WorldWideScience

Sample records for nucleotide sequence determination

  1. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  2. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    Science.gov (United States)

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  3. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  4. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  5. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  6. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  7. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  8. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  9. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  10. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  11. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  12. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  13. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.

  14. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  15. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  16. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...

  17. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  18. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  19. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  20. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  1. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  2. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  3. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

    Science.gov (United States)

    The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

  5. CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

    Science.gov (United States)

    Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

  6. Nucleotide sequence and phylogeny of the tet (L) tetracycline resistance determinant encoded by the plasmid pSTE1 from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Schwarz, S.; Cardoso, M.; Wegener, Henrik Caspar

    1992-01-01

    O from Streptococcus mutans were performed. An alignment of Tet amino acid sequence revealed the presence of 30 conserved amino acids among these Tet variants. On the basis of the alignment, a phylogenetic tree was constructed. It demonstrated large evolutionary distances between the Tet M and Tet O...

  7. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  8. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  9. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  10. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  11. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  12. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  13. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  14. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  15. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  16. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  17. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  18. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Science.gov (United States)

    Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

    2011-01-01

    Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  19. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  20. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  1. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  2. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  3. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  4. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  5. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  6. Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

    Science.gov (United States)

    Li, Hongshan; Dai, Huaguo; Wei, Hui

    2005-01-01

    A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

  7. FASH: A web application for nucleotides sequence search

    Directory of Open Access Journals (Sweden)

    Chew Paul

    2008-05-01

    Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

  8. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    NARCIS (Netherlands)

    Steenbergh, P.H.; Sussenbach, J.S.

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  9. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  10. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  11. Nature and distribution of feline sarcoma virus nucleotide sequences.

    Science.gov (United States)

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  12. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  13. Applications of High-Throughput Nucleotide Sequencing (PhD)

    DEFF Research Database (Denmark)

    Waage, Johannes

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  14. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  15. The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

    Science.gov (United States)

    Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

    1992-12-01

    The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

  16. The nucleotide sequence of a Polish isolate of Tomato torrado virus.

    Science.gov (United States)

    Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

    2008-12-01

    A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

  17. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  18. Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

    Science.gov (United States)

    Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2012-07-01

    We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

  19. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  20. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  1. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  2. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    mt) genome of the round-tongued floating frog, Occidozyga martensii was determined. Although, the base composition and codon usage of O. martensii conformed to the typical vertebrate patterns, this mt genome contained 23 tRNAs (a ...

  3. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    Science.gov (United States)

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  4. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  5. Sequence determinants of human microsatellite variability

    Directory of Open Access Journals (Sweden)

    Jakobsson Mattias

    2009-12-01

    Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

  6. Characterization of Sri Lanka rabies virus isolates using nucleotide sequence analysis of nucleoprotein gene.

    Science.gov (United States)

    Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L

    2001-01-01

    Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.

  7. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

    2015-01-01

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  8. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  9. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  10. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  11. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  12. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

    Science.gov (United States)

    Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

    2010-12-01

    Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

  14. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  15. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  16. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  17. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  18. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Science.gov (United States)

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  19. The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

    2009-01-01

    The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

  20. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  1. Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

    NARCIS (Netherlands)

    Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

    2005-01-01

    The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

  2. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    2015-11-01

    Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  3. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India

    Directory of Open Access Journals (Sweden)

    Sukdeb Nandi

    2010-03-01

    Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India

  4. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

    Science.gov (United States)

    Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

  5. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

    Science.gov (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

    1998-07-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  6. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Science.gov (United States)

    2010-07-01

    ... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...

  7. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  8. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  9. Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Dunez, J

    1988-02-01

    Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

  10. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  11. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  12. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  13. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Science.gov (United States)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  14. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  15. Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

    Science.gov (United States)

    Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

    2010-09-01

    The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  16. Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

    Directory of Open Access Journals (Sweden)

    White Frank F

    2011-07-01

    Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

  17. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    Science.gov (United States)

    2010-07-01

    ... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

  18. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  19. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  20. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    Science.gov (United States)

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  1. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  2. Partial sequence determination of metabolically labeled radioactive proteins and peptides

    International Nuclear Information System (INIS)

    Anderson, C.W.

    1982-01-01

    The author has used the sequence analysis of radioactive proteins and peptides to approach several problems during the past few years. They, in collaboration with others, have mapped precisely several adenovirus proteins with respect to the nucleotide sequence of the adenovirus genome; identified hitherto missed proteins encoded by bacteriophage MS2 and by simian virus 40; analyzed the aminoterminal maturation of several virus proteins; determined the cleavage sites for processing of the poliovirus polyprotein; and analyzed the mechanism of frameshifting by excess normal tRNAs during cell-free protein synthesis. This chapter is designed to aid those without prior experience at protein sequence determinations. It is based primarily on the experience gained in the studies cited above, which made use of the Beckman 890 series automated protein sequencers

  3. Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

    Directory of Open Access Journals (Sweden)

    Jacqueline Morris

    2017-12-01

    Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

  4. Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

    Science.gov (United States)

    Wolf, P

    1997-10-01

    Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

  5. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  6. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

    Science.gov (United States)

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

    2002-12-01

    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  7. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

    Science.gov (United States)

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

    2012-07-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  8. Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

    Directory of Open Access Journals (Sweden)

    Cheng-Chong Chou

    2004-11-01

    Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

  9. The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

    Science.gov (United States)

    Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

    2011-04-01

    A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

  10. Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

    Science.gov (United States)

    Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

    2017-08-01

    A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

  11. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    Directory of Open Access Journals (Sweden)

    Ji-Sun Park

    2015-01-01

    Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  12. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  13. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  14. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  15. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui

    2012-10-01

    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  16. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  17. ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

    Science.gov (United States)

    Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

    2012-09-08

    The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  18. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Directory of Open Access Journals (Sweden)

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  19. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Science.gov (United States)

    2012-01-01

    Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

  20. Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

    Science.gov (United States)

    Guo, D; Maiss, E; Adam, G; Casper, R

    1995-05-01

    The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

  1. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  2. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  3. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Science.gov (United States)

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

    2016-03-22

    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  4. Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

    OpenAIRE

    Liljeström, P L; Liljeström, P

    1987-01-01

    Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

  5. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L

    2011-06-01

    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  6. Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

    International Nuclear Information System (INIS)

    Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

    1987-01-01

    Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

  7. A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

    Science.gov (United States)

    Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

    2013-07-01

    The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

  8. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  9. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  10. Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Yu-Hoon Kim

    2014-01-01

    Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.

  11. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  12. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  13. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.

    1987-01-01

    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  14. Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

    Science.gov (United States)

    Nishizawa, M; Nishizawa, K

    2000-10-01

    The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

  15. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  16. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  17. Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

    International Nuclear Information System (INIS)

    Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

    1998-01-01

    To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

  18. Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.

    Directory of Open Access Journals (Sweden)

    Peter Norberg

    Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

  19. CLONING AND SEQUENCING OF PSEUDOMONAS GENES DETERMINING SODIUM DODECYL-SULFATE BIODEGRADATION

    NARCIS (Netherlands)

    DAVISON, J; BRUNEL, F; PHANOPOULOS, A; PROZZI, D; TERPSTRA, P

    1992-01-01

    The nucleotide sequences of two genes involved in sodium dodecyl sulfate (SDS) degradation, by Pseudomonas, have been determined. One of these, sdsA, codes for an alkyl sulfatase (58 957 Da) and has similarity (31.8% identity over a 201-amino acid stretch) to the N terminus of a predicted protein of

  20. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    Science.gov (United States)

    Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

    2016-01-01

    Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  1. Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

    Data.gov (United States)

    US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

  2. Complete nucleotide sequence of Bacillus subtilis (natto) bacteriophage PM1, a phage associated with disruption of food production.

    Science.gov (United States)

    Umene, Kenichi; Shiraishi, Atsushi

    2013-06-01

    "Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.

  3. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    National Research Council Canada - National Science Library

    Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M

    2004-01-01

    .... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

  4. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    Science.gov (United States)

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    Science.gov (United States)

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  6. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M

    2018-01-01

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  7. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian

    2018-04-10

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  8. Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

    Science.gov (United States)

    Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

    2012-10-01

    To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

  9. Nucleotide sequence analysis of HTLV-I isolated from cerebrospinal fluid of a patient with TSP/HAM: comparison to other HTLV-I isolates.

    Science.gov (United States)

    Mukhopadhyaya, R; Sadaie, M R

    1993-02-01

    Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.

  10. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  11. Mason: a JavaScript web site widget for visualizing and comparing annotated features in nucleotide or protein sequences.

    Science.gov (United States)

    Jaschob, Daniel; Davis, Trisha N; Riffle, Michael

    2015-03-07

    Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.

  12. Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

    Science.gov (United States)

    Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

    2008-01-01

    During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

  13. Selection, Recombination and History in a Parasitic Flatworm (Echinococcus Inferred from Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Haag KL

    1998-01-01

    Full Text Available Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli and four strains of E. granulosus (cattle, horse, pig and sheep strains were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1. The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised

  14. Nucleotide sequences of the Erwinia chrysanthemi ogl and pelE genes negatively regulated by the kdgR gene product.

    Science.gov (United States)

    Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J

    1989-12-21

    The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  15. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  16. Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

    1997-01-01

    A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

  17. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  18. Symbolic complexity for nucleotide sequences: a sign of the genome structure

    International Nuclear Information System (INIS)

    Salgado-García, R; Ugalde, E

    2016-01-01

    We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)

  19. Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

    Science.gov (United States)

    Han, S S; Karasev, A V; Ieki, H; Iwanami, T

    2002-11-01

    Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

  20. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  1. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  2. Complete nucleotide sequences and virion particle association of two satellite RNAs of panicum mosaic virus.

    Science.gov (United States)

    Pyle, Jesse D; Monis, Judit; Scholthof, Karen-Beth

    2017-08-15

    Over six decades ago, panicum mosaic virus (PMV) was identified as the first viral pathogen of cultivated switchgrass (Panicum virgatum). Subsequently, PMV was demonstrated to support the replication of both a satellite RNA virus (SPMV) and satellite RNA (satRNA) agents during natural infections of host grasses. In this study, we report the isolation and full-length sequences of two PMV satRNAs identified in 1988 from St. Augustinegrass (Stenotaphrum secundatum) and centipedegrass (Eremochloa ophiuroides) hosts. Each of these satellites have sequence relatedness at their 5'- and 3'-ends. In addition, satC has a region of ∼100 nt complementary to the 3'-end of the PMV genome. These agents are associated with purified virions of SPMV infections. Additionally, satS and satC RNAs contain conserved in-frame open reading frames in the complementary-sense sequences that could potentially generate 6.6- and 7.9-kDa proteins, respectively. In protoplasts and plants satS is infectious, when co-inoculated with the PMV RNA alone or PMV+SPMV RNAs, and negatively affects their accumulation. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  4. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    Science.gov (United States)

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  5. Complete nucleotide sequence of CTX-M-15-plasmids from clinical Escherichia coli isolates: insertional events of transposons and insertion sequences.

    Directory of Open Access Journals (Sweden)

    Annemieke Smet

    Full Text Available BACKGROUND: CTX-M-producing Escherichia coli strains are regarded as major global pathogens. METHODOLOGY/PRINCIPAL FINDINGS: The nucleotide sequence of three plasmids (pEC_B24: 73801-bp; pEC_L8: 118525-bp and pEC_L46: 144871-bp from Escherichia coli isolates obtained from patients with urinary tract infections and one plasmid (pEC_Bactec: 92970-bp from an Escherichia coli strain isolated from the joint of a horse with arthritis were determined. Plasmid pEC_Bactec belongs to the IncI1 group and carries two resistance genes: bla(TEM-1 and bla(CTX-M-15. It shares more than 90% homology with a previously published bla(CTX-M-plasmid from E. coli of human origin. Plasmid pEC_B24 belongs to the IncFII group whereas plasmids pEC_L8 and pEC_L46 represent a fusion of two replicons of type FII and FIA. On the pEC_B24 backbone, two resistance genes, bla(TEM-1 and bla(CTX-M-15, were found. Six resistance genes, bla(TEM-1, bla(CTX-M-15, bla(OXA-1, aac6'-lb-cr, tetA and catB4, were detected on the pEC_L8 backbone. The same antimicrobial drug resistance genes, with the exception of tetA, were also identified on the pEC_L46 backbone. Genome analysis of all 4 plasmids studied provides evidence of a seemingly frequent transposition event of the bla(CTX-M-15-ISEcp1 element. This element seems to have a preferred insertion site at the tnpA gene of a bla(TEM-carrying Tn3-like transposon, the latter itself being inserted by a transposition event. The IS26-composite transposon, which contains the bla(OXA-1, aac6'-lb-cr and catB4 genes, was inserted into plasmids pEC_L8 and pEC_L46 by homologous recombination rather than a transposition event. Results obtained for pEC_L46 indicated that IS26 also plays an important role in structural rearrangements of the plasmid backbone and seems to facilitate the mobilisation of fragments from other plasmids. CONCLUSIONS: Collectively, these data suggests that IS26 together with ISEcp1 could play a critical role in the evolution of

  6. The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

    International Nuclear Information System (INIS)

    Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

    2003-01-01

    The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

  7. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  8. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    Science.gov (United States)

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  9. Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

    Science.gov (United States)

    Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

    2003-01-01

    A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

  10. Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ross, J

    1976-09-15

    In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

  11. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  12. Identification and nucleotide sequence of the thymidine kinase gene of Shope fibroma virus

    International Nuclear Information System (INIS)

    Upton, C.; McFadden, G.

    1986-01-01

    The thymidine kinase (TK) gene of Shope fibroma virus (SFV), a tumorigenic leporipoxvirus, was localized within the viral genome with degenerate oligonucleotide probes. These probes were constructed to two regions of high sequence conservation between the vaccinia virus TK gene and those of several known eucaryotic cellular TK genes, including human, mouse, hamster, and chicken TK genes. The oligonucleotide probes initially localized the SFV TK gene 50 kilobases (kb) from the right terminus of the 160-kb SFV genome within the 9.5-kb BamHI-HindIII fragment E. Fine-mapping analysis indicated that the TK Gene was within a 1.2-kb AvaI-HaeIII fragment, and DNA sequencing of this region revealed an open reading frame capable of encoding a polypeptide of 187 amino acids possessing considerable homology to the TK genes of the vaccinia, variola, and monkeypox orthopoxviruses and also to a variety of cellular TK genes. Homology matrix analysis and homology scores suggest that the SFV TK gene has diverged significantly from its counterpart members in the orthopoxvirus genus. Nevertheless, the presence of conserved upstream open reading frames on the 5' side of all of the poxvirus TK genes indicates a similarity of functional organization between the orthopoxviruses and leporipoxviruses. These data suggest a common ancestral origin for at least some of the unique internal regions of the leporipoxviruses and orthopoxviruses as exemplified by SFV and vaccinia virus, respectively

  13. [Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

    Science.gov (United States)

    Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

    2014-04-01

    Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

  14. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    Science.gov (United States)

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

  15. The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.

    Directory of Open Access Journals (Sweden)

    Fang Lü

    Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.

  16. The complete nucleotide sequences of the 5 genetically distinct plastid genomes of Oenothera, subsection Oenothera: II. A microevolutionary view using bioinformatics and formal genetic data.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg

    2008-09-01

    A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.

  17. Nucleotide and deduced amino acid sequence of the envelope gene of the Vasilchenko strain of TBE virus; comparison with other flaviviruses.

    Science.gov (United States)

    Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A

    1993-02-01

    A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.

  18. The R package otu2ot for implementing the entropy decomposition of nucleotide variation in sequence data

    Directory of Open Access Journals (Sweden)

    Alban eRamette

    2014-11-01

    Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.

  19. Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.

    Science.gov (United States)

    Sasaya, T; Ishikawa, K; Koganezawa, H

    2001-06-01

    A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.

  20. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    Science.gov (United States)

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    Science.gov (United States)

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  2. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Directory of Open Access Journals (Sweden)

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  3. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  4. Nucleotide Sequence and Analysis of an orotate transporter-containing plasmid isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410

    DEFF Research Database (Denmark)

    Defoor, Els Marie Celine; Martinussen, Jan

    A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...

  5. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

    2013-01-01

    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

  6. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

    Science.gov (United States)

    Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2014-11-01

    In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

  7. Genetic differentiation between fake abalone and genuine Haliotis species using the forensically informative nucleotide sequencing (FINS) method.

    Science.gov (United States)

    Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S

    2011-05-25

    Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.

