Determination of 5 '-leader sequences from radically disparate strains of porcine reproductive and respiratory syndrome virus reveals the presence of highly conserved sequence motifs

DEFF Research Database (Denmark)

Oleksiewicz, M.B.; Bøtner, Anette; Nielsen, Jens

1999-01-01

We determined the untranslated 5'-leader sequence for three different isolates of porcine reproductive and respiratory syndrome virus (PRRSV): pathogenic European- and American-types, as well as an American-type vaccine strain. 5'-leader from European- and American-type PRRSV differed in length...... (220 and 190 nt, respectively), and exhibited only approximately 50% nucleotide homology. Nevertheless, highly conserved areas were identified in the leader of all 3 PRRSV isolates, which constitute candidate motifs for binding of protein(s) involved in viral replication. These comparative data provide...

A Novel Protein Interaction between Nucleotide Binding Domain of Hsp70 and p53 Motif

Directory of Open Access Journals (Sweden)

Asita Elengoe

2015-01-01

Full Text Available Currently, protein interaction of Homo sapiens nucleotide binding domain (NBD of heat shock 70 kDa protein (PDB: 1HJO with p53 motif remains to be elucidated. The NBD-p53 motif complex enhances the p53 stabilization, thereby increasing the tumor suppression activity in cancer treatment. Therefore, we identified the interaction between NBD and p53 using STRING version 9.1 program. Then, we modeled the three-dimensional structure of p53 motif through homology modeling and determined the binding affinity and stability of NBD-p53 motif complex structure via molecular docking and dynamics (MD simulation. Human DNA binding domain of p53 motif (SCMGGMNR retrieved from UniProt (UniProtKB: P04637 was docked with the NBD protein, using the Autodock version 4.2 program. The binding energy and intermolecular energy for the NBD-p53 motif complex were −0.44 Kcal/mol and −9.90 Kcal/mol, respectively. Moreover, RMSD, RMSF, hydrogen bonds, salt bridge, and secondary structure analyses revealed that the NBD protein had a strong bond with p53 motif and the protein-ligand complex was stable. Thus, the current data would be highly encouraging for designing Hsp70 structure based drug in cancer therapy.

Identification of a Baeyer-Villiger monooxygenase sequence motif

NARCIS (Netherlands)

Fraaije, MW; Kamerbeek, NM; van Berkel, WJH; Janssen, DB; Kamerbeek, Nanne M.; Berkel, Willem J.H. van

2002-01-01

Baeyer-Villiger monooxygenases (BVMOs) form a distinct class of flavoproteins that catalyze the insertion of an oxygen atom in a C-C bond using dioxygen and NAD(P)H. Using newly characterized BVMO sequences, we have uncovered a BVMO-identifying sequence motif: FXGXXXRXXXW(P/D). Studies with

PISMA: A Visual Representation of Motif Distribution in DNA Sequences

Directory of Open Access Journals (Sweden)

Rogelio Alcántara-Silva

2017-03-01

Full Text Available Background: Because the graphical presentation and analysis of motif distribution can provide insights for experimental hypothesis, PISMA aims at identifying motifs on DNA sequences, counting and showing them graphically. The motif length ranges from 2 to 10 bases, and the DNA sequences range up to 10 kb. The motif distribution is shown as a bar-code–like, as a gene-map–like, and as a transcript scheme. Results: We obtained graphical schemes of the CpG site distribution from 91 human papillomavirus genomes. Also, we present 2 analyses: one of DNA motifs associated with either methylation-resistant or methylation-sensitive CpG islands and another analysis of motifs associated with exosome RNA secretion. Availability and Implementation: PISMA is developed in Java; it is executable in any type of hardware and in diverse operating systems. PISMA is freely available to noncommercial users. The English version and the User Manual are provided in Supplementary Files 1 and 2, and a Spanish version is available at www.biomedicas.unam.mx/wp-content/software/pisma.zip and www.biomedicas.unam.mx/wp-content/pdf/manual/pisma.pdf .

CompariMotif: quick and easy comparisons of sequence motifs.

Science.gov (United States)

Edwards, Richard J; Davey, Norman E; Shields, Denis C

2008-05-15

CompariMotif is a novel tool for making motif-motif comparisons, identifying and describing similarities between regular expression motifs. CompariMotif can identify a number of different relationships between motifs, including exact matches, variants of degenerate motifs and complex overlapping motifs. Motif relationships are scored using shared information content, allowing the best matches to be easily identified in large comparisons. Many input and search options are available, enabling a list of motifs to be compared to itself (to identify recurring motifs) or to datasets of known motifs. CompariMotif can be run online at http://bioware.ucd.ie/ and is freely available for academic use as a set of open source Python modules under a GNU General Public License from http://bioinformatics.ucd.ie/shields/software/comparimotif/

The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

Science.gov (United States)

Hammond, R W; Crosslin, J M

1995-04-01

The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

DNA Nucleotide Sequence Restricted by the RI Endonuclease

Science.gov (United States)

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

The BsaHI restriction-modification system: Cloning, sequencing and analysis of conserved motifs

Directory of Open Access Journals (Sweden)

Roberts Richard J

2008-05-01

Full Text Available Abstract Background Restriction and modification enzymes typically recognise short DNA sequences of between two and eight bases in length. Understanding the mechanism of this recognition represents a significant challenge that we begin to address for the BsaHI restriction-modification system, which recognises the six base sequence GRCGYC. Results The DNA sequences of the genes for the BsaHI methyltransferase, bsaHIM, and restriction endonuclease, bsaHIR, have been determined (GenBank accession #EU386360, cloned and expressed in E. coli. Both the restriction endonuclease and methyltransferase enzymes share significant similarity with a group of 6 other enzymes comprising the restriction-modification systems HgiDI and HgiGI and the putative HindVP, NlaCORFDP, NpuORFC228P and SplZORFNP restriction-modification systems. A sequence alignment of these homologues shows that their amino acid sequences are largely conserved and highlights several motifs of interest. We target one such conserved motif, reading SPERRFD, at the C-terminal end of the bsaHIR gene. A mutational analysis of these amino acids indicates that the motif is crucial for enzymatic activity. Sequence alignment of the methyltransferase gene reveals a short motif within the target recognition domain that is conserved among enzymes recognising the same sequences. Thus, this motif may be used as a diagnostic tool to define the recognition sequences of the cytosine C5 methyltransferases. Conclusion We have cloned and sequenced the BsaHI restriction and modification enzymes. We have identified a region of the R. BsaHI enzyme that is crucial for its activity. Analysis of the amino acid sequence of the BsaHI methyltransferase enzyme led us to propose two new motifs that can be used in the diagnosis of the recognition sequence of the cytosine C5-methyltransferases.

Physical-chemical property based sequence motifs and methods regarding same

Science.gov (United States)

Braun, Werner [Friendswood, TX; Mathura, Venkatarajan S [Sarasota, FL; Schein, Catherine H [Friendswood, TX

2008-09-09

A data analysis system, program, and/or method, e.g., a data mining/data exploration method, using physical-chemical property motifs. For example, a sequence database may be searched for identifying segments thereof having physical-chemical properties similar to the physical-chemical property motifs.

The limits of de novo DNA motif discovery.

Directory of Open Access Journals (Sweden)

David Simcha

Full Text Available A major challenge in molecular biology is reverse-engineering the cis-regulatory logic that plays a major role in the control of gene expression. This program includes searching through DNA sequences to identify "motifs" that serve as the binding sites for transcription factors or, more generally, are predictive of gene expression across cellular conditions. Several approaches have been proposed for de novo motif discovery-searching sequences without prior knowledge of binding sites or nucleotide patterns. However, unbiased validation is not straightforward. We consider two approaches to unbiased validation of discovered motifs: testing the statistical significance of a motif using a DNA "background" sequence model to represent the null hypothesis and measuring performance in predicting membership in gene clusters. We demonstrate that the background models typically used are "too null," resulting in overly optimistic assessments of significance, and argue that performance in predicting TF binding or expression patterns from DNA motifs should be assessed by held-out data, as in predictive learning. Applying this criterion to common motif discovery methods resulted in universally poor performance, although there is a marked improvement when motifs are statistically significant against real background sequences. Moreover, on synthetic data where "ground truth" is known, discriminative performance of all algorithms is far below the theoretical upper bound, with pronounced "over-fitting" in training. A key conclusion from this work is that the failure of de novo discovery approaches to accurately identify motifs is basically due to statistical intractability resulting from the fixed size of co-regulated gene clusters, and thus such failures do not necessarily provide evidence that unfound motifs are not active biologically. Consequently, the use of prior knowledge to enhance motif discovery is not just advantageous but necessary. An implementation of

The International Nucleotide Sequence Database Collaboration.

Science.gov (United States)

Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

2011-01-01

Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

Statistical properties and fractals of nucleotide clusters in DNA sequences

International Nuclear Information System (INIS)

Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

2004-01-01

Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

Perception Enhancement using Visual Attributes in Sequence Motif Visualization

OpenAIRE

Oon, Yin; Lee, Nung; Kok, Wei

2016-01-01

Sequence logo is a well-accepted scientific method to visualize the conservation characteristics of biological sequence motifs. Previous studies found that using sequence logo graphical representation for scientific evidence reports or arguments could seriously cause biases and misinterpretation by users. This study investigates on the visual attributes performance of a sequence logo in helping users to perceive and interpret the information based on preattentive theories and Gestalt principl...

Sequence alignment reveals possible MAPK docking motifs on HIV proteins.

Directory of Open Access Journals (Sweden)

Perry Evans

Full Text Available Over the course of HIV infection, virus replication is facilitated by the phosphorylation of HIV proteins by human ERK1 and ERK2 mitogen-activated protein kinases (MAPKs. MAPKs are known to phosphorylate their substrates by first binding with them at a docking site. Docking site interactions could be viable drug targets because the sequences guiding them are more specific than phosphorylation consensus sites. In this study we use multiple bioinformatics tools to discover candidate MAPK docking site motifs on HIV proteins known to be phosphorylated by MAPKs, and we discuss the possibility of targeting docking sites with drugs. Using sequence alignments of HIV proteins of different subtypes, we show that MAPK docking patterns previously described for human proteins appear on the HIV matrix, Tat, and Vif proteins in a strain dependent manner, but are absent from HIV Rev and appear on all HIV Nef strains. We revise the regular expressions of previously annotated MAPK docking patterns in order to provide a subtype independent motif that annotates all HIV proteins. One revision is based on a documented human variant of one of the substrate docking motifs, and the other reduces the number of required basic amino acids in the standard docking motifs from two to one. The proposed patterns are shown to be consistent with in silico docking between ERK1 and the HIV matrix protein. The motif usage on HIV proteins is sufficiently different from human proteins in amino acid sequence similarity to allow for HIV specific targeting using small-molecule drugs.

Selection of functional 2A sequences within foot-and-mouth disease virus; requirements for the NPGP motif with a distinct codon bias.

Science.gov (United States)

Kjær, Jonas; Belsham, Graham J

2018-01-01

Foot-and-mouth disease virus (FMDV) has a positive-sense ssRNA genome including a single, large, open reading frame. Splitting of the encoded polyprotein at the 2A/2B junction is mediated by the 2A peptide (18 residues long), which induces a nonproteolytic, cotranslational "cleavage" at its own C terminus. A conserved feature among variants of 2A is the C-terminal motif N 16 P 17 G 18 /P 19 , where P 19 is the first residue of 2B. It has been shown previously that certain amino acid substitutions can be tolerated at residues E 14 , S 15 , and N 16 within the 2A sequence of infectious FMDVs, but no variants at residues P 17 , G 18 , or P 19 have been identified. In this study, using highly degenerate primers, we analyzed if any other residues can be present at each position of the NPG/P motif within infectious FMDV. No alternative forms of this motif were found to be encoded by rescued FMDVs after two, three, or four passages. However, surprisingly, a clear codon preference for the wt nucleotide sequence encoding the NPGP motif within these viruses was observed. Indeed, the codons selected to code for P 17 and P 19 within this motif were distinct; thus the synonymous codons are not equivalent. © 2018 Kjær and Belsham; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Finding the most significant common sequence and structure motifs in a set of RNA sequences

DEFF Research Database (Denmark)

Gorodkin, Jan; Heyer, L.J.; Stormo, G.D.

1997-01-01

We present a computational scheme to locally align a collection of RNA sequences using sequence and structure constraints, In addition, the method searches for the resulting alignments with the most significant common motifs, among all possible collections, The first part utilizes a simplified...

MotifMark: Finding regulatory motifs in DNA sequences.

Science.gov (United States)

Hassanzadeh, Hamid Reza; Kolhe, Pushkar; Isbell, Charles L; Wang, May D

2017-07-01

The interaction between proteins and DNA is a key driving force in a significant number of biological processes such as transcriptional regulation, repair, recombination, splicing, and DNA modification. The identification of DNA-binding sites and the specificity of target proteins in binding to these regions are two important steps in understanding the mechanisms of these biological activities. A number of high-throughput technologies have recently emerged that try to quantify the affinity between proteins and DNA motifs. Despite their success, these technologies have their own limitations and fall short in precise characterization of motifs, and as a result, require further downstream analysis to extract useful and interpretable information from a haystack of noisy and inaccurate data. Here we propose MotifMark, a new algorithm based on graph theory and machine learning, that can find binding sites on candidate probes and rank their specificity in regard to the underlying transcription factor. We developed a pipeline to analyze experimental data derived from compact universal protein binding microarrays and benchmarked it against two of the most accurate motif search methods. Our results indicate that MotifMark can be a viable alternative technique for prediction of motif from protein binding microarrays and possibly other related high-throughput techniques.

A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

NARCIS (Netherlands)

Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

1996-01-01

A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

The nucleotide sequences of two leghemoglobin genes from soybean

DEFF Research Database (Denmark)

Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

1982-01-01

We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

BayesMotif: de novo protein sorting motif discovery from impure datasets.

Science.gov (United States)

Hu, Jianjun; Zhang, Fan

2010-01-18

Protein sorting is the process that newly synthesized proteins are transported to their target locations within or outside of the cell. This process is precisely regulated by protein sorting signals in different forms. A major category of sorting signals are amino acid sub-sequences usually located at the N-terminals or C-terminals of protein sequences. Genome-wide experimental identification of protein sorting signals is extremely time-consuming and costly. Effective computational algorithms for de novo discovery of protein sorting signals is needed to improve the understanding of protein sorting mechanisms. We formulated the protein sorting motif discovery problem as a classification problem and proposed a Bayesian classifier based algorithm (BayesMotif) for de novo identification of a common type of protein sorting motifs in which a highly conserved anchor is present along with a less conserved motif regions. A false positive removal procedure is developed to iteratively remove sequences that are unlikely to contain true motifs so that the algorithm can identify motifs from impure input sequences. Experiments on both implanted motif datasets and real-world datasets showed that the enhanced BayesMotif algorithm can identify anchored sorting motifs from pure or impure protein sequence dataset. It also shows that the false positive removal procedure can help to identify true motifs even when there is only 20% of the input sequences containing true motif instances. We proposed BayesMotif, a novel Bayesian classification based algorithm for de novo discovery of a special category of anchored protein sorting motifs from impure datasets. Compared to conventional motif discovery algorithms such as MEME, our algorithm can find less-conserved motifs with short highly conserved anchors. Our algorithm also has the advantage of easy incorporation of additional meta-sequence features such as hydrophobicity or charge of the motifs which may help to overcome the limitations of

Exploring the correlation between the sequence composition of the nucleotide binding G5 loop of the FeoB GTPase domain (NFeoB) and intrinsic rate of GDP release.

Science.gov (United States)

Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika

2014-12-12

GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.

Sequence-based classification using discriminatory motif feature selection.

Directory of Open Access Journals (Sweden)

Hao Xiong

Full Text Available Most existing methods for sequence-based classification use exhaustive feature generation, employing, for example, all k-mer patterns. The motivation behind such (enumerative approaches is to minimize the potential for overlooking important features. However, there are shortcomings to this strategy. First, practical constraints limit the scope of exhaustive feature generation to patterns of length ≤ k, such that potentially important, longer (> k predictors are not considered. Second, features so generated exhibit strong dependencies, which can complicate understanding of derived classification rules. Third, and most importantly, numerous irrelevant features are created. These concerns can compromise prediction and interpretation. While remedies have been proposed, they tend to be problem-specific and not broadly applicable. Here, we develop a generally applicable methodology, and an attendant software pipeline, that is predicated on discriminatory motif finding. In addition to the traditional training and validation partitions, our framework entails a third level of data partitioning, a discovery partition. A discriminatory motif finder is used on sequences and associated class labels in the discovery partition to yield a (small set of features. These features are then used as inputs to a classifier in the training partition. Finally, performance assessment occurs on the validation partition. Important attributes of our approach are its modularity (any discriminatory motif finder and any classifier can be deployed and its universality (all data, including sequences that are unaligned and/or of unequal length, can be accommodated. We illustrate our approach on two nucleosome occupancy datasets and a protein solubility dataset, previously analyzed using enumerative feature generation. Our method achieves excellent performance results, with and without optimization of classifier tuning parameters. A Python pipeline implementing the approach is

Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

Science.gov (United States)

Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

1987-06-01

The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

A tandem sequence motif acts as a distance-dependent enhancer in a set of genes involved in translation by binding the proteins NonO and SFPQ

Directory of Open Access Journals (Sweden)

Roepcke Stefan

2011-12-01

Full Text Available Abstract Background Bioinformatic analyses of expression control sequences in promoters of co-expressed or functionally related genes enable the discovery of common regulatory sequence motifs that might be involved in co-ordinated gene expression. By studying promoter sequences of the human ribosomal protein genes we recently identified a novel highly specific Localized Tandem Sequence Motif (LTSM. In this work we sought to identify additional genes and LTSM-binding proteins to elucidate potential regulatory mechanisms. Results Genome-wide analyses allowed finding a considerable number of additional LTSM-positive genes, the products of which are involved in translation, among them, translation initiation and elongation factors, and 5S rRNA. Electromobility shift assays then showed specific signals demonstrating the binding of protein complexes to LTSM in ribosomal protein gene promoters. Pull-down assays with LTSM-containing oligonucleotides and subsequent mass spectrometric analysis identified the related multifunctional nucleotide binding proteins NonO and SFPQ in the binding complex. Functional characterization then revealed that LTSM enhances the transcriptional activity of the promoters in dependency of the distance from the transcription start site. Conclusions Our data demonstrate the power of bioinformatic analyses for the identification of biologically relevant sequence motifs. LTSM and the here found LTSM-binding proteins NonO and SFPQ were discovered through a synergistic combination of bioinformatic and biochemical methods and are regulators of the expression of a set of genes of the translational apparatus in a distance-dependent manner.

A 6-Nucleotide Regulatory Motif within the AbcR Small RNAs of Brucella abortus Mediates Host-Pathogen Interactions.

Science.gov (United States)

Sheehan, Lauren M; Caswell, Clayton C

2017-06-06

In Brucella abortus , two small RNAs (sRNAs), AbcR1 and AbcR2, are responsible for regulating transcripts encoding ABC-type transport systems. AbcR1 and AbcR2 are required for Brucella virulence, as a double chromosomal deletion of both sRNAs results in attenuation in mice. Although these sRNAs are responsible for targeting transcripts for degradation, the mechanism utilized by the AbcR sRNAs to regulate mRNA in Brucella has not been described. Here, two motifs (M1 and M2) were identified in AbcR1 and AbcR2, and complementary motif sequences were defined in AbcR-regulated transcripts. Site-directed mutagenesis of M1 or M2 or of both M1 and M2 in the sRNAs revealed transcripts to be targeted by one or both motifs. Electrophoretic mobility shift assays revealed direct, concentration-dependent binding of both AbcR sRNAs to a target mRNA sequence. These experiments genetically and biochemically characterized two indispensable motifs within the AbcR sRNAs that bind to and regulate transcripts. Additionally, cellular and animal models of infection demonstrated that only M2 in the AbcR sRNAs is required for Brucella virulence. Furthermore, one of the M2-regulated targets, BAB2_0612, was found to be critical for the virulence of B. abortus in a mouse model of infection. Although these sRNAs are highly conserved among Alphaproteobacteria , the present report displays how gene regulation mediated by the AbcR sRNAs has diverged to meet the intricate regulatory requirements of each particular organism and its unique biological niche. IMPORTANCE Small RNAs (sRNAs) are important components of bacterial regulation, allowing organisms to quickly adapt to changes in their environments. The AbcR sRNAs are highly conserved throughout the Alphaproteobacteria and negatively regulate myriad transcripts, many encoding ABC-type transport systems. In Brucella abortus , AbcR1 and AbcR2 are functionally redundant, as only a double abcR1 abcR2 ( abcR1 / 2 ) deletion results in attenuation in

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

Science.gov (United States)

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Dragon polya spotter: Predictor of poly(A) motifs within human genomic DNA sequences

KAUST Repository

Kalkatawi, Manal M.

2011-11-15

Motivation: Recognition of poly(A) signals in mRNA is relatively straightforward due to the presence of easily recognizable polyadenylic acid tail. However, the task of identifying poly(A) motifs in the primary genomic DNA sequence that correspond to poly(A) signals in mRNA is a far more challenging problem. Recognition of poly(A) signals is important for better gene annotation and understanding of the gene regulation mechanisms. In this work, we present one such poly(A) motif prediction method based on properties of human genomic DNA sequence surrounding a poly(A) motif. These properties include thermodynamic, physico-chemical and statistical characteristics. For predictions, we developed Artificial Neural Network and Random Forest models. These models are trained to recognize 12 most common poly(A) motifs in human DNA. Our predictors are available as a free web-based tool accessible at http://cbrc.kaust.edu.sa/dps. Compared with other reported predictors, our models achieve higher sensitivity and specificity and furthermore provide a consistent level of accuracy for 12 poly(A) motif variants. The Author(s) 2011. Published by Oxford University Press. All rights reserved.

PDL1 Signals through Conserved Sequence Motifs to Overcome Interferon-Mediated Cytotoxicity

Directory of Open Access Journals (Sweden)

Maria Gato-Cañas

2017-08-01

Full Text Available PDL1 blockade produces remarkable clinical responses, thought to occur by T cell reactivation through prevention of PDL1-PD1 T cell inhibitory interactions. Here, we find that PDL1 cell-intrinsic signaling protects cancer cells from interferon (IFN cytotoxicity and accelerates tumor progression. PDL1 inhibited IFN signal transduction through a conserved class of sequence motifs that mediate crosstalk with IFN signaling. Abrogation of PDL1 expression or antibody-mediated PDL1 blockade strongly sensitized cancer cells to IFN cytotoxicity through a STAT3/caspase-7-dependent pathway. Moreover, somatic mutations found in human carcinomas within these PDL1 sequence motifs disrupted motif regulation, resulting in PDL1 molecules with enhanced protective activities from type I and type II IFN cytotoxicity. Overall, our results reveal a mode of action of PDL1 in cancer cells as a first line of defense against IFN cytotoxicity.

Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

Science.gov (United States)

Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

2016-09-01

Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

WEB-server for search of a periodicity in amino acid and nucleotide sequences

Science.gov (United States)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

Science.gov (United States)

Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

1989-04-01

The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

Directory of Open Access Journals (Sweden)

Kouki Yonezawa

Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

Science.gov (United States)

Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

2017-01-01

Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

Science.gov (United States)

Dong, Min; Graham, Mitchell; Yadav, Nehul

2017-01-01

Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

Directory of Open Access Journals (Sweden)

Jieming Shi

Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

Science.gov (United States)

Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

1989-10-11

The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

MicroRNA categorization using sequence motifs and k-mers.

Science.gov (United States)

Yousef, Malik; Khalifa, Waleed; Acar, İlhan Erkin; Allmer, Jens

2017-03-14

Post-transcriptional gene dysregulation can be a hallmark of diseases like cancer and microRNAs (miRNAs) play a key role in the modulation of translation efficiency. Known pre-miRNAs are listed in miRBase, and they have been discovered in a variety of organisms ranging from viruses and microbes to eukaryotic organisms. The computational detection of pre-miRNAs is of great interest, and such approaches usually employ machine learning to discriminate between miRNAs and other sequences. Many features have been proposed describing pre-miRNAs, and we have previously introduced the use of sequence motifs and k-mers as useful ones. There have been reports of xeno-miRNAs detected via next generation sequencing. However, they may be contaminations and to aid that important decision-making process, we aimed to establish a means to differentiate pre-miRNAs from different species. To achieve distinction into species, we used one species' pre-miRNAs as the positive and another species' pre-miRNAs as the negative training and test data for the establishment of machine learned models based on sequence motifs and k-mers as features. This approach resulted in higher accuracy values between distantly related species while species with closer relation produced lower accuracy values. We were able to differentiate among species with increasing success when the evolutionary distance increases. This conclusion is supported by previous reports of fast evolutionary changes in miRNAs since even in relatively closely related species a fairly good discrimination was possible.

Recoding method that removes inhibitory sequences and improves HIV gene expression

Energy Technology Data Exchange (ETDEWEB)

Rabadan, Raul; Krasnitz, Michael; Robins, Harlan; Witten, Daniela; Levine, Arnold

2016-08-23

The invention relates to inhibitory nucleotide signal sequences or "INS" sequences in the genomes of lentiviruses. In particular the invention relates to the AGG motif present in all viral genomes. The AGG motif may have an inhibitory effect on a virus, for example by reducing the levels of, or maintaining low steady-state levels of, viral RNAs in host cells, and inducing and/or maintaining in viral latency. In one aspect, the invention provides vaccines that contain, or are produced from, viral nucleic acids in which the AGG sequences have been mutated. In another aspect, the invention provides methods and compositions for affecting the function of the AGG motif, and methods for identifying other INS sequences in viral genomes.

Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences

Science.gov (United States)

König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.

2013-01-01

G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141

Identification of cyclic nucleotide gated channels using regular expressions

KAUST Repository

Zelman, Alice K.

2013-09-03

Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

Science.gov (United States)

Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

2003-01-01

A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

Science.gov (United States)

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

OpenAIRE

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

Science.gov (United States)

Guo, D; Maiss, E; Adam, G; Casper, R

1995-05-01

The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

Nucleotide sequence of tomato ringspot virus RNA-2.

Science.gov (United States)

Rott, M E; Tremaine, J H; Rochon, D M

1991-07-01

The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

Complete motif analysis of sequence requirements for translation initiation at non-AUG start codons.

Science.gov (United States)

Diaz de Arce, Alexander J; Noderer, William L; Wang, Clifford L

2018-01-25

The initiation of mRNA translation from start codons other than AUG was previously believed to be rare and of relatively low impact. More recently, evidence has suggested that as much as half of all translation initiation utilizes non-AUG start codons, codons that deviate from AUG by a single base. Furthermore, non-AUG start codons have been shown to be involved in regulation of expression and disease etiology. Yet the ability to gauge expression based on the sequence of a translation initiation site (start codon and its flanking bases) has been limited. Here we have performed a comprehensive analysis of translation initiation sites that utilize non-AUG start codons. By combining genetic-reporter, cell-sorting, and high-throughput sequencing technologies, we have analyzed the expression associated with all possible variants of the -4 to +4 positions of non-AUG translation initiation site motifs. This complete motif analysis revealed that 1) with the right sequence context, certain non-AUG start codons can generate expression comparable to that of AUG start codons, 2) sequence context affects each non-AUG start codon differently, and 3) initiation at non-AUG start codons is highly sensitive to changes in the flanking sequences. Complete motif analysis has the potential to be a key tool for experimental and diagnostic genomics. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

Science.gov (United States)

Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

2012-05-01

The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

An effective approach for annotation of protein families with low sequence similarity and conserved motifs: identifying GDSL hydrolases across the plant kingdom.

Science.gov (United States)

Vujaklija, Ivan; Bielen, Ana; Paradžik, Tina; Biđin, Siniša; Goldstein, Pavle; Vujaklija, Dušica

2016-02-18

The massive accumulation of protein sequences arising from the rapid development of high-throughput sequencing, coupled with automatic annotation, results in high levels of incorrect annotations. In this study, we describe an approach to decrease annotation errors of protein families characterized by low overall sequence similarity. The GDSL lipolytic family comprises proteins with multifunctional properties and high potential for pharmaceutical and industrial applications. The number of proteins assigned to this family has increased rapidly over the last few years. In particular, the natural abundance of GDSL enzymes reported recently in plants indicates that they could be a good source of novel GDSL enzymes. We noticed that a significant proportion of annotated sequences lack specific GDSL motif(s) or catalytic residue(s). Here, we applied motif-based sequence analyses to identify enzymes possessing conserved GDSL motifs in selected proteomes across the plant kingdom. Motif-based HMM scanning (Viterbi decoding-VD and posterior decoding-PD) and the here described PD/VD protocol were successfully applied on 12 selected plant proteomes to identify sequences with GDSL motifs. A significant number of identified GDSL sequences were novel. Moreover, our scanning approach successfully detected protein sequences lacking at least one of the essential motifs (171/820) annotated by Pfam profile search (PfamA) as GDSL. Based on these analyses we provide a curated list of GDSL enzymes from the selected plants. CLANS clustering and phylogenetic analysis helped us to gain a better insight into the evolutionary relationship of all identified GDSL sequences. Three novel GDSL subfamilies as well as unreported variations in GDSL motifs were discovered in this study. In addition, analyses of selected proteomes showed a remarkable expansion of GDSL enzymes in the lycophyte, Selaginella moellendorffii. Finally, we provide a general motif-HMM scanner which is easily accessible through

An integrative and applicable phylogenetic footprinting framework for cis-regulatory motifs identification in prokaryotic genomes.

Science.gov (United States)

Liu, Bingqiang; Zhang, Hanyuan; Zhou, Chuan; Li, Guojun; Fennell, Anne; Wang, Guanghui; Kang, Yu; Liu, Qi; Ma, Qin

2016-08-09

Phylogenetic footprinting is an important computational technique for identifying cis-regulatory motifs in orthologous regulatory regions from multiple genomes, as motifs tend to evolve slower than their surrounding non-functional sequences. Its application, however, has several difficulties for optimizing the selection of orthologous data and reducing the false positives in motif prediction. Here we present an integrative phylogenetic footprinting framework for accurate motif predictions in prokaryotic genomes (MP(3)). The framework includes a new orthologous data preparation procedure, an additional promoter scoring and pruning method and an integration of six existing motif finding algorithms as basic motif search engines. Specifically, we collected orthologous genes from available prokaryotic genomes and built the orthologous regulatory regions based on sequence similarity of promoter regions. This procedure made full use of the large-scale genomic data and taxonomy information and filtered out the promoters with limited contribution to produce a high quality orthologous promoter set. The promoter scoring and pruning is implemented through motif voting by a set of complementary predicting tools that mine as many motif candidates as possible and simultaneously eliminate the effect of random noise. We have applied the framework to Escherichia coli k12 genome and evaluated the prediction performance through comparison with seven existing programs. This evaluation was systematically carried out at the nucleotide and binding site level, and the results showed that MP(3) consistently outperformed other popular motif finding tools. We have integrated MP(3) into our motif identification and analysis server DMINDA, allowing users to efficiently identify and analyze motifs in 2,072 completely sequenced prokaryotic genomes. The performance evaluation indicated that MP(3) is effective for predicting regulatory motifs in prokaryotic genomes. Its application may enhance

Thermal Stability of Modified i-Motif Oligonucleotides with Naphthalimide Intercalating Nucleic Acids

DEFF Research Database (Denmark)

El-Sayed, Ahmed Ali; Pedersen, Erik B.; Khaireldin, Nahid Y.

2016-01-01

In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion of naphtha......In continuation of our investigation of characteristics and thermodynamic properties of the i-motif 5′-d[(CCCTAA)3CCCT)] upon insertion of intercalating nucleotides into the cytosine-rich oligonucleotide, this article evaluates the stabilities of i-motif oligonucleotides upon insertion...... of naphthalimide (1H-benzo[de]isoquinoline-1,3(2H)-dione) as the intercalating nucleic acid. The stabilities of i-motif structures with inserted naphthalimide intercalating nucleotides were studied using UV melting temperatures (Tm) and circular dichroism spectra at different pH values and conditions (crowding...

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

International Nuclear Information System (INIS)

Lo, A.; Yang, H.L.

1990-01-01

This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

Energy Technology Data Exchange (ETDEWEB)

Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

1983-01-01

Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

A Comparison Study for DNA Motif Modeling on Protein Binding Microarray

KAUST Repository

Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Wong, Hau-San

2015-01-01

Transcription Factor Binding Sites (TFBSs) are relatively short (5-15 bp) and degenerate. Identifying them is a computationally challenging task. In particular, Protein Binding Microarray (PBM) is a high-throughput platform that can measure the DNA binding preference of a protein in a comprehensive and unbiased manner; for instance, a typical PBM experiment can measure binding signal intensities of a protein to all possible DNA k-mers (k=810). Since proteins can often bind to DNA with different binding intensities, one of the major challenges is to build motif models which can fully capture the quantitative binding affinity data. To learn DNA motif models from the non-convex objective function landscape, several optimization methods are compared and applied to the PBM motif model building problem. In particular, representative methods from different optimization paradigms have been chosen for modeling performance comparison on hundreds of PBM datasets. The results suggest that the multimodal optimization methods are very effective for capturing the binding preference information from PBM data. In particular, we observe a general performance improvement using di-nucleotide modeling over mono-nucleotide modeling. In addition, the models learned by the best-performing method are applied to two independent applications: PBM probe rotation testing and ChIP-Seq peak sequence prediction, demonstrating its biological applicability.

A Comparison Study for DNA Motif Modeling on Protein Binding Microarray

KAUST Repository

Wong, Ka-Chun

2015-06-11

Transcription Factor Binding Sites (TFBSs) are relatively short (5-15 bp) and degenerate. Identifying them is a computationally challenging task. In particular, Protein Binding Microarray (PBM) is a high-throughput platform that can measure the DNA binding preference of a protein in a comprehensive and unbiased manner; for instance, a typical PBM experiment can measure binding signal intensities of a protein to all possible DNA k-mers (k=810). Since proteins can often bind to DNA with different binding intensities, one of the major challenges is to build motif models which can fully capture the quantitative binding affinity data. To learn DNA motif models from the non-convex objective function landscape, several optimization methods are compared and applied to the PBM motif model building problem. In particular, representative methods from different optimization paradigms have been chosen for modeling performance comparison on hundreds of PBM datasets. The results suggest that the multimodal optimization methods are very effective for capturing the binding preference information from PBM data. In particular, we observe a general performance improvement using di-nucleotide modeling over mono-nucleotide modeling. In addition, the models learned by the best-performing method are applied to two independent applications: PBM probe rotation testing and ChIP-Seq peak sequence prediction, demonstrating its biological applicability.

Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

Science.gov (United States)

Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

2014-06-01

The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

Complete nucleotide sequences of avian metapneumovirus subtype B genome.

