuating pro-inflammatory responses.

  6. Mutant Brucella abortus membrane fusogenic protein induces protection against challenge infection in mice. (United States)

    de Souza Filho, Job Alves; de Paulo Martins, Vicente; Campos, Priscila Carneiro; Alves-Silva, Juliana; Santos, Nathalia V; de Oliveira, Fernanda Souza; Menezes, Gustavo B; Azevedo, Vasco; Cravero, Silvio Lorenzo; Oliveira, Sergio Costa


    Brucella species can cause brucellosis, a zoonotic disease that causes serious livestock economic losses and represents a public health threat. The mechanism of virulence of Brucella spp. is not yet fully understood. Therefore, it is crucial to identify new molecules that serve as virulence factors to better understand this host-pathogen interplay. Here, we evaluated the role of the Brucella membrane fusogenic protein (Mfp) and outer membrane protein 19 (Omp19) in bacterial pathogenesis. In this study, we showed that B. abortus Δmfp::kan and Δomp19::kan deletion mutant strains have reduced persistence in vivo in C57BL/6 and interferon regulatory factor 1 (IRF-1) knockout (KO) mice. Additionally, 24 h after macrophage infection with a Δmfp::kan or Δomp19::kan strain expressing green fluorescent protein (GFP) approximately 80% or 65% of Brucella-containing vacuoles (BCVs) retained the late endosomal/lysosomal marker LAMP-1, respectively, whereas around 60% of BCVs containing wild-type S2308 were found in LAMP-1-negative compartments. B. abortus Δomp19::kan was attenuated in vivo but had a residual virulence in C57BL/6 and IRF-1 KO mice, whereas the Δmfp::kan strain had a lower virulence in these same mouse models. Furthermore, Δmfp::kan and Δomp19::kan strains were used as live vaccines. Challenge experiments revealed that in C57BL/6 and IRF-1 KO mice, the Δmfp::kan strain induced greater protection than the vaccine RB51 and protection similar that of vaccine S19. However, a Δomp19::kan strain induced protection similar to that of RB51. Thus, these results demonstrate that Brucella Mfp and Omp19 are critical for full bacterial virulence and that the Δmfp::kan mutant may serve as a potential vaccine candidate in future studies.

  7. Immunization against multidrug-resistant Acinetobacter baumannii effectively protects mice in both pneumonia and sepsis models.

    Directory of Open Access Journals (Sweden)

    Weiwei Huang

    Full Text Available OBJECTIVE: Acinetobacter baumannii is considered the prototypical example of a multi- or pan- drug-resistant bacterium. It has been increasingly implicated as a major cause of nosocomial and community-associated infections. This study proposed to evaluate the efficacy of immunological approaches to prevent and treat A. baumannii infections. METHODS: Mice were immunized with outer membrane vesicles (OMVs prepared from a clinically isolated multidrug-resistant strain of A. baumannii. Pneumonia and sepsis models were used to evaluate the efficacy of active and passive immunization with OMVs. The probable effective mechanisms and the protective potential of clonally distinct clinical isolates were investigated in vitro using an opsonophagocytic assay. RESULTS: Intramuscular immunization with OMVs rapidly produced high levels of OMV-specific IgG antibodies, and subsequent intranasal challenge with A. baumannii elicited mucosal IgA and IgG responses. Both active and passive immunization protected the mice from challenges with homologue bacteria in a sepsis model. Bacterial burden in bronchoalveolar lavage fluids (BALF, lung, and spleen, inflammatory cell infiltration in BALF and lung, and inflammatory cytokine accumulation in BALF was significantly suppressed in the pneumonia model by both active and passive immunization strategies. The antisera from immunized mice presented with significant opsonophagocytic activities in a dose-dependent manner against not only homologous strains but also five of the other six clonally distinct clinical isolates. CONCLUSIONS: Utilizing immunological characteristics of outer membrane proteins to elevate protective immunity and circumvent complex multidrug-resistance mechanisms might be a viable approach to effectively control A. baumannii infections.

  8. Protective effect of sericin peptide against alcohol-induced gastric injury in mice

    Institute of Scientific and Technical Information of China (English)

    LI You-gui; JI Dong-feng; LIN Tian-bao; ZHONG Shi; HU Gui-yan; CHEN Shi


    Background Sericin peptide (SP) has shown a powerful anti-oxidant property in a host of studies. The present study was designed to investigate the possible protective effects of SP against alcohol-induced gastric lesions in mice and to explore the potential mechanisms.Methods Animals were randomly divided into 5 groups: control, alcohol (56%, 14.2 ml/kg), SP-treated mice (0.2, 0.4, 0.8 g/kg). Mice were pretreated with SP before administering alcohol, the concentration of ethanol in serum and urine, the contents of malondialdehyde (MDA), glutathione (GSH) and the glutathione peroxidase (GSH-PX), catalase (CAT) and superoxide dismutase (SOD) activities in the gastric mucosa were measured, subsequently, the pathological evaluation of stomach was also observed.Results Of the animals pre-treated with SP (0.4, 0.8 g/kg), the concentration of ethanol in serum was significantly decreased, while increased in urine as compared to the alcohol-administered alone animals. Alcohol administration caused severe gastric damage as indicated by markedly increased MDA levels and decreased antioxidants, such as reduced GSH, GSM-PX and SOD in the gastric tissue while the CAT activity was not altered. On SP administration there was a reversal in these values towards normal. Histopathological studies confirmed the beneficial role of SP, which was in accordance with the biochemical parameters.Conclusions SP could protect gastric mucosa from alcohol-induced mucosal injury. These gastroprotective effects might be due to increasing 'first-pass metabolism' in the stomach and hastening ethanol elimination directly through the urine. SP might also play an important role in the protection of the structure and function of gastric mitochondria, at least partly based on their anti-oxidant effect.

  9. The Mx1 Gene Protects Mice against the Pandemic 1918 and Highly Lethal Human H5N1 Influenza Viruses▿



    Mice carrying a wild-type Mx1 gene (Mx1+/+) differ from standard laboratory mice (Mx1−/−) in being highly resistant to infection with common laboratory strains of influenza A virus. We report that Mx1 also protects mice against the pandemic human 1918 influenza virus and a highly lethal human H5N1 strain from Vietnam. Resistance to H5N1 of Mx1+/+ but not Mx1−/− mice was enhanced if the animals were treated with a single dose of exogenous alpha interferon before infection. Thus, the interferon...

  10. Human CD8+ T cells mediate protective immunity induced by a human malaria vaccine in human immune system mice. (United States)

    Li, Xiangming; Huang, Jing; Zhang, Min; Funakoshi, Ryota; Sheetij, Dutta; Spaccapelo, Roberta; Crisanti, Andrea; Nussenzweig, Victor; Nussenzweig, Ruth S; Tsuji, Moriya


    A number of studies have shown that CD8+ T cells mediate protective anti-malaria immunity in a mouse model. However, whether human CD8+ T cells play a role in protection against malaria remains unknown. We recently established human immune system (HIS) mice harboring functional human CD8+ T cells (HIS-CD8 mice) by transduction with HLA-A∗0201 and certain human cytokines using recombinant adeno-associated virus-based gene transfer technologies. These HIS-CD8 mice mount a potent, antigen-specific HLA-A∗0201-restricted human CD8+ T-cell response upon immunization with a recombinant adenovirus expressing a human malaria antigen, the Plasmodium falciparum circumsporozoite protein (PfCSP), termed AdPfCSP. In the present study, we challenged AdPfCSP-immunized HIS-CD8 mice with transgenic Plasmodium berghei sporozoites expressing full-length PfCSP and found that AdPfCSP-immunized (but not naïve) mice were protected against subsequent malaria challenge. The level of the HLA-A∗0201-restricted, PfCSP-specific human CD8+ T-cell response was closely correlated with the level of malaria protection. Furthermore, depletion of human CD8+ T cells from AdPfCSP-immunized HIS-CD8 mice almost completely abolished the anti-malaria immune response. Taken together, our data show that human CD8+ T cells mediate protective anti-malaria immunity in vivo.

  11. Hepatocyte IKK2 protects Mdr2-/- mice from chronic liver failure.

    Directory of Open Access Journals (Sweden)

    Hanno Ehlken

    Full Text Available Mice lacking the Abc4 protein encoded by the multidrug resistance-2 gene (Mdr2(-/- develop chronic periductular inflammation and cholestatic liver disease resulting in the development of hepatocellular carcinoma (HCC. Inhibition of NF-κB by expression of an IκBα super-repressor (IκBαSR transgene in hepatocytes was shown to prevent HCC development in Mdr2(-/- mice, suggesting that NF-κB acts as a tumour promoter in this model of inflammation-associated carcinogenesis. On the other hand, inhibition of NF-κB by hepatocyte specific ablation of IKK2 resulted in increased liver tumour development induced by the chemical carcinogen DEN. To address the role of IKK2-mediated NF-κB activation in hepatocytes in the pathogenesis of liver disease and HCC in Mdr2(-/- mice, we generated Mdr2-deficient animals lacking IKK2 specifically in hepatocytes using the Cre-loxP system. Mdr2(-/- mice lacking IKK2 in hepatocytes developed spontaneously a severe liver disease characterized by cholestasis, major hyperbilirubinemia and severe to end-stage fibrosis, which caused muscle wasting, loss of body weight, lethargy and early spontaneous death. Cell culture experiments showed that primary hepatocytes lacking IKK2 were more sensitive to bile acid induced death, suggesting that hepatocyte-specific IKK2 deficiency sensitized hepatocytes to the toxicity of bile acids under conditions of cholestasis resulting in greatly exacerbated liver damage. Mdr2(-/-IKK2(Hep-KO mice remarkably recapitulate chronic liver failure in humans and might be of special importance for the study of the mechanisms contributing to the pathogenesis of end-stage chronic liver disease or its implications on other organs.IKK2-mediated signaling in hepatocytes protects the liver from damage under conditions of chronic inflammatory cholestasis and prevents the development of severe fibrosis and liver failure.

  12. Protective effects of astragaloside IV on db/db mice with diabetic retinopathy.

    Directory of Open Access Journals (Sweden)

    Yuzhi Ding

    Full Text Available Diabetic retinopathy (DR is a common diabetic eye disease which is well-known as the result of microvascular retinal changes. Although the potential biological functions of astragaloside IV (AS IV have long been described in traditional system of medicine, its protective effect on DR remains unclear. This study aims to investigate the function and mechanism of AS IV on type 2 diabetic db/db mice.Db/db mice were treated with AS IV (4.5 mg/kg or 9 mg/kg or physiological saline by oral gavage for 20 weeks along with db/m mice. In each group, retinal ganglion cell (RGC function was measured by pattern electroretinogram (ERG and apoptosis was determined by Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL staining. Blood and retina aldose reductase (AR activity were quantified by chemiluminescence analysis. The expressions of phosporylated-ERK1/2, NF-κB were determined by Western blot analysis. Furthermore, the expression of related downstream proteins were quantified by Label-based Mouse Antibody Array.Administration of AS IV significantly improved the amplitude in pattern ERG and reduced the apoptosis of db/db mice. Furthermore, downregulation of AR activity, ERK1/2 phosphorylation, NF-κB and related cytokine were observed in AS IV treatment group.Our study indicated that AS IV, as an inhibitor of AR, could prevent the activation of ERK1/2 phosporylation and NF-kB and further relieve the RGCs disfunction in db/db mice with DR. It has provided a basis for investigating the clinical efficacy of AR inhibitors in preventing DR.

  13. Physical exercise protects against Alzheimer's disease in 3xTg-AD mice. (United States)

    García-Mesa, Yoelvis; López-Ramos, Juan Carlos; Giménez-Llort, Lydia; Revilla, Susana; Guerra, Rafael; Gruart, Agnès; Laferla, Frank M; Cristòfol, Rosa; Delgado-García, José M; Sanfeliu, Coral


    Physical exercise is considered to exert a positive neurophysiological effect that helps to maintain normal brain activity in the elderly. Expectations that it could help to fight Alzheimer's disease (AD) were recently raised. This study analyzed the effects of different patterns of physical exercise on the 3xTg-AD mouse. Male and female 3xTg-AD mice at an early pathological stage (4-month-old) have had free access to a running wheel for 1 month, whereas mice at a moderate pathological stage(7-month-old) have had access either during 1 or 6 months. The non-transgenic mouse strain was used as a control. Parallel animal groups were housed in conventional conditions. Cognitive loss and behavioral and psychological symptoms of dementia (BPSD)-like behaviors were present in the 3xTg-AD mice along with alteration in synaptic function and ong-term potentiation impairment in vivo. Brain tissue showed AD-pathology and oxidative-related changes. Disturbances were more severe at the older age tested. Oxidative stress was higher in males but other changes were similar or higher in females. Exercise treatment ameliorated cognitive deterioration and BPSD-like behaviors such as anxiety and the startle response. Synaptic changes were partially protected by exercise. Oxidative stress was reduced. The best neuroprotection was generally obtained after 6 months of exercise in 7-month-old 3xTg-AD mice. Improved sensorimotor function and brain tissue antioxidant defence were induced in both 3xTg-AD and NonTg mice. Therefore, the benefits of aerobic physical exercise on synapse, redox homeostasis, and general brain function demonstrated in the 3xTg-AD mouse further support the value of this healthy life-style against neurodegeneration.

  14. Nicotine, but not cotinine, partially protects dopaminergic neurons against MPTP-induced degeneration in mice. (United States)

    Parain, K; Marchand, V; Dumery, B; Hirsch, E


    In order to analyze the putative neuroprotective role of nicotine and cotinine in parkinsonian syndromes, these two compounds were administered in male C57Bl6 mice for 4 weeks. On day 8, four injections of 1-methyl-4-phenyl-1,2,3,6,-tetrahydropyridine (MPTP) were administered. MPTP intoxication induced a 50% loss of dopaminergic neurons in the substantia nigra and a 45% reduction in dopaminergic fibers in the striatum. Administration of cotinine did not affect MPTP toxicity in the nigrostriatal system but chronic nicotine treatment showed a slight protection (15%) of nigrostriatal dopaminergic neurons against MPTP.

  15. Critical role of IFN-gamma in CFA-mediated protection of NOD mice from diabetes development. (United States)

    Mori, Yoshiko; Kodaka, Tetsuro; Kato, Takako; Kanagawa, Edith M; Kanagawa, Osami


    IFN-gamma signaling-deficient non-obese diabetic (NOD) mice develop diabetes with similar kinetics to those of wild-type NOD mice. However, the immunization of IFN-gamma signaling-deficient NOD mice with CFA failed to induce long-term protection, whereas wild-type NOD mice receiving CFA remained diabetes-free. CFA also failed to protect IFN-gamma receptor-deficient (IFN-gammaR(-/-)) NOD mice from the autoimmune rejection of transplanted islets, as it does in diabetic NOD mice, and from disease transfer by spleen cells from diabetic NOD mice. These data clearly show that the pro-inflammatory cytokine IFN-gamma is necessary for the CFA-mediated protection of NOD mice from diabetes. There is no difference in the T(h)1/T(h)17 balance between IFN-gammaR(-/-) NOD and wild-type NOD mice. There is also no difference in the total numbers and percentages of regulatory T (Treg) cells in the lymph node CD4(+) T-cell populations between IFN-gammaR(-/-) NOD and wild-type NOD mice. However, pathogenic T cells lacking IFN-gammaR are resistant to the suppressive effect of Treg cells, both in vivo and in vitro. Therefore, it is likely that CFA-mediated protection against diabetes development depends on a change in the balance between Treg cells and pathogenic T cells, and IFN-gamma signaling seems to control the susceptibility of pathogenic T cells to the inhibitory activity of Treg cells.

  16. Antibody to the E3 Glycoprotein Protects Mice against Lethal Venezuelan Equine Encephalitis Virus Infection▿ (United States)

    Parker, Michael D.; Buckley, Marilyn J.; Melanson, Vanessa R.; Glass, Pamela J.; Norwood, David; Hart, Mary Kate


    Six monoclonal antibodies were isolated that exhibited specificity for a furin cleavage site deletion mutant (V3526) of Venezuelan equine encephalitis virus (VEEV). These antibodies comprise a single competition group and bound the E3 glycoprotein of VEEV subtype I viruses but failed to bind the E3 glycoprotein of other alphaviruses. These antibodies neutralized V3526 virus infectivity but did not neutralize the parental strain of Trinidad donkey (TrD) VEEV. However, the E3-specific antibodies did inhibit the production of virus from VEEV TrD-infected cells. In addition, passive immunization of mice demonstrated that antibody to the E3 glycoprotein provided protection against lethal VEEV TrD challenge. This is the first recognition of a protective epitope in the E3 glycoprotein. Furthermore, these results indicate that E3 plays a critical role late in the morphogenesis of progeny virus after E3 appears on the surfaces of infected cells. PMID:20926570

  17. L-citrulline protects from kidney damage in type 1 diabetic mice.

    Directory of Open Access Journals (Sweden)

    Maritza J Romero


    Full Text Available Rationale. Diabetic nephropathy is a major cause of end-stage renal disease, associated with endothelial dysfunction. Chronic supplementation of L-arginine (L-arg, the substrate for endothelial nitric oxide synthase (eNOS, failed to improve vascular function. L-citrulline (L-cit supplementation not only increases L-arg synthesis, but also inhibits cytosolic arginase I (Arg I, a competitor of eNOS for the use of L-arg, in the vasculature. Aims. To investigate whether L-cit treatment reduces diabetic nephropathy in streptozotocin (STZ-induced type 1 diabetes in mice and rats and to study its effects on arginase II (ArgII function, the main renal isoform. Methods. STZ-C57BL6 mice received L-cit or vehicle supplemented in the drinking water. For comparative analysis, diabetic ArgII knock out mice and L-cit-treated STZ-rats were evaluated. Results. L-cit exerted protective effects in kidneys of STZ-rats, and markedly reduced urinary albumin excretion, tubulo-interstitial fibrosis and kidney hypertrophy, observed in untreated diabetic mice. Intriguingly, L-cit treatment was accompanied by a sustained elevation of tubular ArgII at 16 wks and significantly enhanced plasma levels of the anti-inflammatory cytokine IL-10. Diabetic ArgII knock out mice showed greater BUN levels, hypertrophy, and dilated tubules than diabetic wild type mice. Despite a marked reduction in collagen deposition in ArgII knock out mice, their albuminuria was not significantly different from diabetic wild type animals. L-cit also restored NO/ROS balance and barrier function in high glucose-treated monolayers of human glomerular endothelial cells. Moreover, L-cit also has the ability to establish an anti-inflammatory profile, characterized by increased IL-10 and reduced IL-1beta and IL-12(p70 generation in the human proximal tubular cells. Conclusions. L-cit supplementation established an anti-inflammatory profile and significantly preserved the nephron function during type 1

  18. Protective effect of salvianolate on lung injury induced by ischemia reperfusion injury of liver in mice

    Directory of Open Access Journals (Sweden)

    Zheng-xin WANG


    Full Text Available Objective To evaluate the protective effect of salvianolate on lung injury induced by hepatic ischemia reperfusion(IR injury in mice and its underlying mechanisms.Methods A hepatic IR model of mice was reproduced,and 24 animals were assigned into 3 groups(8 each: sham operation(SO group,control group and salvianolate(SV group.Just before ischemia induction,animals in SV group received salvianolate injection at a dose of 60 mg/kg via tail vein,while in control group the mice received normal saline with an equal volume,and in SO group the mice received the same operation as in SV group but without producing liver ischemia.Four hours after reperfusion,the serum,liver and lung tissue were collected.The alanine aminotransferase(ALT and aspartate aminotransferase(AST levels in serum were detected and the histological changes in liver and lung were examined.The wet-to-dry weight ratio of pulmonary tissue was measured.The contents of tumor necrosis factor α(TNF-α,interleukin(IL-6,IL-1β and IL-10 in bronchoalveolar lavage fluid(BALF were detected by enzyme linked immunosorbent assay(ELISA,and the relative mRNA levels of TNF-α,IL-6,IL-1β and IL-10 in pulmonary tissue were analyzed by real-time reverse transcription PCR(RT-PCR.The activaty of transcription factor NF-κB was measured with Western blotting analysis.Results No significant pathologic change was found in mice of SO group.Compared with the mice in control group,those in SV group exhibited lower levels of ALT and AST(P < 0.01,lighter histological changes in liver and lung(P < 0.05,lower levels of wet-to-dry weight ratio of lung tissue(P < 0.05,lower expression levels of TNF-α,IL-6,IL-1β and IL-10 in BALF and lung tissue(P < 0.05 or P < 0.01.Further examination demonstrated that the activity of NF-κB in SV group was significantly down-regulated as compared with that in control group.Conclusion Salvianolate can attenuate lung injury induced by hepatic IR in mice,the mechanism may inclade

  19. Immunization of mice with YscF provides protection from Yersinia pestis infections

    Directory of Open Access Journals (Sweden)

    Bradley David S


    Full Text Available Abstract Background Yersinia pestis, the causative agent of plague, is a pathogen with a tremendous ability to cause harm and panic in populations. Due to the severity of plague and its potential for use as a bioweapon, better preventatives and therapeutics for plague are desirable. Subunit vaccines directed against the F1 capsular antigen and the V antigen (also known as LcrV of Y. pestis are under development. However, these new vaccine formulations have some possible limitations. The F1 antigen is not required for full virulence of Y. pestis and LcrV has a demonstrated immunosuppressive effect. These limitations could damper the ability of F1/LcrV based vaccines to protect against F1-minus Y. pestis strains and could lead to a high rate of undesired side effects in vaccinated populations. For these reasons, the use of other antigens in a plague vaccine formulation may be advantageous. Results Desired features in vaccine candidates would be antigens that are conserved, essential for virulence and accessible to circulating antibody. Several of the proteins required for the construction or function of the type III secretion system (TTSS complex could be ideal contenders to meet the desired features of a vaccine candidate. Accordingly, the TTSS needle complex protein, YscF, was selected to investigate its potential as a protective antigen. In this study we describe the overexpression, purification and use of YscF as a protective antigen. YscF immunization triggers a robust antibody response to YscF and that antibody response is able to afford significant protection to immunized mice following challenge with Y. pestis. Additionally, evidence is presented that suggests antibody to YscF is likely not protective by blocking the activity of the TTSS. Conclusion In this study we investigated YscF, a surface-expressed protein of the Yersinia pestis type III secretion complex, as a protective antigen against experimental plague infection. Immunization of

  20. Protective effect of HI-6 and trimedoxime combination in mice acutely poisoned with tabun, dichlorvos or heptenophos


    Antonijević Biljana; Vučinić Slavica; Ćupić V.


    The aim of this study was to compare the protective effect of two individual oximes (HI-6 and trimedoxime) with their combination in mice acutely poisoned with tabun, dichlorvos or heptenophos. Oxime HI-6 did not protect experimental animals against either dichlorvos, heptenophos or tabun. Trimedoxime was very effective against all three OPs. The ED-500 doses of trimedoxime necessary to protect 50% of animals after the simultaneous administration of OPs and...

  1. Protective effect of HI-6 and trimedoxime combination in mice acutely poisoned with tabun, dichlorvos or heptenophos


    Antonijević Biljana; Vučinić Slavica; Ćupić V.


    The aim of this study was to compare the protective effect of two individual oximes (HI-6 and trimedoxime) with their combination in mice acutely poisoned with tabun, dichlorvos or heptenophos. Oxime HI-6 did not protect experimental animals against either dichlorvos, heptenophos or tabun. Trimedoxime was very effective against all three OPs. The ED-500 doses of trimedoxime necessary to protect 50% of animals after the simultaneous administration of OPs and oxime were 42.18, 14.97 and 3...

  2. A CpG oligonucleotide can protect mice from a low aerosol challenge dose of Burkholderia mallei. (United States)

    Waag, David M; McCluskie, Michael J; Zhang, Ningli; Krieg, Arthur M


    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-gamma)-inducible protein 10, interleukin-12 (IL-12), IFN-gamma, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  3. A CpG Oligonucleotide Can Protect Mice from a Low Aerosol Challenge Dose of Burkholderia mallei


    Waag, David M.; Michael J. McCluskie; Zhang, Ningli; Krieg, Arthur M.


    Treatment with an oligodeoxynucleotide (ODN) containing CPG motifs (CpG ODN 7909) was found to protect BALB/c mice from lung infection or death after aerosol challenge with Burkholderia mallei. Protection was associated with enhanced levels of gamma interferon (IFN-γ)-inducible protein 10, interleukin-12 (IL-12), IFN-γ, and IL-6. Preexposure therapy with CpG ODNs may protect victims of a biological attack from glanders.

  4. Radon inhalation protects mice from carbon-tetrachloride-induced hepatic and renal damage. (United States)

    Kataoka, Takahiro; Nishiyama, Yuichi; Toyota, Teruaki; Yoshimoto, Masaaki; Sakoda, Akihiro; Ishimori, Yuu; Aoyama, Yutaka; Taguchi, Takehito; Yamaoka, Kiyonori


    We assessed whether radon inhalation provided protection from carbon tetrachloride (CCl4)-induced hepatic and renal damage in mice. Mice were subjected to intraperitoneal injection of CCl4 after inhaling approximately 18 kBq/m3 radon for 6 h. Radon inhalation significantly increased total glutathione (t-GSH) content and glutathione peroxidase (GPx) activity in the liver and kidney. Injection of CCl4 was associated with significantly higher levels of glutamic oxaloacetic transaminase (GOT) and alkaline phosphatase (ALP) activity and creatinine level in serum, and pretreatment with radon significantly decreased the GOT and ALP activity and creatinine level associated with CCl4 injection, suggesting that radon inhalation alleviates CCl4-induced hepatic and renal damage. The t-GSH contents and GPx activity in the liver and kidney of animals pretreated with radon were significantly higher than those of the CCl(4)-only group. These findings suggested that radon inhalation activated antioxidative functions and inhibited CCl4-induced hepatic and renal damage in mice.

  5. Myristica fragrans seed extract protects against dextran sulfate sodium-induced colitis in mice. (United States)

    Kim, Hyojung; Bu, Youngmin; Lee, Beom-Joon; Bae, Jinhyun; Park, Sujin; Kim, Jinsung; Lee, Kyungjin; Cha, Jae-Myung; Ryu, Bongha; Ko, Seok-Jae; Han, Gajin; Min, Byungil; Park, Jae-Woo


    Nutmeg (seed of Myristica fragrans [MF]) is one of the most commonly used spices in the world and also a well-known herb for the treatment of various intestinal diseases, including colitis in traditional Korean medicine. The purpose of the current study was to investigate whether water extract of MF (MFE) can protect against dextran sulfate sodium (DSS) induced colitis in a mouse model. Colitis was induced by 5% DSS in balb/c mice. MFE (100, 300 or 1000 mg/kg) was orally administered to the mice twice a day for 7 days. Body weight, colon length, clinical score, and histological score were assessed to determine the effects on colitis. Proinflammatory cytokines (interferon-γ, tumor necrosis factor-α, interleukin [IL]-1β, and IL-6) were measured to investigate the mechanisms of action. MFE dose dependently inhibited the colon shortening and histological damage to the colon. However, it did not prevent weight loss. MFE also inhibited proinflammatory cytokines. The current results suggest that MFE ameliorates DSS-induced colitis in mice by inhibiting inflammatory cytokines. Further investigation, including the exact mechanisms is needed.

  6. Black tattoos protect against UVR-induced skin cancer in mice. (United States)

    Lerche, Catharina M; Sepehri, Mitra; Serup, Jørgen; Poulsen, Thomas; Wulf, Hans Christian


    Black tattoos may involve risk of cancer owing to polycyclic aromatic hydrocarbons including benzo(a)pyrene (BaP) in inks. Ultraviolet radiation (UVR) induces skin cancer. The combination of UVR and black tattoo may therefore potentially be very problematic, but has not been previously studied. Immunocompetent C3.Cg/TifBomTac mice (n = 99) were tattooed on the back with Starbrite Tribal Black(™) . This ink has a high content of the carcinogen BaP. Half of the mice were irradiated with three standard erythema doses UVR thrice weekly. Time to induction of first, second and third squamous cell carcinoma (SCC) was measured. Controls were 'tattooed' without ink. All irradiated mice developed SCCs while no malignant tumours were found in the nonirradiated group. In the tattooed and irradiated group, the development of the first, second and third SCC was significantly delayed in comparison with the irradiated controls without black tattoos (212, 232, 247 days vs. 163, 183, 191 days, P tattoos, remarkably, the development of UVR-induced skin cancer was delayed by the tattoos. Skin reflectance measurement indicated that the protective effect of black pigment in the dermis might be attributed to UVR absorption by black pigment below the epidermis and thereby reduction of backscattered radiation. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. CXCR2 knockout mice are protected against DSS-colitis-induced acute kidney injury and inflammation. (United States)

    Ranganathan, Punithavathi; Jayakumar, Calpurnia; Manicassamy, Santhakumar; Ramesh, Ganesan


    Organ cross talk exists in many diseases of the human and animal models of human diseases. A recent study demonstrated that inflammatory mediators can cause acute kidney injury and neutrophil infiltration in a mouse model of dextran sodium sulfate (DSS)-colitis. However, the chemokines and their receptors that may mediate distant organ effects in colitis are unknown. We hypothesized that keratinocyte chemoattractant (KC)/IL-8 receptor chemokine (C-X-C motif) ligand 2 (CXCL2) mediates DSS-colitis-induced acute kidney injury. Consistent with our hypothesis, wild-type (WT) mice developed severe colitis with DSS treatment, which was associated with inflammatory cytokine and chemokine expression and neutrophil infiltration in the colon. DSS-colitis in WT was accompanied by acute kidney injury and enhanced expression of inflammatory cytokines in the kidney. However, CXCR2 knockout mice were protected against DSS-colitis as well as acute kidney injury. Moreover, the expression of cytokines and chemokines and neutrophil infiltration was blunted in CXCR2 knockout mice in the colon and kidney. Administration of recombinant KC exacerbated DSS-colitis-induced acute kidney injury. Our results suggest that KC/IL-8 and its receptor CXCR2 are critical and major mediators of organ cross talk in DSS colitis and neutralization of CXCR2 will help to reduce the incidence of acute kidney injury due to ulcerative colitis and Crohn's disease in humans.

  8. Immunization of Mice with Anthrax Protective Antigen Limits Cardiotoxicity but Not Hepatotoxicity Following Lethal Toxin Challenge. (United States)

    Devera, T Scott; Prusator, Dawn K; Joshi, Sunil K; Ballard, Jimmy D; Lang, Mark L


    Protective immunity against anthrax is inferred from measurement of vaccine antigen-specific neutralizing antibody titers in serum samples. In animal models, in vivo challenges with toxin and/or spores can also be performed. However, neither of these approaches considers toxin-induced damage to specific organ systems. It is therefore important to determine to what extent anthrax vaccines and existing or candidate adjuvants can provide organ-specific protection against intoxication. We therefore compared the ability of Alum, CpG DNA and the CD1d ligand α-galactosylceramide (αGC) to enhance protective antigen-specific antibody titers, to protect mice against challenge with lethal toxin, and to block cardiotoxicity and hepatotoxicity. By measurement of serum cardiac Troponin I (cTnI), and hepatic alanine aminotransferase (ALT), and aspartate aminotransferase (AST), it was apparent that neither vaccine modality prevented hepatic intoxication, despite high Ab titers and ultimate survival of the subject. In contrast, cardiotoxicity was greatly diminished by prior immunization. This shows that a vaccine that confers survival following toxin exposure may still have an associated morbidity. We propose that organ-specific intoxication should be monitored routinely during research into new vaccine modalities.

  9. Rapid CD8+ Function Is Critical for Protection of Neonatal Mice from an Extracellular Bacterial Enteropathogen (United States)

    Siefker, David T.; Adkins, Becky


    Both human and murine neonates are characteristically highly susceptible to bacterial infections. However, we recently discovered that neonatal mice are surprisingly highly resistant to oral infection with Yersinia enterocolitica. This resistance was linked with activation of both innate and adaptive responses, involving innate phagocytes, CD4+ cells, and B cells. We have now extended these studies and found that CD8+ cells also contribute importantly to neonatal protection from Y. enterocolitica. Strikingly, neonatal CD8+ cells in the mesenteric lymph nodes (MLN) are rapidly mobilized, increasing in proportion, number, and IFNγ production as early as 48 h post infection. This early activation appears to be critical for protection since B2m−/− neonates are significantly more susceptible than wt neonates to primary Y. enterocolitica infection. In the absence of CD8+ cells, Y. enterocolitica rapidly disseminated to peripheral tissues. Within 48 h of infection, both the spleens and livers of B2m−/−, but not wt, neonates became heavily colonized, likely leading to their deaths from sepsis. In contrast to primary infection, CD8+ cells were dispensable for the generation of immunological memory protective against secondary infection. These results indicate that CD8+ cells in the neonatal MLN contribute importantly to protection against an extracellular bacterial enteropathogen but, notably, they appear to act during the early innate phase of the immune response. PMID:28119902

  10. A novel carbon monoxide-releasing molecule fully protects mice from severe malaria. (United States)

    Pena, Ana C; Penacho, Nuno; Mancio-Silva, Liliana; Neres, Rita; Seixas, João D; Fernandes, Afonso C; Romão, Carlos C; Mota, Maria M; Bernardes, Gonçalo J L; Pamplona, Ana


    Severe forms of malaria infection, such as cerebral malaria (CM) and acute lung injury (ALI), are mainly caused by the apicomplexan parasite Plasmodium falciparum. Primary therapy with quinine or artemisinin derivatives is generally effective in controlling P. falciparum parasitemia, but mortality from CM and other forms of severe malaria remains unacceptably high. Herein, we report the design and synthesis of a novel carbon monoxide-releasing molecule (CO-RM; ALF492) that fully protects mice against experimental CM (ECM) and ALI. ALF492 enables controlled CO delivery in vivo without affecting oxygen transport by hemoglobin, the major limitation in CO inhalation therapy. The protective effect is CO dependent and induces the expression of heme oxygenase-1, which contributes to the observed protection. Importantly, when used in combination with the antimalarial drug artesunate, ALF492 is an effective adjunctive and adjuvant treatment for ECM, conferring protection after the onset of severe disease. This study paves the way for the potential use of CO-RMs, such as ALF492, as adjunctive/adjuvant treatment in severe forms of malaria infection.

  11. Cross-protection induced by Japanese encephalitis vaccines against different genotypes of Dengue viruses in mice. (United States)

    Li, Jieqiong; Gao, Na; Fan, Dongying; Chen, Hui; Sheng, Ziyang; Fu, Shihong; Liang, Guodong; An, Jing


    Dengue viruses (DENVs) and Japanese encephalitis virus (JEV) are closely related mosquito-borne flaviviruses that cause very high global disease burdens. Although cross-reactivity and cross-protection within flaviviruses have been demonstrated, the effect of JEV vaccination on susceptibility to DENV infection has not been well elucidated. In this study, we found that vaccination with the JEV inactivated vaccine (INV) and live attenuated vaccine (LAV) could induce cross-immune responses and cross-protection against DENV1-4 in mice. Despite the theoretical risk of immune enhancement, no increased mortality was observed in our mouse model. Additionally, low but consistently detectable cross-neutralizing antibodies against DENV2 and DENV3 were also observed in the sera of JEV vaccine-immunized human donors. The results suggested that both JEV-LAV and JEV-INV could elicit strong cross-immunity and protection against DENVs, indicating that inoculation with JEV vaccines may influence the distribution of DENVs in co-circulated areas and that the cross-protection induced by JEV vaccines against DENVs might provide important information in terms of DENV prevention.

  12. The Protective Effect of Selenium on Chronic Zearalenone-Induced Reproductive System Damage in Male Mice. (United States)

    Long, Miao; Yang, Shuhua; Wang, Yuan; Li, Peng; Zhang, Yi; Dong, Shuang; Chen, Xinliang; Guo, Jiayi; He, Jianbin; Gao, Zenggui; Wang, Jun


    This study aims to explore the protective effect of selenium (Se) on chronic zearalenone (ZEN)-induced reproductive system damage in male mice and the possible protective molecular mechanism against this. The chronic ZEN-induced injury mouse model was established with the continuous intragastric administration of 40 mg/kg body mass (B.M.) ZEN for 28 days. Then, interventions with different doses (0.1, 0.2, and 0.4 mg/kg B.M.) of Se were conducted on mice to analyse the changes in organ indexes of epididymis and testis, antioxidant capability of testis, serum level of testosterone, sperm concentration and motility parameters, and the expression levels of apoptosis-associated genes and blood testis barrier- (BTB) related genes. Our results showed that Se could greatly improve the ZEN-induced decrease of epididymis indexes and testis indexes. Results also showed that the decrease in sperm concentration, sperm normality rate, and sperm motility parameters, including percentage of motile sperm (motile), tropism percentage (progressive) and sperm average path velocity (VAP), caused by ZEN were elevated upon administration of the higher dose (0.4 mg/kg) and intermediate dose (0.2 mg/kg) of Se. Selenium also significantly reduced the content of malondialdehyde (MDA) but enhanced the activities of antioxidant enzymes superoxide dismutase (SOD) and glutathione peroxidase (GPx) in the testis tissue. Further research demonstrated that ZEN increased the level of mRNA expression of BCL2-associated X protein (Bax) and caspase 3 (Casp3), decreased the level of mRNA expression of B cell leukemia/lymphoma 2 (Bcl2), vimentin (Vim) and cadherin 2 (Cdh2), whereas the co-administration of Se reversed these gene expression levels. Our results indicated that high levels of Se could protect against reproductive system damage in male mice caused by ZEN and the mechanism might such be that Se improved mice antioxidant ability, inhibited reproductive cell apoptosis, and increased the decrease

  13. The Protective Effect of Selenium on Chronic Zearalenone-Induced Reproductive System Damage in Male Mice

    Directory of Open Access Journals (Sweden)

    Miao Long


    Full Text Available This study aims to explore the protective effect of selenium (Se on chronic zearalenone (ZEN-induced reproductive system damage in male mice and the possible protective molecular mechanism against this. The chronic ZEN-induced injury mouse model was established with the continuous intragastric administration of 40 mg/kg body mass (B.M. ZEN for 28 days. Then, interventions with different doses (0.1, 0.2, and 0.4 mg/kg B.M. of Se were conducted on mice to analyse the changes in organ indexes of epididymis and testis, antioxidant capability of testis, serum level of testosterone, sperm concentration and motility parameters, and the expression levels of apoptosis-associated genes and blood testis barrier- (BTB related genes. Our results showed that Se could greatly improve the ZEN-induced decrease of epididymis indexes and testis indexes. Results also showed that the decrease in sperm concentration, sperm normality rate, and sperm motility parameters, including percentage of motile sperm (motile, tropism percentage (progressive and sperm average path velocity (VAP, caused by ZEN were elevated upon administration of the higher dose (0.4 mg/kg and intermediate dose (0.2 mg/kg of Se. Selenium also significantly reduced the content of malondialdehyde (MDA but enhanced the activities of antioxidant enzymes superoxide dismutase (SOD and glutathione peroxidase (GPx in the testis tissue. Further research demonstrated that ZEN increased the level of mRNA expression of BCL2-associated X protein (Bax and caspase 3 (Casp3, decreased the level of mRNA expression of B cell leukemia/lymphoma 2 (Bcl2, vimentin (Vim and cadherin 2 (Cdh2, whereas the co-administration of Se reversed these gene expression levels. Our results indicated that high levels of Se could protect against reproductive system damage in male mice caused by ZEN and the mechanism might such be that Se improved mice antioxidant ability, inhibited reproductive cell apoptosis, and increased the

  14. Elevated global SUMOylation in Ubc9 transgenic mice protects their brains against focal cerebral ischemic damage.

    Directory of Open Access Journals (Sweden)

    Yang-Ja Lee

    Full Text Available We have previously shown that a massive increase in global SUMOylation occurs during torpor in ground squirrels, and that overexpression of Ubc9 and/or SUMO-1 in cell lines and cortical neurons protects against oxygen and glucose deprivation. To examine whether increased global SUMOylation protects against ischemic brain damage, we have generated transgenic mice in which Ubc9 is expressed strongly in all tissues under the chicken β-actin promoter. Ubc9 expression levels in 10 founder lines ranged from 2 to 30 times the endogenous level, and lines that expressed Ubc9 at modestly increased levels showed robust resistance to brain ischemia compared to wild type mice. The infarction size was inversely correlated with the Ubc9 expression levels for up to five times the endogenous level. Although further increases showed no additional benefit, the Ubc9 expression level was highly correlated with global SUMO-1 conjugation levels (and SUMO-2,3 levels to a lesser extent up to a five-fold Ubc9 increase. Most importantly, there were striking reciprocal relationships between SUMO-1 (and SUMO-2,3 conjugation levels and cerebral infarction volumes among all tested animals, suggesting that the limit in cytoprotection by global SUMOylation remains undefined. These results support efforts to further augment global protein SUMOylation in brain ischemia.

  15. Proteomic analysis of protective effects of polysaccharides from Salvia miltiorrhiza against immunological liver injury in mice. (United States)

    Sun, Xue-Gang; Fu, Xiu-Qiong; Cai, Hong-Bing; Liu, Qiang; Li, Chun-Hua; Liu, Ya-Wei; Li, Ying-Jia; Liu, Zhi-Feng; Song, Yu-Hong; Lv, Zhi-Ping


    This study was designed to investigate mechanisms of the protective effects of Salvia miltiorrhiza polysaccharide (SMPS) against lipopolysaccharide (LPS)-induced immunological liver injury (ILI) in Bacille Calmette-Guérin (BCG)-primed mice. Two-dimensional difference gel electrophoresis (2D-DIGE) and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) analysis showed that three proteins are down-regulated and six proteins are up-regulated by SMPS. SMPS reduces the degree of liver injury by up-regulating the enzymes of the citric acid cycle, namely malate dehydrogenase (MDH) and 2-oxoglutarate dehydrogenase complex. LPS significantly increases nuclear factor kappa B (NF-κB) activation, inducible nitric oxide synthase (iNOS) expression and MDA level in BCG primed mice liver, whereas SMPS treatment protects against the immunological liver injury through inhibition of the NF-κB activation by up-regulation of PRDX6 and the subsequent attenuation of lipid peroxidation, iNOS expression and inflammation. Copyright © 2011 John Wiley & Sons, Ltd.

  16. Protective Effect of Amphipterygium adstringens Extract on Dextran Sulphate Sodium-Induced Ulcerative Colitis in Mice

    Directory of Open Access Journals (Sweden)

    Mario Rodriguez-Canales


    Full Text Available Amphipterygium adstringens is an endemic species in Mexico commonly known as “cuachalalate.” Healers to treat gastritis, gastric ulcers, and gastrointestinal cancer have traditionally used the bark. We investigated the effects of alcoholic extract of A. adstringens (AaEE in DSS-induced colitis in mice. The protective effect of AaEE was determined at 200 mg/kg by oral gavage for 10 days. We determine the effect of AaEE on clinical features (disease activity index, antioxidants, anti-inflammatory, and immunomodulatory activities in relation to the activity of SOD, CAT, and GPx, levels of proinflammatory cytokines, and changes both macroscopic and microscopic of the colonic mucosa. AaEE significantly reduced the inflammation of colon and significantly increased SOD and GPx activities. AaEE also significantly decreased TNF-α, IFN-γ, and IL-1β cytokine levels compared to DSS-treated mice and reduced both infiltration of inflammatory cells and the mucosal damage in colon. The results suggested the protective potential of AaEE in DSS-induced colitis and this might be attributed to its phytochemicals compounds that have been found to induce a wide spectrum of activities such as reduction in oxidative stress, suppression of inflammation, modulating numerous signal transduction pathways, and induction of apoptosis. The findings of this study suggest that AaEE has substantial potential for the treatment of inflammatory colitis.