  8. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Directory of Open Access Journals (Sweden)

    Kei-ichi Morita

    Full Text Available Gorlin syndrome (GS is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs. In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals, whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  9. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Science.gov (United States)

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

    2015-01-01

    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  10. The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3.

    Science.gov (United States)

    Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio

    2005-12-20

    Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.

  11. High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

  12. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

    Science.gov (United States)

    McAllister, Christine A; Miller, Allison J

    2016-07-01

    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

  13. The mitochondrial genome sequence of the ciliate Paramecium caudatum reveals a shift in nucleotide composition and codon usage within the genus Paramecium

    Directory of Open Access Journals (Sweden)

    Berendonk Thomas U

    2011-05-01

    Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino

  14. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  15. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

    Science.gov (United States)

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-01-01

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  16. Determinant Representations of Sequences: A Survey

    Directory of Open Access Journals (Sweden)

    Moghaddamfar A. R.

    2014-01-01

    Full Text Available This is a survey of recent results concerning (integer matrices whose leading principal minors are well-known sequences such as Fibonacci, Lucas, Jacobsthal and Pell (subsequences. There are different ways for constructing such matrices. Some of these matrices are constructed by homogeneous or nonhomogeneous recurrence relations, and others are constructed by convolution of two sequences. In this article, we will illustrate the idea of these methods by constructing some integer matrices of this type.

  17. Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

    Science.gov (United States)

    Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

    2014-11-01

    Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  18. The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

    Science.gov (United States)

    Nallaseth, Ferez Soli

    The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1

  19. The proviral genome of radiation leukemia virus: Molecular cloning, nucleotide sequence of its long terminal repeat and integration in lymphoma cell DNA

    International Nuclear Information System (INIS)

    Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.

    1985-01-01

    The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy

  20. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  1. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek

    2015-01-01

    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  2. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  3. Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

    DEFF Research Database (Denmark)

    Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili

    2013-01-01

    In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...

  4. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Liu, Siyang; Huang, Shujia; Rao, Junhua

    2015-01-01

    present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

  6. Sequence determination of synthesized chondroitin sulfate dodecasaccharides.

    Science.gov (United States)

    Shioiri, Tatsumasa; Tsuchimoto, Jun; Watanabe, Hideto; Sugiura, Nobuo

    2016-06-01

    Chondroitin sulfate (CS) is a linear acidic polysaccharide composed of repeating disaccharide units of glucuronic acid and N-acetyl-d-galactosamine. The polysaccharide is modified with sulfate groups at different positions by a variety of sulfotransferases. CS chains exhibit various biological and pathological functions by interacting with cytokines and growth factors and regulating their signal transduction. The fine structure of the CS chain defines its specific biological roles. However, structural analysis of CS has been restricted to disaccharide analysis, hampering the understanding of the structure-function relationship of CS chains. Here, we chemo-enzymatically synthesized CS dodecasaccharides having various sulfate modifications using a bioreactor system of bacterial chondroitin polymerase mutants and various CS sulfotransferases. We developed a sequencing method for CS chains using the CS dodecasaccharides. The method consists of (i) labeling a reducing end with 2-aminopyridine (PA), (ii) partial digestion of CS with testicular hyaluronidase, followed by separation of PA-conjugated oligosaccharides with different chain lengths, (iii) limited digestion of these oligosaccharides with chondroitin lyase AC II into disaccharides, followed by labeling with 2-aminobenzamide, (iv) CS disaccharide analysis using a dual-fluorescence HPLC system (reversed-phase ion-pair and ion-exchange chromatography), and (v) estimation of the composition by calculating individual disaccharide ratios. This CS chain sequencing allows characterization of CS-modifying enzymes and provides a useful tool toward understanding the structure-function relationship of CS chains. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Complete nucleotide sequence of the Coturnix chinensis (blue-breasted quail) mitochondrial genome and a phylogenetic analysis with related species.

    Science.gov (United States)

    Nishibori, M; Tsudzuki, M; Hayashi, T; Yamamoto, Y; Yasue, H

    2002-01-01

    Coturnix chinensis (blue-breasted quail) has been classically grouped in Galliformes Phasianidae Coturnix, based on morphologic features and biochemical evidence. Since the blue-breasted quail has the smallest body size among the species of Galliformes, in addition to a short generation time and an excellent reproductive performance, it is a possible model fowl for breeding and physiological studies of the Coturnix japonica (Japanese quail) and Gallus gallus domesticus (chicken), which are classified in the same family as blue-breasted quail. However, since its phylogenetic position in the family Phasianidae has not been determined conclusively, the sequence of the entire blue-breasted quail mitochondria (mt) genome was obtained to provide genetic information for phylogenetic analysis in the present study. The blue-breasted quail mtDNA was found to be a circular DNA of 16,687 base pairs (bp) with the same genomic structure as the mtDNAs of Japanese quail and chicken, though it is smaller than Japanese quail and chicken mtDNAs by 10 bp and 88 bp, respectively. The sequence identity of all mitochondrial genes, including those for 12S and 16S ribosomal RNAs, between blue-breasted quail and Japanese quail ranged from 84.5% to 93.5%; between blue-breasted quail and chicken, sequence identity ranged from 78.0% to 89.6%. In order to obtain information on the phylogenetic position of blue-breasted quail in Galliformes Phasianidae, the 2,184 bp sequence comprising NADH dehydrogenase subunit 2 and cytochrome b genes available for eight species in Galliformes [Japanese quail, chicken, Gallus varius (green junglefowl), Bambusicola thoracica (Chinese bamboo partridge), Pavo cristatus (Indian peafowl), Perdix perdix (gray partridge), Phasianus colchicus (ring-neck pheasant), and Tympanchus phasianellus (sharp-tailed grouse)] together with that of Aythya americana (redhead) were examined using a maximum likelihood (ML) method. The ML analyses on the first/second codon positions

  8. Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

    Science.gov (United States)

    Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

    2004-01-01

    Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  9. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  10. PCR Assays for Identification of Coccidioides posadasii Based on the Nucleotide Sequence of the Antigen 2/Proline-Rich Antigen

    Science.gov (United States)

    Bialek, Ralf; Kern, Jan; Herrmann, Tanja; Tijerina, Rolando; Ceceñas, Luis; Reischl, Udo; González, Gloria M.

    2004-01-01

    A conventional nested PCR and a real-time LightCycler PCR assay for detection of Coccidioides posadasii DNA were designed and tested in 120 clinical strains. These had been isolated from 114 patients within 10 years in Monterrey, Nuevo Leon, Mexico, known to be endemic for coccidioidomycosis. The gene encoding the specific antigen 2/proline-rich antigen (Ag2/PRA) was used as a target. All strains were correctly identified, whereas DNA from related members of the family Onygenaceae remained negative. Melting curve analysis by LightCycler and sequencing of the 526-bp product of the first PCR demonstrated either 100% identity to the GenBank sequence of the Silveira strain, now known to be C. posadasii (accession number AF013256), or a single silent mutation at position 1228. Length determination of two microsatellite-containing loci (GAC and 621) identified all 120 isolates as C. posadasii. Specific DNA was amplified by conventional nested PCR from three microscopically spherule-positive paraffin-embedded tissue samples, whereas 20 human tissue samples positive for other dimorphic fungi remained negative. Additionally, the safety of each step of a modified commercially available DNA extraction procedure was evaluated by using 10 strains. At least three steps of the protocol were demonstrated to sufficiently kill arthroconidia. This safe procedure is applicable to cultures and to clinical specimens. PMID:14766853

  11. Characterisation of purified parvalbumin from five fish species and nucleotide sequencing of this major allergen from Pacific pilchard, Sardinops sagax.

    Science.gov (United States)

    Beale, Janine E; Jeebhay, Mohamed F; Lopata, Andreas L

    2009-09-01

    IgE-mediated allergic reaction to seafood is a common cause of food allergy including anaphylactic reactions. Parvalbumin, the major fish allergen, has been shown to display IgE cross-reactivity among fish species consumed predominantly in Europe and the Far East. However, cross-reactivity studies of parvalbumin from fish species widely consumed in the Southern hemisphere are limited as is data relating to immunological and molecular characterisation. In this study, antigenic cross-reactivity and the presence of oligomers and isomers of parvalbumin from five highly consumed fish species in Southern Africa were assessed by immunoblotting using purified parvalbumin and crude fish extracts. Pilchard (Sardinops sagax) parvalbumin was found to display the strongest IgE reactivity among 10 fish-allergic consumers. The cDNA sequence of the beta-form of pilchard parvalbumin was determined and designated Sar sa 1.0101 (accession number FM177701 EMBL/GenBank/DDBJ databases). Oligomeric forms of parvalbumin were observed in all fish species using a monoclonal anti-parvalbumin antibody and subject's sera. Isoforms varied between approximately 10-13 kDa. A highly cross-reactive allergenic isoform of parvalbumin was identified and sequenced, providing a successful primary step towards the generation of a recombinant form that could be used for diagnostic and potential therapeutic use in allergic individuals.

  12. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  13. Clinical and molecular characterization of a cohort of patients with novel nucleotide alterations of the Dystrophin gene detected by direct sequencing

    Directory of Open Access Journals (Sweden)

    Corti Stefania

    2011-03-01

    Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects

  14. Complete genome sequence of a novel Plum pox virus strain W isolate determined by 454 pyrosequencing.

    Science.gov (United States)

    Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei

    2013-10-01

    The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.

  15. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    Science.gov (United States)

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  16. Protein and DNA sequence determinants of thermophilic adaptation.

    Directory of Open Access Journals (Sweden)

    Konstantin B Zeldovich

    2007-01-01

    Full Text Available There have been considerable attempts in the past to relate phenotypic trait--habitat temperature of organisms--to their genotypes, most importantly compositions of their genomes and proteomes. However, despite accumulation of anecdotal evidence, an exact and conclusive relationship between the former and the latter has been elusive. We present an exhaustive study of the relationship between amino acid composition of proteomes, nucleotide composition of DNA, and optimal growth temperature (OGT of prokaryotes. Based on 204 complete proteomes of archaea and bacteria spanning the temperature range from -10 degrees C to 110 degrees C, we performed an exhaustive enumeration of all possible sets of amino acids and found a set of amino acids whose total fraction in a proteome is correlated, to a remarkable extent, with the OGT. The universal set is Ile, Val, Tyr, Trp, Arg, Glu, Leu (IVYWREL, and the correlation coefficient is as high as 0.93. We also found that the G + C content in 204 complete genomes does not exhibit a significant correlation with OGT (R = -0.10. On the other hand, the fraction of A + G in coding DNA is correlated with temperature, to a considerable extent, due to codon patterns of IVYWREL amino acids. Further, we found strong and independent correlation between OGT and the frequency with which pairs of A and G nucleotides appear as nearest neighbors in genome sequences. This adaptation is achieved via codon bias. These findings present a direct link between principles of proteins structure and stability and evolutionary mechanisms of thermophylic adaptation. On the nucleotide level, the analysis provides an example of how nature utilizes codon bias for evolutionary adaptation to extreme conditions. Together these results provide a complete picture of how compositions of proteomes and genomes in prokaryotes adjust to the extreme conditions of the environment.

  17. Turn-on fluorescence probes based on pyranine/viologen charge-transfer complexes for the determination of nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Schäferling, Michael, E-mail: Michael.schaeferling@utu.fi; Lang, Thomas; Schnettelker, Annette

    2014-10-15

    The formation of ground state charge-transfer complexes between pyranine (8-hydroxypyrene-1,3,6-trisulfonic acid) and viologen (paraquat) derivatives is utilized for the design of novel fluoroionophores for the determination of phosphate species, particularly of nucleotides. The strong quenching of the pyranine fluorescence by viologen-type charge transfer acceptors can be countermanded if these are functionalized with triethylammonium groups that serve as recognition elements for phosphate anions. We report on the fluorogenic responses of these water-soluble molecular probes in presence of different phosphates. Absorbance measurements give additional information on the charge transfer complex formation and the interaction with nucleotides. The experimental data show that these aggregates form attractive, simple and versatile fluorescence turn-on probes for nucleoside triphosphates. The reversibility of the fluorescence response is demonstrated by means of an enzymatic model assay using ATPase for the decomposition of adenosine triphosphate. - Highlights: • Pyranine/viologen charge-transfer complexes as molecular probe for ATP recognition. • Fluorescence turn on mechanism. • Selective compared to other nucleotides and phosphate anions. • Fast and reversible response applicable to monitor enzymatic reactions.

  18. Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

    2016-09-01

    Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

  19. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  20. Complete nucleotide sequence of pGA45, a 140,698-bp incFIIY plasmid encoding blaIMI-3-mediated carbapenem resistance, from river sediment

    Directory of Open Access Journals (Sweden)

    Bingjun eDang

    2016-02-01

    Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.

  1. Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

    International Nuclear Information System (INIS)

    Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.

    1987-01-01

    The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

  2. Nucleotide sequences of two cellulase genes from alkalophilic Bacillus sp. strain N-4 and their strong homology.

    OpenAIRE

    Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K

    1986-01-01

    Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...

  3. Comparative In silico Study of Sex-Determining Region Y (SRY) Protein Sequences Involved in Sex-Determining.

    Science.gov (United States)

    Vakili Azghandi, Masoume; Nasiri, Mohammadreza; Shamsa, Ali; Jalali, Mohsen; Shariati, Mohammad Mahdi

    2016-04-01

    The SRY gene (SRY) provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/) and MEGA6 softwares. The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale) and Tursiopsaduncus (dolphin) have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee) have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

  4. Comparative In silico Study of Sex-Determining Region Y (SRY Protein Sequences Involved in Sex-Determining

    Directory of Open Access Journals (Sweden)

    Masoume Vakili Azghandi

    2016-05-01

    Full Text Available Background: The SRY gene (SRY provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Methods: Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/ and MEGA6 softwares. Results: The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale and Tursiopsaduncus (dolphin have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. Conclusion: These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

  5. The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

    Science.gov (United States)

    Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

    1995-05-01

    The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

  6. Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1.

    Science.gov (United States)

    Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi

    2016-12-01

    The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

  7. Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

    Science.gov (United States)

    Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

    2018-03-01

    Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

  8. A 19-nucleotide insertion in the leader sequence of avian leukosis virus subgroup J contributes to its replication in vitro but is not related to its pathogenicity in vivo.

    Directory of Open Access Journals (Sweden)

    Xiaolin Ji

    Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.

  9. Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

    International Nuclear Information System (INIS)

    Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada

    1988-01-01

    HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription

  10. Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

    DEFF Research Database (Denmark)

    Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

    1991-01-01

    After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

  11. Complete nucleotide sequence and genome analysis of bacteriophage BFK20 — A lytic phage of the industrial producer Brevibacterium flavum

    Czech Academy of Sciences Publication Activity Database

    Bukovska, G.; Klucar, L.; Vlček, Čestmír; Adamovic, J.; Turna, J.; Timko, J.

    2006-01-01

    Roč. 348, č. 1 (2006), s. 57-71 ISSN 0042-6822 Grant - others:Slovenská akademie věd(SK) VEGA2/5068/25; Science and Technology Assistance Agency(SK) APVT-51-025004 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bacteriophage * Complete genome sequence * Sequence analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.525, year: 2006

  12. Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

    International Nuclear Information System (INIS)

    Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.

    1987-01-01

    The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

  13. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  14. Molecular study and nucleotide sequencing of Chlamydia abortus isolated from aborted sheep fetuses ewes of Alborz province

    Directory of Open Access Journals (Sweden)

    amirreza ebadi

    2015-02-01

    Full Text Available Chlamydia is an obligate intracellular and gram negative coccobacilli and one of the most important causes of abortion in ruminants especially in ewes. This investigation was performed with the purpose of molecular study and sequencing of Chlamydia abortus isolated from aborted sheep fetuses of Alborz Province. In this study, DNA extraction was performed on 100 samples from aborted fetuses of 32 sheep flocks from different areas of Alborz province. Then using specific primers of gene IGS-Sr- RNA, polymerase chain reaction was conducted and 10 samples were selected randomly from the positive cases were sent to Macrogene company in Korea for sequencing. In this study, 37 samples from a total of 100 aborted fetuses were positive for Chlamydia abortus. After sequencing, more than 99 percent of the positive samples were similar with sequences in gene bank. The sequencing results indicated that the samples were very similar to isolates LN554882/1, AF051935/1 and CR848038/1 of the gene bank and were in the same cluster. Also, this investigation indicated that Chlamydia abortus is one of the main reasons of ewe abortion in Alborz province.