Science.gov (United States)

Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

2010-12-01

Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

Quantitative statistical analysis of cis-regulatory sequences in ABA/VP1- and CBF/DREB1-regulated genes of Arabidopsis.

Science.gov (United States)

Suzuki, Masaharu; Ketterling, Matthew G; McCarty, Donald R

2005-09-01

We have developed a simple quantitative computational approach for objective analysis of cis-regulatory sequences in promoters of coregulated genes. The program, designated MotifFinder, identifies oligo sequences that are overrepresented in promoters of coregulated genes. We used this approach to analyze promoter sequences of Viviparous1 (VP1)/abscisic acid (ABA)-regulated genes and cold-regulated genes, respectively, of Arabidopsis (Arabidopsis thaliana). We detected significantly enriched sequences in up-regulated genes but not in down-regulated genes. This result suggests that gene activation but not repression is mediated by specific and common sequence elements in promoters. The enriched motifs include several known cis-regulatory sequences as well as previously unidentified motifs. With respect to known cis-elements, we dissected the flanking nucleotides of the core sequences of Sph element, ABA response elements (ABREs), and the C repeat/dehydration-responsive element. This analysis identified the motif variants that may correlate with qualitative and quantitative differences in gene expression. While both VP1 and cold responses are mediated in part by ABA signaling via ABREs, these responses correlate with unique ABRE variants distinguished by nucleotides flanking the ACGT core. ABRE and Sph motifs are tightly associated uniquely in the coregulated set of genes showing a strict dependence on VP1 and ABA signaling. Finally, analysis of distribution of the enriched sequences revealed a striking concentration of enriched motifs in a proximal 200-base region of VP1/ABA and cold-regulated promoters. Overall, each class of coregulated genes possesses a discrete set of the enriched motifs with unique distributions in their promoters that may account for the specificity of gene regulation.

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

Energy Technology Data Exchange (ETDEWEB)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

qPMS7: a fast algorithm for finding (ℓ, d-motifs in DNA and protein sequences.

Directory of Open Access Journals (Sweden)

Hieu Dinh

Full Text Available Detection of rare events happening in a set of DNA/protein sequences could lead to new biological discoveries. One kind of such rare events is the presence of patterns called motifs in DNA/protein sequences. Finding motifs is a challenging problem since the general version of motif search has been proven to be intractable. Motifs discovery is an important problem in biology. For example, it is useful in the detection of transcription factor binding sites and transcriptional regulatory elements that are very crucial in understanding gene function, human disease, drug design, etc. Many versions of the motif search problem have been proposed in the literature. One such is the (ℓ, d-motif search (or Planted Motif Search (PMS. A generalized version of the PMS problem, namely, Quorum Planted Motif Search (qPMS, is shown to accurately model motifs in real data. However, solving the qPMS problem is an extremely difficult task because a special case of it, the PMS Problem, is already NP-hard, which means that any algorithm solving it can be expected to take exponential time in the worse case scenario. In this paper, we propose a novel algorithm named qPMS7 that tackles the qPMS problem on real data as well as challenging instances. Experimental results show that our Algorithm qPMS7 is on an average 5 times faster than the state-of-art algorithm. The executable program of Algorithm qPMS7 is freely available on the web at http://pms.engr.uconn.edu/downloads/qPMS7.zip. Our online motif discovery tools that use Algorithm qPMS7 are freely available at http://pms.engr.uconn.edu or http://motifsearch.com.

Statistical tests to compare motif count exceptionalities

Directory of Open Access Journals (Sweden)

Vandewalle Vincent

2007-03-01

Full Text Available Abstract Background Finding over- or under-represented motifs in biological sequences is now a common task in genomics. Thanks to p-value calculation for motif counts, exceptional motifs are identified and represent candidate functional motifs. The present work addresses the related question of comparing the exceptionality of one motif in two different sequences. Just comparing the motif count p-values in each sequence is indeed not sufficient to decide if this motif is significantly more exceptional in one sequence compared to the other one. A statistical test is required. Results We develop and analyze two statistical tests, an exact binomial one and an asymptotic likelihood ratio test, to decide whether the exceptionality of a given motif is equivalent or significantly different in two sequences of interest. For that purpose, motif occurrences are modeled by Poisson processes, with a special care for overlapping motifs. Both tests can take the sequence compositions into account. As an illustration, we compare the octamer exceptionalities in the Escherichia coli K-12 backbone versus variable strain-specific loops. Conclusion The exact binomial test is particularly adapted for small counts. For large counts, we advise to use the likelihood ratio test which is asymptotic but strongly correlated with the exact binomial test and very simple to use.

MSDmotif: exploring protein sites and motifs

Directory of Open Access Journals (Sweden)

Henrick Kim

2008-07-01

Full Text Available Abstract Background Protein structures have conserved features – motifs, which have a sufficient influence on the protein function. These motifs can be found in sequence as well as in 3D space. Understanding of these fragments is essential for 3D structure prediction, modelling and drug-design. The Protein Data Bank (PDB is the source of this information however present search tools have limited 3D options to integrate protein sequence with its 3D structure. Results We describe here a web application for querying the PDB for ligands, binding sites, small 3D structural and sequence motifs and the underlying database. Novel algorithms for chemical fragments, 3D motifs, ϕ/ψ sequences, super-secondary structure motifs and for small 3D structural motif associations searches are incorporated. The interface provides functionality for visualization, search criteria creation, sequence and 3D multiple alignment options. MSDmotif is an integrated system where a results page is also a search form. A set of motif statistics is available for analysis. This set includes molecule and motif binding statistics, distribution of motif sequences, occurrence of an amino-acid within a motif, correlation of amino-acids side-chain charges within a motif and Ramachandran plots for each residue. The binding statistics are presented in association with properties that include a ligand fragment library. Access is also provided through the distributed Annotation System (DAS protocol. An additional entry point facilitates XML requests with XML responses. Conclusion MSDmotif is unique by combining chemical, sequence and 3D data in a single search engine with a range of search and visualisation options. It provides multiple views of data found in the PDB archive for exploring protein structures.

Peptomics, identification of novel cationic Arabidopsis peptides with conserved sequence motifs

DEFF Research Database (Denmark)

Olsen, Addie Nina; Mundy, John; Skriver, Karen

2002-01-01

Arabidopsis family of 34 genes. The predicted peptides are characterized by a conserved C-terminal sequence motif and additional primary structure conservation in a core region. The majority of these genes had not previously been annotated. A subset of the predicted peptides show high overall sequence...... similarity to Rapid Alkalinization Factor (RALF), a peptide isolated from tobacco. We therefore refer to this peptide family as RALFL for RALF-Like. RT-PCR analysis confirmed that several of the Arabidopsis genes are expressed and that their expression patterns vary. The identification of a large gene family...

Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

2006-01-01

Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

Design of character-based DNA barcode motif for species identification: A computational approach and its validation in fishes.

Science.gov (United States)

Chakraborty, Mohua; Dhar, Bishal; Ghosh, Sankar Kumar

2017-11-01

The DNA barcodes are generally interpreted using distance-based and character-based methods. The former uses clustering of comparable groups, based on the relative genetic distance, while the latter is based on the presence or absence of discrete nucleotide substitutions. The distance-based approach has a limitation in defining a universal species boundary across the taxa as the rate of mtDNA evolution is not constant throughout the taxa. However, character-based approach more accurately defines this using a unique set of nucleotide characters. The character-based analysis of full-length barcode has some inherent limitations, like sequencing of the full-length barcode, use of a sparse-data matrix and lack of a uniform diagnostic position for each group. A short continuous stretch of a fragment can be used to resolve the limitations. Here, we observe that a 154-bp fragment, from the transversion-rich domain of 1367 COI barcode sequences can successfully delimit species in the three most diverse orders of freshwater fishes. This fragment is used to design species-specific barcode motifs for 109 species by the character-based method, which successfully identifies the correct species using a pattern-matching program. The motifs also correctly identify geographically isolated population of the Cypriniformes species. Further, this region is validated as a species-specific mini-barcode for freshwater fishes by successful PCR amplification and sequencing of the motif (154 bp) using the designed primers. We anticipate that use of such motifs will enhance the diagnostic power of DNA barcode, and the mini-barcode approach will greatly benefit the field-based system of rapid species identification. © 2017 John Wiley & Sons Ltd.

Target motifs affecting natural immunity by a constitutive CRISPR-Cas system in Escherichia coli.

Directory of Open Access Journals (Sweden)

Cristóbal Almendros

Full Text Available Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR and CRISPR associated (cas genes conform the CRISPR-Cas systems of various bacteria and archaea and produce degradation of invading nucleic acids containing sequences (protospacers that are complementary to repeat intervening spacers. It has been demonstrated that the base sequence identity of a protospacer with the cognate spacer and the presence of a protospacer adjacent motif (PAM influence CRISPR-mediated interference efficiency. By using an original transformation assay with plasmids targeted by a resident spacer here we show that natural CRISPR-mediated immunity against invading DNA occurs in wild type Escherichia coli. Unexpectedly, the strongest activity is observed with protospacer adjoining nucleotides (interference motifs that differ from the PAM both in sequence and location. Hence, our results document for the first time native CRISPR activity in E. coli and demonstrate that positions next to the PAM in invading DNA influence their recognition and degradation by these prokaryotic immune systems.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Evolutionary and Structural Perspectives of Plant Cyclic Nucleotide Gated Cation Channels

Directory of Open Access Journals (Sweden)

Alice Kira Zelman

2012-05-01

Full Text Available Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs. CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide binding domain (CNBD and a calmodulin binding domain (CaMBD as well as a 6 transmembrane/1 pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments.

Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

KAUST Repository

Zelman, Alice K.

2012-05-29

Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs). CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a calmodulin binding domain as well as a six transmembrane/one pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments. 2012 Zelman, Dawe, Gehring and Berkowitz.

Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium.

Science.gov (United States)

Catania, Francesco; Lynch, Michael

2010-05-04

In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa) remains a virtually unexplored issue. By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Our observations 1) shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2) are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3) reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

Science.gov (United States)

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-10-11

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

Flow Cytometry-Assisted Cloning of Specific Sequence Motifs from Complex 16S rRNA Gene Libraries

DEFF Research Database (Denmark)

Nielsen, Jeppe Lund; Schramm, Andreas; Bernhard, Anne E.

2004-01-01

for Systems Biology,3 Seattle, Washington, and Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany2 A flow cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting......  FLOW CYTOMETRY-ASSISTED CLONING OF SPECIFIC SEQUENCE MOTIFS FROM COMPLEX 16S RRNA GENE LIBRARIES Jeppe L. Nielsen,1 Andreas Schramm,1,2 Anne E. Bernhard,1 Gerrit J. van den Engh,3 and David A. Stahl1* Department of Civil and Environmental Engineering, University of Washington,1 and Institute......-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant in a clone library of environmental 16S rRNA genes.  ...

Detecting remote sequence homology in disordered proteins: discovery of conserved motifs in the N-termini of Mononegavirales phosphoproteins.

Directory of Open Access Journals (Sweden)

David Karlin

Full Text Available Paramyxovirinae are a large group of viruses that includes measles virus and parainfluenza viruses. The viral Phosphoprotein (P plays a central role in viral replication. It is composed of a highly variable, disordered N-terminus and a conserved C-terminus. A second viral protein alternatively expressed, the V protein, also contains the N-terminus of P, fused to a zinc finger. We suspected that, despite their high variability, the N-termini of P/V might all be homologous; however, using standard approaches, we could previously identify sequence conservation only in some Paramyxovirinae. We now compared the N-termini using sensitive sequence similarity search programs, able to detect residual similarities unnoticeable by conventional approaches. We discovered that all Paramyxovirinae share a short sequence motif in their first 40 amino acids, which we called soyuz1. Despite its short length (11-16aa, several arguments allow us to conclude that soyuz1 probably evolved by homologous descent, unlike linear motifs. Conservation across such evolutionary distances suggests that soyuz1 plays a crucial role and experimental data suggest that it binds the viral nucleoprotein to prevent its illegitimate self-assembly. In some Paramyxovirinae, the N-terminus of P/V contains a second motif, soyuz2, which might play a role in blocking interferon signaling. Finally, we discovered that the P of related Mononegavirales contain similarly overlooked motifs in their N-termini, and that their C-termini share a previously unnoticed structural similarity suggesting a common origin. Our results suggest several testable hypotheses regarding the replication of Mononegavirales and suggest that disordered regions with little overall sequence similarity, common in viral and eukaryotic proteins, might contain currently overlooked motifs (intermediate in length between linear motifs and disordered domains that could be detected simply by comparing orthologous proteins.

Sequence motifs in MADS transcription factors responsible for specificity and diversification of protein-protein interaction.

Directory of Open Access Journals (Sweden)

Aalt D J van Dijk

Full Text Available Protein sequences encompass tertiary structures and contain information about specific molecular interactions, which in turn determine biological functions of proteins. Knowledge about how protein sequences define interaction specificity is largely missing, in particular for paralogous protein families with high sequence similarity, such as the plant MADS domain transcription factor family. In comparison to the situation in mammalian species, this important family of transcription regulators has expanded enormously in plant species and contains over 100 members in the model plant species Arabidopsis thaliana. Here, we provide insight into the mechanisms that determine protein-protein interaction specificity for the Arabidopsis MADS domain transcription factor family, using an integrated computational and experimental approach. Plant MADS proteins have highly similar amino acid sequences, but their dimerization patterns vary substantially. Our computational analysis uncovered small sequence regions that explain observed differences in dimerization patterns with reasonable accuracy. Furthermore, we show the usefulness of the method for prediction of MADS domain transcription factor interaction networks in other plant species. Introduction of mutations in the predicted interaction motifs demonstrated that single amino acid mutations can have a large effect and lead to loss or gain of specific interactions. In addition, various performed bioinformatics analyses shed light on the way evolution has shaped MADS domain transcription factor interaction specificity. Identified protein-protein interaction motifs appeared to be strongly conserved among orthologs, indicating their evolutionary importance. We also provide evidence that mutations in these motifs can be a source for sub- or neo-functionalization. The analyses presented here take us a step forward in understanding protein-protein interactions and the interplay between protein sequences and

Ciliate telomerase RNA loop IV nucleotides promote hierarchical RNP assembly and holoenzyme stability.

Science.gov (United States)

Robart, Aaron R; O'Connor, Catherine M; Collins, Kathleen

2010-03-01

Telomerase adds simple-sequence repeats to chromosome 3' ends to compensate for the loss of repeats with each round of genome replication. To accomplish this de novo DNA synthesis, telomerase uses a template within its integral RNA component. In addition to providing the template, the telomerase RNA subunit (TER) also harbors nontemplate motifs that contribute to the specialized telomerase catalytic cycle of reiterative repeat synthesis. Most nontemplate TER motifs function through linkage with the template, but in ciliate and vertebrate telomerases, a stem-loop motif binds telomerase reverse transcriptase (TERT) and reconstitutes full activity of the minimal recombinant TERT+TER RNP, even when physically separated from the template. Here, we resolve the functional requirements for this motif of ciliate TER in physiological RNP context using the Tetrahymena thermophila p65-TER-TERT core RNP reconstituted in vitro and the holoenzyme reconstituted in vivo. Contrary to expectation based on assays of the minimal recombinant RNP, we find that none of a panel of individual loop IV nucleotide substitutions impacts the profile of telomerase product synthesis when reconstituted as physiological core RNP or holoenzyme RNP. However, loop IV nucleotide substitutions do variably reduce assembly of TERT with the p65-TER complex in vitro and reduce the accumulation and stability of telomerase RNP in endogenous holoenzyme context. Our results point to a unifying model of a conformational activation role for this TER motif in the telomerase RNP enzyme.

Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

Science.gov (United States)

Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

2017-03-17

Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

Energy Technology Data Exchange (ETDEWEB)

Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

1988-09-26

The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

Evolutionary dynamics of a conserved sequence motif in the ribosomal genes of the ciliate Paramecium

Directory of Open Access Journals (Sweden)

Lynch Michael

2010-05-01

Full Text Available Abstract Background In protozoa, the identification of preserved motifs by comparative genomics is often impeded by difficulties to generate reliable alignments for non-coding sequences. Moreover, the evolutionary dynamics of regulatory elements in 3' untranslated regions (both in protozoa and metazoa remains a virtually unexplored issue. Results By screening Paramecium tetraurelia's 3' untranslated regions for 8-mers that were previously found to be preserved in mammalian 3' UTRs, we detect and characterize a motif that is distinctly conserved in the ribosomal genes of this ciliate. The motif appears to be conserved across Paramecium aurelia species but is absent from the ribosomal genes of four additional non-Paramecium species surveyed, including another ciliate, Tetrahymena thermophila. Motif-free ribosomal genes retain fewer paralogs in the genome and appear to be lost more rapidly relative to motif-containing genes. Features associated with the discovered preserved motif are consistent with this 8-mer playing a role in post-transcriptional regulation. Conclusions Our observations 1 shed light on the evolution of a putative regulatory motif across large phylogenetic distances; 2 are expected to facilitate the understanding of the modulation of ribosomal genes expression in Paramecium; and 3 reveal a largely unexplored--and presumably not restricted to Paramecium--association between the presence/absence of a DNA motif and the evolutionary fate of its host genes.

Markovian Model in High Order Sequence Prediction From Log-Motif Patterns in Agbada Paralic Section, Niger Delta, Nigeria

International Nuclear Information System (INIS)

Olabode, S. O.; Adekoya, J. A.

2002-01-01

Markovian model in the elucidation of high order sequence was applied to repetitive events of regressive and transgressive phases in the Agbada paralic section Niger Delta. The repetitive events are made up of delta front, delta topset and fluvio-deltaic sediments. The sediments consist of sands, sandstones, siltstones and shales in various proportions. Five wells: MN1, AA1, NP2, NP6 and NP8 were studied.Summary of biostratigraphic report and well log-motif patterns was used to delineate the third order depositional sequences in the wells.Various Markovian properties - observed transition frequency matrix, observed transition probability matrix, fixed probability vector, expected random matrix (randomised transition matrix) and difference matrix were determined for stacked high order sequence (high frequency cyclic events) nested within the third-order sequences using the log-motif patterns for the various sand bodies and shales. Flow diagrams were constructed for each of the depositional sequences to know the likely occurrence of number of cycles.Upward transition matrix between the log-motif patterns and flow diagram to elucidate cyclicity show that the overall regressive sequence of the Niger Delta has been modified by deltaic depositional elements and fluctuations in sea level. The predictions of higher order sequence within third order sequences from Markovian Properties provide good basis for correlation within the depositional sequences. The model has also been used to decipher the dominant depositional processes during the formation of the sequences. Discrete reservoir intervals and seal potentials within the sequences were also predicted from the flow diagrams constructed

Viroids: from genotype to phenotype just relying on RNA sequence and structural motifs

Directory of Open Access Journals (Sweden)

Ricardo eFlores

2012-06-01

Full Text Available As a consequence of two unique physical properties, small size and circularity, viroid RNAs do not code for proteins and thus depend on RNA sequence/structural motifs for interacting with host proteins that mediate their invasion, replication, spread, and circumvention of defensive barriers. Viroid genomes fold up on themselves adopting collapsed secondary structures wherein stretches of nucleotides stabilized by Watson-Crick pairs are flanked by apparently unstructured loops. However, compelling data show that they are instead stabilized by alternative non-canonical pairs and that specific loops in the rod-like secondary structure, characteristic of Potato spindle tuber viroid and most other members of the family Pospiviroidae, are critical for replication and systemic trafficking. In contrast, rather than folding into a rod-like secondary structure, most members of the family Avsunvioidae adopt multibranched conformations occasionally stabilized by kissing loop interactions critical for viroid viability in vivo. Besides these most stable secondary structures, viroid RNAs alternatively adopt during replication transient metastable conformations containing elements of local higher-order structure, prominent among which are the hammerhead ribozymes catalyzing a key replicative step in the family Avsunvioidae, and certain conserved hairpins that also mediate replication steps in the family Pospiviroidae. Therefore, different RNA structures ⎯either global or local ⎯ determine different functions, thus highlighting the need for in-depth structural studies on viroid RNAs.

The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

Science.gov (United States)

Chan, Y L; Paz, V; Olvera, J; Wool, I G

1993-04-30

The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

BayesMD: flexible biological modeling for motif discovery

DEFF Research Database (Denmark)

Tang, Man-Hung Eric; Krogh, Anders; Winther, Ole

2008-01-01

We present BayesMD, a Bayesian Motif Discovery model with several new features. Three different types of biological a priori knowledge are built into the framework in a modular fashion. A mixture of Dirichlets is used as prior over nucleotide probabilities in binding sites. It is trained on trans......We present BayesMD, a Bayesian Motif Discovery model with several new features. Three different types of biological a priori knowledge are built into the framework in a modular fashion. A mixture of Dirichlets is used as prior over nucleotide probabilities in binding sites. It is trained...

Multiple POU-binding motifs, recognized by tissue-specific nuclear factors, are important for Dll1 gene expression in neural stem cells

International Nuclear Information System (INIS)

Nakayama, Kohzo; Nagase, Kazuko; Tokutake, Yuriko; Koh, Chang-Sung; Hiratochi, Masahiro; Ohkawara, Takeshi; Nakayama, Noriko

2004-01-01

We cloned the 5'-flanking region of the mouse homolog of the Delta gene (Dll1) and demonstrated that the sequence between nucleotide position -514 and -484 in the 5'-flanking region of Dll1 played a critical role in the regulation of its tissue-specific expression in neural stem cells (NSCs). Further, we showed that multiple POU-binding motifs, located within this short sequence of 30 bp, were essential for transcriptional activation of Dll1 and also that multiple tissue-specific nuclear factors recognized these POU-binding motifs in various combinations through differentiation of NSCs. Thus, POU-binding factors may play an important role in Dll1 expression in developing NSCs

RANDNA: a random DNA sequence generator.

Science.gov (United States)

Piva, Francesco; Principato, Giovanni

2006-01-01

Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.

Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.

Directory of Open Access Journals (Sweden)

Michael Allevato

Full Text Available The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX bind Enhancer box (E-box DNA elements (CANNTG and have the greatest affinity for the canonical MYC E-box (CME CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87% of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.

A Nuclear Ribosomal DNA Phylogeny of Acer Inferred with Maximum Likelihood, Splits Graphs, and Motif Analysis of 606 Sequences

Directory of Open Access Journals (Sweden)

Guido W. Grimm

2006-01-01

Full Text Available The multi-copy internal transcribed spacer (ITS region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation instead of the full (partly redundant original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly.

A Nuclear Ribosomal DNA Phylogeny of Acer Inferred with Maximum Likelihood, Splits Graphs, and Motif Analysis of 606 Sequences

Science.gov (United States)

Grimm, Guido W.; Renner, Susanne S.; Stamatakis, Alexandros; Hemleben, Vera

2007-01-01

The multi-copy internal transcribed spacer (ITS) region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML) and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation) instead of the full (partly redundant) original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994) 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly. PMID:19455198

Conserved binding of GCAC motifs by MEC-8, couch potato, and the RBPMS protein family

Science.gov (United States)

Soufari, Heddy

2017-01-01

Precise regulation of mRNA processing, translation, localization, and stability relies on specific interactions with RNA-binding proteins whose biological function and target preference are dictated by their preferred RNA motifs. The RBPMS family of RNA-binding proteins is defined by a conserved RNA recognition motif (RRM) domain found in metazoan RBPMS/Hermes and RBPMS2, Drosophila couch potato, and MEC-8 from Caenorhabditis elegans. In order to determine the parameters of RNA sequence recognition by the RBPMS family, we have first used the N-terminal domain from MEC-8 in binding assays and have demonstrated a preference for two GCAC motifs optimally separated by >6 nucleotides (nt). We have also determined the crystal structure of the dimeric N-terminal RRM domain from MEC-8 in the unbound form, and in complex with an oligonucleotide harboring two copies of the optimal GCAC motif. The atomic details reveal the molecular network that provides specificity to all four bases in the motif, including multiple hydrogen bonds to the initial guanine. Further studies with human RBPMS, as well as Drosophila couch potato, confirm a general preference for this double GCAC motif by other members of the protein family and the presence of this motif in known targets. PMID:28003515

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

Directory of Open Access Journals (Sweden)

Shui-Lian He

Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

Science.gov (United States)

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Automated classification of RNA 3D motifs and the RNA 3D Motif Atlas

Science.gov (United States)

Petrov, Anton I.; Zirbel, Craig L.; Leontis, Neocles B.

2013-01-01

The analysis of atomic-resolution RNA three-dimensional (3D) structures reveals that many internal and hairpin loops are modular, recurrent, and structured by conserved non-Watson–Crick base pairs. Structurally similar loops define RNA 3D motifs that are conserved in homologous RNA molecules, but can also occur at nonhomologous sites in diverse RNAs, and which often vary in sequence. To further our understanding of RNA motif structure and sequence variability and to provide a useful resource for structure modeling and prediction, we present a new method for automated classification of internal and hairpin loop RNA 3D motifs and a new online database called the RNA 3D Motif Atlas. To classify the motif instances, a representative set of internal and hairpin loops is automatically extracted from a nonredundant list of RNA-containing PDB files. Their structures are compared geometrically, all-against-all, using the FR3D program suite. The loops are clustered into motif groups, taking into account geometric similarity and structural annotations and making allowance for a variable number of bulged bases. The automated procedure that we have implemented identifies all hairpin and internal loop motifs previously described in the literature. All motif instances and motif groups are assigned unique and stable identifiers and are made available in the RNA 3D Motif Atlas (http://rna.bgsu.edu/motifs), which is automatically updated every four weeks. The RNA 3D Motif Atlas provides an interactive user interface for exploring motif diversity and tools for programmatic data access. PMID:23970545

The nucleotide sequence of human transition protein 1 cDNA

Energy Technology Data Exchange (ETDEWEB)

Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis.

Science.gov (United States)

Zheng, Jin-Shuang; Sun, Cheng-Zhen; Zhang, Shu-Ning; Hou, Xi-Lin; Bonnema, Guusje

2016-01-01

A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis.

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

Science.gov (United States)

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Counting of oligomers in sequences generated by markov chains for DNA motif discovery.

Science.gov (United States)

Shan, Gao; Zheng, Wei-Mou

2009-02-01

By means of the technique of the imbedded Markov chain, an efficient algorithm is proposed to exactly calculate first, second moments of word counts and the probability for a word to occur at least once in random texts generated by a Markov chain. A generating function is introduced directly from the imbedded Markov chain to derive asymptotic approximations for the problem. Two Z-scores, one based on the number of sequences with hits and the other on the total number of word hits in a set of sequences, are examined for discovery of motifs on a set of promoter sequences extracted from A. thaliana genome. Source code is available at http://www.itp.ac.cn/zheng/oligo.c.

Exploiting nucleotide composition to engineer promoters.

Directory of Open Access Journals (Sweden)

Manfred G Grabherr

Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

The MHC motif viewer: a visualization tool for MHC binding motifs

DEFF Research Database (Denmark)

Rapin, Nicolas; Hoof, Ilka; Lund, Ole

2010-01-01

is hampered by the lack of tools for browsing and comparing specificity of these molecules. We have developed a Web server, MHC Motif Viewer, which allows the display of the binding motif for MHC class I proteins for human, chimpanzee, rhesus monkey, mouse, and swine, as well as HLA-DR protein sequences...

Crystal Structures of the Scaffolding Protein LGN Reveal the General Mechanism by Which GoLoco Binding Motifs Inhibit the Release of GDP from Gαi *

Science.gov (United States)

Jia, Min; Li, Jianchao; Zhu, Jinwei; Wen, Wenyu; Zhang, Mingjie; Wang, Wenning

2012-01-01

GoLoco (GL) motif-containing proteins regulate G protein signaling by binding to Gα subunit and acting as guanine nucleotide dissociation inhibitors. GLs of LGN are also known to bind the GDP form of Gαi/o during asymmetric cell division. Here, we show that the C-terminal GL domain of LGN binds four molecules of Gαi·GDP. The crystal structures of Gαi·GDP in complex with LGN GL3 and GL4, respectively, reveal distinct GL/Gαi interaction features when compared with the only high resolution structure known with GL/Gαi interaction between RGS14 and Gαi1. Only a few residues C-terminal to the conserved GL sequence are required for LGN GLs to bind to Gαi·GDP. A highly conserved “double Arg finger” sequence (RΨ(D/E)(D/E)QR) is responsible for LGN GL to bind to GDP bound to Gαi. Together with the sequence alignment, we suggest that the LGN GL/Gαi interaction represents a general binding mode between GL motifs and Gαi. We also show that LGN GLs are potent guanine nucleotide dissociation inhibitors. PMID:22952234

Sequencing genes in silico using single nucleotide polymorphisms

Directory of Open Access Journals (Sweden)

Zhang Xinyi

2012-01-01

Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

Bayesian centroid estimation for motif discovery.

Science.gov (United States)

Carvalho, Luis

2013-01-01

Biological sequences may contain patterns that signal important biomolecular functions; a classical example is regulation of gene expression by transcription factors that bind to specific patterns in genomic promoter regions. In motif discovery we are given a set of sequences that share a common motif and aim to identify not only the motif composition, but also the binding sites in each sequence of the set. We propose a new centroid estimator that arises from a refined and meaningful loss function for binding site inference. We discuss the main advantages of centroid estimation for motif discovery, including computational convenience, and how its principled derivation offers further insights about the posterior distribution of binding site configurations. We also illustrate, using simulated and real datasets, that the centroid estimator can differ from the traditional maximum a posteriori or maximum likelihood estimators.

Bayesian centroid estimation for motif discovery.

Directory of Open Access Journals (Sweden)

Luis Carvalho

Full Text Available Biological sequences may contain patterns that signal important biomolecular functions; a classical example is regulation of gene expression by transcription factors that bind to specific patterns in genomic promoter regions. In motif discovery we are given a set of sequences that share a common motif and aim to identify not only the motif composition, but also the binding sites in each sequence of the set. We propose a new centroid estimator that arises from a refined and meaningful loss function for binding site inference. We discuss the main advantages of centroid estimation for motif discovery, including computational convenience, and how its principled derivation offers further insights about the posterior distribution of binding site configurations. We also illustrate, using simulated and real datasets, that the centroid estimator can differ from the traditional maximum a posteriori or maximum likelihood estimators.

The kissing-loop motif is a preferred site of 5' leader recombination during replication of SL3-3 murine leukemia viruses in mice

DEFF Research Database (Denmark)

Lund, Anders Henrik; Mikkelsen, J G; Schmidt, J

1999-01-01

, and the upstream part of the 5' untranslated region, enabled us to map recombination sites, guided by distinct scattered nucleotide differences. In 30 of 44 analyzed sequences, recombination was mapped to a 33-nucleotide similarity window coinciding with the kissing-loop stem-loop motif implicated in dimerization...... of the diploid genome. Interestingly, the recombination pattern preference found in replication-competent viruses from T-cell tumors is very similar to the pattern previously reported for retroviral vectors in cell culture experiments. The data therefore sustain the hypothesis that the kissing loop, presumably...

Sequence-specific high mobility group box factors recognize 10-12-base pair minor groove motifs

DEFF Research Database (Denmark)

van Beest, M; Dooijes, D; van De Wetering, M

2000-01-01

Sequence-specific high mobility group (HMG) box factors bind and bend DNA via interactions in the minor groove. Three-dimensional NMR analyses have provided the structural basis for this interaction. The cognate HMG domain DNA motif is generally believed to span 6-8 bases. However, alignment...

Temporal motifs in time-dependent networks

International Nuclear Information System (INIS)

Kovanen, Lauri; Karsai, Márton; Kaski, Kimmo; Kertész, János; Saramäki, Jari

2011-01-01

Temporal networks are commonly used to represent systems where connections between elements are active only for restricted periods of time, such as telecommunication, neural signal processing, biochemical reaction and human social interaction networks. We introduce the framework of temporal motifs to study the mesoscale topological–temporal structure of temporal networks in which the events of nodes do not overlap in time. Temporal motifs are classes of similar event sequences, where the similarity refers not only to topology but also to the temporal order of the events. We provide a mapping from event sequences to coloured directed graphs that enables an efficient algorithm for identifying temporal motifs. We discuss some aspects of temporal motifs, including causality and null models, and present basic statistics of temporal motifs in a large mobile call network

Development of Genome-Wide SSR Markers from Angelica gigas Nakai Using Next Generation Sequencing.

Science.gov (United States)

Gil, Jinsu; Um, Yurry; Kim, Serim; Kim, Ok Tae; Koo, Sung Cheol; Reddy, Chinreddy Subramanyam; Kim, Seong-Cheol; Hong, Chang Pyo; Park, Sin-Gi; Kim, Ho Bang; Lee, Dong Hoon; Jeong, Byung-Hoon; Chung, Jong-Wook; Lee, Yi

2017-09-21

Angelica gigas Nakai is an important medicinal herb, widely utilized in Asian countries especially in Korea, Japan, and China. Although it is a vital medicinal herb, the lack of sequencing data and efficient molecular markers has limited the application of a genetic approach for horticultural improvements. Simple sequence repeats (SSRs) are universally accepted molecular markers for population structure study. In this study, we found over 130,000 SSRs, ranging from di- to deca-nucleotide motifs, using the genome sequence of Manchu variety (MV) of A. gigas, derived from next generation sequencing (NGS). From the putative SSR regions identified, a total of 16,496 primer sets were successfully designed. Among them, we selected 848 SSR markers that showed polymorphism from in silico analysis and contained tri- to hexa-nucleotide motifs. We tested 36 SSR primer sets for polymorphism in 16 A. gigas accessions. The average polymorphism information content (PIC) was 0.69; the average observed heterozygosity ( H O ) values, and the expected heterozygosity ( H E ) values were 0.53 and 0.73, respectively. These newly developed SSR markers would be useful tools for molecular genetics, genotype identification, genetic mapping, molecular breeding, and studying species relationships of the Angelica genus.

Overlapping ETS and CRE Motifs (G/CCGGAAGTGACGTCA) Preferentially Bound by GABPα and CREB Proteins

Science.gov (United States)

Chatterjee, Raghunath; Zhao, Jianfei; He, Ximiao; Shlyakhtenko, Andrey; Mann, Ishminder; Waterfall, Joshua J.; Meltzer, Paul; Sathyanarayana, B. K.; FitzGerald, Peter C.; Vinson, Charles

2012-01-01

Previously, we identified 8-bps long DNA sequences (8-mers) that localize in human proximal promoters and grouped them into known transcription factor binding sites (TFBS). We now examine split 8-mers consisting of two 4-mers separated by 1-bp to 30-bps (X4-N1-30-X4) to identify pairs of TFBS that localize in proximal promoters at a precise distance. These include two overlapping TFBS: the ETS⇔ETS motif (C/GCCGGAAGCGGAA) and the ETS⇔CRE motif (C/GCGGAAGTGACGTCAC). The nucleotides in bold are part of both TFBS. Molecular modeling shows that the ETS⇔CRE motif can be bound simultaneously by both the ETS and the B-ZIP domains without protein-protein clashes. The electrophoretic mobility shift assay (EMSA) shows that the ETS protein GABPα and the B-ZIP protein CREB preferentially bind to the ETS⇔CRE motif only when the two TFBS overlap precisely. In contrast, the ETS domain of ETV5 and CREB interfere with each other for binding the ETS⇔CRE. The 11-mer (CGGAAGTGACG), the conserved part of the ETS⇔CRE motif, occurs 226 times in the human genome and 83% are in known regulatory regions. In vivo GABPα and CREB ChIP-seq peaks identified the ETS⇔CRE as the most enriched motif occurring in promoters of genes involved in mRNA processing, cellular catabolic processes, and stress response, suggesting that a specific class of genes is regulated by this composite motif. PMID:23050235

A survey of motif finding Web tools for detecting binding site motifs in ChIP-Seq data.