  17. Protective Effect of Amphipterygium adstringens Extract on Dextran Sulphate Sodium-Induced Ulcerative Colitis in Mice (United States)

    Rodriguez-Canales, Mario; Jimenez-Rivas, Ruben; Canales-Martinez, Maria Margarita; Garcia-Lopez, Ana Judith; Rivera-Yañez, Nelly; Nieto-Yañez, Oscar; Ledesma-Soto, Yadira; Sanchez-Torres, Luvia Enid; Rodriguez-Sosa, Miriam; Terrazas, Luis Ignacio


    Amphipterygium adstringens is an endemic species in Mexico commonly known as “cuachalalate.” Healers to treat gastritis, gastric ulcers, and gastrointestinal cancer have traditionally used the bark. We investigated the effects of alcoholic extract of A. adstringens (AaEE) in DSS-induced colitis in mice. The protective effect of AaEE was determined at 200 mg/kg by oral gavage for 10 days. We determine the effect of AaEE on clinical features (disease activity index), antioxidants, anti-inflammatory, and immunomodulatory activities in relation to the activity of SOD, CAT, and GPx, levels of proinflammatory cytokines, and changes both macroscopic and microscopic of the colonic mucosa. AaEE significantly reduced the inflammation of colon and significantly increased SOD and GPx activities. AaEE also significantly decreased TNF-α, IFN-γ, and IL-1β cytokine levels compared to DSS-treated mice and reduced both infiltration of inflammatory cells and the mucosal damage in colon. The results suggested the protective potential of AaEE in DSS-induced colitis and this might be attributed to its phytochemicals compounds that have been found to induce a wide spectrum of activities such as reduction in oxidative stress, suppression of inflammation, modulating numerous signal transduction pathways, and induction of apoptosis. The findings of this study suggest that AaEE has substantial potential for the treatment of inflammatory colitis. PMID:27635116

  18. Protective effects of apocynin and allopurinol on ischemia/reperfusion-induced liver injury in mice

    Institute of Scientific and Technical Information of China (English)

    Ping-Guo Liu; Song-Qing He; Yan-Hong Zhang; Jian Wu


    AIM: To determine the effects of allopurinol, an inhibitor of xanthine oxidase, and apocynin, an inhibitor of NADPH oxidase, on oxidant stress and liver injury caused by hepatic ischemia/reperfusion (I/R) procedure in mice. METHODS: Nice were pretreated with a xanthine oxidase inhibitor, allopurinol, or NADPH oxidase (NOX)inhibitor, apocynin before the hepatic I/R procedure. Then treated or untreated mice underwent the hepatic I/R procedure. The effects on hepatic injury and superoxide anions were determined after starting reperfusion. RESULTS: A standard warm hepatic I/R procedure led to a marked increase in superoxide anion production as indicated by a superoxide anion tracer, MCLA. At the same time, the procedure caused profound acute liver injury, as indicated by elevated serum alanine aminotransferase and tumor necrosis factor-αlevels, reduced liver glutathione levels and elevated malondialdehyde contents, as well as a high apoptotic cell count. All these changes were reversed by the use of apocynin or allopurinol prior to the hepatic I/R procedure. CONCLUSION: AIIopurinol and apocynin exerted protective effects on hepatic ischemia/reperfusion injury. The protection is associated with blocking the generation of superoxide anions during the hepatic I/R procedure by inhibiting xanthine oxidase and NADPH oxidase activity.

  19. Caffeine protects mice against whole-body lethal dose of {gamma}-irradiation

    Energy Technology Data Exchange (ETDEWEB)

    George, K.C.; Hebbar, S.A.; Kale, S.P.; Kesavan, P.C. [Biosciences Group, Bhabha Atomic Research Centre, Trombay, Mumbai 400 085 (India)


    Administration of caffeine (1,3,7-trimethylxanthine), a major component of coffee, to Swiss mice at doses of 80 or 100 mg/kg body weight 60 min prior to whole-body lethal dose of {gamma}-irradiation (7.5 Gy) resulted in the survival of 70 and 63% of animals, respectively, at the above doses in contrast to absolutely no survivors (LD-100/25 days) in the group exposed to radiation alone. Pre-treatment with a lower concentration of caffeine (50 mg/kg) did not confer any radioprotection. The protection exerted by caffeine (80 mg/kg), however, was reduced from 70 to 50% if administered 30 min prior to irradiation. The trend statistics reveal that a dose of 80 mg/kg administered 60 min before whole-body exposure to 7.5 Gy is optimal for maximal radioprotection. However, caffeine (80 mg/kg) administered within 3 min after irradiation offered no protection. While there is documentation in the literature that caffeine is an antioxidant and radioprotector against the toxic pathway of radiation damage in a wide range of cells and organisms, this is the first report demonstrating unequivocally its potent radioprotective action in terms of survival of lethally whole-body irradiated mice. (author)

  20. Temperature-sensitive mutants of Actinobacillus pleuropneumoniae induce protection in mice. (United States)

    Byrd, W; Hooke, A M


    Temperature-sensitive mutants of Actinobacillus pleuropneumoniae 4074, serotype 1, were isolated after treatment with nitrosoguanidine and enrichment with penicillin and D-cycloserine. Of the four temperature-sensitive mutants evaluated in mice, one (A-1) had a tight phenotype (i.e., it ceased replication immediately after transfer to the nonpermissive temperature [37 degrees C]) and three (1-2, 4-1, and 12-1) were coasters that continued replication for up to three generations after transfer to 37 degrees C. The reversion frequencies ranged from 10(-6) to 10(-9), and cutoff temperatures ranged from 33 to 35 degrees C. No major changes were detected in the biochemical profiles; agglutination reactions; electrophoretic profiles of the lipopolysaccharides, outer membrane proteins, and hemolysin proteins; hemolytic titers; or CAMP factor reactions of the mutants and the wild-type bacteria. Groups of 3- to 5-week-old, female ICR mice were immunized intranasally with three doses of 3.5 x 10(6) CFU of the mutants over 3 weeks and subsequently challenged intranasally with 5 50% lethal doses of the parental wild-type. Protection was induced by both the tight and the coaster mutants, with the 4-1 and 12-1 coasters eliciting greater protection (67 and 82%, respectively) than that induced by the A-1 tight mutant (57%). Intranasal immunization with both phenotypes induced serum antibody responses against the surface antigens and the hemolysin protein. PMID:9169752

  1. Protective Effects of Red Guava on Inflammation and Oxidative Stress in Streptozotocin-Induced Diabetic Mice

    Directory of Open Access Journals (Sweden)

    Pei-Ying Li


    Full Text Available Diabetes is an important chronic disease and the 4th leading cause of death in Taiwan. Hyperglycemia-induced oxidative and inflammatory damage are the main causes of chronic complications in diabetic patients. The red guava (red-fleshed guava cultivar of Psidium guajava L. is a tropical fruit belonging to the Myrtaceae family and an important commercial crop in Taiwan. In this study, the protective effects of a diet containing red guava on inflammation and oxidative stress in streptozotocin (STZ-induced diabetic mice were examined. The experimental group was divided into seven subgroups: normal (N, diabetes mellitus (DM, diabetes + red guava 1% (L, 2% (M, and 5% (H, diabetes + 5% red guava + anti-diabetic rosiglitazone (HR, and diabetes + anti-diabetic rosiglitazone (R. The mice were fed for 8 weeks and sacrificed by decapitation. Compared with the DM group, the experimental groups with diets containing red guava as well as rosiglitazone all showed significant improvements in blood glucose control, insulin resistance, creatinine, blood urea nitrogen, triglycerides, non-esterified fatty acids, cholesterol, c-reactive protein, TNF-α, and IL-10. Furthermore, the expression of inflammatory proteins, such as iNOS and NF-κB, was suppressed via activated PPARγ, and the expression levels of GPx3 and ACO increased. In summary, red guava can significantly suppress inflammatory and oxidative damage caused by diabetes and alleviate diabetic symptoms; thus, it exerts protective effects and has potential applications for the development of a dietary supplement.

  2. Protective Effect of Calculus Bovis Sativus on Dextran Sulphate Sodium-Induced Ulcerative Colitis in Mice

    Directory of Open Access Journals (Sweden)

    Xiping Li


    Full Text Available Calculus Bovis Sativus (CBS is a commonly used traditional Chinese medicine, which has been reported to exhibit antispasmodic, fever-reducing, anti-inflammatory, and gallbladder-repairing effects. The present study aims to investigate the protective effect of CBS on dextran sulphate sodium- (DSS- induced ulcerative colitis (UC in mice. C57BL/6 male mice were exposed to 5% DSS in drinking water. CBS was given orally at 50 and 150 mg/kg once per day for 7 days. Body weight, disease activity index (DAI, colon length, colonic myeloperoxidase (MPO activity, superoxide dismutase (SOD activity, and malondialdehyde (MDA and nitric oxide (NO levels were measured. Administration of CBS significantly reserved these changes, decreased the MPO activity and MDA and NO level, and increased the SOD activity in the colon tissue. Histological observation suggested that CBS alleviated edema, mucosal damage, and inflammatory cells infiltration induced by DSS in the colon. Moreover, CBS significantly downregulated the mRNA expression of tumor necrosis factor-α (TNF-α, interleukin- (IL- 1β and IL-6 in the colon tissue. Our data suggested that CBS exerted protective effect on DSS-induced UC partially through the antioxidant and anti-inflammatory activities.

  3. Protective effects of Aloe sterols against UVB-induced photoaging in hairless mice. (United States)

    Misawa, Eriko; Tanaka, Miyuki; Saito, Marie; Nabeshima, Kazumi; Yao, Ruiqing; Yamauchi, Kouji; Abe, Fumiaki; Yamamoto, Yuki; Furukawa, Fukumi


    Aloe vera is a traditional medical plant whose gel has been widely used in skin care. Previously, we have identified Aloe sterols from Aloe vera as active ingredients. This study investigated the protective effects of Aloe sterols without polysaccharides, against ultraviolet B (UVB)-induced skin photoaging in mice using Aloe vera gel extract (AVGE) obtained by supercritical fluid extraction. Aloe vera gel extract was supplemented in the diet (12 or 120 ppm), and HR-1 hairless mice were exposed to UVB irradiation for 7 weeks. Skin measurements and histological and analytical studies were performed. Repeated UVB irradiation induced rough wrinkling of skin with water content reduction and hyperkeratosis. AVGE administration resulted in the significant improvement of UVB-induced skin dryness, epidermal thickness, and wrinkle formation. The AVGE group also suppressed the degenerations of dermal collagen fibers and the appearance of cutaneous apoptosis cells induced by UVB. Furthermore, AVGE administration reduced the excess elevation of pro-inflammatory cytokines (IL-1β and TNF-α) and matrix metalloproteinases (MMP-2, MMP-9, MMP-12, and MMP-13) in UVB-exposed skin. The dietary ingestion of Aloe sterols protected against chronic UVB damage in mouse skin, and our results suggest that Aloe sterols may prevent skin photoaging through the anti-inflammation and MMP regulation. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  4. Protective Effect of Amphipterygium adstringens Extract on Dextran Sulphate Sodium-Induced Ulcerative Colitis in Mice. (United States)

    Rodriguez-Canales, Mario; Jimenez-Rivas, Ruben; Canales-Martinez, Maria Margarita; Garcia-Lopez, Ana Judith; Rivera-Yañez, Nelly; Nieto-Yañez, Oscar; Ledesma-Soto, Yadira; Sanchez-Torres, Luvia Enid; Rodriguez-Sosa, Miriam; Terrazas, Luis Ignacio; Rodriguez-Monroy, Marco Aurelio


    Amphipterygium adstringens is an endemic species in Mexico commonly known as "cuachalalate." Healers to treat gastritis, gastric ulcers, and gastrointestinal cancer have traditionally used the bark. We investigated the effects of alcoholic extract of A. adstringens (AaEE) in DSS-induced colitis in mice. The protective effect of AaEE was determined at 200 mg/kg by oral gavage for 10 days. We determine the effect of AaEE on clinical features (disease activity index), antioxidants, anti-inflammatory, and immunomodulatory activities in relation to the activity of SOD, CAT, and GPx, levels of proinflammatory cytokines, and changes both macroscopic and microscopic of the colonic mucosa. AaEE significantly reduced the inflammation of colon and significantly increased SOD and GPx activities. AaEE also significantly decreased TNF-α, IFN-γ, and IL-1β cytokine levels compared to DSS-treated mice and reduced both infiltration of inflammatory cells and the mucosal damage in colon. The results suggested the protective potential of AaEE in DSS-induced colitis and this might be attributed to its phytochemicals compounds that have been found to induce a wide spectrum of activities such as reduction in oxidative stress, suppression of inflammation, modulating numerous signal transduction pathways, and induction of apoptosis. The findings of this study suggest that AaEE has substantial potential for the treatment of inflammatory colitis.

  5. Immunization with a live attenuated H7N9 influenza vaccine protects mice against lethal challenge.

    Directory of Open Access Journals (Sweden)

    Xiaolan Yang

    Full Text Available The emergence of severe cases of human influenza A (H7N9 viral infection in China in the spring of 2003 resulted in a global effort to rapidly develop an effective candidate vaccine. In this study, a cold-adapted (ca, live attenuated monovalent reassortant influenza H7N9 virus (Ah01/AA ca was generated using reverse genetics that contained hemagglutinin (HA and neuraminidase (NA genes from a 2013 pandemic A H7N9 isolate, A/Anhui/01/2013 virus (Ah01/H7N9; the remaining six backbone genes derived from the cold-adapted influenza H2N2 A/Ann Arbor/6/60 virus (AA virus. Ah01/AA ca virus exhibited temperature sensitivity (ts, ca, and attenuation (att phenotypes. Intranasal immunization of female BALB/c mice with Ah01/AA ca twice at a 2-week interval induced robust humoral, mucosal, and cell-mediated immune responses in a dose-dependent manner. Furthermore, the candidate Ah01/AA ca virus was immunogenic and offered partial or complete protection of mice against a lethal challenge by the live 2013 influenza A H7N9 (A/Anhui/01/2013. Protection was demonstrated by the inhibition of viral replication and the attenuation of histopathological changes in the challenged mouse lung. Taken together, these data support the further evaluation of this Ah01/AA ca candidate vaccine in primates.

  6. Transgenic Tobacco Expressing a Modified VP6 Gene Protects Mice Against Rotavirus Infection

    Institute of Scientific and Technical Information of China (English)

    Jiang-Li DONG; Bo ZHOU; Gang SHENG; Tao WANG


    Elevated expression of the rotavirus VP6 antigen in transgenic plants is a critical factor in the development of a safe and effective rotavirus vaccine. Using codon optimization, a gene that encodes the inner capsid protein VP6 of the human group A rotavirus was synthesized (sVP6). The VP6 and sVp6genes were transformed into tobacco (Nicotiana tabacum L.) plants using Agrobacterium tumefaciens. The expression level of the sVP6 gene in transgenic plants was 3.8-34-fold higher than that of controls containing the non-modified VP6 gene, accounting for up to 0.34% of the total soluble protein (TSP). Then, BALB/c female mice that had been gavaged weekly with 10 mg TSP containing 34 μg VP6 protein, in which VP6-specific serum IgG and mucosal IgA antibodies were investigated. The severity and duration of diarrhea caused by simian rotavirus SA-11 challenge were reduced significantly in passively immunized pups, which indicates that anti-VP6 antibodies generated in orally immunized female mice can be passed onto pups and provide heterotypic protection. An edible vaccine based on the VP6 of human rotavirus group A could provide a means to protect children and young animals from severe acute diarrhea.

  7. Protective effects of Fructus sophorae extract on collagen-induced arthritis in BALB/c mice (United States)

    Han, Hyoung-Min; Hong, Su-Hyun; Park, Heung-Sik; Jung, Jae-Chul; Kim, Jong-Sik; Lee, Yong-Tae; Lee, Eun-Woo; Choi, Yung-Hyun; Kim, Byung-Woo; Kim, Cheol-Min; Kang, Kyung-Hwa


    Styphnolobium japonicum (L.) is utilized in Korean medicine for the treatment of various inflammatory diseases. The aim of the present study was to explore the effects of Fructus sophorae extract (FSE) isolated from the dried ripe fruit of S. japonicum (L.) on the development of type II collagen-induced arthritis (CIA) in BALB/c mice. The CIA mice were orally administered FSE or saline daily for 2 weeks. The incidence and severity of disease and the inflammatory response in the serum and the joint tissues were assessed. Macroscopic and histological investigation indicated that FSE protected against CIA development. FSE was associated with a significant reduction in the levels of total immunoglobulin G2a and proinflammatory cytokines and mediators in the serum. In addition, FSE suppressed the gene expression levels of proinflammatory cytokines and mediators, the mediator of osteoclastic bone remodeling, the receptor activator of nuclear factor κ-B ligand and matrix metalloproteinases in the joint tissues. The present results suggest that FSE may protect against inflammation and bone damage, and would be a valuable candidate for further investigation as a novel anti-arthritic agent. PMID:28123483

  8. p-Methoxyl-diphenyl diselenide protects against cisplatin-induced renal toxicity in mice. (United States)

    Wilhelm, Ethel A; Bortolatto, Cristiani F; Nogueira, Cristina W


    The present study was designed to investigate the effects of p-methoxyl-diphenyl diselenide (OMePhSe)(2) on oxidative stress and renal damage parameters of mice exposed to cisplatin. (OMePhSe)(2) (50 and 100 mg/kg/day) was orally administered to mice for six consecutive days. On the third day after the beginning of (OMePhSe)(2) treatment, the renal toxicity was induced by injecting cisplatin (10 mg/kg intraperitoneal) in mice. (OMePhSe)(2) treatment (50 mg/kg) partially reduced plasma urea and creatinine levels increased by cisplatin. Histopathological examination of kidneys showed that (OMePhSe)(2) ameliorated renal injury caused by cisplatin. (OMePhSe)(2) attenuated the decrease in reduced glutathione (GSH) and ascorbic acid (AA) levels, the inhibition of glutathione peroxidase (GPx), glutathione S-transferase (GST), glutathione reductase (GR) and catalase (CAT) activities caused by cisplatin in kidney. (OMePhSe)(2) treatment partially protected against the inhibition of renal δ-aminolevulinic dehydratase (δ-ALA-D) activity caused by cisplatin. No alteration in renal lipid peroxidation levels was found in cisplatin and/or (OMePhSe)(2) groups. (OMePhSe)(2) was effective against the increase in reactive species (RS) levels caused by the cisplatin exposure. Based on the renoprotective and antioxidant actions of (OMePhSe)(2) we suggest that this organoselenium compound could be considered a feasible candidate to protect against toxicity commonly encountered in cisplatin exposure.

  9. Human immune system mice immunized with Plasmodium falciparum circumsporozoite protein induce protective human humoral immunity against malaria. (United States)

    Huang, Jing; Li, Xiangming; Coelho-dos-Reis, Jordana G A; Zhang, Min; Mitchell, Robert; Nogueira, Raquel Tayar; Tsao, Tiffany; Noe, Amy R; Ayala, Ramses; Sahi, Vincent; Gutierrez, Gabriel M; Nussenzweig, Victor; Wilson, James M; Nardin, Elizabeth H; Nussenzweig, Ruth S; Tsuji, Moriya


    In this study, we developed human immune system (HIS) mice that possess functional human CD4+ T cells and B cells, named HIS-CD4/B mice. HIS-CD4/B mice were generated by first introducing HLA class II genes, including DR1 and DR4, along with genes encoding various human cytokines and human B cell activation factor (BAFF) to NSG mice by adeno-associated virus serotype 9 (AAV9) vectors, followed by engrafting human hematopoietic stem cells (HSCs). HIS-CD4/B mice, in which the reconstitution of human CD4+ T and B cells resembles to that of humans, produced a significant level of human IgG against Plasmodium falciparum circumsporozoite (PfCS) protein upon immunization. CD4+ T cells in HIS-CD4/B mice, which possess central and effector memory phenotypes like those in humans, are functional, since PfCS protein-specific human CD4+ T cells secreting IFN-γ and IL-2 were detected in immunized HIS-CD4/B mice. Lastly, PfCS protein-immunized HIS-CD4/B mice were protected from in vivo challenge with transgenic P. berghei sporozoites expressing the PfCS protein. The immune sera collected from protected HIS-CD4/B mice reacted against transgenic P. berghei sporozoites expressing the PfCS protein and also inhibited the parasite invasion into hepatocytes in vitro. Taken together, these studies show that our HIS-CD4/B mice could mount protective human anti-malaria immunity, consisting of human IgG and human CD4+ T cell responses both specific for a human malaria antigen.

  10. Puerarin protects against damage to spatial learning and memory ability in mice with chronic alcohol poisoning

    Directory of Open Access Journals (Sweden)

    S.Q. Cui


    Full Text Available We evaluated the effect of puerarin on spatial learning and memory ability of mice with chronic alcohol poisoning. A total of 30 male C57BL/6 mice were randomly divided into model, puerarin, and control groups (n=10 each. The model group received 60% (v/v ethanol by intragastric administration followed by intraperitoneal injection of normal saline 30 min later. The puerarin group received intragastric 60% ethanol followed by intraperitoneal puerarin 30 min later, and the control group received intragastric saline followed by intraperitoneal saline. Six weeks after treatment, the Morris water maze and Tru Scan behavioral tests and immunofluorescence staining of cerebral cortex and hippocampal neurons (by Neu-N and microglia (by Ib1 were conducted. Glutamic acid (Glu and gamma amino butyric acid (GABA in the cortex and hippocampus were assayed by high-performance liquid chromatography (HPLC, and tumor necrosis factor (TNF-α and interleukin (IL-1β were determined by ELISA. Compared with mice in the control group, escape latency and distance were prolonged, and spontaneous movement distance was shortened (P<0.05 by puerarin. The number of microglia was increased in both the cortex and hippocampal dentate gyrus (P<0.01, and neurons were reduced only in the hippocampal dentate gyrus (P<0.01 in puerarin-treated mice. In the model group, Glu and GABA levels decreased (P<0.05, and Glu/GABA, TNF-α, and IL-1β increased (P<0.01 with puerarin treatment, returning to near normal levels. In conclusion, puerarin protected against the effects of chronic alcohol poisoning on spatial learning and memory ability primarily because of anti-inflammatory activity and regulation of the balance of Glu and GABA.

  11. Protective effect of chelerythrine against ethanol-induced gastric ulcer in mice. (United States)

    Li, Wei-Feng; Hao, Ding-Jun; Fan, Ting; Huang, Hui-Min; Yao, Huan; Niu, Xiao-Feng


    The quaternary benzo[c]phenanthridine alkaloid, chelerythrine (CHE), is of great practical and research interest because of its pronounced, widespread physiological effects, primarily antimicrobial and anti-inflammatory, arising from its ability to interact with proteins and DNA. Although CHE was originally shown to possess anti-inflammatory properties, its effects on acute gastric ulcer have not been previously explored. The aim of the present study is to evaluate the protective effect of CHE on ethanol induced gastric ulcer in mice. Administration of CHE at doses of 1, 5 and 10mg/kg bodyweight prior to ethanol ingestion dose-dependently inhibited gastric ulcer. The gastric mucosal lesion was assessed by ulcer area, gastric juice acidity, myeloperoxidase (MPO) activities, macroscopic and histopathological examinations. CHE significantly reduced the gastric ulcer index, myeloperoxidase activities, macroscopic and histological score in a dose-dependent manner. In addition, CHE also significantly inhibited nitric oxide (NO) concentration, pro-inflammatory interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-α) level in serum and gastric mucosal in the mice exposed to ethanol induced ulceration in a dose-dependent manner. In addition, immunohistochemical analysis revealed that CHE markedly attenuated the overexpression of nuclear factor-κB in gastric mucosa of mice. It was concluded that CHE represents a potential therapeutic option to reduce the risk of gastric ulceration. In addition, acute toxicity study revealed no abnormal sign to the mice treated with CHE (15mg/kg). These findings suggest that the gastroprotective activity of CHE might contribute in adjusting the inflammatory cytokine by regulating the NF-κB signalling pathway.

  12. Mode of action of FK-506 on protective immunity to Hymenolepis nana in mice. (United States)

    Asano, K; Taki, M; Matsuo, S; Yamada, K


    FK-506 (Tacrolimus) has been shown to block T cell proliferation in vitro by inhibiting the generation of several lymphokines, especially interleukin (IL)-2, but little direct evidence is available to support the view that the immunosuppressive effects of FK-506 in vivo are mediated by a similar inhibition of lymphokine cascade. To investigate the mechanisms of FK-506-induced immunosuppression, the effects of FK-506 on cell-mediated immunity to Hymenolepis nana were examined in mice. FK-506 administration into BALB/c mice daily at a dose of 10.0 mg/kg (but not 5.0 mg/kg) for 5 days caused suppression of protective immunity against H. nana challenge infection. During the infection of mice with H. nana, IL-2 and interferon (IFN)-gama were produced by mesenteric lymph node (MLN) cells with a time course corresponding to that of MLN T cell proliferation. These responses were completely suppressed by repeated administration of FK-506 for 5 days at a dose of 10.0 mg/kg/day (but not 5.0 mg/kg/day). In contrast to the effects of FK-506 on IL-2 and IFN-gamma productions in MLN, IL-1 and tumor necrosis factor-alpha in the intestinal wall, which were enhanced by H. nana infection, were not completely decreased as a result of 10.0 mg/kg FK-506 treatment. The reverse transcriptase-PCR revealed complete inhibition of IL-2 and IFN-gamma mRNA expression on mesenteric L3T4+ cells that were induced by H. nana infection, when mice were given 10.0 mg/kg/day FK-506 for 5 days. These results strongly suggest that FK-506 affects cell-mediated immunity in vivo with mechanisms similar to those observed in vitro.

  13. TLR-Activated Gap Junction Channels Protect Mice against Bacterial Infection through Extracellular UDP Release. (United States)

    Qin, Juliang; Zhang, Guangxu; Zhang, Xiaoyu; Tan, Binghe; Lv, Zhangsheng; Liu, Mingyao; Ren, Hua; Qian, Min; Du, Bing


    Extracellular UDP (eUDP), released as a danger signal by stressed or apoptotic cells, plays an important role in a series of physiological processes. Although the mechanism of eUDP release in apoptotic cells has been well defined, how the eUDP is released in innate immune responses remains unknown. In this study, we demonstrated that UDP was released in both Escherichia coli-infected mice and LPS- or Pam3CSK4-treated macrophages. Also, LPS-induced UDP release could be significantly blocked by selective TLR4 inhibitor Atractylenolide I and selective gap junction inhibitors carbenoxolone and flufenamic acid (FFA), suggesting the key role of TLR signaling and gap junction channels in this process. Meanwhile, eUDP protected mice from peritonitis by reducing invaded bacteria that could be rescued by MRS2578 (selective P2Y6 receptor inhibitor) and FFA. Then, connexin 43, as one of the gap junction proteins, was found to be clearly increased by LPS in a dose- and time-dependent manner. Furthermore, if we blocked LPS-induced ERK signaling by U0126, the expression of connexin 43 and UDP release was also inhibited dramatically. In addition, UDP-induced MCP-1 secretion was significantly reduced by MRS2578, FFA, and P2Y6 mutation. Accordingly, pretreating mice with U0126 and Gap26 increased invaded bacteria and aggravated mice death. Taken together, our study reveals an internal relationship between danger signals and TLR signaling in innate immune responses, which suggests a potential therapeutic significance of gap junction channel-mediated UDP release in infectious diseases. Copyright © 2016 by The American Association of Immunologists, Inc.

  14. Protective roles of heat stress on the neurons in hippocampal CA1 region of mice

    Institute of Scientific and Technical Information of China (English)

    WANG Chunxu; WANG Hanxing


    The effects of heat stress on the neurons in hippocampal CA1 region of brain ischemia/reperfusion were explored.The mice were pretreated with heat stress followed by ischemia/reperfusion by clipping bilateral cervical common arteries for 7 min.Mice were divided randomly into four groups as follows:(1)normal control group;(2)heat stress pretreated subsequent to ischemia/reperfusion group (HS/IR);(3)ischemia/reperfusion group(IR);and(4)heat stress group(HS).Animals in the last three groups were subdivided into three subgroups:1 d,4 d,14 d respectively.The Morris water maze was used to test the ability of learning and memorizing,Nissl staining was used to count the average number of survived neurons in hippocampal CA1 region,and immunohistochemistry combined with image analysis system to detect the changes of Microtubule associated protein 2 (MAP-2)expression.The results showed that mice in IR group exhibited increased escape latency when compared with that of normal,HS and HS/IR groups(P<0.01),and the mice in IR group adopted an inefficient search strategy,major in circling and restricted searching manners.Nissl staining results showed a significant reduction in the number of pyramidal neurons in hippocampal CA1 regions in HS/IR and IR groups,with a decrease in IR group(P<0.01).Compared with normal group,the expression of MAP-2 in hippocampal CA1 region obviously decreased in IR group(P<0.05).The present results indicate that heat stress pretreatment can improve the spatial learning and memorizing function through protection to hippocampal neurons.

  15. Soluble Dietary Fiber Can Protect the Gastrointestinal Mucosa Against Nonsteroidal Anti-Inflammatory Drugs in Mice. (United States)

    Satoh, Hiroshi; Urushidani, Tetsuro


    Nonsteroidal anti-inflammatory drug (NSAID)-induced small intestinal damage is a serious problem in patients, but effective therapy is not available at present. The effects of feeding conditions and dietary fiber (DF) on NSAID-induced gastrointestinal lesions were examined in mice. NSAIDs (indomethacin, diclofenac, loxoprofen, aspirin) were administered to male mice in various feeding conditions. Gastrointestinal lesions were examined 24 h after NSAID dosing. Regular diets, dietary-fiber-free diet (FFD), and diets supplemented with various types of DF were given to mice. NSAIDs produced marked ulcers and perforations selectively in the gastric antrum when they were administered after feeding of regular diet for 2 h after a 22-h fast. When NSAIDs, except for aspirin, were administered in unfasted conditions, they caused marked lesions in the small intestine. When mice were given FFD, antral ulcers and intestinal lesions induced by indomethacin (30 mg/kg, s.c.) markedly decreased, but when cellulose, an insoluble DF, was added to FFD, the lesions appeared again. The addition of pectin, a soluble DF, to regular diet containing 4.1 % crude fiber significantly inhibited the formation of antral ulcers as well as intestinal lesions caused by indomethacin or diclofenac (100 mg/kg, s.c.). The results indicated that NSAIDs given after feeding of diet produced ulcers selectively in the gastric antrum. The severity of the gastrointestinal lesions depended on the concentration of soluble or insoluble DF in food. Our results suggest that soluble DF such as pectin may be a safe means for protecting the gastrointestinal mucosa against NSAIDs.

  16. Immunosuppressive therapy exacerbates autoimmunity in NOD mice and diminishes the protective activity of regulatory T cells. (United States)

    Kaminitz, Ayelet; Mizrahi, Keren; Yaniv, Isaac; Stein, Jerry; Askenasy, Nadir


    Mounting evidence indicates that immunosuppressive therapy and autologous bone marrow transplantation are relatively inefficient approaches to treat autoimmune diabetes. In this study we assessed the impact of immunosuppression on inflammatory insulitis in NOD mice, and the effect of radiation on immunomodulation mediated by adoptive transfer of various cell subsets. Sublethal radiation of NOD females at the age of 14 weeks (onset of hyperglycemia) delayed the onset of hyperglycemia, however two thirds of the mice became diabetic. Adoptive transfer of splenocytes into irradiated NON and NOD mice precipitated disease onset despite increased contents of CD25(+)FoxP3(+) T cells in the pancreas and regional lymphatics. Similar phenotypic changes were observed when CD25(+) T cells were infused after radiation, which also delayed disease onset without affecting its incidence. Importantly, irradiation increased the susceptibility to diabetes in NOD and NON mice (71-84%) as compared to immunomodulation with splenocytes and CD25(+) T cells in naïve recipients (44-50%). Although irradiation had significant and durable influence on pancreatic infiltrates and the fractions of functional CD25(+)FoxP3(+) Treg cells were elevated by adoptive cell transfer, this approach conferred no protection from disease progression. Irradiation was ineffective both in debulking of pathogenic clones and in restoring immune homeostasis, and the consequent homeostatic expansion evolves as an unfavorable factor in attempts to restore self-tolerance and might even provoke uncontrolled proliferation of pathogenic clones. The obstacles imposed by immunosuppression on abrogation of autoimmune insulitis require replacement of non-specific immunosuppressive therapy by selective immunomodulation that does not cause lymphopenia.

  17. Glutathione Reductase Targeted to Type II Cells Does Not Protect Mice from Hyperoxic Lung Injury (United States)

    Heyob, Kathryn M.; Rogers, Lynette K.; Welty, Stephen E.


    Exposure of the lung epithelium to reactive oxygen species without adequate antioxidant defenses leads to airway inflammation, and may contribute to lung injury. Glutathione peroxidase catalyzes the reduction of peroxides by oxidation of glutathione (GSH) to glutathione disulfide (GSSG), which can in turn be reduced by glutathione reductase (GR). Increased levels of GSSG have been shown to correlate negatively with outcome after oxidant exposure, and increased GR activity has been protective against hyperoxia in lung epithelial cells in vitro. We tested the hypothesis that increased GR expression targeted to type II alveolar epithelial cells would improve outcome in hyperoxia-induced lung injury. Human GR with a mitochondrial targeting sequence was targeted to mouse type II cells using the SPC promoter. Two transgenic lines were identified, with Line 2 having higher lung GR activities than Line 1. Both transgenic lines had lower lung GSSG levels and higher GSH/GSSG ratios than wild-type. Six-week-old wild-type and transgenic mice were exposed to greater than 95% O2 or room air (RA) for 84 hours. After exposure, Line 2 mice had higher right lung/body weight ratios and lavage protein concentrations than wild-type mice, and both lines 1 and 2 had lower GSSG levels than wild-type mice. These findings suggest that GSSG accumulation in the lung may not play a significant role in the development of hyperoxic lung injury, or that compensatory responses to unregulated GR expression render animals more susceptible to hyperoxic lung injury. PMID:18566333

  18. Protective role of taurine against genotoxic damage in mice treated with methotrexate and tamoxfine. (United States)

    Alam, Sally S; Hafiz, Nagla A; Abd El-Rahim, Abeer H


    The genotoxic actions of anti-neoplastic drugs can lead to the development of secondary cancers in patients in extended remission. One of the most attractive approaches to disease prevention involves the use of natural antioxidants to protect tissue against toxic injury. We investigated the modulatory effects of exogenously administered taurine, on the genotoxicity of two well known anti-neoplastic drugs methotrexate (MTX) and tamoxifen (TAM) in Swiss albino mice. The animals were randomly divided into six groups consisting of ten mice each. Two groups were received single intraperitoneal injection of MTX (10 mg/kgb.wt.) and TAM (50 mg/kgb.wt.) to induce genotoxicity. Two other groups were treated orally with taurine (100 mg/kgb.wt.) for nine days prior to MTX and TAM administration. A vehicle treated control group and taurine control groups were also included. The protective effects of taurine were monitored by apoptosis assays and level of reduced glutathione (GSH), a key antioxidant, in liver, chromosomal aberrations in somatic and germ cells as well as sperm count, motility and morphology. The results indicated that taurine pre-treatment showed significant increment in the levels of GSH content, reduction in DNA fragmentation and ladder formation in hepatic tissue, suggesting the antioxidant activity of taurine may reduce the toxic effects of MTX and TAM. Treatment with taurine showed also significant reduction in the frequency of chromosomal aberrations in both somatic and germ cells. Moreover, it increases sperm count and motility, and decreases the incidence of sperm abnormalities. In conclusion, it appears that taurine protects against anti-neoplastic drugs-induced genotoxicity in somatic and germ tissues and may be of therapeutic potential in alleviating the risk of secondary tumors in chemotherapy.

  19. Fluoxetine protection in decompression sickness in mice is enhanced by blocking TREK-1 potassium channel with the spadin antidepressant.

    Directory of Open Access Journals (Sweden)

    Nicolas eVallée


    Full Text Available In mice, disseminated coagulation, inflammation and ischemia induce neurological damages that can lead to the death. These symptoms result from circulating bubbles generated by a pathogenic decompression. An acute fluoxetine treatment or the presence of the TREK-1 potassium channel increased the survival rate when mice are subjected to an experimental dive/decompression protocol. This is a paradox because fluoxetine is a blocker of TREK-1 channels. First, we studied the effects of an acute dose of fluoxetine (50mg/kg in wild-type (WT and TREK-1 deficient mice (Knockout homozygous KO and heterozygous HET. Then, we combined the same fluoxetine treatment with a five-day treatment by spadin, in order to specifically block TREK-1 activity (KO-like mice. KO and KO-like mice could be regarded as antidepressed models.167 mice (45 WTcont 46 WTflux 30 HETflux and 46 KOflux constituting the flux-pool and 113 supplementary mice (27 KO-like 24 WTflux2 24 KO-likeflux 21 WTcont2 17 WTno dive constituting the spad-pool were included in this study. Only 7% of KO-TREK-1 treated with fluoxetine (KOflux and 4% of mice treated with both spadin and fluoxetine (KO-likeflux died from decompression sickness (DCS symptoms. These values are much lower than those of WT control (62% or KO-like mice (41%. After the decompression protocol, mice showed a significant consumption of their circulating platelets and leukocytes.Spadin antidepressed mice were more likely to declare DCS. Nevertheless, which had both blocked TREK-1 channel and were treated with fluoxetine were better protected against DCS. We conclude that the protective effect of such an acute dose of fluoxetine is enhanced when TREK-1 is inhibited. We confirmed that antidepressed models may have worse DCS outcomes, but a concomitant fluoxetine treatment not only decreases DCS severity but increases the survival rate.

  20. Complement C3 deficiency protects against neurodegeneration in aged plaque-rich APP/PS1 mice. (United States)

    Shi, Qiaoqiao; Chowdhury, Saba; Ma, Rong; Le, Kevin X; Hong, Soyon; Caldarone, Barbara J; Stevens, Beth; Lemere, Cynthia A


    The complement cascade not only is an innate immune response that enables removal of pathogens but also plays an important role in microglia-mediated synaptic refinement during brain development. Complement C3 is elevated in Alzheimer's disease (AD), colocalizing with neuritic plaques, and appears to contribute to clearance of Aβ by microglia in the brain. Previously, we reported that C3-deficient C57BL/6 mice were protected against age-related and region-specific loss of hippocampal synapses and cognitive decline during normal aging. Furthermore, blocking complement and downstream iC3b/CR3 signaling rescued synapses from Aβ-induced loss in young AD mice before amyloid plaques had accumulated. We assessed the effects of C3 deficiency in aged, plaque-rich APPswe/PS1dE9 transgenic mice (APP/PS1;C3 KO). We examined the effects of C3 deficiency on cognition, Aβ plaque deposition, and plaque-related neuropathology at later AD stages in these mice. We found that 16-month-old APP/PS1;C3 KO mice performed better on a learning and memory task than did APP/PS1 mice, despite having more cerebral Aβ plaques. Aged APP/PS1;C3 KO mice also had fewer microglia and astrocytes localized within the center of hippocampal Aβ plaques compared to APP/PS1 mice. Several proinflammatory cytokines in the brain were reduced in APP/PS1;C3 KO mice, consistent with an altered microglial phenotype. C3 deficiency also protected APP/PS1 mice against age-dependent loss of synapses and neurons. Our study suggests that complement C3 or downstream complement activation fragments may play an important role in Aβ plaque pathology, glial responses to plaques, and neuronal dysfunction in the brains of APP/PS1 mice. Copyright © 2017, American Association for the Advancement of Science.

  1. The Mx1 gene protects mice against the pandemic 1918 and highly lethal human H5N1 influenza viruses. (United States)

    Tumpey, Terrence M; Szretter, Kristy J; Van Hoeven, Neal; Katz, Jacqueline M; Kochs, Georg; Haller, Otto; García-Sastre, Adolfo; Staeheli, Peter


    Mice carrying a wild-type Mx1 gene (Mx1+/+) differ from standard laboratory mice (Mx1-/-) in being highly resistant to infection with common laboratory strains of influenza A virus. We report that Mx1 also protects mice against the pandemic human 1918 influenza virus and a highly lethal human H5N1 strain from Vietnam. Resistance to H5N1 of Mx1+/+ but not Mx1-/- mice was enhanced if the animals were treated with a single dose of exogenous alpha interferon before infection. Thus, the interferon-induced resistance factor Mx1 represents a key component of the murine innate immune system that mediates protection against epidemic and pandemic influenza viruses.

  2. Huperzine A provides robust and sustained protection against induced seizures in Scn1a mutant mice

    Directory of Open Access Journals (Sweden)

    Jennifer C. Wong


    Full Text Available De novo loss-of-function mutations in the voltage-gated sodium channel (VGSC SCN1A (encoding Nav1.1 are the main cause of Dravet syndrome (DS, a catastrophic early-life encephalopathy associated with prolonged and recurrent early-life febrile seizures (FSs, refractory afebrile epilepsy, cognitive and behavioral deficits, and a 15-20% mortality rate. SCN1A mutations also lead to genetic epilepsy with febrile seizures plus (GEFS+, which is an inherited disorder characterized by early-life FSs and the development of a range of adult epilepsy subtypes. Current antiepileptic drugs often fail to protect against the severe seizures and behavioral and cognitive deficits found in patients with SCN1A mutations. To address the need for more efficacious treatments for SCN1A-derived epilepsies, we evaluated the therapeutic potential of Huperzine A, a naturally occurring reversible acetylcholinesterase inhibitor. In CF1 mice, Hup A (0.56 or 1 mg/kg was found to confer protection against 6 Hz-, pentylenetetrazole (PTZ-, and maximal electroshock (MES-induced seizures. Robust protection against 6 Hz-, MES-, and hyperthermia-induced seizures was also achieved following Hup A administration in mouse models of DS (Scn1a+/- and GEFS+ (Scn1aRH/+. Furthermore, Hup A-mediated seizure protection was sustained during 3 weeks of daily injections in Scn1aRH/+ mutants. Finally, we determined that the muscarinic and GABAA receptors play a role in Hup A-mediated seizure protection. These findings indicate that Hup A might provide a novel therapeutic strategy for increasing seizure resistance in DS and GEFS+, and more broadly, in other forms of refractory epilepsy.

  3. Human anti-plague monoclonal antibodies protect mice from Yersinia pestis in a bubonic plague model.

    Directory of Open Access Journals (Sweden)

    Xiaodong Xiao

    Full Text Available Yersinia pestis is the etiologic agent of plague that has killed more than 200 million people throughout the recorded history of mankind. Antibiotics may provide little immediate relief to patients who have a high bacteremia or to patients infected with an antibiotic resistant strain of plague. Two virulent factors of Y. pestis are the capsid F1 protein and the low-calcium response (Lcr V-protein or V-antigen that have been proven to be the targets for both active and passive immunization. There are mouse monoclonal antibodies (mAbs against the F1- and V-antigens that can passively protect mice in a murine model of plague; however, there are no anti-Yersinia pestis monoclonal antibodies available for prophylactic or therapeutic treatment in humans. We identified one anti-F1-specific human mAb (m252 and two anti-V-specific human mAb (m253, m254 by panning a naïve phage-displayed Fab library against the F1- and V-antigens. The Fabs were converted to IgG1s and their binding and protective activities were evaluated. M252 bound weakly to peptides located at the F1 N-terminus where a protective mouse anti-F1 mAb also binds. M253 bound strongly to a V-antigen peptide indicating a linear epitope; m254 did not bind to any peptide from a panel of 53 peptides suggesting that its epitope may be conformational. M252 showed better protection than m253 and m254 against a Y, pestis challenge in a plague mouse model. A synergistic effect was observed when the three antibodies were combined. Incomplete to complete protection was achieved when m252 was given at different times post-challenge. These antibodies can be further studied to determine their potential as therapeutics or prophylactics in Y. pestis infection in humans.

  4. Protective effects of Astragalus-Lilygranules on intestinal mucosal barrier of mice in high altitude hypoxia

    Directory of Open Access Journals (Sweden)

    Ling LI


    Full Text Available Objective  To investigate the protective effect of Astragalus-Lily Granules on intestinal mucosa and intestinal flora homeostasis in mice under high altitude hypoxia condition. Methods  We put mice into high altitude hypoxia cabin to establish high altitude hypoxia model mice. Sixty Kunming mice were randomly divided into control group, model group, Astragalus-Lily particles (ALP low, medium and high dose groups [1.75, 3.5, 7g/(kg•d] respectively. After three days of routine feeding, the ALP mice received drug by intragastric administration, once a day for continuous 17 days,control group and model group were given double distilled water in same volume. From the 15th day, all the mice but control group were exposed to simulated high altitude hypoxia condition for 3 days in a high altitude hypoxia cabin after they were gavaged for half an hour daily. By the 18th day, the fresh mouse feces were collected and smeared to observe the changes of microflora. The pathological changes of intestinal tissues were observed by HE staining and the expression of HIF-1αprotein in intestines was detected by immunohistochemistry. Results  The enterococci and gram negative bacteria showed a higher proportion (65.2%±2.4% and 56.7%±3.3%, respectively in the model group compared with the control group (24.7%±1.2%, 23.2%±1.5%, respectively, P<0.05. The pathological score of intestinal mucosal necrosis and edema (3.10±0.99, 3.30±0.67 respectively and inflammatory cell count (15.93±3.30, 16.40±3.97/ HP respectively was higher compared with the model group (0.70±0.67, 0.80±0.78; 4.07±2.12, 4.28±2.16/HP respectively; P<0.05. HIF-1αexpression increased significantly compared with the model group (P<0.05. The enterococci (46.7%±2.0%, 32.0%±2.6% respectively and gram negative bacteria rate (34.2%±1.6%, 38.0%±2.8% respectively in the ALP medium and high dose groups were lower compared with the model group (24.7%±1.2%, 23.2%±1.5% respectively, P<0

  5. C-reactive protein protects mice against pneumococcal infection via both phosphocholine-dependent and phosphocholine-independent mechanisms. (United States)

    Gang, Toh B; Hanley, Gregory A; Agrawal, Alok


    The mechanism of action of C-reactive protein (CRP) in protecting mice against lethal Streptococcus pneumoniae infection is unknown. The involvement of the phosphocholine (PCh)-binding property of CRP in its antipneumococcal function previously has been explored twice, with conflicting results. In this study, using three different intravenous sepsis mouse models, we investigated the role of the PCh-binding property of CRP by employing a CRP mutant incapable of binding to PCh. The ability of wild-type CRP to protect mice against infection was found to differ in the three models; the protective ability of wild-type CRP decreased when the severity of infection was increased, as determined by measuring mortality and bacteremia. In the first animal model, in which we used 25 μg of CRP and 10(7) CFU of pneumococci, both wild-type and mutant CRP protected mice against infection, suggesting that the protection was independent of the PCh-binding activity of CRP. In the second model, in which we used 25 μg of CRP and 5 × 10(7) CFU of pneumococci, mutant CRP was not protective while wild-type CRP was, suggesting that the protection was dependent on the PCh-binding activity of CRP. In the third model, in which we used 150 μg of CRP and 10(7) CFU of pneumococci, mutant CRP was as protective as wild-type CRP, again indicating that the protection was independent of the PCh-binding activity of CRP. We conclude that both PCh-dependent and PCh-independent mechanisms are involved in the CRP-mediated decrease in bacteremia and the resulting protection of mice against pneumococcal infection.