  15. Genetic Relationships among Reptilian and Mammalian Campylobacter fetus Strains Determined by Multilocus Sequence Typing

    NARCIS (Netherlands)

    Dingle, K.E.; Blaser, M.J.; Tu, Z.C.; Pruckler, J.; Fitzgerald, C.; Bergen, van M.A.P.; Lawson, A.J.; Owen, R.J.; Wagenaar, J.A.

    2010-01-01

    Reptile Campylobacter fetus isolates and closely related strains causing human disease were characterized by multilocus sequence typing. They shared similar to 90% nucleotide sequence identity with classical mammalian C. fetus, and there was evidence of recombination among members of these two

  16. Determination of 5 '-leader sequences from radically disparate strains of porcine reproductive and respiratory syndrome virus reveals the presence of highly conserved sequence motifs

    DEFF Research Database (Denmark)

    Oleksiewicz, M.B.; Bøtner, Anette; Nielsen, Jens

    1999-01-01

    We determined the untranslated 5'-leader sequence for three different isolates of porcine reproductive and respiratory syndrome virus (PRRSV): pathogenic European- and American-types, as well as an American-type vaccine strain. 5'-leader from European- and American-type PRRSV differed in length...... (220 and 190 nt, respectively), and exhibited only approximately 50% nucleotide homology. Nevertheless, highly conserved areas were identified in the leader of all 3 PRRSV isolates, which constitute candidate motifs for binding of protein(s) involved in viral replication. These comparative data provide...

  17. Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. lactis DSM 7290, and partial characterization of the enzyme.

    Science.gov (United States)

    Vongerichten, K F; Klein, J R; Matern, H; Plapp, R

    1994-10-01

    Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.

  18. Striking structural dynamism and nucleotide sequence variation of the transposon Galileo in the genome of Drosophila mojavensis.

    Science.gov (United States)

    Marzo, Mar; Bello, Xabier; Puig, Marta; Maside, Xulio; Ruiz, Alfredo

    2013-02-04

    Galileo is a transposable element responsible for the generation of three chromosomal inversions in natural populations of Drosophila buzzatii. Although the most characteristic feature of Galileo is the long internally-repetitive terminal inverted repeats (TIRs), which resemble the Drosophila Foldback element, its transposase-coding sequence has led to its classification as a member of the P-element superfamily (Class II, subclass 1, TIR order). Furthermore, Galileo has a wide distribution in the genus Drosophila, since it has been found in 6 of the 12 Drosophila sequenced genomes. Among these species, D. mojavensis, the one closest to D. buzzatii, presented the highest diversity in sequence and structure of Galileo elements. In the present work, we carried out a thorough search and annotation of all the Galileo copies present in the D. mojavensis sequenced genome. In our set of 170 Galileo copies we have detected 5 Galileo subfamilies (C, D, E, F, and X) with different structures ranging from nearly complete, to only 2 TIR or solo TIR copies. Finally, we have explored the structural and length variation of the Galileo copies that point out the relatively frequent rearrangements within and between Galileo elements. Different mechanisms responsible for these rearrangements are discussed. Although Galileo is a transposable element with an ancient history in the D. mojavensis genome, our data indicate a recent transpositional activity. Furthermore, the dynamism in sequence and structure, mainly affecting the TIRs, suggests an active exchange of sequences among the copies. This exchange could lead to new subfamilies of the transposon, which could be crucial for the long-term survival of the element in the genome.

  19. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    Science.gov (United States)

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  20. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    International Nuclear Information System (INIS)

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

    1988-01-01

    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  1. A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome.

    Science.gov (United States)

    Keel, B N; Nonneman, D J; Rohrer, G A

    2017-08-01

    Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  2. Direct Determination of Six Cytokinin Nucleotide Monophosphates in Coconut Flesh by Reversed-Phase Liquid Chromatography-Tandem Mass Spectrometry.

    Science.gov (United States)

    Cao, Zhao-Yun; Ma, You-Ning; Sun, Li-Hua; Mou, Ren-Xiang; Zhu, Zhi-Wei; Chen, Ming-Xue

    2017-11-15

    Coconut contains many uncharacterized cytokinins that have important physiological effects in plants and humans. In this work, a method based on liquid chromatography-tandem mass spectrometry was developed for identification and quantification of six cytokinin nucleotide monophosphates in coconut flesh. Excellent separation was achieved using a low-coverage C18 bonded-phase column with an acidic mobile phase, which greatly improved the retention of target compounds. To enable high-throughput analysis, a single-step solid-phase extraction using mixed-mode anion-exchange cartridges was employed for sample preparation. This proved to be an effective method to minimize matrix effects and ensure high selectivity. The limits of detection varied from 0.06 to 0.3 ng/mL, and the limits of quantification ranged from 0.2 to 1.0 ng/mL. The linearity was statistically verified over 2 orders of magnitude, giving a coefficient of determination (R 2 ) greater than 0.9981. The mean recoveries were from 81 to 108%; the intraday precision (n = 6) was less than 11%; and the interday precision (n = 11) was within 14%. The developed method was applied to the determination of cytokinin nucleotide monophosphates in coconut flesh samples, and four of them were successfully identified and quantified. The results showed that trans-zeatin riboside-5'-monophosphate was the dominant cytokinin, with a concentration of 2.7-34.2 ng/g, followed by N 6 -isopentenyladenosine-5'-monophosphate (≤12.9 ng/g), while the concentrations of cis-zeatin riboside-5'-monophosphate and dihydrozeatin riboside-5'-monophosphate were less than 2.2 and 4.9 ng/g, respectively.

  3. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  4. Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

    International Nuclear Information System (INIS)

    Xiong Gang; Wang, X.R.

    2005-01-01

    The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

  5. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses.

    Science.gov (United States)

    Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen

    2013-01-01

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).

  6. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Directory of Open Access Journals (Sweden)

    Elizabeth N. Krueger

    2013-07-01

    Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.

  7. The influence of selection on the evolutionary distance estimated from the base changes observed between homologous nucleotide sequences.

    Science.gov (United States)

    Otsuka, J; Kawai, Y; Sugaya, N

    2001-11-21

    In most studies of molecular evolution, the nucleotide base at a site is assumed to change with the apparent rate under functional constraint, and the comparison of base changes between homologous genes is thought to yield the evolutionary distance corresponding to the site-average change rate multiplied by the divergence time. However, this view is not sufficiently successful in estimating the divergence time of species, but mostly results in the construction of tree topology without a time-scale. In the present paper, this problem is investigated theoretically by considering that observed base changes are the results of comparing the survivals through selection of mutated bases. In the case of weak selection, the time course of base changes due to mutation and selection can be obtained analytically, leading to a theoretical equation showing how the selection has influence on the evolutionary distance estimated from the enumeration of base changes. This result provides a new method for estimating the divergence time more accurately from the observed base changes by evaluating both the strength of selection and the mutation rate. The validity of this method is verified by analysing the base changes observed at the third codon positions of amino acid residues with four-fold codon degeneracy in the protein genes of mammalian mitochondria; i.e. the ratios of estimated divergence times are fairly well consistent with a series of fossil records of mammals. Throughout this analysis, it is also suggested that the mutation rates in mitochondrial genomes are almost the same in different lineages of mammals and that the lineage-specific base-change rates indicated previously are due to the selection probably arising from the preference of transfer RNAs to codons.

  8. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  9. A single nucleotide polymorphism at the right terminal region of Mexican papita viroid is a virulent determinant factor on tomato

    Science.gov (United States)

    Mexican papita viroid (MPVd), a pospiviroid, causes serious disease outbreaks on greenhouse tomato in North America. Two dominant genotypes (MPV-S and MPV-M), sharing 93.8% sequence identity, incited striking different symptom expression (severe and mild) on tomato ‘Rutgers’. To determine genetic ...

  10. TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine.

    Science.gov (United States)

    Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun

    2016-10-01

    As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.

  11. Meta-analysis of sequence-based association studies across three cattle breeds reveals 25 QTL for fat and protein percentages in milk at nucleotide resolution.

    Science.gov (United States)

    Pausch, Hubert; Emmerling, Reiner; Gredler-Grandl, Birgit; Fries, Ruedi; Daetwyler, Hans D; Goddard, Michael E

    2017-11-09

    Genotyping and whole-genome sequencing data have been generated for hundreds of thousands of cattle. International consortia used these data to compile imputation reference panels that facilitate the imputation of sequence variant genotypes for animals that have been genotyped using dense microarrays. Association studies with imputed sequence variant genotypes allow for the characterization of quantitative trait loci (QTL) at nucleotide resolution particularly when individuals from several breeds are included in the mapping populations. We imputed genotypes for 28 million sequence variants in 17,229 cattle of the Braunvieh, Fleckvieh and Holstein breeds in order to compile large mapping populations that provide high power to identify QTL for milk production traits. Association tests between imputed sequence variant genotypes and fat and protein percentages in milk uncovered between six and thirteen QTL (P < 1e-8) per breed. Eight of the detected QTL were significant in more than one breed. We combined the results across breeds using meta-analysis and identified a total of 25 QTL including six that were not significant in the within-breed association studies. Two missense mutations in the ABCG2 (p.Y581S, rs43702337, P = 4.3e-34) and GHR (p.F279Y, rs385640152, P = 1.6e-74) genes were the top variants at QTL on chromosomes 6 and 20. Another known causal missense mutation in the DGAT1 gene (p.A232K, rs109326954, P = 8.4e-1436) was the second top variant at a QTL on chromosome 14 but its allelic substitution effects were inconsistent across breeds. It turned out that the conflicting allelic substitution effects resulted from flaws in the imputed genotypes due to the use of a multi-breed reference population for genotype imputation. Many QTL for milk production traits segregate across breeds and across-breed meta-analysis has greater power to detect such QTL than within-breed association testing. Association testing between imputed sequence variant genotypes and

  12. Single-nucleotide variant in multiple copies of a deleted in azoospermia (DAZ) sequence - a human Y chromosome quantitative polymorphism.

    Science.gov (United States)

    Szmulewicz, Martin N; Ruiz, Luis M; Reategui, Erika P; Hussini, Saeed; Herrera, Rene J

    2002-01-01

    The evolution of the deleted in azoospermia (DAZ) gene family supports prevalent theories on the origin and development of sex chromosomes and sexual dimorphism. The ancestral DAZL gene in human chromosome 3 is known to be involved in germline development of both males and females. The available phylogenetic data suggest that some time after the divergence of the New World and Old World monkey lineages, the DAZL gene, which is found in all mammals, was copied to the Y chromosome of an ancestor to the Old World monkeys, but not New World monkeys. In modern man, the Y-linked DAZ gene complex is located on the distal part of the q arm. It is thought that after being copied to the Y chromosome, and after the divergence of the human and great ape lineages, the DAZ gene in the former underwent internal rearrangements. This included tandem duplications as well as a T > C transition altering an MboI restriction enzyme site in a duplicated sequence. In this study, we report on the ratios of MboI-/MboI+ variant sequences in individuals from seven worldwide human populations (Basque, Benin, Egypt, Formosa, Kungurtug, Oman and Rwanda) in the DAZ complex. The ratio of PCR MboI- and MboI+ amplicons can be used to characterize individuals and populations. Our results show a nonrandom distribution of MboI-/MboI+ sequence ratios in all populations examined, as well as significant differences in ratios between populations when compared pairwise. The multiple ratios imply that there have been more than one recent reorganization events at this locus. Considering the dynamic nature of this locus and its involvement in male fertility, we investigated the extent and distribution of this polymorphism. Copyright 2002 S. Karger AG, Basel

  13. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  14. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  15. Purification, enzymatic characterization, and nucleotide sequence of a high-isoelectric-point alpha-glucosidase from barley malt

    DEFF Research Database (Denmark)

    Frandsen, T P; Lok, F; Mirgorodskaya, E

    2000-01-01

    in the transition state complex. Mass spectrometry of tryptic fragments assigned the 92-kD protein to a barley cDNA (GenBank accession no. U22450) that appears to encode an alpha-glucosidase. A corresponding sequence (HvAgl97; GenBank accession no. AF118226) was isolated from a genomic phage library using a c......High-isoelectric-point (pI) alpha-glucosidase was purified 7, 300-fold from an extract of barley (Hordeum vulgare) malt by ammonium sulfate fractionation, ion-exchange, and butyl-Sepharose chromatography. The enzyme had high activity toward maltose (k(cat) = 25 s(-1)), with an optimum at pH 4...

  16. Complete nucleotide sequence of the Oenothera elata plastid chromosome, representing plastome I of the five distinguishable euoenothera plastomes.

    Science.gov (United States)

    Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B

    2000-05-01

    We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.

  17. COMPLETE NUCLEOTIDE SEQUENCE OF SPHEROIDIN GENES OF CALLIPTAMUS ITALICUS ENTOMOPOXVIRUS(CIEPV) AND GOMPHOCERUS SIBIRICUS ENTOMOPOXVIRUS(GSEPV)

    Institute of Scientific and Technical Information of China (English)

    Yong-danLi; Li-yingWang; Xi-wuGao; Chao-yangZhao; Zhao-fengTian

    2004-01-01

    The spheroidin genes of Calliptamus italicus entomopoxvirus (CiEPV) and Gomphocerus sibiricus entomopoxvirus (GsEPV) were obtained by PCR,and the fragments were cloned, sequenced and analyzed. The CiEPV and GsEPV spheroidin genes respectively harbored ORFs of 2 922 bps and 2 967 bps that were capable of coding polypeptides of 109.2 and 111.1 kDa. Computer analysis indicated that CiEPV and GsEPV spheroidins shared less than 20% amino acid identities with lepidopteran AmEPV and coleopteran AcEPV spheroidins, but more than 80% amino acid identities with orthopteran OaEPV, MsEPV and AaEPV spheroidins. The CiEPV and GsEPV spheroidins respectively contained 19 and 21 cysteine residues that were particularly abundant at the C-termini, as is the case with those of the other orthopteran EPV spheroidins. The numbers and locations of the cysteine residues of the spheroidins were most similar to those of the spheroidins of EPVs that are virulent on the same insect orders. The promoter regions of the two spheroidin genes were highly conserved (99%) among the orthopteran EPVs and also contained the typical very A+T rich and TAAATG signal mediating transcription of poxvirus late genes. We also sequenced an incomplete ORF downstream of the pheroidin gene of CiEPV and GsEPV. The ORF was in the opposite direction to the spheroidin gene and was homologous to MSV072 putative protein of MsEPV.

  18. Species delimitation of common reef corals in the genus Pocillopora using nucleotide sequence phylogenies, population genetics and symbiosis ecology.

    Science.gov (United States)

    Pinzón, Jorge H; LaJeunesse, Todd C

    2011-01-01

    Stony corals in the genus Pocillopora are among the most common and widely distributed of Indo-Pacific corals and, as such, are often the subject of physiological and ecological research. In the far Tropical Eastern Pacific (TEP), they are major constituents of shallow coral communities, exhibiting considerable variability in colony shape and branch morphology and marked differences in response to thermal stress. Numerous intermediates occur between morphospecies that may relate to extensive hybridization. The diversity of the Pocillopora genus in the TEP was analysed genetically using nuclear ribosomal (ITS2) and mitochondrial (ORF) sequences, and population genetic markers (seven microsatellite loci). The resident dinoflagellate endosymbiont (Symbiodinium sp.) in each sample was also characterized using sequences of the internal transcribed spacer 2 (ITS2) rDNA and the noncoding region of the chloroplast psbA minicircle. From these analyses, three symbiotically distinct, reproductively isolated, nonhybridizing, evolutionarily divergent animal lineages were identified. Designated types 1, 2 and 3, these groupings were incongruent with traditional morphospecies classification. Type 1 was abundant and widespread throughout the TEP; type 2 was restricted to the Clipperton Atoll; and type 3 was found only in Panama and the Galapagos Islands. Each type harboured a different Symbiodinium'species lineage' in Clade C, and only type 1 associated with the 'stress-tolerant'Symbiodinium glynni (D1). The accurate delineation of species and implementation of a proper taxonomy may profoundly improve our assessment of Pocillopora's reproductive biology, biogeographic distributions, and resilience to climate warming, information that must be considered when planning for the conservation of reef corals. © 2010 Blackwell Publishing Ltd.

  19. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

    Science.gov (United States)

    Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo

    2002-12-01

    The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

  20. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  1. Genetic relatedness among indigenous rice varieties in the Eastern Himalayan region based on nucleotide sequences of the Waxy gene.

