WorldWideScience

Sample records for ochrobactrum lupini dg-s-01

  1. Determinants of Plant Growth-promoting Ochrobactrum lupini KUDC1013 Involved in Induction of Systemic Resistance against Pectobacterium carotovorum subsp. carotovorum in Tobacco Leaves

    Directory of Open Access Journals (Sweden)

    Marilyn Sumayo

    2013-06-01

    Full Text Available The plant growth-promoting rhizobacterium Ochrobactrum lupini KUDC1013 elicited induced systemic resistance (ISR in tobacco against soft rot disease caused by Pectobacterium carotovorum subsp. carotovorum. We investigated of its factors involved in ISR elicitation. To characterize the ISR determinants, KUDC1013 cell suspension, heat-treated cells, supernatant from a culture medium, crude bacterial lipopolysaccharide (LPS and flagella were tested for their ISR activities. Both LPS and flagella from KUDC1013 were effective in ISR elicitation. Crude cell free supernatant elicited ISR and factors with the highest ISR activity were retained in the n-butanol fraction. Analysis of the ISR-active fraction revealed the metabolites, phenylacetic acid (PAA, 1-hexadecene and linoleic acid (LA, as elicitors of ISR. Treatment of tobacco with these compounds significantly decreased the soft rot disease symptoms. This is the first report on the ISR determinants by plant growth-promoting rhizobacteria (PGPR KUDC1013 and identifying PAA, 1-hexadecene and LA as ISR-related compounds. This study shows that KUDC1013 has a great potential as biological control agent because of its multiple factors involved in induction of systemic resistance against phytopathogens.

  2. Dgroup: DG00808 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ride (JP17/USP) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01674 ... Esterified local anesthetic... ... DG01675 ... Local anesthetic ... DG01674 ... Esterified local anesthetic Cyp inhibitor ... DG0...1645 ... CYP2D6 inhibitor ATC code: N01BC01 R02AD03 S01HA01 S02DA02 Anesthetic (topi

  3. Dgroup: DG00297 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ine (INN) D02220 ... Dibucaine hydrochloride (JP17/USP) Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic... ... DG01673 ... Amide type local anesthetic ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic... ATC code: C05AD04 D04AB02 N01BB06 S01HA06 S02DA04 Anesthetic (loc

  4. Dgroup: DG00298 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hloride (JP17/USP) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01674 ... Esterified local anestheti...c ... DG01675 ... Local anesthetic ... DG01674 ... Esterified local anesthetic ATC code: C05AD05 N01BA02 S01HA05 Anesth...etic (local) Ester-type SCN1A [HSA:6323] [KO:K04833] SCN

  5. Dgroup: DG00296 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ine hydrochloride (JP17/USP) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... ...DG01674 ... Esterified local anesthetic ... DG01675 ... Local anesthetic ... DG01674 ... Esterified local anesthetic ATC c...ode: C05AD02 D04AB06 N01BA03 S01HA03 Anesthetic (local) Ester-type SCN1A [HSA:632

  6. Dgroup: DG00806 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ne hydrochloride (USP); Ropivacaine hydrochloride hydrate (JAN) ... Neuropsychiatric agent ... DG02030 ... Anesthetic...s ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesth...etic Cyp substrate ... DG01892 ... CYP1A2 substrate ATC code: N01BB09 Anesthetic

  7. Dgroup: DG00797 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available propofol disodium (USAN) Neuropsychiatric agent ... DG01567 ... GABA-A receptor agonist ... DG02030 ... Anesthetics ... DG02027 ... General anesthetic...s ... DG02027 ... General anesthetics ATC code: N01AX10 General anesthetics GABRA/GABRB/G

  8. Dgroup: DG02026 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02026 DGroup Opioid anesthetics ... DG00791 ... Fentanyl ... D00320 ... Fentanyl (JAN/USAN/... ... D08473 ... Remifentanil (INN) ... D01177 ... Remifentanil hydrochloride (JAN/USAN) ... Neuropsychiatric agent ... DG02030 ... Anesthetic...s ... DG02027 ... General anesthetics ... DG02027 ... General anesthetics ATC code: N01AH General anesthetics Phenylpiperidine derivative ...

  9. Dgroup: DG02574 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available derivative ... DG01961 ... Prostaglandin derivative ... DG01960 ... Prostaglandin F derivative ATC code: S01EE01 Antiglaucoma, Prostaglandin F receptor agonist PTGFR [HSA:5737] [KO:K04262] ...

  10. Dgroup: DG00803 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available JAN) D01243 ... Prilocaine hydrochloride (USP); Propitocaine hydrochloride (JAN) ... Neuropsychiatric agent ... DG02030 ... Anesthetic...s ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic ... DG01675 ... Local anesthetic... ... DG01673 ... Amide type local anesthetic Other ... DG01575 ... Calcium channel block...er ... DG01573 ... Calcium channel T type blocker ATC code: N01BB04 Local anesthetics voltage-gated Ca2+ channel

  11. Prevalence, Host Range, and Comparative Genomic Analysis of Temperate Ochrobactrum Phages

    Directory of Open Access Journals (Sweden)

    Claudia Jäckel

    2017-06-01

    Full Text Available Ochrobactrum and Brucella are closely related bacteria that populate different habitats and differ in their pathogenic properties. Only little is known about mobile genetic elements in these genera which might be important for survival and virulence. Previous studies on Brucella lysogeny indicated that active phages are rare in this genus. To gain insight into the presence and nature of prophages in Ochrobactrum, temperate phages were isolated from various species and characterized in detail. In silico analyses disclosed numerous prophages in published Ochrobactrum genomes. Induction experiments showed that Ochrobactrum prophages can be induced by various stress factors and that some strains released phage particles even under non-induced conditions. Sixty percent of lysates prepared from 125 strains revealed lytic activity. The host range and DNA similarities of 19 phages belonging to the families Myoviridae, Siphoviridae, or Podoviridae were determined suggesting that they are highly diverse. Some phages showed relationship to the temperate Brucella inopinata phage BiPB01. The genomic sequences of the myovirus POA1180 (41,655 bp and podovirus POI1126 (60,065 bp were analyzed. Phage POA1180 is very similar to a prophage recently identified in a Brucella strain isolated from an exotic frog. The POA1180 genome contains genes which may confer resistance to chromate and the ability to take up sulfate. Phage POI1126 is related to podoviruses of Sinorhizobium meliloti (PCB5, Erwinia pyrifoliae (Pep14, and Burkholderia cenocepacia (BcepIL02 and almost identical to an unnamed plasmid of the Ochrobactrum intermedium strain LMG 3301. Further experiments revealed that the POI1126 prophage indeed replicates as an extrachromosomal element. The data demonstrate for the first time that active prophages are common in Ochrobactrum and suggest that atypical brucellae also may be a reservoir for temperate phages.

  12. Dgroup: DG00796 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hloride (JP17/USP) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02027 ... General anesthetic...s ... DG01498 ... NMDA receptor antagonist ATC code: N01AX03 General anesthetics GRIN (NMDAR) [HSA:2902 2903 2904 2905 2906] [KO:K05208 K05209 K05210 K05211 K05212] ...

  13. Isolation of Ochrobactrum sp.QZ2 from sulfide and nitrite treatment system

    International Nuclear Information System (INIS)

    Mahmood, Qaisar; Hu Baolan; Cai Jing; Zheng Ping; Azim, Muhammad Rashid; Jilani, Ghulam; Islam, Ejazul

    2009-01-01

    A bacterial strain QZ2 was isolated from sludge of anoxic sulfide-oxidizing (ASO) reactor. Based on 16S rDNA sequence analysis and morphology, the isolate was identified as Ochrobactrum sp. QZ2. The strain was facultative chemolithotroph, able of using sulfide to reduce nitrite anaerobically. It produced either elemental sulfur or sulfate as the product of sulfide oxidation, depending on the initial sulfide and nitrite concentrations. The optimum growth pH and temperature for Ochrobactrum sp. QZ2 were found as 6.5-7.0 and 30 deg. C, respectively. The specific growth rate (μ) was found as 0.06 h -1 with a doubling time of 19.75 h; the growth seemed more sensitive to highly alkaline pH. Ochrobactrum sp. QZ2 catalyzed sulfide oxidation to sulfate was more sensitive to sulfide compared with nitrite as indicated by IC 50 values for sulfide and nitrite utilization implying that isolate was relatively more tolerant to nitrite. The comparison of physiology of Ochrobactrum sp. QZ2 with those of other known sulfide-oxidizing bacteria suggested that the present isolate resembled to Ochrobactrum anthropi in its denitrification ability.

  14. Dgroup: DG00789 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hohexital sodium (USP) ... Neuropsychiatric agent ... DG01837 ... Barbiturate sedative-hypnotics ... DG02030 ... Anesthetics... ... DG02027 ... General anesthetics ... DG02025 ... Barbiturate anesthetics ... DG02027 ... General anesthetics ... DG020...25 ... Barbiturate anesthetics ... DG02025 ... Barbiturate anesthetics ATC code: N01AF01 N05CA15 General anesthetics ...

  15. Bacteriemia relacionada a catéter por Ochrobactrum anthropi Catheter-associated bacteremia caused by Ochrobactrum anthropi

    Directory of Open Access Journals (Sweden)

    Rolando Soloaga

    2009-12-01

    Full Text Available Ochrobactrum anthtropi es un bacilo gram negativo aeróbico, no fermentador de la glucosa, anteriormente conocido como Achromobacter sp o CDC grupo Vd. Ha sido aislado del medio ambiente y de infecciones en seres humanos que generalmente presentaban algún tipo de inmunocompromiso. Las infecciones por este microorganismo fueron bacteriemias relacionadas a catéteres y en ocasiones endoftalmitis, infecciones urinarias, meningitis, endocarditis, absceso hepático, osteocondritis, absceso pelviano y absceso pancreático. Se presenta el caso de un paciente de sexo masculino, de 69 años de edad, que consultó a la guardia por hipotensión sostenida y síndrome febril de cuatro días de evolución, escalofrío, sudoración profusa y deterioro del sensorio. El paciente tenía diabetes de tipo 2 y antecedente de accidente cerebrovascular. Debido a insuficiencia renal crónica presentaba un catéter de doble lumen para la diálisis. Se documentó una bacteriemia relacionada a catéter por cultivo de sangre a través de catéter y de vena periférica, utilizando el sistema automatizado de hemocultivos Bact-Alert y la metodología de tiempo diferencial (>120min. La confirmación se realizó, una vez removido el catéter, por la técnica semicuantitativa de Maki (> 15 UFC. El microorganismo fue identificado por API 20NE y Vitek 1 como Ochrobactrum anthropi.Ochrobactrum anthropi is a non-glucose fermentative, aerobic gram-negative bacillus, formerly known as Achromobacter sp or CDC group Vd. It has been isolated from the environment and from infections in usually immunocompromised human beings. The documented infections frequently involved catheter related bacteremia whereas endophthalmitis, urinary infections, meningitis, endocarditis, hepatic abscess, osteochondritis, pelvic abscess and pancreatic abscess were rarely involved. Here it is presented the case of a male patient aged 69 years with sustained hypotension, four day febrile syndrome, chill, lavish

  16. Mushroom tumor: a new disease on Flammulina velutipes caused by Ochrobactrum pseudogrignonense.

    Science.gov (United States)

    Wu, Zhipeng; Peng, Weihong; He, Xiaolan; Wang, Bo; Gan, Bingcheng; Zhang, Xiaoping

    2016-01-01

    Mushroom tumor on Flammulina velutipes has become the main disease during the off-season cultivation of F. velutipes while the causal organism has remained unknown. The present study was aimed at identifying the pathogen confirming its pathogenisity following Koch's Postulates, characterizing it using morphological, physiological, biochemical and molecular features, and studying its current distribution. We determined that mushroom tumor is a new bacterial infection disease caused by Ochrobactrum pseudogrignonense. It produces tumor-like structures on the surface of the substrate, and inhibits the formation of primordia and fruiting of F. velutipes. The molecular studies showed that this new pathogen is closely related to Ochrobactrum based on 16S rRNA sequences. This is the first time that Ochrobactrum has been shown to be a pathogen of a mushroom. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  17. Dgroup: DG00801 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available OMT substrate Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic... ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic... Cyp substrate ... DG01633 ... CYP3A substrate ATC code: N01BB01 Local anesthetics Xylidine SCN1A [HSA:6323] [K

  18. Dgroup: DG01674 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01674 DGroup Esterified local anesthetic -caine ... C17723 ... Metabutethamine DG00298...oride (JP17/USP) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01675 ... Local anesthetic ATC code: N01BA N01BC Local anesthetic ...

  19. Dgroup: DG00686 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available Cytarabine ocfosphate hydrate (JAN) ... D03637 ... Cytarabine hydrochloride (USAN) Antineoplastic ... DG01958 ... Nuc...leic acid derivative, antineoplastic ... DG01439 ... Arabinofuranosyl type antineoplastic ... DG01439 ... Arabinofuranosyl type antineoplastic...acid derivative, antineoplastic ... DG01439 ... Arabinofuranosyl type antineoplastic ATC code: L01BC01 Antineoplastics, Antimetabolite DNA polymerase ... ... Unclassified ... DG02018 ... Antimetabolite ... DG01958 ... Nucleic

  20. Dgroup: DG00006 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ate (USP) Antiparasitic ... DG01884 ... Imidazole antiprotozoal Cyp substrate ... DG01638 ... CYP2A6 substrate Cyp inhib...itor ... DG01643 ... CYP2C9 inhibitor ATC code: A01AB17 D06BX01 G01AF01 J01XD01 P01AB01 Antiprotozoa

  1. Dgroup: DG00452 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available nist ... DG01468 ... Dopamine D2-receptor agonist ... DG01964 ... Ergot alkaloid ... DG01967 ... Antiparkinson agent Cyp subs...trate ... DG01633 ... CYP3A substrate ATC code: G02CB01 N04BC01 Antiparkinsonian, Dopam

  2. Dgroup: DG00793 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available anil citrate (USP) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics... ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ... DG01564 ... Opioid receptor a...gonist ... DG01563 ... mu-Opioid receptor agonist Analgesic ... DG01984 ... Opioid analgesics ATC code: N01AH03 General anesthetics OPRM1 [HSA:4988] [KO:K04215] ...

  3. Dgroup: DG00790 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available (JP17/USP/INN) ... Neuropsychiatric agent ... DG01837 ... Barbiturate sedative-hypnotics ... DG02030 ... Anesthetics ... D...G02027 ... General anesthetics ... DG02025 ... Barbiturate anesthetics ... DG02027 ... General anesthetics ... DG02025 ... Barbiturate anesthetics... ... DG02025 ... Barbiturate anesthetics ATC code: N01AF03 N05CA19 General anesthetics ...

  4. Dgroup: DG00794 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ridine hydrochloride (USP) Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics... ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ATC code: N01AH05 General anesthetics ...

  5. Dgroup: DG01994 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D04237 ... Fluroxene (USAN) Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesth...etics ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetics ATC code: N01AB Inhalation anesthetic ...

  6. Dgroup: DG00800 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available oroprocaine hydrochloride (USP) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... ... DG01674 ... Esterified local anesthetic ... DG01675 ... Local anesthetic ... DG01674 ... Esterified local anesthetic ATC code: N01BA04 Anestheti

  7. Dgroup: DG00804 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available aine hydrochloride Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic... ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic ATC code: N01BB07 Local anesthetic

  8. Dgroup: DG00805 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available rochloride (USAN) Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic... ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic ATC code: N01BB08 Local anesthetic

  9. Dgroup: DG02025 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02025 DGroup Barbiturate anesthetics ... DG00789 ... Methohexital ... D04985 ... Methohexit...iamylal sodium (JP17) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics... ... DG02027 ... General anesthetics ATC code: N01AF General anesthetics ...

  10. Dgroup: DG00807 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available evobupivacaine hydrochloride (JAN/USAN) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic... ... DG01673 ... Amide type local anesthetic ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic... Cyp substrate ... DG01892 ... CYP1A2 substrate ... DG01633 ... CYP3A substrate ATC code: N01BB10 Anesthetic

  11. Dgroup: DG00792 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hydrochloride (USP) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics... ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ... DG01564 ... Opioid receptor ...agonist ... DG01563 ... mu-Opioid receptor agonist ATC code: N01AH02 General anesthetics OPRM1 [HSA:4988] [KO:K04215] Enzyme: CYP3A [HSA:1576 1577 1551] ...

  12. Dgroup: DG00687 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 974 ... Fluorouracil sodium salt Antineoplastic ... DG01958 ... Nucleic acid derivative, antineoplastic ... DG01935 ... Fluoropyrimidine antineopla...stic ... DG01935 ... Fluoropyrimidine antineoplastic Unclassified ... DG02018 ... Antimetabolit...e ... DG01958 ... Nucleic acid derivative, antineoplastic ... DG01935 ... Fluoropyrimidine antineoplastic... ATC code: L01BC02 Antineoplastics, Antimetabolite TYMS [HSA:7298] [KO:K00560] Enzyme: DPYD [HSA:1806] ...

  13. Dgroup: DG00688 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available itabine hydrochloride (JAN/USAN) ... D10222 ... Gemcitabine elaidate (USAN/INN) Antineoplastic ... DG01958 ... Nucleic... acid derivative, antineoplastic ... DG01439 ... Arabinofuranosyl type antineoplastic ... DG01439 ... Arabinofuranosyl type antineoplastic...ic ... DG01439 ... Arabinofuranosyl type antineoplastic ATC code: L01BC05 Antineoplastics, Antimetabolite RRM1 [HSA:6240] [KO:K10807] ... ... Unclassified ... DG02018 ... Antimetabolite ... DG01958 ... Nucleic acid derivative, antineoplast

  14. Dgroup: DG00982 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available or ... DG01968 ... Agents for Alzheimer-type dementia Cyp substrate ... DG01892 ... CYP1A2 substrate ATC code: N06DA01 Anti-Alzheimer...ride (USP) Neuropsychiatric agent ... DG01595 ... Cholinesterase inhibitor ... DG01593 ... Acetylcholinesterase inhibit

  15. Dgroup: DG00102 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hentermine hydrochloride (USP) ... Other ... DG01706 ... Antiobesity ... DG01705 ... Anoretic ... DG01704 ... Phenethylamine anorexic ATC code: A08AA01 Phenethylamine type anorexics ...

  16. Dgroup: DG00851 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available antagonist ... DG01745 ... Anticholinergic antiparkinson agent ... DG01967 ... Antiparkinson agent ... DG01745 ... Anticholinergic antiparkinson... agent ATC code: N04AA01 Anticholinergics, Antiparkinsonian ag

  17. Dgroup: DG00685 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ne phosphate (JAN/USP) ... Antineoplastic ... DG01958 ... Nucleic acid derivative, antineoplastic ... DG01439 ... Arabin...ofuranosyl type antineoplastic ... DG01439 ... Arabinofuranosyl type antineoplastic Unclassified ... DG02018 ... Antimet...abolite ... DG01958 ... Nucleic acid derivative, antineoplastic ... DG01439 ... Arabinofuranosyl type antineoplasti...c ATC code: L01BB05 Antineoplastics, Antimetabolite RRM [HSA:6240 6241 50484] [KO:K10807 K10808] DNA polymerase RNA polymerase ...

  18. Dgroup: DG00684 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00684 Chemical ... DGroup Tioguanine ... D08603 ... Tioguanine (INN) D06109 ... Thioguanine (USP) ... Antineoplastic... ... DG01958 ... Nucleic acid derivative, antineoplastic Unclassified ... DG02018 ... Antimetabo...lite ... DG01958 ... Nucleic acid derivative, antineoplastic ATC code: L01BB03 Antineoplastics, Antimetabolite ...

  19. Dgroup: DG00859 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available eceptor antagonist ... DG01745 ... Anticholinergic antiparkinson agent ... DG01967 ... Antiparkinson agent ... DG01745 ... Anticholinergic antiparkins...on agent ATC code: N04AC01 Anticholinergics, Antiparkinson

  20. Dgroup: DG00112 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00112 Chemical ... DGroup Phenformin ... D08351 ... Phenformin (BAN) D08352 ... Phenformin hydrochloride Antidiabeti...c agent ... DG01685 ... Insulin sensitizer ... DG01684 ... Biguanide antidiabetic Cyp substrat...e ... DG01644 ... CYP2D6 substrate Unclassified ... DG02044 ... Hypoglycemics ... DG01684 ... Biguanide antidiabetic ATC code...: A10BA01 Biganide antidiabetics AMPK (PRKAA) [HSA:5562 5563] [KO:K07198] Enzyme: CYP2D6 [HSA:1565] ...

  1. Dgroup: DG02379 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02379 Chemical ... DGroup Brinzolamide ... D00652 ... Brinzolamide (JAN/USP/INN) ... ATC code: S01EC04 Antiglauco...ma, Carbonic anhydrase inhibitor CA2 [HSA:760] [KO:K18245] ...

  2. Dgroup: DG00593 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00593 Chemical ... DGroup Doripenem ... D03895 ... Doripenem (USAN/INN) ... D01836 ... Doripene...m hydrate (JAN) ... Antibacterial ... DG01710 ... beta-Lactam antibiotic ... DG01713 ... Penicillin skeleton group ... DG01458 ... Carbapene...m ATC code: J01DH04 beta-Lactam antibiotics, carbapenem penicillin binding protein ...

  3. Dgroup: DG00592 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00592 Chemical ... DGroup Ertapenem ... D07908 ... Ertapenem (INN) D04049 ... Ertapenem sod...ium (USAN) ... Antibacterial ... DG01710 ... beta-Lactam antibiotic ... DG01713 ... Penicillin skeleton group ... DG01458 ... Carbapene...m ATC code: J01DH03 beta-Lactam antibiotics, carbapenem penicillin binding protein ...

  4. Dgroup: DG01282 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 601 ... DPP-4 inhibitor ... DPP4 inhibitor, antidiabetics DPP4 [HSA:1803] [KO:K01278] ... ...tin tartrate (USAN) Antidiabetic agent ... DG01601 ... DPP-4 inhibitor Unclassified ... DG02044 ... Hypoglycemics ... DG01... DG01282 Chemical ... DGroup Dutogliptin ... D09333 ... Dutogliptin (USAN) D09334 ... Dutoglip

  5. Dgroup: DG00798 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 66 ... Sodium oxybate (USAN) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02027 ... General anesthetics ATC code: N01AX11 N07XX04 General anesthetics ...

  6. Dgroup: DG00122 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available Dapagliflozin propanediol (USAN); Dapagliflozin propylene glycolate hydrate (JAN) ... Antidiabetic agent ... DG0...1794 ... SGLT2 inhibitor Unclassified ... DG02044 ... Hypoglycemics ... DG01794 ... SGLT2 inhibitor ATC code: A10BK01 Antidiabetic

  7. Dgroup: DG00115 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 7 ... Tolbutamide sodium, sterile Antidiabetic agent ... DG01790 ... Sulfonamide hypoglycemic ... DG01734 ... Sulfonamide ... ... DG01734 ... Sulfonamide type sulfonylurea receptor agonist ATC code: A10BB03 V04CA01 Antidiabetic, sulfonylu

  8. Dgroup: DG00702 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available rubicin hydrochloride ... Antineoplastic ... DG01682 ... Anthracycline antineoplastic Other ... DG01529 ... Topoisomerase... inhibitor ... DG01527 ... Topoisomerase II inhibitor ATC code: L01DB08 Antineoplastic antibiotics TOP2 [HSA:7153 7155] [KO:K03164] ...

  9. Dgroup: DG01147 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01147 Chemical ... DGroup Rose bengal sodium ... D05762 ... Rose bengal sodium I 125 (US...AN) D05763 ... Rose bengal sodium I 131 (USP) ... ATC code: S01JA02 Ophthalmic diagnostic agents ...

  10. Dgroup: DG00864 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available se B inhibitor ... DG01967 ... Antiparkinson agent Cyp substrate ... DG01644 ... CYP2D6 substrate ... DG01633 ... CYP3A substr...ate ATC code: N04BD01 Antidepressant, Antiparkinsonian, Monoamine oxidase B (MAO-

  11. Dgroup: DG00700 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hydrochloride (JP17/USP) ... Antineoplastic ... DG01682 ... Anthracycline antineoplastic Other ... DG01529 ... Topoisomer...ase inhibitor ... DG01527 ... Topoisomerase II inhibitor ATC code: L01DB06 Antineoplastic antibiotics TOP2 [HSA:7153 7155] [KO:K03164] ...

  12. Dgroup: DG00698 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hydrochloride (JP17/USAN) ... Antineoplastic ... DG01682 ... Anthracycline antineoplastic Other ... DG01529 ... Topoisome...rase inhibitor ... DG01527 ... Topoisomerase II inhibitor ATC code: L01DB03 Antineoplastic antibiotics TOP2 [HSA:7153 7155] [KO:K03164] ...

  13. Dgroup: DG01132 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ucoma agents; Agents for Alzheimer-type dementia ACHE [HSA:43] [KO:K01049] ... ...esterase inhibitor ... DG01593 ... Acetylcholinesterase inhibitor ATC code: S01EB05 V03AB19 Acetylcholinesterase (AChE) inhibitor, Antigla

  14. DG CONNECT’s stakeholder engagement strategy

    NARCIS (Netherlands)

    Verheyden, M.; Glidden, J.; Shahin, J.

    2013-01-01

    How do we ensure that public policy represents the interests of all, rather than a select few? How will we ensure it draws upon the best insights and talents of key stakeholders? The European Commission’s DG CONNECT recently announced the results of its Stakeholder Engagement Survey, which is

  15. And the World Turned: Spin Testing the DG-1000S

    Science.gov (United States)

    2015-10-01

    mainly glass-fiber reinforced plastic, with steel as necessary for the landing gear. Load factor limits are +7/- 5g . Manufactured in Germany, the DG...Forward CG’s carry an additional type of risk for spin testing: structural failure due to over- speed /overload. After spin entry, if the aircraft’s...become “sloppy” in the DG-1000S near stall speed , careful attention to the yaw string was required for coordinated flight: anything less tended to cause

  16. Dgroup: DG00877 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 905 ... Phenothiazine antipsychotics ... DG01478 ... Dopamine antagonist ... DG01474 ... Dopamine D2-receptor antagonist ATC code: N05AB06 Phenothiazine antipsychotics DRD2 [HSA:1813] [KO:K04145] ... ...rifluoperazine hydrochloride (JAN/USP) ... D01448 ... Trifluoperazine maleate (JAN) Neuropsychiatric agent ... DG01

  17. Dgroup: DG00994 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ATC code: N07BA01 Nicotine dependence agent ... Enzyme: CYP2A6 [HSA:1548] CYP induction: CYP1A2 [HSA:1544] ...artrate (USAN) ... D05157 ... Nicotine polacrilex (USAN) Other ... DG01718 ... Drugs for addictive disorder ... DG01715 ... Drugs for nicotine depen...dence Cyp substrate ... DG01638 ... CYP2A6 substrate Cyp inducer ... DG01637 ... CYP1A2 inducer

  18. Dgroup: DG00809 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available rochloride (USP) Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01675 ... Local anesthetic... ATC code: N01BX02 R02AD04 Anesthetic (topical) SCN1A [HSA:6323] [KO:K04833] SCN2A [HSA:6326] [KO:K0

  19. Dgroup: DG00322 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01928 ... Dihydropyridine calcium channel blocker Other ... DG01575 ... Calcium channel blocker ... DG01496 ... Calcium channel L type block...1522 ... CYP3A4 inhibitor ATC code: C08CA01 Dihydropyridine calcium channel blocker CACNA1-L [HSA:775 776 778 7

  20. Dgroup: DG00791 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available tanyl citrate (JP17/USP) ... D10811 ... Fentanyl hydrochloride (JAN) Neuropsychiatric agent ... DG02030 ... Anesthetic...s ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetic

  1. Dgroup: DG00860 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hydrochloride (JP17/USP) ... Neuropsychiatric agent ... DG01498 ... NMDA receptor antagonist ... DG01967 ... Antiparkinson... agent ATC code: N04BB01 Antiviral, M2 protein inhibitor, Antiparkinsonian, Dopamine secretagogue Adamantan

  2. Bacteriemia por Ochrobactrum anthropi en paciente con obstrucción de la vía biliar Bacteraemia by Ochrobactrum anthropi in patient with biliary obstruction

    Directory of Open Access Journals (Sweden)

    Sigifredo Ospina

    2009-12-01

    Full Text Available Reporte de caso de bacteriemia por Ochrobactrum anthropi con probable hepatitis bacteriana asociada, en un paciente inmunocompetente, el cual ingresa por sospecha de colangitis y obstrucción biliar. O. anthropi es una bacteria emergente en infecciones intrahospitalarias con notable resistencia antimicrobiana, y es un patógeno inusual en humanos.A case report of bacteraemia by Ochrobactrum anthropi probably associated with bacterial hepatitis, in a inmuno competent patient, who was admitted to the hospital with the diagnostic impression of cholangitis and biliary obstruction. O. anthropi is an emerging bacteria in nosocomial infections with remarkable antimicrobial resistance, being an unusual pathogen in humans.

  3. Dgroup: DG00591 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00591 Chemical ... DGroup Meropenem ... D08185 ... Meropenem (INN) D02222 ... Meropenem (USP); Meropene...n group ... DG01458 ... Carbapenem ATC code: J01DH02 beta-Lactam antibiotics, carbapenem penicillin binding protein ...

  4. Dgroup: DG00986 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available rochloride (JAN/USAN) ... Neuropsychiatric agent ... DG01498 ... NMDA receptor antagonist ... DG01968 ... Agents for Alzheimer...-type dementia ATC code: N06DX01 Anti-Alzheimer's agent, Anticholinesterase agent GRIN (NMDAR) [HSA:290

  5. Dgroup: DG00109 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00109 Chemical ... DGroup Diastase ... D03329 ... Diastase (JP17) ... D08705 ... Digestive enzyme derived from asperg...illus ... Gastrointestinal agent ... DG01744 ... digestive enzyme ATC code: A09AA01 Digestive enzyme ...

  6. Dgroup: DG00533 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ... DG01480 ... Penam ... DG01780 ... Extended spectrum penicillin ATC code: J01CA19 Antibacterial, Cell wall biosynt...hesis inhibitor beta-Lactam, penicillin, penicillinase-sensitive, Semisynthetic penicillin: extended spectrum penicillin penicillin binding protein ...

  7. Dgroup: DG02028 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02028 DGroup Inhalational anaesthetics ... D01772 ... Ether (JP17/USP) DG01994 ... Halog... ... D00102 ... Nitrous oxide (JP17/USP) ... D03841 ... Nitrous oxide - oxygen Neuropsychiatric agent ... DG02030 ... Anesthetic...s ... DG02027 ... General anesthetics ... DG02027 ... General anesthetics ... General anesthetics ...

  8. Environmental conditions affecting exopolysaccharide production by Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.

    Science.gov (United States)

    Kiliç, Nur Koçberber; Dönmez, Gönül

    2008-06-15

    Three different chromium-resistant microorganisms (Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp.) were tested with regard to their EPS production at different pH levels, temperatures, Cr(VI) concentrations, and incubation periods. The optimum pH level was 7 for P. aeruginosa and Micrococcus sp., while it was 8 for Ochrobactrum sp. according to the highest EPS amount at 100 mg/L Cr(VI) concentration. The highest production of EPSs by the three bacteria was obtained under different environmental conditions. P. aeruginosa produced the highest EPS (863.3 mg/L) after incubation for 96 h on media with 50 mg/L Cr(VI) at 20 degrees C, Micrococcus sp. gave the highest yield (444.6 mg/L) after incubation for 72 h on media with 100 mg/L Cr(VI) at the same temperature, and Ochrobactrum sp. had the highest production (430.5 mg/L) on media with 150 mg/L Cr(VI) at 30 degrees C at the end of 48 h of incubation.

  9. Dgroup: DG01248 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available liflozin L-proline (JAN) ... Antidiabetic agent ... DG01794 ... SGLT2 inhibitor Unclassified ... DG02044 ... Hypoglycemic...s ... DG01794 ... SGLT2 inhibitor ... Antidiabetics, SGLT2 inhibitors SLC5A2 (SGLT2) [HSA:6524] [KO:K14382] ...

  10. Dgroup: DG00117 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available azone hydrochloride (JP17/USP) ... Antidiabetic agent ... DG01685 ... Insulin sensitizer ... DG01795 ... PPAR gamma agon...s ... DG01683 ... Thiazolidinedione ATC code: A10BG03 Antidiabetic, thiazolidene NR1C3 (PPARG) [HSA:5468] [KO:K08530] ...

  11. NCBI nr-aa BLAST: CBRC-XTRO-01-0287 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-0287 ref|YP_001372386.1| binding-protein-dependent transport systems i...nner membrane component [Ochrobactrum anthropi ATCC 49188] gb|ABS16557.1| binding-protein-dependent transport systems

  12. Dgroup: DG00760 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00760 Chemical ... DGroup Glucosamine ... D04334 ... Glucosamine (USAN/INN) D08022 ... Glucosa...mine hydrochloride D08023 ... Glucosamine sulfate ... ATC code: M01AX05 Nonsteroidal antiinflammatory drug, Antirheumatics ...

  13. Dgroup: DG02388 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02388 Chemical ... DGroup Diazepam ... D00293 ... Diazepam (JP17/USP/INN) ... ATC code: ...N05BA01 Antianxiety, Minor tranquilizer, Sedative-hypnotic Benzodiazepine derivative GABRA/GABRB/GABRD/GABRE

  14. Dgroup: DG01182 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01182 Chemical ... DGroup Gadopentetic acid ... D08006 ... Gadopentetic acid (INN) D01707 ... Gadopen...tetate dimeglumine (JAN/USP) ... D09795 ... Meglumine gadopentetate (JAN) ... ATC code: V08CA01 Contrast medium for NMR-tomography ...

  15. Dgroup: DG01377 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available P17) ... Neuropsychiatric agent ... DG01837 ... Barbiturate sedative-hypnotics ... DG01567 ... GABA-A receptor agonist ... DG02030 ... Anesthetics... ... DG02027 ... General anesthetics ... DG02025 ... Barbiturate anesthetics ... DG02027 ... General anesthetics... ... DG02025 ... Barbiturate anesthetics ... DG02025 ... Barbiturate anesthetics ... Ba

  16. Dgroup: DG00795 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available tanil hydrochloride (JAN/USAN) ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics... ... DG02026 ... Opioid anesthetics ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ... DG01564 ... Opioi

  17. Biodegradation of chlorpyrifos and its hydrolysis product 3,5,6-trichloro-2-pyridinol using a novel bacterium Ochrobactrum sp. JAS2: A proposal of its metabolic pathway.

    Science.gov (United States)

    Abraham, Jayanthi; Silambarasan, Sivagnanam

    2016-01-01

    Biodegradation of chlorpyrifos and its major metabolite 3,5,6-trichloro-2-pyridinol (TCP) were studied with a novel bacterial strain JAS2 isolated from paddy rhizosphere soil. The molecular characterization based on 16S rRNA gene sequence homology confirmed its identity as Ochrobactrum sp. JAS2. The JAS2 strain degraded 300mgl(-1) of chlorpyrifos within 12h of incubation in the aqueous medium and it produced the TCP metabolite. However, after 72h of incubation TCP was also completely degraded by the JAS2 strain. A tentative degradation pathway of chlorpyrifos by Ochrobactrum sp. JAS2 has been proposed on basis of GC-MS analysis. The complete degradation of chlorpyrifos occurred within 24h in the soil spiked with and without addition of nutrients inoculated with Ochrobactrum sp. JAS2. TCP was obtained in both the studies which was degraded completely by 96h in the soil spiked with nutrients and whereas 120h in absence of nutrients in the soil. The mpd gene which is responsible for organophosphorus hydrolase production was identified. The isolates Ochrobactrum sp. JAS2 also exhibited a time dependent increase in the amount of tricalcium phosphate solubilization in Pikovskaya's medium. Further screening of the strain JAS2 for auxiliary plant growth promoting activities revealed its remarkable capability of producing the indole acetic acid (IAA), hydrogen cyanide (HCN) and ammonia. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Dgroup: DG01718 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01718 DGroup Drugs for addictive disorder ... DG01715 ... Drugs for nicotine dependence ... DG00994 ... Nicotine ... D03365 ... Nicotine (USP) ... D05156 ... Nicotine bitartrate (USAN) ... D05157 ... Nicotine polacrilex (USAN) ... DG00995 ... Varenicline ... D08669 ... Varenicline (INN) ... D06282 ... Varenicline tartrate (JAN/USAN) ... DG01716 ... Drugs for alcohol dependence ... DG00996 ... Acamprosate ... D07058 ... Acamprosate (INN) ... D02780 ... Acamprosate calcium (JAN/USAN) ... DG00997 ... Naltrexone ... D05113 ... Naltrexone (USAN/INN) ... D02095 ... Naltrexone hydrochloride (USP) ... DG00998 ... Nalmefene ... D05111 ... Nalmefene (USAN/INN) ... D02104 ... Nalmefene hydrochloride ... D10812 ... Nalmefene hydrochloride hydrate (JAN) ... DG01756 ... Ondelopran ... D10143 ... Ondelopran (USAN/INN) ... D10144 ... Ondelopran hydrochloride (USAN) ... D00123 ... Cyanamide (JP17) ... D00131 ... Disulfiram (JP17/USP/INN) ... D03288 ... Calcium carbimide (INN) DG01717 ... Drugs for opioid dependence ... DG00820 ... Buprenorphine ... D07132 ... Buprenorphine (JAN/INN) ... D00836 ... Buprenorphine hydrochloride (JP17/USP) ... DG00999 ... Methadone ... D08195 ... Methadone (BAN) ... D02102 ... Methadone hydrochloride (JAN/USP) ... DG01000 ... Levacetylmethadol ... D04716 ... Levomethadyl acetate (USAN); Levacetylmethadol (INN) ... D00840 ... Levomethadyl acetate hydrochloride (USAN) ... DG01001 ... Lofexidine ... D08141 ... Lofexidine (INN) ... D04765 ... Lofexidine hydrochloride (USAN) ... DG01002 ... Levomethadone ... D08121 ... Levomethadone (INN) ... D08122 ... Levomethadone hydrochloride ... DG01003 ... Diamorphine ... D07286 ... Diamorphine (BAN) ... D07810 ... Diacetylmorphine hydrochloride ... D10250 ... Buprenorphine - naloxone mixt ... DG01151 ... Nalorphine ... D08247 ... Nalorphine (INN) ... D08248 ... Nalorphine hydrochloride (USP) ... DG01155 ... Naloxone ... D08249 ... Naloxone (INN) ... D01340 ... Naloxone hydrochloride (JP17/USP

  19. Dgroup: DG00299 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available (INN) ... D08311 ... Oxetacaine hydrochloride Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic... ... DG01673 ... Amide type local anesthetic ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic... Gastrointestinal agent ... DG01975 ... Agents for peptic ulcer ATC code: C05AD06 Anesthetic

  20. Dgroup: DG00118 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available gliptin phosphate (USAN); Sitagliptin phosphate hydrate (JAN) ... Antidiabetic agent ... DG01601 ... DPP-4 inhibito...PP-4 inhibitor ATC code: A10BH01 DPP4 inhibitor, antidiabetics DPP4 [HSA:1803] [KO:K01278] Transporter: ABCB1 [HSA:5243], SLC22A8 [HSA:9376] ...

  1. Dgroup: DG01546 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hydrochloride Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic... ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic ... Local anesthetics ...

  2. Dgroup: DG00734 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00734 Chemical ... DGroup Tamoxifen ... D08559 ... Tamoxifen (INN) D00966 ... Tamoxifen cit...rate (JP17/USP) ... Antineoplastic ... DG01585 ... Estrogen receptor antagonist Other ... DG01619 ... Clomifene and tamox...ifen derivative ... DG01620 ... Tamoxifene-type antineoplastic Cyp substrate ... DG01892 ... CYP1A2 substrate ... DG01642

  3. Dgroup: DG01002 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available gonist ... DG01563 ... mu-Opioid receptor agonist Analgesic ... DG01984 ... Opioid analgesics Other ... DG01718 ... Drugs for... addictive disorder ... DG01717 ... Drugs for opioid dependence Cyp substrate ... DG01633

  4. Dgroup: DG00999 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available agonist ... DG01563 ... mu-Opioid receptor agonist Analgesic ... DG01984 ... Opioid analgesics Other ... DG01718 ... Drugs fo...r addictive disorder ... DG01717 ... Drugs for opioid dependence Cyp substrate ... DG0163

  5. Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

    KAUST Repository

    Lafi, Feras Fawzi; Alam, Intikhab; Geurts, Rene; Bisseling, Ton; Bajic, Vladimir B.; Hirt, Heribert; Saad, Maged

    2017-01-01

    Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic

  6. Dgroup: DG01684 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01684 DGroup Biguanide antidiabetic -formin DG01684.gif DG00112 ... Phenformin ... D08... hydrochloride (JP17) ... D04103 ... Etoformin hydrochloride (USAN) Antidiabetic agen...t ... DG01685 ... Insulin sensitizer Unclassified ... DG02044 ... Hypoglycemics ATC code: A10BA Antidiabetics AMPK (PRKAA) [HSA:5562 5563] [KO:K07198] ...

  7. Dgroup: DG01000 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available pioid receptor agonist ... DG01563 ... mu-Opioid receptor agonist Analgesic ... DG01984 ... Opioid analgesics Other ... DG01718 ... Drugs... for addictive disorder ... DG01717 ... Drugs for opioid dependence Cyp su

  8. Dgroup: DG00113 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available n hydrochloride (JP17/USP) ... Antidiabetic agent ... DG01685 ... Insulin sensitizer ... DG01684 ... Biguanide antidiabetic... Unclassified ... DG02044 ... Hypoglycemics ... DG01684 ... Biguanide antidiabetic ATC code: A10BA02 Biganide antidiabetic

  9. Dgroup: DG01683 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available /INN) D05739 ... Rivoglitazone (USAN/INN) Antidiabetic agent ... DG01685 ... Insulin sensitizer ... DG01795 ... PPAR gamma... agonist Other ... DG01733 ... PPAR agonist Unclassified ... DG02044 ... Hypoglycemics ATC code: A10BG Antidiabetic

  10. Dgroup: DG01458 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01458 DGroup Carbapenem -penem DG01458.gif DG00591 ... Meropenem ... D08185 ... Meropenem (INN) ... D02222 ... Meropene...m (USP); Meropenem hydrate (JP17) ... DG00592 ... Ertapenem ... D07908 ... Ertapenem (INN) ... D04049 ... Ertapene...m sodium (USAN) ... DG00593 ... Doripenem ... D03895 ... Doripenem (USAN/INN) ... D01836 ... Doripenem hydr...ate (JAN) ... DG01212 ... Imipenem ... D04515 ... Imipenem (INN) ... D00206 ... Imipenem (USP); Imipene...m hydrate (JP17) D01048 ... Panipenem (JP17/INN) D01057 ... Biapenem (JAN/USAN/INN) ... D01058 ... Lenapenem hyd

  11. Dgroup: DG01486 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01486 DGroup Penem -penem DG01486.gif DG00594 ... Faropenem ... D01839 ... Faropenem sodi...um hydrate (JP17) ... D08919 ... Faropenem medoxomil (USAN) DG01213 ... Sulopenem ... D05969 ... Sulopenem (USAN/INN) ... D09672 ... Sulopene

  12. Dgroup: DG00861 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ne D1-receptor agonist ... DG01468 ... Dopamine D2-receptor agonist ... DG01964 ... Ergot alkaloid ... DG01967 ... Antiparkinson... agent Cyp substrate ... DG01644 ... CYP2D6 substrate ATC code: N04BC02 Antiparkinson

  13. Dgroup: DG00114 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ydrochloride (JP17) ... Antidiabetic agent ... DG01685 ... Insulin sensitizer ... DG01684 ... Biguanide antidiabetic Unc...lassified ... DG02044 ... Hypoglycemics ... DG01684 ... Biguanide antidiabetic ATC code: A10BA03 Biganide antidiabetics AMPK (PRKAA) [HSA:5562 5563] [KO:K07198] ...