  6. Gaseous hydrogen sulfide protects against myocardial ischemia-reperfusion injury in mice partially independent from hypometabolism.

    Directory of Open Access Journals (Sweden)

    Pauline M Snijder

    Full Text Available BACKGROUND: Ischemia-reperfusion injury (IRI is a major cause of cardiac damage following various pathological processes. Gaseous hydrogen sulfide (H2S is protective during IRI by inducing a hypometabolic state in mice which is associated with anti-apoptotic, anti-inflammatory and antioxidant properties. We investigated whether gaseous H2S administration is protective in cardiac IRI and whether non-hypometabolic concentrations of H2S have similar protective properties. METHODS: Male C57BL/6 mice received a 0, 10, or 100 ppm H2S-N2 mixture starting 30 minutes prior to ischemia until 5 minutes pre-reperfusion. IRI was inflicted by temporary ligation of the left coronary artery for 30 minutes. High-resolution respirometry equipment was used to assess CO2-production and blood pressure was measured using internal transmitters. The effects of H2S were assessed by histological and molecular analysis. RESULTS: Treatment with 100 ppm H2S decreased CO2-production by 72%, blood pressure by 14% and heart rate by 25%, while treatment with 10 ppm H2S had no effects. At day 1 of reperfusion 10 ppm H2S showed no effect on necrosis, while treatment with 100 ppm H2S reduced necrosis by 62% (p<0.05. Seven days post-reperfusion, both 10 ppm (p<0.01 and 100 ppm (p<0.05 H2S showed a reduction in fibrosis compared to IRI animals. Both 10 ppm and 100 ppm H2S reduced granulocyte-influx by 43% (p<0.05 and 60% (p<0.001, respectively. At 7 days post-reperfusion both 10 and 100 ppm H2S reduced expression of fibronectin by 63% (p<0.05 and 67% (p<0.01 and ANP by 84% and 63% (p<0.05, respectively. CONCLUSIONS: Gaseous administration of H2S is protective when administered during a cardiac ischemic insult. Although hypometabolism is restricted to small animals, we now showed that low non-hypometabolic concentrations of H2S also have protective properties in IRI. Since IRI is a frequent cause of myocardial damage during percutaneous coronary intervention and cardiac

  7. Bordetella pertussis infection or vaccination substantially protects mice against B. bronchiseptica infection.

    Directory of Open Access Journals (Sweden)

    Elizabeth M Goebel

    Full Text Available Although B. bronchiseptica efficiently infects a wide range of mammalian hosts and efficiently spreads among them, it is rarely observed in humans. In contrast to the many other hosts of B. bronchiseptica, humans are host to the apparently specialized pathogen B. pertussis, the great majority having immunity due to vaccination, infection or both. Here we explore whether immunity to B. pertussis protects against B. bronchiseptica infection. In a murine model, either infection or vaccination with B. pertussis induced antibodies that recognized antigens of B. bronchiseptica and protected the lower respiratory tract of mice against three phylogenetically disparate strains of B. bronchiseptica that efficiently infect naïve animals. Furthermore, vaccination with purified B. pertussis-derived pertactin, filamentous hemagglutinin or the human acellular vaccine, Adacel, conferred similar protection against B. bronchiseptica challenge. These data indicate that individual immunity to B. pertussis affects B. bronchiseptica infection, and suggest that the high levels of herd immunity against B. pertussis in humans could explain the lack of observed B. bronchiseptica transmission. This could also explain the apparent association of B. bronchiseptica infections with an immunocompromised state.

  8. The protective effect and action mechanism of Vaccinium myrtillus L. on gastric ulcer in mice. (United States)

    Ogawa, Kenjirou; Oyagi, Atsushi; Tanaka, Junji; Kobayashi, Saori; Hara, Hideaki


    Vaccinium myrtillus L. anthocyanoside (VMA) is used as a folk medicine to treat diseases related to gastric ulcers in northern Europe. However, the effects of VMA and its detailed mechanism on gastric ulcer have not been investigated sufficiently. Therefore, the aim of the present study was to investigate the protective effects of VMA on gastric mucosal damage in a murine gastric ulcer model. First the effects of VMA on ethanol-induced gastric ulcers in mice were investigated. Then, the levels of lipid peroxide in murine stomach homogenates were measured to investigate the antioxidative effects of VMA. In addition, the free radical scavenging activity of VMA and its main anthocyanidins were evaluated by electron spin resonance measurement. Oral administration of VMA (10, 30 and 100 mg/kg) significantly protected gastric mucosa against HCl/ethanol-induced gastric ulcers. Furthermore, VMA inhibited lipid peroxide levels in a concentration-dependent manner and showed high scavenging activity against the superoxide anion radical (·O(2) (-) ) and the hydroxyl radical (·OH). Anthocyanidins also showed scavenging activity against the ·O(2) (-) , while only delphinidin showed high scavenging activity against the ·OH. These findings indicate that the protective effects of VMA on HCl/ethanol-induced gastric mucosal injury may be partially due to the antiperoxidative effects of anthocyanidins.

  9. Intranasal immunization with nontypeable Haemophilus influenzae outer membrane vesicles induces cross-protective immunity in mice.

    Directory of Open Access Journals (Sweden)

    Sandro Roier

    Full Text Available Haemophilus influenzae is a Gram-negative human-restricted bacterium that can act as a commensal and a pathogen of the respiratory tract. Especially nontypeable H. influenzae (NTHi is a major threat to public health and is responsible for several infectious diseases in humans, such as pneumonia, sinusitis, and otitis media. Additionally, NTHi strains are highly associated with exacerbations in patients suffering from chronic obstructive pulmonary disease. Currently, there is no licensed vaccine against NTHi commercially available. Thus, this study investigated the utilization of outer membrane vesicles (OMVs as a potential vaccine candidate against NTHi infections. We analyzed the immunogenic and protective properties of OMVs derived from various NTHi strains by means of nasopharyngeal immunization and colonization studies with BALB/c mice. The results presented herein demonstrate that an intranasal immunization with NTHi OMVs results in a robust and complex humoral and mucosal immune response. Immunoprecipitation revealed the most important immunogenic proteins, such as the heme utilization protein, protective surface antigen D15, heme binding protein A, and the outer membrane proteins P1, P2, P5 and P6. The induced immune response conferred not only protection against colonization with a homologous NTHi strain, which served as an OMV donor for the immunization mixtures, but also against a heterologous NTHi strain, whose OMVs were not part of the immunization mixtures. These findings indicate that OMVs derived from NTHi strains have a high potential to act as a vaccine against NTHi infections.

  10. Protection of mice against Trypanosoma cruzi by immunization with paraflagellar rod proteins requires T cell, but not B cell, function. (United States)

    Miller, M J; Wrightsman, R A; Stryker, G A; Manning, J E


    Previous studies have shown that immunization of mice with the paraflagellar rod proteins (PAR) of Trypanosoma cruzi induces an immune response capable of protecting mice against an otherwise lethal challenge with this parasite. Herein, we define immunologic responses that do or do not play a critical role in PAR-mediated protection. Firstly, PAR-immunized Ab-deficient (muMT) strain mice survived an otherwise lethal T. cruzi challenge, indicating that a B cell response is not required for PAR-induced immunity. However, beta2m -/- mice, which are severely deficient in MHC class I and TCR alphabeta+ CD8+ CD4- T cells, did not survive challenge infection following PAR immunization, indicating that MHC class I/CD8+ T cell function is necessary for protection induced by PAR immunization. Surprisingly, PAR-immunized mice depleted of CD4+ T cells survived a T. cruzi challenge for >84 days postinfection while maintaining a parasitemia that is generally thought to be lethal (i.e., >10(6) trypomastigotes/ml), thus associating CD4+ T cell function with the process of parasite clearance. Consistent with this association, CD4+ T cells from PAR-immunized mice released INF-gamma and stimulated T. cruzi-infected macrophages to release nitric oxide. The importance of IFN-gamma in PAR-induced protective immunity is further indicated by the observation that PAR-immunized INF-gamma knockout mice developed an extremely high parasitemia and did not survive a challenge infection. Thus, while Ab-mediated immune mechanisms are not required for protection induced by PAR immunization, T cell responses are necessary for both elimination of bloodstream parasites and survival.

  11. Modulation of macrophage activation state protects tissue from necrosis during critical limb ischemia in thrombospondin-1-deficient mice.

    Directory of Open Access Journals (Sweden)

    Nicolas Bréchot

    Full Text Available BACKGROUND: Macrophages, key regulators of healing/regeneration processes, strongly infiltrate ischemic tissues from patients suffering from critical limb ischemia (CLI. However pro-inflammatory markers correlate with disease progression and risk of amputation, suggesting that modulating macrophage activation state might be beneficial. We previously reported that thrombospondin-1 (TSP-1 is highly expressed in ischemic tissues during CLI in humans. TSP-1 is a matricellular protein that displays well-known angiostatic properties in cancer, and regulates inflammation in vivo and macrophages properties in vitro. We therefore sought to investigate its function in a mouse model of CLI. METHODS AND FINDINGS: Using a genetic model of tsp-1(-/- mice subjected to femoral artery excision, we report that tsp-1(-/- mice were clinically and histologically protected from necrosis compared to controls. Tissue protection was associated with increased postischemic angiogenesis and muscle regeneration. We next showed that macrophages present in ischemic tissues exhibited distinct phenotypes in tsp-1(-/- and wt mice. A strong reduction of necrotic myofibers phagocytosis was observed in tsp-1(-/- mice. We next demonstrated that phagocytosis of muscle cell debris is a potent pro-inflammatory signal for macrophages in vitro. Consistently with these findings, macrophages that infiltrated ischemic tissues exhibited a reduced postischemic pro-inflammatory activation state in tsp-1(-/- mice, characterized by a reduced Ly-6C expression and a less pro-inflammatory cytokine expression profile. Finally, we showed that monocyte depletion reversed clinical and histological protection from necrosis observed in tsp-1(-/- mice, thereby demonstrating that macrophages mediated tissue protection in these mice. CONCLUSION: This study defines targeting postischemic macrophage activation state as a new potential therapeutic approach to protect tissues from necrosis and promote tissue

  12. The protective effect of Moringa oleifera leaf extract on liver damage in mice infected with Plasmodium berghei ANKA

    Directory of Open Access Journals (Sweden)

    Kittiyaporn Dondee


    Full Text Available Objective: To investigate the protective effect of Moringa oleifera leaf extract on liver damage in mice infected with Plasmodium berghei ANKA (P. berghei Methods: For extraction of Moringa oleifera (M. oleifera leaves, microwave with hot water method was used and acute toxicity study was then be done. Standard Peters’ test was carried out to test the efficacy of M. oleifera extract in vivo. The ICR mice were inoculated with 1 × 107 red blood cells infected with P. berghei strain by intraperitoneal injection. They were subsequently given with 100, 500 and 1000 mg/kg of this extract by intragastric route once a day for 4 consecutive days. Parasitemia was estimated using microscopy and levels of aspartate aminotransferase, alanine aminotransferase and albumin were also measured. Results: The M. oleifera leaf extract showed the protective activity on liver damage in mice infected with P. berghei in a dose-dependent fashion. It can be indicated by normal levels of aspartate aminotransferase, alanine aminotransferase and albumin in mice treated with extract. The 1000 mg/kg of extract was observed to present the highest activity. Interestingly, the dosedependent antimalarial activity was also found in the mice treated with extract. Conclusions: The M. oleifera leaf extract presented protective effect on liver damage in mice infected with P. berghei.

  13. Loss of Nlrp3 Does Not Protect Mice from Western Diet-Induced Adipose Tissue Inflammation and Glucose Intolerance (United States)

    Ringling, Rebecca E.; Gastecki, Michelle L.; Woodford, Makenzie L.; Lum-Naihe, Kelly J.; Grant, Ryan W.; Pulakat, Lakshmi; Vieira-Potter, Victoria J.; Padilla, Jaume


    We tested the hypothesis that loss of Nlrp3 would protect mice from Western diet-induced adipose tissue (AT) inflammation and associated glucose intolerance and cardiovascular complications. Five-week old C57BL6J wild-type (WT) and Nlrp3 knockout (Nlrp3-/-) mice were randomized to either a control diet (10% kcal from fat) or Western diet (45% kcal from fat and 1% cholesterol) for 24 weeks (n = 8/group). Contrary to our hypothesis that obesity-mediated white AT inflammation is Nlrp3-dependent, we found that Western diet-induced expression of AT inflammatory markers (i.e., Cd68, Cd11c, Emr1, Itgam, Lgals, Il18, Mcp1, Tnf, Ccr2, Ccl5 mRNAs, and Mac-2 protein) were not accompanied by increased caspase-1 cleavage, a hallmark feature of NLRP3 inflammasome activation. Furthermore, Nlrp3 null mice were not protected from Western diet-induced white or brown AT inflammation. Although Western diet promoted glucose intolerance in both WT and Nlrp3-/- mice, Nlrp3-/- mice were protected from Western diet-induced aortic stiffening. Additionally, Nlrp3-/- mice exhibited smaller cardiomyocytes and reduced cardiac fibrosis, independent of diet. Collectively, these findings suggest that presence of the Nlrp3 gene is not required for Western diet-induced AT inflammation and/or glucose intolerance; yet Nlrp3 appears to play a role in potentiating arterial stiffening, cardiac hypertrophy and fibrosis. PMID:27583382

  14. Phenylbutyric acid protects against carbon tetrachloride-induced hepatic fibrogenesis in mice

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Jian-Qing [School of Pharmacy, Anhui Medical University, Hefei, 230032 (China); Second Affiliated Hospital, Anhui Medical University, Hefei 230601 (China); Chen, Xi [First Affiliated Hospital, Anhui Medical University, Hefei 230022 (China); Zhang, Cheng [Department of Toxicology, Anhui Medical University, Hefei, 230032 (China); Tao, Li [First Affiliated Hospital, Anhui Medical University, Hefei 230022 (China); Zhang, Zhi-Hui; Liu, Xiao-Qian [Department of Toxicology, Anhui Medical University, Hefei, 230032 (China); Xu, Yuan-Bao [Department of Toxicology, Anhui Medical University, Hefei, 230032 (China); First Affiliated Hospital, Anhui Medical University, Hefei 230022 (China); Wang, Hua [Department of Toxicology, Anhui Medical University, Hefei, 230032 (China); Li, Jun, E-mail: [School of Pharmacy, Anhui Medical University, Hefei, 230032 (China); Xu, De-Xiang, E-mail: [Department of Toxicology, Anhui Medical University, Hefei, 230032 (China)


    A recent report showed that the unfolded protein response (UPR) signaling was activated in the pathogenesis of carbon tetrachloride (CCl{sub 4})-induced hepatic fibrosis. Phenylbutyric acid (PBA) is a well-known chemical chaperone that inhibits endoplasmic reticulum (ER) stress and unfolded protein response (UPR) signaling. In the present study, we investigated the effects of PBA on CCl{sub 4}-induced hepatic fibrosis in mice. All mice were intraperitoneally (i.p.) injected with CCl{sub 4} (0.15 ml/kg BW, twice per week) for 8 weeks. In CCl{sub 4} + PBA group, mice were i.p. injected with PBA (150 mg/kg, twice per day) from the beginning of CCl{sub 4} injection to the end. As expected, PBA significantly attenuated CCl{sub 4}-induced hepatic ER stress and UPR activation. Although PBA alleviated, only to a less extent, hepatic necrosis, it obviously inhibited CCl{sub 4}-induced tumor necrosis factor alpha (TNF-α) and transforming growth factor beta (TGF-β). Moreover, PBA inhibited CCl{sub 4}-induced hepatic nuclear factor kappa B (NF-κB) p65 translocation and extracellular signal-regulated kinase (ERK) and c-Jun N-terminal Kinase (JNK) phosphorylation. Interestingly, CCl{sub 4}-induced α-smooth muscle actin (α-SMA), a marker for the initiation phase of HSC activation, was significantly attenuated in mice pretreated with PBA. Correspondingly, CCl{sub 4}-induced hepatic collagen (Col)1α1 and Col1α2, markers for the perpetuation phase of HSC activation, were inhibited in PBA-treated mice. Importantly, CCl{sub 4}-induced hepatic fibrosis, as determined using Sirius red staining, was obviously attenuated by PBA. In conclusion, PBA prevents CCl{sub 4}-induced hepatic fibrosis through inhibiting hepatic inflammatory response and HSC activation. Highlights: ► CCl{sub 4} induces hepatic ER stress, inflammation, HSC activation and hepatic fibrosis. ► PBA alleviates CCl{sub 4}-induced hepatic ER stress and UPR signaling activation. ► PBA inhibits CCl{sub 4}-induced

  15. Characterization of organotypic ventral mesencephalic cultures from embryonic mice and protection against MPP toxicity by GDNF

    DEFF Research Database (Denmark)

    Jakobsen, B; Gramsbergen, J B; Møller Dall, A;


    We characterized organotypic ventral mesencephalic (VM) cultures derived from embryonic day 12 (E12) mice (CBL57/bL6) in terms of number of dopaminergic neurons, cell soma size and dopamine production in relation to time in vitro and tested the effects of 1-methyl-4-phenylpyridinium (MPP...... with dopamine contents reaching control levels and number of tyrosine hydroxylase (TH)(+) cells up to 80% of control, but in three-week-old cultures (10 microm MPP(+), 2 days) the protective potential of GDNF was markedly reduced. Long recovery periods after MPP(+) exposure are required to distinguish between......(+)) and glial derived neurotrophic factor (GDNF) to validate this novel culture model. Dopamine production and dopaminergic neuron soma size increased dramatically with time in vitro, whereas the number of dopamine neurons declined by approximately 30% between week 1 and week 2, which was further reduced after...

  16. Pharmacologically blocking p53-dependent apoptosis protects intestinal stem cells and mice from radiation. (United States)

    Wang, Xinwei; Wei, Liang; Cramer, Julie M; Leibowitz, Brian J; Judge, Colleen; Epperly, Michael; Greenberger, Joel; Wang, Fengchao; Li, Linheng; Stelzner, Matthias G; Dunn, James C Y; Martin, Martin G; Lagasse, Eric; Zhang, Lin; Yu, Jian


    Exposure to high levels of ionizing radiation (IR) leads to debilitating and dose-limiting gastrointestinal (GI) toxicity. Using three-dimensional mouse crypt culture, we demonstrated that p53 target PUMA mediates radiation-induced apoptosis via a cell-intrinsic mechanism, and identified the GSK-3 inhibitor CHIR99021 as a potent radioprotector. CHIR99021 treatment improved Lgr5+ cell survival and crypt regeneration after radiation in culture and mice. CHIR99021 treatment specifically blocked apoptosis and PUMA induction and K120 acetylation of p53 mediated by acetyl-transferase Tip60, while it had no effect on p53 stabilization, phosphorylation or p21 induction. CHIR99021 also protected human intestinal cultures from radiation by PUMA but not p21 suppression. These results demonstrate that p53 posttranslational modifications play a key role in the pathological and apoptotic response of the intestinal stem cells to radiation and can be targeted pharmacologically.

  17. Protective effects of propolis on inorganic mercury induced oxidative stress in mice. (United States)

    Zhao, Jun-Quan; Wen, Yi-Fei; Bhadauria, Monika; Nirala, Satendra Kumar; Sharma, Abhilasha; Shrivastava, Sadhana; Shukla, Sangeeta; Agrawal, Om Prakash; Mathur, Ramesh


    Protective potential of propolis was evaluated against mercury induced oxidative stress and antioxidant enzymatic alterations in mice liver. Exposure to mercuric chloride (HgCl2; 5 mg/kg; ip) induced oxidative stress by increasing lipid peroxidation and oxidized glutathione level along with concomitant decrease in glutathione and various antioxidant enzymes. Mercury intoxication deviated the activity of liver marker enzymes in serum. Conjoint treatment of propolis (200 mg/kg; po) inhibited lipid peroxidation and oxidized glutathione level, whereas increased glutathione level. Activities of antioxidants enzymes, i.e., superoxide dismutase, catalase, glutathione-S-transferase and glucose-6-phosphate dehydrogenase were also restored concomitantly towards control after propolis administration. Release of serum transaminases, alkaline phosphatase, lactate dehydrogenase and y-glutamyl transpeptidase were significantly restored towards control after propolis treatment. Results suggest that propolis augments the antioxidants defense against mercury induced toxicity and provides evidence that it has therapeutic potential as hepatoprotective agent.

  18. T cells kill bacteria captured by transinfection from dendritic cells and confer protection in mice. (United States)

    Cruz-Adalia, Aránzazu; Ramirez-Santiago, Guillermo; Calabia-Linares, Carmen; Torres-Torresano, Mónica; Feo, Lidia; Galán-Díez, Marta; Fernández-Ruiz, Elena; Pereiro, Eva; Guttmann, Peter; Chiappi, Michele; Schneider, Gerd; Carrascosa, José López; Chichón, Francisco Javier; Martínez Del Hoyo, Gloria; Sánchez-Madrid, Francisco; Veiga, Esteban


    Dendritic cells (DCs) phagocytose, process, and present bacterial antigens to T lymphocytes to trigger adaptive immunity. In vivo, bacteria can also be found inside T lymphocytes. However, T cells are refractory to direct bacterial infection, leaving the mechanisms by which bacteria invade T cells unclear. We show that T cells take up bacteria from infected DCs by the process of transinfection, which requires direct contact between the two cells and is enhanced by antigen recognition. Prior to transfer, bacteria localize to the immunological synapse, an intimate DC/T cell contact structure that activates T cells. Strikingly, T cells efficiently eliminate the transinfecting bacteria within the first hours after infection. Transinfected T cells produced high levels of proinflammatory cytokines and were able to protect mice from bacterial challenge following adoptive transfer. Thus, T lymphocytes can capture and kill bacteria in a manner reminiscent of innate immunity.

  19. Equine Immunoglobulin and Equine Neutralizing F(ab')₂ Protect Mice from West Nile Virus Infection. (United States)

    Cui, Jiannan; Zhao, Yongkun; Wang, Hualei; Qiu, Boning; Cao, Zengguo; Li, Qian; Zhang, Yanbo; Yan, Feihu; Jin, Hongli; Wang, Tiecheng; Sun, Weiyang; Feng, Na; Gao, Yuwei; Sun, Jing; Wang, Yanqun; Perlman, Stanley; Zhao, Jincun; Yang, Songtao; Xia, Xianzhu


    West Nile virus (WNV) is prevalent in Africa, Europe, the Middle East, West Asia, and North America, and causes epidemic encephalitis. To date, no effective therapy for WNV infection has been developed; therefore, there is urgent need to find an efficient method to prevent WNV disease. In this study, we prepared and evaluated the protective efficacy of immune serum IgG and pepsin-digested F(ab')₂ fragments from horses immunized with the WNV virus-like particles (VLP) expressing the WNV M and E proteins. Immune equine F(ab')₂ fragments and immune horse sera efficiently neutralized WNV infection in tissue culture. The passive transfer of equine immune antibodies significantly accelerated the virus clearance in the spleens and brains of WNV infected mice, and reduced mortality. Thus, equine immunoglobulin or equine neutralizing F(ab')₂ passive immunotherapy is a potential strategy for the prophylactic or therapeutic treatment of patients infected with WNV.

  20. Equine Immunoglobulin and Equine Neutralizing F(ab′2 Protect Mice from West Nile Virus Infection

    Directory of Open Access Journals (Sweden)

    Jiannan Cui


    Full Text Available West Nile virus (WNV is prevalent in Africa, Europe, the Middle East, West Asia, and North America, and causes epidemic encephalitis. To date, no effective therapy for WNV infection has been developed; therefore, there is urgent need to find an efficient method to prevent WNV disease. In this study, we prepared and evaluated the protective efficacy of immune serum IgG and pepsin-digested F(ab′2 fragments from horses immunized with the WNV virus-like particles (VLP expressing the WNV M and E proteins. Immune equine F(ab′2 fragments and immune horse sera efficiently neutralized WNV infection in tissue culture. The passive transfer of equine immune antibodies significantly accelerated the virus clearance in the spleens and brains of WNV infected mice, and reduced mortality. Thus, equine immunoglobulin or equine neutralizing F(ab′2 passive immunotherapy is a potential strategy for the prophylactic or therapeutic treatment of patients infected with WNV.

  1. Protective Effects of N-Acetylcysteine in Concanavalin A-Induced Hepatitis in Mice

    Directory of Open Access Journals (Sweden)

    Chengfen Wang


    Full Text Available This study was designed to study the protective effects and mechanisms of N-acetylcysteine (NAC in concanavalin A-induced hepatitis in mice. In this study, pretreatment with NAC ameliorated the histopathological changes and suppressed inflammatory cytokines in ConA-induced hepatitis. The expression of IL-2, IL-6, TNF-α, and IFN-γ was significantly reduced in the NAC-treated groups. NAC activated PI3K/Akt pathway and inhibited the activation of NF-κB. Additionally, NAC reduced autophagosome formation, as assessed by detecting the expression of LC3 and Beclin 1. Our results demonstrate that NAC can alleviate ConA-induced hepatitis by regulating the PI3K/Akt pathway and reducing the late stages of autophagy. Our results described a new pharmaceutical to provide more effective therapies for immune hepatitis.

  2. Protective effects of oridonin on the sepsis in mice

    Directory of Open Access Journals (Sweden)

    Yan-Jun Zhao


    Full Text Available This study aimed to investigate the protective effects of oridonin (ORI on cecal ligation and puncture (CLP-induced sepsis in mice. Male C57BL/6 mice weighing 22–30 g and aged 8–10 weeks were randomly assigned to three groups: Sham group, CLP group, or CLP plus ORI group. In the CLP group and ORI group, CLP was induced, and intraperitoneal injection of normal saline and oridonin (100 μg/kg was conducted, respectively. The survival rate was determined within the following 7 days. The blood, liver, and lung were collected at 24 hours after injury. Hematoxylin–eosin staining of the lung, detection of lung wet-to-dry ratio, and serum cytokines (tumor necrosis factor [TNF]-α and interleukin [IL]-6, and examination of intraperitoneal and blood bacterial clearance were conducted to evaluate the therapeutic efficacy. Results showed that ORI treatment significantly reduced the lung wet-to-dry ratio, decreased serum TNF-α and IL-6, and improved liver pathology compared with the CLP group (p < 0.05. Moreover, the intraperitoneal and blood bacterial clearance increased markedly after ORI treatment (p < 0.05. The 7-day survival rate in the ORI group was also dramatically higher than in the CLP group (p < 0.05. Our findings indicate that ORI can attenuate liver and lung injuries and elevate bacterial clearance to increase the survival rate of sepsis mice.

  3. Nrf2 Activation Protects against Solar-Simulated Ultraviolet Radiation in Mice and Humans. (United States)

    Knatko, Elena V; Ibbotson, Sally H; Zhang, Ying; Higgins, Maureen; Fahey, Jed W; Talalay, Paul; Dawe, Robert S; Ferguson, James; Huang, Jeffrey T-J; Clarke, Rosemary; Zheng, Suqing; Saito, Akira; Kalra, Sukirti; Benedict, Andrea L; Honda, Tadashi; Proby, Charlotte M; Dinkova-Kostova, Albena T


    The transcription factor Nrf2 determines the ability to adapt and survive under conditions of electrophilic, oxidative, and inflammatory stress by regulating the expression of elaborate networks comprising nearly 500 genes encoding proteins with versatile cytoprotective functions. In mice, disruption of Nrf2 increases susceptibility to carcinogens and accelerates disease pathogenesis. Paradoxically, Nrf2 is upregulated in established human tumors, but whether this upregulation drives carcinogenesis is not known. Here we show that the incidence, multiplicity, and burden of solar-simulated UV radiation-mediated cutaneous tumors that form in SKH-1 hairless mice in which Nrf2 is genetically constitutively activated are lower than those that arise in their wild-type counterparts. Pharmacologic Nrf2 activation by topical biweekly applications of small (40 nmol) quantities of the potent bis(cyano enone) inducer TBE-31 has a similar protective effect against solar-simulated UV radiation in animals receiving long-term treatment with the immunosuppressive agent azathioprine. Genetic or pharmacologic Nrf2 activation lowers the expression of the pro-inflammatory factors IL6 and IL1β, and COX2 after acute exposure of mice to UV radiation. In healthy human subjects, topical applications of extracts delivering the Nrf2 activator sulforaphane reduced the degree of solar-simulated UV radiation-induced skin erythema, a quantifiable surrogate endpoint for cutaneous damage and skin cancer risk. Collectively, these data show that Nrf2 is not a driver for tumorigenesis even upon exposure to a very potent and complete carcinogen and strongly suggest that the frequent activation of Nrf2 in established human tumors is a marker of metabolic adaptation.

  4. Protective effects of Punica granatum seeds extract against aging and scopolamine induced cognitive impairments in mice. (United States)

    Kumar, Sokindra; Maheshwari, Kamal Kishore; Singh, Vijender


    Dementia is one of the age related mental problems and characteristic symptom of various neurodegenerative diseases including Alzheimer's disease. This impairment probably is due to the vulnerability of the brain cells to increased oxidative stress during aging process. Many studies have shown that certain phenolic antioxidants attenuate neuronal cell death induced by oxidative stress. The present work was undertaken to assess the effect of ethanolic extract of Punica granatum seeds on cognitive performance of aged and scopolamine treated young mice using one trial step-down type passive avoidance and elevated plus maze task. Aged or scopolamine treated mice showed poor retention of memory in step-down type passive avoidance and in elevated plus maze task. Chronic administration (21 days) of Punica granatum extract and vitamin C significantly (p Punica granatum extract also significantly lowered lipid peroxidation level and increased antioxidant glutathione level in brain tissues. Punica granatum preparations could be protective in the treatment of cognitive disorders such as dementia and Alzheimer's disease.

  5. Heat-stable oral alga-based vaccine protects mice from Staphylococcus aureus infection. (United States)

    Dreesen, Imke A J; Charpin-El Hamri, Ghislaine; Fussenegger, Martin


    While 15 million deaths per year are caused by communicable pathogens worldwide, health care authorities emphasize the considerable impact of poverty on the incidence of infectious diseases. The emergence of antigen-expressing plant tissues (e.g. rice, tomato, potato) has indicated the potential of land plants for low-cost vaccines in oral immunization programs. In this study, we engineered the chloroplasts of the unicellular green alga Chlamydomonas reinhardtii for the stable expression of the D2 fibronectin-binding domain of Staphylococcus aureus fused with the cholera toxin B subunit (CTB), under the control of rbcL UTRs. Analysis of sera and faeces of mice, fed for 5 weeks with transgenic algae grown in confined Wave Bioreactor, revealed the induction of specific mucosal and systemic immune responses. Algae-based vaccination significantly reduced the pathogen load in the spleen and the intestine of treated mice and protected 80% of them against lethal doses of S. aureus. Importantly, the alga vaccine was stable for more than 1.5 years at room temperature. These results indicate that C. reinhardtii may play an important role in molecular pharming, as it combines the beneficial features of land plant vaccines, while offering unmatched ease of growth compared to other members of the plant kingdom.

  6. A genetically adjuvanted influenza B virus vector increases immunogenicity and protective efficacy in mice. (United States)

    Kittel, Christian; Wressnigg, Nina; Shurygina, Anna Polina; Wolschek, Markus; Stukova, Marina; Romanovskaya-Romanko, Ekatherina; Romanova, Julia; Kiselev, Oleg; Muster, Thomas; Egorov, Andrej


    The existence of multiple antigenically distinct types and subtypes of influenza viruses allows the construction of a multivalent vector system for the mucosal delivery of foreign sequences. Influenza A viruses have been exploited successfully for the expression of extraneous antigens as well as immunostimulatory molecules. In this study, we describe the development of an influenza B virus vector whose functional part of the interferon antagonist NS1 was replaced by human interleukin 2 (IL2) as a genetic adjuvant. We demonstrate that IL2 expressed by this viral vector displays immune adjuvant activity in immunized mice. Animals vaccinated with the IL2 viral vector showed an increased hemagglutination inhibition antibody response and higher protective efficacy after challenge with a wild-type influenza B virus when compared to mice vaccinated with a control virus. Our results demonstrate that it is feasible to construct influenza B vaccine strains expressing immune-potentiating foreign sequences from the NS genomic segment. Based on these data, it is now hypothetically possible to create a trivalent (or quadrivalent) live attenuated influenza vaccine in which each component expresses a selected genetic adjuvant with tailored expression levels.

  7. Mangiferin antagonizes TNF-α-mediated inflammatory reaction and protects against dermatitis in a mice model. (United States)

    Zhao, Yunpeng; Wang, Wenhan; Wu, Xihai; Ma, Xiaoqian; Qu, Ruize; Chen, Xiaomin; Liu, Chenghao; Liu, Yaoge; Wang, Xiaokai; Yan, Pengcheng; Zhang, Hao; Pan, Jingrui; Li, Weiwei


    This study aimed to investigate whether mangiferin played a protective role in a well-established dermatitis mouse model and tumor necrosis factor alpha (TNF-α)-induced RAW264.7 macrophages. Contact dermatitis is an inflammatory skin disease in the clinic, while its underlying mechanism still remains to be elucidated. Mangiferin, 1,3,6,7-tetrahydroxyxanthone-C2-β-d-glucoside (C-glucosyl xanthone), a natural antioxidant that was reported to inhibit inflammatory reactions, has been recently proved to be a potential therapy for inflammation. As a result, the oxazolone-induced dermatitis mice models were established to explore whether mangiferin has an anti-inflammatory role in vivo. The phosphate-buffered saline treatment groups showed emblematic skin inflammation, whereas the administration of mangiferin obviously inhibited dermatitis in the mice models. Furthermore, exogenous mangiferin alleviated the inflammatory reaction in TNF-α-induced macrophages by suppressing the production of inflammation- and oxidative stress-associated molecules. Also, mangiferin treatment repressed the activation of nuclear factor-kappaB signaling pathway. To sum up, mangiferin could provide a new target for the therapy and prevention of skin inflammation.

  8. Protective effect of tetrahydrocoptisine against ethanol-induced gastric ulcer in mice. (United States)

    Li, Weifeng; Huang, Huimin; Niu, Xiaofeng; Fan, Ting; Mu, Qingli; Li, Huani


    Excessive alcohol consumption can lead to gastric ulcer and the present work was aimed to examine the protective effect of tetrahydrocoptisine (THC) in the model of ethanol-induced gastric ulcer in mice. Fasted mice treated with ethanol 75% (0.5ml/100g) were pre-treated with THC (10 or 20mg/kg, ip), cimetidine (100mg/kg, ip) or saline in different experimental sets for a period of 3days, and animals were euthanized 4h after ethanol ingestion. Gross and microscopic lesions, immunological and biochemical parameters were taken into consideration. The results showed that ethanol induced gastric damage, improving nitric oxide (NO) level, increased pro-inflammatory cytokine (TNF-α and IL-6) levels and myeloperoxidase (MPO) activity, as well as the expression of nuclear factor-κB (NF-κB) in the ethanol group. Pretreatment of THC at doses of 10 and 20mg/kg bodyweight significantly attenuated the gastric lesions as compared to the ethanol group. These results suggest that the gastroprotective activity of THC is attributed to reducing NO production and adjusting the pro-inflammatory cytokine, inhibited neutrophil accumulation and NF-κB expression.

  9. Protective effects of polydatin from Polygonum cuspidatum against carbon tetrachloride-induced liver injury in mice.

    Directory of Open Access Journals (Sweden)

    Hong Zhang

    Full Text Available Polydatin is one of main compounds in Polygonum cuspidatum, a plant with both medicinal and nutritional value. The possible hepatoprotective effects of polydatin on acute liver injury mice induced by carbon tetrachloride (CCl(4 and the mechanisms involved were investigated. Intraperitoneal injection of CCl(4 (50 µl/kg resulted in a significant increase in the levels of serum aspartate aminotransferase (AST, alanine aminotransferase (ALT and hepatic malondialdehyde (MDA, also a marked enhancement in the expression of hepatic tumor necrosis factor-alpha (TNF-α, interleukin-1 beta (IL-1β, cyclooxygenase-2 (COX-2, inducible nitric oxide synthase (iNOS and nuclearfactor-kappa B (NF-κB. On the other hand, decreased glutathione (GSH content and activities of glutathione transferase (GST, superoxide dismutase (SOD, catalase (CAT and glutathione peroxidase (GPx were observed following CCl(4 exposure. Nevertheless, all of these phenotypes were evidently reversed by preadministration of polydatin for 5 continuous days. The mRNA and protein expression levels of hepatic growth factor-beta1 (TGF-β(1 were enhanced further by polydatin. These results suggest that polydatin protects mice against CCl(4-induced liver injury through antioxidant stress and antiinflammatory effects. Polydatin may be an effective hepatoprotective agent and a promising candidate for the treatment of oxidative stress- and inflammation-related diseases.

  10. Probucol-Induced α-Tocopherol Deficiency Protects Mice against Malaria Infection.

    Directory of Open Access Journals (Sweden)

    Maria Shirely Herbas

    Full Text Available The emergence of malaria pathogens having resistance against antimalarials implies the necessity for the development of new drugs. Recently, we have demonstrated a resistance against malaria infection of α-tocopherol transfer protein knockout mice showing undetectable plasma levels of α-tocopherol, a lipid-soluble antioxidant. However, dietary restriction induced α-tocopherol deficiency is difficult to be applied as a clinical antimalarial therapy. Here, we report on a new strategy to potentially treat malaria by using probucol, a drug that can reduce the plasma α-tocopherol concentration. Probucol pre-treatment for 2 weeks and treatment throughout the infection rescued from death of mice infected with Plasmodium yoelii XL-17 or P. berghei ANKA. In addition, survival was extended when the treatment started immediately after parasite inoculation. The ratio of lipid peroxidation products to parent lipids increased in plasma after 2 weeks treatment of probucol. This indicates that the protective effect of probucol might be mediated by the oxidative stressful environment induced by α-tocopherol deficiency. Probucol in combination with dihydroartemisin suppressed the proliferation of P. yoelii XL-17. These results indicated that probucol might be a candidate for a drug against malaria infection by inducing α-tocopherol deficiency without dietary α-tocopherol restriction.

  11. Anti-Staphylococcus aureus single-chain variable region fragments provide protection against mastitis in mice. (United States)

    Wang, Man; Zhang, Yan; Zhu, Jianguo


    Staphylococcus aureus is a leading causative agent of bovine mastitis, which can result in significant economic losses to the dairy industry. However, available vaccines against bovine mastitis do not confer adequate protection, although passive immunization with antibodies may be useful to prevent disease. Hence, we constructed a bovine single-chain variable region fragment (scFv) phage display library using cDNAs from peripheral blood lymphocytes of cows with S. aureus-induced mastitis. After four rounds of selection, eight scFvs that bound S. aureus antigens with high affinity were obtained. The framework regions of the variable domains (VH and VL) of the eight scFvs were highly conserved, and the complementarity-determining regions (CDRs) displayed significant diversity, especially CDR3 of the VH domain. All eight scFvs inhibited S. aureus growth in culture medium. Lactating mice were challenged by injecting S. aureus into the fourth mammary gland. Histopathological analysis showed that treatment with these scFvs prior to bacterial challenge maintained the structure of the mammary acini, decreased infiltration of polymorphonuclear neutrophils, increased levels of interferon-gamma and interleukin-4, and reduced tumor necrosis factor-alpha levels in mammary tissues, as compared with mice treatment with physiological saline (P < 0.05). These novel bovine scFvs may be suitable candidates for therapeutic agents for the prevention of S. aureus-induced bovine mastitis.

  12. Protective effect of tetrahydrocoptisine against ethanol-induced gastric ulcer in mice

    Energy Technology Data Exchange (ETDEWEB)

    Li, Weifeng, E-mail:; Huang, Huimin; Niu, Xiaofeng, E-mail:; Fan, Ting; Mu, Qingli; Li, Huani


    Excessive alcohol consumption can lead to gastric ulcer and the present work was aimed to examine the protective effect of tetrahydrocoptisine (THC) in the model of ethanol-induced gastric ulcer in mice. Fasted mice treated with ethanol 75% (0.5 ml/100 g) were pre-treated with THC (10 or 20 mg/kg, ip), cimetidine (100 mg/kg, ip) or saline in different experimental sets for a period of 3 days, and animals were euthanized 4 h after ethanol ingestion. Gross and microscopic lesions, immunological and biochemical parameters were taken into consideration. The results showed that ethanol induced gastric damage, improving nitric oxide (NO) level, increased pro-inflammatory cytokine (TNF-α and IL-6) levels and myeloperoxidase (MPO) activity, as well as the expression of nuclear factor-κB (NF-κB) in the ethanol group. Pretreatment of THC at doses of 10 and 20 mg/kg bodyweight significantly attenuated the gastric lesions as compared to the ethanol group. These results suggest that the gastroprotective activity of THC is attributed to reducing NO production and adjusting the pro-inflammatory cytokine, inhibited neutrophil accumulation and NF-κB expression. - Highlights: • THC decreased ethanol-induced pro-inflammatory cytokine release. • THC inhibited the production of NO in serum and gastric tissue. • THC reduced NF-κB expression and MPO accumulation in ethanol-induced gastric tissue.

  13. Opuntia ficus indica extract protects against chlorpyrifos-induced damage on mice liver. (United States)

    Ncibi, Saida; Ben Othman, Mahmoud; Akacha, Amira; Krifi, Mohamed Naceur; Zourgui, Lazhar


    This original study investigates the role of Opuntia ficus indica (cactus) cladodes extract against liver damage induced in male SWISS mice by an organophosphorous insecticide, the chlorpyrifos (CPF). Liver damage was evaluated by the measure of its weight and the quantification of some biochemical parameters, such as alanine amino transferase (ALAT), aspartate amino transferase (ASAT), phosphatase alkaline (PAL), lactate dehydrogenase (LDH), cholesterol and albumin in serum by spectrophotometric techniques. The experimental approach lasted 48 h and consisted of 6 treatments of six mice each one; (1) control, (2) 10 mg/kg (b.w) CPF, (3) 10mg/kg (b.w) CPF with 100 mg/kg (b.w) cactus, (4) 150 mg/kg (b.w)CPF, (5) 150 mg/kg (b.w) CPF with 1.5 g/kg cactus, (6) 1.5 g/kg cactus. Both chlorpyrifos and cactus were administrated orally via gavages. Our results showed that CPF affects significantly all parameters studied. However, when this pesticide was administrated associated to cactus, we noticed a recovery of all their levels. In the other hand, cactus alone did not affect the studied parameters. These results allow us to conclude firstly that CPF is hepatotoxic and secondly that Opuntia ficus indica stem extract protects the liver and decreases the toxicity induced by this organophosphorous pesticide.

  14. Protective Effect of N-Acetylserotonin against Acute Hepatic Ischemia-Reperfusion Injury in Mice

    Directory of Open Access Journals (Sweden)

    Jiying Jiang


    Full Text Available The purpose of this study was to investigate the possible protective effect of N-acetylserotonin (NAS against acute hepatic ischemia-reperfusion (I/R injury in mice. Adult male mice were randomly divided into three groups: sham, I/R, and I/R + NAS. The hepatic I/R injury model was generated by clamping the hepatic artery, portal vein, and common bile duct with a microvascular bulldog clamp for 30 min, and then removing the clamp and allowing reperfusion for 6 h. Morphologic changes and hepatocyte apoptosis were evaluated by hematoxylin-eosin (HE and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL staining, respectively. Activated caspase-3 expression was evaluated by immunohistochemistry and Western blot. The activation of aspartate aminotransferase (AST, malondialdehyde (MDA, and superoxide dismutase (SOD was evaluated by enzyme-linked immunosorbent assay (ELISA. The data show that NAS rescued hepatocyte morphological damage and dysfunction, decreased the number of apoptotic hepatocytes, and reduced caspase-3 activation. Our work demonstrates that NAS ameliorates hepatic IR injury.