Science.gov (United States)

Tran, Ngoc Tam L; Huang, Chun-Hsi

2014-02-20

ChIP-Seq (chromatin immunoprecipitation sequencing) has provided the advantage for finding motifs as ChIP-Seq experiments narrow down the motif finding to binding site locations. Recent motif finding tools facilitate the motif detection by providing user-friendly Web interface. In this work, we reviewed nine motif finding Web tools that are capable for detecting binding site motifs in ChIP-Seq data. We showed each motif finding Web tool has its own advantages for detecting motifs that other tools may not discover. We recommended the users to use multiple motif finding Web tools that implement different algorithms for obtaining significant motifs, overlapping resemble motifs, and non-overlapping motifs. Finally, we provided our suggestions for future development of motif finding Web tool that better assists researchers for finding motifs in ChIP-Seq data.

Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

Science.gov (United States)

Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

2017-12-01

The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

Directory of Open Access Journals (Sweden)

Cheng-Chong Chou

2004-11-01

Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

Insights into the motif preference of APOBEC3 enzymes.

Directory of Open Access Journals (Sweden)

Diako Ebrahimi

Full Text Available We used a multivariate data analysis approach to identify motifs associated with HIV hypermutation by different APOBEC3 enzymes. The analysis showed that APOBEC3G targets G mainly within GG, TG, TGG, GGG, TGGG and also GGGT. The G nucleotides flanked by a C at the 3' end (in +1 and +2 positions were indicated as disfavoured targets by APOBEC3G. The G nucleotides within GGGG were found to be targeted at a frequency much less than what is expected. We found that the infrequent G-to-A mutation within GGGG is not limited to the inaccessibility, to APOBEC3, of poly Gs in the central and 3'polypurine tracts (PPTs which remain double stranded during the HIV reverse transcription. GGGG motifs outside the PPTs were also disfavoured. The motifs GGAG and GAGG were also found to be disfavoured targets for APOBEC3. The motif-dependent mutation of G within the HIV genome by members of the APOBEC3 family other than APOBEC3G was limited to GA→AA changes. The results did not show evidence of other types of context dependent G-to-A changes in the HIV genome.

The KYxxL motif in Rad17 protein is essential for the interaction with the 9–1–1 complex

Energy Technology Data Exchange (ETDEWEB)

Fukumoto, Yasunori, E-mail: fukumoto@faculty.chiba-u.jp [Laboratory of Molecular Cell Biology, Graduate School of Pharmaceutical Sciences, Chiba University, Chiba 260-8675 (Japan); Ikeuchi, Masayoshi; Nakayama, Yuji [Department of Biochemistry & Molecular Biology, Kyoto Pharmaceutical University, Kyoto 607-8414 (Japan); Yamaguchi, Naoto, E-mail: nyama@faculty.chiba-u.jp [Laboratory of Molecular Cell Biology, Graduate School of Pharmaceutical Sciences, Chiba University, Chiba 260-8675 (Japan)

2016-09-02

ATR-dependent DNA damage checkpoint is the major DNA damage checkpoint against UV irradiation and DNA replication stress. The Rad17–RFC and Rad9–Rad1–Hus1 (9–1–1) complexes interact with each other to contribute to ATR signaling, however, the precise regulatory mechanism of the interaction has not been established. Here, we identified a conserved sequence motif, KYxxL, in the AAA+ domain of Rad17 protein, and demonstrated that this motif is essential for the interaction with the 9–1–1 complex. We also show that UV-induced Rad17 phosphorylation is increased in the Rad17 KYxxL mutants. These data indicate that the interaction with the 9–1–1 complex is not required for Rad17 protein to be an efficient substrate for the UV-induced phosphorylation. Our data also raise the possibility that the 9–1–1 complex plays a negative regulatory role in the Rad17 phosphorylation. We also show that the nucleotide-binding activity of Rad17 is required for its nuclear localization. - Highlights: • We have identified a conserved KYxxL motif in Rad17 protein. • The KYxxL motif is crucial for the interaction with the 9–1–1 complex. • The KYxxL motif is dispensable or inhibitory for UV-induced Rad17 phosphorylation. • Nucleotide binding of Rad17 is required for its nuclear localization.

Codon based co-occurrence network motifs in human mitochondria

Directory of Open Access Journals (Sweden)

Pramod Shinde

2017-10-01

Full Text Available The nucleotide polymorphism in human mitochondrial genome (mtDNA tolled by codon position bias plays an indispensable role in human population dispersion and expansion. Herein, we constructed genome-wide nucleotide co-occurrence networks using a massive data consisting of five different geographical regions and around 3000 samples for each region. We developed a powerful network model to describe complex mitochondrial evolutionary patterns between codon and non-codon positions. It was interesting to report a different evolution of Asian genomes than those of the rest which is divulged by network motifs. We found evidence that mtDNA undergoes substantial amounts of adaptive evolution, a finding which was supported by a number of previous studies. The dominance of higher order motifs indicated the importance of long-range nucleotide co-occurrence in genomic diversity. Most notably, codon motifs apparently underpinned the preferences among codon positions for co-evolution which is probably highly biased during the origin of the genetic code. Our analyses manifested that codon position co-evolution is very well conserved across human sub-populations and independently maintained within human sub-populations implying the selective role of evolutionary processes on codon position co-evolution. Ergo, this study provided a framework to investigate cooperative genomic interactions which are critical in underlying complex mitochondrial evolution.

NNAlign: A Web-Based Prediction Method Allowing Non-Expert End-User Discovery of Sequence Motifs in Quantitative Peptide Data

DEFF Research Database (Denmark)

Andreatta, Massimo; Schafer-Nielsen, Claus; Lund, Ole

2011-01-01

Recent advances in high-throughput technologies have made it possible to generate both gene and protein sequence data at an unprecedented rate and scale thereby enabling entirely new "omics"-based approaches towards the analysis of complex biological processes. However, the amount and complexity...... to interpret large data sets. We have recently developed a method, NNAlign, which is generally applicable to any biological problem where quantitative peptide data is available. This method efficiently identifies underlying sequence patterns by simultaneously aligning peptide sequences and identifying motifs...... associated with quantitative readouts. Here, we provide a web-based implementation of NNAlign allowing non-expert end-users to submit their data (optionally adjusting method parameters), and in return receive a trained method (including a visual representation of the identified motif) that subsequently can...

Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

Directory of Open Access Journals (Sweden)

Yu-Hoon Kim

2014-01-01

Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.

An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

Directory of Open Access Journals (Sweden)

Tautz Diethard

2002-03-01

Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

Finishing and Special Motifs: Lessons Learned from CRISPR Analysis Using Next-Generation Draft Sequences (7th Annual SFAF Meeting, 2012)

Energy Technology Data Exchange (ETDEWEB)

Campbell, Catherine

2012-06-01

Catherine Campbell on "Finishing and Special Motifs: Lessons learned from CRISPR analysis using next-generation draft sequences" at the 2012 Sequencing, Finishing, Analysis in the Future Meeting held June 5-7, 2012 in Santa Fe, New Mexico.

Gene Isolation Using Degenerate Primers Targeting Protein Motif: A Laboratory Exercise

Science.gov (United States)

Yeo, Brandon Pei Hui; Foong, Lian Chee; Tam, Sheh May; Lee, Vivian; Hwang, Siaw San

2018-01-01

Structures and functions of protein motifs are widely included in many biology-based course syllabi. However, little emphasis is placed to link this knowledge to applications in biotechnology to enhance the learning experience. Here, the conserved motifs of nucleotide binding site-leucine rich repeats (NBS-LRR) proteins, successfully used for the…

Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Madura, K.; Prakash, S.

1986-01-01

The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

Space-related pharma-motifs for fast search of protein binding motifs and polypharmacological targets.

Science.gov (United States)

Chiu, Yi-Yuan; Lin, Chun-Yu; Lin, Chih-Ta; Hsu, Kai-Cheng; Chang, Li-Zen; Yang, Jinn-Moon

2012-01-01

To discover a compound inhibiting multiple proteins (i.e. polypharmacological targets) is a new paradigm for the complex diseases (e.g. cancers and diabetes). In general, the polypharmacological proteins often share similar local binding environments and motifs. As the exponential growth of the number of protein structures, to find the similar structural binding motifs (pharma-motifs) is an emergency task for drug discovery (e.g. side effects and new uses for old drugs) and protein functions. We have developed a Space-Related Pharmamotifs (called SRPmotif) method to recognize the binding motifs by searching against protein structure database. SRPmotif is able to recognize conserved binding environments containing spatially discontinuous pharma-motifs which are often short conserved peptides with specific physico-chemical properties for protein functions. Among 356 pharma-motifs, 56.5% interacting residues are highly conserved. Experimental results indicate that 81.1% and 92.7% polypharmacological targets of each protein-ligand complex are annotated with same biological process (BP) and molecular function (MF) terms, respectively, based on Gene Ontology (GO). Our experimental results show that the identified pharma-motifs often consist of key residues in functional (active) sites and play the key roles for protein functions. The SRPmotif is available at http://gemdock.life.nctu.edu.tw/SRP/. SRPmotif is able to identify similar pharma-interfaces and pharma-motifs sharing similar binding environments for polypharmacological targets by rapidly searching against the protein structure database. Pharma-motifs describe the conservations of binding environments for drug discovery and protein functions. Additionally, these pharma-motifs provide the clues for discovering new sequence-based motifs to predict protein functions from protein sequence databases. We believe that SRPmotif is useful for elucidating protein functions and drug discovery.

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

Defining a conformational consensus motif in cotransin-sensitive signal sequences: a proteomic and site-directed mutagenesis study.

Directory of Open Access Journals (Sweden)

Wolfgang Klein

Full Text Available The cyclodepsipeptide cotransin was described to inhibit the biosynthesis of a small subset of proteins by a signal sequence-discriminatory mechanism at the Sec61 protein-conducting channel. However, it was not clear how selective cotransin is, i.e. how many proteins are sensitive. Moreover, a consensus motif in signal sequences mediating cotransin sensitivity has yet not been described. To address these questions, we performed a proteomic study using cotransin-treated human hepatocellular carcinoma cells and the stable isotope labelling by amino acids in cell culture technique in combination with quantitative mass spectrometry. We used a saturating concentration of cotransin (30 micromolar to identify also less-sensitive proteins and to discriminate the latter from completely resistant proteins. We found that the biosynthesis of almost all secreted proteins was cotransin-sensitive under these conditions. In contrast, biosynthesis of the majority of the integral membrane proteins was cotransin-resistant. Cotransin sensitivity of signal sequences was neither related to their length nor to their hydrophobicity. Instead, in the case of signal anchor sequences, we identified for the first time a conformational consensus motif mediating cotransin sensitivity.

Defining a Conformational Consensus Motif in Cotransin-Sensitive Signal Sequences: A Proteomic and Site-Directed Mutagenesis Study

Science.gov (United States)

Klein, Wolfgang; Westendorf, Carolin; Schmidt, Antje; Conill-Cortés, Mercè; Rutz, Claudia; Blohs, Marcus; Beyermann, Michael; Protze, Jonas; Krause, Gerd; Krause, Eberhard; Schülein, Ralf

2015-01-01

The cyclodepsipeptide cotransin was described to inhibit the biosynthesis of a small subset of proteins by a signal sequence-discriminatory mechanism at the Sec61 protein-conducting channel. However, it was not clear how selective cotransin is, i.e. how many proteins are sensitive. Moreover, a consensus motif in signal sequences mediating cotransin sensitivity has yet not been described. To address these questions, we performed a proteomic study using cotransin-treated human hepatocellular carcinoma cells and the stable isotope labelling by amino acids in cell culture technique in combination with quantitative mass spectrometry. We used a saturating concentration of cotransin (30 micromolar) to identify also less-sensitive proteins and to discriminate the latter from completely resistant proteins. We found that the biosynthesis of almost all secreted proteins was cotransin-sensitive under these conditions. In contrast, biosynthesis of the majority of the integral membrane proteins was cotransin-resistant. Cotransin sensitivity of signal sequences was neither related to their length nor to their hydrophobicity. Instead, in the case of signal anchor sequences, we identified for the first time a conformational consensus motif mediating cotransin sensitivity. PMID:25806945

Annotating RNA motifs in sequences and alignments.

Science.gov (United States)

Gardner, Paul P; Eldai, Hisham

2015-01-01

RNA performs a diverse array of important functions across all cellular life. These functions include important roles in translation, building translational machinery and maturing messenger RNA. More recent discoveries include the miRNAs and bacterial sRNAs that regulate gene expression, the thermosensors, riboswitches and other cis-regulatory elements that help prokaryotes sense their environment and eukaryotic piRNAs that suppress transposition. However, there can be a long period between the initial discovery of a RNA and determining its function. We present a bioinformatic approach to characterize RNA motifs, which are critical components of many RNA structure-function relationships. These motifs can, in some instances, provide researchers with functional hypotheses for uncharacterized RNAs. Moreover, we introduce a new profile-based database of RNA motifs--RMfam--and illustrate some applications for investigating the evolution and functional characterization of RNA. All the data and scripts associated with this work are available from: https://github.com/ppgardne/RMfam. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

DMINDA: an integrated web server for DNA motif identification and analyses.

Science.gov (United States)

Ma, Qin; Zhang, Hanyuan; Mao, Xizeng; Zhou, Chuan; Liu, Bingqiang; Chen, Xin; Xu, Ying

2014-07-01

DMINDA (DNA motif identification and analyses) is an integrated web server for DNA motif identification and analyses, which is accessible at http://csbl.bmb.uga.edu/DMINDA/. This web site is freely available to all users and there is no login requirement. This server provides a suite of cis-regulatory motif analysis functions on DNA sequences, which are important to elucidation of the mechanisms of transcriptional regulation: (i) de novo motif finding for a given set of promoter sequences along with statistical scores for the predicted motifs derived based on information extracted from a control set, (ii) scanning motif instances of a query motif in provided genomic sequences, (iii) motif comparison and clustering of identified motifs, and (iv) co-occurrence analyses of query motifs in given promoter sequences. The server is powered by a backend computer cluster with over 150 computing nodes, and is particularly useful for motif prediction and analyses in prokaryotic genomes. We believe that DMINDA, as a new and comprehensive web server for cis-regulatory motif finding and analyses, will benefit the genomic research community in general and prokaryotic genome researchers in particular. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Automatic annotation of protein motif function with Gene Ontology terms

Directory of Open Access Journals (Sweden)

Gopalakrishnan Vanathi

2004-09-01

Full Text Available Abstract Background Conserved protein sequence motifs are short stretches of amino acid sequence patterns that potentially encode the function of proteins. Several sequence pattern searching algorithms and programs exist foridentifying candidate protein motifs at the whole genome level. However, amuch needed and importanttask is to determine the functions of the newly identified protein motifs. The Gene Ontology (GO project is an endeavor to annotate the function of genes or protein sequences with terms from a dynamic, controlled vocabulary and these annotations serve well as a knowledge base. Results This paperpresents methods to mine the GO knowledge base and use the association between the GO terms assigned to a sequence and the motifs matched by the same sequence as evidence for predicting the functions of novel protein motifs automatically. The task of assigning GO terms to protein motifsis viewed as both a binary classification and information retrieval problem, where PROSITE motifs are used as samples for mode training and functional prediction. The mutual information of a motif and aGO term association isfound to be a very useful feature. We take advantageof the known motifs to train a logistic regression classifier, which allows us to combine mutual information with other frequency-based features and obtain a probability of correctassociation. The trained logistic regression model has intuitively meaningful and logically plausible parameter values, and performs very well empirically according to our evaluation criteria. Conclusions In this research, different methods for automatic annotation of protein motifs have been investigated. Empirical result demonstrated that the methods have a great potential for detecting and augmenting information about thefunctions of newly discovered candidate protein motifs.

A comprehensive analysis of three Asiatic black bear mitochondrial genomes (subspecies ussuricus, formosanus and mupinensis), with emphasis on the complete mtDNA sequence of Ursus thibetanus ussuricus (Ursidae).

Science.gov (United States)

Hwang, Dae-Sik; Ki, Jang-Seu; Jeong, Dong-Hyuk; Kim, Bo-Hyun; Lee, Bae-Keun; Han, Sang-Hoon; Lee, Jae-Seong

2008-08-01

In the present paper, we describe the mitochondrial genome sequence of the Asiatic black bear (Ursus thibetanus ussuricus) with particular emphasis on the control region (CR), and compared with mitochondrial genomes on molecular relationships among the bears. The mitochondrial genome sequence of U. thibetanus ussuricus was 16,700 bp in size with mostly conserved structures (e.g. 13 protein-coding, two rRNA genes, 22 tRNA genes). The CR consisted of several typical conserved domains such as F, E, D, and C boxes, and a conserved sequence block. Nucleotide sequences and the repeated motifs in the CR were different among the bear species, and their copy numbers were also variable according to populations, even within F1 generations of U. thibetanus ussuricus. Comparative analyses showed that the CR D1 region was highly informative for the discrimination of the bear family. These findings suggest that nucleotide sequences of both repeated motifs and CR D1 in the bear family are good markers for species discriminations.

RNA motif search with data-driven element ordering.

Science.gov (United States)

Rampášek, Ladislav; Jimenez, Randi M; Lupták, Andrej; Vinař, Tomáš; Brejová, Broňa

2016-05-18

In this paper, we study the problem of RNA motif search in long genomic sequences. This approach uses a combination of sequence and structure constraints to uncover new distant homologs of known functional RNAs. The problem is NP-hard and is traditionally solved by backtracking algorithms. We have designed a new algorithm for RNA motif search and implemented a new motif search tool RNArobo. The tool enhances the RNAbob descriptor language, allowing insertions in helices, which enables better characterization of ribozymes and aptamers. A typical RNA motif consists of multiple elements and the running time of the algorithm is highly dependent on their ordering. By approaching the element ordering problem in a principled way, we demonstrate more than 100-fold speedup of the search for complex motifs compared to previously published tools. We have developed a new method for RNA motif search that allows for a significant speedup of the search of complex motifs that include pseudoknots. Such speed improvements are crucial at a time when the rate of DNA sequencing outpaces growth in computing. RNArobo is available at http://compbio.fmph.uniba.sk/rnarobo .

A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

Directory of Open Access Journals (Sweden)

Boulund Fredrik

2012-12-01

Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

Promzea: a pipeline for discovery of co-regulatory motifs in maize and other plant species and its application to the anthocyanin and phlobaphene biosynthetic pathways and the Maize Development Atlas.

Science.gov (United States)

Liseron-Monfils, Christophe; Lewis, Tim; Ashlock, Daniel; McNicholas, Paul D; Fauteux, François; Strömvik, Martina; Raizada, Manish N

2013-03-15

The discovery of genetic networks and cis-acting DNA motifs underlying their regulation is a major objective of transcriptome studies. The recent release of the maize genome (Zea mays L.) has facilitated in silico searches for regulatory motifs. Several algorithms exist to predict cis-acting elements, but none have been adapted for maize. A benchmark data set was used to evaluate the accuracy of three motif discovery programs: BioProspector, Weeder and MEME. Analysis showed that each motif discovery tool had limited accuracy and appeared to retrieve a distinct set of motifs. Therefore, using the benchmark, statistical filters were optimized to reduce the false discovery ratio, and then remaining motifs from all programs were combined to improve motif prediction. These principles were integrated into a user-friendly pipeline for motif discovery in maize called Promzea, available at http://www.promzea.org and on the Discovery Environment of the iPlant Collaborative website. Promzea was subsequently expanded to include rice and Arabidopsis. Within Promzea, a user enters cDNA sequences or gene IDs; corresponding upstream sequences are retrieved from the maize genome. Predicted motifs are filtered, combined and ranked. Promzea searches the chosen plant genome for genes containing each candidate motif, providing the user with the gene list and corresponding gene annotations. Promzea was validated in silico using a benchmark data set: the Promzea pipeline showed a 22% increase in nucleotide sensitivity compared to the best standalone program tool, Weeder, with equivalent nucleotide specificity. Promzea was also validated by its ability to retrieve the experimentally defined binding sites of transcription factors that regulate the maize anthocyanin and phlobaphene biosynthetic pathways. Promzea predicted additional promoter motifs, and genome-wide motif searches by Promzea identified 127 non-anthocyanin/phlobaphene genes that each contained all five predicted promoter

Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

Science.gov (United States)

Dunn, Joshua G; Weissman, Jonathan S

2016-11-22

Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

Methods for decoding Cas9 protospacer adjacent motif (PAM) sequences: A brief overview.

Science.gov (United States)

Karvelis, Tautvydas; Gasiunas, Giedrius; Siksnys, Virginijus

2017-05-15

Recently the Cas9, an RNA guided DNA endonuclease, emerged as a powerful tool for targeted genome manipulations. Cas9 protein can be reprogrammed to cleave, bind or nick any DNA target by simply changing crRNA sequence, however a short nucleotide sequence, termed PAM, is required to initiate crRNA hybridization to the DNA target. PAM sequence is recognized by Cas9 protein and must be determined experimentally for each Cas9 variant. Exploration of Cas9 orthologs could offer a diversity of PAM sequences and novel biochemical properties that may be beneficial for genome editing applications. Here we briefly review and compare Cas9 PAM identification assays that can be adopted for other PAM-dependent CRISPR-Cas systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

International Nuclear Information System (INIS)

Maat, J.

1978-01-01

A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

SIRW: A web server for the Simple Indexing and Retrieval System that combines sequence motif searches with keyword searches.

Science.gov (United States)

Ramu, Chenna

2003-07-01

SIRW (http://sirw.embl.de/) is a World Wide Web interface to the Simple Indexing and Retrieval System (SIR) that is capable of parsing and indexing various flat file databases. In addition it provides a framework for doing sequence analysis (e.g. motif pattern searches) for selected biological sequences through keyword search. SIRW is an ideal tool for the bioinformatics community for searching as well as analyzing biological sequences of interest.

Methods and statistics for combining motif match scores.

Science.gov (United States)

Bailey, T L; Gribskov, M

1998-01-01

Position-specific scoring matrices are useful for representing and searching for protein sequence motifs. A sequence family can often be described by a group of one or more motifs, and an effective search must combine the scores for matching a sequence to each of the motifs in the group. We describe three methods for combining match scores and estimating the statistical significance of the combined scores and evaluate the search quality (classification accuracy) and the accuracy of the estimate of statistical significance of each. The three methods are: 1) sum of scores, 2) sum of reduced variates, 3) product of score p-values. We show that method 3) is superior to the other two methods in both regards, and that combining motif scores indeed gives better search accuracy. The MAST sequence homology search algorithm utilizing the product of p-values scoring method is available for interactive use and downloading at URL http:/(/)www.sdsc.edu/MEME.

Nucleotide sequence of the human N-myc gene

International Nuclear Information System (INIS)

Stanton, L.W.; Schwab, M.; Bishop, J.M.

1986-01-01

Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

Effective Feature Selection for Classification of Promoter Sequences.

Directory of Open Access Journals (Sweden)

Kouser K

Full Text Available Exploring novel computational methods in making sense of biological data has not only been a necessity, but also productive. A part of this trend is the search for more efficient in silico methods/tools for analysis of promoters, which are parts of DNA sequences that are involved in regulation of expression of genes into other functional molecules. Promoter regions vary greatly in their function based on the sequence of nucleotides and the arrangement of protein-binding short-regions called motifs. In fact, the regulatory nature of the promoters seems to be largely driven by the selective presence and/or the arrangement of these motifs. Here, we explore computational classification of promoter sequences based on the pattern of motif distributions, as such classification can pave a new way of functional analysis of promoters and to discover the functionally crucial motifs. We make use of Position Specific Motif Matrix (PSMM features for exploring the possibility of accurately classifying promoter sequences using some of the popular classification techniques. The classification results on the complete feature set are low, perhaps due to the huge number of features. We propose two ways of reducing features. Our test results show improvement in the classification output after the reduction of features. The results also show that decision trees outperform SVM (Support Vector Machine, KNN (K Nearest Neighbor and ensemble classifier LibD3C, particularly with reduced features. The proposed feature selection methods outperform some of the popular feature transformation methods such as PCA and SVD. Also, the methods proposed are as accurate as MRMR (feature selection method but much faster than MRMR. Such methods could be useful to categorize new promoters and explore regulatory mechanisms of gene expressions in complex eukaryotic species.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

Science.gov (United States)

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

Energy Technology Data Exchange (ETDEWEB)

Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

1988-03-25

Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

Development and Characterization of Simple Sequence Repeat (SSR) Markers Based on RNA-Sequencing of Medicago sativa and In silico Mapping onto the M. truncatula Genome

Science.gov (United States)

Wang, Zan; Yu, Guohui; Shi, Binbin; Wang, Xuemin; Qiang, Haiping; Gao, Hongwen

2014-01-01

Sufficient codominant genetic markers are needed for various genetic investigations in alfalfa since the species is an outcrossing autotetraploid. With the newly developed next generation sequencing technology, a large amount of transcribed sequences of alfalfa have been generated and are available for identifying SSR markers by data mining. A total of 54,278 alfalfa non-redundant unigenes were assembled through the Illumina HiSeqTM 2000 sequencing technology. Based on 3,903 unigene sequences, 4,493 SSRs were identified. Tri-nucleotide repeats (56.71%) were the most abundant motif class while AG/CT (21.7%), AGG/CCT (19.8%), AAC/GTT (10.3%), ATC/ATG (8.8%), and ACC/GGT (6.3%) were the subsequent top five nucleotide repeat motifs. Eight hundred and thirty- seven EST-SSR primer pairs were successfully designed. Of these, 527 (63%) primer pairs yielded clear and scored PCR products and 372 (70.6%) exhibited polymorphisms. High transferability was observed for ssp falcata at 99.2% (523) and 71.7% (378) in M. truncatula. In addition, 313 of 527 SSR marker sequences were in silico mapped onto the eight M. truncatula chromosomes. Thirty-six polymorphic SSR primer pairs were used in the genetic relatedness analysis of 30 Chinese alfalfa cultivated accessions generating a total of 199 scored alleles. The mean observed heterozygosity and polymorphic information content were 0.767 and 0.635, respectively. The codominant markers not only enriched the current resources of molecular markers in alfalfa, but also would facilitate targeted investigations in marker-trait association, QTL mapping, and genetic diversity analysis in alfalfa. PMID:24642969

Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

Science.gov (United States)

Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

2016-03-01

The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

Validation of Skeletal Muscle cis-Regulatory Module Predictions Reveals Nucleotide Composition Bias in Functional Enhancers

Science.gov (United States)

Kwon, Andrew T.; Chou, Alice Yi; Arenillas, David J.; Wasserman, Wyeth W.

2011-01-01

We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs) using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions. PMID:22144875

Validation of skeletal muscle cis-regulatory module predictions reveals nucleotide composition bias in functional enhancers.

Directory of Open Access Journals (Sweden)

Andrew T Kwon

2011-12-01

Full Text Available We performed a genome-wide scan for muscle-specific cis-regulatory modules (CRMs using three computational prediction programs. Based on the predictions, 339 candidate CRMs were tested in cell culture with NIH3T3 fibroblasts and C2C12 myoblasts for capacity to direct selective reporter gene expression to differentiated C2C12 myotubes. A subset of 19 CRMs validated as functional in the assay. The rate of predictive success reveals striking limitations of computational regulatory sequence analysis methods for CRM discovery. Motif-based methods performed no better than predictions based only on sequence conservation. Analysis of the properties of the functional sequences relative to inactive sequences identifies nucleotide sequence composition can be an important characteristic to incorporate in future methods for improved predictive specificity. Muscle-related TFBSs predicted within the functional sequences display greater sequence conservation than non-TFBS flanking regions. Comparison with recent MyoD and histone modification ChIP-Seq data supports the validity of the functional regions.

Hybrid DNA i-motif: Aminoethylprolyl-PNA (pC5) enhance the stability of DNA (dC5) i-motif structure.

Science.gov (United States)

Gade, Chandrasekhar Reddy; Sharma, Nagendra K

2017-12-15

This report describes the synthesis of C-rich sequence, cytosine pentamer, of aep-PNA and its biophysical studies for the formation of hybrid DNA:aep-PNAi-motif structure with DNA cytosine pentamer (dC 5 ) under acidic pH conditions. Herein, the CD/UV/NMR/ESI-Mass studies strongly support the formation of stable hybrid DNA i-motif structure with aep-PNA even near acidic conditions. Hence aep-PNA C-rich sequence cytosine could be considered as potential DNA i-motif stabilizing agents in vivo conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Science.gov (United States)

2010-07-01

... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...

Novel Nucleotide Variations, Haplotypes Structure and Associations with Growth Related Traits of Goat AT Motif-Binding Factor ( Gene

Directory of Open Access Journals (Sweden)

Xiaoyan Zhang

2015-10-01

Full Text Available The AT motif-binding factor (ATBF1 not only interacts with protein inhibitor of activated signal transducer and activator of transcription 3 (STAT3 (PIAS3 to suppress STAT3 signaling regulating embryo early development and cell differentiation, but is required for early activation of the pituitary specific transcription factor 1 (Pit1 gene (also known as POU1F1 critically affecting mammalian growth and development. The goal of this study was to detect novel nucleotide variations and haplotypes structure of the ATBF1 gene, as well as to test their associations with growth-related traits in goats. Herein, a total of seven novel single nucleotide polymorphisms (SNPs (SNP 1-7 within this gene were found in two well-known Chinese native goat breeds. Haplotypes structure analysis demonstrated that there were four haplotypes in Hainan black goat while seventeen haplotypes in Xinong Saanen dairy goat, and both breeds only shared one haplotype (hap1. Association testing revealed that the SNP2, SNP5, SNP6, and SNP7 loci were also found to significantly associate with growth-related traits in goats, respectively. Moreover, one diplotype in Xinong Saanen dairy goats significantly linked to growth related traits. These preliminary findings not only would extend the spectrum of genetic variations of the goat ATBF1 gene, but also would contribute to implementing marker-assisted selection in genetics and breeding in goats.

Base Sequence Context Effects on Nucleotide Excision Repair

Directory of Open Access Journals (Sweden)

Yuqin Cai

2010-01-01

Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

Two sequence motifs from HIF-1α bind to the DNA-binding site of p53

OpenAIRE

Hansson, Lars O.; Friedler, Assaf; Freund, Stefan; Rüdiger, Stefan; Fersht, Alan R.

2002-01-01

There is evidence that hypoxia-inducible factor-1α (HIF-1α) interacts with the tumor suppressor p53. To characterize the putative interaction, we mapped the binding of the core domain of p53 (p53c) to an array of immobilized HIF-1α-derived peptides and found two peptide-sequence motifs that bound to p53c with micromolar affinity in solution. One sequence was adjacent to and the other coincided with the two proline residues of the oxygen-dependent degradation domain (P402 and P564) that act as...

Genome Analysis of Conserved Dehydrin Motifs in Vascular Plants

Directory of Open Access Journals (Sweden)

Ahmad A. Malik

2017-05-01

Full Text Available Dehydrins, a large family of abiotic stress proteins, are defined by the presence of a mostly conserved motif known as the K-segment, and may also contain two other conserved motifs known as the Y-segment and S-segment. Using the dehydrin literature, we developed a sequence motif definition of the K-segment, which we used to create a large dataset of dehydrin sequences by searching the Pfam00257 dehydrin dataset and the Phytozome 10 sequences of vascular plants. A comprehensive analysis of these sequences reveals that lysine residues are highly conserved in the K-segment, while the amino acid type is often conserved at other positions. Despite the Y-segment name, the central tyrosine is somewhat conserved, but can be substituted with two other small aromatic amino acids (phenylalanine or histidine. The S-segment contains a series of serine residues, but in some proteins is also preceded by a conserved LHR sequence. In many dehydrins containing all three of these motifs the S-segment is linked to the K-segment by a GXGGRRKK motif (where X can be any amino acid, suggesting a functional linkage between these two motifs. An analysis of the sequences shows that the dehydrin architecture and several biochemical properties (isoelectric point, molecular mass, and hydrophobicity score are dependent on each other, and that some dehydrin architectures are overexpressed during certain abiotic stress, suggesting that they may be optimized for a specific abiotic stress while others are involved in all forms of dehydration stress (drought, cold, and salinity.

Metamotifs - a generative model for building families of nucleotide position weight matrices

Directory of Open Access Journals (Sweden)

Down Thomas A

2010-06-01

Full Text Available Abstract Background Development of high-throughput methods for measuring DNA interactions of transcription factors together with computational advances in short motif inference algorithms is expanding our understanding of transcription factor binding site motifs. The consequential growth of sequence motif data sets makes it important to systematically group and categorise regulatory motifs. It has been shown that there are familial tendencies in DNA sequence motifs that are predictive of the family of factors that binds them. Further development of methods that detect and describe familial motif trends has the potential to help in measuring the similarity of novel computational motif predictions to previously known data and sensitively detecting regulatory motifs similar to previously known ones from novel sequence. Results We propose a probabilistic model for position weight matrix (PWM sequence motif families. The model, which we call the 'metamotif' describes recurring familial patterns in a set of motifs. The metamotif framework models variation within a family of sequence motifs. It allows for simultaneous estimation of a series of independent metamotifs from input position weight matrix (PWM motif data and does not assume that all input motif columns contribute to a familial pattern. We describe an algorithm for inferring metamotifs from weight matrix data. We then demonstrate the use of the model in two practical tasks: in the Bayesian NestedMICA model inference algorithm as a PWM prior to enhance motif inference sensitivity, and in a motif classification task where motifs are labelled according to their interacting DNA binding domain. Conclusions We show that metamotifs can be used as PWM priors in the NestedMICA motif inference algorithm to dramatically increase the sensitivity to infer motifs. Metamotifs were also successfully applied to a motif classification problem where sequence motif features were used to predict the family of

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

Science.gov (United States)

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

Motif decomposition of the phosphotyrosine proteome reveals a new N-terminal binding motif for SHIP2

DEFF Research Database (Denmark)

Miller, Martin Lee; Hanke, S.; Hinsby, A. M.