  14. Dgroup: DG01212 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01212 Chemical ... DGroup Imipenem ... D04515 ... Imipenem (INN) D00206 ... Imipenem (USP); Imipene...m hydrate (JP17) Antibacterial ... DG01710 ... beta-Lactam antibiotic ... DG01713 ... Penicillin skeleton group ... DG01458 ... Carbapene...m ... beta-Lactam antibiotics, carbapenem penicillin binding protein ...

  15. Dgroup: DG00835 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available thysergide maleate (USP) Neuropsychiatric agent ... DG01483 ... 5-HT1A-receptor agonist ... DG01964 ... Ergot alkaloid ... DG01982 ... Antimigraine...agonist ... DG01518 ... 5-HT1B/1D-receptor agonist ATC code: N02CA04 Vasoconstrictor, Antimigraine

  16. Dgroup: DG01284 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available liptin succinate (JAN/USAN) ... Antidiabetic agent ... DG01601 ... DPP-4 inhibitor Cyp inhibitor ... DG01915 ... CYP3A5 i...nhibitor Unclassified ... DG02044 ... Hypoglycemics ... DG01601 ... DPP-4 inhibitor ... DPP4 inhibitor, antidiabetics DPP4 [HSA:1803] [KO:K01278] ...

  17. Dgroup: DG01716 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01716 DGroup Drugs for alcohol dependence ... DG00996 ... Acamprosate ... D07058 ... Acamprosate (INN) ... D02780 ... Acamprosate calcium (JAN/USAN) ... DG00997 ... Naltrexone ... D05113 ... Naltrexone (USAN/INN) ... D02095 ... Naltrexone hydrochloride (USP) ... DG00998 ... Nalmefene ... D05111 ... Nalmefene (USAN/INN) ... D02104 ... Nalmefene hydrochloride ... D10812 ... Nalmefene hydrochloride hydrate (JAN) DG01756 ... Ondelopran ... D10143 ... Ondelopran (USAN/INN) ... D10144 ... Ondelopran hydrochloride (USAN) D00123 ... Cyanamide (JP17) ... D00131 ... Disulfiram (JP17/USP/INN) ... D03288 ... Calcium carbimide (INN) Other ... DG01718 ... Drugs for addictive disorder ATC code: N07BB Drugs of addictive disorder ...

  18. Dgroup: DG01789 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ) DG01442 ... Tedizolid ... D09685 ... Tedizolid (USAN/INN) ... D09686 ... Tedizolid phosphate (JAN/USAN) ... D10167 ... Sutezolid (USAN/INN) Antibacterial ... Antibiotics 50S ribosomal subunit ...

  19. Dgroup: DG01382 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ne hydrochloride ethanolate (JAN) ... Cardiovascular agent ... DG01928 ... Dihydropyridine calcium channel blocker ...Other ... DG01575 ... Calcium channel blocker ... DG01496 ... Calcium channel L type blocker ... DG01573 ... Calcium channel T type block...er ... Antihypertensive, calcium channel blocker CACNA1-L [HSA:775 776

  20. Dgroup: DG01272 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 45 ... Anticholinergic antiparkinson agent ... DG01967 ... Antiparkinson agent ... DG01745 ... Anticholinergic antiparkinson... agent ... Anticholinergics, antiparkinsonian agent CHRM [HSA:1128 1129 1131 1132 1133] [KO:K04129 K04130 K04131 K04132 K04133] ... ...ne hydrochloride (JAN) ... Neuropsychiatric agent ... DG01491 ... Muscarinic cholinergic receptor antagonist ... DG017

  1. Dgroup: DG01620 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01620 DGroup Tamoxifene-type antineoplastic -ifen(e) ... DG00734 ... Tamoxifen ... D08559 ... Tam...oxifen (INN) ... D00966 ... Tamoxifen citrate (JP17/USP) ... DG00735 ... Toremifene ... D08620 ... Toremifene (INN) ... D0...USAN/INN) D09380 ... Sivifene (USAN/INN) Other ... DG01619 ... Clomifene and tamoxifen derivative ... Antiestrogens or e

  2. Dgroup: DG01600 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01600 DGroup Bisphosphonate -dronic acid, -dronate ... DG00780 ... Etidronic acid ... D02373 ... Etidron...ic acid (USAN/INN) ... D00314 ... Etidronate disodium (JP17/USP) ... DG00781 ... Clodronic acid ... D03545 ... Clodron...ic acid (USAN/INN) ... D03544 ... Clodronate disodium (USAN); Sodium clodronate hydrate (JAN) ... D07720 ... Clodron...ic acid disodium salt DG00782 ... Pamidronic acid ... D07281 ... Pamidronic acid (INN) ... D00941 ... Pamidron...ate disodium (USAN); Pamidronate disodium hydrate (JAN) ... DG00783 ... Alendronic acid ... D07119 ... Alendron

  3. Draft Genome Sequence of Ochrobactrum intermedium Strain SA148, a Plant Growth-Promoting Desert Rhizobacterium

    KAUST Repository

    Lafi, Feras Fawzi

    2017-03-03

    Ochrobactrum intermedium strain SA148 is a plant growth-promoting bacterium isolated from sandy soil in the Jizan area of Saudi Arabia. Here, we report the 4.9-Mb draft genome sequence of this strain, highlighting different pathways characteristic of plant growth promotion activity and environmental adaptation of SA148.

  4. Dgroup: DG01685 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01685 DGroup Insulin sensitizer ... DG01684 ... Biguanide antidiabetic ... DG00112 ... Phen...litazar (USAN/INN) ... D09350 ... Indeglitazar (USAN) Antidiabetic agent ... Antidiabetics ...

  5. Dgroup: DG02469 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02469 Chemical ... DGroup Naftopidil ... D01674 ... Naftopidil (JP17/INN); Naftopidil tablet...s (JP17); Naftopidil orally disintegrating tablets (JP17) ... Antidysuria, alpha1-Adrenergic receptor a

  6. Dgroup: DG00853 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available or antagonist ... DG01745 ... Anticholinergic antiparkinson agent ... DG01967 ... Antiparkinson agent ... DG01745 ... Anticholinergic antiparkinson... agent ATC code: N04AA03 Anticholinergics, Antiparkinsonian

  7. Dgroup: DG00856 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available mide hydrochloride Neuropsychiatric agent ... DG01491 ... Muscarinic cholinergic receptor antagonist ... DG01745 ... Anticholinergic antiparkinso...n agent ... DG01967 ... Antiparkinson agent ... DG01745 ... Anticholinergic antiparkinson agen...t ATC code: N04AA08 Anticholinergics, Antiparkinsonian agent CHRM [HSA:1128 1129 1131 1132 1133] [KO:K04129 K04130 K04131 K04132 K04133] ...

  8. Dgroup: DG00854 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 45 ... Anticholinergic antiparkinson agent ... DG01967 ... Antiparkinson agent ... DG01745 ... Anticholinergic antiparkinson... agent ATC code: N04AA04 Anticholinergics, Antiparkinsonian agent CHRM [HSA:1128 1129 1131 1132 1133] [KO:K04129 K04130 K04131 K04132 K04133] ... ...idine hydrochloride (USP) Neuropsychiatric agent ... DG01491 ... Muscarinic cholinergic receptor antagonist ... DG017

  9. Dgroup: DG00855 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available cholinergic receptor antagonist ... DG01745 ... Anticholinergic antiparkinson agent ... DG01967 ... Antiparkinson agent... ... DG01745 ... Anticholinergic antiparkinson agent ATC code: N04AA05 Anticholinergics, Antiparkinson

  10. Dgroup: DG00852 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available carinic cholinergic receptor antagonist ... DG01745 ... Anticholinergic antiparkinson agent ... DG01967 ... Antiparkinson... agent ... DG01745 ... Anticholinergic antiparkinson agent ATC code: N04AA02 Anticholinergics, Antiparkinson

  11. Dgroup: DG00858 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ne hydrochloride Neuropsychiatric agent ... DG01745 ... Anticholinergic antiparkinson agent ... DG01967 ... Antiparkinson... agent ... DG01745 ... Anticholinergic antiparkinson agent ATC code: N04AA12 Anticholinergics, Antiparkinsonian agent ...

  12. Dgroup: DG01351 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available t hydrochloride (USAN) Other ... DG01706 ... Antiobesity ... DG01705 ... Anoretic ... DG01754 ... Cannabinoid receptor inverse agonist ... Therapeutic agent of obesity CNR1 [HSA:1268] [KO:K04277] ...

  13. Dgroup: DG00901 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hloride (JP17) ... Neuropsychiatric agent ... DG01941 ... Benzamide antipsychotic ... DG01478 ... Dopamine antagonist ... D... DG00901 Chemical ... DGroup Tiapride ... D08590 ... Tiapride (INN) D01522 ... Tiapride hydroc

  14. Dgroup: DG00116 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available litazone maleate (JAN/USAN) ... Antidiabetic agent ... DG01685 ... Insulin sensitizer ... DG01795 ... PPAR gamma agonist...44 ... Hypoglycemics ... DG01683 ... Thiazolidinedione ATC code: A10BG02 Antidiabetic, th

  15. Dgroup: DG01339 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available il citrate (USAN) Neuropsychiatric agent ... DG01564 ... Opioid receptor agonist ... DG01563 ... mu-Opioid receptor ago... DG01339 Chemical ... DGroup Carfentanil ... D07620 ... Carfentanil (INN) D03405 ... Carfentan

  16. Dgroup: DG00823 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00823 Chemical ... DGroup Tilidine ... D08597 ... Tilidine (INN) D06147 ... Tilidine hydrochloride (USAN) Neuropsych...iatric agent ... DG01564 ... Opioid receptor agonist ... DG01563 ... mu-Opioid receptor agonis

  17. Dgroup: DG00868 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 2-Adrenergic receptor antagonist Neuropsychiatric agent ... DG01905 ... Phenothiazine antipsychotics ... DG01478 ... Dop...ibitor ... DG01645 ... CYP2D6 inhibitor ATC code: N05AA02 Phenothiazine antipsychotics

  18. Dgroup: DG00998 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ... DG01587 ... Opioid receptor agonist/antagonist Other ... DG01718 ... Drugs for addictive disorder ... DG01716 ... Drugs for alcohol dependence... ATC code: N07BB05 Antialcohol dependence, Narcotic antagon

  19. Dgroup: DG00834 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available nist ... DG01964 ... Ergot alkaloid ... DG01982 ... Antimigraine, ergot alkaloid Cyp substrate ... DG01633 ... CYP3A substrate... ATC code: N02CA02 Antimigraine, Vasoconstrictor, Serotonin receptor agonist/anta

  20. Dgroup: DG01732 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available (USAN/INN) D09350 ... Indeglitazar (USAN) Antidiabetic agent ... DG01685 ... Insulin sens...itizer ... DG01795 ... PPAR gamma agonist Other ... DG01733 ... PPAR agonist ... Antidiabetics, PPAR agonist NR1C1 (PPARA)

  1. Dgroup: DG01770 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01770 DGroup Laxative ... DG01764 ... Emollient laxative ... DG00067 ... Liquid paraffin ... ...D05042 ... Mineral oil (USP); Liquid paraffin (JP17) ... D05043 ... Light liquid paraffin (JP17); Mineral oil, li

  2. Dgroup: DG01326 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available son agent ... Antiparkinsonian of dopamin receptor agonist DRD2 [HSA:1813] [KO:K04145] ... ...hydrochloride (JAN) ... Neuropsychiatric agent ... DG01472 ... Dopamine agonist ... DG01468 ... Dopamine D2-receptor agonist ... DG01967 ... Antiparkin

  3. Dgroup: DG01283 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available igliptin hydrobromide hydrate (JAN) ... Antidiabetic agent ... DG01601 ... DPP-4 inhibitor Unclassified ... DG02044 ... H...ypoglycemics ... DG01601 ... DPP-4 inhibitor ... DPP4 inhibitor, antidiabetics DPP4 [HSA:1803] [KO:K01278] ...

  4. Dgroup: DG01764 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01764 DGroup Emollient laxative ... DG00067 ... Liquid paraffin ... D05042 ... Mineral oil (USP); Liquid paraffin... (JP17) ... D05043 ... Light liquid paraffin (JP17); Mineral oil, light (NF) DG01771 ... Doc

  5. Dgroup: DG00486 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available agonist ... DG01467 ... Dopamine D1-receptor agonist ... DG01468 ... Dopamine D2-receptor agonist ... DG01967 ... Antiparkinson... agent ATC code: G04BE07 N04BC07 Antiparkinsonian, Emetic, Dopamine receptor

  6. Dgroup: DG00995 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ne tartrate (JAN/USAN) ... Neuropsychiatric agent ... DG01571 ... Nicotinic cholinergic receptor partial agonist Other ... DG01718 ... Drugs... for addictive disorder ... DG01715 ... Drugs for nicotine dependence ATC code: N07BA03 Nicoti

  7. Dgroup: DG00902 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ide hydrochloride (USAN) Neuropsychiatric agent ... DG01941 ... Benzamide antipsychotic ... DG01478 ... Dopamine antagon...ist ... DG01474 ... Dopamine D2-receptor antagonist ATC code: N05AL04 Antipsychotic, Dopamine D2 receptor antagon

  8. Dgroup: DG00325 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ne hydrochloride (JAN) ... Cardiovascular agent ... DG01928 ... Dihydropyridine calcium channel blocker Other ... DG01575 ... Calcium channel bloc...ker ... DG01496 ... Calcium channel L type blocker Cyp substrate ... DG01633 ... CYP3A substra...te ATC code: C08CA12 Dihydropyridine calcium channel blocker CACNA1-L [HSA:775 776 778 779] [KO:K04850 K04851 K04853 K04857] Enzyme: CYP3A4 [HSA:1576] ...

  9. Dgroup: DG00324 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hydrochloride (JP17) ... Cardiovascular agent ... DG01928 ... Dihydropyridine calcium channel blocker Other ... DG01575 ... Calcium channel block...er ... DG01496 ... Calcium channel L type blocker Cyp substrate ... DG01633 ... CYP3A substrate... ATC code: C08CA11 Dihydropyridine calcium channel blocker CACNA1-L [HSA:775 776 778 779] [KO:K04850 K04851 K04853 K04857] Enzyme: CYP3A4 [HSA:1576] ...

  10. Dgroup: DG00327 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hydrochloride (JP17) ... Cardiovascular agent ... DG01928 ... Dihydropyridine calcium channel blocker Other ... DG01575 ... Calcium channel block...er ... DG01496 ... Calcium channel L type blocker Cyp substrate ... DG01633 ... CYP3A substrate... ATC code: C08CA15 Dihydropyridine calcium channel blocker CACNA1-L [HSA:775 776 778 779] [KO:K04850 K04851 K04853 K04857] Enzyme: CYP3A4 [HSA:1576] ...

  11. Dgroup: DG00996 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available te calcium (JAN/USAN) ... Neuropsychiatric agent ... DG01498 ... NMDA receptor antagonist Other ... DG01718 ... Drugs for... addictive disorder ... DG01716 ... Drugs for alcohol dependence ATC code: N07BB03 Antialcohol dependence, NMDA r

  12. Dgroup: DG01917 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available anib phosphate (JAN) DG01357 ... Varlitinib ... D09689 ... Varlitinib (USAN/INN) ... D09690 ... Varlitinib tosylate (USAN) DG01361 ... Crenolan...ib ... D10102 ... Crenolanib (USAN) ... D10103 ... Crenolanib besylate (USAN) DG01363 ... Toceranib ... D0850

  13. Dgroup: DG00983 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available sterase inhibitor ... DG01968 ... Agents for Alzheimer-type dementia Cyp substrate ... DG01644 ... CYP2D6 substrate ... DG0...1633 ... CYP3A substrate ATC code: N06DA02 Anti-Alzheimer's agent, Anticholinesteras

  14. Dgroup: DG00879 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hioproperazine mesilate (JAN) Neuropsychiatric agent ... DG01905 ... Phenothiazine antipsychotics ... DG01478 ... Dopami...ne antagonist ... DG01474 ... Dopamine D2-receptor antagonist ATC code: N05AB08 Phenothiazine antipsychotics DRD2 [HSA:1813] [KO:K04145] ...

  15. Dgroup: DG00876 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available orperazine edisylate (USP) ... Neuropsychiatric agent ... DG01905 ... Phenothiazine antipsychotics ... DG01478 ... Dopami...ne antagonist ... DG01474 ... Dopamine D2-receptor antagonist ATC code: N05AB04 Phenothiazine antipsychotics DRD2 [HSA:1813] [KO:K04145] ...

  16. Dgroup: DG01727 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01727 DGroup Anthraquinone antineoplastic -antrone DG01727.gif DG00701 ... Mitoxantrone ... D08224 ... Mitoxantron...e (INN) ... D02166 ... Mitoxantrone hydrochloride (JAN/USP) ... DG00704 ... Pixantrone ... D05522 ... Pixantron...e (USAN/INN) ... D09654 ... Pixantrone dimaleate (USAN) D02894 ... Ametantrone acetate (USAN) D04685 ... Ledoxantron...e trihydrochloride (USAN) D04783 ... Losoxantrone hydrochloride (USAN) D05510 ... Piroxantron...e hydrochloride (USAN) D06059 ... Teloxantrone hydrochloride (USAN) D06190 ... Topixantrone (USAN/IN

  17. Dgroup: DG01260 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available on agent ATC code: N04BD03 MAO-B inhibitor, Antiparkinsonian agent MAOB [HSA:4129] [KO:K00274] ... ...mide mesylate (USAN) ... Neuropsychiatric agent ... DG01568 ... MAO inhibitor ... DG01512 ... Monoamine oxidase B inhibitor ... DG01967 ... Antiparkins

  18. Dgroup: DG01715 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01715 DGroup Drugs for nicotine dependence ... DG00994 ... Nicotine ... D03365 ... Nicotine...08669 ... Varenicline (INN) ... D06282 ... Varenicline tartrate (JAN/USAN) ... Other ... DG01718 ... Drugs for addictive disorder ATC code: N07BA Drugs of addictive disorder ...

  19. Dgroup: DG00871 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 0 ... Triflupromazine hydrochloride (JAN/USP) Neuropsychiatric agent ... DG01905 ... Phenothiazine antipsychotics ... DG...01478 ... Dopamine antagonist ... DG01474 ... Dopamine D2-receptor antagonist ATC code: N05AA05 Phenothiazine antipsychotics DRD2 [HSA:1813] [KO:K04145] ...

  20. Dgroup: DG01615 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01615 DGroup Xanthine-type diuretic ... DG00974 ... Caffeine ... D00528 ... Caffeine (USP);... Anhydrous caffeine (JP17) ... D01453 ... Caffeine hydrate (JP17) ... D07603 ... Caffeine citrate (USP) ... D08962 ... Pamabrom (USP) Other ... DG01616 ... Xanthine derivative ...

  1. Dgroup: DG01574 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01574 DGroup Calcium channel alpha-2 delta blocker ... DG01245 ... Gabapentin ... D00332...INN) ... Other ... DG01575 ... Calcium channel blocker ... CACNA2D [HSA:781 9254 55799 93589] [KO:K04858 K04859 K04860 K04861] ...

  2. Dgroup: DG00326 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available nidipine hydrochloride (JAN/USAN) Cardiovascular agent ... DG01928 ... Dihydropyridine calcium channel blocker Oth...er ... DG01575 ... Calcium channel blocker Cyp substrate ... DG01633 ... CYP3A substrate ATC code: C08CA13 Dihydropyridine calcium channel block

  3. Dgroup: DG01277 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01277 Chemical ... DGroup Pirlindole ... D08392 ... Pirlindole (INN) D08393 ... Pirlindole hydrochloride Neuropsychi...atric agent ... DG01568 ... MAO inhibitor ... DG01558 ... Monoamine oxidase A inhibitor ... Reversible monoamine oxidase A (MAO-A) inhibitor MAOA [HSA:4128] [KO:K00274] ...

  4. Dgroup: DG00464 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00464 Chemical ... DGroup Estrone ... D00067 ... Estrone (JAN/USP/INN) D00312 ... Estrone sodium sulfate D00948 ... Est...ropipate (USP) ... Other ... DG01584 ... Estrogen receptor agonist ... DG01986 ... Estrogen ATC code: G03CA07 G03CC04 Est

  5. Dgroup: DG01717 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01717 DGroup Drugs for opioid dependence ... DG00820 ... Buprenorphine ... D07132 ... Bupre... Naloxone ... D08249 ... Naloxone (INN) ... D01340 ... Naloxone hydrochloride (JP17/USP) ... Other ... DG01718 ... Drugs for addictive disorder ATC code: N07BC Drugs of addictive disorder ...

  6. Dgroup: DG00900 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hydrochloride (JAN) ... Neuropsychiatric agent ... DG01941 ... Benzamide antipsychotic ... DG01478 ... Dopamine antagonis...t ... DG01474 ... Dopamine D2-receptor antagonist ATC code: N05AL02 Antipsychotic, Neuroleptic, Dopamine D2 receptor antagonist Benzamide derivative DRD2 [HSA:1813] [KO:K04145] ...

  7. Dgroup: DG00462 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00462 Chemical ... DGroup Estradiol ... D00105 ... Estradiol (JAN/USP/INN) ... D01413 ... Estr...adiol valerate (JAN/USP/INN) ... D01617 ... Estradiol dipropionate (JAN) ... D01953 ... Estradiol benzoate (JP17) D04061 ... Estr...adiol acetate (USAN) ... D04063 ... Estradiol cypionate (USP) ... D04064 ... Estradiol enanthate (USAN) D04065 ... Estr...adiol undecylate (USAN/INN) D07918 ... Estradiol hemihydrate D07919 ... Estr...adiol 17 beta-hemisuccinate Other ... DG01584 ... Estrogen receptor agonist ... DG01986 ... Estrogen Cyp substrate ... DG0

  8. Dgroup: DG00882 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available oridazine hydrochloride (JP17/USP) ... Neuropsychiatric agent ... DG01905 ... Phenothiazine antipsychotics ... DG01478...p inhibitor ... DG01645 ... CYP2D6 inhibitor ATC code: N05AC02 Phenothiazine antipsychotics DRD2 [HSA:1813] [KO:K04145] Enzyme: CYP2D6 [HSA:1565] ...

  9. Dgroup: DG00905 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ne hydrochloride (JAN) ... Neuropsychiatric agent ... DG01942 ... Iminobenzyl antipsychotic ... DG01478 ... Dopamine anta...gonist ... DG01474 ... Dopamine D2-receptor antagonist ATC code: N05AX10 Antipsychotics HTR2A [HSA:3356] [KO:K04157] DRD2 [HSA:1813] [KO:K04145] ...

  10. Dgroup: DG00015 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00015 Chemical ... DGroup Acetylsalicylic acid ... D00109 ... Aspirin (JP17/USP); Aspalon (JAN) ... D05181 ... Aspiri...n aluminum (JP17) D07579 ... Aspirin calcium salt D07580 ... Aspirin DL-lysine (JAN) D07581 ... Aspirin... magnesium salt D07582 ... Aspirin sodium Cardiovascular agent ... DG01712 ... Antiplatelet agent ... DG01950

  11. Dgroup: DG01712 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available salicylic acid ... D00109 ... Aspirin (JP17/USP); Aspalon (JAN) ... D05181 ... Aspirin aluminum (JP17) ... D07579 ... Aspirin... calcium salt ... D07580 ... Aspirin DL-lysine (JAN) ... D07581 ... Aspirin magnesium salt ... D07582 ... Aspirin sodium DG0... DG01712 DGroup Antiplatelet agent Platelet aggregation inhibitor ... DG00015 ... Acetyl

  12. Dgroup: DG00463 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00463 Chemical ... DGroup Estriol ... D00185 ... Estriol (JP17/USP) ... D01986 ... Estriol t...ripropionate (JAN) ... D01989 ... Estriol diacetate benzoate (JAN) D07920 ... Estriol succinate D07921 ... Estriol sod...ium succinate (BAN) Other ... DG01584 ... Estrogen receptor agonist ... DG01986 ... Estrogen ATC code: G03CA04 G03CC06 Estr

  13. Dgroup: DG01803 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01803 DGroup Antidiabetic, alpha-glucosidase inhibitor -bose ... D00216 ... Acarbose (...e (USAN) D09779 ... Emiglitate (JAN/INN) Antidiabetic agent ... DG01663 ... alpha-Glucosidase inhibitor Unclassified ... DG02044 ... Hypoglycemics ATC code: A10BF Antidiabetics GAA [HSA:2548] [KO:K12316] GANC [HSA:2595] [KO:K12317] MGAM [HSA:8972] [KO:K12047] ...

  14. Dgroup: DG01908 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01908 DGroup Antiinflammatory drug, propionic acid derivatives ... DG00245 ... Ibuprofen ... D00126 ... Ibuprofen... (JP17/USP/INN) ... D01122 ... Ibuprofen piconol (JP17/USAN) ... D04490 ... Ibuprofen aluminum (USAN) ... D06606 ... Ibupro...fen lysine (USAN); Ibuprofen L-lysine (JAN) ... D08058 ... Ibuprofen arginine salt ... D08059 ... Ibuprofen... sodium ... D09760 ... Ibuprofen sodium (USAN) DG00455 ... Naproxen ... D00118

  15. Generation of continuous packed bed reactor with PVA-alginate blend immobilized Ochrobactrum sp. DGVK1 cells for effective removal of N,N-dimethylformamide from industrial effluents

    Energy Technology Data Exchange (ETDEWEB)

    Sanjeev Kumar, S.; Kumar, M. Santosh [Department of Biochemistry, Gulbarga University, Gulbarga 585106, Karnataka (India); Siddavattam, D. [Department of Animal Sciences, University of Hyderabad, Hyderabad 500046 (India); Karegoudar, T.B., E-mail: goudartbk@gmail.com [Department of Biochemistry, Gulbarga University, Gulbarga 585106, Karnataka (India)

    2012-01-15

    Highlights: Black-Right-Pointing-Pointer Removal of DMF was compared by free and immobilized cells of Ochrobactrum sp. DGVK1. Black-Right-Pointing-Pointer Ochrobactrum sp. DGVK1 cells entrapped in PVA-alginate have shown more tolerance. Black-Right-Pointing-Pointer PVA-alginate beads removed DMF even in the presence of other organic solvents. Black-Right-Pointing-Pointer Removal of DMF from industrial effluents by PVA-alginate blended batch operations. Black-Right-Pointing-Pointer Development of industrially feasible remediation strategy for DMF removal. - Abstract: Effective removal of dimethylformamide (DMF), the organic solvent found in industrial effluents of textile and pharma industries, was demonstrated by using free and immobilized cells of Ochrobactrum sp. DGVK1, a soil isolate capable of utilizing DMF as a sole source of carbon, nitrogen. The free cells have efficiently removed DMF from culture media and effluents, only when DMF concentration was less than 1% (v/v). Entrapment of cells either in alginate or in polyvinyl alcohol (PVA) failed to increase tolerance limits. However, the cells of Ochrobactrum sp. DGVK1 entrapped in PVA-alginate mixed matrix tolerated higher concentration of DMF (2.5%, v/v) and effectively removed DMF from industrial effluents. As determined through batch fermentation, these immobilized cells have retained viability and degradability for more than 20 cycles. A continuous packed bed reactor, generated by using PVA-alginate beads, efficiently removed DMF from industrial effluents, even in the presence of certain organic solvents frequently found in effluents along with DMF.

  16. Dgroup: DG00875 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ide ... D08341 ... Perphenazine decanoate D08342 ... Perphenazine enantate Neuropsychiatric agent ... DG01905 ... Phenothiazine antipsycho...5AB03 Phenothiazine antipsychotics DRD2 [HSA:1813] [KO:K04145] Enzyme: CYP2D6 [HSA:1565] Genomic biomarker: CYP2D6 [HSA:1565] ...or antagonist Cyp substrate ... DG01644 ... CYP2D6 substrate Cyp inhibitor ... DG01645 ... CYP2D6 inhibitor ATC code: N0

  17. Dgroup: DG01671 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 3 ... Trimethobenzamide hydrochloride (USP) ... Gastrointestinal agent ... DG01762 ... Antiemetic ... DG01783 ... Benzamide type antiemetic ... Antiemetics, benzamides DRD2 [HSA:1813] [KO:K04145] ...

  18. Dgroup: DG01456 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ... D07461 ... Apraclonidine (INN) ... D01008 ... Apraclonidine hydrochloride (JAN/USP) ... DG01318 ... Detomidine ... D07795 ... Detomidine... (INN) ... D03702 ... Detomidine hydrochloride (USAN) ... DG0132

  19. Dgroup: DG01613 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01613 DGroup Xantine-type antiparkinsonian agent -fylline ... D02964 ... Apaxifylline ...(USAN/INN) D04641 ... Istradefylline (JAN/USAN/INN) ... Neuropsychiatric agent ... DG01967 ... Antiparkinson agent ...

  20. Dgroup: DG01584 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01584 DGroup Estrogen receptor agonist -estr- ... DG00461 ... Ethinylestradiol ... D00554... ... Ethinyl estradiol (USP); Ethinylestradiol (JP17/INN) ... D07928 ... Ethinylestradiol propanesulfonate DG00462 ... Estradiol ... D00105 ... Estr...adiol (JAN/USP/INN) ... D01413 ... Estradiol valerate (JAN/USP/INN) ... D01617 ... Estrad...iol dipropionate (JAN) ... D01953 ... Estradiol benzoate (JP17) ... D04061 ... Estradiol a...cetate (USAN) ... D04063 ... Estradiol cypionate (USP) ... D04064 ... Estradiol enanthate (USAN) ... D04065 ... Estradio

  1. Dgroup: DG01704 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D05454 ... Phenmetrazine hydrochloride (USP) D07114 ... Etilamfetamine (INN) D07115 ... Clobenzorex (INN) Other ... DG01706 ... Antiobesity ... DG01705 ... Anoretic ATC code: A08AA Anoretics ...

  2. Dgroup: DG01970 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ylphenidate (USAN/INN) ... D01296 ... Methylphenidate hydrochloride (JAN/USP) ... DG00970 ... Atomoxetine... ... D07473 ... Atomoxetine (USP/INN) ... D02574 ... Atomoxetine hydrochloride (JAN/USP) ... DG00972 ... De

  3. Dgroup: DG00738 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available -dried BCG vaccine (for percutaneous use) (JP17) ... Antiviral ... DG01689 ... Live vaccine ... DG01687 ... Parenteral live vaccine ATC code: L03AX03 Immunoregulators; Vaccines ...

  4. Dgroup: DG02008 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02008 DGroup Gastric mucosal protectant ... DG00025 ... Sucralfate ... C07314 ... Sucralfate ... D00446 ... Sucralfate... (USP/INN); Sucralfate hydrate (JP17) ... D00177 ... Methylmethionine sulfonium chloride (J

  5. Dgroup: DG00503 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00503 Chemical ... DGroup Pasireotide ... D10147 ... Pasireotide (USAN) D10497 ... Pasireot...ide diaspartate ... D10566 ... Pasireotide pamoate (JAN) ... Other ... DG01588 ... Somatostatin receptor agonist ATC co

  6. Dgroup: DG01986 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01986 DGroup Estrogen ... DG00461 ... Ethinylestradiol ... D00554 ... Ethinyl estradiol (US...P); Ethinylestradiol (JP17/INN) ... D07928 ... Ethinylestradiol propanesulfonate DG00462 ... Estradiol ... D00105 ... Estr...adiol (JAN/USP/INN) ... D01413 ... Estradiol valerate (JAN/USP/INN) ... D01617 ... Estradiol dipropionate (JAN) ... D01953 ... Estr...adiol benzoate (JP17) ... D04061 ... Estradiol acetate (USAN) ... D04063 ... Estr...adiol cypionate (USP) ... D04064 ... Estradiol enanthate (USAN) ... D04065 ... Estradiol undecylate (USAN/INN) ... D07918 ... Estr

  7. Dgroup: DG01639 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available amine ... D07984 ... Fluvoxamine (INN) ... D00824 ... Fluvoxamine maleate (JP17/USAN) ... DG00947 ... Escitalopram ... D07913 ... Escitalopram... (INN) ... D02567 ... Escitalopram oxalate (JAN/USAN) ... DG00951 ... Mianserin

  8. Dgroup: DG01975 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 91 ... Enprostil (JAN/USAN/INN) D01451 ... Scopolamine butylbromide (JP17) ... DG02008 ... Gastric mucosal protectant ... DG00025 ... Sucralfate... ... C07314 ... Sucralfate ... D00446 ... Sucralfate (USP/INN); Sucralfate

  9. Dgroup: DG00872 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00872 Chemical ... DGroup Cyamemazine ... D07307 ... Cyamemazine (INN) D07756 ... Cyamemazine tartrate Neuropsychiat...ric agent ... DG01905 ... Phenothiazine antipsychotics ATC code: N05AA06 Phenothiazine antipsychotics ...

  10. Dgroup: DG00887 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00887 Chemical ... DGroup Melperone ... D07309 ... Melperone (INN) D08172 ... Melperone hydrochloride Neuropsychiatr...ic agent ... DG01940 ... Butyrophenone derivative ATC code: N05AD03 Butyrophenone antipsychotics ...

  11. Dgroup: DG00979 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00979 Chemical ... DGroup Pirisudanol ... D07347 ... Pirisudanol (INN) D08390 ... Pirisudanol dimaleate Neuropsychia...tric agent ... DG01972 ... Nootropic ATC code: N06BX08 Nervous system stimulant ...

  12. Dgroup: DG01645 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available done (INN) ... D08122 ... Levomethadone hydrochloride DG01015 ... Hydroxychloroquine ... D08050 ... Hydroxychloroquine (INN) ... D02114 ... Hydroxychloroq...uine sulfate (JAN/USP) ... DG01021 ... Halofantrine ... D08033 ... Halofantrine (INN) ... D02485

  13. Dgroup: DG01614 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01614 DGroup Xanthine-type vasodilator -fylline ... DG00974 ... Caffeine ... D00528 ... Caffeine... (USP); Anhydrous caffeine (JP17) ... D01453 ... Caffeine hydrate (JP17) ... D07603 ... Caffeine citrate (USP)

  14. Dgroup: DG01633 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available Trazodone hydrochloride (JAN/USP) ... DG00974 ... Caffeine ... D00528 ... Caffeine (USP); A...nhydrous caffeine (JP17) ... D01453 ... Caffeine hydrate (JP17) ... D07603 ... Caffeine citrate (USP) ... DG00983 ...

  15. Dgroup: DG01918 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available litinib ... D09689 ... Varlitinib (USAN/INN) ... D09690 ... Varlitinib tosylate (USAN) ... DG01361 ... Crenolanib ... D10102 ... Crenolan...ib (USAN) ... D10103 ... Crenolanib besylate (USAN) ... DG01363 ... Toceranib ... D085

  16. Dgroup: DG00980 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00980 Chemical ... DGroup Nizofenone ... D08280 ... Nizofenone (INN) D01465 ... Nizofenone fumarate (JAN) Neuropsych...iatric agent ... DG01972 ... Nootropic ATC code: N06BX10 Nervous system stimulant ...

  17. Dgroup: DG01673 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available P17/USAN); Oxetacaine (INN) ... D08311 ... Oxetacaine hydrochloride DG00801 ... Bupivacaine ... D07552 ... Bupivacaine (USAN/INN) ... D01450 ... Bup...ivacaine hydrochloride (USP); Bupivacaine hydrochloride hydrate (JP17) ... DG00802 ...

  18. Dgroup: DG01655 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 130 ... Apraclonidine ... D07461 ... Apraclonidine (INN) ... D01008 ... Apraclonidine hydrochloride (JAN/USP) ... DG01318 ... Detomidine ... D07795 ... Detomi...dine (INN) ... D03702 ... Detomidine hydrochloride (USAN) DG01320 ... Medetomidine ... D08165 ...

  19. Dgroup: DG01450 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ne hydrochloride (JAN) ... D02149 ... Epinephrine bitartrate (JAN/USP) ... DG00212 ... Norepinephrine ... D00076 ... Noradrenaline...rine hydrochloride (JAN) ... D02149 ... Epinephrine bitartrate (JAN/USP) ... DG00212 ... Norepinephrine ... D00076 ... Noradrenaline

  20. Dgroup: DG00067 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00067 Chemical ... DGroup Liquid paraffin ... D05042 ... Mineral oil (USP); Liquid paraffin... (JP17) ... D05043 ... Light liquid paraffin (JP17); Mineral oil, light (NF) Gastrointestinal agent ... DG01770

  1. Dgroup: DG00052 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hiatric agent ... DG01491 ... Muscarinic cholinergic receptor antagonist ATC code: A03BA0... DG00052 Chemical ... DGroup Atropine ... D00113 ... Atropine (USP) D02069 ... Atropine sulfate (JP17/USP) ... Neuropsyc

  2. Dgroup: DG01642 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 7/USAN/INN); Fluconazole capsules (JP17) ... D01429 ... Fosfluconazole (JAN/INN) ... DG00375 ... Terbinafine ... D02375 ... Terbinafine... (USAN/INN) ... D02219 ... Terbinafine hydrochloride (JP17/USP) ... DG00441 ... Diclofenac ... D07816 ... Dicl

  3. Dgroup: DG01663 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01663 DGroup alpha-Glucosidase inhibitor -bose, -glustat ... DG01803 ... Antidiabetic,...at ... D09605 ... Duvoglustat (USAN/INN) ... D09606 ... Duvoglustat hydrochloride (USAN) Antidiabetic agent ... alpha-glucosidase [KO:K12316 K12317 K12047] ...

  4. Dgroup: DG01573 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ate semisodium (INN) ... D00710 ... Valproate sodium (USAN); Sodium valproate (JP17) ... D08667 ... Calcium valproate DG01006 ... Flunar...izine ... D07971 ... Flunarizine (INN) ... D01303 ... Flunarizine hydrochloride (JAN/USAN) DG01382 ... E

  5. Dgroup: DG01754 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ... Taranabant (USAN/INN) D09349 ... Ibipinabant (USAN/INN) D10314 ... Giminabant (USAN/INN) Other ... DG01706 ... Antiobesity... ... DG01705 ... Anoretic ATC code: A08AX Antiobesity agents CNR1 [HSA:1268] [KO:K04277] ...

  6. Dgroup: DG01892 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available tine (INN) ... D01179 ... Duloxetine hydrochloride (JAN/USAN) ... DG00974 ... Caffeine ... D00528 ... Caffeine (USP); Anhydr...ous caffeine (JP17) ... D01453 ... Caffeine hydrate (JP17) ... D07603 ... Caffeine citrate (USP) ... DG00982 ... Tacri

  7. Design and optimization analysis of dual material gate on DG-IMOS

    Science.gov (United States)

    Singh, Sarabdeep; Raman, Ashish; Kumar, Naveen

    2017-12-01

    An impact ionization MOSFET (IMOS) is evolved for overcoming the constraint of less than 60 mV/decade sub-threshold slope (SS) of conventional MOSFET at room temperature. In this work, first, the device performance of the p-type double gate impact ionization MOSFET (DG-IMOS) is optimized by adjusting the device design parameters. The adjusted parameters are ratio of gate and intrinsic length, gate dielectric thickness and gate work function. Secondly, the DMG (dual material gate) DG-IMOS is proposed and investigated. This DMG DG-IMOS is further optimized to obtain the best possible performance parameters. Simulation results reveal that DMG DG-IMOS when compared to DG-IMOS, shows better I ON, I ON/I OFF ratio, and RF parameters. Results show that by properly tuning the lengths of two materials at a ratio of 1.5 in DMG DG-IMOS, optimized performance is achieved including I ON/I OFF ratio of 2.87 × 109 A/μm with I ON as 11.87 × 10-4 A/μm and transconductance of 1.06 × 10-3 S/μm. It is analyzed that length of drain side material should be greater than the length of source side material to attain the higher transconductance in DMG DG-IMOS.

  8. Dgroup: DG01630 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01630 DGroup beta-Estrogen receptor agonist -berel ... D06631 ... Prinaberel (USAN/INN...) D09899 ... Erteberel (USAN/INN) Other ... DG01584 ... Estrogen receptor agonist ... NR3A2 (ESR2) [HSA:2100] [KO:K08551] ...

  9. Dgroup: DG00785 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00785 Chemical ... DGroup Ibandronic acid ... D08056 ... Ibandronic acid (INN) D04486 ... Ibandron...ate sodium (USAN); Ibandronate sodium hydrate (JAN) ... Other ... DG01600 ... Bisphosphonate ATC code: M05BA06 Bisphosphonates FDPS [HSA:2224] [KO:K00787] ...

  10. Dgroup: DG00782 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00782 Chemical ... DGroup Pamidronic acid ... D07281 ... Pamidronic acid (INN) D00941 ... Pamidron...ate disodium (USAN); Pamidronate disodium hydrate (JAN) ... Other ... DG01600 ... Bisphosphonate ATC code: M05BA03 Bisphosphonates FDPS [HSA:2224] [KO:K00787] ...

  11. Dgroup: DG01634 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available d hydrate (JP17) ... DG00946 ... Fluvoxamine ... D07984 ... Fluvoxamine (INN) ... D00824 ... Fluvoxamine maleate (JP17/USAN) ... DG00974 ... Caffeine... ... D00528 ... Caffeine (USP); Anhydrous caffeine (JP17) ... D01453 ... Caffeine hydrate (JP17) ... D07603 ... Caffeine

  12. Dgroup: DG00984 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available linesterase inhibitor ... DG01594 ... Butyrylcholinesterase inhibitor ... DG01968 ... Agents for Alzheimer-type dementi...a ATC code: N06DA03 Anti-Alzheimer's agent, Anticholinesterase agent ACHE [HSA:43] [KO:K01049] BCHE [HSA:590] [KO:K01050] ...

  13. Dgroup: DG00857 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 1745 ... Anticholinergic antiparkinson agent ... DG01967 ... Antiparkinson agent ... DG01745 ... Anticholinergic antiparkinson... agent ATC code: N04AA10 Anticholinergics, Antiparkinsonian agent CHRM [HSA:1128 1129 1131 1132 1133] [KO:K04129 K04130 K04131 K04132 K04133] ...

  14. Dgroup: DG00781 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00781 Chemical ... DGroup Clodronic acid ... D03545 ... Clodronic acid (USAN/INN) D03544 ... Clodron...ate disodium (USAN); Sodium clodronate hydrate (JAN) D07720 ... Clodronic acid disodium salt Other ... DG01600 ... Bisphosphonate ATC code: M05BA02 Bisphosphonates ...

  15. Dgroup: DG00783 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00783 Chemical ... DGroup Alendronic acid ... D07119 ... Alendronic acid (INN) D00939 ... Alendron...ate sodium (USAN); Alendronate sodium hydrate (JP17) ... Other ... DG01600 ... Bisphosphonate ATC code: M05BA04 Bisphosphonates FDPS [HSA:2224] [KO:K00787] ...