  15. Antidepressant and proneurogenic influence of environmental enrichment in mice: protective effects vs recovery. (United States)

    Llorens-Martín, María; Tejeda, Gonzalo S; Trejo, José L


    Physical-cognitive activity has long-lasting beneficial effects on the brain and on behavior. Environmental enrichment (EE) induces brain activity known to influence the behavior of mice, as measured in learned helplessness paradigms (forced swim test), and neurogenic cell populations in the hippocampal dentate gyrus. However, it is not completely clear whether the antidepressant and proneurogenic effects of EE are different in animals that are naive or pre-exposed to the stress inducing helplessness, and if this depends on the type of stressor. It also remains unclear whether differential effects are exerted on distinct neurogenic subpopulations. We found that EE has a protective effect in adult female mice (C57BL/6J) when exposed twice to the same stressor (forced swim test) but it has no influence on recovery. The repeated exposure to this stressor was analyzed together with the effects of EE on different neurogenic populations distinguished by age and differentiation state. Younger cells are more sensitive and responsive to the conditions, both the positive and negative effects. These results are relevant to identify the cell populations that are the targets of stress, depression, and enrichment, and that form part of the mechanism responsible for mood dysfunctions.

  16. Protective effect of metalloporphyrins against cisplatin-induced kidney injury in mice.

    Directory of Open Access Journals (Sweden)

    Hao Pan

    Full Text Available Oxidative and nitrative stress is a well-known phenomenon in cisplatin-induced nephrotoxicity. The purpose of this work is to study the role of two metalloporphyrins (FeTMPyP and MnTBAP, water soluble complexes, in cisplatin-induced renal damage and their ability to scavenge peroxynitrite. In cisplatin-induced nephropathy study in mice, renal nitrative stress was evident by the increase in protein nitration. Cisplatin-induced nephrotoxicity was also evident by the histological damage from the loss of the proximal tubular brush border, blebbing of apical membranes, tubular epithelial cell detachment from the basement membrane, or intra-luminal aggregation of cells and proteins and by the increase in blood urea nitrogen and serum creatinine. Cisplatin-induced apoptosis and cell death as shown by Caspase 3 assessments, TUNEL staining and DNA fragmentation Cisplatin-induced nitrative stress, apoptosis and nephrotoxicity were attenuated by both metalloporphyrins. Heme oxygenase (HO-1 also plays a critical role in metalloporphyrin-mediated protection of cisplatin-induced nephrotoxicity. It is evident that nitrative stress plays a critical role in cisplatin-induced nephrotoxicity in mice. Our data suggest that peroxynitrite is involved, at least in part, in cisplatin-induced nephrotoxicity and protein nitration and cisplatin-induced nephrotoxicity can be prevented with the use of metalloporphyrins.

  17. Anti-thromboxane B2 antibodies protect against acetaminophen-induced liver injury in mice

    Directory of Open Access Journals (Sweden)

    Ivan Ćavar


    Full Text Available Prostanoids are lipid compounds that mediate a variety of physiological and pathological functions in almost all body tissues and organs. Thromboxane (TX A2 is a powerful inducer of platelet aggregation and vasoconstriction and it has ulcerogenic activity in the gastrointestinal tract. Overdose or chronic use of a high dose of acetaminophen (N-acetyl-paminophenol, APAP is a major cause of acute liver failure in the Western world. We investigated whether TXA2 plays a role in host response to toxic effect of APAP. CBA/H Zg mice of both sexes were intoxicated with a single lethal or high sublethal dose of APAP, which was administered to animals by oral gavage. The toxicity of APAP was determined by observing the survival of mice during 48 h, by measuring concentration of alanine-aminotransferase (ALT in plasma 20-22 h after APAP administration and by liver histology. The results have shown that anti-thromboxane (TX B2 antibodies (anti-TXB2 and a selective inhibitor of thromboxane (TX synthase, benzylimidazole (BZI, were significantly hepatoprotective, while a selective thromboxane receptor (TPR antagonist, daltroban, was slightly protective in this model of acute liver injury. A stabile metabolite of TXA2, TXB2, and a stabile agonist of TPR, U-46619, had no influence on APAP-induced liver damage. Our findings suggest that TXA2 has a pathogenic role in acute liver toxicity induced with APAP, which was highly abrogated by administration of anti-TXB2. According to our results, this protection is mediated, at least in part, through decreased production of TXB2 by liver fragments ex vivo.

  18. Protective effect of pretreatment with thymoquinone against Aflatoxin B1 induced liver toxicity in mice

    Directory of Open Access Journals (Sweden)

    A Nili-Ahmadabadi


    Full Text Available "n  Background and the purpose of the study: Thymoquinone (TQ is one of the active components of Nigella sativa. The plant has been used in herbal medicine for treatment of many diseases including liver complications. The present study aimed to investigate protective effects of TQ on Aflatoxin B1 (AFB1 induced liver toxicity in mice. "n  Methods: Animals were divided into six groups and treated intraperitoneally. Group 1 (blank served as vehicle, group 2 (positive control received AFB1, Group 3 was treated with 9 mg/kg of TQ, Groups 4, 5 and 6 were treated with 4.5, 9 and 18 mg/kg of TQ, respectively. After three consecutive days, except for groups 1 and 3, animals were administered with a single dose of AFB1 (2 mg/kg. All the animals were killed 24 hrs following the AFB1 administration under ether anesthesia. Biochemical parameters including AST, ALT and ALP in serum samples and glutathione (GSH and malondialdehyde (MDA contents in liver homogenates were determined. Liver sections were collected for histopathological examination. "n  Results: Findings of this study showed that AST, ALT, ALP and MDA levels were significantly lower in the TQ treated animals as compared to AFB1 group (group 2. Furthermore, TQ was able to recover glutathione content (GSH of liver tissue. The best response, however, was observed with the dose of 9 mg/kg. Liver sections of AFB1 intoxicated mice showed inflammation, necrosis, hyperplasia of kupffer and infiltration of mononuclear cells, dilation of sinusoids and disruption of hepatocytes, while treatment with TQ helped to normalize liver architecture in accordance to biochemical findings. "n  Conclusion: Taken collectively, TQ has a protective role with optimum dose of 9 mg/kg in AFB1 hepatotoxicity.

  19. Rickettsia rickettsii outer membrane protein YbgF induces protective immunity in C3H/HeN mice. (United States)

    Gong, Wenping; Qi, Yong; Xiong, Xiaolu; Jiao, Jun; Duan, Changsong; Wen, Bohai


    Rickettsia rickettsii is the etiological agent of Rocky Mountain spotted fever (RMSF). YbgF and TolC are outer membrane-associated proteins of R. rickettsii that play important roles in its interaction with host cells. We investigated the immunogenicity of YbgF and TolC for protection against RMSF. We immunized C3H/HeN mice with recombinant R. rickettsii YbgF (rYbgF) or TolC (rTolC). Rickettsial burden and impairment in the lungs, spleens, and livers of rYbgF-immunized mice were significantly lower than in rTolC-immunized mice. The ratio of IgG2a to IgG1 in rYbgF-immunized mice continued to increase over the course of our experiments, while that in rTolC-immunized mice was reduced. The proliferation and cytokine secretion of CD4(+) and CD8(+) T cells isolated from R. rickettsii-infected mice were analyzed following antigen stimulation. The results indicated that proliferation and interferon (IFN)-γ secretion of CD4(+) or CD8(+) T cells in R. rickettsii-infected mice were significantly greater than in uninfected mice after stimulation with rYbgF. YbgF is a novel protective antigen of R. rickettsii. Protection conferred by YbgF is dependent upon IFN-γ-producing CD4(+) and CD8(+) T cells and IgG2a, which act in synergy to control R. rickettsii infection.

  20. Adenoviral Expression of a Bispecific VHH-Based Neutralizing Agent That Targets Protective Antigen Provides Prophylactic Protection from Anthrax in Mice. (United States)

    Moayeri, Mahtab; Tremblay, Jacqueline M; Debatis, Michelle; Dmitriev, Igor P; Kashentseva, Elena A; Yeh, Anthony J; Cheung, Gordon Y C; Curiel, David T; Leppla, Stephen; Shoemaker, Charles B


    Bacillus anthracis, the causative agent of anthrax, secretes three polypeptides, which form the bipartite lethal and edema toxins (LT and ET, respectively). The common component in these toxins, protective antigen (PA), is responsible for binding to cellular receptors and translocating the lethal factor (LF) and edema factor (EF) enzymatic moieties to the cytosol. Antibodies against PA protect against anthrax. We previously isolated toxin-neutralizing variable domains of camelid heavy-chain-only antibodies (VHHs) and demonstrated their in vivo efficacy. In this work, gene therapy with an adenoviral (Ad) vector (Ad/VNA2-PA) (VNA, VHH-based neutralizing agents) promoting the expression of a bispecific VHH-based neutralizing agent (VNA2-PA), consisting of two linked VHHs targeting different PA-neutralizing epitopes, was tested in two inbred mouse strains, BALB/cJ and C57BL/6J, and found to protect mice against anthrax toxin challenge and anthrax spore infection. Two weeks after a single treatment with Ad/VNA2-PA, serum VNA2-PA levels remained above 1 μg/ml, with some as high as 10 mg/ml. The levels were 10- to 100-fold higher and persisted longer in C57BL/6J than in BALB/cJ mice. Mice were challenged with a lethal dose of LT or spores at various times after Ad/VNA2-PA administration. The majority of BALB/cJ mice having serum VNA2-PA levels of >0.1 μg/ml survived LT challenge, and 9 of 10 C57BL/6J mice with serum levels of >1 μg/ml survived spore challenge. Our findings demonstrate the potential for genetic delivery of VNAs as an effective method for providing prophylactic protection from anthrax. We also extend prior findings of mouse strain-based differences in transgene expression and persistence by adenoviral vectors.

  1. Toll-like receptor 4 protects against stress-induced ulcers via regulation of glucocorticoid production in mice. (United States)

    Wang, Liang; Luo, Pengfei; Zhang, Fang; Zhang, Yuelu; Wang, Xingtong; Chang, Fei; Zhang, Yuechan; Tang, Hongtai; Xia, Zhaofan


    Stress-induced gastric ulcer is an important life-threatening condition, while the molecular basis of its development is incompletely understood. Toll-like receptor 4 (TLR4), an innate immune pattern recognition receptor, can induce pro-inflammatory transcription, aggravating a stress ulcer. The present study found that TLR4 played a protective role in a mouse model of water immersion (23 °C) restraint stress. Wild-type (WT) and TLR4(-/-) male mice were respectively divided into five groups (5 per group), and exposed to the stressor for 0, 0.5, 1, 2, or 4 hours. Gastric ulcer index, determined post mortem, increased with time in both types of mice but was greater in TLR4(-/-) mice. Furthermore, increased serum cortisol and corticosterone concentrations were observed in WT mice only, and such increases were detected only in WT mice 4 h after lipopolysaccharide (LPS) treatment (2 mg/kg, intraperitoneal injection). Moreover, the administration of cortisol alleviated the gastric injury in TLR4(-/-) mice. Western blotting showed expression in the adrenal of P450scc (CYP11A1), the first rate-limiting enzyme in the synthesis of steroids, was increased 4 h after water immersion restraint stress or LPS treatment in WT mice, but was conversely decreased in TLR4(-/-) mice after either stressor. Furthermore, in adrenal glands of TLR4(-/-) mice, structural distortion of mitochondria (which contain CYP11A1) was found with electron microscopy, and lack of lipid-storing droplets was found using light microscopy on adrenal cryosections stained with Oil red O. These data indicate that TLR4 plays a protective role in stress-induced gastric ulcer that is exerted via impacting synthesis of glucocorticoid in the adrenal gland.

  2. Deubiquitinase BRCC36 protects heart against chronic pressure overload-induced cardiac remodeling in mice

    Institute of Scientific and Technical Information of China (English)

    LI Ru-jun; FANG Wei; ZHU Hua-jiang; ZHANG Feng-xia; XU Ou-fang; XU Li-juan; ZHANG Zhen-gang; GONG Kai-zheng


    Emerging evidence has indicated that BRCC 36-mediated K63-linked ubiquitination modification was involved in diverse cellular functions , including endocytosis , apoptosis and DNA damage repair .We previously showed that activation of cGMP/PKG pathway con-tributed to the binding of BRCC36 and the pro-fibrotic factor Smad3.The current study tested the hypothesis that BRCC 36 functions as a negative regulator of transforming growth factor-beta ( TGF-β)/Smad3 pathway and participates in cardiac remodeling .In isolated adult mouse cardiac fibroblasts , we have demonstrated that TGF-β1 treatment significantly increased the expression of BRCC 36.Over-expression BRCC36 suppressed TGF-β1-induced Smad3 phosphorylation, nuclear translocation, extracellular matrix molecular expres-sion and cell proliferation .On the contrary, silencing BRCC36 by transfection of adenovirus-carrying BRCC36 shRNA potentiated to enhance the pro-fibrotic effect of TGF-β.In vivo, under chronic pressure overload condition-induced by transverse aortic constriction , myocardial pro-survival protein Bcl-2 and Mcl-1 expression were significantly decreased and the pro-apoptosis protein Puma was in-creased.However, the cardiac-specific over-expression of BRCC36 significantly increased myocardial Bcl-2 and Mcl-1 and inhibited Puma expression .Interestingly , we also found that sustained pressure overload resulted in a significant myocardial DNA injury in wild type mice, which was characterized by the increase of γH2AX level.However, cardiac-specific BRCC36 over-expression significantly decreased the level of γH2AX in the pressure overloaded heart in the transgenic mice , while effectively enhanced myocardial RAD 51 expression, a marker of DNA damage repair.Furthermore, BRCC36 over-expression effectively attenuated TAC-induced cardiac fibro-sis and remodeling in the transgenic mice , compared with the wild type mice .Collectively , the results have suggested that BRCC 36 ef-fectively protected heart

  3. Intracranial administration of P gene siRNA protects mice from lethal Chandipura virus encephalitis.

    Directory of Open Access Journals (Sweden)

    Satyendra Kumar

    Full Text Available BACKGROUND: In parts of India, Chandipura Virus (CHPV has emerged as an encephalitis causing pathogen in both epidemic and sporadic forms. This pediatric disease follows rapid course leading to 55-75% mortality. In the absence of specific treatment, effectiveness of RNA interference (RNAi was evaluated. METHODS AND FINDINGS: Efficacy of synthetic short interfering RNA (siRNA or short hairpin RNA (shRNA in protecting mice from CHPV infection was assessed. The target genes were P and M genes primarily because important role of the former in viral replication and lethal nature of the latter. Real time one step RT-PCR and plaque assay were used for the assessment of gene silencing. Using pAcGFP1N1-CHPV-P, we showed that P-2 siRNA was most efficient in reducing the expression of P gene in-vitro. Both quantitative assays documented 2 logs reduction in the virus titer when P-2, M-5 or M-6 siRNAs were transfected 2 hr post infection (PI. Use of these siRNAs in combination did not result in enhanced efficiency. P-2 siRNA was found to tolerate four mismatches in the center. As compared to five different shRNAs, P-2 siRNA was most effective in inhibiting CHPV replication. An extended survival was noted when mice infected intracranially with 100 LD50 CHPV were treated with cationic lipid complexed 5 microg P-2 siRNA simultaneously. Infection with 10LD50 and treatment with two doses of siRNA first, simultaneously and second 24 hr PI, resulted in 70% survival. Surviving mice showed 4 logs less CHPV titers in brain without histopathological changes or antibody response. Gene expression profiles of P-2 siRNA treated mice showed no interferon response. First dose of siRNA at 2 hr or 4 hr PI with second dose at 24hr resulted in 40% and 20% survival respectively suggesting potential application in therapy. CONCLUSIONS: The results highlight therapeutic potential of siRNA in treating rapid and fatal Chandipura encephalitis.

  4. The peroxisome proliferator-activated receptor-γ agonist pioglitazone protects against cisplatin-induced renal damage in mice. (United States)

    Jesse, Cristiano R; Bortolatto, Cristiani F; Wilhelm, Ethel A; Roman, Silvane Souza; Prigol, Marina; Nogueira, Cristina W


    Peroxisome proliferator-activated receptor-γ (PPAR-γ) agonists not only improve metabolic abnormalities of diabetes and consequent diabetic nephropathy, but they also protect against non-diabetic kidney disease in experimental models. Here, we investigated the effect of PPAR-γ agonist pioglitazone against acute renal injury on a cisplatin model in mice. Nephrotoxicity was induced by a single intraperitoneal (i.p.) injection of cisplatin (10 mg kg(-1)). Pioglitazone was administered for six consecutive days in doses of 15 or 30 mg kg(-1)  day(-1), per os (p.o.), starting 3 days before cisplatin injection. Cisplatin treatment to mice induced a marked renal failure, characterized by a significant increase in serum urea and creatinine levels and alterations in renal tissue architecture. Cisplatin exposure induced oxidative stress as indicated by decreased levels of non-enzymatic antioxidant defenses [glutathione (GSH) and ascorbic acid levels] and components of the enzymatic antioxidant defenses [superoxide dismutase (SOD), catalase (CAT) glutathione peroxidase (GPx), glutathione reductase (GR) and and glutathione S-transferase(GST) activities)] in renal tissue. Administration of pioglitazone markedly protected against the increase in urea and creatinine levels and histological alterations in kidney induced by cisplatin treatment. Pioglitazone administration ameliorated GSH and ascorbic acid levels decreased by cisplatin exposure in mice. Pioglitazone protected against the inhibition of CAT, SOD, GPx, GR and GST activities induced by cisplatin in the kidneys of mice. These results indicated that pioglitazone has a protective effect against cisplatin-induced renal damage in mice. The protection is mediated by preventing the decline of antioxidant status. The results have implications in use of PPAR-γ agonists in human application for protecting against drugs-induced nephrotoxicity.

  5. Vaccination of mice with a Yop translocon complex elicits antibodies that are protective against infection with F1- Yersinia pestis. (United States)

    Ivanov, Maya I; Noel, Betty L; Rampersaud, Ryan; Mena, Patricio; Benach, Jorge L; Bliska, James B


    Yersinia pestis, the bacterial agent of plague, secretes several proteins important for pathogenesis or host protection. The F1 protein forms a capsule on the bacterial cell surface and is a well-characterized protective antigen but is not essential for virulence. A type III secretion system that is essential for virulence exports Yop proteins, which function as antiphagocytic or anti-inflammatory factors. Yop effectors (e.g., YopE) are delivered across the host cell plasma membrane by a translocon, composed of YopB and YopD. Complexes of YopB, YopD, and YopE (BDE) secreted by Yersinia pseudotuberculosis were purified by affinity chromatography and used as immunogens to determine if antibodies to the translocon could provide protection against Y. pestis in mice. Mice vaccinated with BDE generated high-titer immunoglobulin G antibodies specific for BDE, as shown by enzyme-linked immunosorbent assay and immunoblotting, and were protected against lethal intravenous challenge with F1(-) but not F1(+) Y. pestis. Mice passively immunized with anti-BDE serum were protected from lethal challenge with F1(-) Y. pestis. The YopB protein or a complex of YopB and YopD (BD) was purified and determined by vaccination to be immunogenic in mice. Mice actively vaccinated with BD or passively vaccinated with anti-BD serum were protected against lethal challenge with F1(-) Y. pestis. These results indicate that anti-translocon antibodies can be used as immunotherapy to treat infections by F1(-) Y. pestis.

  6. Systemic Administration of Proteoglycan Protects BALB/c Retired Breeder Mice from Experimental Arthritis

    Directory of Open Access Journals (Sweden)

    Larissa Lumi Watanabe Ishikawa


    Full Text Available This study was undertaken to evaluate the prophylactic potential of proteoglycan (PG administration in experimental arthritis. Female BALB/c retired breeder mice received two (2xPG50 and 2xPG100 groups or three (3xPG50 group intraperitoneal doses of bovine PG (50 μg or 100 μg every three days. A week later the animals were submitted to arthritis induction by immunization with three i.p. doses of bovine PG associated with dimethyldioctadecylammonium bromide adjuvant at intervals of 21 days. Disease severity was daily assessed after the third dose by score evaluation. The 3xPG50 group showed significant reduction in prevalence and clinical scores. This protective effect was associated with lower production of IFN-γ and IL-17 and increased production of IL-5 and IL-10 by spleen cells restimulated in vitro with PG. Even though previous PG administration restrained dendritic cells maturation this procedure did not alter the frequency of regulatory Foxp3+ T cells. Lower TNF-α and IL-6 levels and higher expression of ROR-γ and GATA-3 were detected in the paws of protected animals. A delayed-type hypersensitivity reaction confirmed specific tolerance induction. Taken together, these results indicate that previous PG inoculation determines a specific tolerogenic effect that is able to decrease severity of subsequently induced arthritis.

  7. Immunological response and protection of mice immunized with plasmid encoding Toxoplasma gondii glycolytic enzyme malate dehydrogenase. (United States)

    Hassan, I A; Wang, S; Xu, L; Yan, R; Song, X; XiangRui, L


    Toxoplasma gondii Malate dehydrogenase (TgMDH) plays an important role as part of the energy production cycle. In this investigation, immunological changes and protection efficiency of this protein delivered as a DNA vaccine have been evaluated. Mice were intramuscularly immunized with pTgMDH, followed by challenge with virulent T. gondii RH strain, 2 weeks after the booster immunization. Compared to the control groups, the results showed that pTgMDH has stimulated specific humoral response as demonstrated by significant high titers of total IgG and subclasses IgG1 and IgG2a , beside IgA and IgM, but not IgE. Analysis of cytokine profiles revealed significant increases of IFN-γ, IL-4 and IL-17, while no significant changes were detected in TGF-β1. In cell-mediated response, both T lymphocytes subpopulations CD4(+) and CD8(+) were positively recruited as significant percentages were recorded in response to immunization with TgMDH. Significant long survival rate, 17 days, has been observed in the TgMDH vaccinated group, in contrast with control groups which died within 8-9 days after challenge. These results demonstrated that TgMDH could induce significant immunological responses leading to a considerable level of protection against acute toxoplasmosis infection.

  8. Protective effects of melatonin on lipopolysaccharide-induced mastitis in mice. (United States)

    Shao, Guoxi; Tian, Yinggang; Wang, Haiyu; Liu, Fangning; Xie, Guanghong


    Melatonin, a secretory product of the pineal gland, has been reported to have antioxidant and anti-inflammatory effects. However, the protective effects of melatonin on lipopolysaccharide (LPS)-induced mastitis have not been reported. The purpose of this study was to investigate the anti-inflammatory effects and the underlying mechanisms of melatonin on LPS-induced mastitis both in vivo and in vitro. In vivo, our results showed that melatonin attenuated LPS-induced mammary histopathologic changes and myeloperoxidase (MPO) activity. Melatonin also inhibited LPS-induced inflammatory cytokines tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β) and interleukin-6 (IL-6) production in mammary tissues. In vitro, melatonin was found to inhibit LPS-induced TNF-α and IL-6 production in mouse mammary epithelial cells. Melatonin also suppressed LPS-induced Toll-like receptor 4 (TLR4) expression and nuclear factor-kappaB (NF-κB) activation in a dose-dependent manner. In addition, melatonin was found to up-regulate the expression of PPAR-γ. Inhibition of PPAR-γ by GW9662 reduced the anti-inflammatory effects of melatonin. In conclusion, we found that melatonin, for the first time, had protective effects on LPS-induced mastitis in mice. The anti-inflammatory mechanism of melatonin was through activating PPAR-γ which subsequently inhibited LPS-induced inflammatory responses. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Rebamipide suppresses diclofenac-induced intestinal permeability via mitochondrial protection in mice. (United States)

    Diao, Lei; Mei, Qiao; Xu, Jian-Ming; Liu, Xiao-Chang; Hu, Jing; Jin, Juan; Yao, Qiang; Chen, Mo-Li


    To investigate the protective effect and mechanism of rebamipide on small intestinal permeability induced by diclofenac in mice. Diclofenac (2.5 mg/kg) was administered once daily for 3 d orally. A control group received the vehicle by gavage. Rebamipide (100 mg/kg, 200 mg/kg, 400 mg/kg) was administered intragastrically once a day for 3 d 4 h after diclofenac administration. Intestinal permeability was evaluated by Evans blue and the FITC-dextran method. The ultrastructure of the mucosal barrier was evaluated by transmission electron microscopy (TEM). Mitochondrial function including mitochondrial swelling, mitochondrial membrane potential, mitochondrial nicotinamide adenine dinucleotide-reduced (NADH) levels, succinate dehydrogenase (SDH) and ATPase activities were measured. Small intestinal mucosa was collected for assessment of malondialdehyde (MDA) content and myeloperoxidase (MPO) activity. Compared with the control group, intestinal permeability was significantly increased in the diclofenac group, which was accompanied by broken tight junctions, and significant increases in MDA content and MPO activity. Rebamipide significantly reduced intestinal permeability, improved inter-cellular tight junctions, and was associated with decreases in intestinal MDA content and MPO activity. At the mitochondrial level, rebamipide increased SDH and ATPase activities, NADH level and decreased mitochondrial swelling. Increased intestinal permeability induced by diclofenac can be attenuated by rebamipide, which partially contributed to the protection of mitochondrial function.

  10. The protective effect of astaxanthin on fetal alcohol spectrum disorder in mice. (United States)

    Zheng, Dong; Li, Yi; He, Lei; Tang, Yamei; Li, Xiangpen; Shen, Qingyu; Yin, Deling; Peng, Ying


    Astaxanthin is a strong antioxidant with the ability of reducing the markers of inflammation. To explore the protective effect of astaxanthin on maternal ethanol induced embryonic deficiency, and to investigate the underlying mechanisms, we detected the morphology, expression of neural marker genes, oxidative stress indexes, and inflammatory factors in mice model of fetal alcohol spectrum disorder with or without astaxanthin pretreatment. Our results showed that astaxanthin blocked maternal ethanol induced retardation of embryonic growth, and the down-regulation of neural marker genes, Otx1 and Sox2. Moreover, astaxanthin also reversed the increases of malondialdehyde (MDA), hydrogen peroxide (H2O2), and the decrease of glutathione peroxidase (GPx) in fetal alcohol spectrum disorder. In addition, maternal ethanol induced up-regulation of toll-like receptor 4 (TLR4), and the down-streaming myeloid differentiation factor 88 (MyD88), NF-κB, TNF-α, and IL-1β in embryos, and this was inhibited by astaxanthin pretreatment. These results demonstrated a protective effect of astaxanthin on fetal alcohol spectrum disorder, and suggested that oxidative stress and TLR4 signaling associated inflammatory reaction are involved in this process.

  11. Rebamipide suppresses diclofenac-induced intestinal permeability via mitochondrial protection in mice

    Institute of Scientific and Technical Information of China (English)

    Lei Diao; Qiao Mei; Jian-Ming Xu; Xiao-Chang Liu; Jing Hu; Juan Jin; Qiang Yao


    AIM:To investigate the protective effect and mechanism of rebamipide on small intestinal permeability induced by diclofenac in mice.METHODS:Diclofenac (2.5 mg/kg) was administered once daily for 3 d orally.A control group received the vehicle by gavage.Rebamipide (100 mg/kg,200 mg/kg,400 mg/kg) was administered intragastrically once a day for 3 d 4 h after diclofenac administration.Intestinal permeability was evaluated by Evans blue and the FITC-dextran method.The ultrastructure of the mucosal barrier was evaluated by transmission electron microscopy (TEM).Mitochondrial function including mitochondrial swelling,mitochondrial membrane potential,mitochondrial nicotinamide adenine dinucleotide-reduced (NADH) levels,succinate dehydrogenase (SDH) and ATPase activities were measured.Small intestinal mucosa was collected for assessment of malondialdehyde (MDA) content and myeloperoxidase (MPO) activity.RESULTS:Compared with the control group,intestinal permeability was significantly increased in the diclofenac group,which was accompanied by broken tight junctions,and significant increases in MDA content and MPO activity.Rebamipide significantly reduced intestinal permeability,improved inter-cellular tight junctions,and was associated with decreases in intestinal MDA content and MPO activity.At the mitochondrial level,rebamipide increased SDH and ATPase activities,NADH level and decreased mitochondrial swelling.CONCLUSION:Increased intestinal permeability induced by diclofenac can be attenuated by rebamipide,which partially contributed to the protection of mitochondrial function.

  12. Adoptive transfer of helminth antigen-pulsed dendritic cells protects against the development of experimental colitis in mice. (United States)

    Matisz, Chelsea E; Leung, Gabriella; Reyes, Jose Luis; Wang, Arthur; Sharkey, Keith A; McKay, Derek M


    Infection with helminth parasites and treatment with worm extracts can suppress inflammatory disease, including colitis. Postulating that dendritic cells (DCs) participated in the suppression of inflammation and seeking to move beyond the use of helminths per se, we tested the ability of Hymenolepis diminuta antigen-pulsed DCs to suppress colitis as a novel cell-based immunotherapy. Bone marrow derived DCs pulsed with H. diminuta antigen (HD-DCs), or PBS-, BSA-, or LPS-DCs as controls, were transferred into wild-type (WT), interleukin-10 (IL-10) knock-out (KO), and RAG-1 KO mice, and the impact on dinitrobenzene sulphonic acid (DNBS)-induced colitis and splenic cytokine production assessed 72 h later. Mice receiving HD-DCs were significantly protected from DNBS-induced colitis and of the experimental groups only these mice displayed increased Th2 cytokines and IL-10 production. Adoptive transfer of HD-DCs protected neither RAG-1 nor IL-10 KO mice from DNBS-colitis. Furthermore, the transfer of CD4(+) splenocytes from recipients of HD-DCs protected naïve mice against DNBS-colitis, in an IL-10 dependent manner. Thus, HD-DCs are a novel anti-colitic immunotherapy that can educate anti-colitic CD4(+) T cells: mechanistically, the anti-colitic effect of HD-DCs requires that the host has an adaptive immune response and the ability to mobilize IL-10.

  13. Protective and therapeutic efficacy of Mycobacterium smegmatis expressing HBHA-hIL12 fusion protein against Mycobacterium tuberculosis in mice.

    Directory of Open Access Journals (Sweden)

    Shanmin Zhao

    Full Text Available Tuberculosis (TB remains a major worldwide health problem. The only vaccine against TB, Mycobacterium bovis Bacille Calmette-Guerin (BCG, has demonstrated relatively low efficacy and does not provide satisfactory protection against the disease. More efficient vaccines and improved therapies are urgently needed to decrease the worldwide spread and burden of TB, and use of a viable, metabolizing mycobacteria vaccine may be a promising strategy against the disease. Here, we constructed a recombinant Mycobacterium smegmatis (rMS strain expressing a fusion protein of heparin-binding hemagglutinin (HBHA and human interleukin 12 (hIL-12. Immune responses induced by the rMS in mice and protection against Mycobacterium tuberculosis (MTB were investigated. Administration of this novel rMS enhanced Th1-type cellular responses (IFN-γ and IL-2 in mice and reduced bacterial burden in lungs as well as that achieved by BCG vaccination. Meanwhile, the bacteria load in M. tuberculosis infected mice treated with the rMS vaccine also was significantly reduced. In conclusion, the rMS strain expressing the HBHA and human IL-12 fusion protein enhanced immunogencity by improving the Th1-type response against TB, and the protective effect was equivalent to that of the conventional BCG vaccine in mice. Furthermore, it could decrease bacterial load and alleviate histopathological damage in lungs of M. tuberculosis infected mice.

  14. Short-term long chain omega3 diet protects from neuroinflammatory processes and memory impairment in aged mice.

    Directory of Open Access Journals (Sweden)

    Virginie F Labrousse

    Full Text Available Regular consumption of food enriched in omega3 polyunsaturated fatty acids (ω3 PUFAs has been shown to reduce risk of cognitive decline in elderly, and possibly development of Alzheimer's disease. Docosahexaenoic acid (DHA and eicosapentaenoic acid (EPA are the most likely active components of ω3-rich PUFAs diets in the brain. We therefore hypothesized that exposing mice to a DHA and EPA enriched diet may reduce neuroinflammation and protect against memory impairment in aged mice. For this purpose, mice were exposed to a control diet throughout life and were further submitted to a diet enriched in EPA and DHA during 2 additional months. Cytokine expression together with a thorough analysis of astrocytes morphology assessed by a 3D reconstruction was measured in the hippocampus of young (3-month-old and aged (22-month-old mice. In addition, the effects of EPA and DHA on spatial memory and associated Fos activation in the hippocampus were assessed. We showed that a 2-month EPA/DHA treatment increased these long-chain ω3 PUFAs in the brain, prevented cytokines expression and astrocytes morphology changes in the hippocampus and restored spatial memory deficits and Fos-associated activation in the hippocampus of aged mice. Collectively, these data indicated that diet-induced accumulation of EPA and DHA in the brain protects against neuroinflammation and cognitive impairment linked to aging, further reinforcing the idea that increased EPA and DHA intake may provide protection to the brain of aged subjects.

  15. Adipose-Specific Deficiency of Fumarate Hydratase in Mice Protects Against Obesity, Hepatic Steatosis, and Insulin Resistance. (United States)

    Yang, Hao; Wu, Jiang W; Wang, Shu P; Severi, Ilenia; Sartini, Loris; Frizzell, Norma; Cinti, Saverio; Yang, Gongshe; Mitchell, Grant A


    Obesity and type 2 diabetes are associated with impaired mitochondrial function in adipose tissue. To study the effects of primary deficiency of mitochondrial energy metabolism in fat, we generated mice with adipose-specific deficiency of fumarate hydratase (FH), an integral Krebs cycle enzyme (AFHKO mice). AFHKO mice have severe ultrastructural abnormalities of mitochondria, ATP depletion in white adipose tissue (WAT) and brown adipose tissue, low WAT mass with small adipocytes, and impaired thermogenesis with large unilocular brown adipocytes. AFHKO mice are strongly protected against obesity, insulin resistance, and fatty liver despite aging and high-fat feeding. AFHKO white adipocytes showed normal lipolysis but low triglyceride synthesis. ATP depletion in normal white adipocytes by mitochondrial toxins also decreased triglyceride synthesis, proportionally to ATP depletion, suggesting that reduced triglyceride synthesis may result nonspecifically from adipocyte energy deficiency. At thermoneutrality, protection from insulin resistance and hepatic steatosis was diminished. Taken together, the results show that under the cold stress of regular animal room conditions, adipocyte-specific FH deficiency in mice causes mitochondrial energy depletion in adipose tissues and protects from obesity, hepatic steatosis, and insulin resistance, suggesting that in cold-stressed animals, mitochondrial function in adipose tissue is a determinant of fat mass and insulin sensitivity. © 2016 by the American Diabetes Association.

  16. Short-term long chain omega3 diet protects from neuroinflammatory processes and memory impairment in aged mice. (United States)

    Labrousse, Virginie F; Nadjar, Agnès; Joffre, Corinne; Costes, Laurence; Aubert, Agnès; Grégoire, Stéphane; Bretillon, Lionel; Layé, Sophie


    Regular consumption of food enriched in omega3 polyunsaturated fatty acids (ω3 PUFAs) has been shown to reduce risk of cognitive decline in elderly, and possibly development of Alzheimer's disease. Docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) are the most likely active components of ω3-rich PUFAs diets in the brain. We therefore hypothesized that exposing mice to a DHA and EPA enriched diet may reduce neuroinflammation and protect against memory impairment in aged mice. For this purpose, mice were exposed to a control diet throughout life and were further submitted to a diet enriched in EPA and DHA during 2 additional months. Cytokine expression together with a thorough analysis of astrocytes morphology assessed by a 3D reconstruction was measured in the hippocampus of young (3-month-old) and aged (22-month-old) mice. In addition, the effects of EPA and DHA on spatial memory and associated Fos activation in the hippocampus were assessed. We showed that a 2-month EPA/DHA treatment increased these long-chain ω3 PUFAs in the brain, prevented cytokines expression and astrocytes morphology changes in the hippocampus and restored spatial memory deficits and Fos-associated activation in the hippocampus of aged mice. Collectively, these data indicated that diet-induced accumulation of EPA and DHA in the brain protects against neuroinflammation and cognitive impairment linked to aging, further reinforcing the idea that increased EPA and DHA intake may provide protection to the brain of aged subjects.

  17. CD8 Knockout Mice Are Protected from Challenge by Vaccination with WR201, a Live Attenuated Mutant of Brucella melitensis

    Directory of Open Access Journals (Sweden)

    Samuel L. Yingst


    Full Text Available CD8+ T cells have been reported to play an important role in defense against B. abortus infection in mouse models. In the present report, we use CD8 knockout mice to further elucidate the role of these cells in protection from B. melitensis infection. Mice were immunized orally by administration of B. melitensis WR201, a purine auxotrophic attenuated vaccine strain, then challenged intranasally with B. melitensis 16M. In some experiments, persistence of WR201 in the spleens of CD8 knockout mice was slightly longer than that in the spleens of normal mice. However, development of anti-LPS serum antibody, antigen-induced production of γ-interferon (IFN-γ by immune splenic lymphocytes, protection against intranasal challenge, and recovery of nonimmunized animals from intranasal challenge were similar between normal and knockout animals. Further, primary Brucella infection was not exacerbated in perforin knockout and Fas-deficient mice and these animals’ anti-Brucella immune responses were indistinguishable from those of normal mice. These results indicate that CD8+ T cells do not play an essential role as either cytotoxic cells or IFN-γ producers, yet they do participate in a specific immune response to immunization and challenge in this murine model of B. melitensis infection.

  18. Mice chronically infected with chimeric HIV resist peripheral and brain superinfection: a model of protective immunity to HIV. (United States)

    Kelschenbach, Jennifer L; Saini, Manisha; Hadas, Eran; Gu, Chao-Jiang; Chao, Wei; Bentsman, Galina; Hong, Jessie P; Hanke, Tomas; Sharer, Leroy R; Potash, Mary Jane; Volsky, David J


    Infection by some viruses induces immunity to reinfection, providing a means to identify protective epitopes. To investigate resistance to reinfection in an animal model of HIV disease and its control, we employed infection of mice with chimeric HIV, EcoHIV. When immunocompetent mice were infected by intraperitoneal (IP) injection of EcoHIV, they resisted subsequent secondary infection by IP injection, consistent with a systemic antiviral immune response. To investigate the potential role of these responses in restricting neurotropic HIV infection, we established a protocol for efficient EcoHIV expression in the brain following intracranial (IC) inoculation of virus. When mice were inoculated by IP injection and secondarily by IC injection, they also controlled EcoHIV replication in the brain. To investigate their role in EcoHIV antiviral responses, CD8+ T lymphocytes were isolated from spleens of EcoHIV infected and uninfected mice and adoptively transferred to isogenic recipients. Recipients of EcoHIV primed CD8+ cells resisted subsequent EcoHIV infection compared to recipients of cells from uninfected donors. CD8+ spleen cells from EcoHIV-infected mice also mounted modest but significant interferon-γ responses to two HIV Gag peptide pools. These findings suggest EcoHIV-infected mice may serve as a useful system to investigate the induction of anti-HIV protective immunity for eventual translation to human beings.

  19. Estrogen receptor-alpha mediates estrogen protection from angiotensin II-induced hypertension in conscious female mice. (United States)

    Xue, Baojian; Pamidimukkala, Jaya; Lubahn, Dennis B; Hay, Meredith


    It has been shown that the female sex hormones have a protective role in the development of angiotensin II (ANG II)-induced hypertension. The present study tested the hypotheses that 1) the estrogen receptor-alpha (ERalpha) is involved in the protective effects of estrogen against ANG II-induced hypertension and 2) central ERs are involved. Blood pressure (BP) was measured in female mice with the use of telemetry implants. ANG II (800 was administered subcutaneously via an osmotic pump. Baseline BP in the intact, ovariectomized (OVX) wild-type (WT) and ERalpha knockout (ERalphaKO) mice was similar; however, the increase in BP induced by ANG II was greater in OVX WT (23.0 +/- 1.0 mmHg) and ERalphaKO mice (23.8 +/- 2.5 mmHg) than in intact WT mice (10.1 +/- 4.5 mmHg). In OVX WT mice, central infusion of 17beta-estradiol (E(2); 30 attenuated the pressor effect of ANG II (7.0 +/- 0.4 mmHg), and this protective effect of E(2) was prevented by coadministration of ICI-182,780 (ICI; 1.5, 18.8 +/- 1.5 mmHg), a nonselective ER antagonist. Furthermore, central, but not peripheral, infusions of ICI augmented the pressor effects of ANG II in intact WT mice (17.8 +/- 4.2 mmHg). In contrast, the pressor effect of ANG II was unchanged in either central E(2)-treated OVX ERalphaKO mice (19.0 +/- 1.1 mmHg) or central ICI-treated intact ERalphaKO mice (19.6 +/- 1.6 mmHg). Lastly, ganglionic blockade on day 7 after ANG II infusions resulted in a greater reduction in BP in OVX WT, central ER antagonist-treated intact WT, central E(2) + ICI-treated OVX WT, ERalphaKO, and central E(2)- or ICI-treated ERalphaKO mice compared with that in intact WT mice given just ANG II. Together, these data indicate that ERalpha, especially central expression of the ER, mediates the protective effects of estrogen against ANG II-induced hypertension.

  20. Bacillus anthracis Capsular Conjugates Elicit Chimpanzee Polyclonal Antibodies That Protect Mice from Pulmonary Anthrax. (United States)

    Chen, Zhaochun; Schneerson, Rachel; Lovchik, Julie A; Dai, Zhongdong; Kubler-Kielb, Joanna; Agulto, Liane; Leppla, Stephen H; Purcell, Robert H


    The immunogenicity of Bacillus anthracis capsule (poly-γ-D-glutamic acid [PGA]) conjugated to recombinant B. anthracis protective antigen (rPA) or to tetanus toxoid (TT) was evaluated in two anthrax-naive juvenile chimpanzees. In a previous study of these conjugates, highly protective monoclonal antibodies (MAbs) against PGA were generated. This study examines the polyclonal antibody response of the same animals. Preimmune antibodies to PGA with titers of >10(3) were detected in the chimpanzees. The maximal titer of anti-PGA was induced within 1 to 2 weeks following the 1st immunization, with no booster effects following the 2nd and 3rd immunizations. Thus, the anti-PGA response in the chimpanzees resembled a secondary immune response. Screening of sera from nine unimmunized chimpanzees and six humans revealed antibodies to PGA in all samples, with an average titer of 10(3). An anti-PA response was also observed following immunization with PGA-rPA conjugate, similar to that seen following immunization with rPA alone. However, in contrast to anti-PGA, preimmune anti-PA antibody titers and those following the 1st immunization were ≤300, with the antibodies peaking above 10(4) following the 2nd immunization. The polyclonal anti-PGA shared the MAb 11D epitope and, similar to the MAbs, exerted opsonophagocytic killing of B. anthracis. Most important, the PGA-TT-induced antibodies protected mice from a lethal challenge with virulent B. anthracis spores. Our data support the use of PGA conjugates, especially PGA-rPA targeting both toxin and capsule, as expanded-spectrum anthrax vaccines.

  1. Protective effect of N-Acetylcysteine against ethanol-induced gastric ulcer: a pharmacological assessment in mice

    Directory of Open Access Journals (Sweden)

    Ausama Ayoob Jaccob


    Aim: Since there is an increasing need for gastric ulcer therapies with optimum benefit-risk profile. This study was conducted to investigate gastro-protective effects of N-Acetylcysteine (NAC against ethanol-induced gastric ulcer models in mice. Materials and Methods: Forty-two mice were allocated into six groups consisting of 7 mice each. Groups 1 (normal control and 2 (ulcer control received distilled water at a dose of 10 ml/kg, groups 3, 4 and 5 were given NAC at doses 100, 300 and 500 mg/kg, respectively, and the 6th group received ranitidine (50 mg/kg. All drugs administered orally once daily for 7 days, on the 8th day absolute ethanol (7 ml/kg was administrated orally to all mice to induce the acute ulcer except normal control group. Then 3 h after, all animals were sacrificed then consequently the stomachs were excised for examination. Results: NAC administration at the tested doses showed a dose-related potent gastro-protective effect with significant increase in curative ratio, PH of gastric juice and mucus content viscosity seen with the highest dose of NAC and it is comparable with that observed in ranitidine group. Conclusion: The present findings demonstrate that, oral NAC shows significant gastro-protective effects comparable to ranitidine confirmed by antisecretory, cytoprotective, histological and biochemical data but the molecular mechanisms behind such protection are complex. [J Intercult Ethnopharmacol 2015; 4(2.000: 90-95

  2. Adipose-specific deletion of TFAM increases mitochondrial oxidation and protects mice against obesity and insulin resistance

    DEFF Research Database (Denmark)

    Vernochet, Cecile; Mourier, Arnaud; Bezy, Olivier


    oxygen consumption and uncoupling. As a result, F-TFKO mice exhibit higher energy expenditure and are protected from age- and diet-induced obesity, insulin resistance, and hepatosteatosis, despite a greater food intake. Thus, TFAM deletion in the adipose tissue increases mitochondrial oxidation that has...