    Science.gov (United States)

    Choudhury, Baharul I; Khan, Mohammed L; Dayanandan, Selvadurai

    2014-12-29

    Indigenous rice varieties in the Eastern Himalayan region of Northeast India are traditionally classified into sali, boro and jum ecotypes based on geographical locality and the season of cultivation. In this study, we used DNA sequence data from the Waxy (Wx) gene to infer the genetic relatedness among indigenous rice varieties in Northeast India and to assess the genetic distinctiveness of ecotypes. The results of all three analyses (Bayesian, Maximum Parsimony and Neighbor Joining) were congruent and revealed two genetically distinct clusters of rice varieties in the region. The large group comprised several varieties of sali and boro ecotypes, and all agronomically improved varieties. The small group consisted of only traditionally cultivated indigenous rice varieties, which included one boro, few sali and all jum varieties. The fixation index analysis revealed a very low level of differentiation between sali and boro (F(ST) = 0.005), moderate differentiation between sali and jum (F(ST) = 0.108) and high differentiation between jum and boro (F(ST) = 0.230) ecotypes. The genetic relatedness analyses revealed that sali, boro and jum ecotypes are genetically heterogeneous, and the current classification based on cultivation type is not congruent with the genetic background of rice varieties. Indigenous rice varieties chosen from genetically distinct clusters could be used in breeding programs to improve genetic gain through heterosis, while maintaining high genetic diversity.

  2. Characterization of the transcriptome, nucleotide sequence polymorphism, and natural selection in the desert adapted mouse Peromyscus eremicus

    Directory of Open Access Journals (Sweden)

    Matthew D. MacManes

    2014-10-01

    Full Text Available As a direct result of intense heat and aridity, deserts are thought to be among the most harsh of environments, particularly for their mammalian inhabitants. Given that osmoregulation can be challenging for these animals, with failure resulting in death, strong selection should be observed on genes related to the maintenance of water and solute balance. One such animal, Peromyscus eremicus, is native to the desert regions of the southwest United States and may live its entire life without oral fluid intake. As a first step toward understanding the genetics that underlie this phenotype, we present a characterization of the P. eremicus transcriptome. We assay four tissues (kidney, liver, brain, testes from a single individual and supplement this with population level renal transcriptome sequencing from 15 additional animals. We identified a set of transcripts undergoing both purifying and balancing selection based on estimates of Tajima’s D. In addition, we used the branch-site test to identify a transcript—Slc2a9, likely related to desert osmoregulation—undergoing enhanced selection in P. eremicus relative to a set of related non-desert rodents.

  3. Detection and copy number estimation of the transgenic nucleotide sequences in an unknown GM event of Oryza sativa

    Directory of Open Access Journals (Sweden)

    Ali M. Sajjad

    2016-12-01

    Full Text Available The present study was designed to establish a qualitative detection method based on conventional and real time PCR assay to screen the commonly grown rice varieties for the presence of the cry1Ac gene. The detection of genetically modified rice in the screening process would necessitate accurate assay development and precise qualitative PCR tests complying with established procedures for the detection and characterization of transgenes in food grains. Such assay would not only enable the monitoring of transgene flow in local agricultural environment but also the characterization of different plant species produced with this transgene and its regulatory components. Thus, a reliable and quick screening assay was established for the qualitative detection of the transgene along with the promoter and selectable marker gene in genetically modified rice. By conventional PCR, a fragment of 215 bp was amplified with gene specific primers of cry1Ac. Primers for other transgenes such as gna and bar were also employed; however, no amplification was detected. The presence of the p35s, sps, and nptII genes was confirmed by qualitative real-time PCR. The specificity of the respective PCR products was checked through melt peak curve analysis. Sharp and precise melting temperatures indicated the presence of a single kind of PCR product in correspondence to each of the primers used. Moreover, the copy number of cry1Ac was estimated by ∆∆CT method. It is proposed that the primer sets and experimental conditions used in this study will be sufficient to meet the requirements for molecular detection and characterization of the cry1Ac transgene and affiliated sequences in sorting out conventional rice varieties from the ones which are genetically modified. It will also help to monitor the ecological flow of these transgenes and other biosafety factors.

  4. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  5. [Application of single nucleotide polymorphism-microarray and target gene sequencing in the study of genetic etiology of children with unexplained intellectual disability or developmental delay].

    Science.gov (United States)

    Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M

    2016-10-02

    Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic

  6. A comprehensive experiment for molecular biology: Determination of single nucleotide polymorphism in human REV3 gene using PCR-RFLP.

    Science.gov (United States)

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-07-08

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of DNA polymerase ζ and SNPs in this gene are associated with altered susceptibility to cancer. This newly designed experiment is composed of three parts, including genomic DNA extraction, gene amplification by PCR, and genotyping by RFLP. By combining these activities, the students are not only able to learn a series of biotechniques in molecular biology, but also acquire the ability to link the learned knowledge with practical applications. This comprehensive experiment will help the medical students improve the conceptual understanding of SNP and the technical understanding of SNP detection. © 2017 by The International Union of Biochemistry and Molecular Biology, 45(4):299-304, 2017. © 2017 The International Union of Biochemistry and Molecular Biology.

  7. Nucleotide Variability at Its Limit? Insights into the Number and Evolutionary Dynamics of the Sex-Determining Specificities of the Honey Bee Apis mellifera

    Science.gov (United States)

    Lechner, Sarah; Ferretti, Luca; Schöning, Caspar; Kinuthia, Wanja; Willemsen, David; Hasselmann, Martin

    2014-01-01

    Deciphering the evolutionary processes driving nucleotide variation in multiallelic genes is limited by the number of genetic systems in which such genes occur. The complementary sex determiner (csd) gene in the honey bee Apis mellifera is an informative example for studying allelic diversity and the underlying evolutionary forces in a well-described model of balancing selection. Acting as the primary signal of sex determination, diploid individuals heterozygous for csd develop into females, whereas csd homozygotes are diploid males that have zero fitness. Examining 77 of the functional heterozygous csd allele pairs, we established a combinatorical criteria that provide insights into the minimum number of amino acid differences among those pairs. Given a data set of 244 csd sequences, we show that the total number of csd alleles found in A. mellifera ranges from 53 (locally) to 87 (worldwide), which is much higher than was previously reported (20). Using a coupon-collector model, we extrapolate the presence of in total 116–145 csd alleles worldwide. The hypervariable region (HVR) is of particular importance in determining csd allele specificity, and we provide for this region evidence of high evolutionary rate for length differences exceeding those of microsatellites. The proportion of amino acids driven by positive selection and the rate of nonsynonymous substitutions in the HVR-flanking regions reach values close to 1 but differ with respect to the HVR length. Using a model of csd coalescence, we identified the high originating rate of csd specificities as a major evolutionary force, leading to an origin of a novel csd allele every 400,000 years. The csd polymorphism frequencies in natural populations indicate an excess of new mutations, whereas signs of ancestral transspecies polymorphism can still be detected. This study provides a comprehensive view of the enormous diversity and the evolutionary forces shaping a multiallelic gene. PMID:24170493

  8. Nucleotide variability at its limit? Insights into the number and evolutionary dynamics of the sex-determining specificities of the honey bee Apis mellifera.

    Science.gov (United States)

    Lechner, Sarah; Ferretti, Luca; Schöning, Caspar; Kinuthia, Wanja; Willemsen, David; Hasselmann, Martin

    2014-02-01

    Deciphering the evolutionary processes driving nucleotide variation in multiallelic genes is limited by the number of genetic systems in which such genes occur. The complementary sex determiner (csd) gene in the honey bee Apis mellifera is an informative example for studying allelic diversity and the underlying evolutionary forces in a well-described model of balancing selection. Acting as the primary signal of sex determination, diploid individuals heterozygous for csd develop into females, whereas csd homozygotes are diploid males that have zero fitness. Examining 77 of the functional heterozygous csd allele pairs, we established a combinatorical criteria that provide insights into the minimum number of amino acid differences among those pairs. Given a data set of 244 csd sequences, we show that the total number of csd alleles found in A. mellifera ranges from 53 (locally) to 87 (worldwide), which is much higher than was previously reported (20). Using a coupon-collector model, we extrapolate the presence of in total 116-145 csd alleles worldwide. The hypervariable region (HVR) is of particular importance in determining csd allele specificity, and we provide for this region evidence of high evolutionary rate for length differences exceeding those of microsatellites. The proportion of amino acids driven by positive selection and the rate of nonsynonymous substitutions in the HVR-flanking regions reach values close to 1 but differ with respect to the HVR length. Using a model of csd coalescence, we identified the high originating rate of csd specificities as a major evolutionary force, leading to an origin of a novel csd allele every 400,000 years. The csd polymorphism frequencies in natural populations indicate an excess of new mutations, whereas signs of ancestral transspecies polymorphism can still be detected. This study provides a comprehensive view of the enormous diversity and the evolutionary forces shaping a multiallelic gene.

  9. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  10. Determining physical constraints in transcriptional initiationcomplexes using DNA sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Shultzaberger, Ryan K.; Chiang, Derek Y.; Moses, Alan M.; Eisen,Michael B.

    2007-07-01

    Eukaryotic gene expression is often under the control ofcooperatively acting transcription factors whose binding is limited bystructural constraints. By determining these structural constraints, wecan understand the "rules" that define functional cooperativity.Conversely, by understanding the rules of binding, we can inferstructural characteristics. We have developed an information theory basedmethod for approximating the physical limitations of cooperativeinteractions by comparing sequence analysis to microarray expressiondata. When applied to the coordinated binding of the sulfur amino acidregulatory protein Met4 by Cbf1 and Met31, we were able to create acombinatorial model that can correctly identify Met4 regulatedgenes.

  11. Molecular Comparison and Evolutionary Analyses of VP1 Nucleotide Sequences of New African Human Enterovirus 71 Isolates Reveal a Wide Genetic Diversity

    Science.gov (United States)

    Nougairède, Antoine; Joffret, Marie-Line; Deshpande, Jagadish M.; Dubot-Pérès, Audrey; Héraud, Jean-Michel

    2014-01-01

    Most circulating strains of Human enterovirus 71 (EV-A71) have been classified primarily into three genogroups (A to C) on the basis of genetic divergence between the 1D gene, which encodes the VP1 capsid protein. The aim of the present study was to provide further insights into the diversity of the EV-A71 genogroups following the recent description of highly divergent isolates, in particular those from African countries, including Madagascar. We classified recent EV-A71 isolates by a large comparison of 3,346 VP1 nucleotidic sequences collected from GenBank. Analysis of genetic distances and phylogenetic investigations indicated that some recently-reported isolates did not fall into the genogroups A-C and clustered into three additional genogroups, including one Indian genogroup (genogroup D) and 2 African ones (E and F). Our Bayesian phylogenetic analysis provided consistent data showing that the genogroup D isolates share a recent common ancestor with the members of genogroup E, while the isolates of genogroup F evolved from a recent common ancestor shared with the members of the genogroup B. Our results reveal the wide diversity that exists among EV-A71 isolates and suggest that the number of circulating genogroups is probably underestimated, particularly in developing countries where EV-A71 epidemiology has been poorly studied. PMID:24598878

  12. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper.

    Science.gov (United States)

    Manivannan, Abinaya; Kim, Jin-Hee; Yang, Eun-Young; Ahn, Yul-Kyun; Lee, Eun-Su; Choi, Sena; Kim, Do-Sun

    2018-01-01

    Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS) approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP) indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  13. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2018-01-01

    Full Text Available Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  14. Determination of single-nucleotide polymorphism in the proximal promoter region of apolipoprotein M gene in coronary artery diseases

    Directory of Open Access Journals (Sweden)

    Lu Zheng

    2009-09-01

    Full Text Available Lu Zheng1, Guanghua Luo1, Xiaoying Zhang1, Jun Zhang1, Jiang Zhu1, Jiang Wei1, Qinfeng Mu1, Lujun Chen1, Peter Nilsson-Ehle2, Ning Xu21Comprehensive Laboratory, The Third Affiliated Hospital, Suzhou University, Changzhou China; 2Division of Clinical Chemistry and Pharmacology, Department of Laboratory Medicine, Lund University, Lund, SwedenObjective: It has been reported that single-nucleotide polymorphism (SNP in the proximal promoter region of apolipoprotein M (apoM gene may confer the risk in the development of type 2 diabetes (T2D and coronary artery disease (CAD in the Han Chinese. However, in a recent study demonstrated that plasma apoM level did not correlated to the coronary heart disease. In the present studies, we investigated the SNP T-778C of apoM gene in CAD patients and controls in the Han Chinese population. Moreover we examined whether serum apoM levels could be influenced by this promoter mutation.Material and methods: One hundred twenty-six CAD patients and 118 non-CAD patients were subjected in the present study. All patients were confirmed by the angiography. The genotyping of polymorphisms T-778C in apoM promoter was determined by real-time polymerase chain reaction. Serum apoM levels were semi-quantitatively determined by the dot-blotting analysis. Results: Distribution of apoM T-778C genotype in non-CAD patients was as following: 84.7% were T/T, 15.3% were T/C and 0.0% was C/C. T allele frequencies were 92.4% and C allele, 7.6%. In the CAD patients, 99 patients (78.6% had the T/T genotype, 25 patients (19.8% with T/C genotype and 2 patients (1.6% with C/C genotype. The allele frequency was 88.5% for the T allele and 11.5% for the C allele. There was no statistical significant difference of serum apoM levels found in these three genotypes.Conclusions: There was no significant difference in allele or genotype frequencies between CAD patients and non-CAD patients. Binary logistic regression analysis with adjustments for age

  15. Comparing Enterovirus 71 with Coxsackievirus A16 by analyzing nucleotide sequences and antigenicity of recombinant proteins of VP1s and VP4s

    Directory of Open Access Journals (Sweden)

    Sun Yu

    2011-11-01

    Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.

  16. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    Science.gov (United States)

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  17. Deep Sequence Analysis of Non-Small Cell Lung Cancer: Integrated Analysis of Gene Expression, Alternative Splicing, and Single Nucleotide Variations in Lung Adenocarcinomas with and without Oncogenic KRAS Mutations

    International Nuclear Information System (INIS)

    Kalari, Krishna R.; Rossell, David; Necela, Brian M.; Asmann, Yan W.; Nair, Asha

    2012-01-01

    KRAS mutations are highly prevalent in non-small cell lung cancer (NSCLC), and tumors harboring these mutations tend to be aggressive and resistant to chemotherapy. We used next-generation sequencing technology to identify pathways that are specifically altered in lung tumors harboring a KRAS mutation. Paired-end RNA-sequencing of 15 primary lung adenocarcinoma tumors (8 harboring mutant KRAS and 7 with wild-type KRAS) were performed. Sequences were mapped to the human genome, and genomic features, including differentially expressed genes, alternate splicing isoforms and single nucleotide variants, were determined for tumors with and without KRAS mutation using a variety of computational methods. Network analysis was carried out on genes showing differential expression (374 genes), alternate splicing (259 genes), and SNV-related changes (65 genes) in NSCLC tumors harboring a KRAS mutation. Genes exhibiting two or more connections from the lung adenocarcinoma network were used to carry out integrated pathway analysis. The most significant signaling pathways identified through this analysis were the NFκB, ERK1/2, and AKT pathways. A 27 gene mutant KRAS-specific sub network was extracted based on gene–gene connections from the integrated network, and interrogated for druggable targets. Our results confirm previous evidence that mutant KRAS tumors exhibit activated NFκB, ERK1/2, and AKT pathways and may be preferentially sensitive to target therapeutics toward these pathways. In addition, our analysis indicates novel, previously unappreciated links between mutant KRAS and the TNFR and PPARγ signaling pathways, suggesting that targeted PPARγ antagonists and TNFR inhibitors may be useful therapeutic strategies for treatment of mutant KRAS lung tumors. Our study is the first to integrate genomic features from RNA-Seq data from NSCLC and to define a first draft genomic landscape model that is unique to tumors with oncogenic KRAS mutations.

  18. Hydrophilic interaction ultra-high performance liquid chromatography coupled with triple quadrupole mass spectrometry for determination of nucleotides, nucleosides and nucleobases in Ziziphus plants.