  16. Dgroup: DG01455 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 212 ... Norepinephrine ... D00076 ... Noradrenaline (JP17); Norepinephrine (INN) ... D05206 ... Norepinephrine bitartr...USP); Isoprenaline sulfate (JAN) ... D02150 ... l-Isoprenaline hydrochloride (JP17) ... DG00212 ... Norepinephrine ... D00076 ... Noradrenaline...DG00212 ... Norepinephrine ... D00076 ... Noradrenaline (JP17); Norepinephrine (INN) ...

  17. Ochrobactrum anthropi used to control ammonium for nitrate removal by starch-stabilized nanoscale zero valent iron.

    Science.gov (United States)

    Zhou, Jun; Sun, Qianyu; Chen, Dan; Wang, Hongyu; Yang, Kai

    2017-10-01

    In this study, the hydrogenotrophic denitrifying bacterium Ochrobactrum anthropi was added in to the process of nitrate removal by starch-stabilized nanoscale zero valent iron (nZVI) to minimize undesirable ammonium. The ammonium control performance and cooperative mechanism of this combined process were investigated, and batch experiments were conducted to discuss the effects of starch-stabilized nZVI dose, biomass, and pH on nitrate reduction and ammonium control of this system. The combined system achieved satisfactory performance because the anaerobic iron corrosion process generates H 2 , which is used as an electron donor for the autohydrogenotrophic bacterium Ochrobactrum anthropi to achieve the autohydrogenotrophic denitrification process converting nitrate to N 2 . When starch-stabilized nZVI dose was increased from 0.5 to 2.0 g/L, nitrate reduction rate gradually increased, and ammonium yield also increased from 9.40 to 60.51 mg/L. Nitrate removal rate gradually decreased and ammonium yield decreased from 14.93 to 2.61 mg/L with initial OD 600 increasing from 0.015 to 0.080. The abiotic Fe 0 reduction process played a key role in nitrate removal in an acidic environment and generated large amounts of ammonium. Meanwhile, the nitrate removal rate decreased and ammonium yield also reduced in an alkaline environment.

  18. Dgroup: DG01909 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available salazide DG01909.gif DG00015 ... Acetylsalicylic acid ... D00109 ... Aspirin (JP17/USP); Aspalon (JAN) ... D05181 ... Aspirin... aluminum (JP17) ... D07579 ... Aspirin calcium salt ... D07580 ... Aspirin DL-lysine (JAN) ... D07581 ... Aspirin magnesium salt ... D07582 ... Aspiri

  19. Dgroup: DG00786 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00786 Chemical ... DGroup Risedronic acid ... D08484 ... Risedronic acid (INN) D00942 ... Risedron...ate sodium (USP) ... D03234 ... Sodium risedronate hydrate (JP17) ... Other ... DG01600 ... Bisphosphonate ATC code: M05BA07 Bisphosphonates FDPS [HSA:2224] [KO:K00787] ...

  20. Dgroup: DG01001 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ific agonist Other ... DG01718 ... Drugs for addictive disorder ... DG01717 ... Drugs for op...ioid dependence ATC code: N07BC04 Alpha2b-adrenergic receptor agonist, Drugs used in opioid dependence, Antihypertensives ADRA2B [HSA:151] [KO:K04139] ...

  1. Dgroup: DG00973 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00973 Chemical ... DGroup Lisdexamfetamine ... D08130 ... Lisdexamfetamine (INN) D04747 ... Lisdexamfe...tamine dimesylate (USAN); Lisdexamfetamine mesilate (JAN) ... Neuropsychiatric agent ... DG01970 ... Age...nts for ADHD ATC code: N06BA12 Psychostimulant, Central sympathomimetic agent Active form of prodrug: Dextroamphetamine (Dexamfe

  2. Dgroup: DG00330 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available her ... DG01575 ... Calcium channel blocker ... DG01496 ... Calcium channel L type blocker ATC code: C08DA02 Phenylalky...lamine calcium channel blocker CACNA1-L [HSA:775 776 778 779] [KO:K04850 K04851 K04853 K04857] ...

  3. Dgroup: DG01798 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available eutral (USAN); Neutral insulin injection (INN) D04550 ... Insulin zinc, prompt (USP) Antidiabetic... agent ... DG01636 ... Insulin and analogue ... DG01802 ... Human insulin ATC code: A10AB Antidiabetics INSR (CD220) [HSA:3643] [KO:K04527] ... CYP induction: CYP1A2 [HSA:1544

  4. Dgroup: DG01799 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available e (USP) D04547 ... Insulin, isophane (USP); Isophane insulin injection (aqueous suspension) (JAN) Antidiabetic ...agent ... DG01636 ... Insulin and analogue ... DG01802 ... Human insulin ATC code: A10AC Antidiabetics INSR (CD220) [HSA:3643] [KO:K04527] ... CYP induction: CYP1A2 [HSA:1544

  5. Dgroup: DG01746 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 48 ... Loop diuretic ... Loop diuretics, sulfonamide SLC12A1 (NKCC2) [HSA:6557] [KO:K14425] SLC12A2 (NKCC1) [HSA:6558] [KO:K10951] ... ...P17/USP/INN) ... D01634 ... Piretanide (JAN/USAN/INN) Cardiovascular agent ... DG01690 ... Sulfonamide diuretic ... DG017

  6. Dgroup: DG01504 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ory drug, salicylic acid derivatives ... DG00015 ... Acetylsalicylic acid ... D00109 ... Aspirin (JP17/USP); Aspalon (JAN) ... D05181 ... Aspirin... aluminum (JP17) ... D07579 ... Aspirin calcium salt ... D07580 ... Aspirin DL-lysine (JAN) ... D07581 ... Aspirin... magnesium salt ... D07582 ... Aspirin sodium ... DG00099 ... Olsalazine ... D0

  7. Dgroup: DG01751 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ta-1a (USAN); Interferon beta-1a (genetical recombination) (JAN) ... Antineoplastic ... DG01752 ... Interferone ... Immunostimulants, Antineoplastics ... ... DG01751 Chemical ... DGroup Interferon beta ... D00746 ... Interferon beta-1b (USAN/INN); Interferon beta-1b (genet...ical recombination) (JAN) ... D03304 ... Interferon beta (JAN) ... D04554 ... Interferon be

  8. Dgroup: DG01501 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available N) ... D03077 ... Benazeprilat (USAN/INN) D03440 ... Ceronapril (USAN/INN) D03756 ... Indolapril hydrochloride (USAN) ... (USAN) ... D00383 ... Trandolapril (JAN/INN) ... DG00342 ... Spirapril ... D08529 ... Spirapril (INN) ... D03765 ... Spirapril ...USAN); Cilazapril hydrate (JP17) ... DG00341 ... Fosinopril ... D07992 ... Fosinopril (INN) ... D00622 ... Fosinopril sodium

  9. Dgroup: DG01800 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ulin human zinc (USP) D04543 ... Insulin human zinc, extended (USP) D05622 ... Proinsulin human (USAN) Antidiabetic... agent ... DG01636 ... Insulin and analogue ... DG01802 ... Human insulin ATC code: A10AE Antidiabetics INSR (CD220) [HSA:3643] [KO:K04527] ... CYP induction: CYP1A2 [HSA:1544

  10. Dgroup: DG00874 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available AN/USP) ... D02163 ... Fluphenazine maleate (JAN) ... Neuropsychiatric agent ... DG01905 ... Phenothiazine antipsychoti...ubstrate ... DG01644 ... CYP2D6 substrate ATC code: N05AB02 Antipsychotic, Dopamine D2 receptor antagonist Phenothiazine derivative DRD2 [HSA:1813] [KO:K04145] Enzyme: CYP2D6 [HSA:1565] ...

  11. Dgroup: DG00787 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00787 Chemical ... DGroup Zoledronic acid ... D08689 ... Zoledronic acid (INN) D01968 ... Zoledron...ic acid (USAN); Zoledronic acid hydrate (JAN) ... D06378 ... Zoledronate disodium (USAN) D06379 ... Zoledron...ate trisodium (USAN) D10515 ... Zoledronic acid hemipentahydrate (JAN) Other ... DG01600 ... Bisphosphonate ATC code: M05BA08 Bisphosphonates FDPS [HSA:2224] [KO:K00787] ...

  12. DG TOMO: A new method for tomographic reconstruction

    International Nuclear Information System (INIS)

    Freitas, D. de; Feschet, F.; Cachin, F.; Geissler, B.; Bapt, A.; Karidioula, I.; Martin, C.; Kelly, A.; Mestas, D.; Gerard, Y.; Reveilles, J.P.; Maublant, J.

    2006-01-01

    Aim: FBP and OSEM are the most popular tomographic reconstruction methods in scintigraphy. FBP is a simple method but artifacts of reconstruction are generated which corrections induce degradation of the spatial resolution. OSEM takes account of statistical fluctuations but noise strongly increases after a certain number of iterations. We compare a new method of tomographic reconstruction based on discrete geometry (DG TOMO) to FBP and OSEM. Materials and methods: Acquisitions were performed on a three-head gamma-camera (Philips) with a NEMA Phantom containing six spheres of sizes from 10 to 37 mm inner diameter, filled with around 325 MBq/l of technetium-99 m. The spheres were positioned in water containing 3 MBq/l of technetium-99 m. Acquisitions were realized during a 180 o -rotation around the phantom by 25-s steps. DG TOMO has been developed in our laboratory in order to minimize the number of projections at acquisition. Two tomographic reconstructions utilizing 32 and 16 projections with FBP, OSEM and DG TOMO were performed and transverse slices were compared. Results: FBP with 32 projections detects only the activity in the three largest spheres (diameter ≥22 mm). With 16 projections, the star effect is predominant and the contrast of the third sphere is very low. OSEM with 32 projections provides a better image but the three smallest spheres (diameter ≤17 mm) are difficult to distinguish. With 16 projections, the three smaller spheres are not detectable. The results of DG TOMO are similar to OSEM. Conclusion: Since the parameters of DG TOMO can be further optimized, this method appears as a promising alternative for tomoscintigraphy reconstruction

  13. Optimal DG placement in deregulated electricity market

    International Nuclear Information System (INIS)

    Gautam, Durga; Mithulananthan, Nadarajah

    2007-01-01

    This paper presents two new methodologies for optimal placement of distributed generation (DG) in an optimal power flow (OPF) based wholesale electricity market. DG is assumed to participate in real time wholesale electricity market. The problem of optimal placement, including size, is formulated for two different objectives, namely, social welfare maximization and profit maximization. The candidate locations for DG placement are identified on the basis of locational marginal price (LMP). Obtained as lagrangian multiplier associated with active power flow equation for each node, LMP gives the short run marginal cost (SRMC) of electricity. Consumer payment, evaluated as a product of LMP and load at each load bus, is proposed as another ranking to identify candidate nodes for DG placement. The proposed rankings bridges engineering aspects of system operation and economic aspects of market operation and act as good indicators for the placement of DG, especially in a market environment. In order to provide a scenario of variety of DGs available in the market, several cost characteristics are assumed. For each DG cost characteristic, an optimal placement and size is identified for each of the objectives. The proposed methodology is tested in a modified IEEE 14 bus test system. (author)

  14. Susceptibility of the tomato mutant high pigment-2dg (hp-2dg) to Orobanche spp. infection.

    Science.gov (United States)

    López-Ráez, Juan Antonio; Charnikhova, Tatsiana; Mulder, Patrick; Kohlen, Wouter; Bino, Raoul; Levin, Ilan; Bouwmeester, Harro

    2008-08-13

    The consumption of natural products with potential health benefits has been continuously growing, and enhanced pigmentation is of major economic importance in fruits and vegetables. The tomato hp-2 ( dg ) is an important mutant line that has been introgressed into commercial tomato cultivars marketed as lycopene rich tomatoes (LRT) because of their enhanced fruit pigmentation, attributed to higher levels of carotenoids, including lycopene. Strigolactones are signaling compounds that mediate host finding in root parasitic plants and are biosynthetically derived from carotenoids. Considering the high carotenoid content of the hp-2 ( dg ) mutant, we studied its susceptibility to the root parasite Orobanche. In a field experiment, the average number of Orobanche aegyptiaca plants growing on hp-2 ( dg ) was surprisingly significantly reduced compared with its isogenic wild-type counterpart. In vitro assays and LC-MS/MS analysis showed that this reduction was associated with a lower production of strigolactones, which apparently renders the high-carotenoid hp-2 ( dg ) mutant less susceptible to Orobanche.

  15. Experimental Conditions: SE51_S01_M01_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE51_S01_M01_D01 SE51 RIKEN tandem mass spectral database (ReSpect) for phytochemic...als: A plant-specific MS/MS-based data resource and database SE51_S01 L. japonicus accessions SE51_S01_M01 N

  16. Experimental Conditions: SE48_S01_M01_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available structure elucidation of 36 specialized metabolites from Oryza sativa (rice) by using MS/MS and NMR analyse...s SE48_S01 Habataki SE48_S01_M01 1 μL SE48_MS01 LC–QTOF-MS/MS analysis SE48_DS01 Data upload Default SE48_AM01 SE48_SS01 Isolation of specialized metabolites ...

  17. Biopesticide activity of sugarcane associated rhizobacteria: Ochrobactrum intermedium strain NH-5 and Stenotrophomonas maltophilia strain NH-300 against red rot under field conditions

    Directory of Open Access Journals (Sweden)

    Muhammad Nadeem HASSAN

    2014-09-01

    Full Text Available Colletotrichum falcatum is the major fungal pathogen causing sugarcane red rot. Four antagonistic bacterial strains exhibiting biocontrol activity against this pathogen in greenhouse conditions were characterized for production of different antifungal metabolites and biocontrol determinants to elucidate the mechanism of action involved in their antagonistic activity. The strains were also evaluated under field conditions to assess their biocontrol potential. All the strains produced hydrogen cyanide (HCN, and volatile and diffusible antibiotics. In addition, the Ochrobactrum intermedium strain NH-5 produced siderophores and the broad spectrum antibiotic 2, 4-diacetylphloroglucinol (2,4-DAPG; Pseudomonas sp. NH-203 produced siderophores, and Pseudomonas sp. NH-276 produced protease. Two strains, Ochrobactrum intermedium NH-5 and Stenotrophomonas maltophilia NH-300, exhibited good biocontrol activity, suppressing red rot by 44–52% on two sugarcane varieties, SPF-234 and Co-1148, in field experiments. The strains gave consistent results in three consecutive years and showed potential to be used as biopesticides.

  18. NCBI nr-aa BLAST: CBRC-MEUG-01-2295 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-MEUG-01-2295 ref|ZP_05041983.1| twin arginine-targeting protein translocase Ta...tC [Alcanivorax sp. DG881] gb|EDX89404.1| twin arginine-targeting protein translocase TatC [Alcanivorax sp. DG881] ZP_05041983.1 0.30 30% ...

  19. Dynamic Rupture Benchmarking of the ADER-DG Method

    Science.gov (United States)

    Gabriel, Alice; Pelties, Christian

    2013-04-01

    We will verify the arbitrary high-order derivative Discontinuous Galerkin (ADER-DG) method in various test cases of the 'SCEC/USGS Dynamic Earthquake Rupture Code Verification Exercise' benchmark suite (Harris et al. 2009). The ADER-DG scheme is able to solve the spontaneous rupture problem with high-order accuracy in space and time on three-dimensional unstructured tetrahedral meshes. Strong mesh coarsening or refinement at areas of interest can be applied to keep the computational costs feasible. Moreover, the method does not generate spurious high-frequency contributions in the slip rate spectra and therefore does not require any artificial damping as demonstrated in previous presentations and publications (Pelties et al. 2010 and 2012). We will show that the mentioned features hold also for more advanced setups as e.g. a branching fault system, heterogeneous background stresses and bimaterial faults. The advanced geometrical flexibility combined with an enhanced accuracy will make the ADER-DG method a useful tool to study earthquake dynamics on complex fault systems in realistic rheologies. References: Harris, R.A., M. Barall, R. Archuleta, B. Aagaard, J.-P. Ampuero, H. Bhat, V. Cruz-Atienza, L. Dalguer, P. Dawson, S. Day, B. Duan, E. Dunham, G. Ely, Y. Kaneko, Y. Kase, N. Lapusta, Y. Liu, S. Ma, D. Oglesby, K. Olsen, A. Pitarka, S. Song, and E. Templeton, The SCEC/USGS Dynamic Earthquake Rupture Code Verification Exercise, Seismological Research Letters, vol. 80, no. 1, pages 119-126, 2009 Pelties, C., J. de la Puente, and M. Kaeser, Dynamic Rupture Modeling in Three Dimensions on Unstructured Meshes Using a Discontinuous Galerkin Method, AGU 2010 Fall Meeting, abstract #S21C-2068 Pelties, C., J. de la Puente, J.-P. Ampuero, G. Brietzke, and M. Kaeser, Three-Dimensional Dynamic Rupture Simulation with a High-order Discontinuous Galerkin Method on Unstructured Tetrahedral Meshes, JGR. - Solid Earth, VOL. 117, B02309, 2012

  20. Genome sequence of Ochrobactrum anthropi strain SUBG007, a plant pathogen and potential xenobiotic compounds degradation bacterium

    Directory of Open Access Journals (Sweden)

    Kiran S. Chudasama

    2017-03-01

    Full Text Available Ochrobactrum anthropi SUBG007 was isolated from the fruit of Prunus dulcis in Rajkot (22.30°N, 70.78°E, Gujarat, India. Here we present the 4.37 Mb genome sequence strain SUBG007, which may provide the genetic information for the application in environment pollution degradation and agriculture field. The strain also posses many genes cluster which involved in production of important secondary metabolites. The nucleotide sequence of this genome was deposited into NCBI GenBank under the accession LUAY00000000.

  1. Dgroup: DG01152 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01152 Chemical ... DGroup Edetate ... D00052 ... Edetic acid (NF/INN) D00571 ... Edetate calcium disodium... anhydrous (USP) D01802 ... Edetate disodium (USP); Disodium edetate hydrate (JP17) D03943 ... Edetate calcium disodium... (USP); Calcium sodium edetate hydrate (JP17); Sodium calcium edetate (INN) ... D03944 ... Ed...etate dipotassium (USAN) D03945 ... Disodium edetate D03946 ... Edetate sodium (USAN) D03947 ... Edetate trisodium... (USAN) D07934 ... Edetate calcium disodium D07935 ... Dicobalt edetate (INN) Other ... DG01692 ... Chelator ATC code: V03AB03 Antidotes, Chelating agents ...

  2. A comparative study of the DG-OMEGA (DG Omega), DGII, and GAT method for the structure elucidation of a methylene-acetal linked thymine dinucleotide

    NARCIS (Netherlands)

    van Kampen, A. H. C.; Beckers, M. L. M.; Buydens, L. M. C.

    1997-01-01

    This research continues the investigation of the properties of the recently developed structure elucidation method DG-OMEGA (DG Omega). Towards this end it was applied for the structure determination of a methylene-acetal linked thymine dinucleotide. The performance of DG Omega was compared to the

  3. COST BENEFIT ANALYSIS OF A DG INTEGRATED SYSTEM: CASE STUDY

    Directory of Open Access Journals (Sweden)

    Ch. V. S. S. SAILAJA

    2017-09-01

    Full Text Available Distributed Generation is capable of meeting the load of the consumers partially or completely. Depending on the type of DG involved it can be operated in interconnected mode and islanded mode. The availability of numerous alternatives present for the DG technologies and large initial investments necessitates a detailed cost benefit analysis for the implementation of DG technologies. In this work an attempt has been made to study the costs involved in implementing the DG technologies. A practical system having two kinds of distributed generation i.e., Diesel Generator and solar photovoltaic system for its back up purpose is considered. A detailed cost analysis of the two DG technologies is carried out.

  4. Effect of Load Model Using Ranking Identification Technique for Multi Type DG Incorporating Embedded Meta EP-Firefly Algorithm

    Directory of Open Access Journals (Sweden)

    Abdul Rahim Siti Rafidah

    2018-01-01

    Full Text Available This paper presents the effect of load model prior to the distributed generation (DG planning in distribution system. In achieving optimal allocation and placement of DG, a ranking identification technique was proposed in order to study the DG planning using pre-developed Embedded Meta Evolutionary Programming–Firefly Algorithm. The aim of this study is to analyze the effect of different type of DG in order to reduce the total losses considering load factor. To realize the effectiveness of the proposed technique, the IEEE 33 bus test systems was utilized as the test specimen. In this study, the proposed techniques were used to determine the DG sizing and the suitable location for DG planning. The results produced are utilized for the optimization process of DG for the benefit of power system operators and planners in the utility. The power system planner can choose the suitable size and location from the result obtained in this study with the appropriate company’s budget. The modeling of voltage dependent loads has been presented and the results show the voltage dependent load models have a significant effect on total losses of a distribution system for different DG type.

  5. Performance assessment of gate material engineered AlInN/GaN underlap DG MOSFET for enhanced carrier transport efficiency

    Science.gov (United States)

    Pardeshi, Hemant M.; Raj, Godwin; Pati, Sudhansu; Mohankumar, N.; Sarkar, Chandan Kumar

    2013-08-01

    In the work proposed, performance of dual material gate (DMG) AlInN/GaN underlap DG MOSFET has been analyzed and compared with the corresponding performance of single material gate (SMG) AlInN/GaN underlap DG MOSFET using Sentaurus TCAD device simulation. A systematic, quantitative investigation of key device metrics for DMG-DG device is presented and a comparison with SMG-DG device is done for a wide range of gate and underlap lengths. The key idea in this paper is to demonstrate the improved performance exhibited by DMG-DG device over SMG-DG device, due to enhanced carrier transport efficiency and suppressed short channel effect (SCE). Simulation reveals an improvement in drain current, drain induced barrier lowering (DIBL), Ion/Ioff, Delay and Energy Delay Product (EDP) for DMG-DG MOSFET as compared to SMG-DG MOSFET. Very high drain current of 6.7 mA/μm, low DIBL of 1.62 mV/V, high Ion/Ioff ratio of 4.044e107, low delay of 0.001 ps and low EDP of 1.37e-31 J s/μm are obtained for DGM-DG device. However, subthreshold slope (SS) for DMG-DG device is on higher side than SMG-DG. The proposed AlInN/GaN Heterostructure Underlap DGM-DG MOSFET shows excellent promise as one of the candidates to substitute present MOSFET for future high speed applications.

  6. 2-deoxy-d-glucose (2-DG) inhibits radiation induced carcinogenesis (skin tumors) in mice

    International Nuclear Information System (INIS)

    Singh, Saurabh; Bhuria, Vikas; Pandey, Sanjay; Saluja, Daman; Dwarakanath, B.S.

    2014-01-01

    One of the late effects of radiation exposure i.e. carcinogenesis is exemplified by atomic bomb survivors, radiotherapy patients and occupational workers. Enhanced glucose metabolism (Warburg's effect) is a fundamental metabolic change in transformed cells which drives tumorigenesis. It is suggested that Dietary Energy Restriction (DER) that targets glucose metabolism may afford protection against radiation-induced carcinogenesis. However, DER is practically difficult to sustain in humans. Therefore, we have hypothesized that the glycolytic inhibitor, 2-deoxy-D-glucose (2-DG), a potential energy restriction mimetic agent (ERMA) may impair the process of tumorigenesis as an alternative to DER. In the present studies we investigated the effects of dietary 2-DG on radiation induced papillomas in mice. Swiss albino mice (male) were irradiated with a fractionated dose schedule (1.5 Gy ionizing radiation/week for four weeks) focally on the shaved back followed by the application of tumor promoting agent (TPA) once weekly till the termination of the study. Mice were administered 2-DG (0.2% and 0.4% w/v) containing water starting a week after last irradiation. A significant reduction in the tumor incidence, tumor burden, besides increase in the latency period was observed in the 2-DG fed mice. The average tumor incidence (papillomas formation) was reduced to 25% and 37% in 0.2% and 0.4% 2-DG group respectively from 47% in the control group with a significant delay in the onset. Under these conditions, 2-DG considerably enhanced the level of reduced glutathione (GSH) with a concomitant decrease in the lipid peroxidation. 2-DG fed tumor bearing mice showed decrease in splenic CD4 + to CD8 + T-cell ratio and prevented the tumor induced augmentation of T-regulatory cells (CD4 + CD25 + ) which correlated with an increase in CD8 + (CTLs) cells. Dietary 2-DG also reduced the tumor associated and radiation induced angiogenesis. These observations suggest that dietary 2-DG

  7. Dgroup: DG01220 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available biotic, Antineoplastic, Antiprotozoal (Trypanosoma), Protein biosynthesis inhibitor ribosome ... ... DG01220 Chemical ... DGroup Puromycin ... D05653 ... Puromycin (USAN) D05655 ... Puromycin hydrochloride (USAN) ... Anti

  8. Dgroup: DG02643 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02643 Chemical ... DGroup Ritipenem ... D09849 ... Ritipenem acoxil hydrate (JAN) ... Anti...bacterial, Cell wall biosynthesis inhibitor beta-Lactam, carbapenem penicillin binding protein ...

  9. Dgroup: DG02570 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02570 Chemical ... DGroup Tebipenem ... D09598 ... Tebipenem pivoxil (JAN/INN) ... Anti...bacterial, Cell wall biosynthesis inhibitor beta-Lactam, Carbapenem penicillin binding protein ...

  10. Dgroup: DG01244 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available odium (USAN) Anti-allergic agent ... DG01541 ... Cysteinyl leukotriene receptor antagonist ... Leukotrien-receptor antagonist; Antiasthmatic agent CYSLTR1 [HSA:10800] [KO:K04322] ...

  11. CONTEMPT-DG containment analysis code

    International Nuclear Information System (INIS)

    Deem, R.E.; Rousseau, K.

    1982-01-01

    The assessment of hydrogen burning in a containment building during a degraded core event requires a knowledge of various system responses. These system responses (i.e. heat sinks, fan cooler units, sprays, etc.) can have a marked effect on the overall containment integrity results during a hydrogen burn. In an attempt to properly handle the various system responses and still retain the capability to perform sensitivity analysis on various parameters, the CONTEMPT-DG computer code was developed. This paper will address the historical development of the code, its various features, and the rationale for its development. Comparisons between results from the CONTEMPT-DG analyses and results from similar MARCH analyses will also be given

  12. Dgroup: DG01358 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01358 Chemical ... DGroup Trastuzumab ... D03257 ... Trastuzumab (INN); Trastuzumab (genetica...l recombination) (JAN) ... D09980 ... Trastuzumab emtansine (USAN/INN); Trastuzumab emtansine (genetical re

  13. Dgroup: DG02648 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02648 Chemical ... DGroup Infliximab ... D02598 ... Infliximab (USAN/INN); Infliximab (genetica...l recombination) (JAN); Infliximab (genetical recombination) [Infliximab biosimilar1] (JAN); Infliximab (genetica

  14. Dgroup: DG02612 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02612 Chemical ... DGroup Rituximab ... D02994 ... Rituximab (USAN/INN); Rituximab (gene...tical recombination) (JAN); Rituximab (genetical recombination) [Rituximab biosimilar 1] (JAN) ... ATC code:

  15. Dgroup: DG01417 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01417 Chemical ... DGroup Volasertib ... D10182 ... Volasertib (USAN) D10183 ... Volasertib... trihydrochloride (USAN); Volasertib hydrochloride (JAN) ... Antineoplastics PLK1 [HSA:5347] [KO:K06631] ...

  16. Dgroup: DG01644 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available xetine ... D07473 ... Atomoxetine (USP/INN) ... D02574 ... Atomoxetine...0967 ... Dexamfetamine ... D03740 ... Dextroamphetamine (USAN); Dexamfetamine (INN) ... D02078 ... Dextroamphetamine sulfate (USP) ... DG00970 ... Atomo

  17. Dgroup: DG02007 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02007 DGroup Antianxiety, carbamate derivatives ... D00376 ... Meprobamate (JAN/USP/I...NN) ... D07317 ... Emylcamate (INN) D01807 ... Mebutamate (JAN/USAN) Neuropsychiatric agent ... Antianxiety ...

  18. Dgroup: DG01771 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01771 Chemical ... DGroup Docusate ... D00305 ... Docusate sodium (USP); Sodium dioctyl ...sulfosuccinate (INN); Dioctyl sodium sulfosuccinate (JAN) ... D03885 ... Docusate calcium (USP) D03886 ... Docusate

  19. Dgroup: DG01987 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01987 Chemical ... DGroup Eglumegad Eglumetad ... D08908 ... Eglumegad (INN) D03966 ... Eglumetad (USAN) ... Antianxie...ty, Smoking cessation ajunct GRM2 [HSA:2912] [KO:K04605] ...

  20. Dgroup: DG02590 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02590 Chemical ... DGroup Laropiprant ... D08940 ... Laropiprant (INN/USAN) ... Anti-atherosclerotic, Antidyslipide...mia, Prostaglandin D2 receptor antagonist Target: PTGDR [HSA:5729] [KO:K04332] ...

  1. A multi-objective control strategy for grid connection of DG (distributed generation) resources

    Energy Technology Data Exchange (ETDEWEB)

    Pouresmaeil, Edris; Montesinos-Miracle, Daniel; Bergas-Jane, Joan [Centre d' Innovacio Tecnologica en Convertidors Estatics i Accionaments (CITCEA-UPC), Departament d' Enginyeria Electrica, Universitat Politecnica de Catalunya, ETS d' Enginyeria Industrial de Barcelona (Spain); Gomis-Bellmunt, Oriol [Centre d' Innovacio Tecnologica en Convertidors Estatics i Accionaments (CITCEA-UPC), Departament d' Enginyeria Electrica, Universitat Politecnica de Catalunya, ETS d' Enginyeria Industrial de Barcelona (Spain); Catalonia Institute for Energy Research IREC, Barcelona (Spain)

    2010-12-15

    This paper presents a flexible control technique for connection of DG (distributed generation) resources to distribution networks, especially during ride-through on faulty grid. This strategy is derived from the abc/{alpha}{beta} and {alpha}{beta}/dq transformations of the ac system variables. The active and reactive currents injected by the DG source are controlled in the synchronously rotating orthogonal dq reference frame. The transformed variables are used to control the VSI (voltage source inverter) which connects the DG to the distribution network. Using a P.L.L. (phase locked loop) in circuit of proposed control technique, the angle of positive sequence has been detected, in order to synchronize the currents to the distribution network. The proposed control technique has the capability of providing active and reactive powers and harmonic currents to nonlinear loads with a fast dynamic response. Simulation results and mathematical analysis have been completed in order to achieve a reduced THD (total harmonic distortion), increased power factor and compensated load's active and reactive powers. The analyses show the high performance of this control strategy in DG applications in comparison with other existing strategies. (author)

  2. Dgroup: DG02662 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02662 Chemical ... DGroup Apolizumab ... D02967 ... Apolizumab (USAN/INN) ... Antineoplastic, Anti-HLA-DR antibody... Monoclonal antibody HLA-DRB [HSA:3123 3125 3126 3127] [KO:K06752] ...

  3. Dgroup: DG02658 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02658 Chemical ... DGroup Cysteamine Mercaptamine ... D03634 ... Cysteamine (USAN); Merc...aptamine (INN) D03635 ... Cysteamine hydrochloride (USAN) ... D10468 ... Cysteamine bitartrate (JAN) ... Cystine concentration-lowering agent ...

  4. Dgroup: DG01967 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available de (INN) ... D00502 ... Pergolide mesylate (USP); Pergolide mesilate (JAN) ... D07836 ... Dihydroergocryptine mesilate DG00862 ... Ropini...role ... D08489 ... Ropinirole (USAN/INN) ... D00784 ... Ropinirole hydrochlo

  5. Chrysanthemum WRKY gene DgWRKY5 enhances tolerance to salt stress in transgenic chrysanthemum.

    Science.gov (United States)

    Liang, Qian-Yu; Wu, Yin-Huan; Wang, Ke; Bai, Zhen-Yu; Liu, Qing-Lin; Pan, Yuan-Zhi; Zhang, Lei; Jiang, Bei-Bei

    2017-07-06

    WRKY transcription factors play important roles in plant growth development, resistance and substance metabolism regulation. However, the exact function of the response to salt stress in plants with specific WRKY transcription factors remains unclear. In this research, we isolated a new WRKY transcription factor DgWRKY5 from chrysanthemum. DgWRKY5 contains two WRKY domains of WKKYGQK and two C 2 H 2 zinc fingers. The expression of DgWRKY5 in chrysanthemum was up-regulated under various treatments. Meanwhile, we observed higher expression levels in the leaves contrasted with other tissues. Under salt stress, the activities of superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) enzymes in transgenic chrysanthemum were significantly higher than those in WT, whereas the accumulation of H 2 O 2 , O 2 - and malondialdehyde (MDA) was reduced in transgenic chrysanthemum. Several parameters including root length, root length, fresh weight, chlorophyll content and leaf gas exchange parameters in transgenic chrysanthemum were much better compared with WT under salt stress. Moreover, the expression of stress-related genes DgAPX, DgCAT, DgNCED3A, DgNCED3B, DgCuZnSOD, DgP5CS, DgCSD1 and DgCSD2 was up-regulated in DgWRKY5 transgenic chrysanthemum compared with that in WT. These results suggested that DgWRKY5 could function as a positive regulator of salt stress in chrysanthemum.

  6. Dgroup: DG02651 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ody Monoclonal antibody IL2RA (CD25) [HSA:3559] [KO:K05068] ... ... DG02651 Chemical ... DGroup Daclizumab ... D03639 ... Daclizumab (USAN/INN) ... Immunosuppressant, Anti-CD25 antib

  7. Dgroup: DG00637 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00637 Chemical ... DGroup Micafungin ... D08218 ... Micafungin (INN) D02465 ... Micafungin ...sodium (JAN/USAN) ... D11010 ... Micafungin sodium hydrate (JAN) ... ATC code: J02AX05 Antibiotics ...

  8. Dgroup: DG01735 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available glinide (JP17/USAN/INN) ... D01854 ... Mitiglinide calcium hydrate (JP17) ... Antidiabetic agent Unclassified ... DG02044 ... Hypoglycemics ... Antidiabetics ABCC8 (SUR1) [HSA:6833] [KO:K05032] ...

  9. Dgroup: DG01703 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available AN) DG01610 ... Xanthine-type cardiotonics ... D07151 ... Cafedrine (BAN) ... D07155 ... Theodrenaline (INN) ... D07933 ... Etofy... ... Ciclafrine hydrochloride (USAN) ... D07150 ... Gepefrine (INN) ... D07151 ... Cafedrine (BA

  10. Dgroup: DG01846 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available tat sodium (USAN) ... Antidyslipidemia (hypertriglyceridemic), Diacylglycerol acyltransferase 1 inhibitor DGAT1 [HSA:8694] [KO:K11155] ... ... DG01846 Chemical ... DGroup Pradigastat ... D10664 ... Pradigastat (USAN) D10657 ... Pradigas

  11. Dgroup: DG01773 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01773 Chemical ... DGroup Berberine ... C00757 ... Berberine D01250 ... Berberine chloride ...hydrate (JP17) ... D03258 ... Berberine tannate (JP17) D03293 ... Berberine sulfate hydrate (JAN) ... Anti-allergic

  12. Dgroup: DG01675 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available aine ... D01152 ... Oxethazaine (JP17/USAN); Oxetacaine (INN) ... D08311 ... Oxetacaine hydrochloride ... DG00801 ... Bupivacaine ... D07552 ... Bupiva...caine (USAN/INN) ... D01450 ... Bupivacaine hydrochloride (USP); Bupivacaine hydrochl

  13. Dgroup: DG01872 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01872 Chemical ... DGroup Aluminum silicate ... D03236 ... Synthetic aluminum silicate ...(JP17); Aluminum silicate, synthetic (JAN) ... D03237 ... Natural aluminum silicate (JP17); Aluminum silicate, natural (JAN) ... Antacids ...

  14. Dgroup: DG01720 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available P17); Cyclophosphamide tablets (JP17) ... DG01514 ... Palifosfamide ... D09364 ... Palifosfamide (USAN/INN) ... D10373 ... P...yclophosphamide ... D07760 ... Cyclophosphamide (INN) ... D00287 ... Cyclophosphamide (USP); Cyclophosphamide hydrate (J

  15. Sensitivity analysis of smart grids reliability due to indirect cyber-power interdependencies under various DG technologies, DG penetrations, and operation times

    International Nuclear Information System (INIS)

    Hashemi-Dezaki, Hamed; Agah, Seyed Mohammad Mousavi; Askarian-Abyaneh, Hossein; Haeri-Khiavi, Homayoun

    2016-01-01

    Highlights: • A novel risk assessment method considering the ICPIs is proposed. • The protection and monitoring system as the ICPIs applications are studied. • The uncertainty of results is analyzed in addition to expected average results. • ICPIs impacts due to DG penetrations under various DG technologies are analyzed. • The well-being criteria have been provided in addition to reliability indices. - Abstract: The cyber failures such as failures in protection and monitoring systems will not stop the operation or change the behavior of the power system instantly but will adversely affect the performance of the power system against the potential failure. Such indirect cyber-power interdependencies (ICPIs) may either intensify the probability of future failures or postpone the repercussion to the present failure of the power elements. The much less effort has been devoted in literature to investigate the ICPIs impacts, particularly in stochastic simulating space. In this paper, a novel stochastic-based reliability evaluation method which considers the ICPIs impacts under various uncertain parameters is proposed. The consideration of uncertainty regarding the renewable distributed generation (DG) units, consumption patterns, power and cyber elements, and ICPIs is one of the most important contributions of the proposed method. Further, a novel stochastic-based state upgrading is introduced to concern the ICPIs of protection and monitoring systems. By using the proposed state upgrading methodology, it is possible to evaluate the reliability of smart grid based on ICPIs by using conventional reliability evaluation methods. The proposed risk assessment methodology is applied to an actual distribution grid. The several sensitivity studies are performed to gain insight into how the penetration level of DG units under various DG technology scenarios can affect the ICPIs impacts on the risk level of smart grid. The test results show that regardless of the DG

  16. Dgroup: DG00135 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00135 Chemical ... DGroup Calcium gluconate ... D00935 ... Calcium gluconate (USP) ... D05463 ... Calcium... gluconate hydrate (JP17) ... ATC code: A12AA03 D11AX03 Calcium supplement ...

  17. Dgroup: DG02667 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02667 Chemical ... DGroup Teplizumab ... D09013 ... Teplizumab (USAN/INN) ... Antidiabetic, Anti-CD3 antibody... Monoclonal antibody CD3 [HSA:915 916 917] [KO:K06450 K06451 K06452] ...

  18. Dgroup: DG00694 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00694 Chemical ... DGroup Docetaxel ... D07866 ... Docetaxel (JAN/INN) ... D02165 ... Docetaxel (USAN); Doc...etaxel hydrate (JP17); Docetaxel injection (JP17); Docetaxel for injection (JP17) ... Cyp subs

  19. Dgroup: DG01196 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01196 Chemical ... DGroup Samarium (153Sm) lexidronam ... D08504 ... Samarium (153Sm) lexidron...am (INN) D05795 ... Samarium Sm 153 lexidronam pentasodium (USAN); Samarium (153Sm) lexidronam sodium (JA

  20. Dgroup: DG02000 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available AN/INN) DG01828 ... Deleobuvir ... D10554 ... Deleobuvir (USAN/INN) ... D10622 ... Deleobuvir sodium (JAN/USAN) D10477 ... Mericitabine (USAN/INN) Antiviral ... Treatment of hepatitis C NS5B polymerase ...

  1. Dgroup: DG02722 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available stic, TRAIL receptor 1 antibody Agonistic monoclonal antibody TNFRSF10A (TRAILR1, CD261) [HSA:8797] [KO:K04722] ... ... DG02722 Chemical ... DGroup Mapatumumab ... D04858 ... Mapatumumab (USAN/INN) ... Antineopla

  2. Dgroup: DG02668 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02668 Chemical ... DGroup Visilizumab ... D06314 ... Visilizumab (USAN/INN) ... Immunosuppressant, Anti-CD3 antibod...y Monoclonal antibody CD3 [HSA:915 916 917] [KO:K06450 K06451 K06452] ...

  3. Dgroup: DG01554 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01554 DGroup 5-Nitrofuran antiprotozoal nifur- ... D00830 ... Furazolidone (USP/INN) D... Nifuroxime (INN) D04714 ... Levofuraltadone (USAN/INN) D05165 ... Nifursemizone (USAN/INN) D05166 ... Nifursol (USAN) Antiparasitic ... Antiprotozoals ...

  4. Dgroup: DG01495 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available n (USAN/INN) ... D00626 ... Candesartan cilexetil (JP17/USAN) ... D00627 ... Telmisartan (JP17/USAN/INN); Telmisartan tablet...N); Olmesartan medoxomil tablets (JP17) ... DG00351 ... Azilsartan ... D08864 ... Azilsarta

  5. Dgroup: DG02018 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 03546 ... Clofarabine (JAN/USAN/INN) ... D05134 ... Nelarabine (JAN/USAN/INN); Nelzarabine (USAN) ... DG00686 ... C... ... D01651 ... Ancitabine hydrochloride (JAN) ... D04134 ... Fazarabine (USAN/INN) ... D04233 ... Flurocitabine (USAN/INN)

  6. Restoration of Low-Voltage Distribution Systems with Inverter-Interfaced DG Units

    DEFF Research Database (Denmark)

    Dietmannsberger, Markus; Wang, Xiongfei; Blaabjerg, Frede

    2018-01-01

    -area voltage collapse. This paper proposes a restoration strategy from zero voltage conditions for inverter-interfaced DG under islanded conditions. In the approach, a flexible and scalable Master DG inverter concept is introduced for distributed generations, where no communication is needed and an outage......The increasing share of distributed generation (DG) offers new chances in grid restoration of low-voltage distribution grids. Instead of relying on the transmission or high- and medium-voltage levels, establishing islanding operation in low-voltage grids might be a good option after a wide...... of the Master can be balanced by other DG inverters. The control strategy ensures the tracking of nominal values of the system voltage and frequency without zero steady-state error. The influences of non-controllable DG are also taken into account in the strategy with an effective countermeasure developed...

  7. Dgroup: DG01794 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available rtugliflozin (USAN/INN) D10669 ... Sotagliflozin (USAN/INN) Antidiabetic agent Uncla...ssified ... DG02044 ... Hypoglycemics ATC code: A10BK Antidiabetics SLC5A2 (SGLT2) [HSA:6524] [KO:K14382] ...

  8. Dgroup: DG01612 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ne ... D07944 ... Fenetylline (INN) ... D04147 ... Fenethylline hydrochloride (USAN) DG00974 ... Caffeine ... D00528 ... Caffeine... (USP); Anhydrous caffeine (JP17) ... D01453 ... Caffeine hydrate (JP17) ... D07603 ... Caffeine citrate (USP) ...

  9. Dgroup: DG01958 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available USP) ... D03546 ... Clofarabine (JAN/USAN/INN) ... D05134 ... Nelarabine (JAN/USAN/INN); Nelzarabine (USAN) ... DG...Enocitabine (JAN/INN) ... D01651 ... Ancitabine hydrochloride (JAN) ... D04134 ... Fazarabine (USAN/INN) ... D04233 ... Flu

  10. Stability Analysis for Operation of DG Units in Smart Grids

    DEFF Research Database (Denmark)

    Pouresmaeil, Edris; Shaker, Hamid Reza; Mehrasa, Majid

    2015-01-01

    This paper presents a multifunction control strategy for the stable operation of Distributed Generation (DG) units during grid integration. The proposed control model is based on Direct Lyapunov Control (DLC) theory and provides a stable region for the appropriate operation of DG units during grid....... Application of this concept can guarantee to reduce the stress on the grid during the energy demand peak. Simulation results are presented to demonstrate the proficiency and performance of the proposed DLC technique in DG technology....