  3. Protective effect of N-acetylcysteine against ethanol-induced gastric ulcer: A pharmacological assessment in mice. (United States)

    Jaccob, Ausama Ayoob


    Since there is an increasing need for gastric ulcer therapies with optimum benefit-risk profile. This study was conducted to investigate gastro-protective effects of N-acetylcysteine (NAC) against ethanol-induced gastric ulcer models in mice. A total of 41 mice were allocated into six groups consisted of 7 mice each. Groups 1 (normal control) and 2 (ulcer control) received distilled water at a dose of 10 ml/kg, groups 3, 4 and 5 were given NAC at doses 100, 300 and 500 mg/kg, respectively, and the 6(th) group received ranitidine (50 mg/kg). All drugs administered orally once daily for 7 days, on the 8(th) day absolute ethanol (7 ml/kg) was administrated orally to all mice to induce the acute ulcer except normal control group. Then 3 h after, all animals were sacrificed then consequently the stomachs were excised for examination. NAC administration at the tested doses showed a dose-related potent gastro-protective effect with significant increase in curative ratio, PH of gastric juice and mucus content viscosity seen with the highest dose of NAC and it is comparable with that observed in ranitidine group. The present findings demonstrate that, oral NAC shows significant gastro-protective effects comparable to ranitidine confirmed by anti-secretory, cytoprotective, histological and biochemical data, but the molecular mechanisms behind such protection are complex.

  4. The protein DIIIC-2, aggregated with a specific oligodeoxynucleotide and adjuvanted in alum, protects mice and monkeys against DENV-2. (United States)

    Gil, Lázaro; Marcos, Ernesto; Izquierdo, Alienys; Lazo, Laura; Valdés, Iris; Ambala, Peris; Ochola, Lucy; Hitler, Rikoi; Suzarte, Edith; Álvarez, Mayling; Kimiti, Prisilla; Ndung'u, James; Kariuki, Thomas; Guzmán, María Guadalupe; Guillén, Gerardo; Hermida, Lisset


    Previously, we reported the ability of the chimeric protein DIIIC-2 (domain III of the dengue envelope protein fused to the capsid protein of dengue-2 virus), to induce immunity and protection in mice, when it is highly aggregated with a non-defined oligodeoxynucleotide (ODN) and adjuvanted in alum. In this work, three different defined ODNs were studied as aggregating agents. Our results suggest that the nature of the ODN influences the capacity of protein DIIIC-2 to activate cell-mediated immunity in mice. Consequently, the ODN 39M was selected to perform further experiments in mice and nonhuman primates. Mice receiving the preparation 39M-DIIIC-2 were solidly protected against dengue virus (DENV) challenge. Moreover, monkeys immunized with the same preparation developed neutralizing antibodies, as measured by four different neutralization tests varying the virus strains and the cell lines used. Two of the immunized monkeys were completely protected against challenge, whereas the third animal had a single day of low-titer viremia. This is the first work describing the induction of short-term protection in monkeys by a formulation that is suitable for human use combining a recombinant protein from DENV with alum.

  5. Similar Ability of FbaA with M Protein to Elicit Protective Immunity Against Group A Streptococcus Challenge in Mice

    Institute of Scientific and Technical Information of China (English)

    Cuiqing Ma; Caihong Li; Xiurong Wang; Ruihong Zeng; Xiaolin Yin; Huidong Feng; Lin Wei


    Group A streptococcus (GAS), an important human pathogen, can cause various kinds of infections including superficial infections and potentially lethal infections, and the search for an effective vaccine to prevent GAS infections has been ongoing for many years. This paper compares the immunogenicity and immunoprotection of FbaA (an Fn-binding protein expressed on the surface of GAS) with that of M protein, the best immunogen of GAS. Assay for immune response showed that FbaA, similar to M protein, could induce protein-specific high IgG titer in BALB/c mice. Furthermore, following GAS challenge, the mice immunized with FbaA showed the same protective rate as those with M protein. These results indicate that FbaA is similar in ability to M protein in inducing protective immunity against GAS challenge in mice.

  6. A multiagent filovirus DNA vaccine delivered by intramuscular electroporation completely protects mice from ebola and Marburg virus challenge. (United States)

    Grant-Klein, Rebecca J; Van Deusen, Nicole M; Badger, Catherine V; Hannaman, Drew; Dupuy, Lesley C; Schmaljohn, Connie S


    We evaluated the immunogenicity and protective efficacy of DNA vaccines expressing the codon-optimized envelope glycoprotein genes of Zaire ebolavirus, Sudan ebolavirus, and Marburg marburgvirus (Musoke and Ravn). Intramuscular or intradermal delivery of the vaccines in BALB/c mice was performed using the TriGrid™ electroporation device. Mice that received DNA vaccines against the individual viruses developed robust glycoprotein-specific antibody titers as determined by ELISA and survived lethal viral challenge with no display of clinical signs of infection. Survival curve analysis revealed there was a statistically significant increase in survival compared to the control groups for both the Ebola and Ravn virus challenges. These data suggest that further analysis of the immune responses generated in the mice and additional protection studies in nonhuman primates are warranted.

  7. Immunity to Babesia in mice II. Cross protection between various Babesia and Plasmodium species and its relevance to the nature of Babesia immunity

    NARCIS (Netherlands)

    Kuil, H.; Zivkovic, D.; Speksnijder, J.E.; Seinen, W.


    Mice immunized against B.rodhaini by means of a drug-controlled infection were subsequently resistant to infection with B.microti and B.ratti. In the reciprocal experiments the protection against B.rodhaini was less effective. B.rodhaini immunized mice were also considerably protected against P.vinc

  8. Immune responses and protective effect in mice vaccinated orally with surface sporozoite protein of Eimeria falciformis in ISCOMs. (United States)

    Kazanji, M; Laurent, F; Péry, P


    Immunostimulating complexes (ISCOMs) were built after treatment of a purified surface protein from Eimeria falciformis sporozoites with a palmitic acid derivation, leading to a high ratio (33-64%) of P27 incorporation in these cage-like structures. P27 kept its antigenicity after incorporation in ISCOMs, which induced, after iterative intubations by the oral route to groups of mice, a systemic IgG response, a local IgA response, and a local enhanced cellular response as demonstrated by lymphoproliferation of mesenteric lymph node cells upon in vitro stimulation with antigen. This immunization (120 micrograms in six oral doses at 2-day intervals) afforded mice a partial protection (60%) against a subsequent 400 oocyst challenge. The reduction in daily oocyst excretion was corroborated by significantly different weight losses between immunized and control mice on days 9 and 10 postinfection and the subsequent death of these control mice. These observations provide the first application of ISCOMs to parasitic intestinal diseases.

  9. Protective effect of HI-6 and trimedoxime combination in mice acutely poisoned with tabun, dichlorvos or heptenophos


    Antonijević, Biljana; Vučinić, Slavica; Ćupić, V.


    The aim of this study was to compare the protective effect of two individual oximes (HI-6 and trimedoxime) with their combination in mice acutely poisoned with tabun, dichlorvos or heptenophos. Oxime HI-6 did not protect experimental animals against either dichlorvos, heptenophos or tabun. Trimedoxime was very effective against all three OPs. The ED-500 doses of trimedoxime necessary to protect 50% of animals after the simultaneous administration of OPs and oxime were 42.18, 14.97 and 32.08 μ...

  10. Immunization with chlamydial plasmid protein pORF5 DNA vaccine induces protective immunity against genital chlamydial infection in mice

    Institute of Scientific and Technical Information of China (English)


    To validate the immune protective efficacy of pORF5 DNA vaccine and to analyze potential mechanisms related to this protection. In this study, pORF5 DNA vaccine was constructed and evaluated for its protective immunity in a mouse model of genital chlamydial infection. Groups of BALB/c mice were immunized intranasally with pORF5 DNA vaccine. Humoral and cell mediated immune responses were evaluated. The clearance ability of chlamydial challenge from the genital tract and the chlamy- dia-induced upper genital tract gross pathology and histopathological characterization were also de- tected. The results showed that the total and the IgG2a anti-pORF5 antibody levels in serum were sig- nificantly elevated after pcDNA3.1-pORF5 vaccination, as were the total antibody and IgA levels in vaginal fluids. pcDNA3.1-pORF5 induced a significantly high level of Th1 response as measured by robust gamma interferon (IFN-γ). Minimal IL-4 was produced by immune T cells in response to the re-stimulation with pORF5 protein or the inactive elementary body in vitro. pcDNA3.1-pORF5-vacci- nated mice displayed significantly reduced bacterial shedding upon a chlamydial challenge and an accelerated resolution of infection. 100% of pcDNA3.1-pORF5 vaccinated mice successfully resolved the infection by day 24. pcDNA3.1-pORF5-immunized mice also exhibited protection against patho- logical consequences of chlamydial infection. The stimulated index was significantly higher than that of mice immunized with pcDNA3.1 and PBS (P<0.05). Together, these results demonstrated that immu- nization with pORF5 DNA vaccine is a promising approach for eliciting a protective immunity against a genital chlamydial challenge.

  11. DNA vaccination with a gene encoding Toxoplasma gondii Rhoptry Protein 17 induces partial protective immunity against lethal challenge in mice

    Directory of Open Access Journals (Sweden)

    Wang Hai-Long


    Full Text Available Toxoplasma gondii is an obligate intracellular apicomplexan parasite that affects humans and various vertebrate livestock and causes serious economic losses. To develop an effective vaccine against T. gondii infection, we constructed a DNA vaccine encoding the T. gondii rhoptry protein 17 (TgROP17 and evaluated its immune protective efficacy against acute T. gondii infection in mice. The DNA vaccine (p3×Flag-CMV-14-ROP17 was intramuscularly injected to BALB/c mice and the immune responses of the vaccinated mice were determined. Compared to control mice treated with empty vector or PBS, mice immunized with the ROP17 vaccine showed a relatively high level of specific anti-T. gondii antibodies, and a mixed IgG1/IgG2a response with predominance of IgG2a production. The immunized mice also displayed a specific lymphocyte proliferative response, a Th1-type cellular immune response with production of IFN-γ and interleukin-2, and increased number of CD8+ T cells. Immunization with the ROP17 DNA significantly prolonged the survival time (15.6 ± 5.4 days, P < 0.05 of mice after challenge infection with the virulent T. gondii RH strain (Type I, compared with the control groups which died within 8 days. Therefore, our data suggest that DNA vaccination with TgROP17 triggers significant humoral and cellular responses and induces effective protection in mice against acute T. gondii infection, indicating that TgROP17 is a promising vaccine candidate against acute toxoplasmosis.

  12. Knockout of the 15 kDa selenoprotein protects against chemically-induced aberrant crypt formation in mice.

    Directory of Open Access Journals (Sweden)

    Petra A Tsuji

    Full Text Available Evidence suggests that selenium has cancer preventive properties that are largely mediated through selenoproteins. Our previous observations demonstrated that targeted down-regulation of the 15 kDa selenoprotein (Sep15 in murine colon cancer cells resulted in the reversal of the cancer phenotype. The present study investigated the effect of Sep15 knockout in mice using a chemically-induced colon cancer model. Homozygous Sep15 knockout mice, and wild type littermate controls were given four weekly subcutaneous injections of azoxymethane (10 mg/kg. Sep15 knockout mice developed significantly (p<0.001 fewer aberrant crypt foci than controls demonstrating that loss of Sep15 protects against aberrant crypt foci formation. Dietary selenium above adequate levels did not significantly affect aberrant crypt foci formation in Sep15 knockout mice. To investigate molecular targets affected by loss of Sep15, gene expression patterns in colonic mucosal cells of knockout and wild type mice were examined using microarray analysis. Subsequent analyses verified that guanylate binding protein-1 (GBP-1 mRNA and protein expression were strongly upregulated in Sep15 knockout mice. GBP-1, which is expressed in response to interferon-γ, is considered to be an activation marker during inflammatory diseases, and up-regulation of GBP-1 in humans has been associated with a highly significant, increased five-year survival rate in colorectal cancer patients. In agreement with these studies, we observed a higher level of interferon-γ in plasma of Sep15 knockout mice. Overall, our results demonstrate for the first time, that Sep15 knockout mice are protected against chemically-induced aberrant crypt foci formation and that Sep15 appears to have oncogenic properties in colon carcinogenesis in vivo.

  13. Gender-specific reduction of hepatic Mrp2 expression by high-fat diet protects female mice from ANIT toxicity

    Energy Technology Data Exchange (ETDEWEB)

    Kong, Bo; Csanaky, Iván L. [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Aleksunes, Lauren M. [Department of Pharmacology and Toxicology, School of Pharmacy and Environmental and Occupational Health Institute, Rutgers University, Piscataway, NJ (United States); Patni, Meghan; Chen, Qi; Ma, Xiaochao; Jaeschke, Hartmut [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Weir, Scott; Broward, Melinda; Klaassen, Curtis D. [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); University of Kansas Cancer Center, Kansas City, KS (United States); Guo, Grace L., E-mail: [Department of Pharmacology, Toxicology and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); University of Kansas Cancer Center, Kansas City, KS (United States)


    Emerging evidence suggests that feeding a high-fat diet (HFD) to rodents affects the expression of genes involved in drug transport. However, gender-specific effects of HFD on drug transport are not known. The multidrug resistance-associated protein 2 (Mrp2, Abcc2) is a transporter highly expressed in the hepatocyte canalicular membrane and is important for biliary excretion of glutathione-conjugated chemicals. The current study showed that hepatic Mrp2 expression was reduced by HFD feeding only in female, but not male, C57BL/6J mice. In order to determine whether down-regulation of Mrp2 in female mice altered chemical disposition and toxicity, the biliary excretion and hepatotoxicity of the Mrp2 substrate, α-naphthylisothiocyanate (ANIT), were assessed in male and female mice fed control diet or HFD for 4 weeks. ANIT-induced biliary injury is a commonly used model of experimental cholestasis and has been shown to be dependent upon Mrp2-mediated efflux of an ANIT glutathione conjugate that selectively injures biliary epithelial cells. Interestingly, HFD feeding significantly reduced early-phase biliary ANIT excretion in female mice and largely protected against ANIT-induced liver injury. In summary, the current study showed that, at least in mice, HFD feeding can differentially regulate Mrp2 expression and function and depending upon the chemical exposure may enhance or reduce susceptibility to toxicity. Taken together, these data provide a novel interaction between diet and gender in regulating hepatobiliary excretion and susceptibility to injury. -- Highlights: ► High-fat diet decreases hepatic Mrp2 expression only in female but not in male mice. ► HFD significantly reduces early-phase biliary ANIT excretion in female mice. ► HFD protects female mice against ANIT-induced liver injury.

  14. Nedd4 haploinsufficient mice display moderate insulin resistance, enhanced lipolysis, and protection against high-fat diet-induced obesity. (United States)

    Li, Jing Jing; Ferry, Robert J; Diao, Shiyong; Xue, Bingzhong; Bahouth, Suleiman W; Liao, Francesca-Fang


    Neural precursor cell expressed developmentally down-regulated protein 4 (Nedd4) is the prototypical protein in the Nedd4 ubiquitin ligase (E3) family, which governs ubiquitin-dependent endocytosis and/or degradation of plasma membrane proteins. Loss of Nedd4 results in embryonic or neonatal lethality in mice and reduced insulin/IGF-1 signaling in embryonic fibroblasts. To delineate the roles of Nedd4 in vivo, we examined the phenotypes of heterozygous knockout mice using a high-fat diet-induced obesity (HFDIO) model. We observed that Nedd4+/- mice are moderately insulin resistant but paradoxically protected against HFDIO. After high-fat diet feeding, Nedd4+/- mice showed less body weight gain, less fat mass, and smaller adipocytes vs the wild type. Despite ameliorated HFDIO, Nedd4+/- mice did not manifest improvement in glucose tolerance vs the wild type in both genders. Nedd4+/- male, but not female, mice displayed significantly lower fasting blood glucose levels and serum insulin levels. Under obesogenic conditions, Nedd4+/- mice displayed elevated stimulated lipolytic activity, primarily through a β2-adrenergic receptor. Combined, these data support novel complex roles for Nedd4 in metabolic regulation involving altered insulin and β-adrenergic signaling pathways.

  15. Immunization protected well nourished mice but not undernourished ones from lung injury in Methicillin-resistant Staphylococcus aureus (MRSA infection

    Directory of Open Access Journals (Sweden)

    da Cunha Maria


    Full Text Available Abstract Background Staphylococcus aureus methicillin-resistant (MRSA has been frequently isolated from endotracheal and lung puncture aspirates in malnourished children with pneumonia. In this work we evaluated the susceptibility of undernourished BALB/c mice and its ability to mount a protective immunity against MRSA with emphasis on the lung involvement. Results BALB/c mice submitted to a 20% dietary restriction during 20 days presented a significant decrease in body weight, lymphocyte number and also atrophy in thymus and intestinal epithelium. Determination of bacterial load by the number of colony forming units (CFU indicated a similar susceptibility whereas the findings of Gram stain clearly suggested a higher amount of bacteria in the lungs of normal mice than in the undernourished ones. Immunization reduced bacterial growth in the lungs of normal mice but not in the undernourished ones. Histopathological analysis showed that inflammation appeared in the lungs from normal mice only after infection and that immunization prevented this pulmonary inflammatory process. On the other hand, undernourished mice presented lung inflammation even before infection. In addition, the degree of this inflammatory process did not change with infection or previous immunization. Conclusion Our results indicated that lung injury during MRSA infection is prevented by previous immunization in well nourished but not in undernourished mice.

  16. Protective Effects of Scrophularia Striata in Ovalbumin-induced Mice Asthma Model

    Directory of Open Access Journals (Sweden)

    Abbas Azadmehr


    Full Text Available Background:Scrophularia striata Boiss. (Scrophulariaceae is a plant growing in the northeastern part of Iran and being used as a traditional herb for various inflammatory disorders.This study was designed to investigate the protective effects of the Scrophularia striata extract in Ovalbumin (OVA induced-asthma mice model.Methods:OVA-sensitized mice were intrapritonealy treated with two doses (100 and 200 mg/kg of the extract on days 8 to 14 separately. Broncoalveolar lavage fluids (BALF was collected 48 h after the final OVA challenge and then the number of eosinophils and other inflammatory cells were assessed by direct microscopic counting. In addition, total immunoglubolin (Ig E and OVA-specific IgE levels in serum, IL-4 and IL-5 cytokines in BALF were determined by Enzyme-Linked Immunosorbent Assay. Moreover, phytochemical assay by thin layer chromatography (TLC and the 2, 2 diphenyl-1-picrylhydrazyl (DPPH were used to evaluate the main compounds and the antioxidant capacity of the plant extract, respectively.Results:The results showed that the main components; including flavonoids, phenolic compounds and phenyl propanoids were presented in the S. striata extract. In addition, the treatment with extract significantly reduced the number of inflammatory cells and suppressed T-helper 2 (Th2 cytokines including IL-4 and IL-5 in BALF. Also, total IgE and OVA-specific IgE levels in the serum decreased.Conclusion:Collectively, it is concluded that the extract has the potential to modulate the Th2 cytokines and could be used as immunomodulatory agent in the treatment of allergic asthma.

  17. Protective effects of seed melon extract on CCl4-induced hepatic fibrosis in mice. (United States)

    Zhan, Yuan-Yuan; Wang, Jin-Hui; Tian, Xing; Feng, Shi-Xiu; Xue, Lin; Tian, Li-Ping


    Citrullus lanatus ssp. vulgaris var. megalaspermus Lin et Chao, was also known as watermelon belongs to family Cucurbitaceae, variously used as healthy food and in the treatment of liver and lungs problems. Currently, Citrullus lanatus has become a major economic crop of medicinal and edible effects with regional characteristics. This study was designed to evaluate the hepatoprotective and antioxidant activity of the seed melon (Citrullus lanatus ssp. vulgaris var. megalaspermus Lin et Chao) extract (SME) against carbon tetrachloride (CCl4) induced hepatic fibrosis in mice. In this study, mice were randomly divided into 7 groups, including normal control, model, silymarin tablets as the positive control, SME 100, 200, 400, and 800mg/kg. After 8 weeks, activities of serum alanine aminotransferase (ALT), aspartate aminotransferase (AST), triglycerides (TG), hyaluronic acid (HA) and laminin (LN) were checked. The levels of antioxidant enzymes such as superoxide dismutase (SOD), glutataion (GSH) and glutathione peroxidase (GSH-Px) were determined after SME administration. The hydroxyproline (HYP) levels, malondialdehyde (MDA) levels and histopathologic examinations of hepatocyte fibrosis were also determined. Additionally, effects of SME on alpha-smooth muscle actin (α-SMA) and transforming growth factor beta-1(TGF-β1) protein expressions were determined. We found that SME could significantly lower the serum levels of hepatic enzyme markers AST, ALT, HA and LN (P<0.01). Compared with the CCl4-only treatment group, levels of hepatic SOD and GSH-Px were significantly increased, and the MDA levels were remarkably decreased in mice treated by SME at medium dose (400mg/kg) and high dose (800mg/kg) (P<0.01). A histological examination of the liver showed that lesions, including necrosis, lymphocyte infiltration and fatty degeneration, were partially healed by treatment with SME. The results of protein expressions studies displayed that SME could inhibit α-SMA and TGF-β1

  18. Inhibitory effect of human telomerase antisense oligodeoxyribonucleotides on the growth of gastric cancer cell lines in variant tumor pathological subtype

    Institute of Scientific and Technical Information of China (English)

    Jing Ye; Yun-Lin Wu; Shu Zhang; Zi Chen; Li-Xia Guo; Ruo-Yu Zhou; Hong Xie


    AIM: To investigate the inhibitory effect of specialized human telomerase antisense oligodeoxyribonucleotides on the growth of well (MKN-28), moderately (SGC-7901)and poorly (MKN-45) differentiated gastric cancer cell lines under specific conditions and its inhibition mechanism,and to observe the correlation between the growth inhibition ratio and the tumor pathologic subtype of gastric cancer cells.METHODS: Telomerase activity in three gastric cancer cell lines of variant tumor pathologic subtype was determined by modified TRAP assay before and after the specialized human telomerase antisense oligodeoxyribonucleotides were dealt with under specific conditions. Effect of antisense oligomer under specific conditions of the growth and viability of gastric cancer cell lines was explored by using trypan blue dye exclusion assay, and cell apoptosis was detected by cell morphology observation, flow cytometry and TUNEL assay.RESULTS: Telomerase activity was detected in well,moderately and poorly differentiated gastric cancer cell lines (the quantification expression of telomerase activity was 43.7TPG, 56.5TPG, 76.7TPG, respectively).Telomerase activity was controlled to 30.2TPG, 36.3TPG and 35.2TPG for MKN-28, SGC-7901 and MKN-45 cell lines respectively after treatment with human telomerase antisense oligomers at the concentration of 5 μmol/L, and was entirely inhibited at 10 μmol/L, against the template region of telomerase RNA component, whereas no inhibition effect was detected in missense oligomers (P<0.05). After treatment with antisense oligomers at different concentrations under specific conditions for 96 h, significant growth inhibition effects were found in MKN-45 and SGC-7901gastric cancer cell lines (the inhibition ratio was 40.89%and 71.28%), but not in MKN-28 cell lines (15.86%). The ratio of inactive SGC-7901 cells increased according to the prolongation of treatment from 48 to 96 h. Missense oligomers could not lead to the same effect (P<0

  19. Black Hoof Medicinal Mushroom Phellinus linteus (Agaricomycetes) Extracts Protect Against Radiation-Induced Hematopoietic Abnormality in Mice. (United States)

    Huang, Shu-Ming; Chen, Jen-Yin; Chen, Chin-Chu; Su, Chih-Chung; Hu, Miao-Lin


    We investigated the effects of Phellinus linteus extracts (PLEs) against radiation damage in mice. First, BALB/c mice were irradiated once with γ-rays at 4, 5, 6, or 8 Gy and allowed to recover for 20 days. Results reveal that 8-Gy radiation caused death in 100% of mice on day 13, and 6-Gy radiation caused death in 86.7% of mice (13/15) at the end of the experiment, whereas 4- and 5-Gy radiation did not result in any death. We then used 5-Gy γ-ray radiation to examine the protective effects of PLEs. Mice were orally administered a PLE (500, 1000, and 1500 mg/kg) daily for 2 weeks before radiation and for 6 weeks after radiation. γ-Ray radiation significantly decreased body weight starting from week 2 after radiation. Supplementation with a median and high dose of PLE significantly restored body weights starting at weeks 5 and 3, respectively. The radiation-protective agent WR2721 (200 mg/kg intraperitoneally) restored body weights starting at week 4. White blood cells, platelets, red blood cells, and hemoglobin were significantly decreased by radiation, and PLEs (primarily at high doses) and WR2721 significantly prevented hematologic abnormality. These results suggest that PLE has potential as a radioprotective agent.

  20. Protective Effect of Aqueous Crude Extract of Neem (Azadirachta indica) Leaves on Plasmodium berghei-Induced Renal Damage in Mice. (United States)

    Somsak, Voravuth; Chachiyo, Sukanya; Jaihan, Ubonwan; Nakinchat, Somrudee


    Malaria is a major public health problem in the world because it can cause of death in patients. Malaria-associated renal injury is associated with 45% of mortality in adult patients hospitalized with severe form of the disease. Therefore, new plant extracts to protect against renal injury induced by malaria infection are urgently needed. In this study, we investigated the protective effect of aqueous crude extract of Azadirachta indica (neem) leaves on renal injury induced by Plasmodium berghei ANKA infection in mice. ICR mice were injected intraperitoneally with 1 × 10(7) parasitized erythrocytes of PbANKA, and neem extracts (500, 1,000, and 2,000 mg/kg) were given orally for 4 consecutive days. Plasma blood urea nitrogen (BUN) and creatinine levels were subsequently measured. Malaria-induced renal injury was evidenced as marked increases of BUN and creatinine levels. However, the oral administration of neem leaf extract to PbANKA infected mice for 4 days brought back BUN and creatinine levels to near normalcy, and the highest activity was observed at doses of 1,000 and 2,000 mg/kg. Additionally, no toxic effects were found in normal mice treated with this extract. Hence, neem leaf extract can be considered a potential candidate for protection against renal injury induced by malaria.

  1. Evaluation of protective effect of IL-22 and IL-12 on cutaneous leishmaniasis in BALB/c mice

    Institute of Scientific and Technical Information of China (English)

    Hajar Ziaei Hezarjaribi; Fatemeh Ghaffarifar; Abdolhossein Dalimi; Zohreh Sharifi


    Objective:To investigate the protective effect ofIL-22 andIL-12 on cutaneous leishmaniasisin BALB/c mice.Methods:The protective effect ofIL-22 andIL-12 on cutaneous leishmanias in BALB/c mice was evaluated by measurement ofIL-4,INF-γ, totalIgG,IgG1 andIgG2a after challenge withLeishamania major.Clinical evaluations were performed by measurement of lesion diameter, and survival rate of the mice.Results:In week27 post infection, the mortality rates for control groups were100%.While the survival rates for theIL-12,IL-12+IL-22, andIL-22(5 ng/g) groups were100%.The size of lesions decreased in the presenceIL-22(5 ng/g) of mice weight, which was statistically significant in comparison with other groups(P<0.05).Mean of totalIgG, IgG1 andIgG2a forIL-22(5 ng/g) group was more than other groups.InIL-22group(5 ng/g),INF-γ production was significantly higher than other groups andIL-4 was significantly lower than other groups.Conclusions:The results obtained indicate the effectiveness ofIL-22 and its effect onIL-12 in protection of cutaneous leishmaniasis.

  2. Low-dose alcohol consumption protects against transient focal cerebral ischemia in mice: possible role of PPARγ.

    Directory of Open Access Journals (Sweden)

    Hong Sun

    Full Text Available BACKGROUND: We examined the influence of low-dose alcohol consumption on cerebral ischemia/reperfusion (I/R injury in mice and a potential mechanism underlying the neuroprotective effect of low-dose alcohol consumption. METHODOLOGY/PRINCIPAL FINDINGS: C57BL/6 J mice were fed a liquid diet without or with 1% alcohol for 8 weeks, orally treated with rosiglitazone (20 mg/kg/day, a peroxisome proliferator-activated receptor gamma (PPARγ-selective agonist, or GW9662 (3 mg/kg/day, a selective PPARγ antagonist, for 2 weeks. The mice were subjected to unilateral middle cerebral artery occlusion (MCAO for 90 minutes. Brain injury, DNA fragmentation and nuclear PPARγ protein/activity were evaluated at 24 hours of reperfusion. We found that the brain injury and DNA fragmentation were reduced in 1% alcohol-fed mice compared to nonalcohol-fed mice. Rosiglitazone suppressed the brain injury in nonalcohol-fed mice, but didn't alter the brain injury in alcohol-fed mice. In contrast, GW9662 worsened the brain injury in alcohol-fed mice, but didn't alter the brain injury in nonalcohol-fed mice. Nuclear PPARγ protein/activity at peri-infarct and the contralateral corresponding areas of the parietal cortex was greater in alcohol-fed mice compared to nonalcohol-fed mice. Using differentiated catecholaminergic (CATH.a neurons, we measured dose-related influences of chronic alcohol exposure on nuclear PPARγ protein/activity and the influence of low-dose alcohol exposure on 2-hour oxygen-glucose deprivation (OGD/24-hour reoxygenation-induced apoptosis. We found that low-dose alcohol exposure increased nuclear PPARγ protein/activity and protected against the OGD/reoxygenation-induced apoptosis. The beneficial effect of low-dose alcohol exposure on OGD/reoxygenation-induced apoptosis was abolished by GW9662. CONCLUSIONS/SIGNIFICANCE: Our findings suggest that chronic consumption of low-dose alcohol protects the brain against I/R injury. The neuroprotective effect

  3. Protective effects of Nasturtium officinale against gamma-irradiation-induced hepatotoxicity in C57 mice

    Directory of Open Access Journals (Sweden)

    M. Karami


    Full Text Available Background and objectives: Nasturtium officinale W.T.Aiton (Brassicaceae is used as an edible vegetable in various parts of Iran. The aim of the present study was to investigate the protective activity of the methanolic extract of Nasturtium officinale against gamma-radiation-induced hepatotoxicity in terms of histopathological changes. Methods: Male C57 mice were divided into 10 groups. Groups 1 and 2 received saline solution intra-peritoneally (IP for 15 days (subacute and 2 h (acute before whole body γ-irradiation (6 Gy. Groups 3 to 5 (subacute and 6 to 8 (acute received the extract at doses of 20 mg/kg, 50 mg/kg and 100 mg/kg body weight IP, respectively. Group 9 served as radiation group. Group 10 received nothing. Finally, sections of the liver tissue were evaluated for any histopathologic changes. Total phenolic and flavonoid contents were determined using Folin Ciocalteu andaluminium chloride methods. Results: Pre-treatment with 100 mg/kg body weight per day for 15 days and 2 h before γ-radiation significantly lowered incidence of inflammation (portal and periportal inflammation. Furthermore, liver cells necrosis, edema and congestion were slightly reduced. The total phenolic and total flavonoid contents of the extract were 11.3 ± 0.4 mg gallic acid equivalents and 9.4 ± 0.7 mg quercetin equivalents per gram of dried extract. Conclusion: This protection can be attributed to the presence of phenols and isothiocyanates in the extract of N. officinale which act as antioxidants and anti-inflammatory agents.

  4. Partial protective effect of intranasal immunization with recombinant Toxoplasma gondii rhoptry protein 17 against toxoplasmosis in mice.

    Directory of Open Access Journals (Sweden)

    Hai-Long Wang

    Full Text Available Toxoplasma gondii (T. gondii is an obligate intracellular protozoan parasite that infects a variety of mammals, including humans. An effective vaccine for this parasite is therefore needed. In this study, RH strain T. gondii rhoptry protein 17 was expressed in bacteria as a fusion with glutathione S-transferase (GST and the recombinant proteins (rTgROP17 were purified via GST-affinity chromatography. BALB/c mice were nasally immunised with rTgROP17, and induction of immune responses and protection against chronic and lethal T. gondii infections were investigated. The results revealed that mice immunised with rTgROP17 produced high levels of specific anti-rTgROP17 IgGs and a mixed IgG1/IgG2a response of IgG2a predominance. The systemic immune response was associated with increased production of Th1 (IFN-γand IL-2 and Th2 (IL-4 cytokines, and enhanced lymphoproliferation (stimulation index, SI in the mice immunised with rTgROP17. Strong mucosal immune responses with increased secretion of TgROP17-specific secretory IgA (SIgA in nasal, vaginal and intestinal washes were also observed in these mice. The vaccinated mice displayed apparent protection against chronic RH strain infection as evidenced by their lower liver and brain parasite burdens (59.17% and 49.08%, respectively than those of the controls. The vaccinated mice also exhibited significant protection against lethal infection of the virulent RH strain (survival increased by 50% compared to the controls. Our data demonstrate that rTgROP17 can trigger strong systemic and mucosal immune responses against T. gondii and that ROP17 is a promising candidate vaccine for toxoplasmosis.

  5. Protective effects of white button mushroom (Agaricus bisporus against hepatic steatosis in ovariectomized mice as a model of postmenopausal women.

    Directory of Open Access Journals (Sweden)

    Noriko Kanaya

    Full Text Available Nonalcoholic fatty liver disease (NAFLD includes various hepatic pathologies ranging from hepatic steatosis to non-alcoholic steatohepatitis (NASH, fibrosis and cirrhosis. Estrogen provides a protective effect on the development of NAFLD in women. Therefore, postmenopausal women have a higher risk of developing NAFLD. Hepatic steatosis is an early stage of fatty liver disease. Steatosis can develop to the aggressive stages (nonalcoholic steatohepatitis, fibrosis and cirrhosis. Currently, there is no specific drug to prevent/treat these liver diseases. In this study, we found that white button mushroom (WBM, Agaricus Bisporus, has protective effects against liver steatosis in ovariectomized (OVX mice (a model of postmenopausal women. OVX mice were fed a high fat diet supplemented with WBM powder. We found that dietary WBM intake significantly lowered liver weight and hepatic injury markers in OVX mice. Pathological examination of liver tissue showed less fat accumulation in the livers of mice on WBM diet; moreover, these animals had improved glucose clearance ability. Microarray analysis revealed that genes related to the fatty acid biosynthesis pathway, particularly the genes for fatty acid synthetase (Fas and fatty acid elongase 6 (Elovl6, were down-regulated in the liver of mushroom-fed mice. In vitro mechanistic studies using the HepG2 cell line showed that down-regulation of the expression of FAS and ELOVL6 by WBM extract was through inhibition of Liver X receptor (LXR signaling and its downstream transcriptional factor SREBP1c. These results suggest that WBM is protective against hepatic steatosis and NAFLD in OVX mice as a model for postmenopausal women.

  6. Increased osteoblastogenesis and decreased bone resorption protect against ovariectomy-induced bone loss in thrombospondin-2-null mice. (United States)

    Hankenson, K D; James, I E; Apone, S; Stroup, G B; Blake, S M; Liang, X; Lark, M W; Bornstein, P


    Although bone is composed primarily of extracellular matrix (ECM), the dynamic role that the ECM plays in regulating bone remodeling secondary to estrogen loss is relatively unexplored. Previous studies have shown that mice deficient in the matricellular protein thrombospondin-2 (TSP2-null) form excess endocortical bone; thus, we postulated that enhanced bone formation in TSP2-null mice could protect against ovariectomy (OVX)-induced bone loss. Wild-type (WT) OVX mice showed a significant loss of both midfemoral endocortical and proximal tibial trabecular bone, but OVX did not significantly alter TSP2-null bone. TSP2-null mice showed an increase in bone formation, as indicated by a 70% increase in serum osteocalcin two weeks post OVX and a two-fold increase in bone formation rate (BFR) five weeks post OVX as measured by dynamic histomorphometry. WT animals showed only a 20% increase in serum osteocalcin at two weeks and no change in BFR at five weeks. This increase in bone formation in TSP2-null OVX mice was accompanied by a three-fold increase in osteoprogenitor number. Although these results provide a partial explanation for the maintenance of bone geometry post-OVX, TSP2-null mice five weeks post-OVX also showed a significantly lower level of bone resorption than OVX WT mice, as determined by serum levels of the amino-terminal telopeptide of type I collagen (NTx). We conclude that the absence of TSP2 protects against OVX-induced bone loss by two complementary processes: increased formation and decreased resorption.

  7. Protective effect of acupuncture on heart in mice with hyperlipemia and its mechanism

    Institute of Scientific and Technical Information of China (English)



    Objective To observe the inhibiting effect of acupuncture on blood lipid,myocardial hypertrophy and fibrosis in mice with hyperlipemia,and explore its possible action mechanism.Methods Ten inbred mice(C57)were applied.Forty ApoE(-/-)mice removed gene of apolipoprotein E were randomly divided into a control

  8. Simvastatin enhances protection against Listeria monocytogenes infection in mice by counteracting Listeria-induced phagosomal escape.

    Directory of Open Access Journals (Sweden)

    Suraj P Parihar

    Full Text Available Statins are well-known cholesterol lowering drugs targeting HMG-CoA-reductase, reducing the risk of coronary disorders and hypercholesterolemia. Statins are also involved in immunomodulation, which might influence the outcome of bacterial infection. Hence, a possible effect of statin treatment on Listeriosis was explored in mice. Statin treatment prior to subsequent L. monocytogenes infection strikingly reduced bacterial burden in liver and spleen (up to 100-fold and reduced histopathological lesions. Statin-treatment in infected macrophages resulted in increased IL-12p40 and TNF-α and up to 4-fold reduced bacterial burden within 6 hours post infection, demonstrating a direct effect of statins on limiting bacterial growth in macrophages. Bacterial uptake was normal investigated in microbeads and GFP-expressing Listeria experiments by confocal microscopy. However, intracellular membrane-bound cholesterol level was decreased, as analyzed by cholesterol-dependent filipin staining and cellular lipid extraction. Mevalonate supplementation restored statin-inhibited cholesterol biosynthesis and reverted bacterial growth in Listeria monocytogenes but not in listeriolysin O (LLO-deficient Listeria. Together, these results suggest that statin pretreatment increases protection against L. monocytogenes infection by reducing membrane cholesterol in macrophages and thereby preventing effectivity of the cholesterol-dependent LLO-mediated phagosomal escape of bacteria.

  9. Protective effect of daidzin against D-galactosamine and lipopolysaccharide-induced hepatic failure in mice. (United States)

    Kim, Sung-Hwa; Heo, Jeong-Haing; Kim, Yeong Shik; Kang, Sam Sik; Choi, Jae Sue; Lee, Sun-Mee


    This study examined the effects of daidzin, a major isoflavone from Puerariae Radix, on D-galactosamine (D-GalN) and lipopolysaccharide (LPS)-induced liver failure. Mice were given an intraperitoneal injection of daidzin (25, 50, 100 and 200 mg/kg) 1 h before receiving an injection of D-GalN (700 mg/kg)/LPS (10 microg/kg). Daidzin markedly reduced the elevated serum aminotransferase activity and the levels of lipid peroxidation and tumor necrosis factor-alpha. The glutathione content was lower in the D-GalN/LPS group, which was attenuated by daidzin. The daidzin pretreatment attenuated the swollen mitochondria observed in the d-GalN/LPS group. Daidzin attenuated the apoptosis of hepatocytes, which was confirmed using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling method and a caspase-3 assay. Overall, these results suggest that the liver protection of daidzin is due to reduced oxidative stress and its antiapoptotic activity.

  10. Ephedrine hydrochloride protects mice from LPS challenge by promoting IL-10 secretion and inhibiting proinflammatory cytokines. (United States)

    Zheng, Yuejuan; Guo, Ziyi; He, Weigang; Yang, Yang; Li, Yuhu; Zheng, Aoxiang; Li, Ping; Zhang, Yan; Ma, Jinzhu; Wen, Mingyue; Yang, Muyi; An, Huazhang; Ji, Guang; Yu, Yizhi


    Sepsis and its derivative endotoxic shock are still serious conditions with high mortality in the intensive care unit. The mechanisms that ensure the balance of proinflammatory cytokines and anti-inflammatory cytokine production are of particular importance. As an active α- and β-adrenergic agonist, ephedrine hydrochloride (EH) is a widely used agent for cardiovascular diseases, especially boosting blood pressure. Here we demonstrate that EH increased Toll-like receptor 4 (TLR4)-mediated production of interleukin 10 (IL-10) through p38 MAPK activation. Simultaneously, EH negatively regulated the production of proinflammatory cytokines. Consistently, EH increased lipopolysaccharide (LPS)-induced serum IL-10 and inhibited tumor necrotic factor-α (TNFα) production in vivo. As a result, EH treatment protected mice from endotoxic shock by lethal LPS challenge. In brief, our data demonstrated that EH could contribute to immune homeostasis by balancing the production of proinflammatory cytokines and anti-inflammatory cytokine in TLR4 signaling. This study provides a potential usage of EH in autoimmunologic diseases or other severe inflammations.

  11. Protective Effects of Moschus Against Carbon Tetrachloride-Induced Acute Hepatotoxicity in ICR Mice

    Directory of Open Access Journals (Sweden)

    Jae Seuk Park


    Full Text Available Objectives : This study was aimed at investigating liver protection mechanism of Moschus by inducing liver toxicity through CCl4 in mice and evaluated histological and serological findings. Methods : Experiment groups was categorized into untreated normal group, CCl4 treated control group, and orally administered Moschus experiment group. At the termination of experiment, gross examination of the liver as well as histological findings, and Total protein, Total bilirubin, Direct bilirubin SGOT, SGPT, and ALP contents in the serum were evaluated. Results : 1. For gross examination and histological findings, CCl4 treated control group showed destroyed lobular structure, increased fibrosis, as well as hepatic cirrhosis. For the group treated with Moschus, the lobular structure suffered less damage, and showed lower level of fibrosis and liver cirrhosis compared to the control group. 2. For serum analysis, Total protein were significantly increased in the Moschus experiment group than the control group. 3. Total bilirubin didn't show significant differences between the two groups. but direct bilirubin was significantly increased in the Moschus experiment group than the control group. 4. SGOT, SGPT, were significantly decreased in the normal and Moschus experiment groups compared to the control group. 5. ALP was significantly decreased in the normal group compared to the control group, but Moschus experiment group didn't show significant differences compared to the control group. Conclusion : Taken together, Moschus can be effectively used for recovering the liver functions and further researches must be conducted to verify the efficacies of Moschus bile juice.

  12. Protective Effects of near nile Juice Against Carbon Tetrachloride-Induced Acute Hepatotoxicity in ICR Mice

    Directory of Open Access Journals (Sweden)

    Ki Rok Kwon


    Full Text Available Objectives : This study was aimed at investigating liver protection mechanism of bear bile juice (Fel Ursiby inducing liver toxicity through CCl4 in mice and evaluated histological and serological findings. Methods : Experiment groups was categorized into untreated normal group, CCl4 treated control group, and orally administered bear bile juice experiment group. At the termination of experiment, gross examination of the liver as well as histological findings, and Total protein, Albumin, Total bilirubin, Direct bilirubin SGOT, SGPT, and ALP contents in the serum were evaluated. Results : 1. For gross examination and histological findings, CCl4 treated control group showed destroyed lobular structure, increased fibrosis, as well as hepatic cirrhosis. For the group treated with bear bile juice, the lobular structure suffered less damage, and showed lower level of fibrosis and liver cirrhosis compared to the control group. 2. For serum analysis, Total protein and Albumin were significantly increased in the bear bile juice experiment group than the control group. Total bilirubin and Direct bilirubin didn't show significant differences between the two groups. SGOT, SGPT, and ALP were significantly decreased in the normal and bear bile juice experiment groups compared to the control group. Conclusion : Taken together, bear bile juice can be effectively used for recovering the liver functions and further researches must be conducted to verify the efficacies of bear bile juice.