2008-01-01

set of 481 unique phosphotyrosine (Tyr(P)) peptides by sequence similarity to known ligands of the Src homology 2 (SH2) and the phosphotyrosine binding (PTB) domains. From 20 clusters we extracted 16 known and four new interaction motifs. Using quantitative mass spectrometry we pulled down Tyr......(P)-specific binding partners for peptides corresponding to the extracted motifs. We confirmed numerous previously known interaction motifs and found 15 new interactions mediated by phosphosites not previously known to bind SH2 or PTB. Remarkably, a novel hydrophobic N-terminal motif ((L/V/I)(L/V/I)pY) was identified...

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

Science.gov (United States)

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

Science.gov (United States)

Han, S S; Karasev, A V; Ieki, H; Iwanami, T

2002-11-01

Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

Science.gov (United States)

Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

1998-07-01

An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

Expressed Sequence Tag-Simple Sequence Repeat (EST-SSR Marker Resources for Diversity Analysis of Mango (Mangifera indica L.

Directory of Open Access Journals (Sweden)

Natalie L. Dillon

2014-01-01

Full Text Available In this study, a collection of 24,840 expressed sequence tags (ESTs generated from five mango (Mangifera indica L. cDNA libraries was mined for EST-based simple sequence repeat (SSR markers. Over 1,000 ESTs with SSR motifs were detected from more than 24,000 EST sequences with di- and tri-nucleotide repeat motifs the most abundant. Of these, 25 EST-SSRs in genes involved in plant development, stress response, and fruit color and flavor development pathways were selected, developed into PCR markers and characterized in a population of 32 mango selections including M. indica varieties, and related Mangifera species. Twenty-four of the 25 EST-SSR markers exhibited polymorphisms, identifying a total of 86 alleles with an average of 5.38 alleles per locus, and distinguished between all Mangifera selections. Private alleles were identified for Mangifera species. These newly developed EST-SSR markers enhance the current 11 SSR mango genetic identity panel utilized by the Australian Mango Breeding Program. The current panel has been used to identify progeny and parents for selection and the application of this extended panel will further improve and help to design mango hybridization strategies for increased breeding efficiency.

Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

Energy Technology Data Exchange (ETDEWEB)

Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

1987-02-01

To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

Science.gov (United States)

Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

Sequence requirement of the ade6-4095 meiotic recombination hotspot in Schizosaccharomyces pombe.

Science.gov (United States)

Foulis, Steven J; Fowler, Kyle R; Steiner, Walter W

2018-02-01

Homologous recombination occurs at a greatly elevated frequency in meiosis compared to mitosis and is initiated by programmed double-strand DNA breaks (DSBs). DSBs do not occur at uniform frequency throughout the genome in most organisms, but occur preferentially at a limited number of sites referred to as hotspots. The location of hotspots have been determined at nucleotide-level resolution in both the budding and fission yeasts, and while several patterns have emerged regarding preferred locations for DSB hotspots, it remains unclear why particular sites experience DSBs at much higher frequency than other sites with seemingly similar properties. Short sequence motifs, which are often sites for binding of transcription factors, are known to be responsible for a number of hotspots. In this study we identified the minimum sequence required for activity of one of such motif identified in a screen of random sequences capable of producing recombination hotspots. The experimentally determined sequence, GGTCTRGACC, closely matches the previously inferred sequence. Full hotspot activity requires an effective sequence length of 9.5 bp, whereas moderate activity requires an effective sequence length of approximately 8.2 bp and shows significant association with DSB hotspots. In combination with our previous work, this result is consistent with a large number of different sequence motifs capable of producing recombination hotspots, and supports a model in which hotspots can be rapidly regenerated by mutation as they are lost through recombination.

Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

Directory of Open Access Journals (Sweden)

White Frank F

2011-07-01

Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

Science.gov (United States)

Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

2012-01-01

Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

Science.gov (United States)

Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

2012-07-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

Identification of a novel calcium binding motif based on the detection of sequence insertions in the animal peroxidase domain of bacterial proteins.

Science.gov (United States)

Santamaría-Hernando, Saray; Krell, Tino; Ramos-González, María-Isabel

2012-01-01

Proteins of the animal heme peroxidase (ANP) superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20), where it was found to be involved in Ca(2+) coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+) binding with a K(D) of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821) is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of life.

Identification of a novel calcium binding motif based on the detection of sequence insertions in the animal peroxidase domain of bacterial proteins.

Directory of Open Access Journals (Sweden)

Saray Santamaría-Hernando

Full Text Available Proteins of the animal heme peroxidase (ANP superfamily differ greatly in size since they have either one or two catalytic domains that match profile PS50292. The orf PP_2561 of Pseudomonas putida KT2440 that we have called PepA encodes a two-domain ANP. The alignment of these domains with those of PepA homologues revealed a variable number of insertions with the consensus G-x-D-G-x-x-[GN]-[TN]-x-D-D. This motif has also been detected in the structure of pseudopilin (pdb 3G20, where it was found to be involved in Ca(2+ coordination although a sequence analysis did not reveal the presence of any known calcium binding motifs in this protein. Isothermal titration calorimetry revealed that a peptide containing this consensus motif bound specifically calcium ions with affinities ranging between 33-79 µM depending on the pH. Microcalorimetric titrations of the purified N-terminal ANP-like domain of PepA revealed Ca(2+ binding with a K(D of 12 µM and stoichiometry of 1.25 calcium ions per protein monomer. This domain exhibited peroxidase activity after its reconstitution with heme. These data led to the definition of a novel calcium binding motif that we have termed PERCAL and which was abundantly present in animal peroxidase-like domains of bacterial proteins. Bacterial heme peroxidases thus possess two different types of calcium binding motifs, namely PERCAL and the related hemolysin type calcium binding motif, with the latter being located outside the catalytic domains and in their C-terminal end. A phylogenetic tree of ANP-like catalytic domains of bacterial proteins with PERCAL motifs, including single domain peroxidases, was divided into two major clusters, representing domains with and without PERCAL motif containing insertions. We have verified that the recently reported classification of bacterial heme peroxidases in two families (cd09819 and cd09821 is unrelated to these insertions. Sequences matching PERCAL were detected in all kingdoms of

RegRNA: an integrated web server for identifying regulatory RNA motifs and elements

OpenAIRE

Huang, Hsi-Yuan; Chien, Chia-Hung; Jen, Kuan-Hua; Huang, Hsien-Da

2006-01-01

Numerous regulatory structural motifs have been identified as playing essential roles in transcriptional and post-transcriptional regulation of gene expression. RegRNA is an integrated web server for identifying the homologs of regulatory RNA motifs and elements against an input mRNA sequence. Both sequence homologs and structural homologs of regulatory RNA motifs can be recognized. The regulatory RNA motifs supported in RegRNA are categorized into several classes: (i) motifs in mRNA 5′-untra...

MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

Science.gov (United States)

Ozaki, Haruka; Iwasaki, Wataru

2016-08-01

As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

NARCIS (Netherlands)

Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

Science.gov (United States)

Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

2011-04-01

A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1987-01-01

The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

Large-scale discovery of promoter motifs in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Thomas A Down

2007-01-01

Full Text Available A key step in understanding gene regulation is to identify the repertoire of transcription factor binding motifs (TFBMs that form the building blocks of promoters and other regulatory elements. Identifying these experimentally is very laborious, and the number of TFBMs discovered remains relatively small, especially when compared with the hundreds of transcription factor genes predicted in metazoan genomes. We have used a recently developed statistical motif discovery approach, NestedMICA, to detect candidate TFBMs from a large set of Drosophila melanogaster promoter regions. Of the 120 motifs inferred in our initial analysis, 25 were statistically significant matches to previously reported motifs, while 87 appeared to be novel. Analysis of sequence conservation and motif positioning suggested that the great majority of these discovered motifs are predictive of functional elements in the genome. Many motifs showed associations with specific patterns of gene expression in the D. melanogaster embryo, and we were able to obtain confident annotation of expression patterns for 25 of our motifs, including eight of the novel motifs. The motifs are available through Tiffin, a new database of DNA sequence motifs. We have discovered many new motifs that are overrepresented in D. melanogaster promoter regions, and offer several independent lines of evidence that these are novel TFBMs. Our motif dictionary provides a solid foundation for further investigation of regulatory elements in Drosophila, and demonstrates techniques that should be applicable in other species. We suggest that further improvements in computational motif discovery should narrow the gap between the set of known motifs and the total number of transcription factors in metazoan genomes.

SeqVISTA: a graphical tool for sequence feature visualization and comparison

Directory of Open Access Journals (Sweden)

Niu Tianhua

2003-01-01

Full Text Available Abstract Background Many readers will sympathize with the following story. You are viewing a gene sequence in Entrez, and you want to find whether it contains a particular sequence motif. You reach for the browser's "find in page" button, but those darn spaces every 10 bp get in the way. And what if the motif is on the opposite strand? Subsequently, your favorite sequence analysis software informs you that there is an interesting feature at position 13982–14013. By painstakingly counting the 10 bp blocks, you are able to examine the sequence at this location. But now you want to see what other features have been annotated close by, and this information is buried several screenfuls higher up the web page. Results SeqVISTA presents a holistic, graphical view of features annotated on nucleotide or protein sequences. This interactive tool highlights the residues in the sequence that correspond to features chosen by the user, and allows easy searching for sequence motifs or extraction of particular subsequences. SeqVISTA is able to display results from diverse sequence analysis tools in an integrated fashion, and aims to provide much-needed unity to the bioinformatics resources scattered around the Internet. Our viewer may be launched on a GenBank record by a single click of a button installed in the web browser. Conclusion SeqVISTA allows insights to be gained by viewing the totality of sequence annotations and predictions, which may be more revealing than the sum of their parts. SeqVISTA runs on any operating system with a Java 1.4 virtual machine. It is freely available to academic users at http://zlab.bu.edu/SeqVISTA.

CMD: A Database to Store the Bonding States of Cysteine Motifs with Secondary Structures

Directory of Open Access Journals (Sweden)

Hamed Bostan

2012-01-01

Full Text Available Computational approaches to the disulphide bonding state and its connectivity pattern prediction are based on various descriptors. One descriptor is the amino acid sequence motifs flanking the cysteine residue motifs. Despite the existence of disulphide bonding information in many databases and applications, there is no complete reference and motif query available at the moment. Cysteine motif database (CMD is the first online resource that stores all cysteine residues, their flanking motifs with their secondary structure, and propensity values assignment derived from the laboratory data. We extracted more than 3 million cysteine motifs from PDB and UniProt data, annotated with secondary structure assignment, propensity value assignment, and frequency of occurrence and coefficiency of their bonding status. Removal of redundancies generated 15875 unique flanking motifs that are always bonded and 41577 unique patterns that are always nonbonded. Queries are based on the protein ID, FASTA sequence, sequence motif, and secondary structure individually or in batch format using the provided APIs that allow remote users to query our database via third party software and/or high throughput screening/querying. The CMD offers extensive information about the bonded, free cysteine residues, and their motifs that allows in-depth characterization of the sequence motif composition.

The nucleotide sequence of a Polish isolate of Tomato torrado virus.

Science.gov (United States)

Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

2008-12-01

A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

Directory of Open Access Journals (Sweden)

Meiler Arno

2012-09-01

Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

Science.gov (United States)

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

Motif signatures of transcribed enhancers

KAUST Repository

Kleftogiannis, Dimitrios

2017-09-14

In mammalian cells, transcribed enhancers (TrEn) play important roles in the initiation of gene expression and maintenance of gene expression levels in spatiotemporal manner. One of the most challenging questions in biology today is how the genomic characteristics of enhancers relate to enhancer activities. This is particularly critical, as several recent studies have linked enhancer sequence motifs to specific functional roles. To date, only a limited number of enhancer sequence characteristics have been investigated, leaving space for exploring the enhancers genomic code in a more systematic way. To address this problem, we developed a novel computational method, TELS, aimed at identifying predictive cell type/tissue specific motif signatures. We used TELS to compile a comprehensive catalog of motif signatures for all known TrEn identified by the FANTOM5 consortium across 112 human primary cells and tissues. Our results confirm that distinct cell type/tissue specific motif signatures characterize TrEn. These signatures allow discriminating successfully a) TrEn from random controls, proxy of non-enhancer activity, and b) cell type/tissue specific TrEn from enhancers expressed and transcribed in different cell types/tissues. TELS codes and datasets are publicly available at http://www.cbrc.kaust.edu.sa/TELS.

Simple sequence repeat marker development from bacterial artificial chromosome end sequences and expressed sequence tags of flax (Linum usitatissimum L.).

Science.gov (United States)

Cloutier, Sylvie; Miranda, Evelyn; Ward, Kerry; Radovanovic, Natasa; Reimer, Elsa; Walichnowski, Andrzej; Datla, Raju; Rowland, Gordon; Duguid, Scott; Ragupathy, Raja

2012-08-01

Flax is an important oilseed crop in North America and is mostly grown as a fibre crop in Europe. As a self-pollinated diploid with a small estimated genome size of ~370 Mb, flax is well suited for fast progress in genomics. In the last few years, important genetic resources have been developed for this crop. Here, we describe the assessment and comparative analyses of 1,506 putative simple sequence repeats (SSRs) of which, 1,164 were derived from BAC-end sequences (BESs) and 342 from expressed sequence tags (ESTs). The SSRs were assessed on a panel of 16 flax accessions with 673 (58 %) and 145 (42 %) primer pairs being polymorphic in the BESs and ESTs, respectively. With 818 novel polymorphic SSR primer pairs reported in this study, the repertoire of available SSRs in flax has more than doubled from the combined total of 508 of all previous reports. Among nucleotide motifs, trinucleotides were the most abundant irrespective of the class, but dinucleotides were the most polymorphic. SSR length was also positively correlated with polymorphism. Two dinucleotide (AT/TA and AG/GA) and two trinucleotide (AAT/ATA/TAA and GAA/AGA/AAG) motifs and their iterations, different from those reported in many other crops, accounted for more than half of all the SSRs and were also more polymorphic (63.4 %) than the rest of the markers (42.7 %). This improved resource promises to be useful in genetic, quantitative trait loci (QTL) and association mapping as well as for anchoring the physical/genetic map with the whole genome shotgun reference sequence of flax.

Efficient motif finding algorithms for large-alphabet inputs

Directory of Open Access Journals (Sweden)

Pavlovic Vladimir

2010-10-01

Full Text Available Abstract Background We consider the problem of identifying motifs, recurring or conserved patterns, in the biological sequence data sets. To solve this task, we present a new deterministic algorithm for finding patterns that are embedded as exact or inexact instances in all or most of the input strings. Results The proposed algorithm (1 improves search efficiency compared to existing algorithms, and (2 scales well with the size of alphabet. On a synthetic planted DNA motif finding problem our algorithm is over 10× more efficient than MITRA, PMSPrune, and RISOTTO for long motifs. Improvements are orders of magnitude higher in the same setting with large alphabets. On benchmark TF-binding site problems (FNP, CRP, LexA we observed reduction in running time of over 12×, with high detection accuracy. The algorithm was also successful in rapidly identifying protein motifs in Lipocalin, Zinc metallopeptidase, and supersecondary structure motifs for Cadherin and Immunoglobin families. Conclusions Our algorithm reduces computational complexity of the current motif finding algorithms and demonstrate strong running time improvements over existing exact algorithms, especially in important and difficult cases of large-alphabet sequences.

A cyclic nucleotide-gated channel mutation associated with canine daylight blindness provides insight into a role for the S2 segment tri-Asp motif in channel biogenesis.

Directory of Open Access Journals (Sweden)

Naoto Tanaka

Full Text Available Cone cyclic nucleotide-gated channels are tetramers formed by CNGA3 and CNGB3 subunits; CNGA3 subunits function as homotetrameric channels but CNGB3 exhibits channel function only when co-expressed with CNGA3. An aspartatic acid (Asp to asparagine (Asn missense mutation at position 262 in the canine CNGB3 (D262N subunit results in loss of cone function (daylight blindness, suggesting an important role for this aspartic acid residue in channel biogenesis and/or function. Asp 262 is located in a conserved region of the second transmembrane segment containing three Asp residues designated the Tri-Asp motif. This motif is conserved in all CNG channels. Here we examine mutations in canine CNGA3 homomeric channels using a combination of experimental and computational approaches. Mutations of these conserved Asp residues result in the absence of nucleotide-activated currents in heterologous expression. A fluorescent tag on CNGA3 shows mislocalization of mutant channels. Co-expressing CNGB3 Tri-Asp mutants with wild type CNGA3 results in some functional channels, however, their electrophysiological characterization matches the properties of homomeric CNGA3 channels. This failure to record heteromeric currents suggests that Asp/Asn mutations affect heteromeric subunit assembly. A homology model of S1-S6 of the CNGA3 channel was generated and relaxed in a membrane using molecular dynamics simulations. The model predicts that the Tri-Asp motif is involved in non-specific salt bridge pairings with positive residues of S3/S4. We propose that the D262N mutation in dogs with CNGB3-day blindness results in the loss of these inter-helical interactions altering the electrostatic equilibrium within in the S1-S4 bundle. Because residues analogous to Tri-Asp in the voltage-gated Shaker potassium channel family were implicated in monomer folding, we hypothesize that destabilizing these electrostatic interactions impairs the monomer folding state in D262N mutant CNG

Fast social-like learning of complex behaviors based on motor motifs

Science.gov (United States)

Calvo Tapia, Carlos; Tyukin, Ivan Y.; Makarov, Valeri A.

2018-05-01

Social learning is widely observed in many species. Less experienced agents copy successful behaviors exhibited by more experienced individuals. Nevertheless, the dynamical mechanisms behind this process remain largely unknown. Here we assume that a complex behavior can be decomposed into a sequence of n motor motifs. Then a neural network capable of activating motor motifs in a given sequence can drive an agent. To account for (n -1 )! possible sequences of motifs in a neural network, we employ the winnerless competition approach. We then consider a teacher-learner situation: one agent exhibits a complex movement, while another one aims at mimicking the teacher's behavior. Despite the huge variety of possible motif sequences we show that the learner, equipped with the provided learning model, can rewire "on the fly" its synaptic couplings in no more than (n -1 ) learning cycles and converge exponentially to the durations of the teacher's motifs. We validate the learning model on mobile robots. Experimental results show that the learner is indeed capable of copying the teacher's behavior composed of six motor motifs in a few learning cycles. The reported mechanism of learning is general and can be used for replicating different functions, including, for example, sound patterns or speech.

A generalized allosteric mechanism for cis-regulated cyclic nucleotide binding domains.

Directory of Open Access Journals (Sweden)

Alexandr P Kornev

2008-04-01

Full Text Available Cyclic nucleotides (cAMP and cGMP regulate multiple intracellular processes and are thus of a great general interest for molecular and structural biologists. To study the allosteric mechanism of different cyclic nucleotide binding (CNB domains, we compared cAMP-bound and cAMP-free structures (PKA, Epac, and two ionic channels using a new bioinformatics method: local spatial pattern alignment. Our analysis highlights four major conserved structural motifs: 1 the phosphate binding cassette (PBC, which binds the cAMP ribose-phosphate, 2 the "hinge," a flexible helix, which contacts the PBC, 3 the beta(2,3 loop, which provides precise positioning of an invariant arginine from the PBC, and 4 a conserved structural element consisting of an N-terminal helix, an eight residue loop and the A-helix (N3A-motif. The PBC and the hinge were included in the previously reported allosteric model, whereas the definition of the beta(2,3 loop and the N3A-motif as conserved elements is novel. The N3A-motif is found in all cis-regulated CNB domains, and we present a model for an allosteric mechanism in these domains. Catabolite gene activator protein (CAP represents a trans-regulated CNB domain family: it does not contain the N3A-motif, and its long range allosteric interactions are substantially different from the cis-regulated CNB domains.

Finding a Leucine in a Haystack: Searching the Proteome for ambigous Leucine-Aspartic Acid motifs

KAUST Repository

Arold, Stefan T.

2016-01-25

Leucine-aspartic acid (LD) motifs are short helical protein-protein interaction motifs involved in cell motility, survival and communication. LD motif interactions are also implicated in cancer metastasis and are targeted by several viruses. LD motifs are notoriously difficult to detect because sequence pattern searches lead to an excessively high number of false positives. Hence, despite 20 years of research, only six LD motif–containing proteins are known in humans, three of which are close homologues of the paxillin family. To enable the proteome-wide discovery of LD motifs, we developed LD Motif Finder (LDMF), a web tool based on machine learning that combines sequence information with structural predictions to detect LD motifs with high accuracy. LDMF predicted 13 new LD motifs in humans. Using biophysical assays, we experimentally confirmed in vitro interactions for four novel LD motif proteins. Thus, LDMF allows proteome-wide discovery of LD motifs, despite a highly ambiguous sequence pattern. Functional implications will be discussed.

Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

International Nuclear Information System (INIS)

Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

1987-01-01

Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

Armadillo motifs involved in vesicular transport.

Directory of Open Access Journals (Sweden)

Harald Striegl

Full Text Available Armadillo (ARM repeat proteins function in various cellular processes including vesicular transport and membrane tethering. They contain an imperfect repeating sequence motif that forms a conserved three-dimensional structure. Recently, structural and functional insight into tethering mediated by the ARM-repeat protein p115 has been provided. Here we describe the p115 ARM-motifs for reasons of clarity and nomenclature and show that both sequence and structure are highly conserved among ARM-repeat proteins. We argue that there is no need to invoke repeat types other than ARM repeats for a proper description of the structure of the p115 globular head region. Additionally, we propose to define a new subfamily of ARM-like proteins and show lack of evidence that the ARM motifs found in p115 are present in other long coiled-coil tethering factors of the golgin family.

Efficient farnesylation of an extended C-terminal C(x)3X sequence motif expands the scope of the prenylated proteome.

Science.gov (United States)

Blanden, Melanie J; Suazo, Kiall F; Hildebrandt, Emily R; Hardgrove, Daniel S; Patel, Meet; Saunders, William P; Distefano, Mark D; Schmidt, Walter K; Hougland, James L

2018-02-23

Protein prenylation is a post-translational modification that has been most commonly associated with enabling protein trafficking to and interaction with cellular membranes. In this process, an isoprenoid group is attached to a cysteine near the C terminus of a substrate protein by protein farnesyltransferase (FTase) or protein geranylgeranyltransferase type I or II (GGTase-I and GGTase-II). FTase and GGTase-I have long been proposed to specifically recognize a four-amino acid C AAX C-terminal sequence within their substrates. Surprisingly, genetic screening reveals that yeast FTase can modify sequences longer than the canonical C AAX sequence, specifically C( x ) 3 X sequences with four amino acids downstream of the cysteine. Biochemical and cell-based studies using both peptide and protein substrates reveal that mammalian FTase orthologs can also prenylate C( x ) 3 X sequences. As the search to identify physiologically relevant C( x ) 3 X proteins begins, this new prenylation motif nearly doubles the number of proteins within the yeast and human proteomes that can be explored as potential FTase substrates. This work expands our understanding of prenylation's impact within the proteome, establishes the biologically relevant reactivity possible with this new motif, and opens new frontiers in determining the impact of non-canonically prenylated proteins on cell function. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

Science.gov (United States)

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

Directory of Open Access Journals (Sweden)

Francesca Bertolini

Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

NARCIS (Netherlands)

Steenbergh, P.H.; Sussenbach, J.S.

The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

OpenAIRE

Liljeström, P L; Liljeström, P

1987-01-01

Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

Deciphering functional glycosaminoglycan motifs in development.

Science.gov (United States)

Townley, Robert A; Bülow, Hannes E

2018-03-23

Glycosaminoglycans (GAGs) such as heparan sulfate, chondroitin/dermatan sulfate, and keratan sulfate are linear glycans, which when attached to protein backbones form proteoglycans. GAGs are essential components of the extracellular space in metazoans. Extensive modifications of the glycans such as sulfation, deacetylation and epimerization create structural GAG motifs. These motifs regulate protein-protein interactions and are thereby repsonsible for many of the essential functions of GAGs. This review focusses on recent genetic approaches to characterize GAG motifs and their function in defined signaling pathways during development. We discuss a coding approach for GAGs that would enable computational analyses of GAG sequences such as alignments and the computation of position weight matrices to describe GAG motifs. Copyright © 2018 Elsevier Ltd. All rights reserved.

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Science.gov (United States)

2010-07-01

... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

Science.gov (United States)

Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

1992-12-01

The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

Science.gov (United States)

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

International Nuclear Information System (INIS)

Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

1987-01-01

Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

Science.gov (United States)

Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

2013-07-01

The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

Convergent evolution and mimicry of protein linear motifs in host-pathogen interactions.

Science.gov (United States)

Chemes, Lucía Beatriz; de Prat-Gay, Gonzalo; Sánchez, Ignacio Enrique

2015-06-01

Pathogen linear motif mimics are highly evolvable elements that facilitate rewiring of host protein interaction networks. Host linear motifs and pathogen mimics differ in sequence, leading to thermodynamic and structural differences in the resulting protein-protein interactions. Moreover, the functional output of a mimic depends on the motif and domain repertoire of the pathogen protein. Regulatory evolution mediated by linear motifs can be understood by measuring evolutionary rates, quantifying positive and negative selection and performing phylogenetic reconstructions of linear motif natural history. Convergent evolution of linear motif mimics is widespread among unrelated proteins from viral, prokaryotic and eukaryotic pathogens and can also take place within individual protein phylogenies. Statistics, biochemistry and laboratory models of infection link pathogen linear motifs to phenotypic traits such as tropism, virulence and oncogenicity. In vitro evolution experiments and analysis of natural sequences suggest that changes in linear motif composition underlie pathogen adaptation to a changing environment. Copyright © 2015 Elsevier Ltd. All rights reserved.

Conserved XPB Core Structure and Motifs for DNA Unwinding:Implications for Pathway Selection of Transcription or ExcisionRepair

Energy Technology Data Exchange (ETDEWEB)

Fan, Li; Arval, Andrew S.; Cooper, Priscilla K.; Iwai, Shigenori; Hanaoka, Fumio; Tainer, John A.

2005-04-01

The human xeroderma pigmentosum group B (XPB) helicase is essential for transcription, nucleotide excision repair, and TFIIH functional assembly. Here, we determined crystal structures of an Archaeoglobus fulgidus XPB homolog (AfXPB) that characterize two RecA-like XPB helicase domains and discover a DNA damage recognition domain (DRD), a unique RED motif, a flexible thumb motif (ThM), and implied conformational changes within a conserved functional core. RED motif mutations dramatically reduce helicase activity, and the DRD and ThM, which flank the RED motif, appear structurally as well as functionally analogous to the MutS mismatch recognition and DNA polymerase thumb domains. Substrate specificity is altered by DNA damage, such that AfXPB unwinds dsDNA with 3' extensions, but not blunt-ended dsDNA, unless it contains a lesion, as shown for CPD or (6-4) photoproducts. Together, these results provide an unexpected mechanism of DNA unwinding with Implications for XPB damage verification in nucleotide excision repair.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

OpenAIRE

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-01-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon

Directory of Open Access Journals (Sweden)

Shenglong Tan

2012-01-01

Full Text Available Nucleotide-binding site (NBS disease resistance genes play an important role in defending plants from a variety of pathogens and insect pests. Many R-genes have been identified in various plant species. However, little is known about the NBS-encoding genes in Brachypodium distachyon. In this study, using computational analysis of the B. distachyon genome, we identified 126 regular NBS-encoding genes and characterized them on the bases of structural diversity, conserved protein motifs, chromosomal locations, gene duplications, promoter region, and phylogenetic relationships. EST hits and full-length cDNA sequences (from Brachypodium database of 126 R-like candidates supported their existence. Based on the occurrence of conserved protein motifs such as coiled-coil (CC, NBS, leucine-rich repeat (LRR, these regular NBS-LRR genes were classified into four subgroups: CC-NBS-LRR, NBS-LRR, CC-NBS, and X-NBS. Further expression analysis of the regular NBS-encoding genes in Brachypodium database revealed that these genes are expressed in a wide range of libraries, including those constructed from various developmental stages, tissue types, and drought challenged or nonchallenged tissue.

Palindromic nucleotide analysis in human T cell receptor rearrangements.

Directory of Open Access Journals (Sweden)

Santosh K Srivastava

Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

Probing structural changes of self assembled i-motif DNA

KAUST Repository

Lee, Iljoon; Patil, Sachin; Fhayli, Karim; Alsaiari, Shahad K.; Khashab, Niveen M.

2015-01-01

We report an i-motif structural probing system based on Thioflavin T (ThT) as a fluorescent sensor. This probe can discriminate the structural changes of RET and Rb i-motif sequences according to pH change. This journal is

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

Science.gov (United States)

Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

2005-05-01

The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

Science.gov (United States)

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

[Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

Science.gov (United States)

Kuznedelov, K D; Timoshkin, O A

1995-01-01

Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

A speedup technique for (l, d-motif finding algorithms

Directory of Open Access Journals (Sweden)

Dinh Hieu

2011-03-01

Full Text Available Abstract Background The discovery of patterns in DNA, RNA, and protein sequences has led to the solution of many vital biological problems. For instance, the identification of patterns in nucleic acid sequences has resulted in the determination of open reading frames, identification of promoter elements of genes, identification of intron/exon splicing sites, identification of SH RNAs, location of RNA degradation signals, identification of alternative splicing sites, etc. In protein sequences, patterns have proven to be extremely helpful in domain identification, location of protease cleavage sites, identification of signal peptides, protein interactions, determination of protein degradation elements, identification of protein trafficking elements, etc. Motifs are important patterns that are helpful in finding transcriptional regulatory elements, transcription factor binding sites, functional genomics, drug design, etc. As a result, numerous papers have been written to solve the motif search problem. Results Three versions of the motif search problem have been proposed in the literature: Simple Motif Search (SMS, (l, d-motif search (or Planted Motif Search (PMS, and Edit-distance-based Motif Search (EMS. In this paper we focus on PMS. Two kinds of algorithms can be found in the literature for solving the PMS problem: exact and approximate. An exact algorithm identifies the motifs always and an approximate algorithm may fail to identify some or all of the motifs. The exact version of PMS problem has been shown to be NP-hard. Exact algorithms proposed in the literature for PMS take time that is exponential in some of the underlying parameters. In this paper we propose a generic technique that can be used to speedup PMS algorithms. Conclusions We present a speedup technique that can be used on any PMS algorithm. We have tested our speedup technique on a number of algorithms. These experimental results show that our speedup technique is indeed very

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

Science.gov (United States)

Nishizawa, M; Nishizawa, K

2000-10-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

Science.gov (United States)

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-04-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

Science.gov (United States)

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-01-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

Factoring local sequence composition in motif significance analysis.

Science.gov (United States)

Ng, Patrick; Keich, Uri

2008-01-01

We recently introduced a biologically realistic and reliable significance analysis of the output of a popular class of motif finders. In this paper we further improve our significance analysis by incorporating local base composition information. Relying on realistic biological data simulation, as well as on FDR analysis applied to real data, we show that our method is significantly better than the increasingly popular practice of using the normal approximation to estimate the significance of a finder's output. Finally we turn to leveraging our reliable significance analysis to improve the actual motif finding task. Specifically, endowing a variant of the Gibbs Sampler with our improved significance analysis we demonstrate that de novo finders can perform better than has been perceived. Significantly, our new variant outperforms all the finders reviewed in a recently published comprehensive analysis of the Harbison genome-wide binding location data. Interestingly, many of these finders incorporate additional information such as nucleosome positioning and the significance of binding data.

Structural fragment clustering reveals novel structural and functional motifs in α-helical transmembrane proteins

Directory of Open Access Journals (Sweden)

Vassilev Boris

2010-04-01

Full Text Available Abstract Background A large proportion of an organism's genome encodes for membrane proteins. Membrane proteins are important for many cellular processes, and several diseases can be linked to mutations in them. With the tremendous growth of sequence data, there is an increasing need to reliably identify membrane proteins from sequence, to functionally annotate them, and to correctly predict their topology. Results We introduce a technique called structural fragment clustering, which learns sequential motifs from 3D structural fragments. From over 500,000 fragments, we obtain 213 statistically significant, non-redundant, and novel motifs that are highly specific to α-helical transmembrane proteins. From these 213 motifs, 58 of them were assigned to function and checked in the scientific literature for a biological assessment. Seventy percent of the motifs are found in co-factor, ligand, and ion binding sites, 30% at protein interaction interfaces, and 12% bind specific lipids such as glycerol or cardiolipins. The vast majority of motifs (94% appear across evolutionarily unrelated families, highlighting the modularity of functional design in membrane proteins. We describe three novel motifs in detail: (1 a dimer interface motif found in voltage-gated chloride channels, (2 a proton transfer motif found in heme-copper oxidases, and (3 a convergently evolved interface helix motif found in an aspartate symporter, a serine protease, and cytochrome b. Conclusions Our findings suggest that functional modules exist in membrane proteins, and that they occur in completely different evolutionary contexts and cover different binding sites. Structural fragment clustering allows us to link sequence motifs to function through clusters of structural fragments. The sequence motifs can be applied to identify and characterize membrane proteins in novel genomes.

An efficient identification strategy of clonal tea cultivars using long-core motif SSR markers.

Science.gov (United States)

Wang, Rang Jian; Gao, Xiang Feng; Kong, Xiang Rui; Yang, Jun

2016-01-01

Microsatellites, or simple sequence repeats (SSRs), especially those with long-core motifs (tri-, tetra-, penta-, and hexa-nucleotide) represent an excellent tool for DNA fingerprinting. SSRs with long-core motifs are preferred since neighbor alleles are more easily separated and identified from each other, which render the interpretation of electropherograms and the true alleles more reliable. In the present work, with the purpose of characterizing a set of core SSR markers with long-core motifs for well fingerprinting clonal cultivars of tea (Camellia sinensis), we analyzed 66 elite clonal tea cultivars in China with 33 initially-chosen long-core motif SSR markers covering all the 15 linkage groups of tea plant genome. A set of 6 SSR markers were conclusively selected as core SSR markers after further selection. The polymorphic information content (PIC) of the core SSR markers was >0.5, with ≤5 alleles in each marker containing 10 or fewer genotypes. Phylogenetic analysis revealed that the core SSR markers were not strongly correlated with the trait 'cultivar processing-property'. The combined probability of identity (PID) between two random cultivars for the whole set of 6 SSR markers was estimated to be 2.22 × 10(-5), which was quite low, confirmed the usefulness of the proposed SSR markers for fingerprinting analyses in Camellia sinensis. Moreover, for the sake of quickly discriminating the clonal tea cultivars, a cultivar identification diagram (CID) was subsequently established using these core markers, which fully reflected the identification process and provided the immediate information about which SSR markers were needed to identify a cultivar chosen among the tested ones. The results suggested that long-core motif SSR markers used in the investigation contributed to the accurate and efficient identification of the clonal tea cultivars and enabled the protection of intellectual property.

POWRS: position-sensitive motif discovery.