  11. Dgroup: DG01186 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01186 Chemical ... DGroup Gadobenic acid ... D08018 ... Gadobenic acid (INN) D04283 ... Gadobe...nate dimeglumine (USAN); Meglumine gadobenate (JAN) ... ATC code: V08CA08 Non-ionic Contrast medium for NMR-tomography ...

  12. Dgroup: DG01439 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ine (JAN/USAN/INN) ... D05134 ... Nelarabine (JAN/USAN/INN); Nelzarabine (USAN) ... DG00686 ... Cytarabine ... D00168 ... ...tabine hydrochloride (JAN) D04134 ... Fazarabine (USAN/INN) D04233 ... Flurocitabine (USAN/INN) D06100 ... Tezacitabi

  13. Design and simulation of a nanoelectronic DG MOSFET current source using artificial neural networks

    International Nuclear Information System (INIS)

    Djeffal, F.; Dibi, Z.; Hafiane, M.L.; Arar, D.

    2007-01-01

    The double gate (DG) MOSFET has received great attention in recent years owing to the inherent suppression of short channel effects (SCEs), excellent subthreshold slope (S), improved drive current (I ds ) and transconductance (gm), volume inversion for symmetric devices and excellent scalability. Therefore, simulation tools which can be applied to design nanoscale transistors in the future require new theory and modeling techniques that capture the physics of quantum transport accurately and efficiently. In this sense, this work presents the applicability of the artificial neural networks (ANN) for the design and simulation of a nanoelectronic DG MOSFET current source. The latter is based on the 2D numerical Non-Equilibrium Green's Function (NEGF) simulation of the current-voltage characteristics of an undoped symmetric DG MOSFET. Our results are discussed in order to obtain some new and useful information about the ULSI technology

  14. Dgroup: DG01750 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available tical recombination) (JAN) D02745 ... Interferon alfa-2b (USAN); Interferon alfa-2b (genetica... DG01750 Chemical ... DGroup Interferon alpha ... D00745 ... Interferon alfa-2a (USAN/INN); Interferon alfa-2a (gene

  15. Dgroup: DG01430 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01430 Chemical ... DGroup Paclitaxel ... D00491 ... Paclitaxel (JAN/USP/INN) ... D05333 ... Paclitax...el poliglumex (USAN/INN) ... Antineoplastics, taxane TUBB [HSA:10381 10382 10383 203068 347688 347733 7280 81027 84617] [KO:K07375] ...

  16. Dgroup: DG00850 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available rochloride (USP) ... Neuropsychiatric agent ... DG02037 ... GABA mimetic antiepileptics ATC code: N03AG06 Fatty acid derivative anticonvulsa...nts, Fatty acid derivative antiepileptics SLC6A1 (GAT1) [HSA:6529] [KO:K05034] ...

  17. Dgroup: DG01466 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available granules (JP17); Ifenprodil tartrate tablets (JP17) ... DG00320 ... Labetalol ... D08106 ... Labetalol (INN) ... D... ... D00561 ... Sertindole (USAN/INN) ... D01674 ... Naftopidil (JP17/INN); Naftopidil tablets (JP17); Naftopidil orally disintegrating tablet

  18. Dgroup: DG01592 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available e (INN) ... D00633 ... Dopamine hydrochloride (JP17/USP) ... DG00801 ... Bupivacaine ... D07552 ... Bupivacaine (USAN/INN) ... D01450 ... Bupivacaine... hydrochloride (USP); Bupivacaine hydrochloride hydrate (JP17) ... D00059 ... Levodopa (JP17/USP/INN) ... Cardiovascular agent ...

  19. Dgroup: DG01190 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01190 Chemical ... DGroup Technetium (99mTc) medronic acid ... D02029 ... Technetium Tc 99m medron...ate (USP) ... D06038 ... Technetium Tc 99m medronate disodium (USP) ... ATC code: V09BA02 Radioactive dia

  20. Dgroup: DG00054 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00054 Chemical ... DGroup Belladonna total alkaloid ... D03069 ... Belladonna (USP); Belladon...na extract (JP17) D03223 ... Belladonna leaf (USP) D03224 ... Belladonna root (JP17) ... ATC code: A03BA04 Paralysis of parasympathetic ...

  1. Dgroup: DG02549 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02549 Chemical ... DGroup Rotigotine ... D05768 ... Rotigotine (JAN/USAN/INN) ... ATC code: N04BC09 Antiparkinson...ian, Dopamine D2 receptor agonist DRD2 [HSA:1813] [KO:K04145] Enzyme: SULT1A1 [HSA:

  2. Dgroup: DG00137 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00137 Chemical ... DGroup Calcium chloride ... C08130 ... Calcium chloride anhydrous D02256 ... Calcium... chloride (USP); Calcium chloride hydrate (JP17) ... ATC code: A12AA07 B05XA07 G04BA03 Calcium supplement ...

  3. Dgroup: DG00997 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ctive disorder ... DG01716 ... Drugs for alcohol dependence ATC code: N07BB04 Alcoholic agent OPRM1 [HSA:4988] [KO:K04215] OPRK1 [HSA:4986] [KO:K04214] OPRD1 [HSA:4985] [KO:K04213] ...

  4. Antibacterial properties of silver nanoparticles synthesized by marine Ochrobactrum sp.

    Science.gov (United States)

    Thomas, Roshmi; Janardhanan, Anju; Varghese, Rintu T; Soniya, E V; Mathew, Jyothis; Radhakrishnan, E K

    2014-01-01

    Metal nanoparticle synthesis is an interesting area in nanotechnology due to their remarkable optical, magnetic, electrical, catalytic and biomedical properties, but there needs to develop clean, non-toxic and environmental friendly methods for the synthesis and assembly of nanoparticles. Biological agents in the form of microbes have emerged up as efficient candidates for nanoparticle synthesis due to their extreme versatility to synthesize diverse nanoparticles with varying size and shape. In the present study, an eco favorable method for the biosynthesis of silver nanoparticles using marine bacterial isolate has been attempted. Very interestingly, molecular identification proved it as a strain of Ochrobactrum anhtropi. In addition, the isolate was found to have the potential to form silver nanoparticles intracellularly at room temperature within 24 h. The biosynthesized silver nanoparticles were characterized by UV-Vis spectroscopy, transmission electron microscope (TEM) and scanning electron microscope (SEM). The UV-visible spectrum of the aqueous medium containing silver nanoparticles showed a peak at 450 nm corresponding to the plasmon absorbance of silver nanoparticles. The SEM and TEM micrographs revealed that the synthesized silver nanoparticles were spherical in shape with a size range from 38 nm - 85 nm. The silver nanoparticles synthesized by the isolate were also used to explore its antibacterial potential against pathogens like Salmonella Typhi, Salmonella Paratyphi, Vibrio cholerae and Staphylococcus aureus.

  5. Antibacterial properties of silver nanoparticles synthesized by marine Ochrobactrum sp.

    Directory of Open Access Journals (Sweden)

    Roshmi Thomas

    2014-12-01

    Full Text Available Metal nanoparticle synthesis is an interesting area in nanotechnology due to their remarkable optical, magnetic, electrical, catalytic and biomedical properties, but there needs to develop clean, non-toxic and environmental friendly methods for the synthesis and assembly of nanoparticles. Biological agents in the form of microbes have emerged up as efficient candidates for nanoparticle synthesis due to their extreme versatility to synthesize diverse nanoparticles with varying size and shape. In the present study, an eco favorable method for the biosynthesis of silver nanoparticles using marine bacterial isolate has been attempted. Very interestingly, molecular identification proved it as a strain of Ochrobactrum anhtropi. In addition, the isolate was found to have the potential to form silver nanoparticles intracellularly at room temperature within 24 h. The biosynthesized silver nanoparticles were characterized by UV-Vis spectroscopy, transmission electron microscope (TEM and scanning electron microscope (SEM. The UV-visible spectrum of the aqueous medium containing silver nanoparticles showed a peak at 450 nm corresponding to the plasmon absorbance of silver nanoparticles. The SEM and TEM micrographs revealed that the synthesized silver nanoparticles were spherical in shape with a size range from 38 nm - 85 nm. The silver nanoparticles synthesized by the isolate were also used to explore its antibacterial potential against pathogens like Salmonella Typhi, Salmonella Paratyphi, Vibrio cholerae and Staphylococcus aureus.

  6. NODULATION OF YELLOW LUPIN (Lupinus luteus L. DEPENDING ON THE FORECROP, SEED INOCULATION WITH Bradyrhizobium lupini AND GENISTEIN

    Directory of Open Access Journals (Sweden)

    Janusz PRUSIŃSKI

    2012-12-01

    Full Text Available A strict two-factor field ‘Mister’ yellow lupin experiment was made in a split-plot design in poor rye complex soil (soil valuation class IVb at the Experiment Station of the Faculty of Agriculture and Biotechnology, the University of Technology and Life Sciences at Mochełek over 2008-2011. The experiment design covered 2 factors: growing yellow lupin after intercrops of ‘Bardena’ white mustard and ‘Pastar’ winter rye as well as seed inoculation with Bradyrhizobium lupini with or without genistein added. Growing intercrops in the poor rye complex soil considerably decreased neither the Nmin content in early spring nor the size of nodulation in yellow lupin. After lupin harvest, slightly more Nmin was noted for the treatments where intercrops were applied, especially rye in the 0-30 cm layer. The weather pattern, especially moisture conditions, pointed to a special sensitivity of nodulation to water deficit or excess in the rhizosphere. The method of preparing seeds for sowing did not play a greater role in developing the Nmin content in both soil profile layers analysed. White mustard showed a negative effect on the dry weight of nodules and the total N content in the plants and the seeds of yellow lupin as well as created the least favourable conditions for the survival and the capacity for symbiosis by symbiotic bacteria remaining in soil after lupin harvest. The state of yellow lupin plant nitrogen nutrition did not depend on the experimental factors.

  7. Dgroup: DG02550 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02550 Chemical ... DGroup Entacapone ... D00781 ... Entacapone (JAN/USAN/INN) ... ATC code: N04BX02 Antiparkinson...ian, Antidyskinetic, COMT inhibitor Nitrocactechols COMT [HSA:1312] [KO:K00545] ... CYP inhibition: COMT [HSA:1312], CYP2C9 [HSA:1559

  8. Dgroup: DG02639 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02639 Chemical ... DGroup Erlizumab ... D04045 ... Erlizumab (USAN/INN) ... Immunosuppressant, Anti-CD18 antibody... Monoclonal antibody Immunosuppressant, Anti-CD18 antibody LTBR (TNFRSF3, CD18) [HSA:4055] [KO:K03159] ITGAL (CD11A) [HSA:3683] [KO:K05718] ...

  9. Optimal allocation and adaptive VAR control of PV-DG in distribution networks

    International Nuclear Information System (INIS)

    Fu, Xueqian; Chen, Haoyong; Cai, Runqing; Yang, Ping

    2015-01-01

    Highlights: • A methodology for optimal PV-DG allocation based on a combination of algorithms. • Dealing with the randomicity of solar power energy using CCSP. • Presenting a VAR control strategy to balance the technical demands. • Finding the Pareto solutions using MOPSO and SVM. • Evaluating the Pareto solutions using WRSR. - Abstract: The development of distributed generation (DG) has brought new challenges to power networks. One of them that catches extensive attention is the voltage regulation problem of distribution networks caused by DG. Optimal allocation of DG in distribution networks is another well-known problem being widely investigated. This paper proposes a new method for the optimal allocation of photovoltaic distributed generation (PV-DG) considering the non-dispatchable characteristics of PV units. An adaptive reactive power control model is introduced in PV-DG allocation as to balance the trade-off between the improvement of voltage quality and the minimization of power loss in a distribution network integrated with PV-DG units. The optimal allocation problem is formulated as a chance-constrained stochastic programming (CCSP) model for dealing with the randomness of solar power energy. A novel algorithm combining the multi-objective particle swarm optimization (MOPSO) with support vector machines (SVM) is proposed to find the Pareto front consisting of a set of possible solutions. The Pareto solutions are further evaluated using the weighted rank sum ratio (WRSR) method to help the decision-maker obtain the desired solution. Simulation results on a 33-bus radial distribution system show that the optimal allocation method can fully take into account the time-variant characteristics and probability distribution of PV-DG, and obtain the best allocation scheme

  10. Dgroup: DG00119 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available in hydrate (JAN/USAN) ... D10262 ... Saxagliptin hydrochloride ... Antidiabetic agent ... DG01601 ... DPP-4 inhibitor T...4 inhibitor ATC code: A10BH03 Antidiabetic, Dipeptidyl peptidase-4 (DPP-4) inhibitor DPP4 [HSA:1803] [KO:K01278] Transporter: ABCB1 [HSA:5243] ...

  11. Dgroup: DG00129 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00129 Chemical ... DGroup Tocopherol (vit E) ... D02332 ... Tocopherol (JP17) D01406 ... Toco...pherol calcium succinate (JP17) D01530 ... Tocopherol nicotinate (JP17) ... D01735 ... Tocopherol acetate (JP17) ... D08612 ... Tocopherol succinate ... ATC code: A11HA03 Vitamin E ...

  12. Comparative Analysis of the Dark Ground Buffy Coat Technique (DG ...

    African Journals Online (AJOL)

    The prevalence of typanosome infection in 65 cattle reared under expensive system of management was determined using the dark ground buffy coat (DG) technique and the enzyme-linkedimmunisorbent assay (ELISA). The DG technique showed that there were 18 positive cases (27.69%) of total number of animals, made ...

  13. NCBI nr-aa BLAST: CBRC-XTRO-01-0287 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-XTRO-01-0287 ref|ZP_01892643.1| Binding-protein-dependent transport systems in...ner membrane component [Marinobacter algicola DG893] gb|EDM49210.1| Binding-protein-dependent transport systems

  14. Experimental Conditions: SE3_S02_M01_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE3_S02_M01_D01 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M01 6.7mg [MassBase ID] MDLC1_25529 SE3_MS1 LC-FT-ICR-MS

  15. A New DG Multiobjective Optimization Method Based on an Improved Evolutionary Algorithm

    Directory of Open Access Journals (Sweden)

    Wanxing Sheng

    2013-01-01

    Full Text Available A distribution generation (DG multiobjective optimization method based on an improved Pareto evolutionary algorithm is investigated in this paper. The improved Pareto evolutionary algorithm, which introduces a penalty factor in the objective function constraints, uses an adaptive crossover and a mutation operator in the evolutionary process and combines a simulated annealing iterative process. The proposed algorithm is utilized to the optimize DG injection models to maximize DG utilization while minimizing system loss and environmental pollution. A revised IEEE 33-bus system with multiple DG units was used to test the multiobjective optimization algorithm in a distribution power system. The proposed algorithm was implemented and compared with the strength Pareto evolutionary algorithm 2 (SPEA2, a particle swarm optimization (PSO algorithm, and nondominated sorting genetic algorithm II (NGSA-II. The comparison of the results demonstrates the validity and practicality of utilizing DG units in terms of economic dispatch and optimal operation in a distribution power system.

  16. Dgroup: DG00245 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00245 Chemical ... DGroup Ibuprofen ... D00126 ... Ibuprofen (JP17/USP/INN) ... D01122 ... Ibuprofen... piconol (JP17/USAN) ... D04490 ... Ibuprofen aluminum (USAN) D06606 ... Ibuprofen lysine (USAN); Ibuprofen... L-lysine (JAN) ... D08058 ... Ibuprofen arginine salt D08059 ... Ibuprofen sodium D09760 ... Ibuprofen sodium (USAN)

  17. Dgroup: DG02597 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG02597 Chemical ... DGroup Brexpiprazole ... D10309 ... Brexpiprazole (JAN/USAN/INN) ... ATC code: N05AX16 Antipsy...chotic DRD2 [HSA:1813] [KO:K04145] HTR1A [HSA:3350] [KO:K04153] HTR2A [HSA:3356] [KO:K04157] HTR7 [HSA:3363] [KO:K04163] ...

  18. Evaluation of modified dichloran 18% glycerol (DG18) agar for enumerating fungi in wheat flour: a collaborative study.

    Science.gov (United States)

    Beuchat, L R; Hwang, C A

    1996-04-01

    Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.

  19. Susceptibility of the Tomato Mutant High Pigment-2dg (hp-2dg) to Orobanche spp. Infection

    NARCIS (Netherlands)

    Lopez Raez, J.A.; Charnikhova, T.; Mulder, P.P.J.; Kohlen, W.; Bino, R.J.; Levin, I.; Bouwmeester, H.J.

    2008-01-01

    The consumption of natural products with potential health benefits has been continuously growing, and enhanced pigmentation is of major economic importance in fruits and vegetables. The tomato hp-2dg is an important mutant line that has been introgressed into commercial tomato cultivars marketed as

  20. Dgroup: DG00410 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00410 Chemical ... DGroup Methylprednisolone ... D00407 ... Methylprednisolone (JP17/USP.../INN) ... D00751 ... Methylprednisolone sodium succinate (JAN/USP) ... D00979 ... Methylprednisolone acetate (JAN/US...P) ... D05000 ... Methylprednisolone hemisuccinate (USP); Methylprednisolone succinate (JP17) D05001 ... Methylprednisolo...ne sodium phosphate (USAN) D05002 ... Methylprednisolone suleptanate (USAN/INN) D07203 ... Methylprednisol

  1. Dgroup: DG01457 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available fine granules (JP17); Ifenprodil tartrate tablets (JP17) ... DG00320 ... Labetalol ... D08106 ... Labetalol (INN) ... D0...zide (JP17/USP/INN) ... D00561 ... Sertindole (USAN/INN) D01674 ... Naftopidil (JP17/INN); Naftopidil tablets (JP17...); Naftopidil orally disintegrating tablets (JP17) ... D01965 ... Silodosin (JP17/INN) ... D02995 ... Asenapine male

  2. Cadmium biosorption properties of the metal-resistant ochrobactrum cytisi Azn6.2

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez-Llorente, Ignacio D.; Gamane, Djamila; Lafuente, Alejandro; Dary, Mohammed; El Hamdaoui, Abdelaziz; Delgadillo, Julian; Doukkali, Bouchra; Caviedes, Miguel A.; Pajuelo, Eloisa [Departamento de Microbiologia, Facultad de Farmacia, Universidad de Sevilla, Sevilla (Spain)

    2010-02-15

    The aim of this work was to establish the conditions for using Ochrobactrum cytisi Azn6.2 as a metal biosorbent. Azn6.2 is a novel strain from the legume symbiont O. cytisi that has been isolated from nodules of Medicago polymorpha plants grown on heavy metal-polluted soils. Compared with the strain ESC1, Azn6.2 showed some biochemical differences, as well as antibiotic susceptibility, Azn6.2 was multi-resistant to heavy metals, such as Cu, Cd and Zn, and bacterial pellets were able to biosorb high amounts of Cd and Zn. As shown by scanning electron microscopy coupled to energy dispersive X-ray, most of Cd was attached to the cell surface. Optimal conditions for Cd biosorption were established, being 1 mM Cd ions in solution and 2 h of contact with the biosorbent at room temperature. At these conditions, maximal Cd loading capacity reached 32-34 mg/g. Cd desorption from bacterial pellets was achieved after washing with EDTA or, at higher efficiency, at pH 1.0. These results indicated that biosorption/desorption on O. cytisi Azn6.2 biomass should be a cost-effective method for Cd recovery from contaminated solutions. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  3. Overexpression of DgWRKY4 Enhances Salt Tolerance in Chrysanthemum Seedlings

    Directory of Open Access Journals (Sweden)

    Ke Wang

    2017-09-01

    Full Text Available High salinity seriously affects the production of chrysanthemum, so improving the salt tolerance of chrysanthemum becomes the focus and purpose of our research. The WRKY transcription factor (TF family is highly associated with a number of processes of abiotic stress responses. We isolated DgWRKY4 from Dendranthema grandiflorum, and a protein encoded by this new gene contains two highly conserved WRKY domains and two C2H2 zinc-finger motifs. Then, we functionally characterized that DgWRKY4 was induced by salt, and DgWRKY4 overexpression in chrysanthemum resulted in increased tolerance to high salt stress compared to wild-type (WT. Under salt stress, the transgenic chrysanthemum accumulated less malondialdehyde, hydrogen peroxide (H2O2, and superoxide anion (O2− than WT, accompanied by more proline, soluble sugar, and activities of antioxidant enzymes than WT; in addition, a stronger photosynthetic capacity and a series of up-regulated stress-related genes were also found in transgenic chrysanthemum. All results demonstrated that DgWRKY4 is a positive regulatory gene responding to salt stress, via advancing photosynthetic capacity, promoting the operation of reactive oxygen species-scavenging system, maintaining membrane stability, enhancing the osmotic adjustment, and up-regulating transcript levels of stress-related genes. So, DgWRKY4 can serve as a new candidate gene for salt-tolerant plant breeding.

  4. Dgroup: DG01936 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01936 DGroup TNF inhibitor ... D00742 ... Etanercept (USAN/INN); Etanercept (genetica...l recombination) (JAN); Etanercept (genetical recombination) [etanercept biosimilar 1] (JAN) ... D02598 ... Infl...iximab (USAN/INN); Infliximab (genetical recombination) (JAN); Infliximab (genetical recombination) [Inflixi...mab biosimilar1] (JAN); Infliximab (genetical recombination) [Infliximab biosimil...ar2] (JAN) ... D07436 ... Afelimomab (INN) D02597 ... Adalimumab (USAN/INN); Adalimumab (genetical recombination) (

  5. Dgroup: DG01797 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ical recombination) (JP17); Insulin glargine (genetical recombination) injection (J...P17); Insulin glargine (genetical recombination [Insulin glargin biosimilar 1] (JAN); Insulin glargine (genetica...mir (USAN/INN); Insulin detemir (genetical recombination) (JAN) ... D09727 ... Insulin degludec (USAN/INN); Insulin degludec (genetica... DG01797 DGroup Insulin analogue, long-acting ... D03250 ... Insulin glargine (USAN/INN); Insulin glargine (genet

  6. A control technique for integration of DG units to the electrical networks

    DEFF Research Database (Denmark)

    Pouresmaeil, Edris; Miguel-Espinar, Carlos; Massot-Campos, Miquel

    2013-01-01

    This paper deals with a multiobjective control technique for integration of distributed generation (DG) resources to the electrical power network. The proposed strategy provides compensation for active, reactive, and harmonic load current components during connection of DG link to the grid...

  7. A combined ADER-DG and PML approach for simulating wave propagation in unbounded domains

    KAUST Repository

    Amler, Thomas

    2012-09-19

    In this work, we present a numerical approach for simulating wave propagation in unbounded domains which combines discontinuous Galerkin methods with arbitrary high order time integration (ADER-DG) and a stabilized modification of perfectly matched layers (PML). Here, the ADER-DG method is applied to Bérenger’s formulation of PML. The instabilities caused by the original PML formulation are treated by a fractional step method that allows to monitor whether waves are damped in PML region. In grid cells where waves are amplified by the PML, the contribution of damping terms is neglected and auxiliary variables are reset. Results of 2D simulations in acoustic media with constant and discontinuous material parameters are presented to illustrate the performance of the method.

  8. Dgroup: DG01636 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available analogue, fast-acting ... D04477 ... Insulin lispro (USP/INN); Insulin lispro (genetical recombination) (JAN) ... ... ... D04475 ... Insulin aspart (USAN/INN); Insulin aspart (genetical recombination) (JAN) ... D04540 ... Insulin glu...lisine (USAN/INN); Insulin glulisine (genetical recombination) (JAN) ... DG01797 ... Insulin analogue, long-acting ... D03250 ... Insulin glargine (USAN/INN); Insulin glargine (genetical recombinat...ion) (JP17); Insulin glargine (genetical recombination) injection (JP17); Insulin glargine (genetical recomb

  9. Immobilization of Ochrobactrum tritici As5 on PTFE thin films for arsenite biofiltration.

    Science.gov (United States)

    Branco, Rita; Sousa, Tânia; Piedade, Ana P; Morais, Paula V

    2016-03-01

    Ochrobactrum tritici SCII24T bacteria is an environmental strain with high capacity to resist to arsenic (As) toxicity, which makes it able to grow in the presence of As(III). The inactivation of the two functional arsenite efflux pumps, ArsB and ACR3_1, resulted in the mutant O. tritici As5 exhibiting a high accumulation of arsenite. This work describes a method for the immobilization of the mutant cells O. tritici As5, on a commercial polymeric net after sputtered modified by the deposition of poly(tetrafluoroethylene) (PTFE) thin films, and demonstrates the capacity of immobilized cells to accumulate arsenic from solutions. Six different set of deposition parameters for PTFE thin films were developed and tested in vitro regarding their ability to immobilize the bacterial cells. The surface that exhibited a mild zeta potential value, hydrophobic characteristics, the lowest surface free energy but with a high polar component and the appropriate ratio of chemical reactive groups allowed cells to proliferate and to grow as a biofilm. These immobilized cells maintained their ability to accumulate the surrounding arsenite, making it a great arsenic biofilter to be used in bioremediation processes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. General and Simple Decision Method for DG Penetration Level in View of Voltage Regulation at Distribution Substation Transformers

    Directory of Open Access Journals (Sweden)

    Joon-Ho Choi

    2013-09-01

    Full Text Available A distribution system was designed and operated by considering unidirectional power flow from a utility source to end-use loads. The large penetrations of distributed generation (DG into the existing distribution system causes a variety of technical problems, such as frequent tap changing problems of the on-load tap changer (OLTC transformer, local voltage rise, protection coordination, exceeding short-circuit capacity, and harmonic distortion. In view of voltage regulation, the intermittent fluctuation of the DG output power results in frequent tap changing operations of the OLTC transformer. Thus, many utilities limit the penetration level of DG and are eager to find the reasonable penetration limits of DG in the distribution system. To overcome this technical problem, utilities have developed a new voltage regulation method in the distribution system with a large DG penetration level. In this paper, the impact of DG on the OLTC operations controlled by the line drop compensation (LDC method is analyzed. In addition, a generalized determination methodology for the DG penetration limits in a distribution substation transformer is proposed. The proposed DG penetration limits could be adopted for a simplified interconnection process in DG interconnection guidelines.

  11. Dgroup: DG01664 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available /INN) D06070 ... Tenecteplase (USAN/INN) ... D05412 ... Monteplase (INN); Monteplase (genetical recombination) (JAN...) ... D05410 ... Pamiteplase (INN); Pamiteplase (genetical recombination) (JAN) D0825...6 ... Nateplase (INN) D03695 ... Desmoteplase (USAN/INN) D04665 ... Lanoteplase (USAN/INN); Lanoteplase (genetical re...combination) (JAN) D09814 ... Silteplase (INN); Silteplase (genetical recombination) (JAN) D09823 ... Duteplase (INN); Duteplase (genetica... DG01664 DGroup Tissue plasminogen activator (t-PA) -teplase ... D02837 ... Alteplase (USP/INN); Alteplase (geneti

  12. Dgroup: DG00177 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00177 Chemical ... DGroup Erythropoietin ... D03231 ... Epoetin alfa (USAN/INN); Epoetin... alfa (genetical recombination) (JP17) ... D03232 ... Epoetin beta (USAN/INN); Epoetin beta (genetical recombina...tion) (JP17) ... D04032 ... Epoetin delta (USAN) D09737 ... Epoetin kappa (INN); Epoetin kappa (genetical recombination) (Epoet...in alfa biosimilar 1) (JAN) ... D09998 ... Epoetin beta pegol (genetical ...recombination) (JAN) ... D10000 ... Epoetin epsilon (INN); Epoetin epsilon (genetical recombination) (JAN) D10846 ... Epoet

  13. Impacts on the Voltage Profile of DC Distribution Network with DG Access

    Science.gov (United States)

    Tu, J. J.; Yin, Z. D.

    2017-07-01

    With the development of electronic, more and more distributed generations (DGs) access into grid and cause the research fever of direct current (DC) distribution network. Considering distributed generation (DG) location and capacity have great impacts on voltage profile, so use IEEE9 and IEEE33 typical circuit as examples, with DGs access in centralized and decentralized mode, to compare voltage profile in alternating and direct current (AC/DC) distribution network. Introducing the voltage change ratio as an evaluation index, so gets the general results on voltage profile of DC distributed network with DG access. Simulation shows that, in the premise of reasonable location and capacity, DC distribution network is more suitable for DG access.

  14. A Functional Iron Oxide Nanoparticles Modified with PLA-PEG-DG as Tumor-Targeted MRI Contrast Agent.

    Science.gov (United States)

    Xiong, Fei; Hu, Ke; Yu, Haoli; Zhou, Lijun; Song, Lina; Zhang, Yu; Shan, Xiuhong; Liu, Jianping; Gu, Ning

    2017-08-01

    Tumor targeting could greatly promote the performance of magnetic nanomaterials as MRI (Magnetic Resonance Imaging) agent for tumor diagnosis. Herein, we reported a novel magnetic nanoparticle modified with PLA (poly lactic acid)-PEG (polyethylene glycol)-DG (D-glucosamine) as Tumor-targeted MRI Contrast Agent. In this work, we took use of the D-glucose passive targeting on tumor cells, combining it on PLA-PEG through amide reaction, and then wrapped the PLA-PEG-DG up to the Fe 3 O 4 @OA NPs. The stability and anti phagocytosis of Fe 3 O 4 @OA@PLA-PEG-DG was tested in vitro; the MRI efficiency and toxicity was also detected in vivo. These functional magnetic nanoparticles demonstrated good biocompatibility and stability both in vitro and in vivo. Cell experiments showed that Fe 3 O 4 @OA@PLA-PEG-DG nanoparticles exist good anti phagocytosis and high targetability. In vivo MRI images showed that the contrast effect of Fe 3 O 4 @OA@PLA-PEG-DG nanoparticles prevailed over the commercial non tumor-targeting magnetic nanomaterials MRI agent at a relatively low dose. The DG can validly enhance the tumor-targetting effect of Fe 3 O 4 @OA@PLA-PEG nanoparticle. Maybe MRI agents with DG can hold promise as tumor-targetting development in the future.

  15. Dgroup: DG01980 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG01980 DGroup Calcium ... D00931 ... Calcium acetate (USP) ... D00932 ... Calcium carbonat...e (USP); Precipitated calcium carbonate (JP17); Calcium carbonate, precipitated (JAN) ... D00933 ... Calcium citrate (USP) D00934 ... Calciu...m gluceptate (USP); Calcium glucoheptonate (INN) ... D00935 ... Calcium gluconate (USP) ... D00936 ... Calcium... lactate (USP) D00937 ... Calcium phosphate, dihydrate, dibasic (...USP); Dibasic calcium phosphate hydrate (JP17) ... D00938 ... Tricalcium phosphate D02254 ... Calcium lactate hydrate (JP17) ... D02256 ... Calc

  16. Dgroup: DG00093 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available DG00093 Chemical ... DGroup Prednisolone ... D00472 ... Prednisolone (JP17/USP/INN) ... D00980 ... Prednisolo...ne acetate (JP17/USP/INN) ... D00981 ... Prednisolone sodium phosphate (JP17/USP) ... D00982 ... Prednisolo...ne tebutate (JAN/USP) D01239 ... Prednisolone sodium succinate (JP17/USP) ... D01998 ... Prednisolone farnesy...late (JAN) ... D02156 ... Prednisolone hemisuccinate (USP); Prednisolone succinate (JP17) D03301 ... Prednisolo...ne valerate acetate (JAN) ... D08412 ... Prednisolone pivalate D08413 ... Prednisolone sodiu

  17. CosmosDG: An hp-adaptive Discontinuous Galerkin Code for Hyper-resolved Relativistic MHD

    Science.gov (United States)

    Anninos, Peter; Bryant, Colton; Fragile, P. Chris; Holgado, A. Miguel; Lau, Cheuk; Nemergut, Daniel

    2017-08-01

    We have extended Cosmos++, a multidimensional unstructured adaptive mesh code for solving the covariant Newtonian and general relativistic radiation magnetohydrodynamic (MHD) equations, to accommodate both discrete finite volume and arbitrarily high-order finite element structures. The new finite element implementation, called CosmosDG, is based on a discontinuous Galerkin (DG) formulation, using both entropy-based artificial viscosity and slope limiting procedures for the regularization of shocks. High-order multistage forward Euler and strong-stability preserving Runge-Kutta time integration options complement high-order spatial discretization. We have also added flexibility in the code infrastructure allowing for both adaptive mesh and adaptive basis order refinement to be performed separately or simultaneously in a local (cell-by-cell) manner. We discuss in this report the DG formulation and present tests demonstrating the robustness, accuracy, and convergence of our numerical methods applied to special and general relativistic MHD, although we note that an equivalent capability currently also exists in CosmosDG for Newtonian systems.

  18. CosmosDG: An hp -adaptive Discontinuous Galerkin Code for Hyper-resolved Relativistic MHD

    Energy Technology Data Exchange (ETDEWEB)

    Anninos, Peter; Lau, Cheuk [Lawrence Livermore National Laboratory, P.O. Box 808, Livermore, CA 94550 (United States); Bryant, Colton [Department of Engineering Sciences and Applied Mathematics, Northwestern University, 2145 Sheridan Road, Evanston, Illinois, 60208 (United States); Fragile, P. Chris [Department of Physics and Astronomy, College of Charleston, 66 George Street, Charleston, SC 29424 (United States); Holgado, A. Miguel [Department of Astronomy and National Center for Supercomputing Applications, University of Illinois at Urbana-Champaign, Urbana, Illinois, 61801 (United States); Nemergut, Daniel [Operations and Engineering Division, Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)

    2017-08-01

    We have extended Cosmos++, a multidimensional unstructured adaptive mesh code for solving the covariant Newtonian and general relativistic radiation magnetohydrodynamic (MHD) equations, to accommodate both discrete finite volume and arbitrarily high-order finite element structures. The new finite element implementation, called CosmosDG, is based on a discontinuous Galerkin (DG) formulation, using both entropy-based artificial viscosity and slope limiting procedures for the regularization of shocks. High-order multistage forward Euler and strong-stability preserving Runge–Kutta time integration options complement high-order spatial discretization. We have also added flexibility in the code infrastructure allowing for both adaptive mesh and adaptive basis order refinement to be performed separately or simultaneously in a local (cell-by-cell) manner. We discuss in this report the DG formulation and present tests demonstrating the robustness, accuracy, and convergence of our numerical methods applied to special and general relativistic MHD, although we note that an equivalent capability currently also exists in CosmosDG for Newtonian systems.

  19. CosmosDG: An hp -adaptive Discontinuous Galerkin Code for Hyper-resolved Relativistic MHD

    International Nuclear Information System (INIS)

    Anninos, Peter; Lau, Cheuk; Bryant, Colton; Fragile, P. Chris; Holgado, A. Miguel; Nemergut, Daniel

    2017-01-01

    We have extended Cosmos++, a multidimensional unstructured adaptive mesh code for solving the covariant Newtonian and general relativistic radiation magnetohydrodynamic (MHD) equations, to accommodate both discrete finite volume and arbitrarily high-order finite element structures. The new finite element implementation, called CosmosDG, is based on a discontinuous Galerkin (DG) formulation, using both entropy-based artificial viscosity and slope limiting procedures for the regularization of shocks. High-order multistage forward Euler and strong-stability preserving Runge–Kutta time integration options complement high-order spatial discretization. We have also added flexibility in the code infrastructure allowing for both adaptive mesh and adaptive basis order refinement to be performed separately or simultaneously in a local (cell-by-cell) manner. We discuss in this report the DG formulation and present tests demonstrating the robustness, accuracy, and convergence of our numerical methods applied to special and general relativistic MHD, although we note that an equivalent capability currently also exists in CosmosDG for Newtonian systems.

  20. Glucose metabolism-weighted imaging with chemical exchange-sensitive MRI of 2-deoxyglucose (2DG) in brain: Sensitivity and biological sources.

    Science.gov (United States)

    Jin, Tao; Mehrens, Hunter; Wang, Ping; Kim, Seong-Gi

    2016-12-01

    Recent proof-of-principle studies have demonstrated the feasibility of measuring the uptake and metabolism of non-labeled 2-deoxy-D-glucose (2DG) by a chemical exchange-sensitive spin-lock (CESL) MRI approach. In order to gain better understanding of this new approach, we performed dynamic in vivo CESL MRI on healthy rat brains with an intravenous injection of 2DG under various conditions at 9.4T. For three 2DG doses of 0.25, 0.5 and 1g/kg, we found that 2DG-CESL signals increased linearly with injection dose at the initial (40min) suggesting time-dependent differential weightings of 2DG transport and metabolism. Remaining 2DG-CESL studies were performed with 0.25g/kg 2DG. Since a higher isoflurane level reduces glucose metabolism and increases blood flow, 2DG-CESL was measured under 0.5%, 1.5% and 2.2% isoflurane. The 2DG-CESL signal was reduced at higher isoflurane levels correlating well with the 2DG phosphorylation in the intracellular space. To detect regional heterogeneities of glucose metabolism, 2DG-CESL with 0.33×0.33×1.50mm 3 resolution was obtained, which indeed showed a higher response in the cortex compared to the corpus callosum. Lastly, unlike CESL MRI with the injection of non-transportable mannitol, the 2DG-CESL response decreased with an increased spin-lock pulse power confirming that 2DG-CESL is dominated by chemical exchange processes in the extravascular space. Taken together, our results showed that 2DG-CESL MRI signals mainly indicate glucose transport and metabolism and may be a useful biomarker for metabolic studies of normal and diseased brains. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Electroluminescent TCC, C3dg and fB/Bb epitope assays for profiling complement cascade activation in vitro using an activated complement serum calibration standard.

    Science.gov (United States)

    van Vuuren, B Jansen; Bergseth, G; Mollnes, T E; Shaw, A M

    2014-01-15

    Electroluminescent assays for epitopes on the complement components C3dg, terminal complement complex (TCC) and factor B/Bb (fB/Bb) have been developed with capture and detection antibodies to produce detection limits C3dg=91±9ng/mL, TCC=3±0.1ng/mL and fB=55.7±0.1ng/mL. The assay performance was assessed against a series of zymosan and heat aggregated IgG (HAIgG) in vitro activations of complement using a calibrated activated complement serum (ACS) as calibration standard. The ACS standard was stable within 20% accuracy over a 6-month period with freeze-thaw cycles as required. Differential activation of the complement cascade was observed for TCC showing a pseudo-first order formation half-life of 3.5h after activation with zymosan. The C3dg activation fragment indicates a 10% total activation for both activation agents. The kinetic-epitope analysis for fB indicates that the capture epitope is on the fB/Bb protein fragment which can then become covered by the formation of C3bBb or C3bBbP complexes during the time course of the cascade. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. A novel family of DG methods for diffusion problems

    Science.gov (United States)

    Johnson, Philip; Johnsen, Eric

    2017-11-01

    We describe and demonstrate a novel family of numerical schemes for handling elliptic/parabolic PDE behavior within the discontinuous Galerkin (DG) framework. Starting from the mixed-form approach commonly applied for handling diffusion (examples include Local DG and BR2), the new schemes apply the Recovery concept of Van Leer to handle cell interface terms. By applying recovery within the mixed-form approach, we have designed multiple schemes that show better accuracy than other mixed-form approaches while being more flexible and easier to implement than the Recovery DG schemes of Van Leer. While typical mixed-form approaches converge at rate 2p in the cell-average or functional error norms (where p is the order of the solution polynomial), many of our approaches achieve order 2p +2 convergence. In this talk, we will describe multiple schemes, including both compact and non-compact implementations; the compact approaches use only interface-connected neighbors to form the residual for each element, while the non-compact approaches add one extra layer to the stencil. In addition to testing the schemes on purely parabolic PDE problems, we apply them to handle the diffusive flux terms in advection-diffusion systems, such as the compressible Navier-Stokes equations.

  3. An improved current control scheme for grid-connected DG unit based distribution system harmonic compensation

    DEFF Research Database (Denmark)

    He, Jinwei; Wei Li, Yun; Wang, Xiongfei

    2013-01-01

    In order to utilize DG unit interfacing converters to actively compensate distribution system harmonics, this paper proposes an enhanced current control approach. It seamlessly integrates system harmonic mitigation capabilities with the primary DG power generation function. As the proposed current...... controller has two well decoupled control branches to independently control fundamental and harmonic DG currents, phase-locked loops (PLL) and system harmonic component extractions can be avoided during system harmonic compensation. Moreover, a closed-loop power control scheme is also employed to derive...... the fundamental current reference. The proposed power control scheme effectively eliminates the impacts of steady-state fundamental current tracking errors in the DG units. Thus, an accurate power control is realized even when the harmonic compensation functions are activated. Experimental results from a single...

  4. A power structure over the Grothendieck ring of geometric dg categories

    OpenAIRE

    Gyenge, Ádám

    2017-01-01

    We prove the existence of an effective power structure over the Grothendieck ring of geometric dg categories. Using this power structure we show that the categorical zeta function of a geometric dg category can be expressed as a power with exponent the category itself. This implies a conjecture of Galkin and Shinder relating the motivic and categorical zeta functions of varieties. We also deduce a formula for the generating series of the classes of derived categories of the Hilbert scheme of ...

  5. Characterization of biosurfactants produced by novel strains of Ochrobactrum anthropi HM-1 and Citrobacter freundii HM-2 from used engine oil-contaminated soil

    Directory of Open Access Journals (Sweden)

    Haytham M.M. Ibrahim

    2018-03-01

    Full Text Available Microbial surfactants are widely used for industrial, agricultural, food, cosmetics, pharmaceutical, and medical applications. In this study, two bacterial strains namely, Ochrobactrum anthropi HM-1 and Citrobacter freundii HM-2, previously isolated from used engine oil contaminated soil, and capable of producing biosurfactants, were used. Their cell-free culture broth showed positive results toward five screening tests (hemolysis in blood agar, drop collapse, oil displacement, emulsification activity (E24, and surface tension (ST reduction. They reduced the ST of growth medium (70 ± 0.9 to 30.8 ± 0.6 and 32.5 ± 1.3 mN/m, respectively. The biosurfactants were classified as anionic biomolecules. Based on TLC pattern and FT-IR analysis, they were designated as glycolipids (rhamnolipid. Waste frying oil was feasibly used as a cheap and dominant carbon source for biosurfactants production; 4.9 and 4.1 g/l were obtained after 96 h of incubation, respectively. Compared with non-irradiated cells, gamma-irradiated cells (1.5 kGy revealed enhanced biosurfactant production by 56 and 49% for HM-1 and HM-2, respectively. The biosurfactants showed good stability after exposure to extreme conditions [temperatures (50–100 °C for 30 min, pH (2–12 and salinity (2–10% NaCl], they retained 83 and 79.3% of their E24, respectively, after incubation for a month, under extreme conditions. Biosurfactants effectively recovered up to 70 and 67% of the residual oil, respectively, from oil-saturated sand pack columns. These biosurfactants are an interesting biotechnological product for many environmental and industrial applications. Keywords: Ochrobactrum anthropi, Citrobacter freundii, Biosurfactant, Characterization, Stability

  6. HiCoDG: a hierarchical data-gathering scheme using cooperative multiple mobile elements.

    Science.gov (United States)

    Van Le, Duc; Oh, Hoon; Yoon, Seokhoon

    2014-12-17

    In this paper, we study mobile element (ME)-based data-gathering schemes in wireless sensor networks. Due to the physical speed limits of mobile elements, the existing data-gathering schemes that use mobile elements can suffer from high data-gathering latency. In order to address this problem, this paper proposes a new hierarchical and cooperative data-gathering (HiCoDG) scheme that enables multiple mobile elements to cooperate with each other to collect and relay data. In HiCoDG, two types of mobile elements are used: the mobile collector (MC) and the mobile relay (MR). MCs collect data from sensors and forward them to the MR, which will deliver them to the sink. In this work, we also formulated an integer linear programming (ILP) optimization problem to find the optimal trajectories for MCs and the MR, such that the traveling distance of MEs is minimized. Two variants of HiCoDG, intermediate station (IS)-based and cooperative movement scheduling (CMS)-based, are proposed to facilitate cooperative data forwarding from MCs to the MR. An analytical model for estimating the average data-gathering latency in HiCoDG was also designed. Simulations were performed to compare the performance of the IS and CMS variants, as well as a multiple traveling salesman problem (mTSP)-based approach. The simulation results show that HiCoDG outperforms mTSP in terms of latency. The results also show that CMS can achieve the lowest latency with low energy consumption.