  13. Protective effects of bilberry ( Vaccinium myrtillus L.) extract against endotoxin-induced uveitis in mice. (United States)

    Yao, Nan; Lan, Fang; He, Rong-Rong; Kurihara, Hiroshi


    Endotoxin-induced uveitis (EIU), a useful animal model of ocular inflammation, is induced by injection of lipopolysacharide (LPS). These experiments showed that the nitric oxide (NO) level significantly increased in the whole eye homogenate of BALB/C mice 24 h after footpad injection of LPS at a dosage of 100 mg/mouse. However, the elevated NO level was significantly reduced by oral administration of bilberry extract (containing 42.04% anthocyanins) at dosages of 50, 100, and 200 mg/kg/day for 5 days before the LPS injection. In addition, bilberry extract decreased malondialdehyde (MDA) level and increased oxygen radical absorbance capacity (ORAC) level, glutathione (GSH) level, vitamin C level, and total superoxide dismutase (SOD) and glutathione peroxidase (GPx) activities. Moreover, bilberry extract increased expression of copper/zinc superoxide dismutase (CuZnSOD), manganese superoxide dismutase (MnSOD), and GPx mRNA. Taken together, bilberry extract showed protective effects against EIU, whereas the effects of bilberry extract (100 and 200 mg/kg/day, 5 days) were dose-dependent. In conclusion, these results provide new evidence to elucidate the beneficial effects of bilberry extract on eye health.

  14. Apigenin protects mice from pneumococcal pneumonia by inhibiting the cytolytic activity of pneumolysin. (United States)

    Song, Meng; Li, Li; Li, Meng; Cha, Yonghong; Deng, Xuming; Wang, Jianfeng


    Streptococcus pneumoniae is an important human pathogenic bacterium that can cause various life-threatening infections. Pneumolysin (PLY), the pore-forming toxin that forms large pores in the cell membrane, is a key virulence factor secreted by S. pneumoniae that penetrates the physical defenses of the host and plays an important role in the pathogenesis of pneumococcal diseases, such as pneumonia, meningitis, bacteremia and otitis media. This study showed that apigenin, one of the bioflavonoids widely found in herbs, inhibits PLY-induced hemolysis by inhibiting the oligomerization of PLY and has no anti-S. pneumoniae activity. In addition, when PLY was incubated with human alveolar epithelial (A549) cells, apigenin could effectively alleviate PLY-mediated cell injury. In vivo studies further demonstrated that apigenin could protect mice against S. pneumoniae pneumonia. These results imply that apigenin could directly interact with PLY to decrease the pathogenicity of S. pneumoniae and that novel therapeutics against S. pneumoniae PLY might provide greater effectiveness in combatting S. pneumoniae pneumonia.

  15. Folic acid supplementation during pregnancy protects against lipopolysaccharide-induced neural tube defects in mice. (United States)

    Zhao, Mei; Chen, Yuan-Hua; Chen, Xue; Dong, Xu-Ting; Zhou, Jun; Wang, Hua; Wu, Shu-Xian; Zhang, Cheng; Xu, De-Xiang


    Folic acid is a water-soluble B-complex vitamin. Increasing evidence demonstrates that physiological supply of folic acid during pregnancy prevents folic acid deficiency-related neural tube defects (NTDs). Previous studies showed that maternal lipopolysaccharide (LPS) exposure caused NTDs in rodents. The aim of this study was to investigate the effects of high-dose folic acid supplementation during pregnancy on LPS-induced NTDs. Pregnant mice were intraperitoneally injected with LPS (20 μg/kg/d) from gestational day (GD) 8 to GD12. As expected, a five-day LPS injection resulted in 19.96% of fetuses with NTDs. Interestingly, supplementation with folic acid (3mg/kg/d) during pregnancy significantly alleviated LPS-induced NTDs. Additionally, folic acid significantly attenuated LPS-induced fetal growth restriction and skeletal malformations. Additional experiment showed that folic acid attenuated LPS-induced glutathione (GSH) depletion in maternal liver and placentas. Moreover, folic acid significantly attenuated LPS-induced expression of placental MyD88. Additionally, folic acid inhibited LPS-induced c-Jun NH2-terminal kinase (JNK) phosphorylation and nuclear factor kappa B (NF-κB) activation in placentas. Correspondingly, folic acid significantly attenuated LPS-induced tumor necrosis factor (TNF)-α, interleukin (IL)-1β and IL-6 in placentas, maternal serum and amniotic fluid. In conclusion, supplementation with high-dose folic acid during pregnancy protects against LPS-induced NTDs through its anti-inflammatory and anti-oxidative effects.

  16. The antidiabetic agent glibenclamide protects airway hyperresponsiveness and inflammation in mice. (United States)

    Cui, Wei; Zhang, Shufang; Cai, Zhijian; Hu, Xinlei; Zhang, Ruifeng; Wang, Yong; Li, Na; Chen, Zhihua; Zhang, Gensheng


    Glibenclamide has a newly discovered role in inflammation regulation besides its antidiabetic effect. As an inhibitor of ATP-sensitive potassium (KATP) channel, glibenclamide antagonizes the relaxation of the tracheal smooth muscle. This indicates that glibenclamide might attenuate airway inflammation while aggravate airway hyperresponsiveness (AHR) in asthmatics. Clinically, many diabetics with asthma are prescribed with glibenclamide to control blood glucose. However, whether glibenclamide could exert any effects on asthmatic inflammation remains unknown. Using an ovalbumin (OVA)-induced mouse model of asthma, we evaluated the effects of glibenclamide on the AHR and inflammation. Interestingly, glibenclamide reduced all the cardinal features of asthma in OVA-challenged mice, including AHR, airway inflammation, and T-helper type 2 (Th2) cytokines. Glibenclamide also downregulated OVA-induced expressions of vascular cell adhesion molecule 1 (VCAM-1) and phosphorylated signal transducer and activator of transcription 6 (p-STAT6) in the lung. In addition, increased sulfonylurea receptor 1 (SUR1) expression in the lung was observed after the OVA challenge. These findings suggest that the classic sulfonylurea glibenclamide plays an important protective role in the development of asthma, which not only provides the evidence for the safety of prescribed glibenclamide in diabetics combined with asthma but also indicates a possible new therapeutic for asthma via targeting glibenclamide-related pathways.

  17. IL-23-mediated mononuclear phagocyte crosstalk protects mice from Citrobacter rodentium-induced colon immunopathology. (United States)

    Aychek, Tegest; Mildner, Alexander; Yona, Simon; Kim, Ki-Wook; Lampl, Nardy; Reich-Zeliger, Shlomit; Boon, Louis; Yogev, Nir; Waisman, Ari; Cua, Daniel J; Jung, Steffen


    Gut homeostasis and mucosal immune defense rely on the differential contributions of dendritic cells (DC) and macrophages. Here we show that colonic CX3CR1(+) mononuclear phagocytes are critical inducers of the innate response to Citrobacter rodentium infection. Specifically, the absence of IL-23 expression in macrophages or CD11b(+) DC results in the impairment of IL-22 production and in acute lethality. Highlighting immunopathology as a death cause, infected animals are rescued by the neutralization of IL-12 or IFNγ. Moreover, mice are also protected when the CD103(+) CD11b(-) DC compartment is rendered deficient for IL-12 production. We show that IL-12 production by colonic CD103(+) CD11b(-) DC is repressed by IL-23. Collectively, in addition to its role in inducing IL-22 production, macrophage-derived or CD103(-) CD11b(+) DC-derived IL-23 is required to negatively control the otherwise deleterious production of IL-12 by CD103(+) CD11b(-) DC. Impairment of this critical mononuclear phagocyte crosstalk results in the generation of IFNγ-producing former TH17 cells and fatal immunopathology.

  18. Demethyleneberberine Protects against Hepatic Fibrosis in Mice by Modulating NF-κB Signaling

    Directory of Open Access Journals (Sweden)

    Yongchen Wang


    Full Text Available Demethyleneberberine (DMB is an essential metabolite of Berberine (BBR in vivo. Recent reports have revealed multiple novel therapeutic applications of BBR. However, the pharmacological activities of DMB remain to be elucidated. This study aimed to demonstrate the hepatoprotective and anti-fibrotic effects of DMB both in vitro and in vivo. Here we showed that DMB protects against thioacetamide (TAA-induced hepatic fibrosis in mice and exhibits a higher safety profile as compared to BBR. Flow cytometry and Western blotting analysis showed that DMB is able to suppress the activation of hepatic stellate cells (HSCs and induce cell apoptosis through the nuclear factor-κB (NF-κB cascade. Immunohistochemical (IHC and quantitative polymerase chain reaction (qPCR analysis indicated that DMB also has inhibitory effects on collagen synthesis and is able to increase collagen degradation by blocking the transforming growth factor β 1 (TGF-β1-Smad signaling and reducing the expression of matrix metalloproteinases (MMPs and tissue inhibitors of MMP (TIMPs. These findings indicate that DMB has the potential to attenuate hepatic fibrosis via suppressing HSC activation.

  19. Protective effect of Cassia fistula fruit extract against bromobenzene-induced liver injury in mice. (United States)

    Kalantari, Heibatullah; Jalali, Mohammadtaha; Jalali, Amir; Mahdavinia, Masood; Salimi, Abobakr; Juhasz, Bela; Tosaki, Arpad; Gesztelyi, Rudolf


    In the present study, hepatoprotective effect of Cassia fistula fruit extract was investigated in mice. Animals were divided into six groups receiving normal saline (1), bromobenzene (460 mg/kg) alone (2) and together with increasing doses (200, 400, 600, 800 mg/kg) of a crude hydro-alcoholic extract of Cassia fistula fruit (3-6, respectively). All administrations were carried out orally, daily, for 10 days. On the 11th day, animals were sacrificed. Serum activities of aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase (ALP) and gamma glutamyl transpeptidase (γGT) were determined; serum levels of direct and total bilirubin were measured; furthermore, livers were prepared for histological examination. Our results showed that bromobenzene treatment alone elicited a significant increase in activities of AST, ALT, ALP (but not γGT), and it significantly elevated the levels of direct and total bilirubin. Co-treatment with Cassia fistula fruit extract, however, significantly and dose-dependently decreased the above-mentioned enzyme activities (with exception of γGT) and bilirubin levels, producing a recovery to the naive state. The protective effect of Cassia fistula fruit extract against liver injury evoked by bromobenzene was confirmed by histological examination as well. In conclusion, the Cassia fistula fruit extract has significant hepatoprotective effect in our murine model.

  20. An Intranasal Virus-Like Particle Vaccine Broadly Protects Mice from Multiple Subtypes of Influenza A Virus. (United States)

    Schwartzman, Louis M; Cathcart, Andrea L; Pujanauski, Lindsey M; Qi, Li; Kash, John C; Taubenberger, Jeffery K


    Influenza virus infections are a global public health problem, with a significant impact of morbidity and mortality from both annual epidemics and pandemics. The current strategy for preventing annual influenza is to develop a new vaccine each year against specific circulating virus strains. Because these vaccines are unlikely to protect against an antigenically divergent strain or a new pandemic virus with a novel hemagglutinin (HA) subtype, there is a critical need for vaccines that protect against all influenza A viruses, a so-called "universal" vaccine. Here we show that mice were broadly protected against challenge with a wide variety of lethal influenza A virus infections (94% aggregate survival following vaccination) with a virus-like particle (VLP) vaccine cocktail. The vaccine consisted of a mixture of VLPs individually displaying H1, H3, H5, or H7 HAs, and vaccinated mice showed significant protection following challenge with influenza viruses expressing 1918 H1, 1957 H2, and avian H5, H6, H7, H10, and H11 hemagglutinin subtypes. These experiments suggest a promising and practical strategy for developing a broadly protective "universal" influenza vaccine. The rapid and unpredictable nature of influenza A virus evolution requires new vaccines to be produced annually to match circulating strains. Human infections with influenza viruses derived from animals can cause outbreaks that may be associated with high mortality, and such strains may also adapt to humans to cause a future pandemic. Thus, there is a large public health need to create broadly protective, or "universal," influenza vaccines that could prevent disease from a wide variety of human and animal influenza A viruses. In this study, a noninfectious virus-like particle (VLP) vaccine was shown to offer significant protection against a variety of influenza A viruses in mice, suggesting a practical strategy to develop a universal influenza vaccine. Copyright © 2015 Schwartzman et al.

  1. Major basic protein from eosinophils and myeloperoxidase from neutrophils are required for protective immunity to Strongyloides stercoralis in mice. (United States)

    O'Connell, Amy E; Hess, Jessica A; Santiago, Gilberto A; Nolan, Thomas J; Lok, James B; Lee, James J; Abraham, David


    Eosinophils and neutrophils contribute to larval killing during the primary immune response, and neutrophils are effector cells in the secondary response to Strongyloides stercoralis in mice. The objective of this study was to determine the molecular mechanisms used by eosinophils and neutrophils to control infections with S. stercoralis. Using mice deficient in the eosinophil granule products major basic protein (MBP) and eosinophil peroxidase (EPO), it was determined that eosinophils kill the larvae through an MBP-dependent mechanism in the primary immune response if other effector cells are absent. Infecting PHIL mice, which are eosinophil deficient, with S. stercoralis resulted in development of primary and secondary immune responses that were similar to those of wild-type mice, suggesting that eosinophils are not an absolute requirement for larval killing or development of secondary immunity. Treating PHIL mice with a neutrophil-depleting antibody resulted in a significant impairment in larval killing. Naïve and immunized mice with neutrophils deficient in myeloperoxidase (MPO) infected with S. stercoralis had significantly decreased larval killing. It was concluded that there is redundancy in the primary immune response, with eosinophils killing the larvae through an MBP-dependent mechanism and neutrophils killing the worms through an MPO-dependent mechanism. Eosinophils are not required for the development or function of secondary immunity, but MPO from neutrophils is required for protective secondary immunity.

  2. Tanshinone IIA Protects against Dextran Sulfate Sodium- (DSS-) Induced Colitis in Mice by Modulation of Neutrophil Infiltration and Activation. (United States)

    Liu, Xiaowei; He, Haiyue; Huang, Tingting; Lei, Zhen; Liu, Fuquan; An, Guangyu; Wen, Tao


    Neutrophils play a critical role in the initiation and maintenance of intestinal inflammation. However, conventional neutrophil-targeted therapies can impair normal host defense. Tanshinone IIA has been recently revealed to act directly on neutrophils. Hence, we aimed at investigating whether Tanshinone IIA can protect against experimental colitis through modulation of neutrophils. We induced colitis in C57BL/6 mice by giving 3% dextran sulfate sodium (DSS) orally, and meanwhile, we treated mice daily with Tanshinone IIA intraperitoneally. The severity of colitis was evaluated by calculating disease activity index (DAI) and histological parameters. Neutrophil infiltration and activation in the colons of mice were measured. Moreover, whether Tanshinone IIA has direct effects on neutrophil migration and activation was determined in vitro. Our data showed that Tanshinone IIA significantly ameliorated the severity of DSS-induced colitis in mice, evidenced by the reduced DAI and improved colonic inflammation. In addition, Tanshinone IIA decreased neutrophil infiltration of intestinal mucosa and activation and reduced colonic inflammatory cytokines in DSS-treated mice. Furthermore, Tanshinone IIA was demonstrated to significantly suppress neutrophil migration and activation. These results provide compelling evidence that Tanshinone IIA has a therapeutic potential for alleviating inflammatory colitis in mice, which is possibly mediated by the immunomodulation of neutrophils.

  3. Vaccination with lentiviral vector expressing the nfa1 gene confers a protective immune response to mice infected with Naegleria fowleri. (United States)

    Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon


    Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection.

  4. Evaluation of protective potentials of a potentized homeopathic drug, Chelidonium majus, during azo dye induced hepatocarcinogenesis in mice. (United States)

    Biswas, Surjyo Jyoti; Khuda-Bukhsh, Anisur Rahman


    Several cytogenetical and enzymatic protocols were used to test if two microdoses of Chelidonium majus, namely Chelidonium-30 (Ch-30) and Chelidonium-200 (Ch-200), used as homeopathic drugs, showed anti-tumor activity and also favorably modulated genotoxic damages produced by an azo dye in mice at several intervals of fixation. Different sets of healthy mice were fed: (i) hepatocarcinogen, p-dimethylaminoazobenzene (p-DAB, initiator) + phenobarbital (PB, promoter), (ii) only p-DAB, (iii) only PB, and (iv) neither p-DAB nor PB (normal control). Mice fed with p-DAB + PB were divided into different sets that were also fed either Ch-30 (v) or Ch-200 (vi) or diluted alcohol (vii), the "vehicle" of the microdoses of Chelidonium. All mice of group (i), a few of group (ii) and group (vii) and none of groups (iii) and (iv) developed tumors in liver at the longer intervals of fixation. The frequencies of chromosome aberrations (CA), micronucleated erythrocytes (MN), mitotic index (MI) and sperm head abnormality (SHA) were much higher in groups (i) and (vii) mice than in groups (ii), (iii) and (iv) mice at all fixation intervals. However, in mice of both groups (v) and (vi), the frequencies of CA, MN, SHA were strikingly less than those of groups (i) and (vii), and moderately less than those of groups (ii) and (iii). Both Ch-30 and Ch-200 also modulated favourably some toxicity marker enzymes like acid and alkaline phosphatases, peroxidases, glutamate oxaloacetate and glutamate pyruvate transaminases in liver, kidney and spleen tissues of the carcinogen fed mice. The microdoses of Chelidonium having no visible ill effects of their own, may be strong candidates for use in delaying/protecting liver cancer.

  5. Enhancement of radiosensitivity by CpG-oligodeoxyribonucleotide-7909 in human non-small cell lung cancer A549 cells. (United States)

    Zha, Lin; Qiao, Tiankui; Yuan, Sujuan; Lei, Linjie


    CpG-oligodeoxyribonucleotides (CpG-ODNs), which induce signaling through the toll-like receptor 9, are currently under investigation as immunity stimulators against cancer. It has recently been suggested that CpG-ODNs may also enhance sensitivity to traditional therapies including chemotherapy in certain cancer-cell lines. The purpose of this study was to define the activity of CpG-ODN7909 in increasing radiosensitivity of the human non-small cell lung cancer cell line A549 in vitro. First, a dose- and time-dependent inhibitory effect on cell viability was observed after A549 cells were treated with different concentrations of CpG-ODN7909 (5, 10, 30, and 60 microg/mL). Second, decreased cell clonogenic survival, enhanced cell apoptotic index, accumulated percentage of cells in the G2/M phase, and increased tumor necrosis factor (TNF)-alpha secretion were found after combined treatments with 10 microg/mL of CpG-ODN7909 and radiation compared to either treatment alone (p CpG-ODN7909 can increase the radiosensitivity of human non-small cell lung cancer A549 cells, which may be associated with reduced cell clonogenic survival, enhanced apoptosis, prolonged cell-cycle arrest in G2/M, and stimulation of TNF-alpha secretion.

  6. CpG oligodeoxyribonucleotide 7909 enhances radiosensitivity via downregulating Oct-4 expression in radioresistant lung cancer cells. (United States)

    Xing, Na; Qiao, Tiankui; Zhuang, Xibing; Yuan, Sujuan; Zhang, Qi; Xu, Guoxiong


    Radiotherapy is a powerful cure for local advanced non-small cell lung cancer. However, radioresistance and tumor relapse still occur in a high proportion of patients. Octamer-4 (Oct-4), a transcription factor of the POU family, plays a key role in maintaining chemoradioresistant properties and regulating cancer progression. In this study, we demonstrated that Oct-4 expression was significantly increased in radioresistant H460 (H460R) cell line. CpG oligodeoxyribonucleotide (CpG-ODN) 7909 sensitized H460R cells when combined with irradiation treatment. The clonogenic capacity was significantly decreased, and the values of D0 and Dq were lower than those of irradiation alone group. The sensitive enhancement ratio (SER) of D0 was 1.224. This combined treatment led to a dramatic reduction in Oct-4 expression in a dose-dependent manner and also showed increased percentage of cells in the radiosensitive G2/M phase relative to either treatment alone. These results identified that Oct-4 was involved in radioresistance. CpG-ODN 7909 could enhance radiosensitivity partly through downregulating Oct-4 expression in radioresistant lung cancer cells.

  7. CpG oligodeoxyribonucleotide 7909 enhances radiosensitivity via downregulating Oct-4 expression in radioresistant lung cancer cells

    Directory of Open Access Journals (Sweden)

    Xing N


    Full Text Available Na Xing,1 Tiankui Qiao,1 Xibing Zhuang,1 Sujuan Yuan,1 Qi Zhang,1 Guoxiong Xu2 1Department of Oncology, 2Center Laboratory, Jinshan Hospital, Fudan University, Shanghai, People’s Republic of China Abstract: Radiotherapy is a powerful cure for local advanced non-small cell lung cancer. However, radioresistance and tumor relapse still occur in a high proportion of patients. Octamer-4 (Oct-4, a transcription factor of the POU family, plays a key role in maintaining chemoradioresistant properties and regulating cancer progression. In this study, we demonstrated that Oct-4 expression was significantly increased in radioresistant H460 (H460R cell line. CpG oligodeoxyribonucleotide (CpG-ODN 7909 sensitized H460R cells when combined with irradiation treatment. The clonogenic capacity was significantly decreased, and the values of D0 and Dq were lower than those of irradiation alone group. The sensitive enhancement ratio (SER of D0 was 1.224. This combined treatment led to a dramatic reduction in Oct-4 expression in a dose-dependent manner and also showed increased percentage of cells in the radiosensitive G2/M phase relative to either treatment alone. These results identified that Oct-4 was involved in radioresistance. CpG-ODN 7909 could enhance radiosensitivity partly through downregulating Oct-4 expression in radioresistant lung cancer cells. Keywords: CpG-ODN, Oct-4, lung cancer, TLR9, radiosensitivity

  8. Different immunological mechanisms govern protection from experimental stroke in young and older mice with recombinant TCR ligand therapy

    Directory of Open Access Journals (Sweden)



    Full Text Available Stroke is a leading cause of death and disability in the United States. The lack of clinical success in stroke therapies can be attributed, in part, to inadequate basic research on aging rodents. The current study demonstrates that recombinant TCR ligand therapy uses different immunological mechanisms to protect young and older mice from experimental stroke. In young mice, RTL1000 therapy inhibited splenocyte efflux while reducing frequency of T cells and macrophages in the spleen. Older mice treated with RTL1000 exhibited a significant reduction in inflammatory cells in the brain and inhibition of splenic atrophy. Our data suggest age specific differences in immune response to stroke that allow unique targeting of stroke immunotherapies.

  9. Evaluation in mice of the immunogenicity and protective efficacy of a tetravalent subunit vaccine candidate against dengue virus. (United States)

    Lazo, Laura; Izquierdo, Alienys; Suzarte, Edith; Gil, Lázaro; Valdés, Iris; Marcos, Ernesto; Álvarez, Mayling; Romero, Yaremis; Guzmán, María Guadalupe; Guillén, Gerardo; Hermida Cruz, Lisset


    A dengue vaccine must induce protective immunity against the four serotypes of the virus. Our group has developed chimeric proteins consisting of the protein P64k from Neisseria meningitidis and the domain III from the four viral envelope proteins. In this study, the immunogenicity of a tetravalent vaccine formulation using aluminum hydroxide as adjuvant was evaluated in mice. After three doses, neutralizing antibody titers were detected against the four viral serotypes, the lowest seroconversion rate being against dengue virus serotype 4. One month after the last dose, immunized animals were challenged with infective virus, and partial but statistically significant protection was found to have been achieved. Based on these results, further studies in mice and non-human primates using this tetravalent formulation in a prime-boost strategy with attenuated viruses are strongly recommended.

  10. Protective immunity against Naegleria fowleri infection on mice immunized with the rNfa1 protein using mucosal adjuvants. (United States)

    Lee, Jinyoung; Yoo, Jong-Kyun; Sohn, Hae-Jin; Kang, Hee-kyoung; Kim, Daesik; Shin, Ho-Joon; Kim, Jong-Hyun


    The free-living amoeba, Naegleria fowleri, causes a fatal disease called primary amoebic meningoencephalitis (PAM) in humans and experimental animals. Of the pathogenic mechanism of N. fowleri concerning host tissue invasion, the adherence of amoeba to hose cells is the most important. We previously cloned the nfa1 gene from N. fowleri. The protein displayed immunolocalization in the pseudopodia, especially the food-cups structure, and was related to the contact-dependent mechanism of the amoebic pathogenicity in N. fowleri infection. The cholera toxin B subunit (CTB) and Escherichia coli heat-labile enterotoxin B subunit (LTB) have been used as potent mucosal adjuvants via the parenteral route of immunization in most cases. In this study, to examine the effect of protective immunity of the Nfa1 protein for N. fowleri infection with enhancement by CTB or LTB adjuvants, intranasally immunized BALB/c mice were infected with N. fowleri trophozoites for the development of PAM. The mean time to death of mice immunized with the Nfa1 protein using LTB or CTB adjuvant was prolonged by 5 or 8 days in comparison with that of the control mice. In particular, the survival rate of mice immunized with Nfa1 plus CTB was 100% during the experimental period. The serum IgG levels were significantly increased in mice immunized with Nfa1 protein plus CTB or LTB adjuvants. These results suggest that the Nfa1 protein, with CTB or LTB adjuvants, induces strong protective immunity in mice with PAM due to N. fowleri infection.

  11. Shikonin derivatives protect immune organs from damage and promote immune responses in vivo in tumour-bearing mice. (United States)

    Long, Su; GuangZhi, Yan; BaoJie, Guan; Wei, Xu; YanYong, Hao; YingLi, Wang; Yang, Zhang; LiHua, Liu


    Shikonin, a major component of Lithospermum erythrorhizon and Arnebia euchroma, exhibits antiinflammatory, immunomodulatory and antitumour activities. Although many recent studies have focused on the antitumour effects of shikonin, the exact mechanisms underlying its antitumour and immunomodulatory effects in tumour-bearing mice remain unclear. The aim of the present study was to investigate the antitumour and immunomodulatory effects of shikonin derivatives (ShD) in tumour-bearing mice. Swiss mice inoculated with hepatoma HepA(22) or sarcoma 180 (S(180)) cells were treated with ShD or 5-fluorouracil (5Fu). Survival time, immune organs, natural killer cell activity, lymphocytes, lymphocyte transformation and interleukin (IL)-2 production were analysed. ShD significantly prolonged the survival (median survival time prolonged by >7 days) of tumour-bearing mice in a dose-dependent manner, inhibited the growth of transplantable neoplasms (inhibitory rate, > 33%), and recovered (at [ShD] = 2.5 mg/kg/day) or increased (at [ShD] > 5 mg/kg/day) the number of CD3- and CD19-positive cells. ShD also played a role in protecting the immune organs from damage and reversed or enhanced immune responses, as noted by the nearly normal thymic structure; enlarged splenic corpuscles; and improved natural killer cell activity, lymphocyte transformation and IL-2 production in ShD-treated mice. ShD reduced the tumour load of tumour-bearing mice and protected the immune organs against tumour-induced damage and immune function impairment. Copyright © 2011 John Wiley & Sons, Ltd.

  12. A native outer membrane vesicle vaccine confers protection against meningococcal colonization in human CEACAM1 transgenic mice. (United States)

    Pajon, Rolando; Buckwalter, Carolyn M; Johswich, Kay O; Gray-Owen, Scott D; Granoff, Dan M


    The effect of protein-based meningococcal vaccines on prevention of nasopharyngeal colonization has been difficult to investigate experimentally because a reliable animal colonization model did not exist. Human CEACAM1 transgenic mice, which can be colonized by meningococci, were immunized IP with one of two meningococcal native outer membrane vesicle (NOMV) vaccines prepared from mutants with attenuated endotoxin (lpxL1 knockout) and over-expressed sub-family B Factor H-binding proteins (FHbp). Animals were challenged intranasally two weeks after the third dose with wild-type strain H44/76, or were treated IP with anti-NOMV serum before and during the bacterial challenge. The NOMV-1 vaccine, prepared from the serogroup B H44/76 mutant, elicited ∼40-fold higher serum bactericidal antibody titers against the wild-type H44/76 challenge strain than the NOMV-2 vaccine prepared from a heterologous serogroup W mutant strain with different PorA and FHbp amino acid sequence variants. Compared to aluminum hydroxide-immunized control mice, the efficacy for prevention of any H44/76 colonization was 93% (95% confidence interval, 52-99, P<0.0001) for the NOMV-1 vaccine, and 19% (-3-36, P=0.23) for NOMV-2. NOMV-2-vaccinated mice had a 5.6-fold decrease in geometric mean CFU of bacteria per animal in tracheal washes compared to control mice (P=0.007). The efficacy of passive administration of serum from NOMV-1-vaccinated mice to immunologically naïve mice against colonization was 44% (17-61; P=0.002). Both NOMV vaccines protected against meningococcal colonization but there was greater protection by the NOMV-1 vaccine with antigens matched with the challenge strain. Meningococcal vaccines that target protein antigens have potential to decrease colonization. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Targeted deletion of Kif18a protects from colitis-associated colorectal (CAC) tumors in mice through impairing Akt phosphorylation

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Houbao [State Key Laboratory of Medical Genomics, Research Center for Experimental Medicine, Rui-Jin Hospital and Department of Medical Genetics, E-Institutes of Shanghai Universities, Shanghai Jiao Tong University School of Medicine (SJTUSM), Shanghai 200025 (China); Xu, Wangyang [Department of Clinical Laboratories, Ninth People’s Hospital, SJTUSM, Shanghai 200011 (China); Zhang, Hongxin [State Key Laboratory of Medical Genomics, Research Center for Experimental Medicine, Rui-Jin Hospital and Department of Medical Genetics, E-Institutes of Shanghai Universities, Shanghai Jiao Tong University School of Medicine (SJTUSM), Shanghai 200025 (China); Liu, Jianbing [State Key Laboratory of Medical Genomics, Research Center for Experimental Medicine, Rui-Jin Hospital and Department of Medical Genetics, E-Institutes of Shanghai Universities, Shanghai Jiao Tong University School of Medicine (SJTUSM), Shanghai 200025 (China); Shanghai Research Center for Model Organisms, Shanghai 201203 (China); Xu, Haimin [Department of Pathology, Rui-Jin Hospital, SJTUSM, Shanghai 200025 (China); Lu, Shunyuan; Dang, Suying [State Key Laboratory of Medical Genomics, Research Center for Experimental Medicine, Rui-Jin Hospital and Department of Medical Genetics, E-Institutes of Shanghai Universities, Shanghai Jiao Tong University School of Medicine (SJTUSM), Shanghai 200025 (China); Kuang, Ying [Shanghai Research Center for Model Organisms, Shanghai 201203 (China); Jin, Xiaolong [Department of Pathology, Rui-Jin Hospital, SJTUSM, Shanghai 200025 (China); Wang, Zhugang, E-mail: [State Key Laboratory of Medical Genomics, Research Center for Experimental Medicine, Rui-Jin Hospital and Department of Medical Genetics, E-Institutes of Shanghai Universities, Shanghai Jiao Tong University School of Medicine (SJTUSM), Shanghai 200025 (China); Shanghai Research Center for Model Organisms, Shanghai 201203 (China)


    Highlights: •Kif18A is up-regulated in CAC of mouse model. •Kif18a{sup −/−} mice are protected from CAC. •Tumor cells from Kif18a{sup −/−} mice undergo more apoptosis. •Kif18A deficiency induces poor Atk phosphorylation. -- Abstract: Kinesins are a superfamily of molecular motors involved in cell division or intracellular transport. They are becoming important targets for chemotherapeutic intervention of cancer due to their crucial role in mitosis. Here, we demonstrate that the kinesin-8 Kif18a is overexpressed in murine CAC and is a crucial promoter during early CAC carcinogenesis. Kif18a-deficient mice are evidently protected from AOM–DSS-induced colon carcinogenesis. Kif18A is responsible for proliferation of colonic tumor cells, while Kif18a ablation in mice promotes cell apoptosis. Mechanistically, Kif18a is responsible for induction of Akt phosphorylation, which is known to be associated with cell survival regulation. In conclusion, Kif18a is critical for colorectal carcinogenesis in the setting of inflammation by mechanisms of increased PI3K-AKT signaling. Inhibition of Kif18A activity may be useful in the prevention or chemotherapeutic intervention of CAC.

  14. Increased production of omega-3 fatty acids protects retinal ganglion cells after optic nerve injury in mice. (United States)

    Peng, Shanshan; Shi, Zhe; Su, Huanxing; So, Kwok-Fai; Cui, Qi


    Injury to the central nervous system causes progressive degeneration of injured axons, leading to loss of the neuronal bodies. Neuronal survival after injury is a prerequisite for successful regeneration of injured axons. In this study, we investigated the effects of increased production of omega-3 fatty acids and elevation of cAMP on retinal ganglion cell (RGC) survival and axonal regeneration after optic nerve (ON) crush injury in adult mice. We found that increased production of omega-3 fatty acids in mice enhanced RGC survival, but not axonal regeneration, over a period of 3 weeks after ON injury. cAMP elevation promoted RGC survival in wild type mice, but no significant difference in cell survival was seen in mice over-producing omega-3 fatty acids and receiving intravitreal injections of CPT-cAMP, suggesting that cAMP elevation protects RGCs after injury but does not potentiate the actions of the omega-3 fatty acids. The observed omega-3 fatty acid-mediated neuroprotection is likely achieved partially through ERK1/2 signaling as inhibition of this pathway by PD98059 hindered, but did not completely block, RGC protection. Our study thus enhances our current understanding of neural repair after CNS injury, including the visual system.

  15. Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice

    Directory of Open Access Journals (Sweden)

    Shih-Yin Tsai


    Full Text Available Obesity is a major risk factor driving the global type II diabetes pandemic. However, the molecular factors linking obesity to disease remain to be elucidated. Gender differences are apparent in humans and are also observed in murine models. Here, we link these differences to expression of eukaryotic translation initiation factor 4E binding protein 1 (4E-BP1, which, upon HFD feeding, becomes significantly reduced in the skeletal muscle and adipose tissue of male but not female mice. Strikingly, restoring 4E-BP1 expression in male mice protects them against HFD-induced obesity and insulin resistance. Male 4E-BP1 transgenic mice also exhibit reduced white adipose tissue accumulation accompanied by decreased circulating levels of leptin and triglycerides. Importantly, transgenic 4E-BP1 male mice are also protected from aging-induced obesity and metabolic decline on a normal diet. These results demonstrate that 4E-BP1 is a gender-specific suppressor of obesity that regulates insulin sensitivity and energy metabolism.

  16. Anti-Diabetic and Hepato-Renal Protective Effects of Ziyuglycoside II Methyl Ester in Type 2 Diabetic Mice

    Directory of Open Access Journals (Sweden)

    Dong Ju Son


    Full Text Available Type 2 diabetes is a metabolic disorder caused by abnormal carbohydrate metabolism, and closely associated with abnormal lipid metabolism and hepato-renal dysfunction. This study investigated the anti-diabetic and hepato-renal protective properties of ziyuglycoside I (ZG01 derivative on type 2 diabetes. ZG01 was isolated from roots of Sanguisorba officinalis and chemically modified by deglycosylation and esterification to obtained ziyuglycoside II methyl ester (ZG02-ME. Here, we showed that ZG02-ME has stronger anti-diabetic activity than the original compound (ZG01 through decreasing blood glucose, glycated hemoglobin (HbA1c, and insulin levels in a mouse model of type 2 diabetes (db/db mice. We further found that ZG02-ME treatment effectively ameliorated serum insulin, leptin and C-peptide levels, which are key metabolic hormones, in db/db mice. In addition, we showed that elevated basal blood lipid levels were decreased by ZG02-ME treatment in db/db mice. Furthermore, treatment of ZG02-ME significantly decreased serum AST, ALT, BUN, creatinine, and liver lipid peroxidation in db/db mice. These results demonstrated that compared to ZG01, chemically modified ZG02-ME possess improved anti-diabetic properties, and has hepato-renal protective activities in type 2 diabetes.



    M. Keshavarzi; Z.M. Hassan


    In this study, a crude leishmanial antigen, was prepared by sonicating Leishmania major promastigotes used to induce immunity in BALB/c mice against cutaneous leishmaniasis. Correlation between the route of antigen injection and the efficacy of induced protection was examined. To enhance the effectiveness of the antigen, an immunostimulant drug, daraprim (pyrimethamine), was administered simultaneously with the antigen. The experiment demonstrated that simultaneous intraperitoneal injection o...

  18. Luteolin protects mice from severe acute pancreatitis by exerting HO-1-mediated anti-inflammatory and antioxidant effects (United States)

    Xiong, Jie; Wang, Kezhou; Yuan, Chunxiao; Xing, Rong; Ni, Jianbo; Hu, Guoyong; Chen, Fengling; Wang, Xingpeng


    Reseda odorata L. has long been used in traditional Asian medicine for the treatment of diseases associated with oxidative injury and acute inflammation, such as endotoxemia, acute lung injury, acute myocardial infarction and hepatitis. Luteolin, the main component of Reseda odorata L., which is also widely found in many natural herbs and vege tables, has been shown to induce heme oxygenase-1 (HO-1) expression to exert anti-inflammatory and antioxidant effects. In this study, we aimed to examine the effects of luteolin on mice with severe acute pancreatitis (SAP), and to explore the underlying mechanisms. Cerulein and lipopolysaccharide were used to induce SAP in male Institute of Cancer Research (ICR) mice in the SAP group. The SAP group was divided into 4 subgroups, as follows: the vehicle, luteolin, zinc protoporphyrin (ZnPP) only, and luteolin (Lut) + ZnPP (luteolin plus zinc protoporphyrin treatment) groups. The wet/dry weight ratios, hematoxylin and eosin staining and pathological scores of pancreatic tissues were assessed and compared to those of the control mice. Amylase, lipase, nuclear factor-κB (NF-κB) and myeloperoxidase activities, and malondialdehyde, tumor necrosis factor α (TNFα), interleukin (IL)-6, IL-10 and HO-1 levels, as well as the expression of HO-1 were determined in serum and/or pancreatic tissue samples. SAP was successfully induced in male mice compared to normal control mice. The wet/dry weight ratios, pathological scores, and amylase and lipase activity, as well as the levels of TNFα and IL-6 were significantly reduced in the pancreatic tissues of the mice in the Lut group compared with those of the mice in the vehicle group. The Lut group exhibited a significant increase in HO-1 expression in the pancreas and enhanced serum HO-1 and IL-10 levels compared with the vehicle group. The suppression of HO-1 activity in the ZnPP group significantly abolished the protective effects of luteolin. NF-κB expression in the pancreatic tissues

  19. Roles of nitric oxide in protective effect of berberine in ethanol-induced gastric ulcer mice

    Institute of Scientific and Technical Information of China (English)

    Long-rui PAN; Qiang TANG; Qin FU; Ben-rong HU; Ji-zhou XIANG; Jia-qing QIAN


    Aim: To investigate the protective effects of berberine on ethanol-induced gastric ulcer in mice. Methods: Gastric ulcers were induced by oral ingestion of ethanol. Nitric oxide (NO) content was measured, and mRNA expression of endothelial nitric oxide synthase (eNOS) and inducible nitric oxide synthase (iNOS)were analyzed by reverse transcription-polymerase chain reaction (RT-PCR).Results: The ulcer index (UI) at 1 h, 2 h, 3 h and 6 h after oral administration of ethanol was 23.8± 1.4, 23.3±2.2, 22.3± 1.2 and 20.8± 1.1, respectively. The UI in the berberine-treated groups (5 mg/kg and 50 mg/kg) was less than the control group.The content of NO in the control group was 73.3±7.3 μL/L, 94.0±9.2 μL/L, 109.6±6.4 μL/L and 138.2±10.2 μL/L in gastric juice and 5.8± 1.1 μmol/g protein, 8.3±1.1 μmol/g protein, 9.8± 1.1 μmol/g protein and 11.9± 1.2 μmol/g protein in gastric tissue at 1 h, 2 h, 3 h and 6 h, respectively, after the oral administration of ethanol.The content of NO in the berberine-treated groups (5 mg/kg and 50 mg/kg) was higher than the control group at 1 h after the oral administration of ethanol(P<0.05), and was lower at 6 h (P<0.05). Analysis by RT-PCR showed that expression of eNOS was inhibited but iNOS expression was enhanced by ethanol.However, the expression of eNOS could be enhanced and iNOS expression could be inhibited by berberine (P<0.01). Conclusion: Berberine could significantly protect gastric mucosa from damage by ethanol. This effect may be related to the increased expression of eNOS mRNA and inhibited expression of iNOS mRNA.

  20. Maternal Antibiotic Treatment Protects Offspring from Diabetes Development in Nonobese Diabetic Mice by Generation of Tolerogenic APCs. (United States)

    Hu, Youjia; Peng, Jian; Tai, Ningwen; Hu, Changyun; Zhang, Xiaojun; Wong, F Susan; Wen, Li


    Type 1 diabetes (T1D) is a T cell-mediated autoimmune disease that involves the slow, progressive destruction of islet β cells and loss of insulin production, as a result of interaction with environmental factors, in genetically susceptible individuals. The gut microbiome is established very early in life. Commensal microbiota establish mutualism with the host and form an important part of the environment to which individuals are exposed in the gut, providing nutrients and shaping immune responses. In this study, we studied the impact of targeting most Gram-negative bacteria in the gut of NOD mice at different time points in their life, using a combination of three antibiotics--neomycin, polymyxin B, and streptomycin--on diabetes development. We found that the prenatal period is a critical time for shaping the immune tolerance in the progeny, influencing development of autoimmune diabetes. Prenatal neomycin, polymyxin B, and streptomycin treatment protected NOD mice from diabetes development through alterations in the gut microbiota, as well as induction of tolerogenic APCs, which led to reduced activation of diabetogenic CD8 T cells. Most importantly, we found that the protective effect was age dependent, and the most profound protection was found when the mice were treated before birth. This indicates the importance of the prenatal environment and early exposure to commensal bacteria in shaping the host immune system and health.

  1. The Protective Effect of Ascorbic Acid and Thiamine Supplementation against Damage Caused by Lead in the Testes of Mice

    Institute of Scientific and Technical Information of China (English)

    Guang SHAN; Tian TANG; Xiaobin ZHANG


    Lead is a ubiquitous environmental and industrial pollutant that may have toxic effects on the male.Vitamins may protect against toxic effects of lead in the liver and reproductive system,which is confirmed by our initial research.The aim of this study was to further investigate the protec-tive effects of vitamins (ascorbic acid combined with thiamine) on lead acetate (Pb)-induced repro-ductive toxicities in mice and study the possible mechanisms underlying these effects.Forty-five male mice were randomly divided into 3 groups,15 mice in each and received daily intragastric ad-ministration with control,Pb (20 mg/kg),and Pb+vitamins (ascorbic acid of 420 mg/kg+thiamine of 30 mg/kg) for 6 weeks,respectively.The Pb-treated animals showed significant decreases in the epididymal sperm count and motility compared to the control group,while the Pb+vitamins group had significant increases for these variables.Moreover,an increasing apoptosis of germinal cells in-duced by Pb was reduced by vitamin treatment.Pb induced the activation of Caspase-3,Fas/Fas-L and Bcl-2 with elevated levels,and the adaptor protein primarily regulated signaling through Fas and required for Fas-induced apoptosis.In conclusion,ascorbic acid combined with thiamine exhibited protective effect on reproductive system by inhibiting Pb-induced excessive cell apoptosis.

  2. Protective effect of porphyran isolated from discolored nori (Porphyra yezoensis) on lipopolysaccharide-induced endotoxin shock in mice. (United States)

    Nishiguchi, Tomoki; Cho, Kichul; Isaka, Shogo; Ueno, Mikinori; Jin, Jun-O; Yamaguchi, Kenichi; Kim, Daekyung; Oda, Tatsuya


    Porphyran, a sulfated polysaccharide, isolated from discolored nori (Porphyra yezoensis) (dc-porphyran) and one fraction (F1) purified from dc-porphyran by DEAE-chromatography showed the protective effects on LPS-induced endotoxin shock in mice. Intraperitoneal (i.p.) treatment with dc-porphyran or F1 (100mg/kg) 60min prior to i.p. injection of LPS (30mg/kg) completely protected mice from LPS lethality. At 10mg/kg concentration, F1 demonstrated more protection than dc-porphyran. Intravenous (i.v.) challenge of LPS, even at 20mg/kg, was more lethal than i.p. administration; i.v. injection of F1 (100mg/kg) with LPS significantly improved the survival rate. However, i.v. dc-porphyran (100mg/kg) produced an even lower survival rate than that of LPS alone. We examined pro-inflammatory mediators such as NO and TNF-α in serum. F1 significantly reduced the levels of these markers. Additionally, F1 significantly decreased the malondialdehyde level in the liver, a marker of oxidative stress, while dc-porphyran had almost no effect. Furthermore, F1 significantly decreased the production of TNF-α and NO in peritoneal exudate cells harvested from LPS-challenged mice, while dc-porphyran treatment showed a lesser decrease. Our results suggest that porphyran isolated from discolored nori, especially F1, is capable of suppressing LPS-induced endotoxin shock in vivo.