    Science.gov (United States)

    Guo, Sheng; Duan, Jin-ao; Qian, Dawei; Wang, Hanqing; Tang, Yuping; Qian, Yefei; Wu, Dawei; Su, Shulan; Shang, Erxin

    2013-08-02

    In this study, a rapid and sensitive analytical method was developed for the determination of 20 nucleobases, nucleosides and nucleotides in Ziziphus plants at trace levels by using hydrophilic interaction ultra-high performance liquid chromatography coupled with triple-quadrupole tandem mass spectrometry (HILIC-UHPLC-TQ-MS/MS) in multiple-reaction monitoring (MRM) mode. Under the optimized chromatographic conditions, good separation for 20 target compounds were obtained on a UHPLC Amide column with sub-2μm particles within 10min. The overall LODs and LOQs were between 0.11-3.12ngmL(-1) and 0.29-12.48ngmL(-1) for the 20 analytes, respectively. It is the first report about simultaneous analysis of nucleobases, nucleosides and nucleotides in medicinal plants using HILIC-UHPLC-TQ-MS/MS method, which affords good linearity, precision, repeatability and accuracy. The developed method was successfully applied to Ziziphus plant (Z. jujuba, Z. jujuba var. spinosa and Z. mauritiana) samples. The analysis showed that the fruits and leaves of Ziziphus plants are rich in nucleosides and nucleobases as well as nucleotides, and could be selected as the healthy food resources. Our results in present study suggest that HILIC-UHPLC-TQ-MS/MS method could be employed as a useful tool for quality assessment of the samples from the Ziziphus plants as well as other medicinal plants or food samples using nucleotides, nucleosides and nucleobases as markers. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  20. Sequence determination and analysis of the NSs genes of two tospoviruses.

    Science.gov (United States)

    Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

    2012-03-01

    The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

  1. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Directory of Open Access Journals (Sweden)

    Mullen Michael P

    2011-01-01

    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  2. Ion torrent personal genome machine sequencing for genomic typing of Neisseria meningitidis for rapid determination of multiple layers of typing information.

    Science.gov (United States)

    Vogel, Ulrich; Szczepanowski, Rafael; Claus, Heike; Jünemann, Sebastian; Prior, Karola; Harmsen, Dag

    2012-06-01

    Neisseria meningitidis causes invasive meningococcal disease in infants, toddlers, and adolescents worldwide. DNA sequence-based typing, including multilocus sequence typing, analysis of genetic determinants of antibiotic resistance, and sequence typing of vaccine antigens, has become the standard for molecular epidemiology of the organism. However, PCR of multiple targets and consecutive Sanger sequencing provide logistic constraints to reference laboratories. Taking advantage of the recent development of benchtop next-generation sequencers (NGSs) and of BIGSdb, a database accommodating and analyzing genome sequence data, we therefore explored the feasibility and accuracy of Ion Torrent Personal Genome Machine (PGM) sequencing for genomic typing of meningococci. Three strains from a previous meningococcus serogroup B community outbreak were selected to compare conventional typing results with data generated by semiconductor chip-based sequencing. In addition, sequencing of the meningococcal type strain MC58 provided information about the general performance of the technology. The PGM technology generated sequence information for all target genes addressed. The results were 100% concordant with conventional typing results, with no further editing being necessary. In addition, the amount of typing information, i.e., nucleotides and target genes analyzed, could be substantially increased by the combined use of genome sequencing and BIGSdb compared to conventional methods. In the near future, affordable and fast benchtop NGS machines like the PGM might enable reference laboratories to switch to genomic typing on a routine basis. This will reduce workloads and rapidly provide information for laboratory surveillance, outbreak investigation, assessment of vaccine preventability, and antibiotic resistance gene monitoring.

  3. Recommendations to address the difficulties encountered when determining linezolid resistance from whole genome sequencing data.

    Science.gov (United States)

    Beukers, Alicia G; Hasman, Henrik; Hegstad, Kristin; van Hal, Sebastiaan J

    2018-05-29

    Mutations associated with linezolid resistance within the V domain of 23S rRNA are annotated using an Escherichia coli numbering system. The 23S rRNA gene varies in length, nucleotide sequence and copy number between bacterial species. Consequently, this numbering system is not intuitive and can lead to confusion when locating mutation sites using whole genome sequencing data. Using the mutation G2576T as an example, we demonstrate the difficulties associated with using the E. coli numbering system. © Crown copyright 2018.

  4. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  5. Retroviral DNA Sequences as a Means for Determining Ancient Diets.

    Directory of Open Access Journals (Sweden)

    Jessica I Rivera-Perez

    Full Text Available For ages, specialists from varying fields have studied the diets of the primeval inhabitants of our planet, detecting diet remains in archaeological specimens using a range of morphological and biochemical methods. As of recent, metagenomic ancient DNA studies have allowed for the comparison of the fecal and gut microbiomes associated to archaeological specimens from various regions of the world; however the complex dynamics represented in those microbial communities still remain unclear. Theoretically, similar to eukaryote DNA the presence of genes from key microbes or enzymes, as well as the presence of DNA from viruses specific to key organisms, may suggest the ingestion of specific diet components. In this study we demonstrate that ancient virus DNA obtained from coprolites also provides information reconstructing the host's diet, as inferred from sequences obtained from pre-Columbian coprolites. This depicts a novel and reliable approach to determine new components as well as validate the previously suggested diets of extinct cultures and animals. Furthermore, to our knowledge this represents the first description of the eukaryotic viral diversity found in paleofaeces belonging to pre-Columbian cultures.

  6. Analysis of complete nucleotide sequences of Angolan hepatitis B virus isolates reveals the existence of a separate lineage within genotype E.

    Directory of Open Access Journals (Sweden)

    Barbara V Lago

    Full Text Available Hepatitis B virus genotype E (HBV/E is highly prevalent in Western Africa. In this work, 30 HBV/E isolates from HBsAg positive Angolans (staff and visitors of a private hospital in Luanda were genetically characterized: 16 of them were completely sequenced and the pre-S/S sequences of the remaining 14 were determined. A high proportion (12/30, 40% of subjects tested positive for both HBsAg and anti-HBs markers. Deduced amino acid sequences revealed the existence of specific substitutions and deletions in the B- and T-cell epitopes of the surface antigen (pre-S1- and pre-S2 regions of the virus isolates derived from 8/12 individuals with concurrent HBsAg/anti-HBs. Phylogenetic analysis performed with 231 HBV/E full-length sequences, including 16 from this study, showed that all isolates from Angola, Namibia and the Democratic Republic of Congo (n = 28 clustered in a separate lineage, divergent from the HBV/E isolates from nine other African countries, namely Cameroon, Central African Republic, Côte d'Ivoire, Ghana, Guinea, Madagascar, Niger, Nigeria and Sudan, with a Bayesian posterior probability of 1. Five specific mutations, namely small S protein T57I, polymerase Q177H, G245W and M612L, and X protein V30L, were observed in 79-96% of the isolates of the separate lineage, compared to a frequency of 0-12% among the other HBV/E African isolates.

  7. Genome sequencing and analysis reveals possible determinants of Staphylococcus aureus nasal carriage

    Directory of Open Access Journals (Sweden)

    Cole Alexander M

    2008-09-01

    Full Text Available Abstract Background Nasal carriage of Staphylococcus aureus is a major risk factor in clinical and community settings due to the range of etiologies caused by the organism. We have identified unique immunological and ultrastructural properties associated with nasal carriage isolates denoting a role for bacterial factors in nasal carriage. However, despite extensive molecular level characterizations by several groups suggesting factors necessary for colonization on nasal epithelium, genetic determinants of nasal carriage are unknown. Herein, we have set a genomic foundation for unraveling the bacterial determinants of nasal carriage in S. aureus. Results MLST analysis revealed no lineage specific differences between carrier and non-carrier strains suggesting a role for mobile genetic elements. We completely sequenced a model carrier isolate (D30 and a model non-carrier strain (930918-3 to identify differential gene content. Comparison revealed the presence of 84 genes unique to the carrier strain and strongly suggests a role for Type VII secretion systems in nasal carriage. These genes, along with a putative pathogenicity island (SaPIBov present uniquely in the carrier strains are likely important in affecting carriage. Further, PCR-based genotyping of other clinical isolates for a specific subset of these 84 genes raise the possibility of nasal carriage being caused by multiple gene sets. Conclusion Our data suggest that carriage is likely a heterogeneic phenotypic trait and implies a role for nucleotide level polymorphism in carriage. Complete genome level analyses of multiple carriage strains of S. aureus will be important in clarifying molecular determinants of S. aureus nasal carriage.

  8. Structural determination of functional units of the nucleotide binding domain (NBD94 of the reticulocyte binding protein Py235 of Plasmodium yoelii.

    Directory of Open Access Journals (Sweden)

    Ardina Grüber

    2010-02-01

    Full Text Available Invasion of the red blood cells (RBC by the merozoite of malaria parasites involves a large number of receptor ligand interactions. The reticulocyte binding protein homologue family (RH plays an important role in erythrocyte recognition as well as virulence. Recently, it has been shown that members of RH in addition to receptor binding may also have a role as ATP/ADP sensor. A 94 kDa region named Nucleotide-Binding Domain 94 (NBD94 of Plasmodium yoelii YM, representative of the putative nucleotide binding region of RH, has been demonstrated to bind ATP and ADP selectively. Binding of ATP or ADP induced nucleotide-dependent structural changes in the C-terminal hinge-region of NBD94, and directly impacted on the RBC binding ability of RH.In order to find the smallest structural unit, able to bind nucleotides, and its coupling module, the hinge region, three truncated domains of NBD94 have been generated, termed NBD94(444-547, NBD94(566-663 and NBD94(674-793, respectively. Using fluorescence correlation spectroscopy NBD94(444-547 has been identified to form the smallest nucleotide binding segment, sensitive for ATP and ADP, which became inhibited by 4-Chloro-7-nitrobenzofurazan. The shape of NBD94(444-547 in solution was calculated from small-angle X-ray scattering data, revealing an elongated molecule, comprised of two globular domains, connected by a spiral segment of about 73.1 A in length. The high quality of the constructs, forming the hinge-region, NBD94(566-663 and NBD94(674-793 enabled to determine the first crystallographic and solution structure, respectively. The crystal structure of NBD94(566-663 consists of two helices with 97.8 A and 48.6 A in length, linked by a loop. By comparison, the low resolution structure of NBD94(674-793 in solution represents a chair-like shape with three architectural segments.These structures give the first insight into how nucleotide binding impacts on the overall structure of RH and demonstrates the

  9. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  10. Determining and comparing protein function in Bacterial genome sequences

    DEFF Research Database (Denmark)

    Vesth, Tammi Camilla

    of this class have very little homology to other known genomes making functional annotation based on sequence similarity very difficult. Inspired in part by this analysis, an approach for comparative functional annotation was created based public sequenced genomes, CMGfunc. Functionally related groups......In November 2013, there was around 21.000 different prokaryotic genomes sequenced and publicly available, and the number is growing daily with another 20.000 or more genomes expected to be sequenced and deposited by the end of 2014. An important part of the analysis of this data is the functional...... annotation of genes – the descriptions assigned to genes that describe the likely function of the encoded proteins. This process is limited by several factors, including the definition of a function which can be more or less specific as well as how many genes can actually be assigned a function based...

  11. Rate-determining Step of Flap Endonuclease 1 (FEN1) Reflects a Kinetic Bias against Long Flaps and Trinucleotide Repeat Sequences.

    Science.gov (United States)

    Tarantino, Mary E; Bilotti, Katharina; Huang, Ji; Delaney, Sarah

    2015-08-21

    Flap endonuclease 1 (FEN1) is a structure-specific nuclease responsible for removing 5'-flaps formed during Okazaki fragment maturation and long patch base excision repair. In this work, we use rapid quench flow techniques to examine the rates of 5'-flap removal on DNA substrates of varying length and sequence. Of particular interest are flaps containing trinucleotide repeats (TNR), which have been proposed to affect FEN1 activity and cause genetic instability. We report that FEN1 processes substrates containing flaps of 30 nucleotides or fewer at comparable single-turnover rates. However, for flaps longer than 30 nucleotides, FEN1 kinetically discriminates substrates based on flap length and flap sequence. In particular, FEN1 removes flaps containing TNR sequences at a rate slower than mixed sequence flaps of the same length. Furthermore, multiple-turnover kinetic analysis reveals that the rate-determining step of FEN1 switches as a function of flap length from product release to chemistry (or a step prior to chemistry). These results provide a kinetic perspective on the role of FEN1 in DNA replication and repair and contribute to our understanding of FEN1 in mediating genetic instability of TNR sequences. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Genetic diversity of Taenia hydatigena in the northern part of the West Bank, Palestine as determined by mitochondrial DNA sequences.

    Science.gov (United States)

    Adwan, Kamel; Jayousi, Alaa; Abuseir, Sameh; Abbasi, Ibrahim; Adwan, Ghaleb; Jarrar, Naser

    2018-06-26

    Cysticercus tenuicollis is the metacestode of canine tapeworm Taenia hydatigena, which has been reported in domestic and wild ruminants and is causing veterinary and economic losses in the meat industry. This study was conducted to determine the sequence variation in the mitochondrial cytochrome c oxidase subunit 1 (coxl) gene in 20 isolates of T. hydatigena metacestodes (cysticercus tenuicollis) collected from northern West Bank in Palestine. Nine haplotypes were detected, with one prevailing (55%). The total haplotype diversity (0.705) and the total nucleotide diversity (0.0045) displayed low genetic diversity among our isolates. Haplotype analysis showed a star-shaped network with a centrally positioned common haplotype. The Tajima's D, and Fu and Li's statistics in cysticercus tenuicollis population of this region showed a negative value, indicating deviations from neutrality and both suggested recent population expansion for the population. The findings of this study would greatly help to implement control and preventive measures for T. hydatigena larvae infection in Palestine.

  13. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...

  14. Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human monoclonal antibody with broad reactivity to malignant tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)

    1989-06-12

    The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.

  15. Insertion sequence transposition determines imipenem resistance in Acinetobacter baumannii.

    Science.gov (United States)

    Kuo, Han-Yueh; Chang, Kai-Chih; Liu, Chih-Chin; Tang, Chuan Yi; Peng, Jhih-Hua; Lu, Chia-Wei; Tu, Chi-Chao; Liou, Ming-Li

    2014-10-01

    This study employed genomewide analysis to investigate potential resistance mechanisms in Acinetobacter baumannii following imipenem exposure. Imipenem-selected mutants were generated from the imipenem-susceptible strain ATCC 17978 by multistep selection resistance. Antibiotic susceptibilities were examined, and the selected mutants originated from the ATCC 17978 strain were confirmed by pulsed-field gel electrophoresis. The genomic sequence of a resistant mutant was analyzed using a next-generation sequencing platform, and genetic recombination was further confirmed by PCR. The result showed that phenotypic resistance was observed with carbapenem upon exposure to various concentrations of imipenem. Genomewide analysis showed that ISAba1 transposition was initiated by imipenem exposure at concentrations up to 0.5 mg/L. Transposition of ISAba1 upstream of blaOXA-95 was detected in all the selected mutants. The expression of blaOXA-95 was further analyzed by quantitative PCR, and the results demonstrated that a 200-fold increase in gene expression was required for resistance to imipenem. This study concluded that imipenem exposure at a concentration of 0.5 mg/L mediated the transposition of ISAba1 upstream of the blaOXA-95 gene and resulted in the overexpression of blaOXA-95 gene, which may play a major role in the resistance to imipenem in A. baumannii.

  16. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    Science.gov (United States)

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  17. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    Science.gov (United States)

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  18. Comparison of nucleotide sequences of recent and previous lineages of peste-des-petits-ruminants viruses of sheep and goats in Nigeria

    Directory of Open Access Journals (Sweden)

    Samuel Mantip

    2016-08-01

    Full Text Available Peste-des-petits-ruminants virus (PPRV is a highly contagious, fatal and economically important viral disease of small ruminants that is still endemic and militates against the production of sheep and goats in endemic areas of the world. The aim of this study was to describe the viral strains within the country. This was carried out by collecting tissue and swab samples from sheep and goats in various agro-ecological zones of Nigeria. The phylogeny of archived PPRV strains or isolates and those circulating and causing recent outbreaks was determined by sequencing of the nucleoprotein (N-gene. Twenty tissue and swab samples from apparently healthy and sick sheep and goats were collected randomly from 18 states, namely 3 states in each of the 6 agro-ecological zones visited. A total of 360 samples were collected. A total of 35 samples of 360 (9.7% tested positive by reverse transcriptase–polymerase chain reaction, of which 25 were from oculo-nasal swabs and 10 were from tissue samples. Neighbour-joining phylogenetic analysis using Phylogenetic Analysis Using Parsimony (PAUP identified four different lineages, that is, lineages I, II, III and IV. Interestingly, the Nigerian strains described in this study grouped in two separate major lineages, that is, lineages II and IV. Strains from Sokoto, Oyo, Plateau and Ondo states grouped according to the historical distribution of PPRV together with the Nigerian 75/1 strain of lineage II, while other strains from Sokoto, Oyo, Plateau, Akwa-Ibom, Adamawa, Kaduna, Lagos, Bauchi, Niger and Kano states grouped together with the East African and Asian strains of lineage IV. This finding confirms that both lineage II and IV strains of PPRV are circulating in Nigeria. Previously, only strains of lineage II were found to be present in the country.