  7. HiCoDG: A Hierarchical Data-Gathering Scheme Using Cooperative Multiple Mobile Elements

    Directory of Open Access Journals (Sweden)

    Duc Van Le

    2014-12-01

    Full Text Available In this paper, we study mobile element (ME-based data-gathering schemes in wireless sensor networks. Due to the physical speed limits of mobile elements, the existing data-gathering schemes that usemobile elements can suffer from high data-gathering latency. In order to address this problem, this paper proposes a new hierarchical and cooperative data-gathering (HiCoDG scheme that enables multiple mobile elements to cooperate with each other to collect and relay data. In HiCoDG, two types of mobile elements are used: the mobile collector (MC and the mobile relay (MR. MCs collect data from sensors and forward them to the MR, which will deliver them to the sink. In this work, we also formulated an integer linear programming (ILP optimization problem to find the optimal trajectories for MCs and the MR, such that the traveling distance of MEs is minimized. Two variants of HiCoDG, intermediate station (IS-based and cooperative movement scheduling (CMS-based, are proposed to facilitate cooperative data forwarding from MCs to theMR. An analytical model for estimating the average data-gathering latency in HiCoDG was also designed. Simulations were performed to compare the performance of the IS and CMS variants, as well as a multiple traveling salesman problem (mTSP-based approach. The simulation results show that HiCoDG outperformsmTSP in terms of latency. The results also show that CMS can achieve the lowest latency with low energy consumption.

  8. Overcurrent protection issues due to the DG connection

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, J.C.; Tourn, D.H.; Amatti, J.C. [Rio Cuarto National University (IPSEP/UNRC), Cordoba (Argentina). Electric Power Systems Protection Institute], E-mail: jcgomez@ing.unrc.edu.ar

    2009-07-01

    The present energy crisis drives to carry to an extreme the use of all the available energy sources, which need to be connected to the network in their closest point. Traditional electric systems are changing their characteristics, in what concerns to structure, operation, and especially on protection methodologies. The new protection problems of the different parts of the system are explained. The solution presents positive and negative aspects that impact the utility and the customer in different ways. A revision about interconnection international standards is presented. The contributions of generators to short circuit currents is analyzed, especially the double fed generator. Philosophy changes are studied, such as: fault current bi directionality, modification of the protection reach, failures of the overcurrent coordination due to current share, etc. Solicitations to DG due to the normal unbalance of distribution systems are also studied. It is analyzed the discrepancy between the customers and utilities regarding the 'islanding operation', presenting the semi-rigid connection. The changes in the coordination methodology fusible-recloser are also studied, proposing a new methodology to check this coordination. Experimental results on 13.2 kV are presented that relate the deionization without zero current, with arc length and with 'network power to DG power ratio'. It is concluded that DG application offers technical-economic advantages so much to the utility as to the user; and that the technology for these new protection approaches is already available, requiring of investments whose justification needs of a specific analysis for each particular case. (author)

  9. CERN High School Teachers Training Programme meets DG

    CERN Multimedia

    Brice, Maximilien

    2014-01-01

    CERN's DG Rolf Heuer met with the participants of the High School Teachers Training Programme on 23 July 2014 for a Q&A Session. Following the interaction, he met with the HST Working Group collaborating on a lesson plan for teaching SESAME in high schools.

  10. Experiment data report for semiscale Mod-1 Tests S-01-4 and S-01-4A (isothermal blowdown with core resistance simulator)

    International Nuclear Information System (INIS)

    Zender, S.N.; Jensen, M.F.; Sackett, K.E.

    1975-03-01

    Recorded test data are presented for Tests S-01-4 and S-01-4A of the semiscale Mod-1 isothermal blowdown test series. These tests are among several semiscale Mod-1 experiments which are counterparts of the planned Loss-of-Fluid Test (LOFT) nonnuclear experiments. System hardware is representative of LOFT design based on volumetric scaling methods, and initial conditions duplicate those identified for the LOFT nonnuclear tests. Tests S-01-4 and S-01-4A employed an intact loop resistance that was similar to that of Test S-01-3 and low relative to that of Test S-01-2. An orificed structure was used in the pressure vessel to simulate the LOFT core simulator. The tests were initiated at initial isothermal conditions of about 2250 psig and 540 0 F by a simulated offset shear of the cold-leg broken-loop piping. During system depressurization, coolant was injected into the cold leg of the intact loop to provide data on the effects of emergency core cooling on system response. Following the blowdown portion of Test S-01-4, coolant spray was introduced into the pressure suppression tank to determine the response of the pressure suppression system. The uninterpreted data are presented. The data, presented in the form of graphs in engineering units, have been analyzed only to the extent necessary to assure that they are reasonable and consistent. (U.S.)

  11. June Council - DG presentation to personnel / Conseil de juin - présentation de la DG au personnel

    CERN Multimedia

    CERN. Geneva

    2017-01-01

    Please note that the DG presentation will be transmitted also in the following rooms: Council Chamber - 503-1-001 IT Amphitheatre - 31-3-004 Kjell Johnsen Auditorium - 30-7-018 Prevessin 864-1-B04 Simultaneous interpreting into French and English will be available in the Main Auditorium. Une interprétation simultanée en français et en anglais sera disponible dans l'amphithéâtre principal.  

  12. Molecular species analysis of phosphatidylinositol (PI), phosphatidic acid (PA) and diacylglycerol (DG) in rat mast cells

    International Nuclear Information System (INIS)

    Kennerly, D.A.

    1987-01-01

    The metabolism of DG, PA and PI were studied in purified rat mast cells to determine whether generally accepted pathways of PI metabolism could explain the pattern of fatty acids seen in these intermediates. A method was developed to separate and quantitate by mass (for DG) or endogenous labeling (for PA and PI) the different molecular species of each lipid that are defined by their component fatty acids. The resultant molecular species fingerprint for each lipid was examined to see if it was similar to other intermediates in the PI cycle. For each class of compounds the percent in a given subclass was recorded. Stimulation caused a reduction of more saturated subclasses and/or an increase in AA containing compounds in PA, PI and DG. The relative similarity of subclasses of 32 P-PA and 32 P-PI supports the view that they are metabolically related. The relative absence of AA-containing species of DG suggests that most of the stimulated increase of DG was not produced by PI hydrolysis

  13. Reactive power and voltage control strategy based on dynamic and adaptive segment for DG inverter

    Science.gov (United States)

    Zhai, Jianwei; Lin, Xiaoming; Zhang, Yongjun

    2018-03-01

    The inverter of distributed generation (DG) can support reactive power to help solve the problem of out-of-limit voltage in active distribution network (ADN). Therefore, a reactive voltage control strategy based on dynamic and adaptive segment for DG inverter is put forward to actively control voltage in this paper. The proposed strategy adjusts the segmented voltage threshold of Q(U) droop curve dynamically and adaptively according to the voltage of grid-connected point and the power direction of adjacent downstream line. And then the reactive power reference of DG inverter can be got through modified Q(U) control strategy. The reactive power of inverter is controlled to trace the reference value. The proposed control strategy can not only control the local voltage of grid-connected point but also help to maintain voltage within qualified range considering the terminal voltage of distribution feeder and the reactive support for adjacent downstream DG. The scheme using the proposed strategy is compared with the scheme without the reactive support of DG inverter and the scheme using the Q(U) control strategy with constant segmented voltage threshold. The simulation results suggest that the proposed method has a significant improvement on solving the problem of out-of-limit voltage, restraining voltage variation and improving voltage quality.

  14. Dgroup: DG01752 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available (USAN/INN); Interferon alfa-2a (genetical recombination) (JAN) ... D02745 ... Interferon alfa-2b (USAN); Interferon alfa-2b (genetica... Interferon alfa-n3 (USAN) DG01751 ... Interferon beta ... D00746 ... Interferon beta-1b (USAN/INN); Interferon beta-1b (genetica...D00747 ... Interferon gamma-1b (USAN/INN) ... D03357 ... Interferon gamma-1a (genetical recombination) (JAN) ... D...08805 ... Interferon gamma-n1 (JAN) D02744 ... Interferon alfacon-1 (USAN/INN); Interferon alfacon-1 (genetical re...combination) (JAN) D02747 ... Peginterferon alfa-2a (USAN/INN); Peginterferon alfa-2a (genetica

  15. [Effect of 5-HT1A receptors in the hippocampal DG on active avoidance learning in rats].

    Science.gov (United States)

    Jiang, Feng-ze; Lv, Jing; Wang, Dan; Jiang, Hai-ying; Li, Ying-shun; Jin, Qing-hua

    2015-01-01

    To investigate the effects of serotonin (5-HTIA) receptors in the hippocampal dentate gyrus (DG) on active avoidance learning in rats. Totally 36 SD rats were randomly divided into control group, antagonist group and agonist group(n = 12). Active avoidance learning ability of rats was assessed by the shuttle box. The extracellular concentrations of 5-HT in the DG during active avoidance conditioned reflex were measured by microdialysis and high performance liquid chromatography (HPLC) techniques. Then the antagonist (WAY-100635) or agonist (8-OH-DPAT) of the 5-HT1A receptors were microinjected into the DG region, and the active avoidance learning was measured. (1) During the active avoidance learning, the concentration of 5-HT in the hippocampal DG was significantly increased in the extinction but not establishment in the conditioned reflex, which reached 164.90% ± 26.07% (P active avoidance learning. (3) The microinjection of 8-OH-DPAT(an agonist of 5-HT1A receptor) into the DG significantly facilitated the establishment process and inhibited the extinction process during active avoidance conditioned reflex. The data suggest that activation of 5-HT1A receptors in hipocampal DG may facilitate active avoidance learning and memory in rats.

  16. Dgroup: DG00398 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available sidate sodium (USAN); Sodium fusidate (JP17) ... D08000 ... Diethanolamine fusidate D08003 ... Fusidic acid hemihydrate ... ATC code: D06AX01 D09AA02 J01XC01 S01AA13 Antibiotics ...

  17. Combined effect of CVR and penetration of DG in the voltage profile and losses of lowvoltage secondary distribution networks

    Science.gov (United States)

    Bokhari, Abdullah

    Demarcations between traditional distribution power systems and distributed generation (DG) architectures are increasingly evolving as higher DG penetration is introduced in the system. The concerns in existing electric power systems (EPSs) to accommodate less restrictive interconnection policies while maintaining reliability and performance of power delivery have been the major challenge for DG growth. In this dissertation, the work is aimed to study power quality, energy saving and losses in a low voltage distributed network under various DG penetration cases. Simulation platform suite that includes electric power system, distributed generation and ZIP load models is implemented to determine the impact of DGs on power system steady state performance and the voltage profile of the customers/loads in the network under the voltage reduction events. The investigation designed to test the DG impact on power system starting with one type of DG, then moves on multiple DG types distributed in a random case and realistic/balanced case. The functionality of the proposed DG interconnection is designed to meet the basic requirements imposed by the various interconnection standards, most notably IEEE 1547, public service commission, and local utility regulation. It is found that implementation of DGs on the low voltage secondary network would improve customer's voltage profile, system losses and significantly provide energy savings and economics for utilities. In a network populated with DGs, utility would have a uniform voltage profile at the customers end as the voltage profile becomes more concentrated around targeted voltage level. The study further reinforced the concept that the behavior of DG in distributed network would improve voltage regulation as certain percentage reduction on utility side would ensure uniform percentage reduction seen by all customers and reduce number of voltage violations.

  18. HiCoDG: A Hierarchical Data-Gathering Scheme Using Cooperative Multiple Mobile Elements †

    Science.gov (United States)

    Van Le, Duc; Oh, Hoon; Yoon, Seokhoon

    2014-01-01

    In this paper, we study mobile element (ME)-based data-gathering schemes in wireless sensor networks. Due to the physical speed limits of mobile elements, the existing data-gathering schemes that use mobile elements can suffer from high data-gathering latency. In order to address this problem, this paper proposes a new hierarchical and cooperative data-gathering (HiCoDG) scheme that enables multiple mobile elements to cooperate with each other to collect and relay data. In HiCoDG, two types of mobile elements are used: the mobile collector (MC) and the mobile relay (MR). MCs collect data from sensors and forward them to the MR, which will deliver them to the sink. In this work, we also formulated an integer linear programming (ILP) optimization problem to find the optimal trajectories for MCs and the MR, such that the traveling distance of MEs is minimized. Two variants of HiCoDG, intermediate station (IS)-based and cooperative movement scheduling (CMS)-based, are proposed to facilitate cooperative data forwarding from MCs to the MR. An analytical model for estimating the average data-gathering latency in HiCoDG was also designed. Simulations were performed to compare the performance of the IS and CMS variants, as well as a multiple traveling salesman problem (mTSP)-based approach. The simulation results show that HiCoDG outperforms mTSP in terms of latency. The results also show that CMS can achieve the lowest latency with low energy consumption. PMID:25526356

  19. The biodistribution and radiation dosimetry of 99Tcmm-EC-DG in normal volunteers

    International Nuclear Information System (INIS)

    Tang Jun; Yang Yi; Liu Zengli; Shi Yizhen

    2010-01-01

    The objective of this study is to evaluate the biodistribution of technetium-99m labeled ethylenedicysteine-deoxyglucose ( 99 Tc m -EC-DG) and to calculate its internal radiation absorbed dose in normal volunteers. 740 MBq 99 Tc m -EC-DG was injected into the antecubital vein. 2 ml blood were sampled from the contralateral antecubital vein at different time after the injection, and its radioactivity was measured. The bi-exponential curve of time-radioactivity of blood and the dynamic parameters were obtained by using ORIGIN 5.0. Urine was collected in 24 hours after the injection and the percentage of Radioactivity excreted by urine to the total injected radioactivity was calculated. The anterior and posterior whole body imaging were acquired at different time after the injection of 740 MBq 99 Tc m -EC-DG. The region of interest of these referring organs and tissues was drawn, their radioactivity at different time was calculated. The bi-exponential curve of time-radioactivity of every organ was obtained by using ORIGIN 5.0, and then cumulated radioactivity and retaining time of 99 Tcm-EC-DG were calculated and input into the software MIRDOSE 3.0 to obtain the radiation absorbed dose of every organ and tissue. The heart rate, blood pressure and breathing frequency is normal after the injection. The male volunteer's T1/2α is 39 seconds, T1/2β is 59 minutes and that of female volunteer is 21 seconds and 61 minutes. 99 Tc m -EC-DG imaging is safe, and its characteristic of biodistribution in normal volunteer makes it easy to accumulate in tumor. Brain is not imaged, the uptake of muscle is low. The absorbed dose of every organ is far lower than that of the public annual average limitation. (authors)

  20. Drug: D04088 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D04088 Drug Ethyl chloride (USP) ... C2H5Cl D04088.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetic...s ... DG01675 ... Local anesthetic ... DG01675 ... Local anesthetic Same as: C18248 ATC code: N01BX01 ...

  1. Short circuit analysis of distribution system with integration of DG

    DEFF Research Database (Denmark)

    Su, Chi; Liu, Zhou; Chen, Zhe

    2014-01-01

    and as a result bring challenges to the network protection system. This problem has been frequently discussed in the literature, but mostly considering only the balanced fault situation. This paper presents an investigation on the influence of full converter based wind turbine (WT) integration on fault currents......Integration of distributed generation (DG) such as wind turbines into distribution system is increasing all around the world, because of the flexible and environmentally friendly characteristics. However, DG integration may change the pattern of the fault currents in the distribution system...... during both balanced and unbalanced faults. Major factors such as external grid short circuit power capacity, WT integration location, connection type of WT integration transformer are taken into account. In turn, the challenges brought to the protection system in the distribution network are presented...

  2. 18F-DG PET/CT in detection of recurrence and metastasis of colorectal cancer

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    AIM: To evaluate the value of 18F-DG PET/CT in detecting recurrence and/or metastasis of colorectal cancer (CRC).METHODS: Combined visual analysis with semiquantitative analysis, the 18F-DG PET/CT wholebody imaging results and the corresponding clinical data of 68 postoperative CRC patients including 48 male and 20 female with average age of 58.1 were analyzed retrospectively.RESULTS: Recurrence and/or metastasis were confirmed in 56 patients in the clinical follow-up after the PET/CT imaging. The sensitivity of PET/CT diagnosis of CRC recurrence and/or metastasis was 94.6%, and the specificity was 83.3%. The positive predictive value (PPV)was 96.4% and the negative predictive value (NPV) was 76.9%. PET/CT imaging detected one or more occult malignant lesions in 8 cases where abdominal/pelvic CT and/or ultrasonography showed negative findings, and also detected more lesions than CT or ultrasonography did in 30.4% (17/56) cases. Recurrence and/or metastasis was detected in 91.7% (22/24) cases with elevated serum CEA levels by 18F-DG PET/CT imaging.CONCLUSION: 18F-DG PET/CT could detect the recurrence and/or metastasis of CRC with high sensitivity and specificity.

  3. Molecular characterization and expression of DgZFP1, a gene ...

    African Journals Online (AJOL)

    USER

    2010-04-12

    Apr 12, 2010 ... Full Length Research Paper. Molecular characterization and ... stem mainly done by removing the auxiliary flower buds. But cultivars as potted ... DgZFP1 by using the first strand cDNA of chrysanthemum as a template.

  4. síční integrace modelu ALADIN v klimatickém modu: vliv některých parametrů

    Czech Academy of Sciences Publication Activity Database

    Huth, Radan; Kyselý, Jan; Pokorná, Lucie; Farda, A.; Mládek, R.; Huthová, Z.; Kliegrová, S.; Metelka, L.

    2004-01-01

    Roč. 57, - (2004), s. 41-46 ISSN 0026-1173 R&D Projects: GA ČR GA205/01/0804; GA MŽP SF/740/7/01 Institutional research plan: CEZ:AV0Z3042911 Keywords : regional climatic model * long-term integration * model validity Subject RIV: DG - Athmosphere Sciences, Meteorology

  5. Beneficial role of hydrophytes in removing Cr(VI) from wastewater in association with chromate-reducing bacterial strains Ochrobactrum intermedium and Brevibacterium.

    Science.gov (United States)

    Faisal, Muhammad; Hasnain, Shahida

    2005-01-01

    This study deals with the use of three chromium-resistant bacterial strains (Ochrobactrum intermedium CrT-1, Brevibacterium CrT-13, and CrM-1) in conjunction with Eichornia crassipes for the removal of toxic chromium from wastewater. Bacterial strains resulted in reduced uptake of chromate into inoculated plants as compared to noninoculated control plants. In the presence of different heavy metals, chromium uptake into the plants was 28.7 and 7.15% less at an initial K2CrO4 concentration of 100 and 500 microg ml(-1) in comparison to a metal free chromium solution. K2CrO4 uptake into the plant occurred at different pHs tested, but maximum uptake was observed at pH 5. Nevertheless, the bacterial strains caused some decrease in chromate uptake into the plants, but the combined effect of plants and bacterial strains conduce more removal of Cr(VI) from the solution.

  6. Simulation of InGaAs subchannel DG-HEMTs for analogue/RF applications

    Science.gov (United States)

    Saravana Kumar, R.; Mohanbabu, A.; Mohankumar, N.; Godwin Raj, D.

    2018-03-01

    The paper reports on the influence of a barrier thickness and gate length on the various device parameters of double gate high electron mobility transistors (DG-HEMTs). The DC and RF performance of the device have been studied by varying the barrier thickness from 1 to 5 nm and gate length from 10 to 150 nm, respectively. As the gate length is reduced below 50 nm regime, the barrier thickness plays an important role in device performance. Scaling the gate length leads to higher transconductance and high frequency operations with the expense of poor short channel effects. The authors claim that the 30-nm gate length, mole fractions tuned In0.53Ga0.47As/In0.7Ga0.3As/In0.53Ga0.47As subchannel DG-HEMT with optimised device structure of 2 nm In0.48Al0.52As barrier layer show a peak gm of 3.09 mS/µm, VT of 0.29 V, ION/IOFF ratio of 2.24 × 105, subthreshold slope 73 mV/decade and drain induced barrier lowering 68 mV/V with fT and fmax of 776 and 905 GHz at Vds = 0.5 V is achieved. These superior performances are achieved by using double-gate architecture with reduced gate to channel distance.

  7. How Do R&D Programs Funded by the Dg Xii (Science, Research and Development Directorate of the European Commission Impact the Upstream Oil and Gas Industry in Europe? Comment les programmes de R&D financés par la DG XII de la Commission européenne influencent-ils l'industrie pétrolière amont en Europe ?

    Directory of Open Access Journals (Sweden)

    Forbes P.

    2006-12-01

    Full Text Available This paper provides an overview of the direct and indirect impact which DG XII funding for research and development has on the oil and gas exploration and production industry in Europe. Despite the relatively low level of funding, the impact is quite significant. These impacts are presented using a bottom-up analysis, starting with the impact of technology on industry and society, the impact of research on technology, and the impact of DG XII funding on both research and technology for the exploration and production of oil and gas. The different aspects that are discussed include the direct impact, the impact on R&D organization and management, and the impact due to the Commission demonstration program for oil and gas (Thermie. Examples are provided from current and past project results. The future impact on the industry, and Commission policy toward the oil and gas sector are suggestedIn the near future, it is expected that there will be greater impact on production technologies, on the contribution of oil and gas companies to long-term R&D, and on the transfer of results to the Commission demonstration program. L'article apporte une vue d'ensemble sur la manière dont les financements de la DG XII pour la recherche et le développement (R&D ont une influence, directe ou indirecte, sur l'exploration et la production dans l'industrie du pétrole et du gaz en Europe. Le niveau de ces financements est présenté comme relativement faible de façon à mettre en évidence que, comparativement, leur répercution est très significative. L'impact de ces financements est abordé en couvrant successivement les effets sur la société, l'industrie, la technologie et finalement la recherche elle-même. Nous décrivons ici les influences de la technologie sur l'industrie et sur la société, puis les influences de la recherche sur la technologie et enfin celles des financements de la DG XII sur la recherche et la technologie en exploration-production. Diff

  8. Drug: D07678 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D07678 Drug Chloroprocaine (INN) ... C13H19ClN2O2 D07678.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetic...s ... DG01675 ... Local anesthetic ... DG01674 ... Esterified local anesthetic ... DG01675 ... Local anesthetic... ... DG01674 ... Esterified local anesthetic Same as: C07877 ATC code: N01BA04 Chemical group: DG00800

  9. Drug: D07468 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available tics ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic ... DG01675 ... Local anesthetic... ... DG01673 ... Amide type local anesthetic ATC code: N01BB08 Chemical group: DG00805 ... CAS:... D07468 Drug Articaine (INN); Carticaine ... C13H20N2O3S D07468.gif ... Neuropsychiatric agent ... DG02030 ... Anesthe

  10. Drug: D04095 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D04095 Drug Etidocaine (USAN/INN) ... C17H28N2O D04095.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetic...s ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic ... DG01675 ... Local anesthetic... ... DG01673 ... Amide type local anesthetic Same as: C07530 ATC code: N01BB07 Chemical group: DG00804 ...

  11. Effect of Multi-DG Installation to Loss Reduction in Distribution System

    Directory of Open Access Journals (Sweden)

    Nur Zahirah Mohd Ali

    2016-03-01

    Full Text Available Since last decade, Artificial Intelligence (AI methods have been used to solve complex DG problems because in most cases, they can provide global or near global solution. The major advantage of the AI methods is that they are relatively versatile for handling various qualitative constraints. AI methods mainly include Artificial Neural Network (ANN, Expert System (ES, Genetic Algorithm (GA, Evolutionary Programming (EP, Ant Colony Optimization (ACO and Particle Swarm Optimization (PSO. The purpose of this paper is to present a new technique, namely Adaptive Embedded Clonal Evolutionary Programming (AECEP. The objective of the study is to employ AECEP optimization techniques for loss minimization. This technique was developed to optimally determine the location and sizing of DG. The IEEE 41- Bus RTS was implemented for testing several cases in terms of loading conditions.

  12. On the use of kinetic energy preserving DG-schemes for large eddy simulation

    Science.gov (United States)

    Flad, David; Gassner, Gregor

    2017-12-01

    Recently, element based high order methods such as Discontinuous Galerkin (DG) methods and the closely related flux reconstruction (FR) schemes have become popular for compressible large eddy simulation (LES). Element based high order methods with Riemann solver based interface numerical flux functions offer an interesting dispersion dissipation behavior for multi-scale problems: dispersion errors are very low for a broad range of scales, while dissipation errors are very low for well resolved scales and are very high for scales close to the Nyquist cutoff. In some sense, the inherent numerical dissipation caused by the interface Riemann solver acts as a filter of high frequency solution components. This observation motivates the trend that element based high order methods with Riemann solvers are used without an explicit LES model added. Only the high frequency type inherent dissipation caused by the Riemann solver at the element interfaces is used to account for the missing sub-grid scale dissipation. Due to under-resolution of vortical dominated structures typical for LES type setups, element based high order methods suffer from stability issues caused by aliasing errors of the non-linear flux terms. A very common strategy to fight these aliasing issues (and instabilities) is so-called polynomial de-aliasing, where interpolation is exchanged with projection based on an increased number of quadrature points. In this paper, we start with this common no-model or implicit LES (iLES) DG approach with polynomial de-aliasing and Riemann solver dissipation and review its capabilities and limitations. We find that the strategy gives excellent results, but only when the resolution is such, that about 40% of the dissipation is resolved. For more realistic, coarser resolutions used in classical LES e.g. of industrial applications, the iLES DG strategy becomes quite inaccurate. We show that there is no obvious fix to this strategy, as adding for instance a sub

  13. A new evolutionary solution method for dynamic expansion planning of DG-integrated primary distribution networks

    International Nuclear Information System (INIS)

    Ahmadigorji, Masoud; Amjady, Nima

    2014-01-01

    Highlights: • A new dynamic distribution network expansion planning model is presented. • A Binary Enhanced Particle Swarm Optimization (BEPSO) algorithm is proposed. • A Modified Differential Evolution (MDE) algorithm is proposed. • A new bi-level optimization approach composed of BEPSO and MDE is presented. • The effectiveness of the proposed optimization approach is extensively illustrated. - Abstract: Reconstruction in the power system and appearing of new technologies for generation capacity of electrical energy has led to significant innovation in Distribution Network Expansion Planning (DNEP). Distributed Generation (DG) includes the application of small/medium generation units located in power distribution networks and/or near the load centers. Appropriate utilization of DG can affect the various technical and operational indices of the distribution network such as the feeder loading, energy losses and voltage profile. In addition, application of DG in proper size is an essential tool to achieve the DG maximum potential benefits. In this paper, a time-based (dynamic) model for DNEP is proposed to determine the optimal size, location and installation year of DG in distribution system. Also, in this model, the Optimal Power Flow (OPF) is exerted to determine the optimal generation of DGs for every potential solution in order to minimize the investment and operation costs following the load growth in a specified planning period. Besides, the reinforcement requirements of existing distribution feeders are considered, simultaneously. The proposed optimization problem is solved by the combination of evolutionary methods of a new Binary Enhanced Particle Swarm Optimization (BEPSO) and Modified Differential Evolution (MDE) to find the optimal expansion strategy and solve OPF, respectively. The proposed planning approach is applied to two typical primary distribution networks and compared with several other methods. These comparisons illustrate the

  14. DOMAIN DECOMPOSITION FOR POROELASTICITY AND ELASTICITY WITH DG JUMPS AND MORTARS

    KAUST Repository

    GIRAULT, V.; PENCHEVA, G.; WHEELER, M. F.; WILDEY, T.

    2011-01-01

    by introducing DG jumps and mortars. The unknowns are condensed on the interface, so that at each time step, the computation in each subdomain can be performed in parallel. In addition, by extrapolating the displacement, we present an algorithm where

  15. Effect of grid disturbances on fault-ride-through behaviour of MV-connected DG-units, in especially CHP-plants

    NARCIS (Netherlands)

    Coster, E.J.; Myrzik, J.M.A.; Kling, W.L.

    2009-01-01

    In the near future a significant amount of the consumed electrical energy will be generated by distributed generation (DG). Because of the small size these units are normally connected to the local distribution grid [1]. Connection of DG changes the operation of the distribution grid. In order to

  16. Doppler-Guided Transanal Hemorrhoidal Dearterialization (DG-THD) Versus Stapled Hemorrhoidopexy (SH) in the Treatment of Third-Degree Hemorrhoids: Clinical Results at Short and Long-Term Follow-Up.

    Science.gov (United States)

    Leardi, S; Pessia, B; Mascio, M; Piccione, F; Schietroma, M; Pietroletti, R

    2016-11-01

    The stapled hemorrhoidopexy (SH) and the Doppler-guided transanal hemorrhoidal dearterialization (DG-THD) are minimally invasive procedures for the surgical treatment of hemorrhoids. This study aims to verify the efficacy of the DG-THD versus the SH in the treatment of third-degree hemorrhoids. One hundred consecutive patients were causally allocated to either procedure, obtaining two groups of 50 pts. A clinical examination was performed at 3, 7, 15, and 30 days after the operation. Quality of life, anal symptoms, recurrence of hemorrhoids, and reoperation were assessed by means of a questionnaire and of a clinical examination at long-term follow-up (7.0 year average). At short-term follow-up, the median postoperative pain score was significantly lower in DG-THD group compared to SH group, (V.A.S 2 vs 6; t = 2.65, p hemorrhoids.

  17. RTS,S/AS01 malaria vaccine and child mortality

    DEFF Research Database (Denmark)

    Aaby, Peter; Rodrigues, Amabelia; Kofoed, Poul-Erik

    2015-01-01

    Comment on Efficacy and safety of RTS,S/AS01 malaria vaccine with or without a booster dose in infants and children in Africa: final results of a phase 3, individually randomised, controlled trial. [Lancet. 2015]......Comment on Efficacy and safety of RTS,S/AS01 malaria vaccine with or without a booster dose in infants and children in Africa: final results of a phase 3, individually randomised, controlled trial. [Lancet. 2015]...

  18. Path Searching Based Fault Automated Recovery Scheme for Distribution Grid with DG

    Science.gov (United States)

    Xia, Lin; Qun, Wang; Hui, Xue; Simeng, Zhu

    2016-12-01

    Applying the method of path searching based on distribution network topology in setting software has a good effect, and the path searching method containing DG power source is also applicable to the automatic generation and division of planned islands after the fault. This paper applies path searching algorithm in the automatic division of planned islands after faults: starting from the switch of fault isolation, ending in each power source, and according to the line load that the searching path traverses and the load integrated by important optimized searching path, forming optimized division scheme of planned islands that uses each DG as power source and is balanced to local important load. Finally, COBASE software and distribution network automation software applied are used to illustrate the effectiveness of the realization of such automatic restoration program.

  19. Microbial Fuel Cell Inoculated with Ochrobactrum Tritici KCC210 for Chromium (VI) Measurement in Electroplating Wastewater

    Science.gov (United States)

    Kuo, Jongtar; Kuo, Juiling; Cheng, Chiuyu; Chung, Yingchien

    2018-01-01

    Many methods/techniques have been developed for Cr(VI) measurement, but they are often conducted offsite or/and cannot provide real-time for Cr(VI) monitoring. A microbial fuel cell (MFC) is a self-sustaining device and has great potential as a biosensor for in situ Cr(VI) measurement, especially for wastewater generated from different electroplating units. In this study, Ochrobactrum tritici KCC210, a facultatively anaerobic, Cr(VI)-reducing, and exoelectrogenic bacterium, was isolated and inoculated into the MFC to evaluate its feasibility as a Cr(VI) biosensor. The results indicated that O. tritici KCC210 exhibited high adaptability to pH, and temperature under anaerobic conditions. The maximum power density of the MFC biosensor was 17.5±0.9 mW/m2 at 2,000 Ω. A good linear relationship was observed between the Cr(VI) concentration (10-80 mg/L) and voltage output. The stable performance of the MFC biosensor indicated its potential as a reliable biosensor system. Moreover, the developed MFC biosensor is a simple device that can accurately measure Cr(VI) concentrations in the actual electroplating wastewater generated from different electroplating units within 15 min with low deviations (-1.8% to 7.8%) in comparison with the values determined using standard method. Thus, the MFC biosensor can measure Cr(VI) concentrations in situ in the effluents and has potential as an early warning detection device.

  20. Differential uptake of FDG and DG during post-ischaemic reperfusion in the isolated, perfused rat heart

    Energy Technology Data Exchange (ETDEWEB)

    Garlick, P.B.; Medina, R.A.; Southworth, R.; Marsden, P.K. [Department of Radiological Sciences, Guy' s, King' s and St. Thomas' School of Medicine, London (United Kingdom)

    1999-10-01

    Fluorine-18 2-fluoro-2-deoxyglucose (FDG) and 2-deoxyglucose (DG) are widely used as tracers of glucose uptake in the myocardium. Although there is agreement that the two analogues behave similarly to glucose under control conditions, there is growing evidence that some interventions (e.g. insulin stimulation or ischaemia/reperfusion) cause differential changes in their behaviour. The addition of a two-surface coil nuclear magnetic resonance (NMR) probe and a dual-perfusion cannula to our recently developed PET and NMR dual-acquisition (PANDA) system allows us to collect PET (FDG) images and phosphorus-31 NMR (2-deoxyglucose-6-phosphate) spectra simultaneously from each independently perfused coronary bed of the heart. We have used this technique to study the effect of regional ischaemia/reperfusion on FDG and DG uptake in the isolated, perfused rat heart. During control perfusion, FDG uptake was almost identical in both coronary beds. When one coronary bed was made ischaemic, FDG uptake ceased on that side but continued on the control side. Reperfusion failed to restore FDG uptake. In contrast, NMR spectra showed that, during reperfusion, the uptake and phosphorylation of DG did not differ between the two coronary beds. The results thus demonstrate that regional myocardial ischaemia/reperfusion has different effects on the uptake of FDG and DG in the isolated, perfused rat heart. (orig.)

  1. Differential uptake of FDG and DG during post-ischaemic reperfusion in the isolated, perfused rat heart

    International Nuclear Information System (INIS)

    Garlick, P.B.; Medina, R.A.; Southworth, R.; Marsden, P.K.

    1999-01-01

    Fluorine-18 2-fluoro-2-deoxyglucose (FDG) and 2-deoxyglucose (DG) are widely used as tracers of glucose uptake in the myocardium. Although there is agreement that the two analogues behave similarly to glucose under control conditions, there is growing evidence that some interventions (e.g. insulin stimulation or ischaemia/reperfusion) cause differential changes in their behaviour. The addition of a two-surface coil nuclear magnetic resonance (NMR) probe and a dual-perfusion cannula to our recently developed PET and NMR dual-acquisition (PANDA) system allows us to collect PET (FDG) images and phosphorus-31 NMR (2-deoxyglucose-6-phosphate) spectra simultaneously from each independently perfused coronary bed of the heart. We have used this technique to study the effect of regional ischaemia/reperfusion on FDG and DG uptake in the isolated, perfused rat heart. During control perfusion, FDG uptake was almost identical in both coronary beds. When one coronary bed was made ischaemic, FDG uptake ceased on that side but continued on the control side. Reperfusion failed to restore FDG uptake. In contrast, NMR spectra showed that, during reperfusion, the uptake and phosphorylation of DG did not differ between the two coronary beds. The results thus demonstrate that regional myocardial ischaemia/reperfusion has different effects on the uptake of FDG and DG in the isolated, perfused rat heart. (orig.)

  2. Multi-objective PSO based optimal placement of solar power DG in radial distribution system

    Directory of Open Access Journals (Sweden)

    Mahesh Kumar

    2017-06-01

    Full Text Available Ever increasing trend of electricity demand, fossil fuel depletion and environmental issues request the integration of renewable energy into the distribution system. The optimal planning of renewable distributed generation (DG is much essential for ensuring maximum benefits. Hence, this paper proposes the optimal placement of probabilistic based solar power DG into the distribution system. The two objective functions such as power loss reduction and voltage stability index improvement are optimized. The power balance and voltage limits are kept as constraints of the problem. The non-sorting pare to-front based multi-objective particle swarm optimization (MOPSO technique is proposed on standard IEEE 33 radial distribution test system.

  3. Comparative Analysis of Doppler Guided Hemorrhoidal Artery Ligation (DG-HAL) & Infrared Coagulation (IRC) in Management of Hemorrhoids.

    Science.gov (United States)

    Ahmad, Arshad; Kant, Rama; Gupta, Avneet

    2013-08-01

    Both Doppler-guided hemorrhoidal artery ligation (DG-HAL) and infrared coagulation (IRC) are well-established techniques in the management of hemorrhoids. The aim of the study is to compare the clinical outcomes of DG-HAL and IRC in the patients with grade 1 and 2 hemorrhoids. A total of 296 patients were registered for the study, but 51 patients were lost in follow-up; hence, finally 245 patients were included in the analysis. Patients were randomized into two groups (mean age, 42 years; range, 19-60 years). Group A (n = 116) was treated with DG-HAL and group B (n = 129) was treated with IRC. Patients were examined at 1 week, 1 month, and 6 months after the procedure. Mean time taken for HAL was 21 min and for IRC, 12 min. The cost of the DG-HAL procedure was 1,440 rupees ($31.53) and that of IRC was 376 rupees ($8). The mean duration of hospital stay after HAL was 6 h and after IRC, 2 h. Control of symptoms with HAL was 96 %, whereas with IRC, 81 %. Postoperative complication rate for HAL was 2 %, whereas for IRC, 13 %. Requirement of repeat procedure with HAL was 9 % and with IRC, 28 %. Both the procedures are minimally invasive, associated with minimal discomfort, and suitable for day care surgery. IRC requires lesser procedure time, lesser postoperative hospital stay, and has lower procedure cost, whereas DG-HAL is more effective in controlling symptoms of hemorrhoids, has lower post operative complication rate, and has lesser requirement of repeat procedure.

  4. Distributed Generation potential of the U.S. commercial sector

    International Nuclear Information System (INIS)

    Hamachi LaCommare, Kristina; Edwards, Jennifer L.; Gumerman, Etan; Marnay, Chris

    2005-01-01

    Small-scale (100 kW - 5 MW) on-site distributed generation (DG) economically driven by combined heat and power (CHP) applications and, in some cases, reliability concerns will likely emerge as a common feature of commercial building energy systems in developed countries over the next two decades. In the U.S., private and public expectations for this technology are heavily influenced by forecasts published by the Energy Information Administration (EIA), most notably the Annual Energy Outlook (AEO). EIA's forecasts are typically made using the National Energy Modeling System (NEMS), which has a forecasting module that predicts the penetration of several possible commercial building DG technologies over the period 2005-2025. Annual penetration is forecast by estimating the payback period for each technology, for each of a limited number of representative building types, for each of nine regions. This process results in an AEO2004 forecast deployment of about a total 3 GW of DG electrical generating capacity by 2025, which is only 0.25% of total forecast U.S. capacity. Analyses conducted using both the AEO2003 and AEO2004 versions of NEMS changes the baseline costs and performance characteristics of DG to reflect a world without U.S. Dept. of Energy (DOE) research into several thermal DG technologies, which is then compared to a case with enhanced technology representative of the successful achievement of DOE research goals. The net difference in 2025 DG penetration is dramatic using the AEO2003 version of NEMS, but much smaller in the AEO2004 version. The significance and validity of these contradictory results are discussed, and possibilities for improving estimates of commercial U.S. DG potential are explored

  5. Optimal placement and sizing of wind / solar based DG sources in distribution system

    Science.gov (United States)

    Guan, Wanlin; Guo, Niao; Yu, Chunlai; Chen, Xiaoguang; Yu, Haiyang; Liu, Zhipeng; Cui, Jiapeng

    2017-06-01

    Proper placement and sizing of Distributed Generation (DG) in distribution system can obtain maximum potential benefits. This paper proposes quantum particle swarm algorithm (QPSO) based wind turbine generation unit (WTGU) and photovoltaic (PV) array placement and sizing approach for real power loss reduction and voltage stability improvement of distribution system. Performance modeling of wind and solar generation system are described and classified into PQ\\PQ (V)\\PI type models in power flow. Considering the WTGU and PV based DGs in distribution system is geographical restrictive, the optimal area and DG capacity limits of each bus in the setting area need to be set before optimization, the area optimization method is proposed . The method has been tested on IEEE 33-bus radial distribution systems to demonstrate the performance and effectiveness of the proposed method.

  6. Molecular Cloning and Characterization of a Newly Isolated Pyrethroid-Degrading Esterase Gene from a Genomic Library of Ochrobactrum anthropi YZ-1

    Science.gov (United States)

    Song, Jinlong; Shi, Yanhua; Li, Kang; Zhao, Bin; Yan, Yanchun

    2013-01-01

    A novel pyrethroid-degrading esterase gene pytY was isolated from the genomic library of Ochrobactrum anthropi YZ-1. It possesses an open reading frame (ORF) of 897 bp. Blast search showed that its deduced amino acid sequence shares moderate identities (30% to 46%) with most homologous esterases. Phylogenetic analysis revealed that PytY is a member of the esterase VI family. pytY showed very low sequence similarity compared with reported pyrethroid-degrading genes. PytY was expressed, purified, and characterized. Enzyme assay revealed that PytY is a broad-spectrum degrading enzyme that can degrade various pyrethroids. It is a new pyrethroid-degrading gene and enriches genetic resource. Kinetic constants of Km and Vmax were 2.34 mmol·L−1 and 56.33 nmol min−1, respectively, with lambda-cyhalothrin as substrate. PytY displayed good degrading ability and stability over a broad range of temperature and pH. The optimal temperature and pH were of 35°C and 7.5. No cofactors were required for enzyme activity. The results highlighted the potential use of PytY in the elimination of pyrethroid residuals from contaminated environments. PMID:24155944

  7. 26th May 2011 -Delegate to CERN Open Council sessions and European Commission Head of Unit for Joint Programming European Research Area, DG Research and Innovation R. Lečbychová visiting the CERN Control Centre with M. Pojer, accompanied by CERN S. Stavrev.