  3. Acacetin Protects Mice from Staphylococcus aureus Bloodstream Infection by Inhibiting the Activity of Sortase A. (United States)

    Bi, Chongwei; Dong, Xiaoyun; Zhong, Xiaobo; Cai, Hongjun; Wang, Dacheng; Wang, Lin


    Staphylococcus aureus (S. aureus) is a major cause of infection in hospitals and communities. Widespread dissemination of multi-drug resistant S. aureus is a serious threat to the health of humans and animals. An anti-virulence strategy has been widely considered as an alternative therapeutic approach. Inhibitors of virulence factors are able to treat S. aureus infections without influencing the growth or viability of bacteria and rarely lead to bacterial resistance. Sortase A (SrtA) is a membrane-associated cysteine transpeptidase that catalyzes up to 25 surface proteins that covalently bind to cell wall peptidoglycans. In S. aureus, most of these surface proteins have been identified as important virulence factors that are vital in bacterial pathogenesis. In the present study, we show that acacetin, a natural flavonoid compound, inhibits the activity of SrtA in S. aureus (IC50 = 36.46 ± 4.69 μg/mL, 128 μM) which affects the assembly of protein A (SpA) to cell walls and reduces the binding of S. aureus to fibrinogen (Fg). The mechanism of the interaction between acacetin and SrtA were preliminarily discussed using molecular dynamics simulations. The results suggested that acacetin adopted a compact conformation binding at the pocket of the SrtA via residues Arg-139 and Lys-140. By performing an animal infection model, we demonstrated that acacetin was able to protect mice from renal abscess formation induced by S. aureus and significantly increased survival rates. Taken together, these findings suggest that acacetin may be a promising candidate for the development of anti-S. aureus drugs.

  4. Protective effect of polyphenols in an inflammatory process associated with experimental pulmonary fibrosis in mice. (United States)

    Impellizzeri, Daniela; Talero, Elena; Siracusa, Rosalba; Alcaide, Antonio; Cordaro, Marika; Maria Zubelia, Jose; Bruschetta, Giuseppe; Crupi, Rosalia; Esposito, Emanuela; Cuzzocrea, Salvatore; Motilva, Virginia


    Polyphenols have been described to have a wide range of biological activities, and many reports, published during recent years, have highlighted the beneficial effects of phenolic compounds, illustrating their promising role as therapeutic tools in several acute and chronic disorders. The purpose of study was to evaluate, in an already-assessed model of lung injury caused by bleomycin (BLM) administration, the role of resveratrol and quercetin, as well as to explore the potential beneficial properties of a mango leaf extract, rich in mangiferin, and a grape leaf extract, rich in dihydroquercetin (DHQ), on the same model. Mice were subjected to intra-tracheal administration of BLM, and polyphenols were administered by oral route immediately after BLM instillation and daily for 7 d. Treatment with resveratrol, mangiferin, quercetin and DHQ inhibited oedema formation and body weight loss, as well as ameliorated polymorphonuclear infiltration into the lung tissue and reduced the number of inflammatory cells in bronchoalveolar lavage fluid. Moreover, polyphenols suppressed inducible nitric oxide synthase expression, and prevented oxidative and nitroxidative lung injury, as shown by the reduced nitrotyrosine and poly (ADP-ribose) polymerase levels. The degree of apoptosis, as evaluated by Bid and Bcl-2 balance, was also suppressed after polyphenol treatment. Finally, these natural products down-regulated cyclo-oxygenase-2, extracellular signal-regulated kinase phosphorylated expression and reduced NF-κBp65 translocation. Our findings confirmed the anti-inflammatory effects of resveratrol and quercetin in BLM-induced lung damage, and highlight, for the first time, the protective properties of exogenous administration of mangiferin and DHQ on experimental pulmonary fibrosis.

  5. Dietary Fisetin Supplementation Protects Against Alcohol-Induced Liver Injury in Mice. (United States)

    Sun, Qian; Zhang, Wenliang; Zhong, Wei; Sun, Xinguo; Zhou, Zhanxiang


    Overproduction of reactive oxygen species is associated with the development of alcoholic liver disease (ALD). Plant polyphenols have been used as dietary interventions for multiple diseases including ALD. The objective of this study was to determine whether dietary supplementation with fisetin, a novel flavonoid, exerts beneficial effect on alcohol-induced liver injury. C57BL/6J mice were pair-fed with the Lieber-DeCarli control or ethanol (EtOH) diet for 4 weeks with or without fisetin supplementation at 10 mg/kg/d. Alcohol feeding induced lipid accumulation in the liver and increased plasma alanine aminotransferase and aspartate aminotransferase activities, which were attenuated by fisetin supplementation. The EtOH concentrations in the plasma and liver were significantly elevated by alcohol exposure but were reduced by fisetin supplementation. Although fisetin did not affect the protein expression of alcohol metabolism enzymes, the aldehyde dehydrogenase activities were significantly increased by fisetin compared to the alcohol alone group. In addition, fisetin supplementation remarkably reduced hepatic NADPH oxidase 4 levels along with decreased plasma hydrogen peroxide and hepatic superoxide and 4-hydroxynonenal levels after alcohol exposure. Alcohol-induced apoptosis and up-regulation of Fas and cleaved caspase-3 in the liver were prevented by fisetin. Moreover, fisetin supplementation attenuated alcohol-induced hepatic steatosis through increasing plasma adiponectin levels and hepatic protein levels of p-AMPK, ACOX1, CYP4A, and MTTP. This study demonstrated that the protective effect of fisetin on ALD is achieved by accelerating EtOH clearance and inhibition of oxidative stress. The data suggest that fisetin has a therapeutical potential for treating ALD. Copyright © 2016 by the Research Society on Alcoholism.

  6. Protection against Naegleria fowleri infection in mice immunized with Cry1Ac plus amoebic lysates is dependent on the STAT6 Th2 response. (United States)

    Carrasco-Yepez, M; Rojas-Hernandez, S; Rodriguez-Monroy, M A; Terrazas, L I; Moreno-Fierros, L


    We previously reported that intranasal administration of Cry1Ac protoxin alone or in combination with amoebic lysates increases protection against Naegleria fowleri meningoencephalitis in mice. Those results suggested that both antibody responses and innate immune mechanisms may be participating in the protective effects observed. The present study was aimed to investigate whether the STAT6-induced Th2 immune response is essential for the resistance to N. fowleri infection, conferred by immunization with amoebic lysates plus Cry1Ac. STAT6-deficient (STAT6-/-) and wild-type (STAT6+/+) BALB/c mice were immunized by the intranasal route with a combination of N. fowleri lysates plus Cry1Ac, and subsequently challenged with lethal doses of N. fowleri trophozoites. STAT6+/+ mice displayed 100% protection, while no protection was observed in STAT6-/- mice. Significantly higher titres of Th2-associated IgG1 as well as interleukin-4 (IL-4) were found in STAT6+/+ mice, whereas in STAT6-/- mice significantly more IL-12 and IFN-gamma as well as significantly higher titres of Th1-associated IgG2a were detected. Thus, whereas protected STAT6+/+-immunized mice elicited a Th-2 type inclined immune response that produced predominantly humoral immunity, unprotected STAT6-/- mice exhibited a polarized Th1 type cellular response. These findings suggest that the STAT6-signalling pathway is critical for defence against N. fowleri infection.

  7. Protective Effects of Overexpression of bcl-xl Gene on Local Cerebral Infarction in Transgenic Mice Undergoing Permanent Occlusion of Middle Cerebral Artery

    Institute of Scientific and Technical Information of China (English)

    Furong WANG; Yongsheng JIANG; Suming ZHANG; Wenwu XIAO; Suiqiang ZHU


    In order to investigate the protective effects of the overexpression of bcl-xl gene on local cerebral infarction in the transgenic mice subject to permanent occlusion of middle cerebral artery, the models of bcl-xl transgenic mice were established and subjected to cerebral infarction by intralu- minal occlusion of the middle cerebral artery. The infarct volume and the neurological scores were observed and comparison between the wild type mice and the transgenic mice was made. It was found that the infarct volume and the neurological scores in the transgenic mice were significantly decreased as compared with those in the wild type mice. It was suggested that the overexpression of bcl-xl gene in transgenic mice could reduce the infarct volume and improve the neurological function of the mice.

  8. CCR5 plays a critical role in the development of myocarditis and host protection in mice infected with Trypanosoma cruzi. (United States)

    Machado, Fabiana S; Koyama, Natalia S; Carregaro, Vanessa; Ferreira, Beatriz R; Milanezi, Cristiane M; Teixeira, Mauro M; Rossi, Marcos A; Silva, João S


    The pathogenesis of myocarditis during Trypanosoma cruzi infection is poorly understood. We investigated the role played by chemokine receptor 5 (CCR5) in the influx of T cells to the cardiac tissue of T. cruzi-infected mice. mRNA and protein for the CCR5 ligands CCL3, CCL4, and CCL5 were detected in the hearts of infected mice in association with CD4+ and CD8+ T cells. There was a high level of CCR5 expression on CD8+ T cells in the hearts of infected mice. Moreover, CCR5 expression on CD8+ T cells was positively modulated by T. cruzi infection. CCR5-deficient mice infected with T. cruzi experienced a dramatically inhibited migration of T cells to the heart and were also more susceptible to infection. These results suggest that CCR5 and its ligands play a central role in the control of T cell influx in T. cruzi-infected mice. Knowledge of the mechanisms that trigger and control the migration of cells to the heart in patients with Chagas disease may help in the design of drugs that prevent myocarditis and protect against the development of severe disease.

  9. Renal Protective Effect of Xiao-Chai-Hu-Tang on Diabetic Nephropathy of Type 1-Diabetic Mice

    Directory of Open Access Journals (Sweden)

    Chun-Ching Lin


    Full Text Available Xiao-Chai-Hu-Tang (XCHT, a traditional Chinese medicine formula consisting of seven medicinal plants, is used in the treatment of various diseases. We show here that XCHT could protect type-1 diabetic mice against diabetic nephropathy, using streptozotocin (STZ-induced diabetic mice and high-glucose (HG-exposed rat mesangial cell (RMC as models. Following 4 weeks of oral administration with XCHT, renal functions and renal hypertrophy significantly improved in the STZ-diabetic mice, while serum glucose was only moderately reduced compared to vehicle treatment. Treatment with XCHT in the STZ-diabetic mice and HG-exposed RMC resulted in a decrease in expression levels of TGF-β1, fibronectin, and collagen IV, with concomitant increase in BMP-7 expression. Data from DPPH assay, DHE stain, and CM-H2DCFDA analysis indicated that XCHT could scavenge free radicals and inhibit high-glucose-induced ROS in RMCs. Taken together, these results suggest that treatment with XCHT can improve renal functions in STZ-diabetic mice, an effect that is potentially mediated through decreasing oxidative stress and production of TGF-β1, fibronectin, and collagen IV in the kidney during development of diabetic nephropathy. XCHT, therefore merits further investigation for application to improve renal functions in diabetic disorders.

  10. A recombinant DNA vaccine protects mice deficient in the alpha/beta interferon receptor against lethal challenge with Usutu virus. (United States)

    Martín-Acebes, Miguel A; Blázquez, Ana-Belén; Cañas-Arranz, Rodrigo; Vázquez-Calvo, Ángela; Merino-Ramos, Teresa; Escribano-Romero, Estela; Sobrino, Francisco; Saiz, Juan-Carlos


    Usutu virus (USUV) is a mosquito-borne flavivirus whose circulation had been confined to Africa since it was first detected in 1959. However, in the last decade USUV has emerged in Europe causing episodes of avian mortality and sporadic severe neuroinvasive infections in humans. Remarkably, adult laboratory mice exhibit limited susceptibility to USUV infection, which has impaired the analysis of the immune responses, thus complicating the evaluation of virus-host interactions and of vaccine candidates against this pathogen. In this work, we showed that mice deficient in the alpha/beta interferon receptor (IFNAR (-/-) mice) were highly susceptible to USUV infection and provided a lethal challenge model for vaccine testing. To validate this infection model, a plasmid DNA vaccine candidate encoding the precursor of membrane (prM) and envelope (E) proteins of USUV was engineered. Transfection of cultured cells with this plasmid resulted in expression of USUV antigens and the assembly and secretion of small virus-like particles also known as recombinant subviral particles (RSPs). A single intramuscular immunization with this plasmid was sufficient to elicit a significant level of protection against challenge with USUV in IFNAR (-/-) mice. The characterization of the humoral response induced revealed that DNA vaccination primed anti-USUV antibodies, including neutralizing antibodies. Overall, these results probe the suitability of IFNAR (-/-) mice as an amenable small animal model for the study of USUV host virus interactions and vaccine testing, as well as the feasibility of DNA-based vaccine strategies for the control of this pathogen.

  11. Protective effects of Lactobacillus rhamnosus GG against dyslipidemia in high-fat diet-induced obese mice. (United States)

    Kim, Bobae; Park, Kun-Young; Ji, Yosep; Park, Soyoung; Holzapfel, Wilhelm; Hyun, Chang-Kee


    Recent reports suggest that gut microbiota can be a major determinant of dyslipidemia and non-alcoholic fatty liver disease (NAFLD) and its modulation by treating probiotics is a valid strategy to exert a protective effect. In this study, high-fat diet (HFD)-fed mice were orally administrated with Lactobacillus rhamnosus GG (LGG) for 13 weeks. Significant reductions in the weights of the liver, mesenteric and subcutaneous adipose tissues were observed in LGG-treated HFD-fed mice compared to LGG-non-treated controls. The serum levels of triglyceride and cholesterol were also significantly reduced in LGG-treated mice. Gut microbial composition analysis showed that shifts in the diversity of dominant gut bacteria were caused by HFD and restored by LGG treatment. A remarkable decrease of hepatic fat content was also observed in LGG-treated mice, accompanied by downregulated expressions of lipogenic and pro-inflammatory genes in the liver. LGG-treated mice had lower expression levels of genes involved in cholesterol synthesis, but conversely, higher expression levels of cholesterol efflux-related genes compared to LGG-non-treated controls. The cholesterol-lowering effect of LGG was also found to be mediated by suppression of FXR and FGF15 signaling, resulting in the upregulation of hepatic CYP7A1. Our findings confirm a therapeutic potential of probiotics for ameliorating dyslipidemia and NAFLD.

  12. Mice lacking caspase-2 are protected from behavioral changes, but not pathology, in the YAC128 model of Huntington disease

    Directory of Open Access Journals (Sweden)

    Bissada Nagat


    Full Text Available Abstract Background Huntington Disease (HD is a neurodegenerative disorder in which caspase activation and cleavage of substrates, including the huntingtin protein, has been invoked as a pathological mechanism. Specific changes in caspase-2 (casp2 activity have been suggested to contribute to the pathogenesis of HD, however unique casp2 cleavage substrates have remained elusive. We thus utilized mice completely lacking casp2 (casp2-/- to examine the role played by casp2 in the progression of HD. This 'substrate agnostic' approach allows us to query the effect of casp2 on HD progression without pre-defining proteolytic substrates of interest. Results YAC128 HD model mice lacking casp2 show protection from well-validated motor and cognitive features of HD, including performance on rotarod, swimming T-maze, pre-pulse inhibition, spontaneous alternation and locomotor tasks. However, the specific pathological features of the YAC128 mice including striatal volume loss and testicular degeneration are unaltered in mice lacking casp2. The application of high-resolution magnetic resonance imaging (MRI techniques validates specific neuropathology in the YAC128 mice that is not altered by ablation of casp2. Conclusions The rescue of behavioral phenotypes in the absence of pathological improvement suggests that different pathways may be operative in the dysfunction of neural circuitry in HD leading to behavioral changes compared to the processes leading to cell death and volume loss. Inhibition of caspase-2 activity may be associated with symptomatic improvement in HD.

  13. The novel role of platelet-activating factor in protecting mice against lipopolysaccharide-induced endotoxic shock.

    Directory of Open Access Journals (Sweden)

    Young-Il Jeong

    Full Text Available BACKGROUND: Platelet-activating factor (PAF has been long believed to be associated with many pathophysiological processes during septic shock. Here we present novel activities for PAF in protecting mice against LPS-mediated endotoxic shock. PRINCIPAL FINDINGS: In vivo PAF treatment immediately after LPS challenge markedly improved the survival rate against mortality from endotoxic shock. Administration of PAF prominently attenuated LPS-induced organ injury, including profound hypotension, excessive polymorphonuclear neutrophil infiltration, and severe multiple organ failure. In addition, PAF treatment protects against LPS-induced lymphocytes apoptosis. These protective effects of PAF was correlated with significantly decreases in the production of the inflammatory mediators such as TNF-alpha, IL-1beta, IL-12, and IFN-gamma, while increasing production of the anti-inflammatory cytokine IL-10 in vivo and in vitro. CONCLUSIONS: Taken together, these results suggest that PAF may protect mice against endotoxic shock via a complex mechanism involving modulation of inflammatory and anti-inflammatory mediators.

  14. Protective effects of vitamin E and Cornus mas fruit extract on methotrexate-induced cytotoxicity in sperms of adult mice

    Directory of Open Access Journals (Sweden)

    Leila Zarei


    Full Text Available This study was aimed to assess the protective effects of Cornus mas fruit extract (CMFE and vitamin E (Vit E on sperm quality parameters in the methotrexate (MTX-treated mice. Forty-eight young adult male mice (8-12 weeks were randomly divided into six groups including control and test groups. The control group received normal saline orally , and the test groups were treated MTX (20 mg kg-1, ip, once weekly, MTX + CMFE (250 mg kg-1, MTX + CMFE (500 mg kg-1, MTX + CMFE (1000 mg kg-1, and MTX + Vit E (100 IU kg-1, po for 35 consecutive days. On day 35, after euthanasia the epididymal sperms were isolated. Then the total mean sperm count, sperm viability and motility were determined. The total antioxidant capacity (TAOC of all experimental groups were also evaluated. The MTX-treated animals showed a significant changes in all parameters of sperm quality assessment compared to the control group. Both Vit E and CMFE were able to protect from MTX-induced effects on sperm maturity and DNA damage. Co-administration of MTX and CMFE and/or Vit E resulted in protection from MTX-reduced TAOC. In conclusion, these data suggested that MTX administration could adversely affect the sperm quality. Moreover, the protective effect of Vit E and CMFE on MTX-induced sperm toxicity was also documented.

  15. Protective and therapeutic effects of the resuscitation-promoting factor domain and its mutants against Mycobacterium tuberculosis in mice. (United States)

    Zhao, Shanmin; Song, Xiaoqin; Zhao, Yong; Qiu, Yi; Mao, Fengfeng; Zhang, Caiqin; Bai, Bing; Zhang, Hai; Wu, Shaoping; Shi, Changhong


    The resuscitation-promoting factor (Rpf), a secretory protein first reported in Micrococcus luteus, plays a critical role in mycobacterial survival and infection. There are five functionally redundant Rpf-like proteins identified in M. tuberculosis (Mtb). All these Rpfs share a conserved Rpf domain (Rpfd) composed of approximately 70 amino acids, which possesses the same biological functions as the full-length Rpf protein. Glutamic acid at position 54 in Rpfd (E54) has been implicated in mediating multiple physiological processes, and a single amino acid substitution at residue E54 can affect the protein biological activity. In order to determine the effects of different amino acid substitutions of E54 in Rpfd on its immunogenic activity, we generated three recombinant Rpfd mutants, Rpfd1 (E54K), Rpfd2 (E54A) and Rpfd3 (E54K and D48A), based on T-cell epitope prediction and tested their potential protective/therapeutic effects against Mtb in mice. Our results demonstrated that replacement of E54 by different amino acids in Rpfd distinctively influenced its resuscitation-promoting activities and Th1-type immune responses induced in mice. Administration of Rpfd2 mutant enhanced Th1-type cellular responses (IFN-γ and IL-2) in mice (P < 0.05, Rpfd2 versus control) and provided effective protection against Mtb in mice by significantly inhibiting the growth of Mtb during the initial stage of infection. Four weeks after the challenge, the slightest pathological injury in lung was observed in the Rpfd2-immunized group among all three Rfpd mutant-immunized groups. Furthermore, Rpfd2 therapy significantly decreased the bacterial load in lung and alleviated histopathological damage in Mtb-infected mice. Together, our results suggest Rpfd2 as a novel effective vaccine candidate against Mtb.

  16. Protective effect of taurine on the decreased biogenic amine neurotransmitter levels in the brain of mice exposed to arsenic. (United States)

    Liu, Xiaohui; Piao, Fengyuan; Li, Yachen


    Arsenic (As) exposure has a toxic effect on the central nervous system, especially on learning and memory. Norepinephrine (NE), dopamine (DA), and serotonin (5-HT) play an important role in learning and memory function of the brain. In the present study, the protective effect of taurine on the disturbed biogenic amine neurotransmitter levels in the mouse brain induced by arsenic was examined. Sixty SPF mice were divided into three groups. The As exposure group was administered with 4 ppm As(2)O(3) through drinking water for 60 days. The protective group was treated with both 4 ppm As(2)O(3) and 150 mg/kg taurine. The control group was given drinking water alone. The levels of NE, DA, and 5-HT were determined by HPLC in the cerebrum and cerebellum of mice. Ultrastructure of synapses in brain tissue of mice was observed in these groups by transmission electron microscopy. The mRNA expressions of dopamine beta hydroxylase (DBH), tyrosine hydroxylase (TH), and tryptophan hydroxylase (TPH) as NE, DA, and 5-HT synzymes were also analyzed by real-time RT-PCR. The results showed that the concentrations of NE, DA, and 5-HT; the number of synaptic vesicles; and the expressions of TH, TPH, and DBH genes in the brains of mice exposed to As alone were significantly decreased. However, administration of taurine significantly alleviated the toxic effect on biochemicals detected in the experiment, compared with that in the brain of mice exposed to As alone. These results indicated that taurine was effective in counteracting the decreased biogenic amine neurotransmitter level and the mRNA expressions of their synzymes induced by arsenic.

  17. Nelfinavir inhibits intra-mitochondrial calcium influx and protects brain against hypoxic-ischemic injury in neonatal mice.

    Directory of Open Access Journals (Sweden)

    Irina V Utkina-Sosunova

    Full Text Available Nelfinavir (NLF, an antiretroviral agent, preserves mitochondrial membranes integrity and protects mature brain against ischemic injury in rodents. Our study demonstrates that in neonatal mice NLF significantly limits mitochondrial calcium influx, the event associated with protection of the brain against hypoxic-ischemic insult (HI. Compared to the vehicle-treated mice, cerebral mitochondria from NLF-treated mice exhibited a significantly greater tolerance to the Ca(2+-induced membrane permeabilization, greater ADP-phosphorylating activity and reduced cytochrome C release during reperfusion. Pre-treatment with NLF or Ruthenium red (RuR significantly improved viability of murine hippocampal HT-22 cells, reduced Ca(2+ content and preserved membrane potential (Ψm in mitochondria following oxygen-glucose deprivation (OGD. Following histamine-stimulated Ca(2+ release from endoplasmic reticulum, in contrast to the vehicle-treated cells, the cells treated with NLF or RuR also demonstrated reduced Ca(2+ content in their mitochondria, the event associated with preserved Ψm. Because RuR inhibits mitochondrial Ca(2+ uniporter, we tested whether the NLF acts via the mechanism similar to the RuR. However, in contrast to the RuR, in the experiment with direct interaction of these agents with mitochondria isolated from naïve mice, the NLF did not alter mitochondrial Ca(2+ influx, and did not prevent Ca(2+ induced collapse of the Ψm. These data strongly argues against interaction of NLF and mitochondrial Ca(2+ uniporter. Although the exact mechanism remains unclear, our study is the first to show that NLF inhibits intramitochondrial Ca(2+ flux and protects developing brain against HI-reperfusion injury. This novel action of NLF has important clinical implication, because it targets a fundamental mechanism of post-ischemic cell death: intramitochondrial Ca(2+ overload → mitochondrial membrane permeabilization → secondary energy failure.

  18. Monoclonal anti-envelope antibody AP33 protects humanized mice against a patient-derived hepatitis C virus challenge. (United States)

    Desombere, Isabelle; Fafi-Kremer, Samira; Van Houtte, Freya; Pessaux, Patrick; Farhoudi, Ali; Heydmann, Laura; Verhoye, Lieven; Cole, Sarah; McKeating, Jane A; Leroux-Roels, Geert; Baumert, Thomas F; Patel, Arvind H; Meuleman, Philip


    End-stage liver disease (ESLD) caused by hepatitis C virus (HCV) infection is a major indication for liver transplantation. However, immediately after transplantation, the liver graft of viremic patients universally becomes infected by circulating virus, resulting in accelerated liver disease progression. Currently available direct-acting antiviral therapies have reduced efficacy in patients with ESLD and prophylactic strategies to prevent HCV recurrence are still highly needed. In this study, we compared the ability of two broadly reactive monoclonal antibodies (mAbs), designated 3/11 and AP33, recognizing a distinct, but overlapping, epitope in the viral E2 glycoprotein to protect humanized mice from a patient-derived HCV challenge. Their neutralizing activity was assessed using the HCV pseudoparticles and cell-culture-derived HCV systems expressing multiple patient-derived envelopes and a human-liver chimeric mouse model. HCV RNA was readily detected in all control mice challenged with a patient-derived HCV genotype 1b isolate, whereas 3 of 4 AP33-treated mice were completely protected. In contrast, only one of four 3/11-treated mice remained HCV-RNA negative throughout the observation period, whereas the other 3 had a viral load that was indistinguishable from that in the control group. The increased in vivo efficacy of AP33 was in line with its higher affinity and neutralizing capacity observed in vitro. Although mAbs AP33 and 3/11 target the same region in E2, only mAb AP33 can efficiently protect from challenge with a heterologous HCV population in vivo. Given that mAb AP33 efficiently neutralizes viral variants that escaped the humoral immune response and reinfected the liver graft of transplant patients, it may be a valuable candidate to prevent HCV recurrence. In addition, our data are valuable for the design of a prophylactic vaccine. © 2015 by the American Association for the Study of Liver Diseases.

  19. Heme oxygenase-1-mediated autophagy protects against pulmonary endothelial cell death and development of emphysema in cadmium-treated mice. (United States)

    Surolia, Ranu; Karki, Suman; Kim, Hyunki; Yu, Zhihong; Kulkarni, Tejaswini; Mirov, Sergey B; Carter, A Brent; Rowe, Steven M; Matalon, Sadis; Thannickal, Victor J; Agarwal, Anupam; Antony, Veena B


    Pulmonary exposure to cadmium, a major component of cigarette smoke, has a dramatic impact on lung function and the development of emphysema. Cigarette smoke exposure induces heme oxygenase-1 (HO-1), a cytoprotective enzyme. In this study, we employed a truncated mouse model of emphysema by intratracheal instillation of cadmium (CdCl2) solution (0.025% per 1 mg/kg body wt) in HO-1(+/+), HO-1(-/-), and overexpressing humanized HO-1 bacterial artificial chromosome (hHO-1BAC) mice. We evaluated the role of HO-1 in cadmium-induced emphysema in mice by analyzing histopathology, micro-computed tomography scans, and lung function tests. CdCl2-exposed HO-1(-/-) mice exhibited more severe emphysema compared with HO-1(+/+) or hHO-1BAC mice. Loss of pulmonary endothelial cells (PECs) from the alveolar capillary membrane is recognized to be a target in emphysema. PECs from HO-1(+/+), HO-1(-/-), and hHO-1BAC were employed to define the underlying molecular mechanism for the protection from emphysema by HO-1. Electron microscopy, expression of autophagic markers (microtubule-associated protein 1B-light chain 3 II, autophagy protein 5, and Beclin1) and apoptotic marker (cleaved caspase 3) suggested induction of autophagy and apoptosis in PECs after CdCl2 treatment. CdCl2-treated HO-1(-/-) PECs exhibited downregulation of autophagic markers and significantly increased cleaved caspase 3 expression and activity (∼4-fold higher). Moreover, hHO-1BAC PECs demonstrated upregulated autophagy and absence of cleaved caspase 3 expression or activity. Pretreatment of HO-1(+/+) PECs with rapamycin induced autophagy and resulted in reduced cell death upon cadmium treatment. Induction of autophagy following CdCl2 treatment was found to be protective from apoptotic cell death. HO-1 induced protective autophagy in PECs and mitigated cadmium-induced emphysema. Copyright © 2015 the American Physiological Society.

  20. Induction of Protective Immune Responses against Schistosomiasis Haematobium in Hamsters and Mice Using Cysteine Peptidase-Based Vaccine

    Directory of Open Access Journals (Sweden)

    Hatem A M Tallima


    Full Text Available One of the major lessons we learned from the radiation-attenuated cercariae (RA vaccine studies is that protective immunity against schistosomiasis is dependent on the induction of T helper (Th1/Th2-related immune responses. Since most schistosome larval and adult-worm-derived molecules used for vaccination uniformly induce a polarized Th1 response, it was essential to include a type 2 immune responses-inducing molecule, such as cysteine peptidases, in the vaccine formula. Here we demonstrate that a single subcutaneous injection of Syrian hamsters with 200 microg active papain 1 h before percutaneous exposure to 150 cercariae of Schistosoma haematobium led to highly significant (P 50% in worm burden and worm egg counts in intestine. Immunization of hamsters with 20 microg recombinant glyceraldehyde 3-phosphate dehydrogenase (rSG3PDH and 20 ug 2-cys peroxiredoxin-derived peptide in a multiple antigen peptide construct (PRX MAP together with papain (20 microg/hamster as adjuvant led to considerable (64% protection against challenge S. haematobium infection, similar to the levels reported with irradiated cercariae. Cysteine peptidases-based vaccination was also effective in protecting outbred mice against a percutaneous challenge infection with S. haematobium cercariae. In two experiments, a mixture of Schistosoma mansoni cathepsin B1 (SmCB1 and Fasciola hepatica cathepsin L1 (FhCL1 led to highly significant (P < 0.005 reduction of 70% in challenge S. haematobium worm burden and 60% reduction in liver egg counts. Mice vaccinated with SmCB1/FhCL1/ rSG3PDH mixture and challenged with S. haematobium cercariae three weeks after the second immunization displayed highly significant (P < 0.005 reduction of 72% in challenge worm burden and no eggs in liver of 8-10 mice/group, as compared to unimmunized mice, associated with production of a mixture of type 1 and type 2-related cytokines and antibody responses.

  1. Evaluation of safety and protective effects of Potentilla fulgens root extract in experimentally induced diarrhoea in mice

    Directory of Open Access Journals (Sweden)

    V. Tangpu


    Methods: The protective effects of P. fulgens root extract was investigated against experimentally induced diarrhoea in mice, using four experimental models, i.e. measurement of faecal output, castor oil model, prostaglandin E2 (PGE2 enteropooling assay and gastrointestinal transit test. The safety assessment of root extract was done in mice on the basis of general signs and symptoms of toxicity, food water intake and mortality of animals following their treatment with various doses of extract (100 and ndash;3200 mg/kg. In addition, the serum glutamate oxaloacetate transaminase (SGOT, serum glutamate pyruvate transaminase (SGPT, cholesterol and total protein of experimental mice were also monitored to assess the toxicity of root extract. Results: In the safety assessment studies, P. fulgens root extract did not showed any visible signs of toxicity, but mortality was observed in a single animal at 3200 mg/kg dose of extract. The extract also did not showed any adverse effects on the studied serum parameters of experimental animals. In the antidiarrhoeal tests, administration of 800 mg/kg dose of extract to mice showed 50% protection from diarrhoea evoked by castor oil. In addition, the extract also showed 29.27% reduction in PGE2-induced intestinal secretion as compared to 30.31% recorded for loperamide, a standard anti-diarrhoeal drug. Conclusions: The results of this study indicate that P. fulgens root extract possesses significant anti-diarrhoeal properties. Therefore, the roots of this plant can be an effective traditional medicine for the protection from diarrhoea. [J Intercult Ethnopharmacol 2014; 3(3.000: 103-108

  2. Skin-specific Deletion of Stearoyl-CoA Desaturase-1 Alters Skin Lipid Composition and Protects Mice from High Fat Diet-induced Obesity

    National Research Council Canada - National Science Library

    Harini Sampath; Matthew T. Flowers; Xueqing Liu; Chad M. Paton; Ruth Sullivan; Kiki Chu; Minghui Zhao; James M. Ntambi


    .... In addition, SKO mice have significantly increased energy expenditure and are protected from high fat diet-induced obesity, thereby recapitulating the hypermetabolic phenotype of global SCD1 deficiency...

  3. Dietary folic acid protects against genotoxicity in the red blood cells of mice (United States)

    MacFarlane, Amanda J.; Behan, Nathalie A.; Field, Martha S.; Williams, Andrew; Stover, Patrick J.; Yauk, Carole L.


    Folate is an essential B vitamin required for the de novo synthesis of purines, thymidylate and methionine. Folate deficiency can lead to mutations and genome instability, and has been shown to exacerbate the genotoxic potential of environmental toxins. We hypothesized that a folic acid (FA) deficient diet would induce genotoxicity in mice as measured by the Pig-a mutant phenotype (CD24−) and micronuclei (MN) in reticulocytes (RET) and red blood cells/normochromatic erythrocytes (RBC/NCE). Male Balb/c mice were fed a FA deficient (0 mg/kg), control (2 mg/kg) or supplemented (6 mg/kg) diet from weaning for 18 wk. Mice fed the deficient diet had 70% lower liver folate (p control diet. RETCD24− and RBCCD24− frequencies were not different between mice fed the deficient and control diets. Compared to mice fed the FA supplemented diet, mice fed the deficient diet had 73% lower liver folate (p cells of mice. PMID:26177356

  4. CTRP9 transgenic mice are protected from diet-induced obesity and metabolic dysfunction (United States)

    Peterson, Jonathan M.; Wei, Zhikui; Seldin, Marcus M.; Byerly, Mardi S.; Aja, Susan


    CTRP9 is a secreted multimeric protein of the C1q family and the closest paralog of the insulin-sensitizing adipokine, adiponectin. The metabolic function of this adipose tissue-derived plasma protein remains largely unknown. Here, we show that the circulating levels of CTRP9 are downregulated in diet-induced obese mice and upregulated upon refeeding. Overexpressing CTRP9 resulted in lean mice that dramatically resisted weight gain induced by a high-fat diet, largely through decreased food intake and increased basal metabolism. Enhanced fat oxidation in CTRP9 transgenic mice resulted from increases in skeletal muscle mitochondrial content, expression of enzymes involved in fatty acid oxidation (LCAD and MCAD), and chronic AMPK activation. Hepatic and skeletal muscle triglyceride levels were substantially decreased in transgenic mice. Consequently, CTRP9 transgenic mice had a greatly improved metabolic profile with markedly reduced fasting insulin and glucose levels. The high-fat diet-induced obesity, insulin resistance, and hepatic steatosis observed in wild-type mice were prevented in transgenic mice. Consistent with the in vivo data, recombinant protein significantly enhanced fat oxidation in L6 myotubes via AMPK activation and reduced lipid accumulation in H4IIE hepatocytes. Collectively, these data establish CTRP9 as a novel metabolic regulator and a new component of the metabolic network that links adipose tissue to lipid metabolism in skeletal muscle and liver. PMID:23842676

  5. Targeting connexin 43 protects against the progression of experimental chronic kidney disease in mice. (United States)

    Abed, Ahmed; Toubas, Julie; Kavvadas, Panagiotis; Authier, Florence; Cathelin, Dominique; Alfieri, Carlo; Boffa, Jean-Jacques; Dussaule, Jean-Claude; Chatziantoniou, Christos; Chadjichristos, Christos E


    Excessive recruitment of monocytes and progression of fibrosis are hallmarks of chronic kidney disease (CKD). Recently we reported that the expression of connexin 43 (Cx43) was upregulated in the kidney during experimental nephropathy. To investigate the role of Cx43 in the progression of CKD, we interbred RenTg mice, a genetic model of hypertension-induced CKD, with Cx43+/- mice. The renal cortex of 5-month-old RenTgCx43+/- mice showed a marked decrease of cell adhesion markers leading to reduced monocyte infiltration and interstitial renal fibrosis compared with their littermates. In addition, functional and histological parameters such as albuminuria and glomerulosclerosis were ameliorated in RenTgCx43+/- mice. Interestingly, treatment with Cx43 antisense produced remarkable improvement of renal function and structure in 1-year-old RenTg mice. Similar results were found in Cx43+/- or wild-type mice treated with Cx43 antisense after obstructive nephropathy. Furthermore, in these mice, Cx43 antisense attenuated E-cadherin downregulation and phosphorylation of the transcription factor Sp1 by the ERK pathway resulting in decreased transcription of type I collagen gene. Interestingly, Cx43-specific blocking peptide inhibited monocyte adhesion in activated endothelium and profibrotic pathways in tubular cells. Cx43 was highly increased in biopsies of patients with CKD. Thus, Cx43 may represent a new therapeutic target against the progression of CKD.

  6. β - Alanine protects mice from memory deficits induced by ageing, scopolamine, diazepam and ethanol

    Directory of Open Access Journals (Sweden)

    Dhingra D


    Full Text Available The present study was undertaken to investigate the effects of β-alanine (a glycine agonist, on learning and memory in mice. β-alanine (5, 10, 20 and 40 mg/kg i.p. was administered for 6 successive days, to young (3 months old and aged-mice (16 months old. The learning and memory parameters were assessed, using elevated plus-maze and passive-avoidance apparatus. The effect of β-alanine (20 mg/kg for 6 days on locomotor function of young and aged mice, was studied using photoactometer, to rule out the increase in locomotor performance of mice. β-alanine at both the doses (10 and 20 mg/kg, significantly improved learning and memory of young- and aged- mice. β-alanine also reversed scopolamine (0.4 mg/kg i.p., ethanol (1.0 g/kg i.p. and diazepam (1.0 mg/kg i.p. -induced amnesia in young mice. There was no significant effect of β-alanine on the locomotor activity of both young and aged mice. The probable underlying mechanism of the memory-enhancing effect of β-alanine appears to be related to its antioxidant, anti-amyloid and procholinergic activities.

  7. Neonatal periostin knockout mice are protected from hyperoxia-induced alveolar simplication.

    Directory of Open Access Journals (Sweden)

    Paul D Bozyk

    Full Text Available In bronchopulmonary dysplasia (BPD, alveolar septae are thickened with collagen and α-smooth muscle actin, transforming growth factor (TGF-β-positive myofibroblasts. Periostin, a secreted extracellular matrix protein, is involved in TGF-β-mediated fibrosis and myofibroblast differentiation. We hypothesized that periostin expression is required for hypoalveolarization and interstitial fibrosis in hyperoxia-exposed neonatal mice, an animal model for this disease. We also examined periostin expression in neonatal lung mesenchymal stromal cells and lung tissue of hyperoxia-exposed neonatal mice and human infants with BPD. Two-to-three day-old wild-type and periostin null mice were exposed to air or 75% oxygen for 14 days. Mesenchymal stromal cells were isolated from tracheal aspirates of premature infants. Hyperoxic exposure of neonatal mice increased alveolar wall periostin expression, particularly in areas of interstitial thickening. Periostin co-localized with α-smooth muscle actin, suggesting synthesis by myofibroblasts. A similar pattern was found in lung sections of infants dying of BPD. Unlike wild-type mice, hyperoxia-exposed periostin null mice did not show larger air spaces or α-smooth muscle-positive myofibroblasts. Compared to hyperoxia-exposed wild-type mice, hyperoxia-exposed periostin null mice also showed reduced lung mRNA expression of α-smooth muscle actin, elastin, CXCL1, CXCL2 and CCL4. TGF-β treatment increased mesenchymal stromal cell periostin expression, and periostin treatment increased TGF-β-mediated DNA synthesis and myofibroblast differentiation. We conclude that periostin expression is increased in the lungs of hyperoxia-exposed neonatal mice and infants with BPD, and is required for hyperoxia-induced hypoalveolarization and interstitial fibrosis.

  8. Cross-protective immunity against multiple influenza virus subtypes by a novel modified vaccinia Ankara (MVA) vectored vaccine in mice. (United States)

    Brewoo, Joseph N; Powell, Tim D; Jones, Jeremy C; Gundlach, Nancy A; Young, Ginger R; Chu, Haiyan; Das, Subash C; Partidos, Charalambos D; Stinchcomb, Dan T; Osorio, Jorge E


    Development of an influenza vaccine that provides cross-protective immunity remains a challenge. Candidate vaccines based on a recombinant modified vaccinia Ankara (MVA) viral vector expressing antigens from influenza (MVA/Flu) viruses were constructed. A vaccine candidate, designated MVA/HA1/C13L/NP, that expresses the hemagglutinin from pandemic H1N1 (A/California/04/09) and the nucleoprotein (NP) from highly pathogenic H5N1 (A/Vietnam/1203/04) fused to a secretory signal sequence from vaccinia virus was highly protective. The vaccine elicited strong antibody titers to homologous H1N1 viruses while cross-reactive antibodies to heterologous viruses were not detectable. In mice, this MVA/HA1/C13L/NP vaccine conferred complete protection against lethal challenge with A/Vietnam/1203/04 (H5N1), A/Norway/3487-2/09 (pandemic H1N1) or A/Influenza/Puerto Rico/8/34 (seasonal H1N1) and partial protection (57.1%) against challenge with seasonal H3N2 virus (A/Aichi/68). The protective efficacy of the vaccine was not affected by pre-existing immunity to vaccinia. Our findings highlight MVA as suitable vector to express multiple influenza antigens that could afford broad cross-protective immunity against multiple subtypes of influenza virus.

  9. CD38 Knockout Mice Show Significant Protection Against Ischemic Brain Damage Despite High Level Poly-ADP-Ribosylation. (United States)

    Long, Aaron; Park, Ji H; Klimova, Nina; Fowler, Carol; Loane, David J; Kristian, Tibor


    Several enzymes in cellular bioenergetics metabolism require NAD(+) as an essential cofactor for their activity. NAD(+) depletion following ischemic insult can result in cell death and has been associated with over-activation of poly-ADP-ribose polymerase PARP1 as well as an increase in NAD(+) consuming enzyme CD38. CD38 is an NAD(+) glycohydrolase that plays an important role in inflammatory responses. To determine the contribution of CD38 activity to the mechanisms of post-ischemic brain damage we subjected CD38 knockout (CD38KO) mice and wild-type (WT) mice to transient forebrain ischemia. The CD38KO mice showed a significant amelioration in both histological and neurologic outcome following ischemic insult. Decrease of hippocampal NAD(+) levels detected during reperfusion in WT mice was only transient in CD38KO animals, suggesting that CD38 contributes to post-ischemic NAD(+) catabolism. Surprisingly, pre-ischemic poly-ADP-ribose (PAR) levels were dramatically higher in CD38KO animals compared to WT animals and exhibited reduction post-ischemia in contrast to the increased levels in WT animals. The high PAR levels in CD38 mice were due to reduced expression levels of poly-ADP-ribose glycohydrolase (PARG). Thus, the absence of CD38 activity can not only directly affect inflammatory response, but also result in unpredicted alterations in the expression levels of enzymes participating in NAD(+) metabolism. Although the CD38KO mice showed significant protection against ischemic brain injury, the changes in enzyme activity related to NAD(+) metabolism makes the determination of the role of CD38 in mechanisms of ischemic brain damage more complex.

  10. Black tattoos protect against UVR-induced skin cancer in mice

    DEFF Research Database (Denmark)

    Lerche, Catharina M; Sepehri, Mitra; Serup, Jørgen


    studied. METHODS: Immunocompetent C3.Cg/TifBomTac mice (n = 99) were tattooed on the back with Starbrite Tribal Black(™) . This ink has a high content of the carcinogen BaP. Half of the mice were irradiated with three standard erythema doses UVR thrice weekly. Time to induction of first, second and third...... squamous cell carcinoma (SCC) was measured. Controls were 'tattooed' without ink. RESULTS: All irradiated mice developed SCCs while no malignant tumours were found in the nonirradiated group. In the tattooed and irradiated group, the development of the first, second and third SCC was significantly delayed...

  11. Protection of Mice with a Divalent Tuberculosis DNA Vaccine Encoding Antigens Ag85B and MPT64

    Institute of Scientific and Technical Information of China (English)

    Xia TIAN; Hong CAI; Yu-Xian ZHU


    DNA vaccine may be a promising tool for controlling tuberculosis development. However,vaccines encoding single antigens of mycobacterium did not produce protective effect as BCG did. In the present study, we evaluated the immunogenicity and protective efficacy of a divalent DNA vaccine encoding two immunodominant antigens Ag85B and MPT64 of Mycobacterium tuberculosis. We found that both humoral and Th1-type (high IFN-γ, low IL-4) cellular responses obtained from the divalent DNA vaccine group were significantly higher than that conferred by BCG. RT-PCR results showed that antigens were expressed differentially in various organs in divalent DNA vaccine group. The survival rate for mice treated with the divalent DNA vaccine after challenging with high doses of virulent M. tuberculosis H37Rv was significantly higher than that of the BCG group or any of the single DNA vaccine group. Significant differences were also found between the single and divalent DNA vaccinated mice in terms of body, spleen and lung weight. Bacterial loading decreased about 2000-fold in lungs and about 100-fold in spleens of divalent DNA vaccinated mice when compared with that of the control group. We conclude that our divalent DNA vaccine may be a better choice for controlling tuberculosis disease in animals.