Directory of Open Access Journals (Sweden)

Ian W Davis

Full Text Available Transcription factors and the short, often degenerate DNA sequences they recognize are central regulators of gene expression, but their regulatory code is challenging to dissect experimentally. Thus, computational approaches have long been used to identify putative regulatory elements from the patterns in promoter sequences. Here we present a new algorithm "POWRS" (POsition-sensitive WoRd Set for identifying regulatory sequence motifs, specifically developed to address two common shortcomings of existing algorithms. First, POWRS uses the position-specific enrichment of regulatory elements near transcription start sites to significantly increase sensitivity, while providing new information about the preferred localization of those elements. Second, POWRS forgoes position weight matrices for a discrete motif representation that appears more resistant to over-generalization. We apply this algorithm to discover sequences related to constitutive, high-level gene expression in the model plant Arabidopsis thaliana, and then experimentally validate the importance of those elements by systematically mutating two endogenous promoters and measuring the effect on gene expression levels. This provides a foundation for future efforts to rationally engineer gene expression in plants, a problem of great importance in developing biotech crop varieties.BSD-licensed Python code at http://grassrootsbio.com/papers/powrs/.

Phylogenetic analysis, based on EPIYA repeats in the cagA gene of Indian Helicobacter pylori, and the implications of sequence variation in tyrosine phosphorylation motifs on determining the clinical outcome

Directory of Open Access Journals (Sweden)

Santosh K. Tiwari

2011-01-01

Full Text Available The population of India harbors one of the world's most highly diverse gene pools, owing to the influx of successive waves of immigrants over regular periods in time. Several phylogenetic studies involving mitochondrial DNA and Y chromosomal variation have demonstrated Europeans to have been the first settlers in India. Nevertheless, certain controversy exists, due to the support given to the thesis that colonization was by the Austro-Asiatic group, prior to the Europeans. Thus, the aim was to investigate pre-historic colonization of India by anatomically modern humans, using conserved stretches of five amino acid (EPIYA sequences in the cagA gene of Helicobacter pylori. Simultaneously, the existence of a pathogenic relationship of tyrosine phosphorylation motifs (TPMs, in 32 H. pylori strains isolated from subjects with several forms of gastric diseases, was also explored. High resolution sequence analysis of the above described genes was performed. The nucleotide sequences obtained were translated into amino acids using MEGA (version 4.0 software for EPIYA. An MJ-Network was constructed for obtaining TPM haplotypes by using NETWORK (version 4.5 software. The findings of the study suggest that Indian H. pylori strains share a common ancestry with Europeans. No specific association of haplotypes with the outcome of disease was revealed through additional network analysis of TPMs.

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

Science.gov (United States)

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Direct AUC optimization of regulatory motifs.

Science.gov (United States)

Zhu, Lin; Zhang, Hong-Bo; Huang, De-Shuang

2017-07-15

The discovery of transcription factor binding site (TFBS) motifs is essential for untangling the complex mechanism of genetic variation under different developmental and environmental conditions. Among the huge amount of computational approaches for de novo identification of TFBS motifs, discriminative motif learning (DML) methods have been proven to be promising for harnessing the discovery power of accumulated huge amount of high-throughput binding data. However, they have to sacrifice accuracy for speed and could fail to fully utilize the information of the input sequences. We propose a novel algorithm called CDAUC for optimizing DML-learned motifs based on the area under the receiver-operating characteristic curve (AUC) criterion, which has been widely used in the literature to evaluate the significance of extracted motifs. We show that when the considered AUC loss function is optimized in a coordinate-wise manner, the cost function of each resultant sub-problem is a piece-wise constant function, whose optimal value can be found exactly and efficiently. Further, a key step of each iteration of CDAUC can be efficiently solved as a computational geometry problem. Experimental results on real world high-throughput datasets illustrate that CDAUC outperforms competing methods for refining DML motifs, while being one order of magnitude faster. Meanwhile, preliminary results also show that CDAUC may also be useful for improving the interpretability of convolutional kernels generated by the emerging deep learning approaches for predicting TF sequences specificities. CDAUC is available at: https://drive.google.com/drive/folders/0BxOW5MtIZbJjNFpCeHlBVWJHeW8 . dshuang@tongji.edu.cn. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

Energy Technology Data Exchange (ETDEWEB)

Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.

2016-12-21

Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.

DNA motif alignment by evolving a population of Markov chains.

Science.gov (United States)

Bi, Chengpeng

2009-01-30

Deciphering cis-regulatory elements or de novo motif-finding in genomes still remains elusive although much algorithmic effort has been expended. The Markov chain Monte Carlo (MCMC) method such as Gibbs motif samplers has been widely employed to solve the de novo motif-finding problem through sequence local alignment. Nonetheless, the MCMC-based motif samplers still suffer from local maxima like EM. Therefore, as a prerequisite for finding good local alignments, these motif algorithms are often independently run a multitude of times, but without information exchange between different chains. Hence it would be worth a new algorithm design enabling such information exchange. This paper presents a novel motif-finding algorithm by evolving a population of Markov chains with information exchange (PMC), each of which is initialized as a random alignment and run by the Metropolis-Hastings sampler (MHS). It is progressively updated through a series of local alignments stochastically sampled. Explicitly, the PMC motif algorithm performs stochastic sampling as specified by a population-based proposal distribution rather than individual ones, and adaptively evolves the population as a whole towards a global maximum. The alignment information exchange is accomplished by taking advantage of the pooled motif site distributions. A distinct method for running multiple independent Markov chains (IMC) without information exchange, or dubbed as the IMC motif algorithm, is also devised to compare with its PMC counterpart. Experimental studies demonstrate that the performance could be improved if pooled information were used to run a population of motif samplers. The new PMC algorithm was able to improve the convergence and outperformed other popular algorithms tested using simulated and biological motif sequences.

DNA mutation motifs in the genes associated with inherited diseases.

Directory of Open Access Journals (Sweden)

Michal Růžička

Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

Directory of Open Access Journals (Sweden)

Yuki Furuse

2015-11-01

Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

Binding properties of SUMO-interacting motifs (SIMs) in yeast.

Science.gov (United States)

Jardin, Christophe; Horn, Anselm H C; Sticht, Heinrich

2015-03-01

Small ubiquitin-like modifier (SUMO) conjugation and interaction play an essential role in many cellular processes. A large number of yeast proteins is known to interact non-covalently with SUMO via short SUMO-interacting motifs (SIMs), but the structural details of this interaction are yet poorly characterized. In the present work, sequence analysis of a large dataset of 148 yeast SIMs revealed the existence of a hydrophobic core binding motif and a preference for acidic residues either within or adjacent to the core motif. Thus the sequence properties of yeast SIMs are highly similar to those described for human. Molecular dynamics simulations were performed to investigate the binding preferences for four representative SIM peptides differing in the number and distribution of acidic residues. Furthermore, the relative stability of two previously observed alternative binding orientations (parallel, antiparallel) was assessed. For all SIMs investigated, the antiparallel binding mode remained stable in the simulations and the SIMs were tightly bound via their hydrophobic core residues supplemented by polar interactions of the acidic residues. In contrary, the stability of the parallel binding mode is more dependent on the sequence features of the SIM motif like the number and position of acidic residues or the presence of additional adjacent interaction motifs. This information should be helpful to enhance the prediction of SIMs and their binding properties in different organisms to facilitate the reconstruction of the SUMO interactome.

Selection against spurious promoter motifs correlates withtranslational efficiency across bacteria

Energy Technology Data Exchange (ETDEWEB)

Froula, Jeffrey L.; Francino, M. Pilar

2007-05-01

Because binding of RNAP to misplaced sites could compromise the efficiency of transcription, natural selection for the optimization of gene expression should regulate the distribution of DNA motifs capable of RNAP-binding across the genome. Here we analyze the distribution of the -10 promoter motifs that bind the {sigma}{sup 70} subunit of RNAP in 42 bacterial genomes. We show that selection on these motifs operates across the genome, maintaining an over-representation of -10 motifs in regulatory sequences while eliminating them from the nonfunctional and, in most cases, from the protein coding regions. In some genomes, however, -10 sites are over-represented in the coding sequences; these sites could induce pauses effecting regulatory roles throughout the length of a transcriptional unit. For nonfunctional sequences, the extent of motif under-representation varies across genomes in a manner that broadly correlates with the number of tRNA genes, a good indicator of translational speed and growth rate. This suggests that minimizing the time invested in gene transcription is an important selective pressure against spurious binding. However, selection against spurious binding is detectable in the reduced genomes of host-restricted bacteria that grow at slow rates, indicating that components of efficiency other than speed may also be important. Minimizing the number of RNAP molecules per cell required for transcription, and the corresponding energetic expense, may be most relevant in slow growers. These results indicate that genome-level properties affecting the efficiency of transcription and translation can respond in an integrated manner to optimize gene expression. The detection of selection against promoter motifs in nonfunctional regions also implies that no sequence may evolve free of selective constraints, at least in the relatively small and unstructured genomes of bacteria.

Composite Structural Motifs of Binding Sites for Delineating Biological Functions of Proteins

Science.gov (United States)

Kinjo, Akira R.; Nakamura, Haruki

2012-01-01

Most biological processes are described as a series of interactions between proteins and other molecules, and interactions are in turn described in terms of atomic structures. To annotate protein functions as sets of interaction states at atomic resolution, and thereby to better understand the relation between protein interactions and biological functions, we conducted exhaustive all-against-all atomic structure comparisons of all known binding sites for ligands including small molecules, proteins and nucleic acids, and identified recurring elementary motifs. By integrating the elementary motifs associated with each subunit, we defined composite motifs that represent context-dependent combinations of elementary motifs. It is demonstrated that function similarity can be better inferred from composite motif similarity compared to the similarity of protein sequences or of individual binding sites. By integrating the composite motifs associated with each protein function, we define meta-composite motifs each of which is regarded as a time-independent diagrammatic representation of a biological process. It is shown that meta-composite motifs provide richer annotations of biological processes than sequence clusters. The present results serve as a basis for bridging atomic structures to higher-order biological phenomena by classification and integration of binding site structures. PMID:22347478

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

Science.gov (United States)

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

2008-04-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

Science.gov (United States)

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

2008-01-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

NARCIS (Netherlands)

Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

Specific interactions between transcription factors and the promoter-regulatory region of the human cytomegalovirus major immediate-early gene

International Nuclear Information System (INIS)

Ghazal, P.; Lubon, H.; Hennighausen, L.

1988-01-01

Repeat sequence motifs as well as unique sequences between nucleotides -150 and -22 of the human cytomegalovirus immediate-early 1 gene interact in vitro with nuclear proteins. The authors show that a transcriptional element between nucleotides -91 and -65 stimulated promoter activity in vivo and in vitro by binding specific cellular transcription factors. Finally, a common sequence motif, (T)TGG/AC, present in 15 of the determined binding sites suggests a particular class of nuclear factors associated with the immediate-early 1 gene

Amino acid sequence motifs essential for P0-mediated suppression of RNA silencing in an isolate of potato leafroll virus from Inner Mongolia.

Science.gov (United States)

Zhuo, Tao; Li, Yuan-Yuan; Xiang, Hai-Ying; Wu, Zhan-Yu; Wang, Xian-Bin; Wang, Ying; Zhang, Yong-Liang; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2014-06-01

Polerovirus P0 suppressors of host gene silencing contain a consensus F-box-like motif with Leu/Pro (L/P) requirements for suppressor activity. The Inner Mongolian Potato leafroll virus (PLRV) P0 protein (P0(PL-IM)) has an unusual F-box-like motif that contains a Trp/Gly (W/G) sequence and an additional GW/WG-like motif (G139/W140/G141) that is lacking in other P0 proteins. We used Agrobacterium infiltration-mediated RNA silencing assays to establish that P0(PL-IM) has a strong suppressor activity. Mutagenesis experiments demonstrated that the P0(PL-IM) F-box-like motif encompasses amino acids 76-LPRHLHYECLEWGLLCG THP-95, and that the suppressor activity is abolished by L76A, W87A, or G88A substitution. The suppressor activity is also weakened substantially by mutations within the G139/W140/G141 region and is eliminated by a mutation (F220R) in a C-terminal conserved sequence of P0(PL-IM). As has been observed with other P0 proteins, P0(PL-IM) suppression is correlated with reduced accumulation of the host AGO1-silencing complex protein. However, P0(PL-IM) fails to bind SKP1, which functions in a proteasome pathway that may be involved in AGO1 degradation. These results suggest that P0(PL-IM) may suppress RNA silencing by using an alternative pathway to target AGO1 for degradation. Our results help improve our understanding of the molecular mechanisms involved in PLRV infection.

Transcriptome sequencing of mung bean (Vigna radiate L.) genes and the identification of EST-SSR markers.

Science.gov (United States)

Chen, Honglin; Wang, Lixia; Wang, Suhua; Liu, Chunji; Blair, Matthew Wohlgemuth; Cheng, Xuzhen

2015-01-01

Mung bean (Vigna radiate (L.) Wilczek) is an important traditional food legume crop, with high economic and nutritional value. It is widely grown in China and other Asian countries. Despite its importance, genomic information is currently unavailable for this crop plant species or some of its close relatives in the Vigna genus. In this study, more than 103 million high quality cDNA sequence reads were obtained from mung bean using Illumina paired-end sequencing technology. The processed reads were assembled into 48,693 unigenes with an average length of 874 bp. Of these unigenes, 25,820 (53.0%) and 23,235 (47.7%) showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases, respectively. Furthermore, 19,242 (39.5%) could be classified into gene ontology categories, 18,316 (37.6%) into Swiss-Prot categories and 10,918 (22.4%) into KOG database categories (E-value SSR), and 2,303 sequences contained more than one SSR together in the same expressed sequence tag (EST). A total of 13,134 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats being the most abundant motif class and G/C repeats being rare. In this SSR analysis, we found five main repeat motifs: AG/CT (30.8%), GAA/TTC (12.6%), AAAT/ATTT (6.8%), AAAAT/ATTTT (6.2%) and AAAAAT/ATTTTT (1.9%). A total of 200 SSR loci were randomly selected for validation by PCR amplification as EST-SSR markers. Of these, 66 marker primer pairs produced reproducible amplicons that were polymorphic among 31 mung bean accessions selected from diverse geographical locations. The large number of SSR-containing sequences found in this study will be valuable for the construction of a high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.

Genome Survey Sequencing of Luffa Cylindrica L. and Microsatellite High Resolution Melting (SSR-HRM) Analysis for Genetic Relationship of Luffa Genotypes.

Science.gov (United States)

An, Jianyu; Yin, Mengqi; Zhang, Qin; Gong, Dongting; Jia, Xiaowen; Guan, Yajing; Hu, Jin

2017-09-11

Luffa cylindrica (L.) Roem. is an economically important vegetable crop in China. However, the genomic information on this species is currently unknown. In this study, for the first time, a genome survey of L. cylindrica was carried out using next-generation sequencing (NGS) technology. In total, 43.40 Gb sequence data of L. cylindrica , about 54.94× coverage of the estimated genome size of 789.97 Mb, were obtained from HiSeq 2500 sequencing, in which the guanine plus cytosine (GC) content was calculated to be 37.90%. The heterozygosity of genome sequences was only 0.24%. In total, 1,913,731 contigs (>200 bp) with 525 bp N 50 length and 1,410,117 scaffolds (>200 bp) with 885.01 Mb total length were obtained. From the initial assembled L. cylindrica genome, 431,234 microsatellites (SSRs) (≥5 repeats) were identified. The motif types of SSR repeats included 62.88% di-nucleotide, 31.03% tri-nucleotide, 4.59% tetra-nucleotide, 0.96% penta-nucleotide and 0.54% hexa-nucleotide. Eighty genomic SSR markers were developed, and 51/80 primers could be used in both "Zheda 23" and "Zheda 83". Nineteen SSRs were used to investigate the genetic diversity among 32 accessions through SSR-HRM analysis. The unweighted pair group method analysis (UPGMA) dendrogram tree was built by calculating the SSR-HRM raw data. SSR-HRM could be effectively used for genotype relationship analysis of Luffa species.

Seq2Logo: a method for construction and visualization of amino acid binding motifs and sequence profiles including sequence weighting, pseudo counts and two-sided representation of amino acid enrichment and depletion

DEFF Research Database (Denmark)

Thomsen, Martin Christen Frølund; Nielsen, Morten

2012-01-01

Seq2Logo is a web-based sequence logo generator. Sequence logos are a graphical representation of the information content stored in a multiple sequence alignment (MSA) and provide a compact and highly intuitive representation of the position-specific amino acid composition of binding motifs, active...... related to amino acid enrichment and depletion. Besides allowing input in the format of peptides and MSA, Seq2Logo accepts input as Blast sequence profiles, providing easy access for non-expert end-users to characterize and identify functionally conserved/variable amino acids in any given protein...... sites, etc. in biological sequences. Accurate generation of sequence logos is often compromised by sequence redundancy and low number of observations. Moreover, most methods available for sequence logo generation focus on displaying the position-specific enrichment of amino acids, discarding the equally...

Calmodulin as a Ca2+-Sensing Subunit of Arabidopsis Cyclic Nucleotide-Gated Channel Complexes.

Science.gov (United States)

Fischer, Cornelia; DeFalco, Thomas A; Karia, Purva; Snedden, Wayne A; Moeder, Wolfgang; Yoshioka, Keiko; Dietrich, Petra

2017-07-01

Ca2+ serves as a universal second messenger in eukaryotic signaling pathways, and the spatial and temporal patterns of Ca2+ concentration changes are determined by feedback and feed-forward regulation of the involved transport proteins. Cyclic nucleotide-gated channels (CNGCs) are Ca2+-permeable channels that interact with the ubiquitous Ca2+ sensor calmodulin (CaM). CNGCs interact with CaMs via diverse CaM-binding sites, including an IQ-motif, which has been identified in the C-termini of CNGC20 and CNGC12. Here we present a family-wide analysis of the IQ-motif from all 20 Arabidopsis CNGC isoforms. While most of their IQ-peptides interacted with conserved CaMs in yeast, some were unable to do so, despite high sequence conservation across the family. We showed that the CaM binding ability of the IQ-motif is highly dependent on its proximal and distal vicinity. We determined that two alanine residues positioned N-terminal to the core IQ-sequence play a significant role in CaM binding, and identified a polymorphism at this site that promoted or inhibited CaM binding in yeast. Through detailed biophysical analysis of the CNGC2 IQ-motif, we found that this polymorphism specifically affected the Ca2+-independent interactions with the C-lobe of CaM. This same polymorphism partially suppressed the induction of programmed cell death by CNGC11/12 in planta. Our work expands the model of CNGC regulation, and posits that the C-lobe of apo-CaM is permanently associated with the channel at the N-terminal part of the IQ-domain. This mode allows CaM to function as a Ca2+-sensing regulatory subunit of the channel complex, providing a mechanism by which Ca2+ signals may be fine-tuned. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Argo_CUDA: Exhaustive GPU based approach for motif discovery in large DNA datasets.

Science.gov (United States)

Vishnevsky, Oleg V; Bocharnikov, Andrey V; Kolchanov, Nikolay A

2018-02-01

The development of chromatin immunoprecipitation sequencing (ChIP-seq) technology has revolutionized the genetic analysis of the basic mechanisms underlying transcription regulation and led to accumulation of information about a huge amount of DNA sequences. There are a lot of web services which are currently available for de novo motif discovery in datasets containing information about DNA/protein binding. An enormous motif diversity makes their finding challenging. In order to avoid the difficulties, researchers use different stochastic approaches. Unfortunately, the efficiency of the motif discovery programs dramatically declines with the query set size increase. This leads to the fact that only a fraction of top "peak" ChIP-Seq segments can be analyzed or the area of analysis should be narrowed. Thus, the motif discovery in massive datasets remains a challenging issue. Argo_Compute Unified Device Architecture (CUDA) web service is designed to process the massive DNA data. It is a program for the detection of degenerate oligonucleotide motifs of fixed length written in 15-letter IUPAC code. Argo_CUDA is a full-exhaustive approach based on the high-performance GPU technologies. Compared with the existing motif discovery web services, Argo_CUDA shows good prediction quality on simulated sets. The analysis of ChIP-Seq sequences revealed the motifs which correspond to known transcription factor binding sites.

Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

International Nuclear Information System (INIS)

Steenbergh, P.H.

1979-01-01

The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

Science.gov (United States)

Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

2002-12-01

There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

A proposed vestigial translation initiation motif in VP1 of hepatitis A virus.

Science.gov (United States)

Kang, Jeong-Ah; Funkhouser, Ann W

2002-07-01

The internal ribosome entry site (IRES) of picornaviruses has a 3' polypyrimidine tract (PPT) 16-24 bases upstream of an AUG triplet (PPT/AUG motif). This motif is critical in determining the efficiency of cap-independent translation. HAV has a conserved PPT/AUG motif consisting of a nine base sequence (AGGUUUUUC) 23 bases upstream of the preferred AUG start codon. This HAV-specific PPT/AUG motif is repeated and conserved in VP1 of HAV, but not of other picornaviruses. We proposed that the PPT/AUG motif in the open reading frame initiated translation and/or had an impact on the life cycle of the virus. In vitro translation of mutant bicistronic mRNAs and growth in cell culture of mutant viruses provided no evidence that the VP1 PPT/AUG motif had any impact on either translation or growth. HAV differs from other picornaviruses in its inefficient growth in cell culture. Since the HAV-specific PPT/AUG motif is found in only 1 in 300,000 reported viral sequences outside the hepatovirus genus, this motif may be a vestigial translation initiation element and may have played a role in determining the unusual phenotype of HAV.

Efficient sequential and parallel algorithms for planted motif search.

Science.gov (United States)

Nicolae, Marius; Rajasekaran, Sanguthevar

2014-01-31

Motif searching is an important step in the detection of rare events occurring in a set of DNA or protein sequences. One formulation of the problem is known as (l,d)-motif search or Planted Motif Search (PMS). In PMS we are given two integers l and d and n biological sequences. We want to find all sequences of length l that appear in each of the input sequences with at most d mismatches. The PMS problem is NP-complete. PMS algorithms are typically evaluated on certain instances considered challenging. Despite ample research in the area, a considerable performance gap exists because many state of the art algorithms have large runtimes even for moderately challenging instances. This paper presents a fast exact parallel PMS algorithm called PMS8. PMS8 is the first algorithm to solve the challenging (l,d) instances (25,10) and (26,11). PMS8 is also efficient on instances with larger l and d such as (50,21). We include a comparison of PMS8 with several state of the art algorithms on multiple problem instances. This paper also presents necessary and sufficient conditions for 3 l-mers to have a common d-neighbor. The program is freely available at http://engr.uconn.edu/~man09004/PMS8/. We present PMS8, an efficient exact algorithm for Planted Motif Search. PMS8 introduces novel ideas for generating common neighborhoods. We have also implemented a parallel version for this algorithm. PMS8 can solve instances not solved by any previous algorithms.

Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India

Directory of Open Access Journals (Sweden)

Sukdeb Nandi

2010-03-01

Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India

Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

Science.gov (United States)

Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

Science.gov (United States)

Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

1995-03-01

A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

Science.gov (United States)

Fauteux, François; Strömvik, Martina V

2009-01-01

Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP) gene promoters from three plant families, namely Brassicaceae (mustards), Fabaceae (legumes) and Poaceae (grasses) using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L.) Heynh.), soybean (Glycine max (L.) Merr.) and rice (Oryza sativa L.) respectively. We have identified three conserved motifs (two RY-like and one ACGT-like) in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination of conserved motifs

Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae

Directory of Open Access Journals (Sweden)

Fauteux François

2009-10-01

Full Text Available Abstract Background Accurate computational identification of cis-regulatory motifs is difficult, particularly in eukaryotic promoters, which typically contain multiple short and degenerate DNA sequences bound by several interacting factors. Enrichment in combinations of rare motifs in the promoter sequence of functionally or evolutionarily related genes among several species is an indicator of conserved transcriptional regulatory mechanisms. This provides a basis for the computational identification of cis-regulatory motifs. Results We have used a discriminative seeding DNA motif discovery algorithm for an in-depth analysis of 54 seed storage protein (SSP gene promoters from three plant families, namely Brassicaceae (mustards, Fabaceae (legumes and Poaceae (grasses using backgrounds based on complete sets of promoters from a representative species in each family, namely Arabidopsis (Arabidopsis thaliana (L. Heynh., soybean (Glycine max (L. Merr. and rice (Oryza sativa L. respectively. We have identified three conserved motifs (two RY-like and one ACGT-like in Brassicaceae and Fabaceae SSP gene promoters that are similar to experimentally characterized seed-specific cis-regulatory elements. Fabaceae SSP gene promoter sequences are also enriched in a novel, seed-specific E2Fb-like motif. Conserved motifs identified in Poaceae SSP gene promoters include a GCN4-like motif, two prolamin-box-like motifs and an Skn-1-like motif. Evidence of the presence of a variant of the TATA-box is found in the SSP gene promoters from the three plant families. Motifs discovered in SSP gene promoters were used to score whole-genome sets of promoters from Arabidopsis, soybean and rice. The highest-scoring promoters are associated with genes coding for different subunits or precursors of seed storage proteins. Conclusion Seed storage protein gene promoter motifs are conserved in diverse species, and different plant families are characterized by a distinct combination

The Runt domain of AML1 (RUNX1) binds a sequence-conserved RNA motif that mimics a DNA element.

Science.gov (United States)

Fukunaga, Junichi; Nomura, Yusuke; Tanaka, Yoichiro; Amano, Ryo; Tanaka, Taku; Nakamura, Yoshikazu; Kawai, Gota; Sakamoto, Taiichi; Kozu, Tomoko

2013-07-01

AML1 (RUNX1) is a key transcription factor for hematopoiesis that binds to the Runt-binding double-stranded DNA element (RDE) of target genes through its N-terminal Runt domain. Aberrations in the AML1 gene are frequently found in human leukemia. To better understand AML1 and its potential utility for diagnosis and therapy, we obtained RNA aptamers that bind specifically to the AML1 Runt domain. Enzymatic probing and NMR analyses revealed that Apt1-S, which is a truncated variant of one of the aptamers, has a CACG tetraloop and two stem regions separated by an internal loop. All the isolated aptamers were found to contain the conserved sequence motif 5'-NNCCAC-3' and 5'-GCGMGN'N'-3' (M:A or C; N and N' form Watson-Crick base pairs). The motif contains one AC mismatch and one base bulged out. Mutational analysis of Apt1-S showed that three guanines of the motif are important for Runt binding as are the three guanines of RDE, which are directly recognized by three arginine residues of the Runt domain. Mutational analyses of the Runt domain revealed that the amino acid residues used for Apt1-S binding were similar to those used for RDE binding. Furthermore, the aptamer competed with RDE for binding to the Runt domain in vitro. These results demonstrated that the Runt domain of the AML1 protein binds to the motif of the aptamer that mimics DNA. Our findings should provide new insights into RNA function and utility in both basic and applied sciences.

Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

Directory of Open Access Journals (Sweden)

Andréia B. Poletto

2008-01-01

Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

G-stack modulated probe intensities on expression arrays - sequence corrections and signal calibration

Directory of Open Access Journals (Sweden)

Fasold Mario

2010-04-01

Full Text Available Abstract Background The brightness of the probe spots on expression microarrays intends to measure the abundance of specific mRNA targets. Probes with runs of at least three guanines (G in their sequence show abnormal high intensities which reflect rather probe effects than target concentrations. This G-bias requires correction prior to downstream expression analysis. Results Longer runs of three or more consecutive G along the probe sequence and in particular triple degenerated G at its solution end ((GGG1-effect are associated with exceptionally large probe intensities on GeneChip expression arrays. This intensity bias is related to non-specific hybridization and affects both perfect match and mismatch probes. The (GGG1-effect tends to increase gradually for microarrays of later GeneChip generations. It was found for DNA/RNA as well as for DNA/DNA probe/target-hybridization chemistries. Amplification of sample RNA using T7-primers is associated with strong positive amplitudes of the G-bias whereas alternative amplification protocols using random primers give rise to much smaller and partly even negative amplitudes. We applied positional dependent sensitivity models to analyze the specifics of probe intensities in the context of all possible short sequence motifs of one to four adjacent nucleotides along the 25meric probe sequence. Most of the longer motifs are adequately described using a nearest-neighbor (NN model. In contrast, runs of degenerated guanines require explicit consideration of next nearest neighbors (GGG terms. Preprocessing methods such as vsn, RMA, dChip, MAS5 and gcRMA only insufficiently remove the G-bias from data. Conclusions Positional and motif dependent sensitivity models accounts for sequence effects of oligonucleotide probe intensities. We propose a positional dependent NN+GGG hybrid model to correct the intensity bias associated with probes containing poly-G motifs. It is implemented as a single-chip based calibration

Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

Science.gov (United States)

Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

2017-08-01

A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

A combined statistical model for multiple motifs search

International Nuclear Information System (INIS)

Gao Lifeng; Liu Xin; Guan Shan

2008-01-01

Transcription factor binding sites (TFBS) play key roles in genebior 6.8 wavelet expression and regulation. They are short sequence segments with definite structure and can be recognized by the corresponding transcription factors correctly. From the viewpoint of statistics, the candidates of TFBS should be quite different from the segments that are randomly combined together by nucleotide. This paper proposes a combined statistical model for finding over-represented short sequence segments in different kinds of data set. While the over-represented short sequence segment is described by position weight matrix, the nucleotide distribution at most sites of the segment should be far from the background nucleotide distribution. The central idea of this approach is to search for such kind of signals. This algorithm is tested on 3 data sets, including binding sites data set of cyclic AMP receptor protein in E.coli, PlantProm DB which is a non-redundant collection of proximal promoter sequences from different species, collection of the intergenic sequences of the whole genome of E.Coli. Even though the complexity of these three data sets is quite different, the results show that this model is rather general and sensible. (general)

Proteome-level assessment of origin, prevalence and function of Leucine-Aspartic Acid (LD) motifs

KAUST Repository

Alam, Tanvir

2018-03-11

Short Linear Motifs (SLiMs) contribute to almost every cellular function by connecting appropriate protein partners. Accurate prediction of SLiMs is difficult due to their shortness and sequence degeneracy. Leucine-aspartic acid (LD) motifs are SLiMs that link paxillin family proteins to factors controlling (cancer) cell adhesion, motility and survival. The existence and importance of LD motifs beyond the paxillin family is poorly understood. To enable a proteome-wide assessment of these motifs, we developed an active-learning based framework that iteratively integrates computational predictions with experimental validation. Our analysis of the human proteome identified a dozen proteins that contain LD motifs, all being involved in cell adhesion and migration, and revealed a new type of inverse LD motif consensus. Our evolutionary analysis suggested that LD motif signalling originated in the common unicellular ancestor of opisthokonts and amoebozoa by co-opting nuclear export sequences. Inter-species comparison revealed a conserved LD signalling core, and reveals the emergence of species-specific adaptive connections, while maintaining a strong functional focus of the LD motif interactome. Collectively, our data elucidate the mechanisms underlying the origin and adaptation of an ancestral SLiM.

Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

Science.gov (United States)

Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

2015-02-01

There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

Directory of Open Access Journals (Sweden)

Erena A. Edae

2013-07-01

Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

Finding a Leucine in a Haystack: Searching the Proteome for ambigous Leucine-Aspartic Acid motifs

KAUST Repository

Arold, Stefan T.

2016-01-01

LDMF predicted 13 new LD motifs in humans. Using biophysical assays, we experimentally confirmed in vitro interactions for four novel LD motif proteins. Thus, LDMF allows proteome-wide discovery of LD motifs, despite a highly ambiguous sequence pattern. Functional implications will be discussed.

Functional Interaction of the Adenovirus IVa2 Protein with Adenovirus Type 5 Packaging Sequences

OpenAIRE

Ostapchuk, Philomena; Yang, Jihong; Auffarth, Ece; Hearing, Patrick

2005-01-01

Adenovirus type 5 (Ad5) DNA packaging is initiated in a polar fashion from the left end of the genome. The packaging process is dependent on the cis-acting packaging domain located between nucleotides 230 and 380. Seven AT-rich repeats that direct packaging have been identified within this domain. A1, A2, A5, and A6 are the most important repeats functionally and share a bipartite sequence motif. Several lines of evidence suggest that there is a limiting trans-acting factor(s) that plays a ro...

A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

DEFF Research Database (Denmark)

Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

2013-01-01

Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells

KAUST Repository

Wong, Ka-Chun; Li, Yue; Peng, Chengbin

2015-01-01

Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.

Identification of coupling DNA motif pairs on long-range chromatin interactions in human K562 cells

KAUST Repository

Wong, Ka-Chun

2015-09-27

Motivation: The protein-DNA interactions between transcription factors (TFs) and transcription factor binding sites (TFBSs, also known as DNA motifs) are critical activities in gene transcription. The identification of the DNA motifs is a vital task for downstream analysis. Unfortunately, the long-range coupling information between different DNA motifs is still lacking. To fill the void, as the first-of-its-kind study, we have identified the coupling DNA motif pairs on long-range chromatin interactions in human. Results: The coupling DNA motif pairs exhibit substantially higher DNase accessibility than the background sequences. Half of the DNA motifs involved are matched to the existing motif databases, although nearly all of them are enriched with at least one gene ontology term. Their motif instances are also found statistically enriched on the promoter and enhancer regions. Especially, we introduce a novel measurement called motif pairing multiplicity which is defined as the number of motifs that are paired with a given motif on chromatin interactions. Interestingly, we observe that motif pairing multiplicity is linked to several characteristics such as regulatory region type, motif sequence degeneracy, DNase accessibility and pairing genomic distance. Taken into account together, we believe the coupling DNA motif pairs identified in this study can shed lights on the gene transcription mechanism under long-range chromatin interactions. © The Author 2015. Published by Oxford University Press.

Selection of functional 2A sequences within foot-and-mouth disease virus; requirements for the NPGP motif with a distinct codon bias

DEFF Research Database (Denmark)

Kjær, Jonas; Belsham, Graham J.

2018-01-01

Foot-and-mouth disease virus (FMDV) has a positive-sense ssRNA genome including a single, large, open reading frame. Splitting of the encoded polyprotein at the 2A/2B junction is mediated by the 2A peptide (18 residues long) which induces a non-proteolytic, co-translational, "cleavage" at its own C......-terminus. A conserved feature among variants of 2A is the C-terminal motif N16P17G18/P19 where P19 is the first residue of 2B. It has been shown previously that certain amino acid substitutions can be tolerated at residues E14, S15 and N16 within the 2A sequence of infectious FMDVs but no variants at residues P17, G18...... or P19 have been identified. In this study, using highly degenerate primers, we analysed if any other residues can be present at each position of the NPG/P motif within infectious FMDV. No alternative forms of this motif were found to be encoded by rescued FMDVs after 2, 3 or 4 passages. However...

A Simple Decision Rule for Recognition of Poly(A) Tail Signal Motifs in Human Genome

KAUST Repository

AbouEisha, Hassan M.