    CERN Multimedia

    Maximilien Brice

    2011-01-01

    26th May 2011 -Delegate to CERN Open Council sessions and European Commission Head of Unit for Joint Programming European Research Area, DG Research and Innovation R. Lečbychová visiting the CERN Control Centre with M. Pojer, accompanied by CERN S. Stavrev.

  8. A control approach for the operation of DG units under variations of interfacing impedance in grid-connected mode

    DEFF Research Database (Denmark)

    Hoseini, S. Kazem; Pouresmaeil, E.; Hosseinnia, S. H.

    2016-01-01

    . However, the converter-based DG interface is subjected to the unexpected uncertainties, which highly influence performance of control loop of DG unit and operation of interfaced converter. The interfacing impedance seen by interfaced VSC may considerably vary in power grid, and the stability of interfaced...... converter is highly sensitive to the impacts of this impedance changes; then, DG unit cannot inject appropriate currents. To deal with the instability problem, a control method based on fractional order active sliding mode is proposed in this paper, which is less sensitive to variations of interfacing...... impedance. A fractional sliding surface, which demonstrates the desired dynamics of system is developed and then, the controller is designed in two phases as sliding and reaching phases to keep the control loop stable. Stability issues of the control method are discussed in details and the conditions...

  9. SU-F-I-01: Normalized Mean Glandular Dose Values for Dedicated Breast CT Using Realistic Breast-Shaped Phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez, A [Department of Radiology, Biomedical Engineering Graduate Group, University of California Davis, Sacramento, CA (United States); Boone, J [Departments of Radiology and Biomedical Engineering, Biomedical Engeering Graduate Group, University of California Davis, Sacramento, CA (United States)

    2016-06-15

    Purpose: To estimate normalized mean glandular dose values for dedicated breast CT (DgN-CT) using breast CT-derived phantoms and compare to estimations using cylindrical phantoms. Methods: Segmented breast CT (bCT) volume data sets (N=219) were used to measure effective diameter profiles and were grouped into quintiles by volume. The profiles were averaged within each quintile to represent the range of breast sizes found clinically. These profiles were then used to generate five voxelized computational phantoms (V1, V2, V3, V4, V5 for the small to large phantom sizes, respectively), and loaded into the MCNP6 lattice geometry to simulate normalized mean glandular dose coefficients (DgN-CT) using the system specifications of the Doheny-prototype bCT scanner in our laboratory. The DgN-CT coefficients derived from the bCT-derived breast-shaped phantoms were compared to those generated using a simpler cylindrical phantom using a constant volume, and the following constraints: (1) Length=1.5*radius; (2) radius determined at chest wall (Rcw), and (3) radius determined at the phantom center-of-mass (Rcm). Results: The change in Dg-NCT coefficients averaged across all phantom sizes, was - 0.5%, 19.8%, and 1.3%, for constraints 1–3, respectively. This suggests that the cylindrical assumption is a good approximation if the radius is taken at the breast center-of-mass, but using the radius at the chest wall results in an underestimation of the glandular dose. Conclusion: The DgN-CT coefficients for bCT-derived phantoms were compared against the assumption of a cylindrical phantom and proved to be essentially equivalent when the cylinder radius was set to r=1.5/L or Rcm. While this suggests that for dosimetry applications a patient’s breast can be approximated as a cylinder (if the correct radius is applied), this assumes a homogenous composition of breast tissue and the results may be different if the realistic heterogeneous distribution of glandular tissue is considered

  10. Reduced Cerebral Oxygen Content in the DG and SVZ In Situ Promotes Neurogenesis in the Adult Rat Brain In Vivo.

    Directory of Open Access Journals (Sweden)

    Kuan Zhang

    Full Text Available Neurogenesis in the adult brain occurs mainly within two neurogenic structures, the dentate gyrus (DG of the hippocampus and the sub-ventricular zone (SVZ of the forebrain. It has been reported that mild hypoxia promoted the proliferation of Neural Stem Cells (NSCsin vitro. Our previous study further demonstrated that an external hypoxic environment stimulated neurogenesis in the adult rat brain in vivo. However, it remains unknown how external hypoxic environments affect the oxygen content in the brain and result in neurogenesis. Here we use an optical fiber luminescent oxygen sensor to detect the oxygen content in the adult rat brain in situ under normoxia and hypoxia. We found that the distribution of oxygen in cerebral regions is spatiotemporally heterogeneous. The Po2 values in the ventricles (45∼50 Torr and DG (approximately 10 Torr were much higher than those of other parts of the brain, such as the cortex and thalamus (approximately 2 Torr. Interestingly, our in vivo studies showed that an external hypoxic environment could change the intrinsic oxygen content in brain tissues, notably reducing oxygen levels in both the DG and SVZ, the major sites of adult neurogenesis. Furthermore, the hypoxic environment also increased the expression of HIF-1α and VEGF, two factors that have been reported to regulate neurogenesis, within the DG and SVZ. Thus, we have demonstrated that reducing the oxygen content of the external environment decreased Po2 levels in the DG and SVZ. This reduced oxygen level in the DG and SVZ might be the main mechanism triggering neurogenesis in the adult brain. More importantly, we speculate that varying oxygen levels may be the physiological basis of the regionally restricted neurogenesis in the adult brain.

  11. Drug: D07284 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D07284 Drug Butanilicaine (INN) ... C13H19ClN2O D07284.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetic...s ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic ... DG01675 ... Local anesthetic... ... DG01673 ... Amide type local anesthetic ATC code: N01BB05 ... CAS: 3785-21-5 PubChem: 51091621 ChEBI: 55518 ChEMBL: CHEMBL2104238 LigandBox: D07284 NIKKAJI: J8.254F ...

  12. Potential repair of free radical adducts of dGMP and dG by a series of reductants. A pulse radiolytic study

    International Nuclear Information System (INIS)

    O'Neill, P.; Chapman, P.W.

    1985-01-01

    Using the technique of pulse radiolysis, it has been demonstrated that the interaction of hydroxyl-radical adducts of dG and dGMP with a series of reductants with different oxidation potentials at pH 7.0-7.4 proceeds via an electron transfer process (k approx. 1.4-34 x 10 8 dm 3 mol -1 s -1 ). The one-electron oxidation of dGMP (dG) by Br2-anion radicals was shown to result in the formation of a species, the properties of which are similar to those of the OH-radical adduct of dGMP with oxidizing properties based upon both spectral and kinetic information. The nature of the dGMP species produced on interaction with Br2-anion radicals to produce specific base damage. The implications of these findings are presented in terms of potential free radical repair of hydroxyl radical damage and of synergistic effects whereby one reductant may be regenerated at the expense of another reductant. (author)

  13. Multi types DG expansion dynamic planning in distribution system under stochastic conditions using Covariance Matrix Adaptation Evolutionary Strategy and Monte-Carlo simulation

    International Nuclear Information System (INIS)

    Sadeghi, Mahmood; Kalantar, Mohsen

    2014-01-01

    Highlights: • Defining a DG dynamic planning problem. • Applying a new evolutionary algorithm called “CMAES” in planning process. • Considering electricity price and fuel price variation stochastic conditions. • Scenario generation and reduction with MCS and backward reduction programs. • Considering approximately all of the costs of the distribution system. - Abstract: This paper presents a dynamic DG planning problem considering uncertainties related to the intermittent nature of the DG technologies such as wind turbines and solar units in addition to the stochastic economic conditions. The stochastic economic situation includes the uncertainties related to the fuel and electricity price of each year. The Monte Carlo simulation is used to generate the possible scenarios of uncertain situations and the produced scenarios are reduced through backward reduction program. The aim of this paper is to maximize the revenue of the distribution system through the benefit cost analysis alongside the encouraging and punishment functions. In order to close to reality, the different growth rates for the planning period are selected. In this paper the Covariance Matrix Adaptation Evolutionary Strategy is introduced and is used to find the best planning scheme of the DG units. The different DG types are considered in the planning problem. The main assumption of this paper is that the DISCO is the owner of the distribution system and the DG units. The proposed method is tested on a 9 bus test distribution system and the results are compared with the known genetic algorithm and PSO methods to show the applicability of the CMAES method in this problem

  14. Experimental Conditions: SE3_S02_M01_D02 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE3_S02_M01_D02 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M01 6.7mg [MassBase ID] MDLC1_25529 SE3_MS1 LC-FT-ICR-MS

  15. Experimental Conditions: SE3_S02_M01_D03 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE3_S02_M01_D03 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M01 6.7mg [MassBase ID] MDLC1_25529 SE3_MS1 LC-FT-ICR-MS

  16. Large-Signal DG-MOSFET Modelling for RFID Rectification

    Directory of Open Access Journals (Sweden)

    R. Rodríguez

    2016-01-01

    Full Text Available This paper analyses the undoped DG-MOSFETs capability for the operation of rectifiers for RFIDs and Wireless Power Transmission (WPT at microwave frequencies. For this purpose, a large-signal compact model has been developed and implemented in Verilog-A. The model has been numerically validated with a device simulator (Sentaurus. It is found that the number of stages to achieve the optimal rectifier performance is inferior to that required with conventional MOSFETs. In addition, the DC output voltage could be incremented with the use of appropriate mid-gap metals for the gate, as TiN. Minor impact of short channel effects (SCEs on rectification is also pointed out.

  17. The synthesis of a D-glucosamine contrast agent, Gd-DTPA-DG, and its application in cancer molecular imaging with MRI

    International Nuclear Information System (INIS)

    Zhang Wei; Chen Yue; Guo Dajing; Huang Zhanwen; Cai Liang; He Ling

    2011-01-01

    Objective: The purpose of this study is to describe the synthesis of Gadolinium-diethylenetriamine pentaacetic acid-deoxyglucosamine (Gd-DTPA-DG) which is a D-glucosamine metabolic MR imaging contrast agent. We will also discuss its use in a pilot MRI study using a xenograft mouse model of human adenocarcinoma. Methods: This novel contrast agent was specifically studied because of its ability to 'target' metabolically active tumor tissues. In this study Gd-DTPA-DG is used to investigate how tumor tissues would react to a dose of 0.2 mmol Gd/kg over a 120 min exposure in a xenograft mouse model. These experiments used athymic mice implanted with human pulmonary adenocarcinoma (A549) as demonstrated by dynamic MRI. Alternately, another contrast agent that is not specific for targeting, Gd-DTPA, was used as the control at a similar dose of gadolinium. Efficacy of the targeted contrast agent was assessed by measuring relaxation rate in vitro and signal intensity (SI) in vivo. Statistical differences were calculated using one-way analysis of variance. Results: The synthesized Gd-DTPA-DG was shown to improve the contrast of tumor tissue in this model. Gd-DTPA-DG was also shown to have a similar pharmacokinetic rate but generated a higher relaxation rate in tumor tissues relative to the control contrast Gd-DTPA. In comparison to the pre-contrast imaging, the SI of tumor tissue in the experimental group was shown to be significantly increased at 15 min after injection of Gd-DTPA-DG (p < 0.001). The enhanced signal intensity spread from the edge of the tumor to the center and seemed to strengthen the idea that MRI performance would be useful in different tumor tissues. Conclusion: This preliminary study shows that this new chelated contrast agent, Gd-DTPA-DG, can be specifically targeted to accumulation in tumor tissue as compared to normal tissues. This targeted paramagnetic contrast agent has potential for specific cancer molecular imaging with MRI.

  18. Fenpropathrin biodegradation pathway in Bacillus sp. DG-02 and its potential for bioremediation of pyrethroid-contaminated soils.

    Science.gov (United States)

    Chen, Shaohua; Chang, Changqing; Deng, Yinyue; An, Shuwen; Dong, Yi Hu; Zhou, Jianuan; Hu, Meiying; Zhong, Guohua; Zhang, Lian-Hui

    2014-03-12

    The widely used insecticide fenpropathrin in agriculture has become a public concern because of its heavy environmental contamination and toxic effects on mammals, yet little is known about the kinetic and metabolic behaviors of this pesticide. This study reports the degradation kinetics and metabolic pathway of fenpropathrin in Bacillus sp. DG-02, previously isolated from the pyrethroid-manufacturing wastewater treatment system. Up to 93.3% of 50 mg L(-1) fenpropathrin was degraded by Bacillus sp. DG-02 within 72 h, and the degradation rate parameters qmax, Ks, and Ki were determined to be 0.05 h(-1), 9.0 mg L(-1), and 694.8 mg L(-1), respectively. Analysis of the degradation products by gas chromatography-mass spectrometry led to identification of seven metabolites of fenpropathrin, which suggest that fenpropathrin could be degraded first by cleavage of its carboxylester linkage and diaryl bond, followed by degradation of the aromatic ring and subsequent metabolism. In addition to degradation of fenpropathrin, this strain was also found to be capable of degrading a wide range of synthetic pyrethroids including deltamethrin, λ-cyhalothrin, β-cypermethrin, β-cyfluthrin, bifenthrin, and permethrin, which are also widely used insecticides with environmental contamination problems with the degradation process following the first-order kinetic model. Bioaugmentation of fenpropathrin-contaminated soils with strain DG-02 significantly enhanced the disappearance rate of fenpropathrin, and its half-life was sharply reduced in the soils. Taken together, these results depict the biodegradation mechanisms of fenpropathrin and also highlight the promising potentials of Bacillus sp. DG-02 in bioremediation of pyrethroid-contaminated soils.

  19. Absolute quantification of regional cerebral glucose utilization in mice by 18F-FDG small animal PET scanning and 2-14C-DG autoradiography.

    Science.gov (United States)

    Toyama, Hiroshi; Ichise, Masanori; Liow, Jeih-San; Modell, Kendra J; Vines, Douglass C; Esaki, Takanori; Cook, Michelle; Seidel, Jurgen; Sokoloff, Louis; Green, Michael V; Innis, Robert B

    2004-08-01

    The purpose of this study was to evaluate the feasibility of absolute quantification of regional cerebral glucose utilization (rCMR(glc)) in mice by use of (18)F-FDG and a small animal PET scanner. rCMR(glc) determined with (18)F-FDG PET was compared with values determined simultaneously by the autoradiographic 2-(14)C-DG method. In addition, we compared the rCMR(glc) values under isoflurane, ketamine and xylazine anesthesia, and awake states. Immediately after injection of (18)F-FDG and 2-(14)C-DG into mice, timed arterial samples were drawn over 45 min to determine the time courses of (18)F-FDG and 2-(14)C-DG. Animals were euthanized at 45 min and their brain was imaged with the PET scanner. The brains were then processed for 2-(14)C-DG autoradiography. Regions of interest were manually placed over cortical regions on corresponding coronal (18)F-FDG PET and 2-(14)C-DG autoradiographic images. rCMR(glc) values were calculated for both tracers by the autoradiographic 2-(14)C-DG method with modifications for the different rate and lumped constants for the 2 tracers. Average rCMR(glc) values in cerebral cortex with (18)F-FDG PET under normoglycemic conditions (isoflurane and awake) were generally lower (by 8.3%) but strongly correlated with those of 2-(14)C-DG (r(2) = 0.95). On the other hand, under hyperglycemic conditions (ketamine/xylazine) average cortical rCMR(glc) values with (18)F-FDG PET were higher (by 17.3%) than those with 2-(14)C-DG. Values for rCMR(glc) and uptake (percentage injected dose per gram [%ID/g]) with (18)F-FDG PET were significantly lower under both isoflurane and ketamine/xylazine anesthesia than in the awake mice. However, the reductions of rCMR(glc) were markedly greater under isoflurane (by 57%) than under ketamine and xylazine (by 19%), whereas more marked reductions of %ID/g were observed with ketamine/xylazine (by 54%) than with isoflurane (by 37%). These reverse differences between isoflurane and ketamine/xylazine may be due to

  20. Biodegradation of used engine oil by novel strains of Ochrobactrum anthropi HM-1 and Citrobacter freundii HM-2 isolated from oil-contaminated soil.

    Science.gov (United States)

    Ibrahim, Haytham M M

    2016-12-01

    Used engine oil (UEO) constitutes a serious environmental problem due to the difficulty of disposal off or reuse. Ten bacterial strains with biodegradation potential were isolated from UEO-contaminated soil sample using enrichment technique. Two strains which exhibited the highest degradation %, 51 ± 1.2 and 48 ± 1.5, respectively, were selected. Based on the morphological, biochemical characteristics and 16S rRNA sequence analysis, they were identified as Ochrobactrum anthropi HM-1 (accession no: KR360745) and Citrobacter freundii HM-2 (accession no: KR360746). The different conditions which may influence their biodegradation activity, including UEO concentration (1-6 %, v/v), inoculum size (0.5-4 %, v/v), initial pH (6-8), incubation temperature (25-45 °C), and rotation speed (0-200 rpm), were evaluated. The optimum conditions were found to be 2 % UEO, 2 % inoculum size, pH 7.5, incubation temperature 37 °C, and 150 rpm. Under the optimized conditions, strains HM-1, HM-2, and their mixture efficiently degraded UEO, they achieved 65 ± 2.2, 58 ± 2.1, and 80 ± 1.9 %, respectively, after 21 days of incubation. Biodegradation of UEO was confirmed by employing gas chromatography analysis. Gamma radiation (1.5 kGy) enhanced the degradation efficiency of irradiated bacterial mixture (95 ± 2.1 %) as compared to non-irradiated (79 ± 1.6 %). Therefore, strains HM-1 and HM-2 can be employed to develop a cost-effective method for bioremediation of used engine-oil-polluted soil.

  1. Utility of Ochrobactrum anthropi YC152 in a Microbial Fuel Cell as an Early Warning Device for Hexavalent Chromium Determination

    Directory of Open Access Journals (Sweden)

    Guey-Horng Wang

    2016-08-01

    Full Text Available Fast hexavalent chromium (Cr(VI determination is important for environmental risk and health-related considerations. We used a microbial fuel cell-based biosensor inoculated with a facultatively anaerobic, Cr(VI-reducing, and exoelectrogenic Ochrobactrum anthropi YC152 to determine the Cr(VI concentration in water. The results indicated that O. anthropi YC152 exhibited high adaptability to pH, temperature, salinity, and water quality under anaerobic conditions. The stable performance of the microbial fuel cell (MFC-based biosensor indicated its potential as a reliable biosensor system. The MFC voltage decreased as the Cr(VI concentration in the MFC increased. Two satisfactory linear relationships were observed between the Cr(VI concentration and voltage output for various Cr(VI concentration ranges (0.0125–0.3 mg/L and 0.3–5 mg/L. The MFC biosensor is a simple device that can accurately measure Cr(VI concentrations in drinking water, groundwater, and electroplating wastewater in 45 min with low deviations (<10%. The use of the biosensor can help in preventing the violation of effluent regulations and the maximum allowable concentration of Cr(VI in water. Thus, the developed MFC biosensor has potential as an early warning detection device for Cr(VI determination even if O. anthropi YC152 is a possible opportunistic pathogen.

  2. Designing a collection layout for DG-CO collections

    CERN Document Server

    Pantic, Radoslav

    2014-01-01

    While CDS is in use for years and contains a very large number of interesting resources (documents, papers, articles, presentations, videos, images, photos, audio files etc), practical and daily use of it has shown some limitations. First of all, the extremely large amount of available resources does not make easy the possibility to focus only on certain specific pre-selected documents. Second, the search capabilities of CDS, while very extended, do not always meet client-specific needs and are not always easy to use by unexperienced external visitors. This document describes an ideal tool to be used by DG-CO (but also potentially other services) to overcome the 2 limitations described above.

  3. Drug: D07478 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D07478 Drug Aurotioprol; Allochrysine (TN) ... C3H6AuO4S2.Na ... Anti-inflammatory ... DG01912 ... Gold... preparations ... DG01985 ... Disease modifying anti-rheumatic drugs (DMARDs) ... DG01912 ... Gold preparat...ions ATC code: M01CB05 ... Gold preparation ... CAS: 27279-43-2 PubChem: 96024436 NIKKAJI: J35.087G ...

  4. DG TO FT - AUTOMATIC TRANSLATION OF DIGRAPH TO FAULT TREE MODELS

    Science.gov (United States)

    Iverson, D. L.

    1994-01-01

    Fault tree and digraph models are frequently used for system failure analysis. Both types of models represent a failure space view of the system using AND and OR nodes in a directed graph structure. Each model has its advantages. While digraphs can be derived in a fairly straightforward manner from system schematics and knowledge about component failure modes and system design, fault tree structure allows for fast processing using efficient techniques developed for tree data structures. The similarities between digraphs and fault trees permits the information encoded in the digraph to be translated into a logically equivalent fault tree. The DG TO FT translation tool will automatically translate digraph models, including those with loops or cycles, into fault tree models that have the same minimum cut set solutions as the input digraph. This tool could be useful, for example, if some parts of a system have been modeled using digraphs and others using fault trees. The digraphs could be translated and incorporated into the fault trees, allowing them to be analyzed using a number of powerful fault tree processing codes, such as cut set and quantitative solution codes. A cut set for a given node is a group of failure events that will cause the failure of the node. A minimum cut set for a node is any cut set that, if any of the failures in the set were to be removed, the occurrence of the other failures in the set will not cause the failure of the event represented by the node. Cut sets calculations can be used to find dependencies, weak links, and vital system components whose failures would cause serious systems failure. The DG TO FT translation system reads in a digraph with each node listed as a separate object in the input file. The user specifies a terminal node for the digraph that will be used as the top node of the resulting fault tree. A fault tree basic event node representing the failure of that digraph node is created and becomes a child of the terminal

  5. Facile construction of 3D graphene/MoS2 composites as advanced electrode materials for supercapacitors

    Science.gov (United States)

    Sun, Tianhua; Li, Zhangpeng; Liu, Xiaohong; Ma, Limin; Wang, Jinqing; Yang, Shengrong

    2016-11-01

    Flower-like molybdenum disulfide (MoS2) microstructures are synthesized based on three-dimensional graphene (3DG) skeleton via a simple and facile one-step hydrothermal method, aiming at constructing series of novel composite electrode materials of 3DG/MoS2 with high electrochemical performances for supercapacitors. The electrochemical properties of the samples are evaluated by cyclic voltammetry and galvanostatic charge/discharge tests. Specifically, the optimal 3DG/MoS2 composite exhibits remarkable performances with a high specific capacitance of 410 F g-1 at a current density of 1 A g-1 and an excellent cycling stability with ca. 80.3% capacitance retention after 10,000 continuous charge-discharge cycles at a high current density of 2 A g-1, making it adaptive for high-performance supercapacitors. The enhanced electrochemical performances can be ascribed to the combination of 3DG and flower-like MoS2, which provides excellent charge transfer network and electrolyte diffusion channels while effectively prevents the collapse, aggregation and morphology change of active materials during charge-discharge process. The results demonstrate that 3DG/MoS2 composite is one of the attractive electrode materials for supercapacitors.

  6. Dynamics simulation of a π-conjugated light-harvesting dendrimer II: phenylene-based dendrimer (phDG2)

    International Nuclear Information System (INIS)

    Kodama, Yasunobu; Ishii, Soh; Ohno, Kaoru

    2009-01-01

    We investigate the light-harvesting property of a π-conjugated dendrimer, phenylene-based dendrimer (phDG2), by carrying out a semi-classical Ehrenfest dynamics simulation based on the time-dependent density functional theory. Similar to our previous study of star-shaped stilbenoid phthalocyanine (SSS1Pc), phDG2 shows electron and hole transfer from the periphery to the core through a π-conjugated network when an electron is selectively excited in the periphery. The one-way electron and hole transfer occurs more easily in dendrimers with planar structure than in those with steric hindrance because π-conjugation is well maintained in the planar structure. The present results explain recent experiments by Akai et al (2005 J. Lumin. 112 449).

  7. Drug: D00712 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available .gif ... Neuropsychiatric agent ... DG01837 ... Barbiturate sedative-hypnotics ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics... ... DG02025 ... Barbiturate anesthetics ... DG02027 ... General anesthetics ... DG02025 ... Barbiturate anesthetics... ... DG02025 ... Barbiturate anesthetics ATC code: N01AF01 N05CA15 Chemical gr

  8. Candidatus Frankia Datiscae Dg1, the Actinobacterial Microsymbiont of Datisca glomerata, Expresses the Canonical nod Genes nodABC in Symbiosis with Its Host Plant

    Science.gov (United States)

    Persson, Tomas; Battenberg, Kai; Demina, Irina V.; Vigil-Stenman, Theoden; Vanden Heuvel, Brian; Pujic, Petar; Facciotti, Marc T.; Wilbanks, Elizabeth G.; O'Brien, Anna; Fournier, Pascale; Cruz Hernandez, Maria Antonia; Mendoza Herrera, Alberto; Médigue, Claudine; Normand, Philippe; Pawlowski, Katharina; Berry, Alison M.

    2015-01-01

    Frankia strains are nitrogen-fixing soil actinobacteria that can form root symbioses with actinorhizal plants. Phylogenetically, symbiotic frankiae can be divided into three clusters, and this division also corresponds to host specificity groups. The strains of cluster II which form symbioses with actinorhizal Rosales and Cucurbitales, thus displaying a broad host range, show suprisingly low genetic diversity and to date can not be cultured. The genome of the first representative of this cluster, Candidatus Frankia datiscae Dg1 (Dg1), a microsymbiont of Datisca glomerata, was recently sequenced. A phylogenetic analysis of 50 different housekeeping genes of Dg1 and three published Frankia genomes showed that cluster II is basal among the symbiotic Frankia clusters. Detailed analysis showed that nodules of D. glomerata, independent of the origin of the inoculum, contain several closely related cluster II Frankia operational taxonomic units. Actinorhizal plants and legumes both belong to the nitrogen-fixing plant clade, and bacterial signaling in both groups involves the common symbiotic pathway also used by arbuscular mycorrhizal fungi. However, so far, no molecules resembling rhizobial Nod factors could be isolated from Frankia cultures. Alone among Frankia genomes available to date, the genome of Dg1 contains the canonical nod genes nodA, nodB and nodC known from rhizobia, and these genes are arranged in two operons which are expressed in D. glomerata nodules. Furthermore, Frankia Dg1 nodC was able to partially complement a Rhizobium leguminosarum A34 nodC::Tn5 mutant. Phylogenetic analysis showed that Dg1 Nod proteins are positioned at the root of both α- and β-rhizobial NodABC proteins. NodA-like acyl transferases were found across the phylum Actinobacteria, but among Proteobacteria only in nodulators. Taken together, our evidence indicates an Actinobacterial origin of rhizobial Nod factors. PMID:26020781

  9. A novel islanding detection scheme for synchronous distributed generation using rate of change of exciter voltage over reactive power at DG-Side

    DEFF Research Database (Denmark)

    Rostami, Ali; Bagheri, Marzieh; Naderi, Seyed Behzad

    2017-01-01

    , the reactive power at DG-side and exciter voltage parameters are selected. The performance of the proposed method is investigated in MATLAB/Simulink software on a sample network in the presence of synchronous diesel-generator. The simulation results indicate that the proposed method is capable to detect all......Penetration of distributed generation (DG) in distribution networks is rapidly increasing. DGs' application enhances system's reliability and power quality. However, along their benefits, there are some issues. One of the most important issues of DGs' application is the islanding. This paper...... of the synchronous generator. Therefore, due to lack of inertia, response of these parameters to small changes is faster than the other passive parameters such as frequency. However, the sensitivity of reactive power at the DG-side and the exciter voltage is much more than reactive power and voltage of the load. So...

  10. DG Allocation Based on Reliability, Losses and Voltage Sag Considerations: an expert system approach

    Directory of Open Access Journals (Sweden)

    Sahar Abdel Moneim Moussa

    2017-03-01

    Full Text Available Expert System (ES as a branch of Artificial Intelligence (AI methodology can potentially help in solving complicated power system problems. This may be more appropriate methodology than conventional optimization techniques when contradiction between objectives appears in reaching the optimum solution. When this contradiction is the hindrance in reaching the required system operation through the application of traditional methods ES can give a hand in such case. In this paper, the  knowledge- based ES technique is proposed to reach near-optimum solution which is further directed to the optimum solution through particle swarm optimization (PSO technique. This idea is known as Hybrid-Expert-System (HES. The proposed idea is used in getting the optimum allocation of a number of distributed generation (DG units on Distribution System (DS busbars taking into consideration three issues; reliability, voltage sag, and line losses. Optimality is assessed on the economic basis by calculating money benefits (or losses resulting from DG addition considering the three aforementioned issues. The effectiveness of the proposed technique is ascertained through example.

  11. Drug: D08521 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D08521 Drug Sodium aurothiosulfate (INN); Gold sodium thiosulfate, dihydrate; Cryt...ioro (TN) ... AuS4O6. 3Na. 2H2O D08521.gif ... Anti-inflammatory ... DG01912 ... Gold preparations ... DG01985 ... Disease m...odifying anti-rheumatic drugs (DMARDs) ... DG01912 ... Gold preparations ATC code: M01CB02 ... Gold preparation ... CAS: 10210-36-3 PubChem: 96025206 ChEMBL: CHEMBL3833379 ...

  12. VERY LARGE ARRAY OBSERVATIONS OF DG TAU'S RADIO JET: A HIGHLY COLLIMATED THERMAL OUTFLOW

    Energy Technology Data Exchange (ETDEWEB)

    Lynch, C.; Mutel, R. L.; Gayley, K. G. [Department of Physics and Astronomy, University of Iowa, Iowa City, Iowa 52240 (United States); Guedel, M. [Department of Astrophysics, University of Vienna, A-1180 Vienna (Austria); Ray, T. [Astronomy and Astrophysics Section, Dublin Institute for Advanced Studies, 31 Fitzwilliam Place, Dublin 2 (Ireland); Skinner, S. L. [Center for Astrophysics and Space Astronomy, University of Colorado, Boulder, CO 80309 (United States); Schneider, P. C. [Hamburger Sternwarte, Gojenbergsweg 112, D-21029 Hamburg (Germany)

    2013-03-20

    The active young protostar DG Tau has an extended jet that has been well studied at radio, optical, and X-ray wavelengths. We report sensitive new Very Large Array (VLA) full-polarization observations of the core and jet between 5 GHz and 8 GHz. Our high angular resolution observation at 8 GHz clearly shows an unpolarized inner jet with a size of 42 AU (0.''35) extending along a position angle similar to the optical-X ray outer jet. Using our nearly coeval 2012 VLA observations, we find a spectral index {alpha} = +0.46 {+-} 0.05, which combined with the lack of polarization is consistent with bremsstrahlung (free-free) emission, with no evidence for a non-thermal coronal component. By identifying the end of the radio jet as the optical depth unity surface, and calculating the resulting emission measure, we find that our radio results are in agreement with previous optical line studies of electron density and consequent mass-loss rate. We also detect a weak radio knot at 5 GHz located 7'' from the base of the jet, coincident with the inner radio knot detected by Rodriguez et al. in 2009 but at lower surface brightness. We interpret this as due to expansion of post-shock ionized gas in the three years between observations.

  13. Changes in Policy and Market and Network Regulation to Increase Power Generation by Renewables and DG in the EU

    International Nuclear Information System (INIS)

    Van Oostvoorn, F.; Van der Welle, A.

    2009-01-01

    Recently the importance of 'Large scale DER integration' has increased as means to meet the ambitious 2020 EU policy objectives and targets for RES, emissions reductions and energy efficiency. Increasing the role of RES and DG (Renewable Energy Sources and Distributed Generation or DER) in supply is also highly beneficial for reducing EU dependency on gas and oil imports. In this EU context, it is important to review the current barriers, support policies and network regulation for integration of more DG, RES and small scale CHP (Combined Heat and Power) in the power systems. Several studies conducted for the EU and led by the ECN (Energy research Centre of the Netherlands) reveal that currently, in some, mainly new, Member States, the contribution of RES and DG is still very low. However, in coming decades the share of variable RES-E sources should become much larger in many EU countries. Note that 20% RES in a country in 2020 implies a share of electricity supply by RES of about 30% or more. Currently, countries like Denmark and Spain, already experience such a large contribution of (mostly intermittent type) renewables and this is already negatively impacting power system costs. Now the question arises whether or not we can increase the contribution of RES to the power supply beyond 20-30% without raising system inefficiency and what changes in system conditions and market and network regulation are necessary to efficiently absorb large volumes of so called intermittent RES supply resources. Based on findings from several large EU projects promoting the role of RES and DG in the power supply, the authors discuss and present the different barriers and solutions that should facilitate meeting the ambitious EU policy targets for RES in 2020

  14. Penentuan Lokasi DG dan Kapasitor Bank dengan Rekonfigurasi Jaringan Untuk Memperoleh Rugi Daya Minimal Pada Sistem Distribusi Radial Menggunakan Algoritma Genetika

    Directory of Open Access Journals (Sweden)

    Ridho Fuaddi

    2016-04-01

    Full Text Available Jaringan distribusi yang paling umum digunakan ialah sistem dengan bentuk radial. Sistem ini memiliki bentuk yang sederhana serta biaya investasinya yang terbilang murah. Namun, kualitas pelayanan dayanya relatif buruk yang terjadi akibat adanya rugi daya pada saluran yang cukup besar. Hal itu terjadi karena jaringan distribusi yang merupakan ujung dari saluran transmisi memiliki perbandingan rasio R/X yang tinggi sehingga mengakibatkan rugi daya yang besar. Terdapat beberapa cara untuk mengurangi rugi daya pada jaringan distribusi yakni dengan menggunakan rekonfigurasi jaringan, pemasangan kapasitor bank dan pemasangan unit distributed generation (DG pada sistem distribusi. Pada tugas akhir ini, algoritma genetika merupakan metode yang digunakan untuk memecahkan suatu pencarian nilai dalam masalah optimasi penentuan lokasi DG dan kapasitor bank serta rekonfigurasi jaringan yang tepat untuk mendapatkan rugi daya yang paling minimal. Dari hasil pengujian yang telah dilakukan pada penelitian ini, diperoleh perbaikan rugi daya nyata paling optimal sebesar 94,92 % terhadap kondisi awal sistem distribusi radial 33-bus standart IEEE melalui penggabungan pemasangan DG dan kapasitor bank serta rekonfigurasi jaringan.

  15. Experimental Conditions: SE3_S02_M03_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE3_S02_M03_D01 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M03 6.7 mg [MassBase ID] MDLC1_25531 SE3_MS1 LC-FT-ICR-M

  16. Experimental Conditions: SE3_S02_M02_D01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available SE3_S02_M02_D01 SE3 Comparison of fruit metabolites among tomato varieties 1 SE3_S0...2 Solanum lycopersicum House Momotaro fruit SE3_S02_M02 6.7 mg [MassBase ID] MDLC1_25530 SE3_MS1 LC-FT-ICR-M

  17. Enhanced electrochemical performance from 3DG/LiFePO4/G sandwich cathode material

    Science.gov (United States)

    Du, Yahui; Tang, Yufeng; Chang, Chengkang

    2017-08-01

    In this paper, we have successfully synthesized a three dimensional graphene/LiFePO4/graphene (3DG/LFP/G) sandwich composite by an in-situ hydrothermal method, in which chemical vapor deposited 3D graphene acts as the high conductivity supporting framework, while the LiFePO4 nanoparticles are anchored onto the 3D graphene framework covered by graphene sheets. XRD and SEM results confirmed the formation of the 3DG/LFP/G sandwich composite. Cyclic Voltammetry curve of the sandwich composite shows sharper redox peaks and reduced voltage separation when compared to the reference electrodes, suggesting high specific capacity and good rate performance. Further charge/discharge measurements presented high capacity of 164 mAh g-1 at 0.2 C and 124 mAh g-1 at 10 C (75.7% of its initial capacity) for the sandwich composite, with capacity retention of 95.7% after 100 cycles, implying potential application in lithium ion battery at high rates. The EIS investigation suggests that both the electronic conductivity and the Li ion diffusion are promoted by the underlined 3D graphene framework, which is regarded as the reason for the enhanced electrochemical performance.

  18. Disease: H00374 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available rts, condyloma acuminatum, Bowenoid papulosis, epidermodysplasia verruciformis, and laryngeal papillomas. Ot...ed wart, Punctate wart, Verrucous papule, Flat wart) Cimetidine [DG:DG00017] (Epidermodysplasia verruciformi...s) Interferon alfa [DR:D00745 D02745 D04552 D04553] (Epidermodysplasia verruciformis) ... ICD-10: B07 MeSH: D01

  19. A Model of U.S. Commercial Distributed Generation Adoption

    Energy Technology Data Exchange (ETDEWEB)

    LaCommare, Kristina Hamachi; Ryan Firestone; Zhou, Nan; Maribu,Karl; Marnay, Chris

    2006-01-10

    Small-scale (100 kW-5 MW) on-site distributed generation (DG) economically driven by combined heat and power (CHP) applications and, in some cases, reliability concerns will likely emerge as a common feature of commercial building energy systems over the next two decades. Forecasts of DG adoption published by the Energy Information Administration (EIA) in the Annual Energy Outlook (AEO) are made using the National Energy Modeling System (NEMS), which has a forecasting module that predicts the penetration of several possible commercial building DG technologies over the period 2005-2025. NEMS is also used for estimating the future benefits of Department of Energy research and development used in support of budget requests and management decisionmaking. The NEMS approach to modeling DG has some limitations, including constraints on the amount of DG allowed for retrofits to existing buildings and a small number of possible sizes for each DG technology. An alternative approach called Commercial Sector Model (ComSeM) is developed to improve the way in which DG adoption is modeled. The approach incorporates load shapes for specific end uses in specific building types in specific regions, e.g., cooling in hospitals in Atlanta or space heating in Chicago offices. The Distributed Energy Resources Customer Adoption Model (DER-CAM) uses these load profiles together with input cost and performance DG technology assumptions to model the potential DG adoption for four selected cities and two sizes of five building types in selected forecast years to 2022. The Distributed Energy Resources Market Diffusion Model (DER-MaDiM) is then used to then tailor the DER-CAM results to adoption projections for the entire U.S. commercial sector for all forecast years from 2007-2025. This process is conducted such that the structure of results are consistent with the structure of NEMS, and can be re-injected into NEMS that can then be used to integrate adoption results into a full forecast.

  20. Small-Signal Modeling of the PVR-Based AD Scheme and Controller Design for Three-Phase Standalone DG System

    DEFF Research Database (Denmark)

    Shen, Pan; Han, Yang; Lu, Chang

    2016-01-01

    This paper presents the small-signal state-space modeling and a new multifunctional multi-loop control strategy for three-phase inverter-based islanded DG systems under unbalanced and/or nonlinear load conditions. The proposed control methodology utilizes the parallel virtual resistance (PVR...... controllers are based on an enhanced proportional resonant (PR) structure to achieve zero steady-state error, and multi-resonant harmonic compensator (MRHC) plus PR controller to prevent low-order load current harmonics to distort the output voltage. The proposed small-signal model of the islanded DG system...... with multi-loop control strategy in the stationary reference frame is presented. Moreover, an enhanced delay compensation (EDC) scheme based on two integrators of the discrete PR controller is presented to improve stability margins with a higher accuracy compared with the existing methods. Then, a detailed...

  1. Drug: D04237 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ic agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetics ... DG01...994 ... Halogenated hydrocarbons ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetics ... DG01994

  2. Design-order, non-conformal low-Mach fluid algorithms using a hybrid CVFEM/DG approach

    Science.gov (United States)

    Domino, Stefan P.

    2018-04-01

    A hybrid, design-order sliding mesh algorithm, which uses a control volume finite element method (CVFEM), in conjunction with a discontinuous Galerkin (DG) approach at non-conformal interfaces, is outlined in the context of a low-Mach fluid dynamics equation set. This novel hybrid DG approach is also demonstrated to be compatible with a classic edge-based vertex centered (EBVC) scheme. For the CVFEM, element polynomial, P, promotion is used to extend the low-order P = 1 CVFEM method to higher-order, i.e., P = 2. An equal-order low-Mach pressure-stabilized methodology, with emphasis on the non-conformal interface boundary condition, is presented. A fully implicit matrix solver approach that accounts for the full stencil connectivity across the non-conformal interface is employed. A complete suite of formal verification studies using the method of manufactured solutions (MMS) is performed to verify the order of accuracy of the underlying methodology. The chosen suite of analytical verification cases range from a simple steady diffusion system to a traveling viscous vortex across mixed-order non-conformal interfaces. Results from all verification studies demonstrate either second- or third-order spatial accuracy and, for transient solutions, second-order temporal accuracy. Significant accuracy gains in manufactured solution error norms are noted even with modest promotion of the underlying polynomial order. The paper also demonstrates the CVFEM/DG methodology on two production-like simulation cases that include an inner block subjected to solid rotation, i.e., each of the simulations include a sliding mesh, non-conformal interface. The first production case presented is a turbulent flow past a high-rate-of-rotation cube (Re, 4000; RPM, 3600) on like and mixed-order polynomial interfaces. The final simulation case is a full-scale Vestas V27 225 kW wind turbine (tower and nacelle omitted) in which a hybrid topology, low-order mesh is used. Both production simulations

  3. Drug: D03046 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available arasid (TN) ... C27H49N3O8P. Na. H2O D03046.gif ... Antineoplastic ... DG01958 ... Nucleic acid derivative, antineoplastic... ... DG01439 ... Arabinofuranosyl type antineoplastic ... DG01439 ... Arabinofuranosyl type antineoplastic Unclassi...fied ... DG02018 ... Antimetabolite ... DG01958 ... Nucleic acid derivative, antineoplastic ... ... DG01439 ... Arabinofuranosyl type antineoplastic Therapeutic category: 4224 ATC code: L01BC01 Chemical group

  4. Turbulent mixing layers in supersonic protostellar outflows, with application to DG Tauri

    Science.gov (United States)

    White, M. C.; Bicknell, G. V.; Sutherland, R. S.; Salmeron, R.; McGregor, P. J.

    2016-01-01

    Turbulent entrainment processes may play an important role in the outflows from young stellar objects at all stages of their evolution. In particular, lateral entrainment of ambient material by high-velocity, well-collimated protostellar jets may be the cause of the multiple emission-line velocity components observed in the microjet-scale outflows driven by classical T Tauri stars. Intermediate-velocity outflow components may be emitted by a turbulent, shock-excited mixing layer along the boundaries of the jet. We present a formalism for describing such a mixing layer based on Reynolds decomposition of quantities measuring fundamental properties of the gas. In this model, the molecular wind from large disc radii provides a continual supply of material for entrainment. We calculate the total stress profile in the mixing layer, which allows us to estimate the dissipation of turbulent energy, and hence the luminosity of the layer. We utilize MAPPINGS IV shock models to determine the fraction of total emission that occurs in [Fe II] 1.644 μm line emission in order to facilitate comparison to previous observations of the young stellar object DG Tauri. Our model accurately estimates the luminosity and changes in mass outflow rate of the intermediate-velocity component of the DG Tau approaching outflow. Therefore, we propose that this component represents a turbulent mixing layer surrounding the well-collimated jet in this object. Finally, we compare and contrast our model to previous work in the field.