  12. Fermented herbal formula KIOM-MA-128 protects against acute colitis induced by dextran sodium sulfate in mice. (United States)

    Kim, Dong-Gun; Lee, Mi-Ra; Yoo, Jae-Myung; Park, Kwang-Il; Ma, Jin-Yeul


    Colitis is a well-known subtype of inflammatory bowel disease and is caused by diverse factors. Previous research has shown that KIOM-MA elicits anti-inflammatory and anti-allergic effects on various diseases. KIOM-MA-128, our novel herbal formula, was generated from KIOM-MA using probiotics to improve the therapeutic efficacy. We investigated whether KIOM-MA-128 has protective activity in a mouse model of acute colitis induced by dextran sodium sulfate (DSS). Colitis was induced by DSS administered to ICR mice in drinking water. KIOM-MA-128 (125 or 250 mg/kg) was orally administered once per day. The body weights of the mice were measured daily, and colonic endoscopies were performed at 5 and 8 days. Colon length as well as histological and cytokine changes were observed at the end of drug administration. KIOM-MA-128 has pharmacological activity in an acute colitis model. KIOM-MA-128 reduced the loss of body weight and disease activity index (DAI) and inhibited the abnormally short colon lengths and the colonic damage in this mouse model of acute colitis. Moreover, KIOM-MA-128 suppressed pro-inflammatory cytokine expression and maintained the integrity of the tight junctions during DSS-induced colitis. The results indicated that KIOM-MA-128 protects against DSS-induced colitis in mice and suggested that this formula might be a candidate treatment for inflammatory bowel disease (IBD).

  13. Administration of nucleoside-modified mRNA encoding broadly neutralizing antibody protects humanized mice from HIV-1 challenge (United States)

    Pardi, Norbert; Secreto, Anthony J.; Shan, Xiaochuan; Debonera, Fotini; Glover, Joshua; Yi, Yanjie; Muramatsu, Hiromi; Ni, Houping; Mui, Barbara L.; Tam, Ying K.; Shaheen, Farida; Collman, Ronald G.; Karikó, Katalin; Danet-Desnoyers, Gwenn A.; Madden, Thomas D.; Hope, Michael J.; Weissman, Drew


    Monoclonal antibodies are one of the fastest growing classes of pharmaceutical products, however, their potential is limited by the high cost of development and manufacturing. Here we present a safe and cost-effective platform for in vivo expression of therapeutic antibodies using nucleoside-modified mRNA. To demonstrate feasibility and protective efficacy, nucleoside-modified mRNAs encoding the light and heavy chains of the broadly neutralizing anti-HIV-1 antibody VRC01 are generated and encapsulated into lipid nanoparticles. Systemic administration of 1.4 mg kg−1 of mRNA into mice results in ∼170 μg ml−1 VRC01 antibody concentrations in the plasma 24 h post injection. Weekly injections of 1 mg kg−1 of mRNA into immunodeficient mice maintain trough VRC01 levels above 40 μg ml−1. Most importantly, the translated antibody from a single injection of VRC01 mRNA protects humanized mice from intravenous HIV-1 challenge, demonstrating that nucleoside-modified mRNA represents a viable delivery platform for passive immunotherapy against HIV-1 with expansion to a variety of diseases. PMID:28251988

  14. The rOmp22-HpaA fusion protein confers protective immunity against helicobacter pylori in mice. (United States)

    Huang, Xueyong; Xu, Bianli; Duan, Guangcai; Song, Chunhua


    Helicobacter pylori (H. pylori) plays an essential role in the development of various gastroduodenal diseases; however, no vaccines preventing H. pylori infection have been available now. This study was to evaluate the protective effect of rOmp22-HpaA fusion protein against H. pylori infection in mouse model and to screen the candidate to be used in the development of an oral vaccine against H. pylori. rOmp22, rHpaA, rOmp22+rHpaA, and rOmp22-HpaA groups were used to immunize mice with mLT63 as adjuvant by intragastric route, respectively, four times at 1-week intervals. Two weeks after last immunization, all of the animals were orally challenged with H. pylori NCTC11637 and then were killed after another 2 weeks. The mice gastric tissue of all groups was separated to detect the presence of infection by urease tests, to culture H. pylori, and to observe the histological characteristics. The protective effect against H. pylori challenge in mice immunized with rOmp22-HpaA fusion protein and mLT63 adjuvant was significantly higher than PBS and mLT63 control groups (P HpaA groups (P > 0.05). rOmp22-HpaA fusion protein retained immunogenicity and could be used as an antigen candidate in the development of an oral vaccine against H. pylori infection.

  15. Immunization of Mice with Recombinant Brucella abortus Organic Hydroperoxide Resistance (Ohr) Protein Protects Against a Virulent Brucella abortus 544 Infection. (United States)

    Hop, Huynh Tan; Reyes, Alisha Wehdnesday Bernardo; Simborio, Hannah Leah Tadeja; Arayan, Lauren Togonon; Min, Won Gi; Lee, Hu Jang; Lee, Jin Ju; Chang, Hong Hee; Kim, Suk


    In this study, the Brucella abortus ohr gene coding for an organic hydroperoxide resistance protein (Ohr) was cloned into a maltose fusion protein expression system (pMAL), inserted into Escherichia coli, and purified, and its immunogenicity was evaluated by western blot analysis using Brucella-positive mouse sera. The purified recombinant Ohr (rOhr) was treated with adjuvant and injected intraperitoneally into BALB/c mice. A protective immune response analysis revealed that rOhr induced a significant increase in both the IgG1 and IgG2a titers, and IgG2a reached a higher level than IgG1 after the second and third immunizations. Additionally, immunization with rOhr induced high production of IFN-γ as well as proinflammatory cytokines such as TNF, MCP-1, IL-12p70, and IL-6, but a lesser amount of IL-10, suggesting that rOhr predominantly elicited a cell-mediated immune response. In addition, immunization with rOhr caused a significantly higher degree of protection against a virulent B. abortus infection compared with a positive control group consisting of mice immunized with maltose-binding protein. These findings showed that B. abortus rOhr was able to induce both humoral and cell-mediated immunity in mice, which suggested that this recombinant protein could be a potential vaccine candidate for animal brucellosis.

  16. Prevention of liver fibrosis by triple helix-forming oligodeoxyribonucleotides targeted to the promoter region of type I collagen gene. (United States)

    Koilan, Subramaniyan; Hamilton, David; Baburyan, Narina; Padala, Mythili K; Weber, Karl T; Guntaka, Ramareddy V


    Hepatic fibrosis leading to cirrhosis remains a global health problem. The most common etiologies are alcoholism and viral infections. Liver fibrosis is associated with major changes in both quantity and composition of extracellular matix and leads to disorganization of the liver architecture and irreversible damage to the liver function. As of now there is no effective therapy to control fibrosis. The end product of fibrosis is abnormal synthesis and accumulation of type I collagen in the extracellular matrix, which is produced by activated stellate or Ito cells in the damaged liver. Therefore, inhibition of transcription of type I collagen should in principle inhibit its production and accumulation in liver. Normally, DNA exists in a duplex form. However, under some circumstances, DNA can assume triple helical (triplex) structures. Intermolecular triplexes, formed by the addition of a sequence-specific third strand to the major groove of the duplex DNA, have the potential to serve as selective gene regulators. Earlier, we demonstrated efficient triplex formation between the exogenously added triplex-forming oligodeoxyribonucleotides (TFOs) and a specific sequence in the promoter region of the COL1A1 gene. In this study we used a rat model of liver fibrosis, induced by dimethylnitrosamine, to test whether these TFOs prevent liver fibrosis. Our results indicate that both the 25-mer and 18-mer TFOs, specific for the upstream nucleotide sequence from -141 to -165 (relative to the transcription start site) in the 5' end of collagen gene promoter, effectively prevented accumulation of liver collagen and fibrosis. We also observed improvement in liver function tests. However, mutations in the TFO that eliminated formation of triplexes are ineffective in preventing fibrosis. We believe that these TFOs can be used as potential antifibrotic therapeutic molecules.

  17. An mRNA Vaccine Encoding Rabies Virus Glycoprotein Induces Protection against Lethal Infection in Mice and Correlates of Protection in Adult and Newborn Pigs.

    Directory of Open Access Journals (Sweden)

    Margit Schnee


    Full Text Available Rabies is a zoonotic infectious disease of the central nervous system (CNS. In unvaccinated or untreated subjects, rabies virus infection causes severe neurological symptoms and is invariably fatal. Despite the long-standing existence of effective vaccines, vaccine availability remains insufficient, with high numbers of fatal infections mostly in developing countries. Nucleic acid based vaccines have proven convincingly as a new technology for the fast development of vaccines against newly emerging pathogens, diseases where no vaccine exists or for replacing already existing vaccines. We used an optimized non-replicating rabies virus glycoprotein (RABV-G encoding messenger RNA (mRNA to induce potent neutralizing antibodies (VN titers in mice and domestic pigs. Functional antibody titers were followed in mice for up to one year and titers remained stable for the entire observation period in all dose groups. T cell analysis revealed the induction of both, specific CD4+ as well as CD8+ T cells by RABV-G mRNA, with the induced CD4+ T cells being higher than those induced by a licensed vaccine. Notably, RABV-G mRNA vaccinated mice were protected against lethal intracerebral challenge infection. Inhibition of viral replication by vaccination was verified by qRT-PCR. Furthermore, we demonstrate that CD4+ T cells are crucial for the generation of neutralizing antibodies. In domestic pigs we were able to induce VN titers that correlate with protection in adult and newborn pigs. This study demonstrates the feasibility of a non-replicating mRNA rabies vaccine in small and large animals and highlights the promises of mRNA vaccines for the prevention of infectious diseases.

  18. BMP4 Gene Therapy in Mature Mice Reduces BAT Activation but Protects from Obesity by Browning Subcutaneous Adipose Tissue

    Directory of Open Access Journals (Sweden)

    Jenny M. Hoffmann


    Full Text Available We examined the effect of Bone Morphogenetic Protein 4 (BMP4 on energy expenditure in adult mature mice by targeting the liver with adeno-associated viral (AAV BMP4 vectors to increase circulating levels. We verified the direct effect of BMP4 in inducing a brown oxidative phenotype in differentiating preadipocytes in vitro. AAV-BMP4-treated mice display marked browning of subcutaneous adipocytes, with increased mitochondria and Uncoupling Protein 1 (UCP1. These mice are protected from obesity on a high-fat diet and have increased whole-body energy expenditure, improved insulin sensitivity, reduced liver fat, and reduced adipose tissue inflammation. On a control diet, they show unchanged body weight but improved insulin sensitivity. In contrast, AAV-BMP4-treated mice showed beiging of BAT with reduced UCP1, increased lipids, and reduced hormone-sensitive lipase (HSL. Thus, BMP4 exerts different effects on WAT and BAT, but the overall effect is to enhance insulin sensitivity and whole-body energy expenditure by browning subcutaneous adipose tissue.

  19. Protection by S-2-(3-aminopropylamino)ethylphosphorothioic acid against radiation-induced leg contractures in mice. [Gamma Radiation

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, N.; Milas, L.


    S-2-(3-Aminopropylamino)ethylphosphorothioic acid (WR-2721) was shown to provide marked protection against development of radiation-induced leg contractures in C3Hf/Kam mice whose legs were exposed to single doses of gamma-radiation. The radiation doses ranged from 3300 to 6200 rads delivered to the right hind thighs from two parallelly opposed 137Cs sources. WR-2721 was given i.p. 30 min before irradiation. The severity of radiation-induced leg contractures in untreated and WR-2721-treated mice was followed for 342 days after irradiation. The degree of leg contractures in both control and WR-2721-treated mice increased up to 100 days after radiation, when the change stabilized, remaining more or less at the same level to the end of the observation period. During this entire period, the severity of contractures was less in WR-2721-treated mice. The dose-modifying factor for the level of 5 mm reduction in leg extension was 1.5 at 182 days after irradiation. Since WR-2721 did not prevent the radiocurability of 8-mm fibrosarcomas growing in the same legs, these data imply that WR-2721 has a high potential for increasing therapeutic gain when combined with irradiation in the treatment of tumors of an appreciable size.

  20. Toll-like receptor 2 signaling protects mice from tumor development in a mouse model of colitis-induced cancer.

    Directory of Open Access Journals (Sweden)

    Emily L Lowe

    Full Text Available Inflammatory bowel disease (IBD is a disorder of chronic inflammation with increased susceptibility to colorectal cancer. The etiology of IBD is unclear but thought to result from a dysregulated adaptive and innate immune response to microbial products in a genetically susceptible host. Toll-like receptor (TLR signaling induced by intestinal commensal bacteria plays a crucial role in maintaining intestinal homeostasis, innate immunity and the enhancement of intestinal epithelial cell (IEC integrity. However, the role of TLR2 in the development of colorectal cancer has not been studied. We utilized the AOM-DSS model for colitis-associated colorectal cancer (CAC in wild type (WT and TLR2(-/- mice. Colons harvested from WT and TLR2(-/- mice were used for histopathology, immunohistochemistry, immunofluorescence and cytokine analysis. Mice deficient in TLR2 developed significantly more and larger colorectal tumors than their WT controls. We provide evidence that colonic epithelium of TLR2(-/- mice have altered immune responses and dysregulated proliferation under steady-state conditions and during colitis, which lead to inflammatory growth signals and predisposition to accelerated neoplastic growth. At the earliest time-points assessed, TLR2(-/- colons exhibited a significant increase in aberrant crypt foci (ACF, resulting in tumors that developed earlier and grew larger. In addition, the intestinal microenvironment revealed significantly higher levels of IL-6 and IL-17A concomitant with increased phospho-STAT3 within ACF. These observations indicate that in colitis, TLR2 plays a protective role against the development of CAC.

  1. Toll-like receptor 2 signaling protects mice from tumor development in a mouse model of colitis-induced cancer. (United States)

    Lowe, Emily L; Crother, Timothy R; Rabizadeh, Shervin; Hu, Bing; Wang, Hanlin; Chen, Shuang; Shimada, Kenichi; Wong, Michelle H; Michelsen, Kathrin S; Arditi, Moshe


    Inflammatory bowel disease (IBD) is a disorder of chronic inflammation with increased susceptibility to colorectal cancer. The etiology of IBD is unclear but thought to result from a dysregulated adaptive and innate immune response to microbial products in a genetically susceptible host. Toll-like receptor (TLR) signaling induced by intestinal commensal bacteria plays a crucial role in maintaining intestinal homeostasis, innate immunity and the enhancement of intestinal epithelial cell (IEC) integrity. However, the role of TLR2 in the development of colorectal cancer has not been studied. We utilized the AOM-DSS model for colitis-associated colorectal cancer (CAC) in wild type (WT) and TLR2(-/-) mice. Colons harvested from WT and TLR2(-/-) mice were used for histopathology, immunohistochemistry, immunofluorescence and cytokine analysis. Mice deficient in TLR2 developed significantly more and larger colorectal tumors than their WT controls. We provide evidence that colonic epithelium of TLR2(-/-) mice have altered immune responses and dysregulated proliferation under steady-state conditions and during colitis, which lead to inflammatory growth signals and predisposition to accelerated neoplastic growth. At the earliest time-points assessed, TLR2(-/-) colons exhibited a significant increase in aberrant crypt foci (ACF), resulting in tumors that developed earlier and grew larger. In addition, the intestinal microenvironment revealed significantly higher levels of IL-6 and IL-17A concomitant with increased phospho-STAT3 within ACF. These observations indicate that in colitis, TLR2 plays a protective role against the development of CAC.

  2. Moderate protective effect of 6-MFA, a microbial metabolite obtained from Aspergillus ochraceus on immunological liver injury in mice. (United States)

    Dhuley, J N; Naik, S R


    Hepatoprotective effect of 6-MFA, obtained from fungus Aspergillus ochraceus ATCC 28706, was evaluated by employing three different immunological liver injury mice models. The first liver injury model was induced by injecting anti-basic liver protein (BLP) antibody into mice previously immunised with rabbit IgG (RGG). The other models were simulated by injecting antiliver specific protein (LSP) antibody or by injecting bacterial lipopolysaccharide (LPS) into mice pretreated with Corynebacterium parvum (C. parvum). 6-MFA treatment inhibited the increased transaminases (GOT and GPT) activities and showed a tendency to inhibit the histopathological changes of the liver in all the models studied. Furthermore, 6-MFA treatment inhibited deoxycholic acid induced transaminase release from cultured rat hepatocytes in vitro, but failed to affect the formation of hemolytic plaque forming cells in immunised mice spleens and hemolytic activity of guinea pig complement in immunohemolytic reaction. Our findings, therefore, suggested that the moderate hepatoprotective effect of 6-MFA could be related to it's protective effect on hepatocyte plasma membrane rather than the direct inhibitory effects on the antibody formation and/or complement activity.

  3. Evaluation of protective effect of freeze-dried strawberry, grape, and blueberry powder on acrylamide toxicity in mice. (United States)

    Zhao, Mengyao; Liu, Xin; Luo, Yinghua; Guo, Huan; Hu, Xiaosong; Chen, Fang


    Berries are dietary plants with high antioxidant activity. The aim of this study is to investigate the protective effect of berries (strawberry, grape, and blueberry) against the acrylamide (AA)-induced general toxicity, genotoxicity, and reproductive toxicity in mice model, respectively. Mice were treated with 50 mg/kg b.w./day AA intraperitoneal injection for 5 d after feeding control diet or diet containing freeze-dried strawberry, grape, and blueberry powder. The results showed that AA induced a significant general toxicity, genotoxicity, and reproductive toxicity in mice. Compared with the control diet, the diets containing berries could reverse the AA-induced alterations in liver antioxidant enzymes activities (P < 0.05). Moreover, the AA-induced genotoxicity could be prevented by the diet containing berries. The DNA damage in the lymphocyte and liver cells and the micronucleus formation in bone marrow cell were significantly alleviated (P < 0.05). Meanwhile, the mice fed with diets containing berries showed a recovery in the sperm count, the sperm activity rate, sperm motility parameters, and the abnormal sperm rate (P < 0.05). Berry powders have remarkable intervention against the AA-induced general toxicity, genotoxicity, reproductive toxicity. Abundant phenolics, especially anthocyanins, may contribute to the intervention.

  4. Protective effects of the dietary supplementation of turmeric (Curcuma longa L.) on sodium arsenite-induced biochemical perturbation in mice. (United States)

    Karim, Md Rezaul; Haque, Abedul; Islam, Khairul; Ali, Nurshad; Salam, Kazi Abdus; Saud, Zahangir Alam; Hossain, Ekhtear; Fajol, Abul; Akhand, Anwarul Azim; Himeno, Seiichiro; Hossain, Khaled


    The present study was undertaken to evaluate the protective effect of turmeric powder on arsenic toxicity through mice model. Swiss albino male mice were divided into four groups. The first group was used as control, while groups 2, 3, and 4 were treated with turmeric powder (T, 50 mg/kg body weight/day), sodium arsenite (Sa, 10 mg/kg body weight/day) and turmeric plus Sa (T+Sa), respectively. Results showed that oral administration of Sa reduced the weight gain of the mice compared to the control group and food supplementation of turmeric prevented the reduction of weight gain. Turmeric abrogated the Sa-induced elevation of serum urea, glucose, triglyceride (TG) level and alanine aminotransferase (ALT) activity except the activity of alkaline phosphatase (ALP). Turmeric also prevented the Sa-induced perturbation of serum butyryl cholinesterase activity (BChE). Therefore, ameliorating effect of turmeric on Sa-treated mice suggested the future application of turmeric to reduce or to prevent arsenic toxicity in human.

  5. Circumsporozoite Protein-Specific Kd-Restricted CD8+ T Cells Mediate Protective Antimalaria Immunity in Sporozoite-Immunized MHC-I-Kd Transgenic Mice

    Directory of Open Access Journals (Sweden)

    Jing Huang


    Full Text Available Although the roles of CD8+ T cells and a major preerythrocytic antigen, the circumsporozoite (CS protein, in contributing protective antimalaria immunity induced by radiation-attenuated sporozoites, have been shown by a number of studies, the extent to which these players contribute to antimalaria immunity is still unknown. To address this question, we have generated C57BL/6 (B6 transgenic (Tg mice, expressing Kd molecules under the MHC-I promoter, called MHC-I-Kd-Tg mice. In this study, we first determined that a single immunizing dose of IrPySpz induced a significant level of antimalaria protective immunity in MHC-I-Kd-Tg mice but not in B6 mice. Then, by depleting various T-cell subsets in vivo, we determined that CD8+ T cells are the main mediator of the protective immunity induced by IrPySpz. Furthermore, when we immunized (MHC-I-Kd-Tg × CS-Tg F1 mice with IrPySpz after crossing MHC-I-Kd-Tg mice with PyCS-transgenic mice (CS-Tg, which are unable to mount PyCS-specific immunity, we found that IrPySpz immunization failed to induce protective antimalaria immunity in (MHC-I-Kd-Tg × CS-Tg F1 mice, thus indicating the absence of PyCS antigen-dependent immunity in these mice. These results indicate that protective antimalaria immunity induced by IrPySpz in MHC-I-Kd-Tg mice is mediated by CS protein-specific, Kd-restricted CD8+ T cells.

  6. Protective Effect of Magnesium Isoglycyrrhizinate on Ethanol-Induced Testicular Injuries in Mice


    He, Yuanqiao; Zeng, Fuqing; Liu, Qing; Ju, Wen; Fu, Houju; Hao, Hua; Li, Lulu; Xie, Yifeng


    Objective Ethanol treatment induces an increase in oxidative stress. As licorice compounds are potent antioxidants, our aim was to examine whether magnesium isoglycyrrhizinate attenuated lipid peroxidation, the major end-point of oxidative damage resulting from ethanol administration. Methods Four groups(18 animals in each group) of male Kunming mice were used. The first group served as control and received 0.4 ml normal saline daily for 18 days orally. The second group of mice was given 56% ...

  7. Failure to Generate Bone Marrow Adipocytes Does Not Protect Mice from Ovariectomy-Induced Osteopenia (United States)

    Iwaniec, Urszula T.; Turner, Russell T.


    A reciprocal association between bone marrow fat and bone mass has been reported in ovariectomized rodents, suggesting that bone marrow adipogenesis has a negative effect on bone growth and turnover balance. Mice with loss of function mutations in kit receptor (kitW/W-v) have no bone marrow adipocytes in tibia or lumbar vertebra. We therefore tested the hypothesis that marrow fat contributes to development of osteopenia by comparing the skeletal response to ovariectomy (ovx) in growing wild type (WT) and bone marrow adipocyte-deficient kitW/W-v mice. Mice were ovx at 4 weeks of age and sacrificed 4 or 10 weeks post-surgery. Body composition was measured at necropsy by dual-energy X-ray absorptiometry. Cortical (tibia) and cancellous (tibia and lumbar vertebra) bone architecture were evaluated by microcomputed tomography. Bone marrow adipocyte size and density, osteoblast- and osteoclast-lined bone perimeters, and bone formation were determined by histomorphometry. Ovx resulted in an increase in total body fat mass at 10 weeks post-ovx in both genotypes, but the response was attenuated in the in kitW/W-v mice. Adipocytes were present in bone marrow of tibia and lumbar vertebra in WT mice and bone marrow adiposity increased following ovx. In contrast, marrow adipocytes were not detected in either intact or ovx kitW/W-v mice. However, ovx in WT and kitW/W-v mice resulted in statistically indistinguishable changes in cortical and cancellous bone mass, cortical and cancellous bone formation rate, and cancellous osteoblast and osteoclast-lined bone perimeters. In conclusion, our findings do not support a causal role for increased bone marrow fat as a mediator of ovx-induced osteopenia in mice. PMID:23246792

  8. Embryonic catalase protects against ethanol embryopathies in acatalasemic mice and transgenic human catalase-expressing mice in embryo culture. (United States)

    Miller-Pinsler, Lutfiya; Wells, Peter G


    Reactive oxygen species (ROS) have been implicated in the mechanism of ethanol (EtOH) teratogenicity, but the protective role of the embryonic antioxidative enzyme catalase is unclear, as embryonic activity is only about 5% of maternal levels. We addressed this question in a whole embryo culture model. C57BL/6 mouse embryos expressing human catalase (hCat) or their wild-type (C57BL/6 WT) controls, and C3Ga.Cg-Cat(b)/J catalase-deficient, acatalasemic (aCat) mouse embryos or their wild-type C3HeB/FeJ (C3H WT) controls, were explanted on gestational day (GD) 9 (plug=GD 1), exposed for 24h to 2 or 4mg/mL EtOH or vehicle, and evaluated for functional and morphological changes. hCat and C57BL/6 WT vehicle-exposed embryos developed normally, while EtOH was embryopathic in C57BL/6 WT embryos, evidenced by decreases in anterior neuropore closure, somites developed, turning and head length, whereas hCat embryos were protected (pcatalase (PEG-cat) 8h prior to embryo culture, which increases embryonic catalase activity, blocked all EtOH embryopathies (pcatalase is a determinant of risk for EtOH embryopathies.

  9. Pretreatment of Mice with Oligonucleotide prop5 Protects Them from Influenza Virus Infections

    Directory of Open Access Journals (Sweden)

    Kang Li


    Full Text Available Influenza A virus is a successful parasite and requires host factors to complete its life cycle. Prop5 is an antisense oligonucleotide, targeting programmed cell death protein 5 (PDCD5. In this study, we tested the antiviral activity of prop5 against mouse-adapted A/FM/1/47 strain of influenza A virus in a mouse model. Prop5 intranasally administered the mice at dosages of 10 and 20 mg/kg/d at 24 h and 30 min before infection, provided 80% and 100% survival rates and prolonged mean survival days in comparison with influenza virus-infected mice (both p < 0.01. Moreover, viral titres in mice pretreated with prop5, at dose of 10 and 20 mg/kg/d, had declined significantly on day two, four, and six post-infection compared with the yields in infected mice (p < 0.05 or p < 0.01; lung index in mice pretreated with prop5 (20 mg/kg/d had been inhibited on day six post-infection (p < 0.05. Western blotting and immunohistochemistry showed that prop5 could down-regulate the PDCD5 protein expression levels in lung tissues of infected mice. These data indicate that antisense oligonucleotide prop5 is a promising drug for prophylaxis and control influenza virus infections and provides an insight into the host-pathogen interaction.

  10. The Protective Effects of Oral Low-dose Quercetin on Diabetic Nephropathy in Hypercholesterolemic Mice

    Directory of Open Access Journals (Sweden)

    Isabele Beserra Santos Gomes


    Full Text Available Aims: Diabetic nephropathy (DN is one of the major causes of end-stage renal disease, and the incidence of DN is increasing worldwide. Considering our previous report indicating that chronic treatment with oral low-dose quercetin (10 mg/Kg demonstrated renoprotective, anti-oxidative and anti-apoptotic effects in the C57BL/6J model of diabetic nephropathy, we investigated whether this flavonoid could also have beneficial effects in concurrent DN and spontaneous atherosclerosis using the apolipoprotein E-deficient mouse (apoE-/-. Methods: DN was induced by streptozotocin (100 mg/kg/day, for 3 days in adult apoE-/-mice. Six weeks later, the mice were divided into the following groups: diabetic apoE-/- mice treated with quercetin (DQ, 10 mg/kg/day, 4 weeks, diabetic ApoE-/- mice treated with vehicle (DV and non-treated non-diabetic (ND mice.Results: Quercetin treatment caused a reduction in polyuria (~30%, glycemia (~25%, abolished the hypertriglyceridemia and had significant effects on renal function, including decreased proteinuria (~15% and creatininemia (~30%, which were accompanied by beneficial effects on the renal structural changes, including normalization of the index of glomerulosclerosis and kidney weight.Conclusions: Our data revealed that quercetin treatment significantly reduced DN in hypercholesterolemic mice by inducing biochemical and morphological modifications. Thus, this translational study highlights the importance of quercetin as a potential nutraceutical for the management of DN, including in diabetes associated with dyslipidemia.

  11. Membrane Sealant Poloxamer P188 Protects Against Isoproterenol Induced Cardiomyopathy in Dystrophin Deficient Mice

    Directory of Open Access Journals (Sweden)

    Sali Arpana


    Full Text Available Abstract Background Cardiomyopathy in Duchenne muscular dystrophy (DMD is an increasing cause of death in patients. The absence of dystrophin leads to loss of membrane integrity, cell death and fibrosis in cardiac muscle. Treatment of cardiomyocyte membrane instability could help prevent cardiomyopathy. Methods Three month old female mdx mice were exposed to the β1 receptor agonist isoproterenol subcutaneously and treated with the non-ionic tri-block copolymer Poloxamer P188 (P188 (460 mg/kg/dose i.p. daily. Cardiac function was assessed using high frequency echocardiography. Tissue was evaluated with Evans Blue Dye (EBD and picrosirius red staining. Results BL10 control mice tolerated 30 mg/kg/day of isoproterenol for 4 weeks while death occurred in mdx mice at 30, 15, 10, 5 and 1 mg/kg/day within 24 hours. Mdx mice tolerated a low dose of 0.5 mg/kg/day. Isoproterenol exposed mdx mice showed significantly increased heart rates (p Conclusions This model suggests that chronic intermittent intraperitoneal P188 treatment can prevent isoproterenol induced cardiomyopathy in dystrophin deficient mdx mice.

  12. Exercise protects against diet-induced insulin resistance through downregulation of protein kinase Cβ in mice.

    Directory of Open Access Journals (Sweden)

    Xiaoquan Rao

    Full Text Available Physical exercise is an important and effective therapy for diabetes. However, its underlying mechanism is not fully understood. Protein kinase Cβ (PKCβ has been suggested to be involved in the pathogenesis of obesity and insulin resistance, but the role of PKCβ in exercise-induced improvements in insulin resistance is completely unknown. In this study, we evaluated the involvement of PKCβ in exercise-attenuated insulin resistance in high-fat diet (HFD-fed mice. PKCβ(-/- and wild-type mice were fed a HFD with or without exercise training. PKC protein expression, body and tissue weight change, glucose and insulin tolerance, metabolic rate, mitochondria size and number, adipose inflammation, and AKT activation were determined to evaluate insulin sensitivity and metabolic changes after intervention. PKCβ expression decreased in both skeletal muscle and liver tissue after exercise. Exercise and PKCβ deficiency can alleviate HFD-induced insulin resistance, as evidenced by improved insulin tolerance. In addition, fat accumulation and mitochondrial dysfunction induced by HFD were also ameliorated by both exercise and PKCβ deficiency. On the other hand, exercise had little effect on PKCβ(-/- mice. Further, our data indicated improved activation of AKT, the downstream signal molecule of insulin, in skeletal muscle and liver of exercised mice, whereas PKCβ deficiency blunted the difference between sedentary and exercised mice. These results suggest that downregulation of PKCβ contributes to exercise-induced improvement of insulin resistance in HFD-fed mice.

  13. Neuronal erythropoietin overexpression protects mice against age-related hearing loss (presbycusis). (United States)

    Naldi, Arianne Monge; Belfrage, Celina; Jain, Neha; Wei, Eric T; Martorell, Belén Canto; Gassmann, Max; Vogel, Johannes


    So far, typical causes of presbycusis such as degeneration of hair cells and/or primary auditory (spiral ganglion) neurons cannot be treated. Because erythropoietin's (Epo) neuroprotective potential has been shown previously, we determined hearing thresholds of juvenile and aged mice overexpressing Epo in neuronal tissues. Behavioral audiometry revealed in contrast to 5 months of age, that 11-month-old Epo-transgenic mice had up to 35 dB lower hearing thresholds between 1.4 and 32 kHz, and at the highest frequencies (50-80 kHz), thresholds could be obtained in aged Epo-transgenic only but not anymore in old C57BL6 control mice. Click-evoked auditory brainstem response showed similar results. Numbers of spiral ganglion neurons in aged C57BL6 but not Epo-transgenic mice were dramatically reduced mainly in the basal turn, the location of high frequencies. In addition, there was a tendency to better preservation of inner and outer hair cells in Epo-transgenic mice. Hence, Epo's known neuroprotective action effectively suppresses the loss of spiral ganglion cells and probably also hair cells and, thus, development of presbycusis in mice.

  14. Targeted deletion of Kif18a protects from colitis-associated colorectal (CAC) tumors in mice through impairing Akt phosphorylation. (United States)

    Zhu, Houbao; Xu, Wangyang; Zhang, Hongxin; Liu, Jianbing; Xu, Haimin; Lu, Shunyuan; Dang, Suying; Kuang, Ying; Jin, Xiaolong; Wang, Zhugang


    Kinesins are a superfamily of molecular motors involved in cell division or intracellular transport. They are becoming important targets for chemotherapeutic intervention of cancer due to their crucial role in mitosis. Here, we demonstrate that the kinesin-8 Kif18a is overexpressed in murine CAC and is a crucial promoter during early CAC carcinogenesis. Kif18a-deficient mice are evidently protected from AOM-DSS-induced colon carcinogenesis. Kif18A is responsible for proliferation of colonic tumor cells, while Kif18a ablation in mice promotes cell apoptosis. Mechanistically, Kif18a is responsible for induction of Akt phosphorylation, which is known to be associated with cell survival regulation. In conclusion, Kif18a is critical for colorectal carcinogenesis in the setting of inflammation by mechanisms of increased PI3K-AKT signaling. Inhibition of Kif18A activity may be useful in the prevention or chemotherapeutic intervention of CAC.

  15. A recombinant rabies vaccine expressing the trimeric form of the glycoprotein confers enhanced immunogenicity and protection in outbred mice. (United States)

    Koraka, Penelope; Bosch, Berend-Jan; Cox, Manon; Chubet, Rick; Amerongen, Geert van; Lövgren-Bengtsson, Karen; Martina, Byron E E; Roose, Jouke; Rottier, Peter J M; Osterhaus, Albert D M E


    Rabies is a disease characterized by an invariably lethal encephalitis of viral origin that can be controlled by preventive vaccination programs of wildlife, domestic animals and humans in areas with a high risk of exposure. Currently available vaccines are expensive, cumbersome to produce and require intensive immunization and booster schemes to induce and maintain protective immunity. In the present study, we describe the development of candidate recombinant subunit rabies vaccines based on the glycoprotein G of the prototype rabies virus (RABV-G) expressed either as a monomer (RABV-mG) or in its native trimeric configuration (RABV-tG), with or without Matrix-M™ adjuvant. Immunogenicity and protective efficacy of the respective candidate vaccines were tested in outbred NIH Swiss albino mice. The RABV-tG candidate vaccine proved to be superior to the RABV-mG vaccine candidate both in terms of immunogenicity and efficacy. The relatively poor immunogenicity of the RABV-mG vaccine candidate was greatly improved by the addition of the adjuvant. A single, low dose of RABV-tG in combination with Matrix-M™ induced high levels of high avidity neutralizing antibodies and protected all mice against challenge with a lethal dose of RABV. Consequently RABV-tG used in combination with Matrix-M™ is a promising vaccine candidate that overcomes the limitations of currently used vaccines.

  16. Protection against Pseudomonas aeruginosa lung infection in mice by recombinant OprF-pulsed dendritic cell immunization

    Directory of Open Access Journals (Sweden)

    De Luna Loredana


    Full Text Available Abstract Background The Pseudomonas aeruginosa major constitutive outer membrane porin protein F (OprF has been shown to be a protective antigen and was previously used to activate an immunological response in a mouse model of lung pneumonia. The purpose of our study was to demonstrate the ability of mouse dendritic cells pulsed with purified or recombinant OprF to protect mice against P. aeruginosa infection and inflammation. Both native (n-OprF, isolated and purified from PAO1 bacterial strain, and recombinant (histidin-conjugated OprF (His-OprF, obtained by cloning of the oprF gene into the pET28a expression vector, were used to stimulate dendritic cells in vitro before adoptive transfer into prospective recipient mice with P. aeruginosa pulmonary infection. Results Similar to n-OprF, His-OprF activated dendritic cells in vitro, inducing the costimulatory molecule expression as well as cytokine production. Upon adoptive transfer in vivo, porin-pulsed dendritic cells (DCs induced Th1-mediated resistance to infection and associated inflammatory pathology caused by either the PAO1 strain or a clinically-isolated mucoid strain. Conclusions This study highlights the pivotal contribution of DCs to vaccine-induced protection against P. aeruginosa infection and associated inflammation.

  17. Passive immunization with anti-ActA and anti-listeriolysin O antibodies protects against Listeria monocytogenes infection in mice (United States)

    Asano, Krisana; Sashinami, Hiroshi; Osanai, Arihiro; Hirose, Shouhei; Ono, Hisaya K.; Narita, Kouji; Hu, Dong-Liang; Nakane, Akio


    Listeria monocytogenes is an intracellular pathogen that causes listeriosis. Due to its intracellular niche, L. monocytogenes has evolved to limit immune recognition and response to infection. Antibodies that are slightly induced by listerial infection are completely unable to protect re-infection of L. monocytogenes. Thus, a role of antibody on the protective effect against L. monocytogenes infection has been neglected for a long time. In the present study, we reported that passive immunization with an excessive amount of antibodies against ActA and listeriolysin O (LLO) attenuates severity of L. monocytogenes infection. Combination of these antibodies improved survival of L. monocytogenes infected mice. Bacterial load in spleen and liver of listerial infected mice and infected RAW264.7 cells were significantly reduced by administration of anti-ActA and anti-LLO antibodies. In addition, anti-LLO antibody neutralized LLO activity and inhibited the bacterial escape from the lysosomal compartments. Moreover, anti-ActA antibody neutralized ActA activity and suppressed actin tail formation and cell-to-cell spread. Thus, our studies reveal that passive immunization with the excessive amount of anti-ActA and -LLO antibodies has potential to provide the protective effect against listerial infection. PMID:28004800

  18. Mucosal immunization with recombinant adenovirus encoding soluble globular head of hemagglutinin protects mice against lethal influenza virus infection. (United States)

    Kim, Joo Young; Choi, Youngjoo; Nguyen, Huan H; Song, Man Ki; Chang, Jun


    Influenza virus is one of the major sources of respiratory tract infection. Due to antigenic drift in surface glycoproteins the virus causes annual epidemics with severe morbidity and mortality. Although hemagglutinin (HA) is one of the highly variable surface glycoproteins of the influenza virus, it remains the most attractive target for vaccine development against seasonal influenza infection because antibodies generated against HA provide virus neutralization and subsequent protection against the virus infection. Combination of recombinant adenovirus (rAd) vector-based vaccine and mucosal administration is a promising regimen for safe and effective vaccination against influenza. In this study, we constructed rAd encoding the globular head region of HA from A/Puerto Rico/8/34 virus as vaccine candidate. The rAd vaccine was engineered to express high level of the protein in secreted form. Intranasal or sublingual immunization of mice with the rAd-based vaccine candidates induced significant levels of sustained HA-specific mucosal IgA and IgG. When challenged with lethal dose of homologous virus, the vaccinated mice were completely protected from the infection. The results demonstrate that intranasal or sublingual vaccination with HA-encoding rAd elicits protective immunity against infection with homologous influenza virus. This finding underlines the potential of our recombinant adenovirus-based influenza vaccine candidate for both efficacy and rapid production.

  19. Induction of a protective response in mice by the dengue virus NS3 protein using DNA vaccines.

    Directory of Open Access Journals (Sweden)

    Simone M Costa

    Full Text Available The dengue non-structural 3 (NS3 is a multifunctional protein, containing a serino-protease domain, located at the N-terminal portion, and helicase, NTPase and RTPase domains present in the C-terminal region. This protein is considered the main target for CD4+ and CD8+ T cell responses during dengue infection, which may be involved in protection. However, few studies have been undertaken evaluating the use of this protein as a protective antigen against dengue, as well as other flavivirus. In the present work, we investigate the protective efficacy of DNA vaccines based on the NS3 protein from DENV2. Different recombinant plasmids were constructed, encoding either the full-length NS3 protein or only its functional domains (protease and helicase, fused or not to a signal peptide (t-PA. The recombinant proteins were successfully expressed in transfected BHK-21 cells, and only plasmids encoding the t-PA signal sequence mediated protein secretion. Balb/c mice were immunized with the different DNA vaccines and challenged with a lethal dose of DENV2. Most animals immunized with plasmids encoding the full-length NS3 or the helicase domain survived challenge, regardless of the presence of the t-PA. However, some mice presented clinical signs of infection with high morbidity (hind leg paralysis and hunched posture, mainly in animal groups immunized with the DNA vaccines based on the helicase domain. On the other hand, inoculation with plasmids encoding the protease domain did not induce any protection, since mortality and morbidity rates in these mouse groups were similar to those detected in the control animals. The cellular immune response was analyzed by ELISPOT with a specific-CD8+ T cell NS3 peptide. Results revealed that the DNA vaccines based on the full-length protein induced the production of INF-γ, thus suggesting the involvement of this branch of the immune system in the protection.

  20. Induction of a protective response in mice by the dengue virus NS3 protein using DNA vaccines. (United States)

    Costa, Simone M; Yorio, Anna Paula; Gonçalves, Antônio J S; Vidale, Mariana M; Costa, Emmerson C B; Mohana-Borges, Ronaldo; Motta, Marcia A; Freire, Marcos S; Alves, Ada M B


    The dengue non-structural 3 (NS3) is a multifunctional protein, containing a serino-protease domain, located at the N-terminal portion, and helicase, NTPase and RTPase domains present in the C-terminal region. This protein is considered the main target for CD4+ and CD8+ T cell responses during dengue infection, which may be involved in protection. However, few studies have been undertaken evaluating the use of this protein as a protective antigen against dengue, as well as other flavivirus. In the present work, we investigate the protective efficacy of DNA vaccines based on the NS3 protein from DENV2. Different recombinant plasmids were constructed, encoding either the full-length NS3 protein or only its functional domains (protease and helicase), fused or not to a signal peptide (t-PA). The recombinant proteins were successfully expressed in transfected BHK-21 cells, and only plasmids encoding the t-PA signal sequence mediated protein secretion. Balb/c mice were immunized with the different DNA vaccines and challenged with a lethal dose of DENV2. Most animals immunized with plasmids encoding the full-length NS3 or the helicase domain survived challenge, regardless of the presence of the t-PA. However, some mice presented clinical signs of infection with high morbidity (hind leg paralysis and hunched posture), mainly in animal groups immunized with the DNA vaccines based on the helicase domain. On the other hand, inoculation with plasmids encoding the protease domain did not induce any protection, since mortality and morbidity rates in these mouse groups were similar to those detected in the control animals. The cellular immune response was analyzed by ELISPOT with a specific-CD8+ T cell NS3 peptide. Results revealed that the DNA vaccines based on the full-length protein induced the production of INF-γ, thus suggesting the involvement of this branch of the immune system in the protection.

  1. Embryonic catalase protects against ethanol embryopathies in acatalasemic mice and transgenic human catalase-expressing mice in embryo culture

    Energy Technology Data Exchange (ETDEWEB)

    Miller-Pinsler, Lutfiya [Department of Pharmacology and Toxicology, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada); Wells, Peter G., E-mail: [Division of Biomolecular Sciences, Faculty of Pharmacy, University of Toronto, Toronto, Ontario (Canada); Department of Pharmacology and Toxicology, Faculty of Medicine, University of Toronto, Toronto, Ontario (Canada)


    Reactive oxygen species (ROS) have been implicated in the mechanism of ethanol (EtOH) teratogenicity, but the protective role of the embryonic antioxidative enzyme catalase is unclear, as embryonic activity is only about 5% of maternal levels. We addressed this question in a whole embryo culture model. C57BL/6 mouse embryos expressing human catalase (hCat) or their wild-type (C57BL/6 WT) controls, and C3Ga.Cg-Cat{sup b}/J catalase-deficient, acatalasemic (aCat) mouse embryos or their wild-type C3HeB/FeJ (C3H WT) controls, were explanted on gestational day (GD) 9 (plug = GD 1), exposed for 24 h to 2 or 4 mg/mL EtOH or vehicle, and evaluated for functional and morphological changes. hCat and C57BL/6 WT vehicle-exposed embryos developed normally, while EtOH was embryopathic in C57BL/6 WT embryos, evidenced by decreases in anterior neuropore closure, somites developed, turning and head length, whereas hCat embryos were protected (p < 0.001). Maternal pretreatment of C57BL/6 WT dams with 50 kU/kg PEG-catalase (PEG-cat) 8 h prior to embryo culture, which increases embryonic catalase activity, blocked all EtOH embryopathies (p < 0.001). Vehicle-exposed aCat mouse embryos had lower yolk sac diameters compared to WT controls, suggesting that endogenous ROS are embryopathic. EtOH was more embryopathic in aCat embryos than WT controls, evidenced by reduced head length and somite development (p < 0.01), and trends for reduced anterior neuropore closure, turning and crown–rump length. Maternal pretreatment of aCat dams with PEG-Cat blocked all EtOH embryopathies (