2015-05-12

Background is the numerous attempts were made to predict motifs in genomic sequences that correspond to poly (A) tail signals. Vast portion of this effort has been directed to a plethora of nonlinear classification methods. Even when such approaches yield good discriminant results, identifying dominant features of regulatory mechanisms nevertheless remains a challenge. In this work, we look at decision rules that may help identifying such features. Findings are we present a simple decision rule for classification of candidate poly (A) tail signal motifs in human genomic sequence obtained by evaluating features during the construction of gradient boosted trees. We found that values of a single feature based on the frequency of adenine in the genomic sequence surrounding candidate signal and the number of consecutive adenine molecules in a well-defined region immediately following the motif displays good discriminative potential in classification of poly (A) tail motifs for samples covered by the rule. Conclusions is the resulting simple rule can be used as an efficient filter in construction of more complex poly(A) tail motifs classification algorithms.

Large-Scale Isolation of Microsatellites from Chinese Mitten Crab Eriocheir sinensis via a Solexa Genomic Survey

Directory of Open Access Journals (Sweden)

Qun Wang

2012-12-01

Full Text Available Microsatellites are simple sequence repeats with a high degree of polymorphism in the genome; they are used as DNA markers in many molecular genetic studies. Using traditional methods such as the magnetic beads enrichment method, only a few microsatellite markers have been isolated from the Chinese mitten crab Eriocheir sinensis, as the crab genome sequence information is unavailable. Here, we have identified a large number of microsatellites from the Chinese mitten crab by taking advantage of Solexa genomic surveying. A total of 141,737 SSR (simple sequence repeats motifs were identified via analysis of 883 Mb of the crab genomic DNA information, including mono-, di-, tri-, tetra-, penta- and hexa-nucleotide repeat motifs. The number of di-nucleotide repeat motifs was 82,979, making this the most abundant type of repeat motif (58.54%; the second most abundant were the tri-nucleotide repeats (42,657, 30.11%. Among di-nucleotide repeats, the most frequent repeats were AC motifs, accounting for 67.55% of the total number. AGG motifs were the most frequent (59.32% of the tri-nucleotide motifs. A total of 15,125 microsatellite loci had a flanking sequence suitable for setting the primer of a polymerase chain reaction (PCR. To verify the identified SSRs, a subset of 100 primer pairs was randomly selected for PCR. Eighty two primer sets (82% produced strong PCR products matching expected sizes, and 78% were polymorphic. In an analysis of 30 wild individuals from the Yangtze River with 20 primer sets, the number of alleles per locus ranged from 2–14 and the mean allelic richness was 7.4. No linkage disequilibrium was found between any pair of loci, indicating that the markers were independent. The Hardy-Weinberg equilibrium test showed significant deviation in four of the 20 microsatellite loci after sequential Bonferroni corrections. This method is cost- and time-effective in comparison to traditional approaches for the isolation of microsatellites.

Dipeptide frequency/bias analysis identifies conserved sites of nonrandomness shared by cysteine-rich motifs.

Science.gov (United States)

Campion, S R; Ameen, A S; Lai, L; King, J M; Munzenmaier, T N

2001-08-15

This report describes the application of a simple computational tool, AAPAIR.TAB, for the systematic analysis of the cysteine-rich EGF, Sushi, and Laminin motif/sequence families at the two-amino acid level. Automated dipeptide frequency/bias analysis detects preferences in the distribution of amino acids in established protein families, by determining which "ordered dipeptides" occur most frequently in comprehensive motif-specific sequence data sets. Graphic display of the dipeptide frequency/bias data revealed family-specific preferences for certain dipeptides, but more importantly detected a shared preference for employment of the ordered dipeptides Gly-Tyr (GY) and Gly-Phe (GF) in all three protein families. The dipeptide Asn-Gly (NG) also exhibited high-frequency and bias in the EGF and Sushi motif families, whereas Asn-Thr (NT) was distinguished in the Laminin family. Evaluation of the distribution of dipeptides identified by frequency/bias analysis subsequently revealed the highly restricted localization of the G(F/Y) and N(G/T) sequence elements at two separate sites of extreme conservation in the consensus sequence of all three sequence families. The similar employment of the high-frequency/bias dipeptides in three distinct protein sequence families was further correlated with the concurrence of these shared molecular determinants at similar positions within the distinctive scaffolds of three structurally divergent, but similarly employed, motif modules.

An Inhibitory Motif on the 5’UTR of Several Rotavirus Genome Segments Affects Protein Expression and Reverse Genetics Strategies

Science.gov (United States)

Papa, Guido; Eichwald, Catherine; Burrone, Oscar R.

2016-01-01

Rotavirus genome consists of eleven segments of dsRNA, each encoding one single protein. Viral mRNAs contain an open reading frame (ORF) flanked by relatively short untranslated regions (UTRs), whose role in the viral cycle remains elusive. Here we investigated the role of 5’UTRs in T7 polymerase-driven cDNAs expression in uninfected cells. The 5’UTRs of eight genome segments (gs3, gs5-6, gs7-11) of the simian SA11 strain showed a strong inhibitory effect on the expression of viral proteins. Decreased protein expression was due to both compromised transcription and translation and was independent of the ORF and the 3’UTR sequences. Analysis of several mutants of the 21-nucleotide long 5’UTR of gs 11 defined an inhibitory motif (IM) represented by its primary sequence rather than its secondary structure. IM was mapped to the 5’ terminal 6-nucleotide long pyrimidine-rich tract 5’-GGY(U/A)UY-3’. The 5’ terminal position within the mRNA was shown to be essentially required, as inhibitory activity was lost when IM was moved to an internal position. We identified two mutations (insertion of a G upstream the 5’UTR and the U to A mutation of the fifth nucleotide of IM) that render IM non-functional and increase the transcription and translation rate to levels that could considerably improve the efficiency of virus helper-free reverse genetics strategies. PMID:27846320

A picorna-like virus from the red imported fire ant, Solenopsis invicta: initial discovery, genome sequence, and characterization

International Nuclear Information System (INIS)

Valles, Steven M.; Strong, Charles A.; Dang, Phat M.; Hunter, Wayne B.; Pereira, Roberto M.; Oi, David H.; Shapiro, Alexandra M.; Williams, David F.

2004-01-01

We report the first discovery and genome sequence of a virus infecting the red imported fire ant, Solenopsis invicta. The 8026 nucleotide, polyadenylated, RNA genome encoded two large open reading frames (ORF1 and ORF2), flanked and separated by 27, 223, and 171 nucleotide untranslated regions, respectively. The predicted amino acid sequence of the 5' proximal ORF1 (nucleotides 28 to 4218) exhibited significant identity and possessed consensus sequences characteristic of the helicase, cysteine protease, and RNA-dependent RNA polymerase sequence motifs from picornaviruses, picorna-like viruses, comoviruses, caliciviruses, and sequiviruses. The predicted amino acid sequence of the 3' proximal ORF2 (nucleotides 4390-7803) showed similarity to structural proteins in picorna-like viruses, especially the acute bee paralysis virus. Electron microscopic examination of negatively stained samples from virus-infected fire ants revealed isometric particles with a diameter of 31 nm, consistent with Picornaviridae. A survey for the fire ant virus from areas around Florida revealed a pattern of fairly widespread distribution. Among 168 nests surveyed, 22.9% were infected. The virus was found to infect all fire ant caste members and developmental stages, including eggs, early (1st-2nd) and late (3rd-4th) instars, worker pupae, workers, sexual pupae, alates ( male and female ), and queens. The virus, tentatively named S. invicta virus (SINV-1), appears to belong to the picorna-like viruses. We did not observe any perceptible symptoms among infected nests in the field. However, in every case where an SINV-1-infected colony was excavated from the field with an inseminated queen and held in the laboratory, all of the brood in these colonies died within 3 months

Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

Science.gov (United States)

Li, Hongshan; Dai, Huaguo; Wei, Hui

2005-01-01

A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

Science.gov (United States)

Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

2013-01-01

Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

SA-Mot: a web server for the identification of motifs of interest extracted from protein loops.

Science.gov (United States)

Regad, Leslie; Saladin, Adrien; Maupetit, Julien; Geneix, Colette; Camproux, Anne-Claude

2011-07-01

The detection of functional motifs is an important step for the determination of protein functions. We present here a new web server SA-Mot (Structural Alphabet Motif) for the extraction and location of structural motifs of interest from protein loops. Contrary to other methods, SA-Mot does not focus only on functional motifs, but it extracts recurrent and conserved structural motifs involved in structural redundancy of loops. SA-Mot uses the structural word notion to extract all structural motifs from uni-dimensional sequences corresponding to loop structures. Then, SA-Mot provides a description of these structural motifs using statistics computed in the loop data set and in SCOP superfamily, sequence and structural parameters. SA-Mot results correspond to an interactive table listing all structural motifs extracted from a target structure and their associated descriptors. Using this information, the users can easily locate loop regions that are important for the protein folding and function. The SA-Mot web server is available at http://sa-mot.mti.univ-paris-diderot.fr.

Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

Science.gov (United States)

Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

2017-07-01

DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

Discriminative motif discovery via simulated evolution and random under-sampling.

Directory of Open Access Journals (Sweden)

Tao Song

Full Text Available Conserved motifs in biological sequences are closely related to their structure and functions. Recently, discriminative motif discovery methods have attracted more and more attention. However, little attention has been devoted to the data imbalance problem, which is one of the main reasons affecting the performance of the discriminative models. In this article, a simulated evolution method is applied to solve the multi-class imbalance problem at the stage of data preprocessing, and at the stage of Hidden Markov Models (HMMs training, a random under-sampling method is introduced for the imbalance between the positive and negative datasets. It is shown that, in the task of discovering targeting motifs of nine subcellular compartments, the motifs found by our method are more conserved than the methods without considering data imbalance problem and recover the most known targeting motifs from Minimotif Miner and InterPro. Meanwhile, we use the found motifs to predict protein subcellular localization and achieve higher prediction precision and recall for the minority classes.

Discriminative motif discovery via simulated evolution and random under-sampling.

Science.gov (United States)

Song, Tao; Gu, Hong

2014-01-01

Conserved motifs in biological sequences are closely related to their structure and functions. Recently, discriminative motif discovery methods have attracted more and more attention. However, little attention has been devoted to the data imbalance problem, which is one of the main reasons affecting the performance of the discriminative models. In this article, a simulated evolution method is applied to solve the multi-class imbalance problem at the stage of data preprocessing, and at the stage of Hidden Markov Models (HMMs) training, a random under-sampling method is introduced for the imbalance between the positive and negative datasets. It is shown that, in the task of discovering targeting motifs of nine subcellular compartments, the motifs found by our method are more conserved than the methods without considering data imbalance problem and recover the most known targeting motifs from Minimotif Miner and InterPro. Meanwhile, we use the found motifs to predict protein subcellular localization and achieve higher prediction precision and recall for the minority classes.

Improved i-motif thermal stability by insertion of anthraquinone monomers

DEFF Research Database (Denmark)

Gouda, Alaa S; Amine, Mahasen S.; Pedersen, Erik Bjerregaard

2017-01-01

In order to gain insight into how to improve thermal stability of i-motifs when used in the context of biomedical and nanotechnological applications, novel anthraquinone-modified i-motifs were synthesized by insertion of 1,8-, 1,4-, 1,5- and 2,6-disubstituted anthraquinone monomers into the TAA...... loops of a 22mer cytosine-rich human telomeric DNA sequence. The influence of the four anthraquinone linkers on the i-motif thermal stability was investigated at 295 nm and pH 5.5. Anthraquinone monomers modulate the i-motif stability in a position-depending manner and the modulation also depends...... unlocked nucleic acid monomers or twisted intercalating nucleic acid. The 2,6-disubstituted anthraquinone linker replacing T10 enabled a significant increase of i-motif thermal melting by 8.2 °C. A substantial increase of 5.0 °C in i-motif thermal melting was recorded when both A6 and T16 were modified...

Dissecting protein loops with a statistical scalpel suggests a functional implication of some structural motifs.

Science.gov (United States)

Regad, Leslie; Martin, Juliette; Camproux, Anne-Claude

2011-06-20

One of the strategies for protein function annotation is to search particular structural motifs that are known to be shared by proteins with a given function. Here, we present a systematic extraction of structural motifs of seven residues from protein loops and we explore their correspondence with functional sites. Our approach is based on the structural alphabet HMM-SA (Hidden Markov Model - Structural Alphabet), which allows simplification of protein structures into uni-dimensional sequences, and advanced pattern statistics adapted to short sequences. Structural motifs of interest are selected by looking for structural motifs significantly over-represented in SCOP superfamilies in protein loops. We discovered two types of structural motifs significantly over-represented in SCOP superfamilies: (i) ubiquitous motifs, shared by several superfamilies and (ii) superfamily-specific motifs, over-represented in few superfamilies. A comparison of ubiquitous words with known small structural motifs shows that they contain well-described motifs as turn, niche or nest motifs. A comparison between superfamily-specific motifs and biological annotations of Swiss-Prot reveals that some of them actually correspond to functional sites involved in the binding sites of small ligands, such as ATP/GTP, NAD(P) and SAH/SAM. Our findings show that statistical over-representation in SCOP superfamilies is linked to functional features. The detection of over-represented motifs within structures simplified by HMM-SA is therefore a promising approach for prediction of functional sites and annotation of uncharacterized proteins.

Dissecting protein loops with a statistical scalpel suggests a functional implication of some structural motifs

Directory of Open Access Journals (Sweden)

Martin Juliette

2011-06-01

Full Text Available Abstract Background One of the strategies for protein function annotation is to search particular structural motifs that are known to be shared by proteins with a given function. Results Here, we present a systematic extraction of structural motifs of seven residues from protein loops and we explore their correspondence with functional sites. Our approach is based on the structural alphabet HMM-SA (Hidden Markov Model - Structural Alphabet, which allows simplification of protein structures into uni-dimensional sequences, and advanced pattern statistics adapted to short sequences. Structural motifs of interest are selected by looking for structural motifs significantly over-represented in SCOP superfamilies in protein loops. We discovered two types of structural motifs significantly over-represented in SCOP superfamilies: (i ubiquitous motifs, shared by several superfamilies and (ii superfamily-specific motifs, over-represented in few superfamilies. A comparison of ubiquitous words with known small structural motifs shows that they contain well-described motifs as turn, niche or nest motifs. A comparison between superfamily-specific motifs and biological annotations of Swiss-Prot reveals that some of them actually correspond to functional sites involved in the binding sites of small ligands, such as ATP/GTP, NAD(P and SAH/SAM. Conclusions Our findings show that statistical over-representation in SCOP superfamilies is linked to functional features. The detection of over-represented motifs within structures simplified by HMM-SA is therefore a promising approach for prediction of functional sites and annotation of uncharacterized proteins.

Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

International Nuclear Information System (INIS)

Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

1998-01-01

To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

Native characterization of nucleic acid motif thermodynamics via non-covalent catalysis

Science.gov (United States)

Wang, Chunyan; Bae, Jin H.; Zhang, David Yu

2016-01-01

DNA hybridization thermodynamics is critical for accurate design of oligonucleotides for biotechnology and nanotechnology applications, but parameters currently in use are inaccurately extrapolated based on limited quantitative understanding of thermal behaviours. Here, we present a method to measure the ΔG° of DNA motifs at temperatures and buffer conditions of interest, with significantly better accuracy (6- to 14-fold lower s.e.) than prior methods. The equilibrium constant of a reaction with thermodynamics closely approximating that of a desired motif is numerically calculated from directly observed reactant and product equilibrium concentrations; a DNA catalyst is designed to accelerate equilibration. We measured the ΔG° of terminal fluorophores, single-nucleotide dangles and multinucleotide dangles, in temperatures ranging from 10 to 45 °C. PMID:26782977

The identification of functional motifs in temporal gene expression analysis

Directory of Open Access Journals (Sweden)

Michael G. Surette

2005-01-01

Full Text Available The identification of transcription factor binding sites is essential to the understanding of the regulation of gene expression and the reconstruction of genetic regulatory networks. The in silico identification of cis-regulatory motifs is challenging due to sequence variability and lack of sufficient data to generate consensus motifs that are of quantitative or even qualitative predictive value. To determine functional motifs in gene expression, we propose a strategy to adopt false discovery rate (FDR and estimate motif effects to evaluate combinatorial analysis of motif candidates and temporal gene expression data. The method decreases the number of predicted motifs, which can then be confirmed by genetic analysis. To assess the method we used simulated motif/expression data to evaluate parameters. We applied this approach to experimental data for a group of iron responsive genes in Salmonella typhimurium 14028S. The method identified known and potentially new ferric-uptake regulator (Fur binding sites. In addition, we identified uncharacterized functional motif candidates that correlated with specific patterns of expression. A SAS code for the simulation and analysis gene expression data is available from the first author upon request.

MotifNet: a web-server for network motif analysis.

Science.gov (United States)

Smoly, Ilan Y; Lerman, Eugene; Ziv-Ukelson, Michal; Yeger-Lotem, Esti

2017-06-15

Network motifs are small topological patterns that recur in a network significantly more often than expected by chance. Their identification emerged as a powerful approach for uncovering the design principles underlying complex networks. However, available tools for network motif analysis typically require download and execution of computationally intensive software on a local computer. We present MotifNet, the first open-access web-server for network motif analysis. MotifNet allows researchers to analyze integrated networks, where nodes and edges may be labeled, and to search for motifs of up to eight nodes. The output motifs are presented graphically and the user can interactively filter them by their significance, number of instances, node and edge labels, and node identities, and view their instances. MotifNet also allows the user to distinguish between motifs that are centered on specific nodes and motifs that recur in distinct parts of the network. MotifNet is freely available at http://netbio.bgu.ac.il/motifnet . The website was implemented using ReactJs and supports all major browsers. The server interface was implemented in Python with data stored on a MySQL database. estiyl@bgu.ac.il or michaluz@cs.bgu.ac.il. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Main: Nucleotide Analysis [KOME

Lifescience Database Archive (English)

Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

Dataset of the HOX1 gene sequences of the wheat polyploids and their diploid relatives

Directory of Open Access Journals (Sweden)

Andrey B. Shcherban

2018-02-01

Full Text Available The TaHOX-1 gene of common wheat Triticum aestivum L. (BAD-genome encodes transcription factor (HD-Zip I which is characterized by the presence of a DNA-binding homeodomain (HD with an adjacent Leucine zipper (LZ motif. This gene can play a role in adapting plant to a variety of abiotic stresses, such as drought, cold, salinity etc., which strongly affect wheat production. However, it's both functional role in stress resistance and divergence during wheat evolution has not yet been elucidated. This data in brief article is associated with the research paper “Structural and functional divergence of homoeologous copies of the TaHOX-1 gene in polyploid wheats and their diploid ancestors”. The data set represents a recent survey of the primary HOX-1 gene sequences isolated from the first wheat allotetraploids (BA-genome and their corresponding Triticum and Aegilops diploid relatives. Specifically, we provide detailed information about the HOX-1 nucleotide sequences of the promoter region and both nucleotide and amino acid sequences of the gene. The sequencing data used here is available at DDBJ/EMBL/GenBank under the accession numbers MG000630-MG000698. Keywords: Wheat, Polyploid, HOX-1 gene, Homeodomain, Transcription factor, Promoter, Triticum, Aegilops

Highly scalable Ab initio genomic motif identification

KAUST Repository

Marchand, Benoit; Bajic, Vladimir B.; Kaushik, Dinesh

2011-01-01

We present results of scaling an ab initio motif family identification system, Dragon Motif Finder (DMF), to 65,536 processor cores of IBM Blue Gene/P. DMF seeks groups of mutually similar polynucleotide patterns within a set of genomic sequences and builds various motif families from them. Such information is of relevance to many problems in life sciences. Prior attempts to scale such ab initio motif-finding algorithms achieved limited success. We solve the scalability issues using a combination of mixed-mode MPI-OpenMP parallel programming, master-slave work assignment, multi-level workload distribution, multi-level MPI collectives, and serial optimizations. While the scalability of our algorithm was excellent (94% parallel efficiency on 65,536 cores relative to 256 cores on a modest-size problem), the final speedup with respect to the original serial code exceeded 250,000 when serial optimizations are included. This enabled us to carry out many large-scale ab initio motiffinding simulations in a few hours while the original serial code would have needed decades of execution time. Copyright 2011 ACM.

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

Science.gov (United States)

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

A recoding method to improve the humoral immune response to an HIV DNA vaccine.

Directory of Open Access Journals (Sweden)

Yaoxing Huang

Full Text Available This manuscript describes a novel strategy to improve HIV DNA vaccine design. Employing a new information theory based bioinformatic algorithm, we identify a set of nucleotide motifs which are common in the coding region of HIV, but are under-represented in genes that are highly expressed in the human genome. We hypothesize that these motifs contribute to the poor protein expression of gag, pol, and env genes from the c-DNAs of HIV clinical isolates. Using this approach and beginning with a codon optimized consensus gag gene, we recode the nucleotide sequence so as to remove these motifs without modifying the amino acid sequence. Transfecting the recoded DNA sequence into a human kidney cell line results in doubling the gag protein expression level compared to the codon optimized version. We then turn both sequences into DNA vaccines and compare induced antibody response in a murine model. Our sequence, which has the motifs removed, induces a five-fold increase in gag antibody response compared to the codon optimized vaccine.

Purification and functional motifs of the recombinant ATPase of orf virus.

Science.gov (United States)

Lin, Fong-Yuan; Chan, Kun-Wei; Wang, Chi-Young; Wong, Min-Liang; Hsu, Wei-Li

2011-10-01

Our previous study showed that the recombinant ATPase encoded by the A32L gene of orf virus displayed ATP hydrolysis activity as predicted from its amino acids sequence. This viral ATPase contains four known functional motifs (motifs I-IV) and a novel AYDG motif; they are essential for ATP hydrolysis reaction by binding ATP and magnesium ions. The motifs I and II correspond with the Walker A and B motifs of the typical ATPase, respectively. To examine the biochemical roles of these five conserved motifs, recombinant ATPases of five deletion mutants derived from the Taiping strain were expressed and purified. Their ATPase functions were assayed and compared with those of two wild type strains, Taiping and Nantou isolated in Taiwan. Our results showed that deletions at motifs I-III or IV exhibited lower activity than that of the wild type. Interestingly, deletion of AYDG motif decreased the ATPase activity more significantly than those of motifs I-IV deletions. Divalent ions such as magnesium and calcium were essential for ATPase activity. Moreover, our recombinant proteins of orf virus also demonstrated GTPase activity, though weaker than the original ATPase activity. Copyright © 2011 Elsevier Inc. All rights reserved.

Sequence determinants of human microsatellite variability

Directory of Open Access Journals (Sweden)

Jakobsson Mattias

2009-12-01

Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

Proteome-level assessment of origin, prevalence and function of Leucine-Aspartic Acid (LD) motifs

KAUST Repository

Alam, Tanvir; Alazmi, Meshari; Naser, Rayan Mohammad Mahmoud; Huser, Franceline; Momin, Afaque Ahmad Imtiyaz; Walkiewicz, Katarzyna Wiktoria; Canlas, Christian; Huser, Raphaë l; Ali, Amal J.; Merzaban, Jasmeen; Bajic, Vladimir B.; Gao, Xin; Arold, Stefan T.

2018-01-01

and migration, and revealed a new type of inverse LD motif consensus. Our evolutionary analysis suggested that LD motif signalling originated in the common unicellular ancestor of opisthokonts and amoebozoa by co-opting nuclear export sequences. Inter

Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

Science.gov (United States)

Wolf, P

1997-10-01

Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

Science.gov (United States)

Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

2010-09-01

The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

A structural study for the optimisation of functional motifs encoded in protein sequences

Directory of Open Access Journals (Sweden)

Helmer-Citterich Manuela

2004-04-01

Full Text Available Abstract Background A large number of PROSITE patterns select false positives and/or miss known true positives. It is possible that – at least in some cases – the weak specificity and/or sensitivity of a pattern is due to the fact that one, or maybe more, functional and/or structural key residues are not represented in the pattern. Multiple sequence alignments are commonly used to build functional sequence patterns. If residues structurally conserved in proteins sharing a function cannot be aligned in a multiple sequence alignment, they are likely to be missed in a standard pattern construction procedure. Results Here we present a new procedure aimed at improving the sensitivity and/ or specificity of poorly-performing patterns. The procedure can be summarised as follows: 1. residues structurally conserved in different proteins, that are true positives for a pattern, are identified by means of a computational technique and by visual inspection. 2. the sequence positions of the structurally conserved residues falling outside the pattern are used to build extended sequence patterns. 3. the extended patterns are optimised on the SWISS-PROT database for their sensitivity and specificity. The method was applied to eight PROSITE patterns. Whenever structurally conserved residues are found in the surface region close to the pattern (seven out of eight cases, the addition of information inferred from structural analysis is shown to improve pattern selectivity and in some cases selectivity and sensitivity as well. In some of the cases considered the procedure allowed the identification of functionally interesting residues, whose biological role is also discussed. Conclusion Our method can be applied to any type of functional motif or pattern (not only PROSITE ones which is not able to select all and only the true positive hits and for which at least two true positive structures are available. The computational technique for the identification of

The proviral genome of radiation leukemia virus: Molecular cloning, nucleotide sequence of its long terminal repeat and integration in lymphoma cell DNA

International Nuclear Information System (INIS)

Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.

1985-01-01

The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy

High affinity recognition of a Phytophthora protein by Arabidopsis via an RGD motif

NARCIS (Netherlands)

Senchou, V.; Weide, R.L.; Carrasco, A.; Bouyssou, H.; Pont-Lezica, R.; Govers, F.; Canut, H.

2004-01-01

The RGD tripeptide sequence, a cell adhesion motif present in several extracellular matrix proteins of mammalians, is involved in numerous plant processes. In plant-pathogen interactions, the RGD motif is believed to reduce plant defence responses by disrupting adhesions between the cell wall and

GPUmotif: an ultra-fast and energy-efficient motif analysis program using graphics processing units.

Science.gov (United States)

Zandevakili, Pooya; Hu, Ming; Qin, Zhaohui

2012-01-01

Computational detection of TF binding patterns has become an indispensable tool in functional genomics research. With the rapid advance of new sequencing technologies, large amounts of protein-DNA interaction data have been produced. Analyzing this data can provide substantial insight into the mechanisms of transcriptional regulation. However, the massive amount of sequence data presents daunting challenges. In our previous work, we have developed a novel algorithm called Hybrid Motif Sampler (HMS) that enables more scalable and accurate motif analysis. Despite much improvement, HMS is still time-consuming due to the requirement to calculate matching probabilities position-by-position. Using the NVIDIA CUDA toolkit, we developed a graphics processing unit (GPU)-accelerated motif analysis program named GPUmotif. We proposed a "fragmentation" technique to hide data transfer time between memories. Performance comparison studies showed that commonly-used model-based motif scan and de novo motif finding procedures such as HMS can be dramatically accelerated when running GPUmotif on NVIDIA graphics cards. As a result, energy consumption can also be greatly reduced when running motif analysis using GPUmotif. The GPUmotif program is freely available at http://sourceforge.net/projects/gpumotif/

GPUmotif: an ultra-fast and energy-efficient motif analysis program using graphics processing units.

Directory of Open Access Journals (Sweden)

Pooya Zandevakili

Full Text Available Computational detection of TF binding patterns has become an indispensable tool in functional genomics research. With the rapid advance of new sequencing technologies, large amounts of protein-DNA interaction data have been produced. Analyzing this data can provide substantial insight into the mechanisms of transcriptional regulation. However, the massive amount of sequence data presents daunting challenges. In our previous work, we have developed a novel algorithm called Hybrid Motif Sampler (HMS that enables more scalable and accurate motif analysis. Despite much improvement, HMS is still time-consuming due to the requirement to calculate matching probabilities position-by-position. Using the NVIDIA CUDA toolkit, we developed a graphics processing unit (GPU-accelerated motif analysis program named GPUmotif. We proposed a "fragmentation" technique to hide data transfer time between memories. Performance comparison studies showed that commonly-used model-based motif scan and de novo motif finding procedures such as HMS can be dramatically accelerated when running GPUmotif on NVIDIA graphics cards. As a result, energy consumption can also be greatly reduced when running motif analysis using GPUmotif. The GPUmotif program is freely available at http://sourceforge.net/projects/gpumotif/

Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

NARCIS (Netherlands)

I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

1993-01-01

textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

Discriminative Motif Discovery via Simulated Evolution and Random Under-Sampling

OpenAIRE

Song, Tao; Gu, Hong

2014-01-01

Conserved motifs in biological sequences are closely related to their structure and functions. Recently, discriminative motif discovery methods have attracted more and more attention. However, little attention has been devoted to the data imbalance problem, which is one of the main reasons affecting the performance of the discriminative models. In this article, a simulated evolution method is applied to solve the multi-class imbalance problem at the stage of data preprocessing, and at the sta...

Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

Science.gov (United States)

Le Gall, O; Candresse, T; Dunez, J

1988-02-01

Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

Directory of Open Access Journals (Sweden)

Jacqueline Morris

2017-12-01

Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

Spectrometric study of the folding process of i-motif-forming DNA sequences upstream of the c-kit transcription initiation site

International Nuclear Information System (INIS)

Bucek, Pavel; Gargallo, Raimundo; Kudrev, Andrei

2010-01-01

The c-kit oncogene shows a cytosine-rich DNA region upstream of the transcription initiation site which forms an i-motif structure at slightly acidic pH values (Bucek et al. ). In the present study, the pH-induced formation of i-motif - forming sequences 5'-CCC CTC CCT CGC GCC CGC CCG-3' (ckitC1, native), 5'-CCC TTC CCT TGT GCC CGC CCG-3' (ckitC2) and 5'-CCCTT CCC TTTTT CCC T CCC T-3' (ckitC3) was studied by spectroscopic techniques, such as UV molecular absorption and circular dichroism (CD), in tandem with two multivariate data analysis methods, the hard modelling-based matrix method and the soft modelling-based MCR-ALS approach. Use of the hard chemical modelling enabled us to propose the equilibrium model, which describes spectral changes as functions of solution acidity. Additionally, the intrinsic protonation constant, K in , and the cooperativity parameters, ω c , and ω a , were calculated from the fitting procedure of the coupled CD and molecular absorption spectra. In the case of ckitC2 and ckitC3, the hard model correctly reproduced the spectral variations observed experimentally. The results indicated that folding was accompanied by a cooperative process, i.e. the enhancement of protonated structure stability upon protonation. In contrast, unfolding was accompanied by an anticooperative process. Finally, folding of the native sequence, ckitC1, seemed to follow a more complex mechanism.

The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

Energy Technology Data Exchange (ETDEWEB)

Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

1988-07-25

The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

Science.gov (United States)

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-09-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

Linear motif atlas for phosphorylation-dependent signaling

DEFF Research Database (Denmark)

Miller, Martin Lee; Jensen, LJ; Diella, F

2008-01-01

bind to them remains a challenge. NetPhorest is an atlas of consensus sequence motifs that covers 179 kinases and 104 phosphorylation-dependent binding domains [Src homology 2 (SH2), phosphotyrosine binding (PTB), BRCA1 C-terminal (BRCT), WW, and 14-3-3]. The atlas reveals new aspects of signaling...

Exploiting BAC-end sequences for the mining, characterization and utility of new short sequences repeat (SSR) markers in Citrus.

Science.gov (United States)

Biswas, Manosh Kumar; Chai, Lijun; Mayer, Christoph; Xu, Qiang; Guo, Wenwu; Deng, Xiuxin

2012-05-01

The aim of this study was to develop a large set of microsatellite markers based on publicly available BAC-end sequences (BESs), and to evaluate their transferability, discriminating capacity of genotypes and mapping ability in Citrus. A set of 1,281 simple sequence repeat (SSR) markers were developed from the 46,339 Citrus clementina BAC-end sequences (BES), of them 20.67% contained SSR longer than 20 bp, corresponding to roughly one perfect SSR per 2.04 kb. The most abundant motifs were di-nucleotide (16.82%) repeats. Among all repeat motifs (TA/AT)n is the most abundant (8.38%), followed by (AG/CT)n (4.51%). Most of the BES-SSR are located in the non-coding region, but 1.3% of BES-SSRs were found to be associated with transposable element (TE). A total of 400 novel SSR primer pairs were synthesized and their transferability and polymorphism tested on a set of 16 Citrus and Citrus relative's species. Among these 333 (83.25%) were successfully amplified and 260 (65.00%) showed cross-species transferability with Poncirus trifoliata and Fortunella sp. These cross-species transferable markers could be useful for cultivar identification, for genomic study of Citrus, Poncirus and Fortunella sp. Utility of the developed SSR marker was demonstrated by identifying a set of 118 markers each for construction of linkage map of Citrus reticulata and Poncirus trifoliata. Genetic diversity and phylogenetic relationship among 40 Citrus and its related species were conducted with the aid of 25 randomly selected SSR primer pairs and results revealed that citrus genomic SSRs are superior to genic SSR for genetic diversity and germplasm characterization of Citrus spp.

A novel k-mer set memory (KSM) motif representation improves regulatory variant prediction.

Science.gov (United States)

Guo, Yuchun; Tian, Kevin; Zeng, Haoyang; Guo, Xiaoyun; Gifford, David Kenneth

2018-04-13

The representation and discovery of transcription factor (TF) sequence binding specificities is critical for understanding gene regulatory networks and interpreting the impact of disease-associated noncoding genetic variants. We present a novel TF binding motif representation, the k -mer set memory (KSM), which consists of a set of aligned k -mers that are overrepresented at TF binding sites, and a new method called KMAC for de novo discovery of KSMs. We find that KSMs more accurately predict in vivo binding sites than position weight matrix (PWM) models and other more complex motif models across a large set of ChIP-seq experiments. Furthermore, KSMs outperform PWMs and more complex motif models in predicting in vitro binding sites. KMAC also identifies correct motifs in more experiments than five state-of-the-art motif discovery methods. In addition, KSM-derived features outperform both PWM and deep learning model derived sequence features in predicting differential regulatory activities of expression quantitative trait loci (eQTL) alleles. Finally, we have applied KMAC to 1600 ENCODE TF ChIP-seq data sets and created a public resource of KSM and PWM motifs. We expect that the KSM representation and KMAC method will be valuable in characterizing TF binding specificities and in interpreting the effects of noncoding genetic variations. © 2018 Guo et al.; Published by Cold Spring Harbor Laboratory Press.

Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

International Nuclear Information System (INIS)

Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

1988-01-01

Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

Science.gov (United States)

de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

2015-01-01

The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

ANALYSIS OF STABILITY OF TRINUCLEOTIDE TTC MOTIFS IN COMMON FLAX PLANTED IN THE CHERNOBYL AREA

Directory of Open Access Journals (Sweden)

Veronika Lancíková

2015-02-01

Full Text Available Flax (Linum usitatissimum L. is one of the oldest domesticated plants — it was cultivated as early as in ancient Egypt and Samaria 10,000 years ago to serve as a source of fiber and oil, whence it later spread around the world. Compared with other plants, the flax genome consists of a high number of repetitive sequences, middle repetitive sequences and small repetitive sequences of nucleotides. The aim of the study was to analyze the stability of the existing trinucleotides motifs of microsatellite DNA of the flax genome (genotype Kyivskyi, growing in the Chernobyl conditions. The Chernobyl area is the most extensive “natural” laboratory suitable for the study of radiation effects. Over the last 20 years, the researches collected important knowledge about the effects of low and high radiation doses on the DNA isolated from the plant material growing on the remediated fields near Chernobyl and the plant material from fields contaminated by radioactive cesium 137Cs and strontium 90Sr. Using eight pairs of microsatellite primers, we successfully amplified the samples from the remediated fields. For each primer in the control samples and remediated samples, we detected 1 to 3 fragments per locus, each in size up to 120 to 250 base pairs. The applied microsatellite primers confirmed the monomorphic condition of microsatellite loci.

Anion induced conformational preference of Cα NN motif residues in functional proteins.

Science.gov (United States)

Patra, Piya; Ghosh, Mahua; Banerjee, Raja; Chakrabarti, Jaydeb

2017-12-01

Among different ligand binding motifs, anion binding C α NN motif consisting of peptide backbone atoms of three consecutive residues are observed to be important for recognition of free anions, like sulphate or biphosphate and participate in different key functions. Here we study the interaction of sulphate and biphosphate with C α NN motif present in different proteins. Instead of total protein, a peptide fragment has been studied keeping C α NN motif flanked in between other residues. We use classical force field based molecular dynamics simulations to understand the stability of this motif. Our data indicate fluctuations in conformational preferences of the motif residues in absence of the anion. The anion gives stability to one of these conformations. However, the anion induced conformational preferences are highly sequence dependent and specific to the type of anion. In particular, the polar residues are more favourable compared to the other residues for recognising the anion. © 2017 Wiley Periodicals, Inc.

Promoter Motifs in NCLDVs: An Evolutionary Perspective

Directory of Open Access Journals (Sweden)

Graziele Pereira Oliveira

2017-01-01

Full Text Available For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV, raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’ that could be evolved gradually by nucleotides’ gain and loss and point mutations.

Promoter Motifs in NCLDVs: An Evolutionary Perspective

Science.gov (United States)

Oliveira, Graziele Pereira; Andrade, Ana Cláudia dos Santos Pereira; Rodrigues, Rodrigo Araújo Lima; Arantes, Thalita Souza; Boratto, Paulo Victor Miranda; Silva, Ludmila Karen dos Santos; Dornas, Fábio Pio; Trindade, Giliane de Souza; Drumond, Betânia Paiva; La Scola, Bernard; Kroon, Erna Geessien; Abrahão, Jônatas Santos

2017-01-01

For many years, gene expression in the three cellular domains has been studied in an attempt to discover sequences associated with the regulation of the transcription process. Some specific transcriptional features were described in viruses, although few studies have been devoted to understanding the evolutionary aspects related to the spread of promoter motifs through related viral families. The discovery of giant viruses and the proposition of the new viral order Megavirales that comprise a monophyletic group, named nucleo-cytoplasmic large DNA viruses (NCLDV), raised new questions in the field. Some putative promoter sequences have already been described for some NCLDV members, bringing new insights into the evolutionary history of these complex microorganisms. In this review, we summarize the main aspects of the transcription regulation process in the three domains of life, followed by a systematic description of what is currently known about promoter regions in several NCLDVs. We also discuss how the analysis of the promoter sequences could bring new ideas about the giant viruses’ evolution. Finally, considering a possible common ancestor for the NCLDV group, we discussed possible promoters’ evolutionary scenarios and propose the term “MEGA-box” to designate an ancestor promoter motif (‘TATATAAAATTGA’) that could be evolved gradually by nucleotides’ gain and loss and point mutations. PMID:28117683

The PurR regulon in Lactococcus lactis – transcriptional regulation of the purine nucleotide metabolism and translational machinery

DEFF Research Database (Denmark)

Jendresen, Christian Bille; Martinussen, Jan; Kilstrup, Mogens

2012-01-01

Purine nucleotides are either synthesized de novo from 5-phosphoribosyl-1-pyrophosphate (PRPP) or salvaged from the environment. In Lactococcus lactis, transcription of the de novo synthesis operons, purCSQLF and purDEK, has genetically been shown to be activated by the PurR protein when bound to......-related functions. Of special interest is the presence of PurBox motifs in rrn promoters, suggesting a novel connection between nucleotide availability and the translational machinery....

Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

Science.gov (United States)

Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

2016-01-01

Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

The position of the Gly-xxx-Gly motif in transmembrane segments modulates dimer affinity.

Science.gov (United States)

Johnson, Rachel M; Rath, Arianna; Deber, Charles M

2006-12-01

Although the intrinsic low solubility of membrane proteins presents challenges to their high-resolution structure determination, insight into the amino acid sequence features and forces that stabilize their folds has been provided through study of sequence-dependent helix-helix interactions between single transmembrane (TM) helices. While the stability of helix-helix partnerships mediated by the Gly-xxx-Gly (GG4) motif is known to be generally modulated by distal interfacial residues, it has not been established whether the position of this motif, with respect to the ends of a given TM segment, affects dimer affinity. Here we examine the relationship between motif position and affinity in the homodimers of 2 single-spanning membrane protein TM sequences: glycophorin A (GpA) and bacteriophage M13 coat protein (MCP). Using the TOXCAT assay for dimer affinity on a series of GpA and MCP TM segments that have been modified with either 4 Leu residues at each end or with 8 Leu residues at the N-terminal end, we show that in each protein, centrally located GG4 motifs are capable of stronger helix-helix interactions than those proximal to TM helix ends, even when surrounding interfacial residues are maintained. The relative importance of GG4 motifs in stabilizing helix-helix interactions therefore must be considered not only in its specific residue context but also in terms of the location of the interactive surface relative to the N and C termini of alpha-helical TM segments.

Creation of Hybrid Nanorods From Sequences of Natural Trimeric Fibrous Proteins Using the Fibritin Trimerization Motif

Science.gov (United States)

Papanikolopoulou, Katerina; van Raaij, Mark J.; Mitraki, Anna

Stable, artificial fibrous proteins that can be functionalized open new avenues in fields such as bionanomaterials design and fiber engineering. An important source of inspiration for the creation of such proteins are natural fibrous proteins such as collagen, elastin, insect silks, and fibers from phages and viruses. The fibrous parts of this last class of proteins usually adopt trimeric, β-stranded structural folds and are appended to globular, receptor-binding domains. It has been recently shown that the globular domains are essential for correct folding and trimerization and can be successfully substituted by a very small (27-amino acid) trimerization motif from phage T4 fibritin. The hybrid proteins are correctly folded nanorods that can withstand extreme conditions. When the fibrous part derives from the adenovirus fiber shaft, different tissue-targeting specificities can be engineered into the hybrid proteins, which therefore can be used as gene therapy vectors. The integration of such stable nanorods in devices is also a big challenge in the field of biomechanical design. The fibritin foldon domain is a versatile trimerization motif and can be combined with a variety of fibrous motifs, such as coiled-coil, collagenous, and triple β-stranded motifs, provided the appropriate linkers are used. The combination of different motifs within the same fibrous molecule to create stable rods with multiple functions can even be envisioned. We provide a comprehensive overview of the experimental procedures used for designing, creating, and characterizing hybrid fibrous nanorods using the fibritin trimerization motif.

A novel fibronectin binding motif in MSCRAMMs targets F3 modules.

Directory of Open Access Journals (Sweden)

Sabitha Prabhakaran

Full Text Available BBK32 is a surface expressed lipoprotein and fibronectin (Fn-binding microbial surface component recognizing adhesive matrix molecule (MSCRAMM of Borrelia burgdorferi, the causative agent of Lyme disease. Previous studies from our group showed that BBK32 is a virulence factor in experimental Lyme disease and located the Fn-binding region to residues 21-205 of the lipoprotein.Studies aimed at identifying interacting sites between BBK32 and Fn revealed an interaction between the MSCRAMM and the Fn F3 modules. Further analysis of this interaction showed that BBK32 can cause the aggregation of human plasma Fn in a similar concentration-dependent manner to that of anastellin, the superfibronectin (sFn inducing agent. The resulting Fn aggregates are conformationally distinct from plasma Fn as indicated by a change in available thermolysin cleavage sites. Recombinant BBK32 and anastellin affect the structure of Fn matrices formed by cultured fibroblasts and inhibit endothelial cell proliferation similarly. Within BBK32, we have located the sFn-forming activity to a region between residues 160 and 175 which contains two sequence motifs that are also found in anastellin. Synthetic peptides mimicking these motifs induce Fn aggregation, whereas a peptide with a scrambled sequence motif was inactive, suggesting that these motifs represent the sFn-inducing sequence.We conclude that BBK32 induces the formation of Fn aggregates that are indistinguishable from those formed by anastellin. The results of this study provide evidence for how bacteria can target host proteins to manipulate host cell activities.

Modeling of the Ebola Virus Delta Peptide Reveals a Potential Lytic Sequence Motif

Directory of Open Access Journals (Sweden)

William R. Gallaher

2015-01-01

Full Text Available Filoviruses, such as Ebola and Marburg viruses, cause severe outbreaks of human infection, including the extensive epidemic of Ebola virus disease (EVD in West Africa in 2014. In the course of examining mutations in the glycoprotein gene associated with 2014 Ebola virus (EBOV sequences, a differential level of conservation was noted between the soluble form of glycoprotein (sGP and the full length glycoprotein (GP, which are both encoded by the GP gene via RNA editing. In the region of the proteins encoded after the RNA editing site sGP was more conserved than the overlapping region of GP when compared to a distant outlier species, Tai Forest ebolavirus. Half of the amino acids comprising the “delta peptide”, a 40 amino acid carboxy-terminal fragment of sGP, were identical between otherwise widely divergent species. A lysine-rich amphipathic peptide motif was noted at the carboxyl terminus of delta peptide with high structural relatedness to the cytolytic peptide of the non-structural protein 4 (NSP4 of rotavirus. EBOV delta peptide is a candidate viroporin, a cationic pore-forming peptide, and may contribute to EBOV pathogenesis.

Condensing the information in DNA with double-headed nucleotides

DEFF Research Database (Denmark)

Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

2017-01-01

A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

NARCIS (Netherlands)

Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

2005-01-01

The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

Context based computational analysis and characterization of ARS consensus sequences (ACS of Saccharomyces cerevisiae genome

Directory of Open Access Journals (Sweden)

Vinod Kumar Singh

2016-09-01

Full Text Available Genome-wide experimental studies in Saccharomyces cerevisiae reveal that autonomous replicating sequence (ARS requires an essential consensus sequence (ACS for replication activity. Computational studies identified thousands of ACS like patterns in the genome. However, only a few hundreds of these sites act as replicating sites and the rest are considered as dormant or evolving sites. In a bid to understand the sequence makeup of replication sites, a content and context-based analysis was performed on a set of replicating ACS sequences that binds to origin-recognition complex (ORC denoted as ORC-ACS and non-replicating ACS sequences (nrACS, that are not bound by ORC. In this study, DNA properties such as base composition, correlation, sequence dependent thermodynamic and DNA structural profiles, and their positions have been considered for characterizing ORC-ACS and nrACS. Analysis reveals that ORC-ACS depict marked differences in nucleotide composition and context features in its vicinity compared to nrACS. Interestingly, an A-rich motif was also discovered in ORC-ACS sequences within its nucleosome-free region. Profound changes in the conformational features, such as DNA helical twist, inclination angle and stacking energy between ORC-ACS and nrACS were observed. Distribution of ACS motifs in the non-coding segments points to the locations of ORC-ACS which are found far away from the adjacent gene start position compared to nrACS thereby enabling an accessible environment for ORC-proteins. Our attempt is novel in considering the contextual view of ACS and its flanking region along with nucleosome positioning in the S. cerevisiae genome and may be useful for any computational prediction scheme.

Cations form sequence selective motifs within DNA grooves via a combination of cation-pi and ion-dipole/hydrogen bond interactions.

Science.gov (United States)

Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

2013-01-01

The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl⁺) and the polarized first hydration shell waters of divalent cations (Mg²⁺, Ca²⁺) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves.

GNG Motifs Can Replace a GGG Stretch during G-Quadruplex Formation in a Context Dependent Manner.

Directory of Open Access Journals (Sweden)

Kohal Das

Full Text Available G-quadruplexes are one of the most commonly studied non-B DNA structures. Generally, these structures are formed using a minimum of 4, three guanine tracts, with connecting loops ranging from one to seven. Recent studies have reported deviation from this general convention. One such deviation is the involvement of bulges in the guanine tracts. In this study, guanines along with bulges, also referred to as GNG motifs have been extensively studied using recently reported HOX11 breakpoint fragile region I as a model template. By strategic mutagenesis approach we show that the contribution from continuous G-tracts may be dispensible during G-quadruplex formation when such motifs are flanked by GNGs. Importantly, the positioning and number of GNG/GNGNG can also influence the formation of G-quadruplexes. Further, we assessed three genomic regions from HIF1 alpha, VEGF and SHOX gene for G-quadruplex formation using GNG motifs. We show that HIF1 alpha sequence harbouring GNG motifs can fold into intramolecular G-quadruplex. In contrast, GNG motifs in mutant VEGF sequence could not participate in structure formation, suggesting that the usage of GNG is context dependent. Importantly, we show that when two continuous stretches of guanines are flanked by two independent GNG motifs in a naturally occurring sequence (SHOX, it can fold into an intramolecular G-quadruplex. Finally, we show the specific binding of G-quadruplex binding protein, Nucleolin and G-quadruplex antibody, BG4 to SHOX G-quadruplex. Overall, our study provides novel insights into the role of GNG motifs in G-quadruplex structure formation which may have both physiological and pathological implications.

Prediction of host - pathogen protein interactions between Mycobacterium tuberculosis and Homo sapiens using sequence motifs.

Science.gov (United States)

Huo, Tong; Liu, Wei; Guo, Yu; Yang, Cheng; Lin, Jianping; Rao, Zihe

2015-03-26

Emergence of multiple drug resistant strains of M. tuberculosis (MDR-TB) threatens to derail global efforts aimed at reigning in the pathogen. Co-infections of M. tuberculosis with HIV are difficult to treat. To counter these new challenges, it is essential to study the interactions between M. tuberculosis and the host to learn how these bacteria cause disease. We report a systematic flow to predict the host pathogen interactions (HPIs) between M. tuberculosis and Homo sapiens based on sequence motifs. First, protein sequences were used as initial input for identifying the HPIs by 'interolog' method. HPIs were further filtered by prediction of domain-domain interactions (DDIs). Functional annotations of protein and publicly available experimental results were applied to filter the remaining HPIs. Using such a strategy, 118 pairs of HPIs were identified, which involve 43 proteins from M. tuberculosis and 48 proteins from Homo sapiens. A biological interaction network between M. tuberculosis and Homo sapiens was then constructed using the predicted inter- and intra-species interactions based on the 118 pairs of HPIs. Finally, a web accessible database named PATH (Protein interactions of M. tuberculosis and Human) was constructed to store these predicted interactions and proteins. This interaction network will facilitate the research on host-pathogen protein-protein interactions, and may throw light on how M. tuberculosis interacts with its host.

Complete Genomic Sequence of Border Disease Virus, a Pestivirus from Sheep

Science.gov (United States)

Becher, Paul; Orlich, Michaela; Thiel, Heinz-Jürgen

1998-01-01

The genus Pestivirus of the family Flaviviridae comprises three established species, namely, bovine viral diarrhea virus (BVDV), classical swine fever virus (CSFV), and border disease virus from sheep (BDV). In this study, we report the first complete nucleotide sequence of BDV, that of strain X818. The genome is 12,333 nucleotides long and contains one long open reading frame encoding 3,895 amino acids. The 5′ noncoding region (NCR) of BDV X818 consists of 372 nucleotides and is thus similar in length to the 5′ NCR reported for other pestiviruses. The 3′ NCR of X818 is 273 nucleotides long and thereby at least 32 nucleotides longer than the 3′ NCR of pestiviruses analyzed thus far. Within the 3′ NCR of BDV X818, the sequence motif TATTTATTTA was identified at four locations. The same repeat was found at two or three locations within the 3′ NCR of different CSFV isolates but was absent in the 3′ NCR of BVDV. Analysis of five additional BDV strains showed that the 3′ NCR sequences are highly conserved within this species. Comparison of the deduced amino acid sequence of X818 with the ones of other pestiviruses allowed the prediction of polyprotein cleavage sites which were conserved with regard to the structural proteins. It has been reported for two BVDV strains that cleavage at the nonstructural (NS) protein sites 3/4A, 4A/4B, 4B/5A, and 5A/5B is mediated by the NS3 serine protease and for each site a conserved leucine was found at the P1 position followed by either serine or alanine at P1′ (N. Tautz, K. Elbers, D. Stoll, G. Meyers, and H.-J. Thiel, J. Virol. 71:5415–5422, 1997; J. Xu, E. Mendez, P. R. Caron, C. Lin, M. A. Murcko, M. S. Collett, and C. M. Rice, J. Virol. 71:5312–5322). Interestingly, P1′ of the predicted NS5A/5B cleavage site of BDV is represented by an asparagine residue. Transient expression studies demonstrated that this unusual NS5A/5B processing site is efficiently cleaved by the NS3 serine protease of BDV. PMID

Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

Science.gov (United States)

Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

2017-11-01

Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

The arabidopsis cyclic nucleotide interactome

KAUST Repository

Donaldson, Lara Elizabeth

2016-05-11

Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

Nucleotide Sequence and Analysis of an orotate transporter-containing plasmid isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410

DEFF Research Database (Denmark)

Defoor, Els Marie Celine; Martinussen, Jan

A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...

Short Arginine Motifs Drive Protein Stickiness in the Escherichia coli Cytoplasm.

Science.gov (United States)

Kyne, Ciara; Crowley, Peter B

2017-09-19

Although essential to numerous biotech applications, knowledge of molecular recognition by arginine-rich motifs in live cells remains limited. 1 H, 15 N HSQC and 19 F NMR spectroscopies were used to investigate the effects of C-terminal -GR n (n = 1-5) motifs on GB1 interactions in Escherichia coli cells and cell extracts. While the "biologically inert" GB1 yields high-quality in-cell spectra, the -GR n fusions with n = 4 or 5 were undetectable. This result suggests that a tetra-arginine motif is sufficient to drive interactions between a test protein and macromolecules in the E. coli cytoplasm. The inclusion of a 12 residue flexible linker between GB1 and the -GR 5 motif did not improve detection of the "inert" domain. In contrast, all of the constructs were detectable in cell lysates and extracts, suggesting that the arginine-mediated complexes were weak. Together these data reveal the significance of weak interactions between short arginine-rich motifs and the E. coli cytoplasm and demonstrate the potential of such motifs to modify protein interactions in living cells. These interactions must be considered in the design of (in vivo) nanoscale assemblies that rely on arginine-rich sequences.

Next generation sequencing and molecular analysis of artichoke Italian latent virus.

Science.gov (United States)

Elbeaino, Toufic; Belghacem, Imen; Mascia, Tiziana; Gallitelli, Donato; Digiaro, Michele

2017-06-01

Next-generation sequencing (NGS) allowed the assembly of the complete RNA-1 and RNA-2 sequences of a grapevine isolate of artichoke Italian latent virus (AILV). RNA-1 and RNA-2 are 7,338 and 4,630 nucleotides in length excluding the 3' terminal poly(A) tail, and encode two putative polyproteins of 255.8 kDa (p1) and 149.6 kDa (p2), respectively. All conserved motifs and predicted cleavage sites, typical for nepovirus polyproteins, were found in p1 and p2. AILV p1 and p2 share high amino acid identity with their homologues in beet ringspot virus (p1, 81% and p2, 71%), tomato black ring virus (p1, 79% and p2, 63%), grapevine Anatolian ringspot virus (p1, 65% and p2, 63%), and grapevine chrome mosaic virus (p1, 60% and p2, 54%), and to a lesser extent with other grapevine nepoviruses of subgroup A and C. Phylogenetic and sequence analyses, all confirmed the strict relationship of AILV with members classified in subgroup B of genus Nepovirus.

Karyological characterization and identification of four repetitive element groups (the 18S – 28S rRNA gene, telomeric sequences, microsatellite repeat motifs, Rex retroelements) of the Asian swamp eel (Monopterus albus)

Science.gov (United States)

Suntronpong, Aorarat; Thapana, Watcharaporn; Twilprawat, Panupon; Prakhongcheep, Ornjira; Somyong, Suthasinee; Muangmai, Narongrit; Surin Peyachoknagul; Srikulnath, Kornsorn

2017-01-01

Abstract Among teleost fishes, Asian swamp eel (Monopterus albus Zuiew, 1793) possesses the lowest chromosome number, 2n = 24. To characterize the chromosome constitution and investigate the genome organization of repetitive sequences in M. albus, karyotyping and chromosome mapping were performed with the 18S – 28S rRNA gene, telomeric repeats, microsatellite repeat motifs, and Rex retroelements. The 18S – 28S rRNA genes were observed to the pericentromeric region of chromosome 4 at the same position with large propidium iodide and C-positive bands, suggesting that the molecular structure of the pericentromeric regions of chromosome 4 has evolved in a concerted manner with amplification of the 18S – 28S rRNA genes. (TTAGGG)n sequences were found at the telomeric ends of all chromosomes. Eight of 19 microsatellite repeat motifs were dispersedly mapped on different chromosomes suggesting the independent amplification of microsatellite repeat motifs in M. albus. Monopterus albus Rex1 (MALRex1) was observed at interstitial sites of all chromosomes and in the pericentromeric regions of most chromosomes whereas MALRex3 was scattered and localized to all chromosomes and MALRex6 to several chromosomes. This suggests that these retroelements were independently amplified or lost in M. albus. Among MALRexs (MALRex1, MALRex3, and MALRex6), MALRex6 showed higher interspecific sequence divergences from other teleost species in comparison. This suggests that the divergence of Rex6 sequences of M. albus might have occurred a relatively long time ago. PMID:29093797

Identification, characterization, and utilization of genome-wide simple sequence repeats to identify a QTL for acidity in apple

Science.gov (United States)

2012-01-01

Background Apple is an economically important fruit crop worldwide. Developing a genetic linkage map is a critical step towards mapping and cloning of genes responsible for important horticultural traits in apple. To facilitate linkage map construction, we surveyed and characterized the distribution and frequency of perfect microsatellites in assembled contig sequences of the apple genome. Results A total of 28,538 SSRs have been identified in the apple genome, with an overall density of 40.8 SSRs per Mb. Di-nucleotide repeats are the most frequent microsatellites in the apple genome, accounting for 71.9% of all microsatellites. AT/TA repeats are the most frequent in genomic regions, accounting for 38.3% of all the G-SSRs, while AG/GA dimers prevail in transcribed sequences, and account for 59.4% of all EST-SSRs. A total set of 310 SSRs is selected to amplify eight apple genotypes. Of these, 245 (79.0%) are found to be polymorphic among cultivars and wild species tested. AG/GA motifs in genomic regions have detected more alleles and higher PIC values than AT/TA or AC/CA motifs. Moreover, AG/GA repeats are more variable than any other dimers in apple, and should be preferentially selected for studies, such as genetic diversity and linkage map construction. A total of 54 newly developed apple SSRs have been genetically mapped. Interestingly, clustering of markers with distorted segregation is observed on linkage groups 1, 2, 10, 15, and 16. A QTL responsible for malic acid content of apple fruits is detected on linkage group 8, and accounts for ~13.5% of the observed phenotypic variation. Conclusions This study demonstrates that di-nucleotide repeats are prevalent in the apple genome and that AT/TA and AG/GA repeats are the most frequent in genomic and transcribed sequences of apple, respectively. All SSR motifs identified in this study as well as those newly mapped SSRs will serve as valuable resources for pursuing apple genetic studies, aiding the apple breeding

In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

African Journals Online (AJOL)

Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

Complete sequence of two tick-borne flaviviruses isolated from Siberia and the UK: analysis and significance of the 5' and 3'-UTRs.

Science.gov (United States)

Gritsun, T S; Venugopal, K; Zanotto, P M; Mikhailov, M V; Sall, A A; Holmes, E C; Polkinghorne, I; Frolova, T V; Pogodina, V V; Lashkevich, V A; Gould, E A

1997-05-01

The complete nucleotide sequence of two tick-transmitted flaviviruses, Vasilchenko (Vs) from Siberia and louping ill (LI) from the UK, have been determined. The genomes were respectively, 10928 and 10871 nucleotides (nt) in length. The coding strategy and functional protein sequence motifs of tick-borne flaviviruses are presented in both Vs and LI viruses. The phylogenies based on maximum likelihood, maximum parsimony and distance analysis of the polyproteins, identified Vs virus as a member of the tick-borne encephalitis virus subgroup within the tick-borne serocomplex, genus Flavivirus, family Flaviviridae. Comparative alignment of the 3'-untranslated regions revealed deletions of different lengths essentially at the same position downstream of the stop codon for all tick-borne viruses. Two direct 27 nucleotide repeats at the 3'-end were found only for Vs and LI virus. Immediately following the deletions a region of 332-334 nt with relatively conserved primary structure (67-94% identity) was observed at the 3'-non-coding end of the virus genome. Pairwise comparisons of the nucleotide sequence data revealed similar levels of variation between the coding region, and the 5' and 3'-termini of the genome, implying an equivalent strong selective control for translated and untranslated regions. Indeed the predicted folding of the 5' and 3'-untranslated regions revealed patterns of stem and loop structures conserved for all tick-borne flaviviruses suggesting a purifying selection for preservation of essential RNA secondary structures which could be involved in translational control and replication. The possible implications of these findings are discussed.

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

Science.gov (United States)

Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

2012-10-01

To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

Science.gov (United States)

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

Science.gov (United States)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

Science.gov (United States)

Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

1996-10-03

We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

Genome-wide conserved consensus transcription factor binding motifs are hyper-methylated

Directory of Open Access Journals (Sweden)

Down Thomas A

2010-09-01

Full Text Available Abstract Background DNA methylation can regulate gene expression by modulating the interaction between DNA and proteins or protein complexes. Conserved consensus motifs exist across the human genome ("predicted transcription factor binding sites": "predicted TFBS" but the large majority of these are proven by chromatin immunoprecipitation and high throughput sequencing (ChIP-seq not to be biological transcription factor binding sites ("empirical TFBS". We hypothesize that DNA methylation at conserved consensus motifs prevents promiscuous or disorderly transcription factor binding. Results Using genome-wide methylation maps of the human heart and sperm, we found that all conserved consensus motifs as well as the subset of those that reside outside CpG islands have an aggregate profile of hyper-methylation. In contrast, empirical TFBS with conserved consensus motifs have a profile of hypo-methylation. 40% of empirical TFBS with conserved consensus motifs resided in CpG islands whereas only 7% of all conserved consensus motifs were in CpG islands. Finally we further identified a minority subset of TF whose profiles are either hypo-methylated or neutral at their respective conserved consensus motifs implicating that these TF may be responsible for establishing or maintaining an un-methylated DNA state, or whose binding is not regulated by DNA methylation. Conclusions Our analysis supports the hypothesis that at least for a subset of TF, empirical binding to conserved consensus motifs genome-wide may be controlled by DNA methylation.

De Novo Discovery of Structured ncRNA Motifs in Genomic Sequences

DEFF Research Database (Denmark)

Ruzzo, Walter L; Gorodkin, Jan

2014-01-01

De novo discovery of "motifs" capturing the commonalities among related noncoding ncRNA structured RNAs is among the most difficult problems in computational biology. This chapter outlines the challenges presented by this problem, together with some approaches towards solving them, with an emphas...... on an approach based on the CMfinder CMfinder program as a case study. Applications to genomic screens for novel de novo structured ncRNA ncRNA s, including structured RNA elements in untranslated portions of protein-coding genes, are presented.......De novo discovery of "motifs" capturing the commonalities among related noncoding ncRNA structured RNAs is among the most difficult problems in computational biology. This chapter outlines the challenges presented by this problem, together with some approaches towards solving them, with an emphasis...

Systematic discovery of regulatory motifs in Fusarium graminearum by comparing four Fusarium genomes

Directory of Open Access Journals (Sweden)

Kistler Corby

2010-03-01

Full Text Available Abstract Background Fusarium graminearum (Fg, a major fungal pathogen of cultivated cereals, is responsible for billions of dollars in agriculture losses. There is a growing interest in understanding the transcriptional regulation of this organism, especially the regulation of genes underlying its pathogenicity. The generation of whole genome sequence assemblies for Fg and three closely related Fusarium species provides a unique opportunity for such a study. Results Applying comparative genomics approaches, we developed a computational pipeline to systematically discover evolutionarily conserved regulatory motifs in the promoter, downstream and the intronic regions of Fg genes, based on the multiple alignments of sequenced Fusarium genomes. Using this method, we discovered 73 candidate regulatory motifs in the promoter regions. Nearly 30% of these motifs are highly enriched in promoter regions of Fg genes that are associated with a specific functional category. Through comparison to Saccharomyces cerevisiae (Sc and Schizosaccharomyces pombe (Sp, we observed conservation of transcription factors (TFs, their binding sites and the target genes regulated by these TFs related to pathways known to respond to stress conditions or phosphate metabolism. In addition, this study revealed 69 and 39 conserved motifs in the downstream regions and the intronic regions, respectively, of Fg genes. The top intronic motif is the splice donor site. For the downstream regions, we noticed an intriguing absence of the mammalian and Sc poly-adenylation signals among the list of conserved motifs. Conclusion This study provides the first comprehensive list of candidate regulatory motifs in Fg, and underscores the power of comparative genomics in revealing functional elements among related genomes. The conservation of regulatory pathways among the Fusarium genomes and the two yeast species reveals their functional significance, and provides new insights in their

Nucleotide sequence analysis of HTLV-I isolated from cerebrospinal fluid of a patient with TSP/HAM: comparison to other HTLV-I isolates.

Science.gov (United States)

Mukhopadhyaya, R; Sadaie, M R

1993-02-01

Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.

HIV protein sequence hotspots for crosstalk with host hub proteins.

Directory of Open Access Journals (Sweden)

Mahdi Sarmady

Full Text Available HIV proteins target host hub proteins for transient binding interactions. The presence of viral proteins in the infected cell results in out-competition of host proteins in their interaction with hub proteins, drastically affecting cell physiology. Functional genomics and interactome datasets can be used to quantify the sequence hotspots on the HIV proteome mediating interactions with host hub proteins. In this study, we used the HIV and human interactome databases to identify HIV targeted host hub proteins and their host binding partners (H2. We developed a high throughput computational procedure utilizing motif discovery algorithms on sets of protein sequences, including sequences of HIV and H2 proteins. We identified as HIV sequence hotspots those linear motifs that are highly conserved on HIV sequences and at the same time have a statistically enriched presence on the sequences of H2 proteins. The HIV protein motifs discovered in this study are expressed by subsets of H2 host proteins potentially outcompeted by HIV proteins. A large subset of these motifs is involved in cleavage, nuclear localization, phosphorylation, and transcription factor binding events. Many such motifs are clustered on an HIV sequence in the form of hotspots. The sequential positions of these hotspots are consistent with the curated literature on phenotype altering residue mutations, as well as with existing binding site data. The hotspot map produced in this study is the first global portrayal of HIV motifs involved in altering the host protein network at highly connected hub nodes.

Multiple TPR motifs characterize the Fanconi anemia FANCG protein.

Science.gov (United States)

Blom, Eric; van de Vrugt, Henri J; de Vries, Yne; de Winter, Johan P; Arwert, Fré; Joenje, Hans

2004-01-05

The genome protection pathway that is defective in patients with Fanconi anemia (FA) is controlled by at least eight genes, including BRCA2. A key step in the pathway involves the monoubiquitylation of FANCD2, which critically depends on a multi-subunit nuclear 'core complex' of at least six FANC proteins (FANCA, -C, -E, -F, -G, and -L). Except for FANCL, which has WD40 repeats and a RING finger domain, no significant domain structure has so far been recognized in any of the core complex proteins. By using a homology search strategy comparing the human FANCG protein sequence with its ortholog sequences in Oryzias latipes (Japanese rice fish) and Danio rerio (zebrafish) we identified at least seven tetratricopeptide repeat motifs (TPRs) covering a major part of this protein. TPRs are degenerate 34-amino acid repeat motifs which function as scaffolds mediating protein-protein interactions, often found in multiprotein complexes. In four out of five TPR motifs tested (TPR1, -2, -5, and -6), targeted missense mutagenesis disrupting the motifs at the critical position 8 of each TPR caused complete or partial loss of FANCG function. Loss of function was evident from failure of the mutant proteins to complement the cellular FA phenotype in FA-G lymphoblasts, which was correlated with loss of binding to FANCA. Although the TPR4 mutant fully complemented the cells, it showed a reduced interaction with FANCA, suggesting that this TPR may also be of functional importance. The recognition of FANCG as a typical TPR protein predicts this protein to play a key role in the assembly and/or stabilization of the nuclear FA protein core complex.

Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

Science.gov (United States)

Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

2013-06-01

Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

Sequence and structural analysis of the chitinase insertion domain reveals two conserved motifs involved in chitin-binding.

Directory of Open Access Journals (Sweden)

Hai Li

2010-01-01

Full Text Available Chitinases are prevalent in life and are found in species including archaea, bacteria, fungi, plants, and animals. They break down chitin, which is the second most abundant carbohydrate in nature after cellulose. Hence, they are important for maintaining a balance between carbon and nitrogen trapped as insoluble chitin in biomass. Chitinases are classified into two families, 18 and 19 glycoside hydrolases. In addition to a catalytic domain, which is a triosephosphate isomerase barrel, many family 18 chitinases contain another module, i.e., chitinase insertion domain. While numerous studies focus on the biological role of the catalytic domain in chitinase activity, the function of the chitinase insertion domain is not completely understood. Bioinformatics offers an important avenue in which to facilitate understanding the role of residues within the chitinase insertion domain in chitinase function.Twenty-seven chitinase insertion domain sequences, which include four experimentally determined structures and span five kingdoms, were aligned and analyzed using a modified sequence entropy parameter. Thirty-two positions with conserved residues were identified. The role of these conserved residues was explored by conducting a structural analysis of a number of holo-enzymes. Hydrogen bonding and van der Waals calculations revealed a distinct subset of four conserved residues constituting two sequence motifs that interact with oligosaccharides. The other conserved residues may be key to the structure, folding, and stability of this domain.Sequence and structural studies of the chitinase insertion domains conducted within the framework of evolution identified four conserved residues which clearly interact with the substrates. Furthermore, evolutionary studies propose a link between the appearance of the chitinase insertion domain and the function of family 18 chitinases in the subfamily A.

Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

African Journals Online (AJOL)

STORAGESEVER

2009-06-17

Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

Science.gov (United States)

Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

2002-06-05

The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

Science.gov (United States)

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Sequence Analysis and Phylogenetic Profiling of the Nonstructural (NS Genes of H9N2 Influenza A Viruses Isolated in Iran during 1998-2007

Directory of Open Access Journals (Sweden)

Ebrahimi, M.

2014-11-01

Full Text Available The earliest evidences on circulation of Avian Influenza (AI virus on the Iranian poultry farms date back to 1998. Great economic losses through dramatic drop in egg production and high mortality rates are characteristically attributed to H9N2 AI virus. In the present work non-structural (NS genes of 10 Iranian H9N2 chicken AI viruses collected during 1998-2007 were fully sequenced and subjected to a phylogenetic analysis. The observations proved allele A was the single-detectable type of the NS gene within the studied isolates. All the examined Iranian isolates fell into the Korean sublineage with a relatively broad sequence homology (91.6-98% in nucleotide construction of the NS genes. The motif for PDZ ligand recognition of the group one isolates was either EDEV (N=6 or ESEV (N=1 While all viruses as group two contained a PL motif “KSEV” (N=3. The present work provides useful epidemiological data at molecular level on source and contemporary evolution of H9N2 virus population in Iran.

Stanniocalcin 1 binds hemin through a partially conserved heme regulatory motif

International Nuclear Information System (INIS)

Westberg, Johan A.; Jiang, Ji; Andersson, Leif C.

2011-01-01

Highlights: → Stanniocalcin 1 (STC1) binds heme through novel heme binding motif. → Central iron atom of heme and cysteine-114 of STC1 are essential for binding. → STC1 binds Fe 2+ and Fe 3+ heme. → STC1 peptide prevents oxidative decay of heme. -- Abstract: Hemin (iron protoporphyrin IX) is a necessary component of many proteins, functioning either as a cofactor or an intracellular messenger. Hemoproteins have diverse functions, such as transportation of gases, gas detection, chemical catalysis and electron transfer. Stanniocalcin 1 (STC1) is a protein involved in respiratory responses of the cell but whose mechanism of action is still undetermined. We examined the ability of STC1 to bind hemin in both its reduced and oxidized states and located Cys 114 as the axial ligand of the central iron atom of hemin. The amino acid sequence differs from the established (Cys-Pro) heme regulatory motif (HRM) and therefore presents a novel heme binding motif (Cys-Ser). A STC1 peptide containing the heme binding sequence was able to inhibit both spontaneous and H 2 O 2 induced decay of hemin. Binding of hemin does not affect the mitochondrial localization of STC1.

Single Nucleotide Polymorphism

DEFF Research Database (Denmark)

Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

2014-01-01

Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

iFORM: Incorporating Find Occurrence of Regulatory Motifs.

Science.gov (United States)

Ren, Chao; Chen, Hebing; Yang, Bite; Liu, Feng; Ouyang, Zhangyi; Bo, Xiaochen; Shu, Wenjie

2016-01-01

Accurately identifying the binding sites of transcription factors (TFs) is crucial to understanding the mechanisms of transcriptional regulation and human disease. We present incorporating Find Occurrence of Regulatory Motifs (iFORM), an easy-to-use and efficient tool for scanning DNA sequences with TF motifs described as position weight matrices (PWMs). Both performance assessment with a receiver operating characteristic (ROC) curve and a correlation-based approach demonstrated that iFORM achieves higher accuracy and sensitivity by integrating five classical motif discovery programs using Fisher's combined probability test. We have used iFORM to provide accurate results on a variety of data in the ENCODE Project and the NIH Roadmap Epigenomics Project, and the tool has demonstrated its utility in further elucidating individual roles of functional elements. Both the source and binary codes for iFORM can be freely accessed at https://github.com/wenjiegroup/iFORM. The identified TF binding sites across human cell and tissue types using iFORM have been deposited in the Gene Expression Omnibus under the accession ID GSE53962.

Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

Data.gov (United States)

US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

Salt-bridging effects on short amphiphilic helical structure and introducing sequence-based short beta-turn motifs.

Science.gov (United States)

Guarracino, Danielle A; Gentile, Kayla; Grossman, Alec; Li, Evan; Refai, Nader; Mohnot, Joy; King, Daniel

2018-02-01

Determining the minimal sequence necessary to induce protein folding is beneficial in understanding the role of protein-protein interactions in biological systems, as their three-dimensional structures often dictate their activity. Proteins are generally comprised of discrete secondary structures, from α-helices to β-turns and larger β-sheets, each of which is influenced by its primary structure. Manipulating the sequence of short, moderately helical peptides can help elucidate the influences on folding. We created two new scaffolds based on a modestly helical eight-residue peptide, PT3, we previously published. Using circular dichroism (CD) spectroscopy and changing the possible salt-bridging residues to new combinations of Lys, Arg, Glu, and Asp, we found that our most helical improvements came from the Arg-Glu combination, whereas the Lys-Asp was not significantly different from the Lys-Glu of the parent scaffold, PT3. The marked 3 10 -helical contributions in PT3 were lessened in the Arg-Glu-containing peptide with the beginning of cooperative unfolding seen through a thermal denaturation. However, a unique and unexpected signature was seen for the denaturation of the Lys-Asp peptide which could help elucidate the stages of folding between the 3 10 and α-helix. In addition, we developed a short six-residue peptide with β-turn/sheet CD signature, again to help study minimal sequences needed for folding. Overall, the results indicate that improvements made to short peptide scaffolds by fine-tuning the salt-bridging residues can enhance scaffold structure. Likewise, with the results from the new, short β-turn motif, these can help impact future peptidomimetic designs in creating biologically useful, short, structured β-sheet-forming peptides.

Mango (Mangifera indica L.) germplasm diversity based on single nucleotide polymorphisms derived from the transcriptome.

Science.gov (United States)

Sherman, Amir; Rubinstein, Mor; Eshed, Ravit; Benita, Miri; Ish-Shalom, Mazal; Sharabi-Schwager, Michal; Rozen, Ada; Saada, David; Cohen, Yuval; Ophir, Ron

2015-11-14

Germplasm collections are an important source for plant breeding, especially in fruit trees which have a long duration of juvenile period. Thus, efforts have been made to study the diversity of fruit tree collections. Even though mango is an economically important crop, most of the studies on diversity in mango collections have been conducted with a small number of genetic markers. We describe a de novo transcriptome assembly from mango cultivar 'Keitt'. Variation discovery was performed using Illumina resequencing of 'Keitt' and 'Tommy Atkins' cultivars identified 332,016 single-nucleotide polymorphisms (SNPs) and 1903 simple-sequence repeats (SSRs). Most of the SSRs (70.1%) were of trinucleotide with the preponderance of motif (GGA/AAG)n and only 23.5% were di-nucleotide SSRs with the mostly of (AT/AT)n motif. Further investigation of the diversity in the Israeli mango collection was performed based on a subset of 293 SNPs. Those markers have divided the Israeli mango collection into two major groups: one group included mostly mango accessions from Southeast Asia (Malaysia, Thailand, Indonesia) and India and the other with mainly of Floridian and Israeli mango cultivars. The latter group was more polymorphic (FS=-0.1 on the average) and was more of an admixture than the former group. A slight population differentiation was detected (FST=0.03), suggesting that if the mango accessions of the western world apparently was originated from Southeast Asia, as has been previously suggested, the duration of cultivation was not long enough to develop a distinct genetic background. Whole-transcriptome reconstruction was used to significantly broaden the mango's genetic variation resources, i.e., SNPs and SSRs. The set of SNP markers described in this study is novel. A subset of SNPs was sampled to explore the Israeli mango collection and most of them were polymorphic in many mango accessions. Therefore, we believe that these SNPs will be valuable as they recapitulate and

Characterization of Sri Lanka rabies virus isolates using nucleotide sequence analysis of nucleoprotein gene.

Science.gov (United States)

Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L

2001-01-01

Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.

Using Maximum Entropy to Find Patterns in Genomes

Science.gov (United States)

Liu, Sophia; Hockenberry, Adam; Lancichinetti, Andrea; Jewett, Michael; Amaral, Luis

The existence of over- and under-represented sequence motifs in genomes provides evidence of selective evolutionary pressures on biological mechanisms such as transcription, translation, ligand-substrate binding, and host immunity. To accurately identify motifs and other genome-scale patterns of interest, it is essential to be able to generate accurate null models that are appropriate for the sequences under study. There are currently no tools available that allow users to create random coding sequences with specified amino acid composition and GC content. Using the principle of maximum entropy, we developed a method that generates unbiased random sequences with pre-specified amino acid and GC content. Our method is the simplest way to obtain maximally unbiased random sequences that are subject to GC usage and primary amino acid sequence constraints. This approach can also be easily be expanded to create unbiased random sequences that incorporate more complicated constraints such as individual nucleotide usage or even di-nucleotide frequencies. The ability to generate correctly specified null models will allow researchers to accurately identify sequence motifs which will lead to a better understanding of biological processes. National Institute of General Medical Science, Northwestern University Presidential Fellowship, National Science Foundation, David and Lucile Packard Foundation, Camille Dreyfus Teacher Scholar Award.

Faster exact Markovian probability functions for motif occurrences: a DFA-only approach.

Science.gov (United States)

Ribeca, Paolo; Raineri, Emanuele

2008-12-15

The computation of the statistical properties of motif occurrences has an obviously relevant application: patterns that are significantly over- or under-represented in genomes or proteins are interesting candidates for biological roles. However, the problem is computationally hard; as a result, virtually all the existing motif finders use fast but approximate scoring functions, in spite of the fact that they have been shown to produce systematically incorrect results. A few interesting exact approaches are known, but they are very slow and hence not practical in the case of realistic sequences. We give an exact solution, solely based on deterministic finite-state automata (DFA), to the problem of finding the whole relevant part of the probability distribution function of a simple-word motif in a homogeneous (biological) sequence. Out of that, the z-value can always be computed, while the P-value can be obtained either when it is not too extreme with respect to the number of floating-point digits available in the implementation, or when the number of pattern occurrences is moderately low. In particular, the time complexity of the algorithms for Markov models of moderate order (0 manage to obtain an algorithm which is both easily interpretable and efficient. This approach can be used for exact statistical studies of very long genomes and protein sequences, as we illustrate with some examples on the scale of the human genome.

Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

Science.gov (United States)

Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

2016-03-22

Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

BEAM web server: a tool for structural RNA motif discovery.

Science.gov (United States)

Pietrosanto, Marco; Adinolfi, Marta; Casula, Riccardo; Ausiello, Gabriele; Ferrè, Fabrizio; Helmer-Citterich, Manuela

2018-03-15

RNA structural motif finding is a relevant problem that becomes computationally hard when working on high-throughput data (e.g. eCLIP, PAR-CLIP), often represented by thousands of RNA molecules. Currently, the BEAM server is the only web tool capable to handle tens of thousands of RNA in input with a motif discovery procedure that is only limited by the current secondary structure prediction accuracies. The recently developed method BEAM (BEAr Motifs finder) can analyze tens of thousands of RNA molecules and identify RNA secondary structure motifs associated to a measure of their statistical significance. BEAM is extremely fast thanks to the BEAR encoding that transforms each RNA secondary structure in a string of characters. BEAM also exploits the evolutionary knowledge contained in a substitution matrix of secondary structure elements, extracted from the RFAM database of families of homologous RNAs. The BEAM web server has been designed to streamline data pre-processing by automatically handling folding and encoding of RNA sequences, giving users a choice for the preferred folding program. The server provides an intuitive and informative results page with the list of secondary structure motifs identified, the logo of each motif, its significance, graphic representation and information about its position in the RNA molecules sharing it. The web server is freely available at http://beam.uniroma2.it/ and it is implemented in NodeJS and Python with all major browsers supported. marco.pietrosanto@uniroma2.it. Supplementary data are available at Bioinformatics online.

A sialoreceptor binding motif in the Mycoplasma synoviae adhesin VlhA.

Directory of Open Access Journals (Sweden)

Meghan May

Full Text Available Mycoplasma synoviae depends on its adhesin VlhA to mediate cytadherence to sialylated host cell receptors. Allelic variants of VlhA arise through recombination between an assemblage of promoterless vlhA pseudogenes and a single transcription promoter site, creating lineages of M. synoviae that each express a different vlhA allele. The predicted full-length VlhA sequences adjacent to the promoter of nine lineages of M. synoviae varying in avidity of cytadherence were aligned with that of the reference strain MS53 and with a 60-a.a. hemagglutinating VlhA C-terminal fragment from a Tunisian lineage of strain WVU1853(T. Seven different sequence variants of an imperfectly conserved, single-copy, 12-a.a. candidate cytadherence motif were evident amid the flanking variable residues of the 11 total sequences examined. The motif was predicted to adopt a short hairpin structure in a low-complexity region near the C-terminus of VlhA. Biotinylated synthetic oligopeptides representing four selected variants of the 12-a.a. motif, with the whole synthesized 60-a.a. fragment as a positive control, differed (P<0.01 in the extent they bound to chicken erythrocyte membranes. All bound to a greater extent (P<0.01 than scrambled or irrelevant VlhA domain negative control peptides did. Experimentally introduced branched-chain amino acid (BCAA substitutions Val3Ile and Leu7Ile did not significantly alter binding, whereas fold-destabilizing substitutions Thr4Gly and Ala9Gly tended to reduce it (P<0.05. Binding was also reduced to background levels (P<0.01 when the peptides were exposed to desialylated membranes, or were pre-saturated with free sialic acid before exposure to untreated membranes. From this evidence we conclude that the motif P-X-(BCAA-X-F-X-(BCAA-X-A-K-X-G binds sialic acid and likely mediates VlhA-dependent M. synoviae attachment to host cells. This conserved mechanism retains the potential for fine-scale rheostasis in binding avidity, which could be a

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

Science.gov (United States)

Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

Science.gov (United States)

Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

DEFF Research Database (Denmark)

Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili

2013-01-01

In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...

Properties and distribution of pure GA-sequences of mammalian genomes.

Directory of Open Access Journals (Sweden)

Guenter Albrecht-Buehler

Full Text Available The article describes DNA sequences of mammalian genomes that are longer than 50 bases, but consist exclusively of G's and A's ('pure GA-sequences'. Although their frequency of incidence should be 10(-16 or smaller, the chromosomes of human, chimpanzee, dog, cat, rat, and mouse contained many tens of thousands of them ubiquitously located along the chromosomes with a species-dependent density, reaching sizes of up to 1300 [b]. With the exception of a small number of poly-A-, poly-G-, poly-GA-, and poly-GAAA-sequences (combined <0.5%, all pure GA-sequences of the mammals tested were unique individuals, contained several repeated short GA-containing motifs, and shared a common hexa-nucleotide spectrum. At most 2% of the human GA-sequences were transcribed into mRNAs; all others were not coding for proteins. Although this could have made them less subject to natural selection, they contained many [corrected] times fewer point mutations than one should expect from the genome at large. As to the presence of other sequences with similarly restricted base contents, there were approximately as many pure TC-sequences as pure GA-sequences, but many fewer pure AC-, TA, and TG-sequences. There were practically no pure GC-sequences. The functions of pure GA-sequences are not known. Supported by a number of observations related to heat shock phenomena, the article speculates that they serve as genomic sign posts which may help guide polymerases and transcription factors to their proper targets, and/or as spatial linkers that help generate the 3-dimensional organization of chromatin.

PSSRdb: a relational database of polymorphic simple sequence repeats extracted from prokaryotic genomes.

Science.gov (United States)

Kumar, Pankaj; Chaitanya, Pasumarthy S; Nagarajaram, Hampapathalu A

2011-01-01

PSSRdb (Polymorphic Simple Sequence Repeats database) (http://www.cdfd.org.in/PSSRdb/) is a relational database of polymorphic simple sequence repeats (PSSRs) extracted from 85 different species of prokaryotes. Simple sequence repeats (SSRs) are the tandem repeats of nucleotide motifs of the sizes 1-6 bp and are highly polymorphic. SSR mutations in and around coding regions affect transcription and translation of genes. Such changes underpin phase variations and antigenic variations seen in some bacteria. Although SSR-mediated phase variation and antigenic variations have been well-studied in some bacteria there seems a lot of other species of prokaryotes yet to be investigated for SSR mediated adaptive and other evolutionary advantages. As a part of our on-going studies on SSR polymorphism in prokaryotes we compared the genome sequences of various strains and isolates available for 85 different species of prokaryotes and extracted a number of SSRs showing length variations and created a relational database called PSSRdb. This database gives useful information such as location of PSSRs in genomes, length variation across genomes, the regions harboring PSSRs, etc. The information provided in this database is very useful for further research and analysis of SSRs in prokaryotes.

Applications of High Throughput Nucleotide Sequencing

DEFF Research Database (Denmark)

Waage, Johannes Eichler

equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types

Directory of Open Access Journals (Sweden)

Stefania Dall'Olio

2010-01-01

Full Text Available Myostatin (MSTN is a negative modulator of muscle mass. We characterized the horse (Equus caballus MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type than in light breeds (dolichomorphic type such as Italian Trotter breed. The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds.

Analysis of Horse Myostatin Gene and Identification of Single Nucleotide Polymorphisms in Breeds of Different Morphological Types

Science.gov (United States)

Dall'Olio, Stefania; Fontanesi, Luca; Nanni Costa, Leonardo; Tassinari, Marco; Minieri, Laura; Falaschini, Adalberto

2010-01-01

Myostatin (MSTN) is a negative modulator of muscle mass. We characterized the horse (Equus caballus) MSTN gene and identified and analysed single nucleotide polymorphisms (SNPs) in breeds of different morphological types. Sequencing of coding, untranslated, intronic, and regulatory regions of MSTN gene in 12 horses from 10 breeds revealed seven SNPs: two in the promoter, four in intron 1, and one in intron 2. The SNPs of the promoter (GQ183900:g.26T>C and GQ183900:g.156T>C, the latter located within a conserved TATA-box like motif) were screened in 396 horses from 16 breeds. The g.26C and the g.156C alleles presented higher frequency in heavy (brachymorphic type) than in light breeds (dolichomorphic type such as Italian Trotter breed). The significant difference of allele frequencies for the SNPs at the promoter and analysis of molecular variance (AMOVA) on haplotypes indicates that these polymorphisms could be associated with variability of morphology traits in horse breeds. PMID:20706663

Dragon polya spotter: Predictor of poly(A) motifs within human genomic DNA sequences

KAUST Repository

Kalkatawi, Manal M.; Rangkuti, Farania; Schramm, Michael C.; Jankovic, Boris R.; Kamau, Allan; Chowdhary, Rajesh; Archer, John A.C.; Bajic, Vladimir B.

2011-01-01

. These models are trained to recognize 12 most common poly(A) motifs in human DNA. Our predictors are available as a free web-based tool accessible at http://cbrc.kaust.edu.sa/dps. Compared with other reported predictors, our models achieve higher sensitivity

Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

DEFF Research Database (Denmark)

Liu, Siyang; Huang, Shujia; Rao, Junhua

2015-01-01

present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

Stanniocalcin 1 binds hemin through a partially conserved heme regulatory motif

Energy Technology Data Exchange (ETDEWEB)

Westberg, Johan A., E-mail: johan.westberg@helsinki.fi [Department of Pathology, Haartman Institute, University of Helsinki and HUSLAB, P.O. Box 21, Haartmaninkatu 3, FI-00014 Helsinki (Finland); Jiang, Ji, E-mail: ji.jiang@helsinki.fi [Department of Pathology, Haartman Institute, University of Helsinki and HUSLAB, P.O. Box 21, Haartmaninkatu 3, FI-00014 Helsinki (Finland); Andersson, Leif C., E-mail: leif.andersson@helsinki.fi [Department of Pathology, Haartman Institute, University of Helsinki and HUSLAB, P.O. Box 21, Haartmaninkatu 3, FI-00014 Helsinki (Finland)

2011-06-03

Highlights: {yields} Stanniocalcin 1 (STC1) binds heme through novel heme binding motif. {yields} Central iron atom of heme and cysteine-114 of STC1 are essential for binding. {yields} STC1 binds Fe{sup 2+} and Fe{sup 3+} heme. {yields} STC1 peptide prevents oxidative decay of heme. -- Abstract: Hemin (iron protoporphyrin IX) is a necessary component of many proteins, functioning either as a cofactor or an intracellular messenger. Hemoproteins have diverse functions, such as transportation of gases, gas detection, chemical catalysis and electron transfer. Stanniocalcin 1 (STC1) is a protein involved in respiratory responses of the cell but whose mechanism of action is still undetermined. We examined the ability of STC1 to bind hemin in both its reduced and oxidized states and located Cys{sup 114} as the axial ligand of the central iron atom of hemin. The amino acid sequence differs from the established (Cys-Pro) heme regulatory motif (HRM) and therefore presents a novel heme binding motif (Cys-Ser). A STC1 peptide containing the heme binding sequence was able to inhibit both spontaneous and H{sub 2}O{sub 2} induced decay of hemin. Binding of hemin does not affect the mitochondrial localization of STC1.

Mutational analysis of the RecJ exonuclease of Escherichia coli: identification of phosphoesterase motifs.

Science.gov (United States)

Sutera, V A; Han, E S; Rajman, L A; Lovett, S T

1999-10-01

The recJ gene, identified in Escherichia coli, encodes a Mg(+2)-dependent 5'-to-3' exonuclease with high specificity for single-strand DNA. Genetic and biochemical experiments implicate RecJ exonuclease in homologous recombination, base excision, and methyl-directed mismatch repair. Genes encoding proteins with strong similarities to RecJ have been found in every eubacterial genome sequenced to date, with the exception of Mycoplasma and Mycobacterium tuberculosis. Multiple genes encoding proteins similar to RecJ are found in some eubacteria, including Bacillus and Helicobacter, and in the archaea. Among this divergent set of sequences, seven conserved motifs emerge. We demonstrate here that amino acids within six of these motifs are essential for both the biochemical and genetic functions of E. coli RecJ. These motifs may define interactions with Mg(2+) ions or substrate DNA. A large family of proteins more distantly related to RecJ is present in archaea, eubacteria, and eukaryotes, including a hypothetical protein in the MgPa adhesin operon of Mycoplasma, a domain of putative polyA polymerases in Synechocystis and Aquifex, PRUNE of Drosophila, and an exopolyphosphatase (PPX1) of Saccharomyces cereviseae. Because these six RecJ motifs are shared between exonucleases and exopolyphosphatases, they may constitute an ancient phosphoesterase domain now found in all kingdoms of life.

The human Ago2 MC region does not contain an eIF4E-like mRNA cap binding motif

Directory of Open Access Journals (Sweden)

Grishin Nick V

2009-01-01

Full Text Available Abstract Background Argonaute (Ago proteins interact with small regulatory RNAs to mediate gene regulatory pathways. A recent report by Kiriakidou et al. 1 describes an MC sequence region identified in Ago2 that displays similarity to the cap-binding motif in translation initiation factor 4E (eIF4E. In a cap-bound eIF4E structure, two important aromatic residues of the motif stack on either side of a 7-methylguanosine 5'-triphosphate (m7Gppp base. The corresponding Ago2 aromatic residues (F450 and F505 were hypothesized to perform the same cap-binding function. However, the detected similarity between the MC sequence and the eIF4E cap-binding motif was questionable. Results A number of sequence-based and structure-based bioinformatics methods reveal the reported similarity between the Ago2 MC sequence region and the eIF4E cap-binding motif to be spurious. Alternatively, the MC sequence region is confidently assigned to the N-terminus of the Ago piwi module, within the mid domain of experimentally determined prokaryotic Ago structures. Confident mapping of the Ago2 MC sequence region to the piwi mid domain results in a homology-based structure model that positions the identified aromatic residues over 20 Å apart, with one of the aromatic side chains (F450 contributing instead to the hydrophobic core of the domain. Conclusion Correct functional prediction based on weak sequence similarity requires substantial evolutionary and structural support. The evolutionary context of the Ago mid domain suggested by multiple sequence alignment is limited to a conserved hydrophobicity profile required for the fold and a motif following the MC region that binds guide RNA. Mapping of the MC sequence to the mid domain structure reveals Ago2 aromatics that are incompatible with eIF4E-like mRNA cap-binding, yet display some limited local structure similarities that cause the chance sequence match to eIF4E. Reviewers This article was reviewed by Arcady Mushegian

Evolutionarily conserved bias of amino-acid usage refines the definition of PDZ-binding motif

Directory of Open Access Journals (Sweden)

Launey Thomas

2011-06-01

Full Text Available Abstract Background The interactions between PDZ (PSD-95, Dlg, ZO-1 domains and PDZ-binding motifs play central roles in signal transductions within cells. Proteins with PDZ domains bind to PDZ-binding motifs almost exclusively when the motifs are located at the carboxyl (C- terminal ends of their binding partners. However, it remains little explored whether PDZ-binding motifs show any preferential location at the C-terminal ends of proteins, at genome-level. Results Here, we examined the distribution of the type-I (x-x-S/T-x-I/L/V or type-II (x-x-V-x-I/V PDZ-binding motifs in proteins encoded in the genomes of five different species (human, mouse, zebrafish, fruit fly and nematode. We first established that these PDZ-binding motifs are indeed preferentially present at their C-terminal ends. Moreover, we found specific amino acid (AA bias for the 'x' positions in the motifs at the C-terminal ends. In general, hydrophilic AAs were favored. Our genomics-based findings confirm and largely extend the results of previous interaction-based studies, allowing us to propose refined consensus sequences for all of the examined PDZ-binding motifs. An ontological analysis revealed that the refined motifs are functionally relevant since a large fraction of the proteins bearing the motif appear to be involved in signal transduction. Furthermore, co-precipitation experiments confirmed two new protein interactions predicted by our genomics-based approach. Finally, we show that influenza virus pathogenicity can be correlated with PDZ-binding motif, with high-virulence viral proteins bearing a refined PDZ-binding motif. Conclusions Our refined definition of PDZ-binding motifs should provide important clues for identifying functional PDZ-binding motifs and proteins involved in signal transduction.

High-resolution characterization of sequence signatures due to non-random cleavage of cell-free DNA.

Science.gov (United States)

Chandrananda, Dineika; Thorne, Natalie P; Bahlo, Melanie

2015-06-17

High-throughput sequencing of cell-free DNA fragments found in human plasma has been used to non-invasively detect fetal aneuploidy, monitor organ transplants and investigate tumor DNA. However, many biological properties of this extracellular genetic material remain unknown. Research that further characterizes circulating DNA could substantially increase its diagnostic value by allowing the application of more sophisticated bioinformatics tools that lead to an improved signal to noise ratio in the sequencing data. In this study, we investigate various features of cell-free DNA in plasma using deep-sequencing data from two pregnant women (>70X, >50X) and compare them with matched cellular DNA. We utilize a descriptive approach to examine how the biological cleavage of cell-free DNA affects different sequence signatures such as fragment lengths, sequence motifs at fragment ends and the distribution of cleavage sites along the genome. We show that the size distributions of these cell-free DNA molecules are dependent on their autosomal and mitochondrial origin as well as the genomic location within chromosomes. DNA mapping to particular microsatellites and alpha repeat elements display unique size signatures. We show how cell-free fragments occur in clusters along the genome, localizing to nucleosomal arrays and are preferentially cleaved at linker regions by correlating the mapping locations of these fragments with ENCODE annotation of chromatin organization. Our work further demonstrates that cell-free autosomal DNA cleavage is sequence dependent. The region spanning up to 10 positions on either side of the DNA cleavage site show a consistent pattern of preference for specific nucleotides. This sequence motif is present in cleavage sites localized to nucleosomal cores and linker regions but is absent in nucleosome-free mitochondrial DNA. These background signals in cell-free DNA sequencing data stem from the non-random biological cleavage of these fragments. This

FASH: A web application for nucleotides sequence search

Directory of Open Access Journals (Sweden)

Chew Paul

2008-05-01

Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

Science.gov (United States)

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

Requirement for asparagine in the aquaporin NPA sequence signature motifs for cation exclusion

DEFF Research Database (Denmark)

Wree, Dorothea; Wu, Binghua; Zeuthen, Thomas

2011-01-01

Two highly conserved NPA motifs are a hallmark of the aquaporin (AQP) family. The NPA triplets form N-terminal helix capping structures with the Asn side chains located in the centre of the water or solute-conducting channel, and are considered to play an important role in AQP selectivity. Although...... interchangeable at both NPA sites without affecting protein expression or water, glycerol and methylamine permeability. However, other mutations in the NPA region led to reduced permeability (S186C and S186D), to nonfunctional channels (N64D), or even to lack of protein expression (S186A and S186T). Using...... electrophysiology, we found that an analogous mammalian AQP1 N76S mutant excluded protons and potassium ions, but leaked sodium ions, providing an argument for the overwhelming prevalence of Asn over other amino acids. We conclude that, at the first position in the NPA motifs, only Asn provides efficient helix cap...

Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

Directory of Open Access Journals (Sweden)

Ji-Sun Park

2015-01-01

Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

Identification of sequence changes in live attenuated goose parvovirus vaccine strains developed in Asia and Europe.

Science.gov (United States)

Shien, J-H; Wang, Y-S; Chen, C-H; Shieh, H K; Hu, C-C; Chang, P-C

2008-10-01

Live attenuated vaccines have been used for control of the disease caused by goose parvovirus (GPV), but the mechanism involved in attenuation of GPV remains elusive. This report presents the complete nucleotide sequences of two live attenuated strains of GPV (82-0321V and VG32/1) that were independently developed in Taiwan and Europe, together with the parental strain of 82-0321V and a field strain isolated in Taiwan in 2006. Sequence comparisons showed that 82-0321V and VG32/1 had multiple deletions and substitutions in the inverted terminal repeats region when compared with their parental strain or the field virus, but these changes did not affect the formation of the hairpin structure essential for viral replication. Moreover, 82-0321V and VG32/1 had five amino acid changes in the non-structural protein, but these changes were located at positions distant from known functional motifs in the non-structural protein. In contrast, 82-0321V had nine changes and VG32/1 had 11 changes in their capsid proteins (VP1), and the majority of these changes occurred at positions close to the putative receptor binding sites of VP1, as predicted using the structure of adeno-associated virus 2 as the model system. Taken together, the results suggest that changes in sequence near the receptor binding sites of VP1 might be responsible for attenuation of GPV. This is the first report of complete nucleotide sequences of GPV other than the virulent B strain, and suggests a possible mechanism for attenuation of GPV.

The ARTT motif and a unified structural understanding of substraterecognition in ADP ribosylating bacterial toxins and eukaryotic ADPribosyltransferases

Energy Technology Data Exchange (ETDEWEB)

Han, S.; Tainer, J.A.

2001-08-01

ADP-ribosylation is a widely occurring and biologically critical covalent chemical modification process in pathogenic mechanisms, intracellular signaling systems, DNA repair, and cell division. The reaction is catalyzed by ADP-ribosyltransferases, which transfer the ADP-ribose moiety of NAD to a target protein with nicotinamide release. A family of bacterial toxins and eukaryotic enzymes has been termed the mono-ADP-ribosyltransferases, in distinction to the poly-ADP-ribosyltransferases, which catalyze the addition of multiple ADP-ribose groups to the carboxyl terminus of eukaryotic nucleoproteins. Despite the limited primary sequence homology among the different ADP-ribosyltransferases, a central cleft bearing NAD-binding pocket formed by the two perpendicular b-sheet core has been remarkably conserved between bacterial toxins and eukaryotic mono- and poly-ADP-ribosyltransferases. The majority of bacterial toxins and eukaryotic mono-ADP-ribosyltransferases are characterized by conserved His and catalytic Glu residues. In contrast, Diphtheria toxin, Pseudomonas exotoxin A, and eukaryotic poly-ADP-ribosyltransferases are characterized by conserved Arg and catalytic Glu residues. The NAD-binding core of a binary toxin and a C3-like toxin family identified an ARTT motif (ADP-ribosylating turn-turn motif) that is implicated in substrate specificity and recognition by structural and mutagenic studies. Here we apply structure-based sequence alignment and comparative structural analyses of all known structures of ADP-ribosyltransfeases to suggest that this ARTT motif is functionally important in many ADP-ribosylating enzymes that bear a NAD binding cleft as characterized by conserved Arg and catalytic Glu residues. Overall, structure-based sequence analysis reveals common core structures and conserved active sites of ADP-ribosyltransferases to support similar NAD binding mechanisms but differing mechanisms of target protein binding via sequence variations within the ARTT

The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences

Directory of Open Access Journals (Sweden)

Ivan V. Stepanyan

2017-01-01

Full Text Available The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.

Classifying Coding DNA with Nucleotide Statistics

Directory of Open Access Journals (Sweden)

Nicolas Carels

2009-10-01

Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

Regulation and function of the CD3¿ DxxxLL motif: a binding site for adaptor protein-1 and adaptor protein-2 in vitro

DEFF Research Database (Denmark)

Dietrich, J; Kastrup, J; Nielsen, B L

1997-01-01

/CD3gamma chimeras; and in vitro by binding CD3gamma peptides to clathrin-coated vesicle adaptor proteins (APs). We find that the CD3gamma D127xxxLL131/132 sequence represents one united motif for binding of both AP-1 and AP-2, and that this motif functions as an active sorting motif in monomeric CD4...... and for AP binding in vitro. Furthermore, we provide evidence indicating that phosphorylation of CD3gamma S126 in the context of the complete TCR induces a conformational change that exposes the DxxxLL sequence for AP binding. Exposure of the DxxxLL motif causes an increase in the TCR internalization rate...

In Silico Retrieving of Opium Poppy (Papaver Somniferum L. Microsatellites

Directory of Open Access Journals (Sweden)

Masárová Veronika

2015-12-01

Full Text Available Repetitive tandem sequences were retrieved within nucleotide sequences of opium poppy (Papaver somniferum L. genomic DNA available in the GenBank® database. Altogether 538 different microsatellites with the desired length characteristics of tandem repeats have been identified within 450 sequences of opium poppy DNA available in the database. The most frequented were mononucleotide repeats (246; nevertheless, 44 dinucleotide, 148 trinucleotide, 62 tetranucleotide, 28 pentanucleotide and 5 hexanucleotide tandem repeats have also been found. The most abundant were trinucleotide motifs (27.50%, and the most abundant motifs within each group of tandem repeats were TA/AT, TTC/GAA, GGTT/AACC and TTTTA/ TAAAA. Five hexanucleotide repeats contained four different motifs.

Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

DEFF Research Database (Denmark)

Leonardsen, L; DeClue, J E; Lybaek, H

1996-01-01

The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

Motif-role-fingerprints: the building-blocks of motifs, clustering-coefficients and transitivities in directed networks.

Directory of Open Access Journals (Sweden)

Mark D McDonnell