  19. Peptide and nucleotide sequences of rat CD4 (W3/25) antigen: evidence for derivation from a structure with four immunoglobulin-related domains

    International Nuclear Information System (INIS)

    Clark, S.J.; Jefferies, W.A.; Barclay, A.N.; Gagnon, J.; Williams, A.F.

    1987-01-01

    The rat W3/25 antigen was the first marker antigen of helper T lymphocytes to be identified. Subsequently, the human OKT4 antigen (now called CD4) was described, and cell distribution and functional data suggested that W3/25 and OKT4 antigens were homologous. This is now confirmed by the matching of peptide sequences from W3/25 antigen with sequence predicted from rat cDNA clones detected by cross-hybridization with a cDNA probe for human CD4. Analysis of the two sequences suggests an evolutionary origin from a structure with four immunoglobulin-related domains, although only domain 1 at the NH 2 terminus meets the standard criteria for an immunoglobulin-related sequence. CD4 domains 2 and 4 contain disulfide bonds but seem like truncated immunoglobulin domains, whereas domain 3 may have a pattern of β-strands like an immunoglobulin variable domain, but without the disulfide bond

  20. Genetic diversity of the captive Asian tapir population in Thailand, based on mitochondrial control region sequence data and the comparison of its nucleotide structure with Brazilian tapir.

    Science.gov (United States)

    Muangkram, Yuttamol; Amano, Akira; Wajjwalku, Worawidh; Pinyopummintr, Tanu; Thongtip, Nikorn; Kaolim, Nongnid; Sukmak, Manakorn; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Maikaew, Umaporn; Thomas, Warisara; Polsrila, Kanda; Dongsaard, Kwanreaun; Sanannu, Saowaphang; Wattananorrasate, Anuwat

    2017-07-01

    The Asian tapir (Tapirus indicus) has been classified as Endangered on the IUCN Red List of Threatened Species (2008). Genetic diversity data provide important information for the management of captive breeding and conservation of this species. We analyzed mitochondrial control region (CR) sequences from 37 captive Asian tapirs in Thailand. Multiple alignments of the full-length CR sequences sized 1268 bp comprised three domains as described in other mammal species. Analysis of 16 parsimony-informative variable sites revealed 11 haplotypes. Furthermore, the phylogenetic analysis using median-joining network clearly showed three clades correlated with our earlier cytochrome b gene study in this endangered species. The repetitive motif is located between first and second conserved sequence blocks, similar to the Brazilian tapir. The highest polymorphic site was located in the extended termination associated sequences domain. The results could be applied for future genetic management based in captivity and wild that shows stable populations.

  1. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  2. Targeted genomic enrichment and sequencing of CyHV-3 from carp tissues confirms low nucleotide diversity and mixed genotype infections

    Directory of Open Access Journals (Sweden)

    Saliha Hammoumi

    2016-09-01

    Full Text Available Koi herpesvirus disease (KHVD is an emerging disease that causes mass mortality in koi and common carp, Cyprinus carpio L. Its causative agent is Cyprinid herpesvirus 3 (CyHV-3, also known as koi herpesvirus (KHV. Although data on the pathogenesis of this deadly virus is relatively abundant in the literature, still little is known about its genomic diversity and about the molecular mechanisms that lead to such a high virulence. In this context, we developed a new strategy for sequencing full-length CyHV-3 genomes directly from infected fish tissues. Total genomic DNA extracted from carp gill tissue was specifically enriched with CyHV-3 sequences through hybridization to a set of nearly 2 million overlapping probes designed to cover the entire genome length, using KHV-J sequence (GenBank accession number AP008984 as reference. Applied to 7 CyHV-3 specimens from Poland and Indonesia, this targeted genomic enrichment enabled recovery of the full genomes with >99.9% reference coverage. The enrichment rate was directly correlated to the estimated number of viral copies contained in the DNA extracts used for library preparation, which varied between ∼5000 and ∼2×107. The average sequencing depth was >200 for all samples, thus allowing the search for variants with high confidence. Sequence analyses highlighted a significant proportion of intra-specimen sequence heterogeneity, suggesting the presence of mixed infections in all investigated fish. They also showed that inter-specimen genetic diversity at the genome scale was very low (>99.95% of sequence identity. By enabling full genome comparisons directly from infected fish tissues, this new method will be valuable to trace outbreaks rapidly and at a reasonable cost, and in turn to understand the transmission routes of CyHV-3.

  3. Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

    Science.gov (United States)

    Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2008-04-30

    The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

  4. Use of four next-generation sequencing platforms to determine HIV-1 coreceptor tropism.

    Science.gov (United States)

    Archer, John; Weber, Jan; Henry, Kenneth; Winner, Dane; Gibson, Richard; Lee, Lawrence; Paxinos, Ellen; Arts, Eric J; Robertson, David L; Mimms, Larry; Quiñones-Mateu, Miguel E

    2012-01-01

    HIV-1 coreceptor tropism assays are required to rule out the presence of CXCR4-tropic (non-R5) viruses prior treatment with CCR5 antagonists. Phenotypic (e.g., Trofile™, Monogram Biosciences) and genotypic (e.g., population sequencing linked to bioinformatic algorithms) assays are the most widely used. Although several next-generation sequencing (NGS) platforms are available, to date all published deep sequencing HIV-1 tropism studies have used the 454™ Life Sciences/Roche platform. In this study, HIV-1 co-receptor usage was predicted for twelve patients scheduled to start a maraviroc-based antiretroviral regimen. The V3 region of the HIV-1 env gene was sequenced using four NGS platforms: 454™, PacBio® RS (Pacific Biosciences), Illumina®, and Ion Torrent™ (Life Technologies). Cross-platform variation was evaluated, including number of reads, read length and error rates. HIV-1 tropism was inferred using Geno2Pheno, Web PSSM, and the 11/24/25 rule and compared with Trofile™ and virologic response to antiretroviral therapy. Error rates related to insertions/deletions (indels) and nucleotide substitutions introduced by the four NGS platforms were low compared to the actual HIV-1 sequence variation. Each platform detected all major virus variants within the HIV-1 population with similar frequencies. Identification of non-R5 viruses was comparable among the four platforms, with minor differences attributable to the algorithms used to infer HIV-1 tropism. All NGS platforms showed similar concordance with virologic response to the maraviroc-based regimen (75% to 80% range depending on the algorithm used), compared to Trofile (80%) and population sequencing (70%). In conclusion, all four NGS platforms were able to detect minority non-R5 variants at comparable levels suggesting that any NGS-based method can be used to predict HIV-1 coreceptor usage.

  5. Use of four next-generation sequencing platforms to determine HIV-1 coreceptor tropism.

    Directory of Open Access Journals (Sweden)

    John Archer

    Full Text Available HIV-1 coreceptor tropism assays are required to rule out the presence of CXCR4-tropic (non-R5 viruses prior treatment with CCR5 antagonists. Phenotypic (e.g., Trofile™, Monogram Biosciences and genotypic (e.g., population sequencing linked to bioinformatic algorithms assays are the most widely used. Although several next-generation sequencing (NGS platforms are available, to date all published deep sequencing HIV-1 tropism studies have used the 454™ Life Sciences/Roche platform. In this study, HIV-1 co-receptor usage was predicted for twelve patients scheduled to start a maraviroc-based antiretroviral regimen. The V3 region of the HIV-1 env gene was sequenced using four NGS platforms: 454™, PacBio® RS (Pacific Biosciences, Illumina®, and Ion Torrent™ (Life Technologies. Cross-platform variation was evaluated, including number of reads, read length and error rates. HIV-1 tropism was inferred using Geno2Pheno, Web PSSM, and the 11/24/25 rule and compared with Trofile™ and virologic response to antiretroviral therapy. Error rates related to insertions/deletions (indels and nucleotide substitutions introduced by the four NGS platforms were low compared to the actual HIV-1 sequence variation. Each platform detected all major virus variants within the HIV-1 population with similar frequencies. Identification of non-R5 viruses was comparable among the four platforms, with minor differences attributable to the algorithms used to infer HIV-1 tropism. All NGS platforms showed similar concordance with virologic response to the maraviroc-based regimen (75% to 80% range depending on the algorithm used, compared to Trofile (80% and population sequencing (70%. In conclusion, all four NGS platforms were able to detect minority non-R5 variants at comparable levels suggesting that any NGS-based method can be used to predict HIV-1 coreceptor usage.

  6. The soybean-Phytophthora resistance locus Rps1-k encompasses coiled coil-nucleotide binding-leucine rich repeat-like genes and repetitive sequences

    Directory of Open Access Journals (Sweden)

    Bhattacharyya Madan K

    2008-03-01

    Full Text Available Abstract Background A series of Rps (resistance to Pytophthora sojae genes have been protecting soybean from the root and stem rot disease caused by the Oomycete pathogen, Phytophthora sojae. Five Rps genes were mapped to the Rps1 locus located near the 28 cM map position on molecular linkage group N of the composite genetic soybean map. Among these five genes, Rps1-k was introgressed from the cultivar, Kingwa. Rps1-k has been providing stable and broad-spectrum Phytophthora resistance in the major soybean-producing regions of the United States. Rps1-k has been mapped and isolated. More than one functional Rps1-k gene was identified from the Rps1-k locus. The clustering feature at the Rps1-k locus might have facilitated the expansion of Rps1-k gene numbers and the generation of new recognition specificities. The Rps1-k region was sequenced to understand the possible evolutionary steps that shaped the generation of Phytophthora resistance genes in soybean. Results Here the analyses of sequences of three overlapping BAC clones containing the 184,111 bp Rps1-k region are reported. A shotgun sequencing strategy was applied in sequencing the BAC contig. Sequence analysis predicted a few full-length genes including two Rps1-k genes, Rps1-k-1 and Rps1-k-2. Previously reported Rps1-k-3 from this genomic region 1 was evolved through intramolecular recombination between Rps1-k-1 and Rps1-k-2 in Escherichia coli. The majority of the predicted genes are truncated and therefore most likely they are nonfunctional. A member of a highly abundant retroelement, SIRE1, was identified from the Rps1-k region. The Rps1-k region is primarily composed of repetitive sequences. Sixteen simple repeat and 63 tandem repeat sequences were identified from the locus. Conclusion These data indicate that the Rps1 locus is located in a gene-poor region. The abundance of repetitive sequences in the Rps1-k region suggested that the location of this locus is in or near a

  7. Using Markov chains of nucleotide sequences as a possible precursor to predict functional roles of human genome: a case study on inactive chromatin regions.

    Science.gov (United States)

    Lee, K-E; Lee, E-J; Park, H-S

    2016-08-30

    Recent advances in computational epigenetics have provided new opportunities to evaluate n-gram probabilistic language models. In this paper, we describe a systematic genome-wide approach for predicting functional roles in inactive chromatin regions by using a sequence-based Markovian chromatin map of the human genome. We demonstrate that Markov chains of sequences can be used as a precursor to predict functional roles in heterochromatin regions and provide an example comparing two publicly available chromatin annotations of large-scale epigenomics projects: ENCODE project consortium and Roadmap Epigenomics consortium.

  8. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    NARCIS (Netherlands)

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.; Elsas, van J.D.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily

  9. Length and nucleotide sequence polymorphism at the trnL and trnF non-coding regions of chloroplast genomes among Saccharum and Erianthus species

    Science.gov (United States)

    The aneupolyploidy genome of sugarcane (Saccharum hybrids spp.) and lack of a classical genetic linkage map make genetics research most difficult for sugarcane. Whole genome sequencing and genetic characterization of sugarcane and related taxa are far behind other crops. In this study, universal PCR...

  10. NUCLEOTIDE SEQUENCING AND TRANSCRIPTIONAL MAPPING OF THE GENES ENCODING BIPHENYL DIOXYGENASE, A MULTICOM- PONENT POLYCHLORINATED-BIPHENYL-DEGRADING ENZYME IN PSEUDOMONAS STRAIN LB400

    Science.gov (United States)

    The DNA region encoding biphenyl dioxygenase, the first enzyme in the biphenyl-polychlorinated biphenyl degradation pathway of Pseudomonas species strain LB400, was sequenced. Six open reading frames were identified, four of which are homologous to the components of toluene dioxy...

  11. Population genetic structure in farm and feral American mink (Neovison vison) inferred from RAD sequencing-generated single nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Thirstrup, Janne Pia; Ruiz-Gonzalez, Aritz; Pujolar, José Martin

    2015-01-01

    Feral American mink populations (Neovison vison), derived from mink farms, are widespread in Europe. In this study we investigated genetic diversity and genetic differentiation between feral and farm mink using a panel of genetic markers (194 SNP) generated from RAD sequencing data. Sampling incl...

  12. Exploring the correlation between the sequence composition of the nucleotide binding G5 loop of the FeoB GTPase domain (NFeoB) and intrinsic rate of GDP release.

    Science.gov (United States)

    Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika

    2014-12-12

    GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.

  13. Determining mutant spectra of three RNA viral samples using ultra-deep sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H

    2012-06-06

    RNA viruses have extremely high mutation rates that enable the virus to adapt to new host environments and even jump from one species to another. As part of a viral transmission study, three viral samples collected from naturally infected animals were sequenced using Illumina paired-end technology at ultra-deep coverage. In order to determine the mutant spectra within the viral quasispecies, it is critical to understand the sequencing error rates and control for false positive calls of viral variants (point mutantations). I will estimate the sequencing error rate from two control sequences and characterize the mutant spectra in the natural samples with this error rate.

  14. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    OpenAIRE

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van, L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily extensible. We present a genome annotation system for prokaryote genomes, which is well tested and readily adaptable to different tasks. The modular system was developed using an object-oriented approac...

  15. Complete nucleotide sequence of Sida golden mosaic Florida virus and phylogenetic relationships with other begomoviruses infecting malvaceous weeds in the Caribbean.

    Science.gov (United States)

    Fiallo-Olivé, Elvira; Martínez-Zubiaur, Yamila; Moriones, Enrique; Navas-Castillo, Jesús

    2010-09-01

    The complete genome sequence of two isolates of the bipartite begomovirus (genus Begomovirus, family Geminiviridae) Sida golden mosaic Florida virus (SiGMFV) is presented. We propose that both isolates, found infecting Malvastrum coromandelianum (family Malvaceae) in Cuba, belong to a new strain of SiGMFV. Phylogenetic analysis showed that SiGMFV DNA-A is located in a monophyletic cluster that includes begomoviruses infecting malvaceous weeds from the Caribbean.

  16. Determination of genetic relatedness from low-coverage human genome sequences using pedigree simulations.

    Science.gov (United States)

    Martin, Michael D; Jay, Flora; Castellano, Sergi; Slatkin, Montgomery

    2017-08-01

    We develop and evaluate methods for inferring relatedness among individuals from low-coverage DNA sequences of their genomes, with particular emphasis on sequences obtained from fossil remains. We suggest the major factors complicating the determination of relatedness among ancient individuals are sequencing depth, the number of overlapping sites, the sequencing error rate and the presence of contamination from present-day genetic sources. We develop a theoretical model that facilitates the exploration of these factors and their relative effects, via measurement of pairwise genetic distances, without calling genotypes, and determine the power to infer relatedness under various scenarios of varying sequencing depth, present-day contamination and sequencing error. The model is validated by a simulation study as well as the analysis of aligned sequences from present-day human genomes. We then apply the method to the recently published genome sequences of ancient Europeans, developing a statistical treatment to determine confidence in assigned relatedness that is, in some cases, more precise than previously reported. As the majority of ancient specimens are from animals, this method would be applicable to investigate kinship in nonhuman remains. The developed software grups (Genetic Relatedness Using Pedigree Simulations) is implemented in Python and freely available. © 2017 John Wiley & Sons Ltd.