  5. Drug: D01772 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetics ... DG02027 ... General anesthetics... ... DG02028 ... Inhalational anaesthetics Same as: C13240 ATC code: N01AA01 ... Enzyme: CYP2E... D01772 Drug Ether (JP17/USP); Diethyl ether ... C4H10O D01772.gif ... Neuropsychiatric

  6. Investigation of the Aerodynamic Performance of a DG808s UAS in Propeller Slipstream Using Computational Fluid Dynamics

    Science.gov (United States)

    Chandra, Yatish

    Unmanned Aerial Systems (UASs) are relatively affordable and immediately available compared to commercial aircraft. Hence, their aerodynamics and design accuracies are often based on extrapolating from design standards and procedures widely used in the aerospace industry for commercial aircraft with most often, acceptable results. Engineering level software such as Advanced Aircraft Analysis (AAA) use general aviation aircraft data and later extrapolate them onto UASs for aerodynamic and flight dynamics modeling but are limited by their platform repository and relatively high Reynolds number evaluations. UASs however, are aircraft which fly at comparatively low speeds and low Reynolds number with close proximities between the components wherein such standards may not hold good. This thesis focuses on evaluating the accuracy and impact of such industry standards on the aerodynamics and flight dynamics of UASs. A DG808s UAS is chosen for the study which was previously modeled using the AAA software at The University of Kansas by the Flight Systems Team. Using the STAR-CCM+ code, performance data were compared and assessed with AAA. Aerodynamic simulations were carried out for two different configurations viz., aircraft with and without propeller slipstream effects. Data obtained for the non-powered simulations were found to be in good agreement with the AAA model. For the powered flight however, discrepancies between the AAA model and CFD data were observed with large values for the vertical tail side-force coefficient. A comparison with the system identification data from the flight tests was made to confirm and validate this vertical tail behavior with the help of rudder deflection inputs. A relationship between the propeller RPM and the aerodynamic model was established by simulating two different propeller speeds. Based on the STAR-CCM+ data and the resulting comparisons with AAA, updates necessary to the UAS aerodynamic and flight dynamics models currently used

  7. Simultaneous analysis of FDG, ClDG and Kryptofix 2.2.2 in [18F]FDG preparation by high-performance liquid chromatography with UV detection

    International Nuclear Information System (INIS)

    Nakao, Ryuji; Ito, Takehito; Yamaguchi, Masatoshi; Suzuki, Kazutoshi

    2008-01-01

    A practical, sensitive and rapid analytical method was established and validated for chemical impurity tests of 2-deoxy-2-fluoro-D-glucose (FDG), 2-deoxy-2-chloro-D-glucose (ClDG) and Kryptofix 2.2.2 (K-222) in [ 18 F]FDG. This method was based on precolumn derivatization with ultraviolet (UV) detection. FDG and ClDG were rapidly derivatized with 1-phenyl-3-methyl-5-pyrazolone in the presence of borate buffer at 40 o C, and the labeled derivatives and K-222 were separated by reversed-phase high-performance liquid chromatography and monitored by UV absorbance at 210 nm. After optimization of the conditions, FDG, ClDG and K-222 could be determined within 15 min and showed good performance in terms of sensitivity, linearity and reproducibility. This method could be successfully applied to the quality control test of [ 18 F]FDG produced by a commercially available apparatus

  8. A word from the DG : Training tomorrow’s scientists


    CERN Multimedia

    2007-01-01

    Research and discovery are CERN’s primary missions, but education and outreach come a close second. Sharing the results of our research and discovery is enshrined in CERN’s convention and is something that CERN has always taken seriously. Right from the start, this Organization has had an active public information office. Today, our educational activities span the full range from informal visits for some 26000 members of the public each year to formal schools for professional physicists, accelerator scientists and IT specialists, and a day never goes by without members of the international media on–site. The 2007 Summer Student Programme has just come to an end, so it is now an opportune moment to speak of the impact of CERN’s educational programmes. This year we welcomed perhaps the most diverse group of summer students we’ve ever had the privilege to work with. Some 200 young people from 53 countries found places in all corners of the Laboratory, a veritable mi...

  9. Market and regulatory incentives for cost efficient integration of DG in the electricity system. IMPROGRES project final report

    Energy Technology Data Exchange (ETDEWEB)

    Nieuwenhout, F.D.J.; Jansen, J.C.; Van der Welle, A.J. [ECN Policy Studies, Petten (Netherlands); Olmos, L.; Cossent, R.; Gomez, T. [Universidad Pontificia Comillas, Madrid (Spain); Poot, J.; Bongaerts, M. [Liander, Duiven (Netherlands); Trebolle, D. [Union Fenosa Distribucion, Madrid (Spain); Doersam, B. [MVV Energie, Mannheim (Germany); Bofinger, S.; Gerhardt, N. [Fraunhofer Institute for Wind Energy and Energy System Technology, IWES, Bremerhaven (Germany); Jacobsen, H.; Ropenus, S.; Schroeder, S. [Risoe National Laboratory for Sustainable Energy, Technical University of Denmark DTU, Roskilde (Denmark); Auer, H.; Weissensteiner, L.; Prueggler, W.; Obersteiner, C.; Zach, K. [Energy Economics Group EEG, Vienna University of Technology, Vienna (Austria)

    2010-05-15

    Achieving the European target of 20% reduction of greenhouse gases in 2020 relies for a major part on increasing the share of renewable electricity generation, and more efficient fossil fuel based generation in combined heat and power installations. Most of these renewable and CHP generators are smaller in size than conventional power plants and are therefore usually connected to distribution grids instead of transmission grids. Different support schemes for renewable energy sources (RES) have been successfully implemented and have resulted in a rapid growth of distributed generation (DG). IMPROGRES scenario analysis shows that the installed capacity of DG in the EU-25 is expected to increase from 201 GW in 2008 to about 317 GW in 2020. A large part of this increase will be made up of more variable and less controllable renewable energy sources like wind and photovoltaics.

  10. Market and regulatory incentives for cost efficient integration of DG in the electricity system. IMPROGRES project final report

    International Nuclear Information System (INIS)

    Nieuwenhout, F.D.J.; Jansen, J.C.; Van der Welle, A.J.; Olmos, L.; Cossent, R.; Gomez, T.; Poot, J.; Bongaerts, M.; Trebolle, D.; Doersam, B.; Bofinger, S.; Gerhardt, N.; Jacobsen, H.; Ropenus, S.; Schroeder, S.; Auer, H.; Weissensteiner, L.; Prueggler, W.; Obersteiner, C.; Zach, K.

    2010-05-01

    Achieving the European target of 20% reduction of greenhouse gases in 2020 relies for a major part on increasing the share of renewable electricity generation, and more efficient fossil fuel based generation in combined heat and power installations. Most of these renewable and CHP generators are smaller in size than conventional power plants and are therefore usually connected to distribution grids instead of transmission grids. Different support schemes for renewable energy sources (RES) have been successfully implemented and have resulted in a rapid growth of distributed generation (DG). IMPROGRES scenario analysis shows that the installed capacity of DG in the EU-25 is expected to increase from 201 GW in 2008 to about 317 GW in 2020. A large part of this increase will be made up of more variable and less controllable renewable energy sources like wind and photovoltaics.

  11. A new approach for optimum DG placement and sizing based on voltage stability maximization and minimization of power losses

    International Nuclear Information System (INIS)

    Aman, M.M.; Jasmon, G.B.; Bakar, A.H.A.; Mokhlis, H.

    2013-01-01

    Highlights: • A new algorithm is proposed for optimum DG placement and sizing.• I 2 R losses minimization and voltage stability maximization is considered in fitness function.• Bus voltage stability and line stability is considered in voltage stability maximization.• Multi-objective PSO is used to solve the problem.• Proposed method is compared with analytical and grid search algorithm. - Abstract: Distributed Generation (DG) placement on the basis of minimization of losses and maximization of system voltage stability are two different approaches, discussed in research. In the new proposed algorithm, a multi-objective approach is used to combine the both approaches together. Minimization of power losses and maximization of voltage stability due to finding weakest voltage bus as well as due to weakest link in the system are considered in the fitness function. Particle Swarm Optimization (PSO) algorithm is used in this paper to solve the multi-objective problem. This paper will also compare the propose method with existing DG placement methods. From results, the proposed method is found more advantageous than the previous work in terms of voltage profile improvement, maximization of system loadability, reduction in power system losses and maximization of bus and line voltage stability. The results are validated on 12-bus, 30-bus, 33-bus and 69-bus radial distribution networks and also discussed in detailed

  12. Normalized glandular dose (DgN) coefficients for flat-panel CT breast imaging

    International Nuclear Information System (INIS)

    Thacker, Samta C; Glick, Stephen J

    2004-01-01

    The development of new digital mammography techniques such as dual-energy imaging, tomosynthesis and CT breast imaging will require investigation of optimal camera design parameters and optimal imaging acquisition parameters. In optimizing these acquisition protocols and imaging systems it is important to have knowledge of the radiation dose to the breast. This study presents a methodology for estimating the normalized glandular dose to the uncompressed breast using the geometry proposed for flat-panel CT breast imaging. The simulation uses the GEANT 3 Monte Carlo code to model x-ray transport and absorption within the breast phantom. The Monte Carlo software was validated for breast dosimetry by comparing results of the normalized glandular dose (DgN) values of the compressed breast to those reported in the literature. The normalized glandular dose was then estimated for a range of breast diameters from 10 cm to 18 cm using an uncompressed breast model with a homogeneous composition of adipose and glandular tissue, and for monoenergetic x-rays from 10 keV to 120 keV. These data were fit providing expressions for the normalized glandular dose. Using these expressions for the DgN coefficients and input variables such as the diameter, height and composition of the breast phantom, the mean glandular dose for any spectra can be estimated. A computer program to provide normalized glandular dose values has been made available online. In addition, figures displaying energy deposition maps are presented to better understand the spatial distribution of dose in CT breast imaging

  13. Mapping analysis of scaffold/matrix attachment regions (s/MARs) from two different mammalian cell lines

    Energy Technology Data Exchange (ETDEWEB)

    Pilus, Nur Shazwani Mohd; Ahmad, Azrin; Yusof, Nurul Yuziana Mohd [School of Bioscience and Biotechnology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Johari, Norazfa [Department of Chemical and Process Engineering, Faculty of Engineering and Built Environment, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

    2014-09-03

    Scaffold/matrix attachment regions (S/MARs) are potential element that can be integrated into expression vector to increase expression of recombinant protein. Many studies on S/MAR have been done but none has revealed the distribution of S/MAR in a genome. In this study, we have isolated S/MAR sequences from HEK293 and Chinese hamster ovary cell lines (CHO DG44) using two different methods utilizing 2 M NaCl and lithium-3,5-diiodosalicylate (LIS). The isolated S/MARs were sequenced using Next Generation Sequencing (NGS) platform. Based on reference mapping analysis against human genome database, a total of 8,994,856 and 8,412,672 contigs of S/MAR sequences were retrieved from 2M NaCl and LIS extraction of HEK293 respectively. On the other hand, reference mapping analysis of S/MAR derived from CHO DG44 against our own CHO DG44 database have generated a total of 7,204,348 and 4,672,913 contigs from 2 M NaCl and LIS extraction method respectively.

  14. Mapping analysis of scaffold/matrix attachment regions (s/MARs) from two different mammalian cell lines

    International Nuclear Information System (INIS)

    Pilus, Nur Shazwani Mohd; Ahmad, Azrin; Yusof, Nurul Yuziana Mohd; Johari, Norazfa

    2014-01-01

    Scaffold/matrix attachment regions (S/MARs) are potential element that can be integrated into expression vector to increase expression of recombinant protein. Many studies on S/MAR have been done but none has revealed the distribution of S/MAR in a genome. In this study, we have isolated S/MAR sequences from HEK293 and Chinese hamster ovary cell lines (CHO DG44) using two different methods utilizing 2 M NaCl and lithium-3,5-diiodosalicylate (LIS). The isolated S/MARs were sequenced using Next Generation Sequencing (NGS) platform. Based on reference mapping analysis against human genome database, a total of 8,994,856 and 8,412,672 contigs of S/MAR sequences were retrieved from 2M NaCl and LIS extraction of HEK293 respectively. On the other hand, reference mapping analysis of S/MAR derived from CHO DG44 against our own CHO DG44 database have generated a total of 7,204,348 and 4,672,913 contigs from 2 M NaCl and LIS extraction method respectively

  15. Drug: D02942 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 2.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics... ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ATC code: N01AH05 Chemical group: DG0079

  16. Power dithering algorithm to avoid the overcoming of the voltage limit in presence of DG on distribution networks

    Energy Technology Data Exchange (ETDEWEB)

    Calderaro, V.; Coppola, V.; Galdi, V.; Piccolo, A. [Salerno Univ., Fisciano (Italy). Dept. of Information System Engineering and Electrical Engineering

    2008-07-01

    A new model of power distribution system has emerged in recent years in response to new generation technologies involving mini- and micro-generators that can be directly connected to medium voltage (MV) or low voltage (LV) power grids. The locations of these dispersed generators (DGs) are typically based on the availability of primary energy resources or on the specific needs of users. The increasing use of DGs causes new problems in terms of distribution network management and planning, with effect on the power quality, voltage profile or protection aspects. One of the problems arising on MV/LV distribution network, especially in weak rural areas, is related to the bus overvoltage at the point of common coupling (PCC). Therefore, this study proposed an approach to power control of the single generator that maximizes the active power injected on the network by DG, avoiding the trip of the minimum and maximum voltage protection installed at the PCC. Overvoltage typically occurs due to the injection of a large amount of power from unschedulable DG and a small power demand by the loads. This can trip overvoltage protection relays of DGs, and disconnect them from the grid. The local control strategy for DG systems proposed in this paper was based on the dithering algorithm. The proposed solution, operating on the electronic interface of the power generator, introduces or absorbs reactive power if the voltage at PCC is close to the limits, thus increasing the total active power injected by renewable sources. 17 refs., 3 tabs., 12 figs.

  17. Drug: D02991 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic ... DG01675 ... Local anesthetic... ... DG01673 ... Amide type local anesthetic ATC code: N01BB08 Chemical group: DG00805 ...

  18. Drug: D00737 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic... ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic ATC code: N01BB07 Chemical group: DG0

  19. DOMAIN DECOMPOSITION FOR POROELASTICITY AND ELASTICITY WITH DG JUMPS AND MORTARS

    KAUST Repository

    GIRAULT, V.

    2011-01-01

    We couple a time-dependent poroelastic model in a region with an elastic model in adjacent regions. We discretize each model independently on non-matching grids and we realize a domain decomposition on the interface between the regions by introducing DG jumps and mortars. The unknowns are condensed on the interface, so that at each time step, the computation in each subdomain can be performed in parallel. In addition, by extrapolating the displacement, we present an algorithm where the computations of the pressure and displacement are decoupled. We show that the matrix of the interface problem is positive definite and establish error estimates for this scheme. © 2011 World Scientific Publishing Company.

  20. How Y-Family DNA polymerase IV is more accurate than Dpo4 at dCTP insertion opposite an N2-dG adduct of benzo[a]pyrene.

    Science.gov (United States)

    Sholder, Gabriel; Creech, Amanda; Loechler, Edward L

    2015-11-01

    To bypass DNA damage, cells have Y-Family DNA polymerases (DNAPs). One Y-Family-class includes DNAP κ and DNAP IV, which accurately insert dCTP opposite N(2)-dG adducts, including from the carcinogen benzo[a]pyrene (BP). Another class includes DNAP η and DNAP V, which insert accurately opposite UV-damage, but inaccurately opposite BP-N(2)-dG. To investigate structural differences between Y-Family-classes, regions are swapped between DNAP IV (a κ/IV-class-member) and Dpo4 (a η/V-class-member); the kinetic consequences are evaluated via primer-extension studies with a BP-N(2)-dG-containing template. Four key structural elements are revealed. (1) Y-Family DNAPs have discreet non-covalent contacts between their little finger-domain (LF-Domain) and their catalytic core-domain (CC-Domain), which we call "non-covalent bridges" (NCBs). Arg37 and Arg38 in DNAP IV's CC-Domain near the active site form a non-covalent bridge (AS-NCB) by interacting with Glu251 and Asp252, respectively, in DNAP IV's LF-Domain. Without these interactions dATP/dGTP/dTTP misinsertions increase. DNAP IV's AS-NCB suppresses misinsertions better than Dpo4's equivalent AS-NCB. (2) DNAP IV also suppresses dATP/dGTP/dTTP misinsertions via a second non-covalent bridge, which is ∼8Å from the active site (Distal-NCB). Dpo4 has no Distal-NCB, rendering it inferior at dATP/dGTP/dTTP suppression. (3) dCTP insertion is facilitated by the larger minor groove opening near the active site in DNAP IV versus Dpo4, which is sensible given that Watson/Crick-like [dCTP:BP-N(2)-dG] pairing requires the BP-moiety to be in the minor groove. (4) Compared to Dpo4, DNAP IV has a smaller major groove opening, which suppresses dGTP misinsertion, implying BP-N(2)-dG bulk in the major groove during Hoogsteen syn-adduct-dG:dGTP pairing. In summary, DNAP IV has a large minor groove opening to enhance dCTP insertion, a plugged major groove opening to suppress dGTP misinsertion, and two non-covalent bridges (near and distal

  1. Genetic Diversity and Protective Efficacy of the RTS,S/AS01 Malaria Vaccine

    DEFF Research Database (Denmark)

    Neafsey, Daniel E; Juraska, Michal; Bedford, Trevor

    2015-01-01

    Background The RTS,S/AS01 vaccine targets the circumsporozoite protein of Plasmodium falciparum and has partial protective efficacy against clinical and severe malaria disease in infants and children. We investigated whether the vaccine efficacy was specific to certain parasite genotypes at the c......Background The RTS,S/AS01 vaccine targets the circumsporozoite protein of Plasmodium falciparum and has partial protective efficacy against clinical and severe malaria disease in infants and children. We investigated whether the vaccine efficacy was specific to certain parasite genotypes...... protein had on vaccine efficacy against first episodes of clinical malaria within 1 year after vaccination. Results In the per-protocol group of 4577 RTS,S/AS01-vaccinated participants and 2335 control-vaccinated participants who were 5 to 17 months of age, the 1-year cumulative vaccine efficacy was 50.......3% (95% confidence interval [CI], 34.6 to 62.3) against clinical malaria in which parasites matched the vaccine in the entire circumsporozoite protein C-terminal (139 infections), as compared with 33.4% (95% CI, 29.3 to 37.2) against mismatched malaria (1951 infections) (P=0.04 for differential vaccine...

  2. 27 February 2012 - Director of the Health Directorate at the Research DG European Commission R. Draghia-Akli in the ATLAS visitor centre with ATLAS Former Collaboration Spokesperson P. Jenni and Head of CERN EU Projects Office S. Stavrev; in the LHC superconducting magnet test hall with E. Todesco; and signing the guest book with CERN Director-General R. Heuer.

    CERN Multimedia

    Michel Blanc

    2012-01-01

    27 February 2012 - Director of the Health Directorate at the Research DG European Commission R. Draghia-Akli in the ATLAS visitor centre with ATLAS Former Collaboration Spokesperson P. Jenni and Head of CERN EU Projects Office S. Stavrev; in the LHC superconducting magnet test hall with E. Todesco; and signing the guest book with CERN Director-General R. Heuer.

  3. Drug: D00732 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D00732.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01674 ... Esterified local anesthetic... ... DG01675 ... Local anesthetic ... DG01674 ... Esterified local anesthetic ATC code: N01BA04 Chemi

  4. Nodal DG-FEM solution of high-order Boussinesq-type equations

    DEFF Research Database (Denmark)

    Engsig-Karup, Allan Peter; Hesthaven, Jan S.; Bingham, Harry B.

    2006-01-01

    We present a discontinuous Galerkin finite element method (DG-FEM) solution to a set of high-order Boussinesq-type equations for modelling highly nonlinear and dispersive water waves in one and two horizontal dimensions. The continuous equations are discretized using nodal polynomial basis...... functions of arbitrary order in space on each element of an unstructured computational domain. A fourth order explicit Runge-Kutta scheme is used to advance the solution in time. Methods for introducing artificial damping to control mild nonlinear instabilities are also discussed. The accuracy...... and convergence of the model with both h (grid size) and p (order) refinement are verified for the linearized equations, and calculations are provided for two nonlinear test cases in one horizontal dimension: harmonic generation over a submerged bar; and reflection of a steep solitary wave from a vertical wall...

  5. First results of phase 3 trial of RTS,S/AS01 malaria vaccine in African children

    DEFF Research Database (Denmark)

    Agnandji, Selidji Todagbe; Lell, Bertrand; Soulanoudjingar, Solange Solmeheim

    2011-01-01

    An ongoing phase 3 study of the efficacy, safety, and immunogenicity of candidate malaria vaccine RTS,S/AS01 is being conducted in seven African countries.......An ongoing phase 3 study of the efficacy, safety, and immunogenicity of candidate malaria vaccine RTS,S/AS01 is being conducted in seven African countries....

  6. Randomized controlled trial of RTS,S/AS02D and RTS,S/AS01E malaria candidate vaccines given according to different schedules in Ghanaian children.

    Directory of Open Access Journals (Sweden)

    Seth Owusu-Agyei

    2009-10-01

    Full Text Available The target delivery channel of RTS,S candidate malaria vaccines in malaria-endemic countries in Africa is the World Health Organisation Expanded Program on Immunization. As an Adjuvant System, age de-escalation and schedule selection step, this study assessed 3 schedules of RTS,S/AS01(E and RTS,S/AS02(D in infants and young children 5-17 months of age in Ghana.A Phase II, partially-blind randomized controlled study (blind to vaccine, not to schedule, of 19 months duration was conducted in two (2 centres in Ghana between August 2006 and May 2008. Subjects were allocated randomly (1:1:1:1:1:1 to one of six study groups at each study site, each defining which vaccine should be given and by which schedule (0,1-, 0,1,2- or 0,1,7-months. For the 0,1,2-month schedule participants received RTS,S/AS01(E or rabies vaccine at one center and RTS,S/AS01(E or RTS,S/AS02(D at the other. For the other schedules at both study sites, they received RTS,S/AS01(E or RTS,S/AS02(D. The primary outcome measure was the occurrence of serious adverse events until 10 months post dose 1.The number of serious adverse events reported across groups was balanced. One child had a simple febrile convulsion, which evolved favourably without sequelae, considered to be related to RTS,S/AS01(E vaccination. Low grade reactions occurred slightly more frequently in recipients of RTS,S/AS than rabies vaccines; grade 3 reactions were infrequent. Less local reactogenicity occurred with RTS,S/AS01(E than RTS,S/AS02(D. Both candidate vaccines were highly immunogenic for anti-circumsporozoite and anti-Hepatitis B Virus surface antigen antibodies. Recipients of RTS,S/AS01(E compared to RTS,S/AS02(D had higher peak anti-circumsporozoite antibody responses for all 3 schedules. Three dose schedules were more immunogenic than 2 dose schedules. Area under the curve analyses for anti-circumsporozoite antibodies were comparable between the 0,1,2- and 0,1,7-month RTS,S/AS01(E schedules.Both candidate

  7. Experiment data report for semiscale Mod-1 test S-01-1B (isothermal blowdown with core resistance simulator)

    International Nuclear Information System (INIS)

    Crapo, H.S.; Jensen, M.F.; Sackett, K.E.; Zender, S.N.

    1975-05-01

    Recorded test data are presented for Test S-01-1B of the semiscale Mod-1 isothermal blowdown test series. System hardware is representative of the LOFT design, selected using volumetric scaling methods, and initial conditions duplicate those identified for the LOFT nonnuclear tests. Test S-01-1B is a repeat of Test S-01-1 with the exception that simulated ECC was injected into the cold leg of the intact loop rather than into the inlet annulus of the downcomer. The principal objective of Test S-01-1B was to determine whether a different ECC injection would significantly alter the system response during the period of ECC injection. Test S-01-1B was conducted from an initial temperature of 541 0 F and an initial pressure of 1630 psig. A simulated intermediate size double-ended hot leg break (0.00145 ft 2 break area on each end) was used to investigate the system response to a slow de-pressurization transient. An orificed structure was used in the pressure vessel to simulate the LOFT core simulator. Following the blowdown portion of Test S-01-1B, coolant spray was introduced into the pressure suppression tank to determine the response of the pressure suppression system. (U.S.)

  8. Drug: D03841 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 02], Oxygen [DR:D00003] ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... ...DG02028 ... Inhalational anaesthetics ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetics ATC code: N01AX63 ... PubChem: 17397927 ...

  9. Drug: D00741 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 5H24N2O2. HCl D00741.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01...674 ... Esterified local anesthetic ... DG01675 ... Local anesthetic ... DG01674 ... Esterified local anesthetic Therapeut

  10. Drug: D08251 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D08251 Drug Nandrolone laurate; Nandrolone dodecanoate; Laurabolin [veterinary] (T...14AB01 S01XA11 Chemical group: DG00142 ... Estren derivative veterinary medicine NR3C4 (AR) [HSA:367] [KO:K085

  11. Drug: D08181 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01673 ... Amide type local anesthetic ... DG01675 ... Local anesthe...tic ... DG01673 ... Amide type local anesthetic Same as: C07528 ATC code: N01BB03 Chemic

  12. Drug: D08422 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available uropsychiatric agent ... DG02030 ... Anesthetics ... DG01675 ... Local anesthetic ... DG01674 ... Esterified local anesthetic ... DG01675 ... Local anesth...etic ... DG01674 ... Esterified local anesthetic Same as: C07375 ATC code: C05AD05 N01BA

  13. Experiment data report for semiscale MOD-1 test S-01-3 (isothermal blowdown with core resistance simulator)

    International Nuclear Information System (INIS)

    Zender, S.N.

    1975-03-01

    Recorded test data are presented for Test S-01-3 of the semiscale Mod-1 isothermal blowdown test series. Test S-01-3 is one of several semiscale Mod-1 experiments which are counterparts of the planned Loss-of-Fluid Test (LOFT) nonnuclear experiments. System hardware is of the LOFT design, selected using volumetric scaling methods, and initial conditions duplicate those identified for the LOFT nonnuclear tests. Test S-01-3 employed an intact loop resistance that was low relative to that of the first test in the series (Test S-01-2) to establish the importance of intact loop resistance on system response during blowdown. An orificed structure was used in the pressure vessel to simulate the LOFT core simulator. The test was initiated at isothermal conditions of 2245 psig and 538 0 F by a simulated offset shear of the cold-leg broken loop piping. During system depressurization, coolant was injected into the lower plenum of the pressure vessel to provide data on the effects of emergency core cooling on system response. Additionally, to aid in determination of the effects of accumulator gas on pressure suppression system response, the nitrogen used to charge the accumulator systems for Test S-01-3 was allowed to vent into the lower plenum following depletion of the coolant. (U.S.)

  14. Drug: D02611 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D02611 Drug Phenoperidine (INN) ... C23H29NO3 D02611.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetics... ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ... DG02027 ... General anesthetics... ... DG02026 ... Opioid anesthetics Analgesic ... DG01984 ... Opioid analgesics ATC code: N01AH04 ... Phenylpiperidine

  15. Drug: D02941 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D02941 Drug Anileridine (USP/INN) ... C22H28N2O2 D02941.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetics... ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ... DG02027 ... General anesthetics... ... DG02026 ... Opioid anesthetics ATC code: N01AH05 Chemical group: DG00794 ... Phenylpiperidine derivative

  16. Adding distiller's grains and molasses on fermentation quality of rice straw silages

    Directory of Open Access Journals (Sweden)

    XianJun Yuan

    Full Text Available ABSTRACT: Ensilage is a simple and low-cost strategy to enable long term preservation and environmentally friendly utilization of agricultural by-products, such as straws and distiller's grains (DG for ruminants. Effect of mixing different proportions of DG and rice straw (i.e. 0, 10, 20 or 30% of DG with or without 5% molasses addition on fermentation and chemical variables of silages was evaluated. The study was conducted as a randomized blocks design in a 4 × 2 factorial arrangement, with three replications, using laboratory silos of 1L capacity (n=24. Despite a significant interaction (P<0.01 between DG and molasses addition was observed for most variables, in general the increased addition of DG linearly decreased the pH value, acetic acid (AA, butyric acid (BA and ammonia N concentration (P<0.01, and increased the lactic acid (LA concentration (P<0.01. Exception was the propionic acid concentration which linearly decreased without molasses addition and linearly increased with molasses addition at increased proportion of DG (P<0.01. In both silages with or without molasses the addition of DG increased the dry matter, water soluble carbohydrates and crude protein (P<0.01, and decreased the NDF content (P<0.01. Based on the perspective of maximum utilization of rice straw, the mixture of 10% of DG associated to 5% molasses at ensilage process is recommended.

  17. Efficacy of RTS,S/AS01E vaccine against malaria in children 5 to 17 months of age

    DEFF Research Database (Denmark)

    Bejon, Philip; Lusingu, John; Olotu, Ally

    2008-01-01

    . We evaluated the efficacy of RTS,S given with a more immunogenic adjuvant system (AS01E) in children 5 to 17 months of age, a target population for vaccine licensure. METHODS: We conducted a double-blind, randomized trial of RTS,S/AS01E vaccine as compared with rabies vaccine in children in Kilifi...... vaccine or the control (rabies) vaccine. Among the 809 children who completed the study procedures according to the protocol, the cumulative number in whom clinical malaria developed was 32 of 402 assigned to receive RTS,S/AS01E and 66 of 407 assigned to receive the rabies vaccine; the adjusted efficacy...... rate for RTS,S/AS01E was 53% (95% confidence interval [CI], 28 to 69; Prabies vaccine, with an adjusted rate of efficacy...

  18. Drug: D00785 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available .gif ... Neuropsychiatric agent ... DG01568 ... MAO inhibitor ... DG01512 ... Monoamine oxidase B inhibitor ... DG01967 ... Antiparkinson...169 ATC code: N04BD01 Chemical group: DG00864 ... Antiparkinsonian in combination w

  19. 1.01-Pb/s (12 SDM/222 WDM/456 Gb/s) Crosstalk-managed Transmission with 91.4-b/s/Hz Aggregate Spectral Efficiency

    DEFF Research Database (Denmark)

    Takara, H.; Sano, A.; Kobayashi, T.

    2012-01-01

    We demonstrate 1.01-Pb/s transmission over 52 km with the highest aggregate spectral efficiency of 91.4 b/s/Hz by using low-crosstalk one-ring-structured 12-core fiber. Our multi-core fiber and compact fan-in/fan-out devices are designed to support high-order modulation formats up to 32-QAM in SD...

  20. Efficacy of RTS,S/AS01E Vaccine against Malaria in Children 5 to 17 Months of Age

    Science.gov (United States)

    Bejon, Philip; Lusingu, John; Olotu, Ally; Leach, Amanda; Lievens, Marc; Vekemans, Johan; Mshamu, Salum; Lang, Trudie; Gould, Jayne; Dubois, Marie-Claude; Demoitié, Marie-Ange; Stallaert, Jean-Francois; Vansadia, Preeti; Carter, Terrell; Njuguna, Patricia; Awuondo, Ken O.; Malabeja, Anangisye; Abdul, Omar; Gesase, Samwel; Mturi, Neema; Drakeley, Chris J.; Savarese, Barbara; Villafana, Tonya; Ballou, W. Ripley; Cohen, Joe; Riley, Eleanor M.; Lemnge, Martha M.; Marsh, Kevin; von Seidlein, Lorenz

    2009-01-01

    BACKGROUND Plasmodium falciparum malaria is a pressing global health problem. A previous study of the malaria vaccine RTS,S (which targets the circumsporozoite protein), given with an adjuvant system (AS02A), showed a 30% rate of protection against clinical malaria in children 1 to 4 years of age. We evaluated the efficacy of RTS,S given with a more immunogenic adjuvant system (AS01E) in children 5 to 17 months of age, a target population for vaccine licensure. METHODS We conducted a double-blind, randomized trial of RTS,S/AS01E vaccine as compared with rabies vaccine in children in Kilifi, Kenya, and Korogwe, Tanzania. The primary end point was fever with a falciparum parasitemia density of more than 2500 parasites per microliter, and the mean duration of follow-up was 7.9 months (range, 4.5 to 10.5). RESULTS A total of 894 children were randomly assigned to receive the RTS,S/AS01E vaccine or the control (rabies) vaccine. Among the 809 children who completed the study procedures according to the protocol, the cumulative number in whom clinical malaria developed was 32 of 402 assigned to receive RTS,S/AS01E and 66 of 407 assigned to receive the rabies vaccine; the adjusted efficacy rate for RTS,S/AS01E was 53% (95% confidence interval [CI], 28 to 69; P<0.001) on the basis of Cox regression. Overall, there were 38 episodes of clinical malaria among recipients of RTS,S/AS01E, as compared with 86 episodes among recipients of the rabies vaccine, with an adjusted rate of efficacy against all malarial episodes of 56% (95% CI, 31 to 72; P<0.001). All 894 children were included in the intention-to-treat analysis, which showed an unadjusted efficacy rate of 49% (95% CI, 26 to 65; P<0.001). There were fewer serious adverse events among recipients of RTS,S/AS01E, and this reduction was not only due to a difference in the number of admissions directly attributable to malaria. CONCLUSIONS RTS,S/AS01E shows promise as a candidate malaria vaccine. (ClinicalTrials.gov number, NCT

  1. Drug: D03731 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ric agent ... DG01568 ... MAO inhibitor ... DG01512 ... Monoamine oxidase B inhibitor ... DG01967 ... Antiparkinson agent Cyp... substrate ... DG01644 ... CYP2D6 substrate ... DG01633 ... CYP3A substrate Same as: C07245 ATC code: N04BD01 Chemical group: DG00864 ... Antiparki...nsonian in combination with levodopa/carbidopa MAOB [HSA

  2. Drug: D10222 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D10222 Drug Gemcitabine elaidate (USAN/INN) ... C27H43F2N3O5 D10222.gif ... Antineoplastic... ... DG01958 ... Nucleic acid derivative, antineoplastic ... DG01439 ... Arabinofuranosyl type antineoplastic ... DG01...439 ... Arabinofuranosyl type antineoplastic Unclassified ... DG02018 ... Antimetabolite ... DG01958 ... Nucleic acid derivative, antineoplastic... ... DG01439 ... Arabinofuranosyl type antineoplastic ATC code:

  3. Drug: D09722 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D09722 Drug Sapacitabine (USAN/INN) ... C26H42N4O5 D09722.gif ... Antineoplastic ... DG01...958 ... Nucleic acid derivative, antineoplastic ... DG01439 ... Arabinofuranosyl type antineoplastic ... DG01439 ... Arabi...nofuranosyl type antineoplastic Unclassified ... DG02018 ... Antimetabolite ... DG01958 ... Nucleic acid derivative, antineoplastic... ... DG01439 ... Arabinofuranosyl type antineoplastic ... nucleoside analo

  4. Analytical Modeling of Triple-Metal Hetero-Dielectric DG SON TFET

    Science.gov (United States)

    Mahajan, Aman; Dash, Dinesh Kumar; Banerjee, Pritha; Sarkar, Subir Kumar

    2018-02-01

    In this paper, a 2-D analytical model of triple-metal hetero-dielectric DG TFET is presented by combining the concepts of triple material gate engineering and hetero-dielectric engineering. Three metals with different work functions are used as both front- and back gate electrodes to modulate the barrier at source/channel and channel/drain interface. In addition to this, front gate dielectric consists of high-K HfO2 at source end and low-K SiO2 at drain side, whereas back gate dielectric is replaced by air to further improve the ON current of the device. Surface potential and electric field of the proposed device are formulated solving 2-D Poisson's equation and Young's approximation. Based on this electric field expression, tunneling current is obtained by using Kane's model. Several device parameters are varied to examine the behavior of the proposed device. The analytical model is validated with TCAD simulation results for proving the accuracy of our proposed model.

  5. TU-D-209-01: Dosimetry of Diagnostic Work Up Mammography

    Energy Technology Data Exchange (ETDEWEB)

    Jallow, N [Emory University, Atlanta, GA (United States); Sechopoulos, I [Radboud University Medical Centre, Nijmegen (Netherlands)

    2016-06-15

    Purpose: To investigate patient average glandular dose (AGD) characteristics of diagnostic mammography. Methods: The techniques used to image 14420 patients who received diagnostic work up mammography from October 2008 to December 2014 at one academic hospital were retrospectively collected. The most common diagnostic views and the techniques used for each according to compressed breast thickness were determined. For all techniques, 1st half value layer and air kerma output per tube current-exposure time product were measured; then the incident air kerma for each acquisition was calculated. The values for normalized glandular dose (DgN) were obtained with a validated Monte Carlo simulation of mammographic acquisition. The mono-energetic DgN results were combined according to relative fluence using the TASMICS model to obtain DgN coefficients for each spectrum. The spectral DgN and calculated incident air kerma were used to estimate AGD of patients with breast thickness ranging from 2 to 8 cm. Results: The most common views utilized during diagnostic mammography were magnification craniocaudal (24%), magnification mediolateral (19%), spot craniocaudal (28%), and spot mediolateral oblique (24%). The AGD increased with increasing breast thickness for both the magnification and spot views. The AGD for a 5.5 cm thick breast was approximately 6.8 mGy and 2.2 mGy for the magnification and spot views, respectively. The AGD ranged from 3.6 mGy to 6.8 mGy for the magnification views and from 1.0 mGy to 3.1 mGy for spot views. The difference in AGD between the two magnification views or the two spot views was not significant. Conclusion: These results provide information on breast dose to which screening recalled women are exposed to. In addition to understanding the dose used for common clinical imaging tests, this data could be used when comparing use of mammography for diagnostic workup to other potential modalities, such as breast tomosynthesis and breast CT.

  6. TU-D-209-01: Dosimetry of Diagnostic Work Up Mammography

    International Nuclear Information System (INIS)

    Jallow, N; Sechopoulos, I

    2016-01-01

    Purpose: To investigate patient average glandular dose (AGD) characteristics of diagnostic mammography. Methods: The techniques used to image 14420 patients who received diagnostic work up mammography from October 2008 to December 2014 at one academic hospital were retrospectively collected. The most common diagnostic views and the techniques used for each according to compressed breast thickness were determined. For all techniques, 1st half value layer and air kerma output per tube current-exposure time product were measured; then the incident air kerma for each acquisition was calculated. The values for normalized glandular dose (DgN) were obtained with a validated Monte Carlo simulation of mammographic acquisition. The mono-energetic DgN results were combined according to relative fluence using the TASMICS model to obtain DgN coefficients for each spectrum. The spectral DgN and calculated incident air kerma were used to estimate AGD of patients with breast thickness ranging from 2 to 8 cm. Results: The most common views utilized during diagnostic mammography were magnification craniocaudal (24%), magnification mediolateral (19%), spot craniocaudal (28%), and spot mediolateral oblique (24%). The AGD increased with increasing breast thickness for both the magnification and spot views. The AGD for a 5.5 cm thick breast was approximately 6.8 mGy and 2.2 mGy for the magnification and spot views, respectively. The AGD ranged from 3.6 mGy to 6.8 mGy for the magnification views and from 1.0 mGy to 3.1 mGy for spot views. The difference in AGD between the two magnification views or the two spot views was not significant. Conclusion: These results provide information on breast dose to which screening recalled women are exposed to. In addition to understanding the dose used for common clinical imaging tests, this data could be used when comparing use of mammography for diagnostic workup to other potential modalities, such as breast tomosynthesis and breast CT.

  7. DG-AMMOS: a new tool to generate 3d conformation of small molecules using distance geometry and automated molecular mechanics optimization for in silico screening.

    Science.gov (United States)

    Lagorce, David; Pencheva, Tania; Villoutreix, Bruno O; Miteva, Maria A

    2009-11-13

    Discovery of new bioactive molecules that could enter drug discovery programs or that could serve as chemical probes is a very complex and costly endeavor. Structure-based and ligand-based in silico screening approaches are nowadays extensively used to complement experimental screening approaches in order to increase the effectiveness of the process and facilitating the screening of thousands or millions of small molecules against a biomolecular target. Both in silico screening methods require as input a suitable chemical compound collection and most often the 3D structure of the small molecules has to be generated since compounds are usually delivered in 1D SMILES, CANSMILES or in 2D SDF formats. Here, we describe the new open source program DG-AMMOS which allows the generation of the 3D conformation of small molecules using Distance Geometry and their energy minimization via Automated Molecular Mechanics Optimization. The program is validated on the Astex dataset, the ChemBridge Diversity database and on a number of small molecules with known crystal structures extracted from the Cambridge Structural Database. A comparison with the free program Balloon and the well-known commercial program Omega generating the 3D of small molecules is carried out. The results show that the new free program DG-AMMOS is a very efficient 3D structure generator engine. DG-AMMOS provides fast, automated and reliable access to the generation of 3D conformation of small molecules and facilitates the preparation of a compound collection prior to high-throughput virtual screening computations. The validation of DG-AMMOS on several different datasets proves that generated structures are generally of equal quality or sometimes better than structures obtained by other tested methods.

  8. Drug: D01901 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D01901 Drug Xenon (JAN); Xenopure (TN) ... Xe D01901.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetics... ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetics ... DG02027 ... General anesthetics... ... DG02028 ... Inhalational anaesthetics Same as: C13373 Therapeutic category: 7290 ATC code: N01AX15

  9. Experiment data report for semiscale Mod-1 test S-01-1 (isothermal blowdown with core resistance simulator)

    International Nuclear Information System (INIS)

    Zender, S.N.; Crapo, H.S.; Jensen, M.F.; Sackett, K.E.

    1975-04-01

    Recorded test data are presented for Test S-01-1 of the semiscale Mod-1 isothermal blowdown test series. Test S-01-1 is one of several semiscale Mod-1 experiments which are counterparts of the planned Loss-of-Fluid Test (LOFT) nonnuclear experiments. System hardware is representative of the LOFT design, selected using volumetric scaling methods, and initial conditions duplicate those identified for the LOFT nonnuclear tests. Test S-01-1 was conducted from an initial temperature of 540 0 F and an initial pressure of 1596 psig. A simulated intermediate size double-ended hot leg break (0.00145 ft 2 break area on each end) was used to investigate the system response to a slow depressurization transient. An orificed structure was used in the pressure vessel to simulate the LOFT core simulator. During system depressurization, coolant was injected into the vessel downcomer inlet annulus to investigate the effectiveness of injection into the inlet annulus with respect to delivery of coolant to the lower plenum. Following the blowdown portion of Test S-01-1, coolant spray was introduced into the pressure suppression tank to determine the response of the pressure suppression system. The purpose of this report is to make available the uninterpreted data from Test S-01-1 for future data analysis and test results reporting activities. The data, presented in the form of graphs in engineering units, have been analyzed only to the extent necessary to assure that they are reasonable and consistent. (U.S.)

  10. Double-grid finite-difference frequency-domain (DG-FDFD) method for scattering from chiral objects

    CERN Document Server

    Alkan, Erdogan; Elsherbeni, Atef

    2013-01-01

    This book presents the application of the overlapping grids approach to solve chiral material problems using the FDFD method. Due to the two grids being used in the technique, we will name this method as Double-Grid Finite Difference Frequency-Domain (DG-FDFD) method. As a result of this new approach the electric and magnetic field components are defined at every node in the computation space. Thus, there is no need to perform averaging during the calculations as in the aforementioned FDFD technique [16]. We formulate general 3D frequency-domain numerical methods based on double-grid

  11. Two design of the S4.BEN01 magnet for the CBETA splitter/merger

    Energy Technology Data Exchange (ETDEWEB)

    Tsoupas, N. [Brookhaven National Lab. (BNL), Upton, NY (United States); Berg, S. [Brookhaven National Lab. (BNL), Upton, NY (United States); Meot, F. [Brookhaven National Lab. (BNL), Upton, NY (United States); Ptitsyn, V. [Brookhaven National Lab. (BNL), Upton, NY (United States); Trbojevic, D. [Brookhaven National Lab. (BNL), Upton, NY (United States); Tuozzolo, J. [Brookhaven National Lab. (BNL), Upton, NY (United States)

    2017-04-10

    The splitter/merger section of the CBETA project [1] consists of 4 beam lines as shown in Fig. 1. Two of the functions of the splitter’s/merger’s lines is to match the beam parameters at the exit of the Energy Recovery Linac (ERL) to the beam parameters at the entrance of the Fixed Field Alternating Gradient (FFAG) arc, and also place the reference particles of the beam bunches at the entrance of the FFAG arc on specified trajectories according to their energies. In this technical note we are presenting results from the 2D and 3D electromagnetic analysis of the S4.BEN01 magnet which is one of the dipole magnets of the 150 MeV line of the splitter/merger. In particular we present results from two designs of the S4.BEN01 magnet, one based on iron dominated current-excited magnet, and the other design based on Halbach-type permanent magnet. An evaluation of the two designs will be given in the section under “conclusion”.