  17. Antinociceptive effect of purine nucleotides.

    Science.gov (United States)

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  18. A STUDY ON DETERMINING THE REFERENCE SPREADING SEQUENCES FOR A DS/CDMACOMMUNICATION SYSTEM

    Directory of Open Access Journals (Sweden)

    Cebrail ÇİFTLİKLİ

    2002-02-01

    Full Text Available In a direct sequence/code division multiple access (DS/CDMA system, the role of the spreading sequences (codes is crucial since the multiple access interference (MAI is the main performance limitation. In this study, we propose an accurate criterion which enables the determination of the reference spreading codes which yield lower bit error rates (BER's in a given code set for a DS/CDMA system using despreading sequences weighted by stepping chip waveforms. The numerical results show that the spreading codes determined by the proposed criterion are the most suitable codes for using as references.

  19. Maximum likelihood and Bayesian analyses of a combined nucleotide sequence dataset for genetic characterization of a novel pestivirus, SVA/cont-08.

    Science.gov (United States)

    Liu, Lihong; Xia, Hongyan; Baule, Claudia; Belák, Sándor

    2009-01-01

    Bovine viral diarrhoea virus 1 (BVDV-1) and Bovine viral diarrhoea virus 2 (BVDV-2) are two recognised bovine pestivirus species of the genus Pestivirus. Recently, a pestivirus, termed SVA/cont-08, was detected in a batch of contaminated foetal calf serum originating from South America. Comparative sequence analysis showed that the SVA/cont-08 virus shares 15-28% higher sequence identity to pestivirus D32/00_'HoBi' than to members of BVDV-1 and BVDV-2. In order to reveal the phylogenetic relationship of SVA/cont-08 with other pestiviruses, a molecular dataset of 30 pestiviruses and 1,896 characters, comprising the 5'UTR, N(pro) and E2 gene regions, was analysed by two methods: maximum likelihood and Bayesian approach. An identical, well-supported tree topology was observed, where four pestiviruses (SVA/cont-08, D32/00_'HoBi', CH-KaHo/cont, and Th/04_KhonKaen) formed a monophyletic clade that is closely related to the BVDV-1 and BVDV-2 clades. The strategy applied in this study is useful for classifying novel pestiviruses in the future.

  20. Mapping and validation of the major sex-determining region in Nile tilapia (Oreochromis niloticus L. Using RAD sequencing.

    Directory of Open Access Journals (Sweden)

    Christos Palaiokostas

    Full Text Available Sex in Oreochromis niloticus (Nile tilapia is principally determined by an XX/XY locus but other genetic and environmental factors also influence sex ratio. Restriction Associated DNA (RAD sequencing was used in two families derived from crossing XY males with females from an isogenic clonal line, in order to identify Single Nucleotide Polymorphisms (SNPs and map the sex-determining region(s. We constructed a linkage map with 3,802 SNPs, which corresponded to 3,280 informative markers, and identified a major sex-determining region on linkage group 1, explaining nearly 96% of the phenotypic variance. This sex-determining region was mapped in a 2 cM interval, corresponding to approximately 1.2 Mb in the O. niloticus draft genome. In order to validate this, a diverse family (4 families; 96 individuals in total and population (40 broodstock individuals test panel were genotyped for five of the SNPs showing the highest association with phenotypic sex. From the expanded data set, SNPs Oni23063 and Oni28137 showed the highest association, which persisted both in the case of family and population data. Across the entire dataset all females were found to be homozygous for these two SNPs. Males were heterozygous, with the exception of five individuals in the population and two in the family dataset. These fish possessed the homozygous genotype expected of females. Progeny sex ratios (over 95% females from two of the males with the "female" genotype indicated that they were neomales (XX males. Sex reversal induced by elevated temperature during sexual differentiation also resulted in phenotypic males with the "female" genotype. This study narrows down the region containing the main sex-determining locus, and provides genetic markers tightly linked to this locus, with an association that persisted across the population. These markers will be of use in refining the production of genetically male O. niloticus for aquaculture.

  1. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  2. Isolation and characterization of human glycophorin A cDNAs using a synthetic oligonucleotide approach: nucleotide sequence, mRNA structure and regulation by 12-O-tetradecanoylphorbol 13-acetate (TPA)

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    The authors have previously shown that treatment of human erythroleukemic K562 cells with the tumor-promoting phorbol ester, TPA, results in a diminished expression of glycophorin A at the level of protein biosynthesis and in vitro mRNA translation activity. To further examine the structure, relationships and expression of human glycophorins they have successfully isolated and sequenced several glycophorin A specific cDNA clones derived from K562 cells, by making extensive use of mixed and exact synthetic oligonucleotides as primers and radioactively labeled probes. The nucleotide sequence obtained from the largest glycophorin A cDNA suggests the presence of a hydrophobic leader-like peptide of at least 19 amino acids. Northern gel analysis using both whole cDNA-plasmid and synthetic oligonucleotide probes revealed the existence of multiple mRNAs, three of which they believe to be glycophorin A-specific, whereas a fourth and smaller mRNA appears to be glycophorin B-specific. Furthermore, the abundance of all four glycophorin mRNAs were found to be extensively reduced following treatment of K562 cells with TPA suggesting coordinate regulation, possibly at the level of gene transcription

  3. A two-step recognition of signal sequences determines the translocation efficiency of proteins.

    OpenAIRE

    Belin, D; Bost, S; Vassalli, J D; Strub, K

    1996-01-01

    The cytosolic and secreted, N-glycosylated, forms of plasminogen activator inhibitor-2 (PAI-2) are generated by facultative translocation. To study the molecular events that result in the bi-topological distribution of proteins, we determined in vitro the capacities of several signal sequences to bind the signal recognition particle (SRP) during targeting, and to promote vectorial transport of murine PAI-2 (mPAI-2). Interestingly, the six signal sequences we compared (mPAI-2 and three mutated...

  4. Plastome Sequence Determination and Comparative Analysis for Members of the Lolium-Festuca Grass Species Complex

    OpenAIRE

    Hand, Melanie L.; Spangenberg, German C.; Forster, John W.; Cogan, Noel O. I.

    2013-01-01

    Chloroplast genome sequences are of broad significance in plant biology, due to frequent use in molecular phylogenetics, comparative genomics, population genetics, and genetic modification studies. The present study used a second-generation sequencing approach to determine and assemble the plastid genomes (plastomes) of four representatives from the agriculturally important Lolium-Festuca species complex of pasture grasses (Lolium multiflorum, Festuca pratensis, Festuca altissima, and Festuca...

  5. Nucleotide sequence of pOLA52: a conjugative IncX1 plasmid from Escherichia coli which enables biofilm formation and multidrug efflux

    DEFF Research Database (Denmark)

    Norman, Anders; Hansen, Lars H.; She, Qunxin

    2008-01-01

    . The plasmid was also classified as IncX1 with incompatibility testing. The conjugal transfer and plasmid maintenance regions of pOLA52 therefore seem to represent IncX1 orthologues of the well-characterized IncX2 plasmid R6K. Sequence homology searches in GenBank also suggested a considerably higher...... of type 3 fimbriae (mrkABCDF). The plasmid was found to be 51,602 bp long with 68 putative genes. About half of the plasmid constituted a conserved IncX1-type backbone with predicted regions for conjugation, replication and partitioning, as well as a toxin/antitoxin (TA) plasmid addiction system...... prevalence of IncX1 group plasmids than IncX2. The 21 kb 'genetic load' region of pOLA52 was shown to consist of a mosaic, among other things a fragmented Tn3 transposon encoding ampicillin resistance. Most notably the oqxAB and mrkABCDF cassettes were contained within two composite transposons (Tn6010...

  6. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae) based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments.

    Science.gov (United States)

    Wang, Zhaoshan; Du, Shuhui; Dayanandan, Selvadurai; Wang, Dongsheng; Zeng, Yanfei; Zhang, Jianguo

    2014-01-01

    Populus (Salicaceae) is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1) the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2) three advanced sections (Populus, Aigeiros and Tacamahaca) are of hybrid origin; (3) species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4) many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  7. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments.

    Directory of Open Access Journals (Sweden)

    Zhaoshan Wang

    Full Text Available Populus (Salicaceae is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1 the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2 three advanced sections (Populus, Aigeiros and Tacamahaca are of hybrid origin; (3 species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4 many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  8. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  9. Characterization of the Complete Nucleotide Sequences of IncA/C2 Plasmids Carrying In809-Like Integrons from Enterobacteriaceae Isolates of Wildlife Origin.

    Science.gov (United States)

    Papagiannitsis, Costas C; Kutilova, Iva; Medvecky, Matej; Hrabak, Jaroslav; Dolejska, Monika

    2017-09-01

    A total of 18 Enterobacteriaceae (17 from gulls and 1 from a clinical sample) collected from Australia, carrying IncA/C plasmids with the IMP-encoding In809-like integrons, were studied. Seven plasmids, being representatives of different origins, plasmid sizes, replicon combinations, and resistance genes, were completely sequenced. Plasmid pEc158, identified in a clinical Escherichia coli ST752 isolate, showed extensive similarity to type 2 IncA/C 2 plasmids. pEc158 carried none of the bla CMY-2 -like region or ARI-B and ARI-A regions, while it contained a hybrid transposon structure. The six remaining plasmids, which were of wildlife origin, were highly similar to each other and probably were fusion derivatives of type 1 and type 2 A/C 2 plasmids. The latter plasmids contained an ARI-B region and hybrid transposon structures. In all plasmids, hybrid transposon structures containing In809-like integrons were inserted 3,434 bp downstream of the rhs2 start codon. In all cases, the one outermost 38-bp inverted repeat (IR) of the transposon was associated with the Tn 1696 tnp module, while the other outermost 38-bp IR of the transposon was associated with either a Tn 6317 -like module or a Tn 21 mer module. However, the internal structure of the transposon and the resistance genes were different in each plasmid. These findings indicated that, for the specific periods of time and settings, different IncA/C 2 plasmid types carrying In809-like elements circulated among isolates of wildlife and clinical origins. Additionally, they provided the basis for speculations regarding the reshuffling of IncA/C 2 plasmids with In809-like integrons and confirmed the rapid evolution of IncA/C 2 plasmid lineages. Copyright © 2017 American Society for Microbiology.

  10. Genotyping-by-Sequencing Analysis for Determining Population Structure of Finger Millet Germplasm of Diverse Origins

    Directory of Open Access Journals (Sweden)

    Anil Kumar

    2016-07-01

    Full Text Available Finger millet [ (L. Gaertn.] is grown mainly by subsistence farmers in arid and semiarid regions of the world. To broaden its genetic base and to boost its production, it is of paramount importance to characterize and genotype the diverse gene pool of this important food and nutritional security crop. However, as a result of nonavailability of the genome sequence of finger millet, the progress could not be made in realizing the molecular basis of unique qualities of the crop. In the present investigation, attempts have been made to characterize the genetically diverse collection of 113 finger millet accessions through whole-genome genotyping-by-sequencing (GBS, which resulted in a genome-wide set of 23,000 single-nucleotide polymorphisms (SNPs segregating across the entire collection and several thousand SNPs segregating within every accession. A model-based population structure analysis reveals the presence of three subpopulations among the finger millet accessions, which are in parallel with the results of phylogenetic analysis. The observed population structure is consistent with the hypothesis that finger millet was domesticated first in Africa, and from there it was introduced to India some 3000 yr ago. A total of 1128 gene ontology (GO terms were assigned to SNP-carrying genes for three main categories: biological process, cellular component, and molecular function. Facilitated access to high-throughput genotyping and sequencing technologies are likely to improve the breeding process in developing countries, and as such, this data will be very useful to breeders who are working for the genetic improvement of finger millet.

  11. Genotyping-by-Sequencing Analysis for Determining Population Structure of Finger Millet Germplasm of Diverse Origins.

    Science.gov (United States)

    Kumar, Anil; Sharma, Divya; Tiwari, Apoorv; Jaiswal, J P; Singh, N K; Sood, Salej

    2016-07-01

    Finger millet [ (L.) Gaertn.] is grown mainly by subsistence farmers in arid and semiarid regions of the world. To broaden its genetic base and to boost its production, it is of paramount importance to characterize and genotype the diverse gene pool of this important food and nutritional security crop. However, as a result of nonavailability of the genome sequence of finger millet, the progress could not be made in realizing the molecular basis of unique qualities of the crop. In the present investigation, attempts have been made to characterize the genetically diverse collection of 113 finger millet accessions through whole-genome genotyping-by-sequencing (GBS), which resulted in a genome-wide set of 23,000 single-nucleotide polymorphisms (SNPs) segregating across the entire collection and several thousand SNPs segregating within every accession. A model-based population structure analysis reveals the presence of three subpopulations among the finger millet accessions, which are in parallel with the results of phylogenetic analysis. The observed population structure is consistent with the hypothesis that finger millet was domesticated first in Africa, and from there it was introduced to India some 3000 yr ago. A total of 1128 gene ontology (GO) terms were assigned to SNP-carrying genes for three main categories: biological process, cellular component, and molecular function. Facilitated access to high-throughput genotyping and sequencing technologies are likely to improve the breeding process in developing countries, and as such, this data will be very useful to breeders who are working for the genetic improvement of finger millet. Copyright © 2016 Crop Science Society of America.

  12. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  13. Plastome Sequence Determination and Comparative Analysis for Members of the Lolium-Festuca Grass Species Complex

    Science.gov (United States)

    Hand, Melanie L.; Spangenberg, German C.; Forster, John W.; Cogan, Noel O. I.

    2013-01-01

    Chloroplast genome sequences are of broad significance in plant biology, due to frequent use in molecular phylogenetics, comparative genomics, population genetics, and genetic modification studies. The present study used a second-generation sequencing approach to determine and assemble the plastid genomes (plastomes) of four representatives from the agriculturally important Lolium-Festuca species complex of pasture grasses (Lolium multiflorum, Festuca pratensis, Festuca altissima, and Festuca ovina). Total cellular DNA was extracted from either roots or leaves, was sequenced, and the output was filtered for plastome-related reads. A comparison between sources revealed fewer plastome-related reads from root-derived template but an increase in incidental bacterium-derived sequences. Plastome assembly and annotation indicated high levels of sequence identity and a conserved organization and gene content between species. However, frequent deletions within the F. ovina plastome appeared to contribute to a smaller plastid genome size. Comparative analysis with complete plastome sequences from other members of the Poaceae confirmed conservation of most grass-specific features. Detailed analysis of the rbcL–psaI intergenic region, however, revealed a “hot-spot” of variation characterized by independent deletion events. The evolutionary implications of this observation are discussed. The complete plastome sequences are anticipated to provide the basis for potential organelle-specific genetic modification of pasture grasses. PMID:23550121

  14. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  15. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  16. Serological and genetic characterisation of bovine respiratory syncytial virus (BRSV) indicates that Danish isolates belong to the intermediate subgroup: no evidence of a selective effect on the variability of G protein nucleotide sequence by prior cell culture adaption and passages in cell culture

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.

    1998-01-01

    on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar......Danish isolates of bovine respiratory syncytial virus (BRSV) were characterised by nucleotide sequencing of the G glycoprotein and by their reactivity with a panel of monoclonal antibodies (MAbs). Among the six Danish isolates, the overall sequence divergence ranged between 0 and 3...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...

  17. Rapid molecular diagnostics of severe primary immunodeficiency determined by using targeted next-generation sequencing.

    Science.gov (United States)

    Yu, Hui; Zhang, Victor Wei; Stray-Pedersen, Asbjørg; Hanson, Imelda Celine; Forbes, Lisa R; de la Morena, M Teresa; Chinn, Ivan K; Gorman, Elizabeth; Mendelsohn, Nancy J; Pozos, Tamara; Wiszniewski, Wojciech; Nicholas, Sarah K; Yates, Anne B; Moore, Lindsey E; Berge, Knut Erik; Sorte, Hanne; Bayer, Diana K; ALZahrani, Daifulah; Geha, Raif S; Feng, Yanming; Wang, Guoli; Orange, Jordan S; Lupski, James R; Wang, Jing; Wong, Lee-Jun

    2016-10-01

    Primary immunodeficiency diseases (PIDDs) are inherited disorders of the immune system. The most severe form, severe combined immunodeficiency (SCID), presents with profound deficiencies of T cells, B cells, or both at birth. If not treated promptly, affected patients usually do not live beyond infancy because of infections. Genetic heterogeneity of SCID frequently delays the diagnosis; a specific diagnosis is crucial for life-saving treatment and optimal management. We developed a next-generation sequencing (NGS)-based multigene-targeted panel for SCID and other severe PIDDs requiring rapid therapeutic actions in a clinical laboratory setting. The target gene capture/NGS assay provides an average read depth of approximately 1000×. The deep coverage facilitates simultaneous detection of single nucleotide variants and exonic copy number variants in one comprehensive assessment. Exons with insufficient coverage (diagnostic yield of severe primary immunodeficiency. Establishing a molecular diagnosis enables early immune reconstitution through prompt therapeutic intervention and guides management for improved long-term quality of life. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  18. Determining the origin of synchronous multifocal bladder cancer by exome sequencing

    International Nuclear Information System (INIS)

    Acar, Ömer; Özkurt, Ezgi; Demir, Gulfem; Saraç, Hilal; Alkan, Can; Esen, Tarık; Somel, Mehmet; Lack, Nathan A.