  12. Drug: D02368 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D02368 Drug Gemcitabine (USAN/INN) ... C9H11F2N3O4 D02368.gif ... Antineoplastic ... DG01...958 ... Nucleic acid derivative, antineoplastic ... DG01439 ... Arabinofuranosyl type antineoplastic ... DG01439 ... Arabi...nofuranosyl type antineoplastic Unclassified ... DG02018 ... Antimetabolite ... DG01958 ... Nucleic acid derivative, antineoplastic... ... DG01439 ... Arabinofuranosyl type antineoplastic Same as: C07650 ATC

  13. Antibacterial activities of multi drug resistant Myroides odoratimimus bacteria isolated from adult flesh flies (Diptera: Sarcophagidae are independent of metallo beta-lactamase gene Atividades antibacterianas de Myroides odoratimimus isolada de moscas varejeiras adultas (Diptera: Sarcophagidae são independentes do gene metalo beta lactamase

    Directory of Open Access Journals (Sweden)

    M.S. Dharne

    2008-06-01

    Full Text Available Flesh flies (Diptera: Sarcophagidae are well known cause of myiasis and their gut bacteria have never been studied for antimicrobial activity against bacteria. Antimicrobial studies of Myroides spp. are restricted to nosocomial strains. A Gram-negative bacterium, Myroides sp., was isolated from the gut of adult flesh flies (Sarcophaga sp. and submitted to evaluation of nutritional parameters using Biolog GN, 16S rRNA gene sequencing, susceptibility to various antimicrobials by disc diffusion method and detection of metallo β-lactamase genes (TUS/MUS. The antagonistic effects were tested on Gram-negative and Gram-positive bacteria isolated from human clinical specimens, environmental samples and insect mid gut. Bacterial species included were Aeromonas hydrophila, A. culicicola, Morganella morganii subsp. sibonii, Ochrobactrum anthropi, Weissella confusa, Escherichia coli, Ochrobactrum sp., Serratia sp., Kestersia sp., Ignatzschineria sp., Bacillus sp. The Myroides sp. strain was resistant to penicillin-G, erythromycin, streptomycin, amikacin, kanamycin, gentamycin, ampicillin, trimethoprim and tobramycin. These strain showed antibacterial action against all bacterial strains except W. confusa, Ignatzschineria sp., A. hydrophila and M. morganii subsp. sibonii. The multidrug resistance of the strain was similar to the resistance of clinical isolates, inhibiting growth of bacteria from clinical, environmental and insect gut samples. The metallo β-lactamase (TUS/MUS genes were absent, and resistance due to these genes was ruled out, indicating involvement of other secretion machinery.Moscas varejeiras (Diptera: Sarcophagidae são causa conhecida de miíase e as bactérias de seus intestinos nunca foram estudadas quanto à atividade antibacteriana. Estudos antimicrobianos de Myroides spp restringem-se à cepas hospitalares. Uma bactéria Gram negativa, Myroides sp, foi isolada do intestino de moscas varejeiras adultas (Sarcophaga sp e submetida

  14. Quantifying metabolic heterogeneity in head and neck tumors in real time: 2-DG uptake is highest in hypoxic tumor regions.

    Directory of Open Access Journals (Sweden)

    Erica C Nakajima

    Full Text Available Intratumoral metabolic heterogeneity may increase the likelihood of treatment failure due to the presence of a subset of resistant tumor cells. Using a head and neck squamous cell carcinoma (HNSCC xenograft model and a real-time fluorescence imaging approach, we tested the hypothesis that tumors are metabolically heterogeneous, and that tumor hypoxia alters patterns of glucose uptake within the tumor.Cal33 cells were grown as xenograft tumors (n = 16 in nude mice after identification of this cell line's metabolic response to hypoxia. Tumor uptake of fluorescent markers identifying hypoxia, glucose import, or vascularity was imaged simultaneously using fluorescent molecular tomography. The variability of intratumoral 2-deoxyglucose (IR800-2-DG concentration was used to assess tumor metabolic heterogeneity, which was further investigated using immunohistochemistry for expression of key metabolic enzymes. HNSCC tumors in patients were assessed for intratumoral variability of (18F-fluorodeoxyglucose ((18F-FDG uptake in clinical PET scans.IR800-2-DG uptake in hypoxic regions of Cal33 tumors was 2.04 times higher compared to the whole tumor (p = 0.0001. IR800-2-DG uptake in tumors containing hypoxic regions was more heterogeneous as compared to tumors lacking a hypoxic signal. Immunohistochemistry staining for HIF-1α, carbonic anhydrase 9, and ATP synthase subunit 5β confirmed xenograft metabolic heterogeneity. We detected heterogeneous (18F-FDG uptake within patient HNSCC tumors, and the degree of heterogeneity varied amongst tumors.Hypoxia is associated with increased intratumoral metabolic heterogeneity. (18F-FDG PET scans may be used to stratify patients according to the metabolic heterogeneity within their tumors, which could be an indicator of prognosis.

  15. DG-AMMOS: A New tool to generate 3D conformation of small molecules using Distance Geometry and Automated Molecular Mechanics Optimization for in silico Screening

    Directory of Open Access Journals (Sweden)

    Villoutreix Bruno O

    2009-11-01

    Full Text Available Abstract Background Discovery of new bioactive molecules that could enter drug discovery programs or that could serve as chemical probes is a very complex and costly endeavor. Structure-based and ligand-based in silico screening approaches are nowadays extensively used to complement experimental screening approaches in order to increase the effectiveness of the process and facilitating the screening of thousands or millions of small molecules against a biomolecular target. Both in silico screening methods require as input a suitable chemical compound collection and most often the 3D structure of the small molecules has to be generated since compounds are usually delivered in 1D SMILES, CANSMILES or in 2D SDF formats. Results Here, we describe the new open source program DG-AMMOS which allows the generation of the 3D conformation of small molecules using Distance Geometry and their energy minimization via Automated Molecular Mechanics Optimization. The program is validated on the Astex dataset, the ChemBridge Diversity database and on a number of small molecules with known crystal structures extracted from the Cambridge Structural Database. A comparison with the free program Balloon and the well-known commercial program Omega generating the 3D of small molecules is carried out. The results show that the new free program DG-AMMOS is a very efficient 3D structure generator engine. Conclusion DG-AMMOS provides fast, automated and reliable access to the generation of 3D conformation of small molecules and facilitates the preparation of a compound collection prior to high-throughput virtual screening computations. The validation of DG-AMMOS on several different datasets proves that generated structures are generally of equal quality or sometimes better than structures obtained by other tested methods.

  16. Drug: D08352 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D08352 Drug Phenformin hydrochloride; Debei (TN) ... C10H15N5. HCl D08352.gif ... Antidiabetic... agent ... DG01685 ... Insulin sensitizer ... DG01684 ... Biguanide antidiabetic Cyp substrate ... DG01644 ... CYP2D6... substrate Unclassified ... DG02044 ... Hypoglycemics ... DG01684 ... Biguanide antidiabetic ATC code: A10BA01 Chemical

  17. BERMUDA-1DG: a one-dimensional photon transport code

    International Nuclear Information System (INIS)

    Suzuki, Tomoo; Hasegawa, Akira; Nakashima, Hiroshi; Kaneko, Kunio.

    1984-10-01

    A one-dimensional photon transport code BERMUDA-1DG has been developed for spherical and infinite slab geometries. The purpose of development is to equip the function of gamma rays calculation for the BERMUDA code system, which was developed by 1983 only for neutron transport calculation as a preliminary version. A group constants library has been prepared for 30 nuclides, and it now consists of the 36-group total cross sections and secondary gamma ray yields by the 120-group neutron flux. For the Compton scattering, group-angle transfer matrices are accurately obtained by integrating the Klein-Nishina formula taking into account the energy and scattering angle correlation. The pair production cross sections are now calculated in the code from atomic number and midenergy of each group. To obtain angular flux distribution, the transport equation is solved in the same way as in case of neutron, using the direct integration method in a multigroup model. Both of an independent gamma ray source problem and a neutron-gamma source problem are possible to be solved. This report is written as a user's manual with a brief description of the calculational method. (author)

  18. Drug: D08351 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D08351 Drug Phenformin (BAN) ... C10H15N5 D08351.gif ... Antidiabetic agent ... DG01685 ... ...Insulin sensitizer ... DG01684 ... Biguanide antidiabetic Cyp substrate ... DG01644 ... CYP2D6 substrate Unclassified ... ...DG02044 ... Hypoglycemics ... DG01684 ... Biguanide antidiabetic Same as: C07673 ATC code: A10BA01 Chemical group: D

  19. Drug: D01071 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available t ... DG01837 ... Barbiturate sedative-hypnotics ... DG01567 ... GABA-A receptor agonist ... DG02030 ... Anesthetics ... DG02027 ... General anesthetic...s ... DG02025 ... Barbiturate anesthetics ... DG02027 ... General anesthetics ... DG02025 ... Barbiturate anesthetic...s ... DG02025 ... Barbiturate anesthetics Cyp substrate ... DG01639 ... CYP2C19

  20. Drug: D00714 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 14.gif ... Neuropsychiatric agent ... DG01837 ... Barbiturate sedative-hypnotics ... DG01567 ... GABA-A receptor agonist ... DG02030 ... Anesthetic...s ... DG02027 ... General anesthetics ... DG02025 ... Barbiturate anesthetics ... DG02027 ... General anesthetic...s ... DG02025 ... Barbiturate anesthetics ... DG02025 ... Barbiturate anesthetics ...

  1. Electricity diversification, decentralization, and decarbonization: The role of U.S. state energy policy

    Science.gov (United States)

    Carley, Sanya

    In response to mounting concerns about climate change and an over-dependence on fossil fuels, U.S. state governments have assumed leadership roles in energy policy. State leaders across the country have constructed policies that target electricity sector operations, and aim to increase the percentage of renewable electricity generation, increase the use of distributed generation, and decrease carbon footprints. The policy literature, however, lacks compelling empirical evidence that state initiatives toward these ends are effective. This research seeks to contribute empirical insights that can help fill this void in the literature, and advance policy knowledge about the efficacy of these instruments. This three-essay dissertation focuses on the assessment of state energy policy instruments aimed at the diversification, decentralization, and decarbonization of the U.S. electricity sector. The first essay considers the effects of state efforts to diversify electricity portfolios via increases in renewable energy. This essay asks: are state-level renewable portfolio standards (RPS) effective at increasing renewable energy deployment, as well as the share of renewable energy out of the total generation mix? Empirical results demonstrate that RPS policies so far are effectively encouraging total renewable energy deployment, but not the percentage of renewable energy generation. The second essay considers state policy efforts to decentralize the U.S. electricity sector via instruments that remove barriers to distributed generation (DG) deployment. The primary question this essay addresses is whether the removal of legal barriers acts as a primary motivating factor for DG deployment. Empirical results reveal that net metering policies are positively associated with DG deployment; interconnection standards significantly increase the likelihood that end-users will adopt DG capacity; and utility DG adoption is related to standard market forces. The third essay asks: what are

  2. DN/DG Screening of Environmental Swipe Samples: FY2016 Report

    Energy Technology Data Exchange (ETDEWEB)

    Glasgow, David C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Croft, Stephen [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Venkataraman, Ramkumar [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); McElroy, Robert Dennis [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Knowles, Justin R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2017-02-01

    The Delayed Neutron Delayed Gamma (DNDG) technique provides a new analytical capability to the International Atomic Energy Agency (IAEA) for detecting undeclared nuclear activities. IAEA’s Long Term R&D (LTRD) plan has a stated high urgency need to develop elemental and isotopic signatures of nuclear fuel cycle activities and processes (LTRD 2.2). The new DNDG capability is used to co-detect both uranium and plutonium as an extension of a DN only method that is already being utilized by the IAEA for the analysis of swipes to inform on undeclared nuclear activities. Analytical method involving irradiation of swipe samples potentially containing trace quantities of fissile material in a thermal neutron field, followed by the counting of delayed neutrons, is a well-known technique in the field of safeguards and nonproliferation. It is used for detecting the presence of microscopic amounts of fissile material, (typically a linear combination of 233U, 235U, 239Pu, and 241Pu)and quantifying it in terms of the equivalent mass of 235U. The delayed neutron (DN) technique is very sensitive and is been routinely employed at the High Flux Isotope Reactor (HFIR) facility at Oak Ridge National Laboratory (ORNL). Both uranium and plutonium are of high safeguards value. However, the DN technique is not well suited for distinguishing between U and Pu isotopes since the decay curves overlap closely. The delayed gamma (DG) technique will help detect the presence of 239Pu in a mixture of U and Pu. Thus the DNDG approach combines the best of both worlds; the sensitivity of DN counting and the isotopic specificity of DG counting. The present work seeks to build on the delayed neutron and delayed gamma methods that have been developed at ORNL. It is recognized that the distribution profile of heavy fission products remains fairly invariant for the fissile nuclides whereas the distribution of light fission products varies from one isotope to

  3. Micromonospora zeae sp. nov., a novel endophytic actinomycete isolated from corn root (Zea mays L.).

    Science.gov (United States)

    Shen, Yue; Zhang, Yuejing; Liu, Chongxi; Wang, Xiangjing; Zhao, Junwei; Jia, Feiyu; Yang, Lingyu; Yang, Deguang; Xiang, Wensheng

    2014-11-01

    A novel actinomycete, designated strain NEAU-gq9(T), was isolated from corn root (Zea mays L.) and characterized using a polyphasic approach. The organism was found to have morphological and chemotaxonomic characteristics typical of the genus Micromonospora. On the basis of 16S rRNA gene sequence similarity studies, strain NEAU-gq9(T) was most closely related to Micromonospora zamorensis CR38(T) (99.3%), Micromonospora jinlongensis NEAU-GRX11(T) (99.2%), Micromonospora saelicesensis Lupac 09(T) (99.2%), Micromonospora chokoriensis 2-19(6)(T) (98.9%), Micromonospora coxensis 2-30-b(28)(T) (98.6%) and Micromonospora lupini Lupac 14N(T) (98.5%). Phylogenetic analysis based on the 16S rRNA gene and gyrB gene demonstrated that strain NEAU-gq9(T) is a member of the genus Micromonospora and supported the closest phylogenetic relationship to M. zamorensis CR38(T), M. jinlongensis NEAU-GRX11(T), M. saelicesensis Lupac 09(T), M. chokoriensis 2-19(6)(T) and M. lupini Lupac 14N(T). A combination of DNA-DNA hybridization, morphological and physiological characteristics indicated that the novel strain could be readily distinguished from the closest phylogenetic relatives. Therefore, it is proposed that strain NEAU-gq9(T) represents a novel species of the genus Micromonospora, for which the name Micromonospora zeae sp. nov. is proposed. The type strain is NEAU-gq9(T) (=CGMCC 4.7092(T)=DSM 45882(T)).

  4. Water-right and water-allocation procedures of farmers' managed perennial spate irrigation systems of mithawan watershed, D.G. Khan, Pakistan

    International Nuclear Information System (INIS)

    Ahmad, M.; Ahmad, S.

    2007-01-01

    A study was conducted on water rights, water allocation and local institutions prevailing in the perennial spate irrigation systems of Mithawan watershed o D.G. Khan District of Punjab. The Study Area was selected is the Mthawan watershed on the D.G. Khan-Quetta Road almost 70 kms from D.G. Khan and 10 km away from the road, representing real-life operating systems. Small-scale isolated and large-scale contiguous perennial spate irrigation systems were selected for study. A three-prong methodology was designed covering (a) interactive dialogue of the focus groups to document the community-perceptions regarding systems water-rights, water allocation and local institution prevailing in the area; (b) structured interviews to document systematic data regarding some of the study-aspects; and (c) diagnostic surveys to document some of the measured data regarding scheme performance. Water rights and allocation procedures both in small-scale isolated and large-scale Contiguous perennial spate irrigation-system are very clearly defined and do not change with time and space. Local institutions like Biradri and Muchi take care of just allocation of water. An irrigator is deputed who takes care of allocated time among various tribes. At the same time, the community is bringing more area under irrigation. Obviously it has increased water-requirements and in turn management of irrigation system. Previously they were reconstructing the diversion structure only. Present expansion in irrigated area has increased the necessity of maintaining the water-conveyance network more frequently, particularly at critical sections. However, the realization regarding water-losses still needs to be promoted. The linkages of resource-management with water-productivity are going to be the future area of consideration in theses systems, due to expansion of the system largely because of increased population and urge to increase their livelihood. (author)

  5. Drug: D05938 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D05938 Drug Sufentanil (USAN/INN) ... C22H30N2O2S D05938.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetic...s ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ... DG02027 ... General anesthetic...s ... DG02026 ... Opioid anesthetics ... DG01564 ... Opioid receptor agonist ... DG01563 ... mu-Opioid receptor agonis

  6. Drug: D06106 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available Barbiturate sedative-hypnotics ... DG01567 ... GABA-A receptor agonist ... DG02030 ... Anesthetics ... DG02027 ... General anesthetic...s ... DG02025 ... Barbiturate anesthetics ... DG02027 ... General anesthetics ... DG02025 ... Barbiturate anesthetic...s ... DG02025 ... Barbiturate anesthetics Same as: C07846 Chemical group: DG01377 ... Ba

  7. Drug: D07816 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 05 M02AA15 S01BC03 Chemical group: DG00441 ... Indication: For relief of mild to moderate pain, Migraine, Primary dysmenorrhea, Osteoar...thritis, Rheumatoid arthritis nonsteroidal antiinflammat

  8. ACCUMULATION OF M1DG DNA ADDUCTS AFTER CHRONIC EXPOSURE TO PCBS, BUT NOT FROM ACUTE EXPOSURE TO DIOXIN-LIKE COMPOUNDS

    Science.gov (United States)

    ABSTRACT: Oxidative DNA damage is one of the key events leading to mutation and cancer. The present study examined the accumulation of M1dG DNA adducts, 3-(2’-deoxy-β-D-erythro-pentofuranosyl)-pyrimido[1,2-a]-purin-10(3H)-one, after single or yearly exposur...

  9. A GOCE only gravity model GOSG01S and the validation of GOCE related satellite gravity models

    Directory of Open Access Journals (Sweden)

    Xinyu Xu

    2017-07-01

    Full Text Available We compile the GOCE-only satellite model GOSG01S complete to spherical harmonic degree of 220 using Satellite Gravity Gradiometry (SGG data and the Satellite-to-Satellite Tracking (SST observations along the GOCE orbit based on applying a least-squares analysis. The diagonal components (Vxx, Vyy, Vzz of the gravitational gradient tensor are used to form the system of observation equations with the band-pass ARMA filter. The point-wise acceleration observations (ax, ay, az along the orbit are used to form the system of observation equations up to the maximum spherical harmonic degree/order 130. The analysis of spectral accuracy characteristics of the newly derived gravitational model GOSG01S and the existing models GOTIM04S, GODIR04S, GOSPW04S and JYY_GOCE02S based on their comparison with the ultra-high degree model EIGEN-6C2 reveals a significant consistency at the spectral window approximately between 80 and 190 due to the same period SGG data used to compile these models. The GOCE related satellite gravity models GOSG01S, GOTIM05S, GODIR05S, GOTIM04S, GODIR04S, GOSPW04S, JYY_GOCE02S, EIGEN-6C2 and EGM2008 are also validated by using GPS-leveling data in China and USA. According to the truncation at degree 200, the statistic results show that all GGMs have very similar differences at GPS-leveling points in USA, and all GOCE related gravity models have better performance than EGM2008 in China. This suggests that all these models provide much more information on the gravity field than EGM2008 in areas with low terrestrial gravity coverage. And STDs of height anomaly differences in China for the selected truncation degrees show that GOCE has improved the accuracy of the global models beyond degree 90 and the accuracies of the models improve from 24 cm to 16 cm. STDs of geoid height differences in USA show that GOSG01S model has best consistency comparing with GPS-leveling data for the frequency band of the degree between 20 and 160.

  10. Brucellosis of the common vole (Microtus arvalis).

    Science.gov (United States)

    Hubálek, Z; Scholz, H C; Sedlácek, I; Melzer, F; Sanogo, Y O; Nesvadbová, J

    2007-01-01

    A systemic disease occurred in a wild population of the common vole Microtus arvalis in South Moravia (Czech Republic) during the years 1999-2003. Acute infections were characterized by edema of extremities, occasionally with colliquating abscesses, arthritis, lymphadenitis, perforations of the skin resulting from colliquated abscesses, orchitis, and peritoneal granulomas. From the clinical samples, small Gram-negative coccobacilli were isolated and identified as Ochrobactrum intermedium by API 20NE and colistin sensitivity profiles. However, subsequent rrs (16S rRNA) and recA (recombinase A) gene sequencing analysis of two isolates (CCM 4915=CAPM 6434; CCM 4916=CAPM 6435) identified them as Brucella sp. with sequence identities of 100% to other Brucella spp. Analysis of the omp2a/b genes confirmed the two isolates as Brucella. In AMOS polymerase chain reaction (PCR), a 2000-bp fragment was generated that was not seen in other brucellae. Experimental infection of outbred ICR mice with these isolates resulted in a mortality rate of 50%. Based on the results of the molecular investigations and the mortality observed in experimentally infected mice we conclude that the epizootic was caused by Brucella sp. and not by Ochrobactrum intermedium. The study demonstrates the limitations of commercial biochemical test systems in accurately differentiating among Ochrobactrum and Brucella.

  11. RTS,S/AS01E Malaria Vaccine Induces Memory and Polyfunctional T Cell Responses in a Pediatric African Phase III Trial

    Directory of Open Access Journals (Sweden)

    Gemma Moncunill

    2017-08-01

    Full Text Available Comprehensive assessment of cellular responses to the RTS,S/AS01E vaccine is needed to understand potential correlates and ultimately mechanisms of protection against malaria disease. Cellular responses recognizing the RTS,S/AS01E-containing circumsporozoite protein (CSP and Hepatitis B surface antigen (HBsAg were assessed before and 1 month after primary vaccination by intracellular cytokine staining and 16-color flow cytometry in 105 RTS,S/AS01-vaccinated and 74 rabies-vaccinated participants (controls in a pediatric phase III trial in Africa. RTS,S/AS01E-vaccinated children had significantly higher frequencies of CSP- and HBsAg-specific CD4+ T cells producing IL-2, TNF-α, and CD40L and HBsAg-specific CD4+ T producing IFN-γ and IL-17 than baseline and the control group. Vaccine-induced responses were identified in both central and effector memory (EM compartments. EM CD4+ T cells expressing IL-4 and IL-21 were detected recognizing both vaccine antigens. Consistently higher response rates to both antigens in RTS,S/AS01E-vaccinated than comparator-vaccinated children were observed. RTS,S/AS01E induced polyfunctional CSP- and HBsAg-specific CD4+ T cells, with a greater degree of polyfunctionality in HBsAg responses. In conclusion, RTS,S/AS01E vaccine induces T cells of higher functional heterogeneity and polyfunctionality than previously characterized. Responses detected in memory CD4+ T cell compartments may provide correlates of RTS,S/AS01-induced immunity and duration of protection in future correlates of immunity studies.

  12. Complete genome sequencing of Agrobacterium sp. H13-3, the former Rhizobium lupini H13-3, reveals a tripartite genome consisting of a circular and a linear chromosome and an accessory plasmid but lacking a tumor-inducing Ti-plasmid.

    Science.gov (United States)

    Wibberg, Daniel; Blom, Jochen; Jaenicke, Sebastian; Kollin, Florian; Rupp, Oliver; Scharf, Birgit; Schneiker-Bekel, Susanne; Sczcepanowski, Rafael; Goesmann, Alexander; Setubal, Joao Carlos; Schmitt, Rüdiger; Pühler, Alfred; Schlüter, Andreas

    2011-08-20

    Agrobacterium sp. H13-3, formerly known as Rhizobium lupini H13-3, is a soil bacterium that was isolated from the rhizosphere of Lupinus luteus. The isolate has been established as a model system for studying novel features of flagellum structure, motility and chemotaxis within the family Rhizobiaceae. The complete genome sequence of Agrobacterium sp. H13-3 has been established and the genome structure and phylogenetic assignment of the organism was analysed. For de novo sequencing of the Agrobacterium sp. H13-3 genome, a combined strategy comprising 454-pyrosequencing on the Genome Sequencer FLX platform and PCR-based amplicon sequencing for gap closure was applied. The finished genome consists of three replicons and comprises 5,573,770 bases. Based on phylogenetic analyses, the isolate could be assigned to the genus Agrobacterium biovar I and represents a genomic species G1 strain within this biovariety. The highly conserved circular chromosome (2.82 Mb) of Agrobacterium sp. H13-3 mainly encodes housekeeping functions characteristic for an aerobic, heterotrophic bacterium. Agrobacterium sp. H13-3 is a motile bacterium driven by the rotation of several complex flagella. Its behaviour towards external stimuli is regulated by a large chemotaxis regulon and a total of 17 chemoreceptors. Comparable to the genome of Agrobacterium tumefaciens C58, Agrobacterium sp. H13-3 possesses a linear chromosome (2.15 Mb) that is related to its reference replicon and features chromosomal and plasmid-like properties. The accessory plasmid pAspH13-3a (0.6 Mb) is only distantly related to the plasmid pAtC58 of A. tumefaciens C58 and shows a mosaic structure. A tumor-inducing Ti-plasmid is missing in the sequenced strain H13-3 indicating that it is a non-virulent isolate. Copyright © 2011 Elsevier B.V. All rights reserved.

  13. Experiment data report for semiscale Mod-1 Test S-01-5 (isothermal blowdown with core resistance simulator)

    International Nuclear Information System (INIS)

    Zender, S.N.; Crapo, H.S.; Jensen, M.F.; Sackett, K.E.

    1975-04-01

    Recorded test data are presented for Test S-01-5 of the semiscale Mod-1 isothermal blowdown test series. Test S-01-5 is one of several semiscale Mod-1 experiments which are counterparts of the LOFT nonnuclear experiments. System hardware is representative of LOFT with the design based on volumetric scaling methods and with initial conditions duplicating those identified for LOFT nonnuclear tests. Test S-01-5 was conducted with the secondary side of the steam generator pressurized with nitrogen gas in order to effectively eliminate heat transfer from the steam generator during blowdown and thereby to investigate the effect on overall system behavior of heat transfer from the steam generator. An orificed structure was used in the pressure vessel to simulate the LOFT core simulator. The test was initiated at isothermal conditions of 2270 psig and 540 0 F by a simulated offset shear of the cold leg broken loop piping. During system depressurization, coolant was injected into the cold leg of the operating loop to simulate emergency core cooling (ECC). Following the blowdown portion of the test, coolant spray was introduced into the pressure suppression tank to determine the response of the pressure suppression system. The uninterpreted data from Test S-01-5 and the reference material needed for future data analysis and test results reporting activities are presented. The data, presented in the form of graphs in engineering units, have been analyzed only to the extent necessary to assure that they are reasonable and consistent. (U.S.)

  14. Polarization Orientation Dependence of the Far Infrared Spectra of Oriented Single Crystals of 1,3,5-trinitro-S-triazine (RDX) using Terahertz Time-Domain Spectroscopy

    Science.gov (United States)

    2009-01-01

    BE, Hogbin MR, Kemp MC (2007) Proc IEEE 95:1559 14. Laman N, Sree Harsha S, Grischkowsky D, Melinger JS (2008) Opt Express 16:4094 15. Melinger JS... Laman N, Grischkowsky D (2008) Appl Phy Lett 93:011102 16. Tribe WR, Newnham DA, Taday PF, Kemp MC (2004) Proc SPIE 5354:168 17. Watters DG, Falconer DG

  15. A phase 3 trial of RTS,S/AS01 malaria vaccine in African infants

    DEFF Research Database (Denmark)

    Agnandji, Selidji Todagbe; Lell, Bertrand; Fernandes, José Francisco

    2012-01-01

    The candidate malaria vaccine RTS,S/AS01 reduced episodes of both clinical and severe malaria in children 5 to 17 months of age by approximately 50% in an ongoing phase 3 trial. We studied infants 6 to 12 weeks of age recruited for the same trial....

  16. Drug: D07282 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D07282 Drug Alfaxalone (INN) ... C21H32O3 D07282.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetics... ... DG02027 ... General anesthetics ... DG02027 ... General anesthetics ATC code: N01AX05 ... Steroid ...

  17. An adaptive control strategy of converter based DG to maintain protection coordination in distribution system

    DEFF Research Database (Denmark)

    Su, Chi; Liu, Zhou; Chen, Zhe

    2014-01-01

    of network protection devices. As a protection measure commonly used in distribution network, recloser-fuse coordination could suffer from this impact. Research work has been conducted to deal with this problem by modifying the control strategy of the DG converters during faults. These solutions generally...... reduce the current output from the converters during faults so as to mitigate the influence on protection coordination. However, converter current reduction may not be necessary for all types of faults. This paper proposes a converter control strategy with adaptivity to different fault types and also non......-fault voltage drop events. This control strategy is validated by simulations in DIgSILENT PowerFactory....

  18. (1S,3S,8R,9S,10R-9,10-Epoxy-3,7,7,10-tetramethyltricyclo[6.4.0.01,3]dodecane

    Directory of Open Access Journals (Sweden)

    Abdoullah Bimoussa

    2014-04-01

    Full Text Available The title compound, C16H26O, was synthesized by treating (1S,3S,8R-3,7,7,10-tetramethyltricyclo[6.4.0.01,3]dodec-9-ene with metachloroperbenzoic acid. The molecule is built up from two fused six- and seven-membered rings. The six-membered ring has a half-chair conformation, whereas the seven-membered ring displays a boat conformation. In the crystal, there are no significant intermolecular interactions present.

  19. Typing of Ochrobactrum anthropi clinical isolates using automated repetitive extragenic palindromic-polymerase chain reaction DNA fingerprinting and matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry.

    Science.gov (United States)

    Quirino, Angela; Pulcrano, Giovanna; Rametti, Linda; Puccio, Rossana; Marascio, Nadia; Catania, Maria Rosaria; Matera, Giovanni; Liberto, Maria Carla; Focà, Alfredo

    2014-03-22

    Ochrobactrum anthropi (O. anthropi), is a non-fermenting gram-negative bacillus usually found in the environment. Nevertheless, during the past decade it has been identified as pathogenic to immunocompromised patients. In this study, we assessed the usefulness of the automated repetitive extragenic palindromic-polymerase chain reaction (rep-PCR-based DiversiLab™ system, bioMèrieux, France) and of matrix-assisted laser desorption/ionization-time-of-flight (MALDI-TOF MS) for typing of twentythree O. anthropi clinical isolates that we found over a four-months period (from April 2011 to August 2011) in bacteriemic patients admitted in the same operative unit of our hospital. Pulsed-field gel electrophoresis (PFGE), commonly accepted as the gold standard technique for typing, was also used. Analysis was carried out using the Pearson correlation coefficient to determine the distance matrice and the unweighted pair group method with arithmetic mean (UPGMA) to generate dendogram. Rep-PCR analysis identified four different patterns: three that clustered together with 97% or more pattern similarity, and one whose members showed < 95% pattern similarity. Interestingly, strains isolated later (from 11/06/2011 to 24/08/2011) displayed a pattern with 99% similarity. MALDI-TOF MS evaluation clustered the twentythree strains of O. anthropi into a single group containing four distinct subgroups, each comprising the majority of strains clustering below 5 distance levels, indicating a high similarity between the isolates. Our results indicate that these isolates are clonally-related and the methods used afforded a valuable contribution to the epidemiology, prevention and control of the infections caused by this pathogen.

  20. Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT

  1. Hemagglutinin 222D/G polymorphism facilitates fast intra-host evolution of pandemic (H1N1 2009 influenza A viruses.

    Directory of Open Access Journals (Sweden)

    Nora Seidel

    Full Text Available The amino acid substitution of aspartic acid to glycine in hemagglutinin (HA in position 222 (HA-D222G as well as HA-222D/G polymorphism of pandemic (H1N1 2009 influenza viruses (A(H1N1pdm09 were frequently reported in severe influenza in humans and mice. Their impact on viral pathogenicity and the course of influenza has been discussed controversially and the underlying mechanism remained unclarified. In the present study, BALB/c mice, infected with the once mouse lung- and cell-passaged A(H1N1pdm09 isolate A/Jena/5258/09 (mpJena/5258, developed severe pneumonia. From day 2 to 3 or 4 post infection (p.i. symptoms (body weight loss and clinical score continuously worsened. After a short disease stagnation or even recovery phase in most mice, severity of disease further increased on days 6 and 7 p.i. Thereafter, surviving mice recovered. A 45 times higher virus titer maximum in the lung than in the trachea on day 2 p.i. and significantly higher tracheal virus titers compared to lung on day 6 p.i. indicated changes in the organ tropism during infection. Sequence analysis revealed an HA-222D/G polymorphism. HA-D222 and HA-G222 variants co-circulated in lung and trachea. Whereas, HA-D222 variant predominated in the lung, HA-G222 became the major variant in the trachea after day 4 p.i. This was accompanied by lower neutralizing antibody titers and broader receptor recognition including terminal sialic acid α-2,3-linked galactose, which is abundant on mouse trachea epithelial cells. Plaque-purified HA-G222-mpJena/5258 virus induced severe influenza with maximum symptom on day 6 p.i. These results demonstrated for the first time that HA-222D/G quasispecies of A(H1N1pdm09 caused severe biphasic influenza because of fast viral intra-host evolution, which enabled partial antibody escape and minor changes in receptor binding.

  2. Safety of the malaria vaccine candidate, RTS,S/AS01E in 5 to 17 month old Kenyan and Tanzanian Children.

    Directory of Open Access Journals (Sweden)

    John Lusingu

    2010-11-01

    Full Text Available The malaria vaccine candidate, RTS,S/AS01(E, showed promising protective efficacy in a trial of Kenyan and Tanzanian children aged 5 to 17 months. Here we report on the vaccine's safety and tolerability. The experimental design was a Phase 2b, two-centre, double-blind (observer- and participant-blind, randomised (1∶1 ratio controlled trial. Three doses of study or control (rabies vaccines were administered intramuscularly at 1 month intervals. Solicited adverse events (AEs were collected for 7 days after each vaccination. There was surveillance and reporting for unsolicited adverse events for 30 days after each vaccination. Serious adverse events (SAEs were recorded throughout the study period which lasted for 14 months after dose 1 in Korogwe, Tanzania and an average of 18 months post-dose 1 in Kilifi, Kenya. Blood samples for safety monitoring of haematological, renal and hepatic functions were taken at baseline, 3, 10 and 14 months after dose 1. A total of 894 children received RTS,S/AS01(E or rabies vaccine between March and August 2007. Overall, children vaccinated with RTS,S/AS01(E had fewer SAEs (51/447 than children in the control group (88/447. One SAE episode in a RTS,S/AS01(E recipient and nine episodes among eight rabies vaccine recipients met the criteria for severe malaria. Unsolicited AEs were reported in 78% of subjects in the RTS,S/AS01(E group and 74% of subjects in the rabies vaccine group. In both vaccine groups, gastroenteritis and pneumonia were the most frequently reported unsolicited AE. Fever was the most frequently observed solicited AE and was recorded after 11% of RTS,S/AS01(E doses compared to 31% of doses of rabies vaccine. The candidate vaccine RTS,S/AS01(E showed an acceptable safety profile in children living in a malaria-endemic area in East Africa. More data on the safety of RTS,S/AS01(E will become available from the Phase 3 programme.

  3. Drug: D00845 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetic...s ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ... DG01564 ... Opioid receptor agonist ... DG01563 ...

  4. Drug: D00320 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available .gif ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetic...s ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ... DG01564 ... Opioid receptor agonist ... DG015

  5. Drug: D00835 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 835.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetic...s ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ... DG01564 ... Opioid receptor agonist ... DG

  6. Drug: D08350 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D08350 Drug Pheneticillin (INN); Phenethicillin; PEPC ... C17H20N2O5S D08350.gif ... A...8 ... beta-Lactamase sensitive penicillin ATC code: J01CE05 Chemical group: DG00538 ... Phenethicillin is called

  7. Drug: D00713 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available europsychiatric agent ... DG01837 ... Barbiturate sedative-hypnotics ... DG01567 ... GABA-A receptor agonist ... DG02030 ... Anesthetic...s ... DG02027 ... General anesthetics ... DG02025 ... Barbiturate anesthetics ... DG02027 ... General anesthetics ... ... DG02025 ... Barbiturate anesthetics ... DG02025 ... Barbiturate anesthetics Therapeutic

  8. Quantum Mechanical Enhancement of the Random Dopant Induced Threshold Voltage Fluctuations and Lowering in Sub 0.1 Micron MOSFETs

    Science.gov (United States)

    Asenov, Asen; Slavcheva, G.; Brown, A. R.; Davies, J. H.; Saini, Subhash

    1999-01-01

    A detailed study of the influence of quantum effects in the inversion layer on the random dopant induced threshold voltage fluctuations and lowering in sub 0.1 micron MOSFETs has been performed. This has been achieved using a full 3D implementation of the density gradient (DG) formalism incorporated in our previously published 3D 'atomistic' simulation approach. This results in a consistent, fully 3D, quantum mechanical picture which implies not only the vertical inversion layer quantisation but also the lateral confinement effects manifested by current filamentation in the 'valleys' of the random potential fluctuations. We have shown that the net result of including quantum mechanical effects, while considering statistical fluctuations, is an increase in both threshold voltage fluctuations and lowering.

  9. Drug: D00544 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetic...s ... DG01994 ... Halogenated hydrocarbons ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetics

  10. Drug: D00542 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available opsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetic...s ... DG01994 ... Halogenated hydrocarbons ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetics ...

  11. Drug: D05406 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D05406 Drug Penamecillin (USAN/INN) ... C19H22N2O6S D05406.gif ... Antibacterial ... DG01...PubChem: 47207081 ChEBI: 131733 ChEMBL: CHEMBL2106988 LigandBox: D05406 NIKKAJI: J7.208G ...

  12. Časová proměnlivost horkých vln v České republice a extrémní horká vlna z roku 1994

    Czech Academy of Sciences Publication Activity Database

    Kyselý, Jan

    2003-01-01

    Roč. 56, - (2003), s. 13-19 ISSN 0026-1173 R&D Projects: GA ČR GP205/01/D040 Institutional research plan: CEZ:AV0Z3042911 Keywords : heat wave * temporal variability * Czech Republic * mortality Subject RIV: DG - Athmosphere Sciences, Meteorology

  13. Drug: D01177 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 1177.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetics ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetic...s ... DG02027 ... General anesthetics ... DG02026 ... Opioid anesthetics ... DG01564 ... Opioid receptor agonist ... D

  14. Impact of cosmic rays and solar energetic particles on the Earth’s ionosphere and atmosphere

    Czech Academy of Sciences Publication Activity Database

    Velinov, P. I. Y.; Asenovski, S.; Kudela, K.; Laštovička, Jan; Mateev, L.; Mishev, A.; Tonev, P.

    2013-01-01

    Roč. 3, 26 March (2013), A14/1-A14/17 ISSN 2115-7251 Grant - others:European COST Action(XE) ES0803 Institutional support: RVO:68378289 Keywords : cosmic rays * solar energetic particles * ionization * ionosphere * atmosphere * solar activity * solar-terrestrial relationships Subject RIV: DG - Athmosphere Sciences, Meteorology Impact factor: 2.519, year: 2013 http://www.swsc-journal.org/articles/swsc/abs/2013/01/swsc120040/swsc120040.html

  15. Sample (S): SE52_S01 [Metabolonote[Archive

    Lifescience Database Archive (English)

    Full Text Available s were soaked on MS agar plates and then incubated at 22°C under 16 h day and 8 h night conditions. At 18 days after germination, the aerial parts of the seedlings were harvested. ...

  16. Pesticides in shallow groundwater of Bahawalnagar, Muzafargarh, D.G. Khan and Rajan Pur districts of Punjab, Pakistan.

    Science.gov (United States)

    Tariq, Muhammad Ilyas; Afzal, Shahzad; Hussain, Ishtiaq

    2004-06-01

    In Pakistan there is little data on environmental contamination of rural water sources by pesticides. This study evaluated pesticide contamination of groundwater in four intensive cotton growing districts. Water samples were collected from 37 rural open wells in the areas of Bahwalnagar, Muzafargarh, D.G. Khan and Rajan Pur districts of Punjab and analysed for eight pesticides which are mostly used. Information on types of pesticide used and distance to nearest pesticide mixing area and application areas was obtained for each site. From the eight pesticides analysed, six pesticides were detected in the water samples. Only cypermethrin and cabosulfan were not detected. The percentage of detection of bifenthrin, lambda-cyhalothrin, carbofuran, endosulfan, methyl parathion and monocrotophos was, respectively 13.5%, 5.4%, 59.4%, 8%, 5.4% and 35.1% in July; 16.2%, 13.55%, 43.2%, 8%, N.D. (not detected) and 24.3% in October. Maximum contamination levels (MCLs) established by the U.S. Environmental Protection Agency for drinking water were not exceeded. The study has shown the need for monitoring pesticide contamination in rural water resources, and the development of drinking water quality standards for specific pesticides in Pakistan. The conclusions and recommendations will be disseminated to senior decision makers in central and local governments, extension agents and farmers.

  17. Dgroup: DG00635 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available N) ... D00855 ... Methenamine hippurate (JAN/USP) ... D00856 ... Methenamine mandelate (USP); Hexamine mandelate (JAN) ... D08199 ... Methenamine sulfosalicylate ... ATC code: J01XX05 Antibiotics ...

  18. Vysoké letní teploty a úmrtnost v ČR v letech 1982-2000

    Czech Academy of Sciences Publication Activity Database

    Kyselý, Jan; Kříž, B.

    2004-01-01

    Roč. 84, č. 8 (2004), s. 105-116 ISSN 0032-6739 R&D Projects: GA ČR GP205/01/D040 Institutional research plan: CEZ:AV0Z3042911 Keywords : mortality - air temperature - heat stress - Czech Republic Subject RIV: DG - Athmosphere Sciences, Meteorology

  19. Drug: D06055 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D06055 Drug Teflurane (USAN/INN) ... C2HBrF4 D06055.gif ... Neuropsychiatric agent ... DG02030 ... Anesthetic...s ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetics ... DG01994 ... Halogen...ated hydrocarbons ... DG02027 ... General anesthetics ... DG02028 ... Inhalational anaesthetics ... DG01994 ... Halogenated

  20. Drug: D05089 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ttenuated mumps vaccine (TN) ... Antiviral ... DG01689 ... Live vaccine ... DG01687 ... Parenteral live vaccine Therapeutic category: 6313 ATC code: J07BE01 ... PubChem: 17398246 ...