    2015-01-01

    Synchronous multifocal tumours are commonly observed in urothelial carcinomas of the bladder. The origin of these physically independent tumours has been proposed to occur by either intraluminal migration (clonal) or spontaneous transformation of multiple cells by carcinogens (field effect). It is unclear which model is correct, with several studies supporting both hypotheses. A potential cause of this uncertainty may be the small number of genetic mutations previously used to quantify the relationship between these tumours. To better understand the genetic lineage of these tumours we conducted exome sequencing of synchronous multifocal pTa urothelial bladder cancers at a high depth, using multiple samples from three patients. Phylogenetic analysis of high confidence single nucleotide variants (SNV) demonstrated that the sequenced multifocal bladder cancers arose from a clonal origin in all three patients (bootstrap value 100 %). Interestingly, in two patients the most common type of tumour-associated SNVs were cytosine mutations of TpC* dinucleotides (Fisher’s exact test p < 10 −41 ), likely caused by APOBEC-mediated deamination. Incorporating these results into our clonal model, we found that TpC* type mutations occurred 2-5× more often among SNVs on the ancestral branches than in the more recent private branches (p < 10 −4 ) suggesting that TpC* mutations largely occurred early in the development of the tumour. These results demonstrate that synchronous multifocal bladder cancers frequently arise from a clonal origin. Our data also suggests that APOBEC-mediated mutations occur early in the development of the tumour and may be a driver of tumourigenesis in non-muscle invasive urothelial bladder cancer. The online version of this article (doi:10.1186/s12885-015-1859-8) contains supplementary material, which is available to authorized users

  19. A Teaching and Learning Sequence about the Interplay of Chance and Determinism in Nonlinear Systems

    Science.gov (United States)

    Stavrou, D.; Duit, R.; Komorek, M.

    2008-01-01

    A teaching and learning sequence aimed at introducing upper secondary school students to the interplay between chance and determinism in nonlinear systems is presented. Three experiments concerning nonlinear systems (deterministic chaos, self-organization and fractals) and one experiment concerning linear systems are introduced. Thirty upper…

  20. Targeted Next-generation Sequencing and Bioinformatics Pipeline to Evaluate Genetic Determinants of Constitutional Disease.

    Science.gov (United States)

    Dilliott, Allison A; Farhan, Sali M K; Ghani, Mahdi; Sato, Christine; Liang, Eric; Zhang, Ming; McIntyre, Adam D; Cao, Henian; Racacho, Lemuel; Robinson, John F; Strong, Michael J; Masellis, Mario; Bulman, Dennis E; Rogaeva, Ekaterina; Lang, Anthony; Tartaglia, Carmela; Finger, Elizabeth; Zinman, Lorne; Turnbull, John; Freedman, Morris; Swartz, Rick; Black, Sandra E; Hegele, Robert A

    2018-04-04

    Next-generation sequencing (NGS) is quickly revolutionizing how research into the genetic determinants of constitutional disease is performed. The technique is highly efficient with millions of sequencing reads being produced in a short time span and at relatively low cost. Specifically, targeted NGS is able to focus investigations to genomic regions of particular interest based on the disease of study. Not only does this further reduce costs and increase the speed of the process, but it lessens the computational burden that often accompanies NGS. Although targeted NGS is restricted to certain regions of the genome, preventing identification of potential novel loci of interest, it can be an excellent technique when faced with a phenotypically and genetically heterogeneous disease, for which there are previously known genetic associations. Because of the complex nature of the sequencing technique, it is important to closely adhere to protocols and methodologies in order to achieve sequencing reads of high coverage and quality. Further, once sequencing reads are obtained, a sophisticated bioinformatics workflow is utilized to accurately map reads to a reference genome, to call variants, and to ensure the variants pass quality metrics. Variants must also be annotated and curated based on their clinical significance, which can be standardized by applying the American College of Medical Genetics and Genomics Pathogenicity Guidelines. The methods presented herein will display the steps involved in generating and analyzing NGS data from a targeted sequencing panel, using the ONDRISeq neurodegenerative disease panel as a model, to identify variants that may be of clinical significance.

  1. [Phylogenetic relationships of the species of Oxytropis DC. subg. Oxytropis and Phacoxytropis (Fabaceae) from Asian Russia inferred from the nucleotide sequence analysis of the intergenic spacers of the chloroplast genome].

    Science.gov (United States)

    Kholina, A B; Kozyrenko, M M; Artyukova, E V; Sandanov, D V; Andrianova, E A

    2016-08-01

    The nucleotide sequence analysis of trnH–psbA, trnL–trnF, and trnS–trnG intergenic spacer regions of chloroplast DNA performed in the representatives of the genus Oxytropis from Asian Russia provided clarification of the phylogenetic relationships of some species and sections in the subgenera Oxytropis and Phacoxytropis and in the genus Oxytropis as a whole. Only the section Mesogaea corresponds to the subgenus Phacoxytropis, while the section Janthina of the same subgenus groups together with the sections of the subgenus Oxytropis. The sections Chrysantha and Ortholoma of the subgenus Oxytropis are not only closely related to each other, but together with the section Mesogaea, they are grouped into the subgenus Phacoxytropis. It seems likely that the sections Chrysantha and Ortholoma should be assigned to the subgenus Phacoxytropis, and the section Janthina should be assigned to the subgenus Oxytropis. The molecular differences were identified between O. coerulea and O. mandshurica from the section Janthina that were indicative of considerable divergence of their chloroplast genomes and the species independence of the taxa. The species independence of O. czukotica belonging to the section Arctobia was also confirmed.

  2. Generic Amplicon Deep Sequencing to Determine Ilarvirus Species Diversity in Australian Prunus.

    Science.gov (United States)

    Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan

    2017-01-01

    The distribution of Ilarvirus species populations amongst 61 Australian Prunus trees was determined by next generation sequencing (NGS) of amplicons generated using a genus-based generic RT-PCR targeting a conserved region of the Ilarvirus RNA2 component that encodes the RNA dependent RNA polymerase (RdRp) gene. Presence of Ilarvirus sequences in each positive sample was further validated by Sanger sequencing of cloned amplicons of regions of each of RNA1, RNA2 and/or RNA3 that were generated by species specific PCRs and by metagenomic NGS. Prunus necrotic ringspot virus (PNRSV) was the most frequently detected Ilarvirus , occurring in 48 of the 61 Ilarvirus -positive trees and Prune dwarf virus (PDV) and Apple mosaic virus (ApMV) were detected in three trees and one tree, respectively. American plum line pattern virus (APLPV) was detected in three trees and represents the first report of APLPV detection in Australia. Two novel and distinct groups of Ilarvirus -like RNA2 amplicon sequences were also identified in several trees by the generic amplicon NGS approach. The high read depth from the amplicon NGS of the generic PCR products allowed the detection of distinct RNA2 RdRp sequence variant populations of PNRSV, PDV, ApMV, APLPV and the two novel Ilarvirus -like sequences. Mixed infections of ilarviruses were also detected in seven Prunus trees. Sanger sequencing of specific RNA1, RNA2, and/or RNA3 genome segments of each virus and total nucleic acid metagenomics NGS confirmed the presence of PNRSV, PDV, ApMV and APLPV detected by RNA2 generic amplicon NGS. However, the two novel groups of Ilarvirus -like RNA2 amplicon sequences detected by the generic amplicon NGS could not be associated to the presence of sequence from RNA1 or RNA3 genome segments or full Ilarvirus genomes, and their origin is unclear. This work highlights the sensitivity of genus-specific amplicon NGS in detection of virus sequences and their distinct populations in multiple samples, and the

  3. Generic Amplicon Deep Sequencing to Determine Ilarvirus Species Diversity in Australian Prunus

    Directory of Open Access Journals (Sweden)

    Wycliff M. Kinoti

    2017-06-01

    Full Text Available The distribution of Ilarvirus species populations amongst 61 Australian Prunus trees was determined by next generation sequencing (NGS of amplicons generated using a genus-based generic RT-PCR targeting a conserved region of the Ilarvirus RNA2 component that encodes the RNA dependent RNA polymerase (RdRp gene. Presence of Ilarvirus sequences in each positive sample was further validated by Sanger sequencing of cloned amplicons of regions of each of RNA1, RNA2 and/or RNA3 that were generated by species specific PCRs and by metagenomic NGS. Prunus necrotic ringspot virus (PNRSV was the most frequently detected Ilarvirus, occurring in 48 of the 61 Ilarvirus-positive trees and Prune dwarf virus (PDV and Apple mosaic virus (ApMV were detected in three trees and one tree, respectively. American plum line pattern virus (APLPV was detected in three trees and represents the first report of APLPV detection in Australia. Two novel and distinct groups of Ilarvirus-like RNA2 amplicon sequences were also identified in several trees by the generic amplicon NGS approach. The high read depth from the amplicon NGS of the generic PCR products allowed the detection of distinct RNA2 RdRp sequence variant populations of PNRSV, PDV, ApMV, APLPV and the two novel Ilarvirus-like sequences. Mixed infections of ilarviruses were also detected in seven Prunus trees. Sanger sequencing of specific RNA1, RNA2, and/or RNA3 genome segments of each virus and total nucleic acid metagenomics NGS confirmed the presence of PNRSV, PDV, ApMV and APLPV detected by RNA2 generic amplicon NGS. However, the two novel groups of Ilarvirus-like RNA2 amplicon sequences detected by the generic amplicon NGS could not be associated to the presence of sequence from RNA1 or RNA3 genome segments or full Ilarvirus genomes, and their origin is unclear. This work highlights the sensitivity of genus-specific amplicon NGS in detection of virus sequences and their distinct populations in multiple samples

  4. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    ABSTRACT: Educational programmes all over the world are facing increasing ... providing biological insights, and proficiency to access and use the vast repository of computational and web- based resources which are the most available information in the world today. ... opening up new frontiers in the past two decades.

  5. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... polymorphisms (SNPs): Emerging molecular marker tools for ... knowledge in plant biology, breeding and biotechnology. The emergence of many ...... phenotypes: past successes for Mendelian disease, future approaches for ...

  6. A two-step recognition of signal sequences determines the translocation efficiency of proteins.

    Science.gov (United States)

    Belin, D; Bost, S; Vassalli, J D; Strub, K

    1996-02-01

    The cytosolic and secreted, N-glycosylated, forms of plasminogen activator inhibitor-2 (PAI-2) are generated by facultative translocation. To study the molecular events that result in the bi-topological distribution of proteins, we determined in vitro the capacities of several signal sequences to bind the signal recognition particle (SRP) during targeting, and to promote vectorial transport of murine PAI-2 (mPAI-2). Interestingly, the six signal sequences we compared (mPAI-2 and three mutated derivatives thereof, ovalbumin and preprolactin) were found to have the differential activities in the two events. For example, the mPAI-2 signal sequence first binds SRP with moderate efficiency and secondly promotes the vectorial transport of only a fraction of the SRP-bound nascent chains. Our results provide evidence that the translocation efficiency of proteins can be controlled by the recognition of their signal sequences at two steps: during SRP-mediated targeting and during formation of a committed translocation complex. This second recognition may occur at several time points during the insertion/translocation step. In conclusion, signal sequences have a more complex structure than previously anticipated, allowing for multiple and independent interactions with the translocation machinery.

  7. RNA sequence determinants of a coupled termination-reinitiation strategy for downstream open reading frame translation in Helminthosporium victoriae virus 190S and other victoriviruses (Family Totiviridae).

    Science.gov (United States)

    Li, Hua; Havens, Wendy M; Nibert, Max L; Ghabrial, Said A

    2011-07-01

    The genome-length, dicistronic mRNA of the double-stranded RNA fungal virus Helminthosporium victoriae virus 190S (genus Victorivirus, family Totiviridae) contains two long open reading frames (ORFs) that overlap in the tetranucleotide AUGA. Translation of the downstream ORF, which encodes the RNA-dependent RNA polymerase (RdRp), has been proposed to depend on ribosomal reinitiation following termination of the upstream ORF, which encodes the capsid protein. In the current study, we examined the RNA sequence determinants for RdRp translation in this virus and demonstrated that a coupled termination-reinitiation (stop-restart) strategy is indeed used. Signals for termination-reinitiation are found within a 32-nucleotide stretch of RNA immediately upstream of the AUGA motif, including a predicted pseudoknot structure. The close proximity in which this predicted structure is followed by the upstream ORF's stop codon appears to be especially important for promoting translation of the downstream ORF. The normal strong preferences for an AUG start codon and the canonical sequence context to favor translation initiation appear somewhat relaxed for the downstream ORF. Similar sequence motifs and predicted RNA structures in other victoriviruses suggest that they all share a related stop-restart strategy for RdRp translation. Members of the genus Victorivirus thus provide new and unique opportunities for exploring the molecular mechanisms of translational coupling, which remain only partly understood in this and other systems.

  8. Apophysomyces variabilis: draft genome sequence and comparison of predictive virulence determinants with other medically important Mucorales.

    Science.gov (United States)

    Prakash, Hariprasath; Rudramurthy, Shivaprakash Mandya; Gandham, Prasad S; Ghosh, Anup Kumar; Kumar, Milner M; Badapanda, Chandan; Chakrabarti, Arunaloke

    2017-09-18

    Apophysomyces species are prevalent in tropical countries and A. variabilis is the second most frequent agent causing mucormycosis in India. Among Apophysomyces species, A. elegans, A. trapeziformis and A. variabilis are commonly incriminated in human infections. The genome sequences of A. elegans and A. trapeziformis are available in public database, but not A. variabilis. We, therefore, performed the whole genome sequence of A. variabilis to explore its genomic structure and possible genes determining the virulence of the organism. The whole genome of A. variabilis NCCPF 102052 was sequenced and the genomic structure of A. variabilis was compared with already available genome structures of A. elegans, A. trapeziformis and other medically important Mucorales. The total size of genome assembly of A. variabilis was 39.38 Mb with 12,764 protein-coding genes. The transposable elements (TEs) were low in Apophysomyces genome and the retrotransposon Ty3-gypsy was the common TE. Phylogenetically, Apophysomyces species were grouped closely with Phycomyces blakesleeanus. OrthoMCL analysis revealed 3025 orthologues proteins, which were common in those three pathogenic Apophysomyces species. Expansion of multiple gene families/duplication was observed in Apophysomyces genomes. Approximately 6% of Apophysomyces genes were predicted to be associated with virulence on PHIbase analysis. The virulence determinants included the protein families of CotH proteins (invasins), proteases, iron utilisation pathways, siderophores and signal transduction pathways. Serine proteases were the major group of proteases found in all Apophysomyces genomes. The carbohydrate active enzymes (CAZymes) constitute the majority of the secretory proteins. The present study is the maiden attempt to sequence and analyze the genomic structure of A. variabilis. Together with available genome sequence of A. elegans and A. trapeziformis, the study helped to indicate the possible virulence determinants of

  9. Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

    Science.gov (United States)

    Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

    2013-06-01

    Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

  10. Two-step processing for activation of the cytolysin/hemolysin of Vibrio cholerae O1 biotype El Tor: nucleotide sequence of the structural gene (hlyA) and characterization of the processed products.

    Science.gov (United States)

    Yamamoto, K; Ichinose, Y; Shinagawa, H; Makino, K; Nakata, A; Iwanaga, M; Honda, T; Miwatani, T

    1990-12-01

    Vibrio cholerae O1 biotype El Tor produces and secretes a 65-kDa cytolysin/hemolysin into the culture medium. We cloned the structural gene (hlyA) for the cytolysin from the total DNA of a V. cholerae O1 El Tor strain, N86. Nucleotide sequence analysis of hlyA revealed an open reading frame consisting of 2,223 bp which can code for a protein of 741 amino acids with a molecular weight of 81,961. Consistent with this, a 79-kDa protein was identified as the product of hlyA by maxicell analysis in Escherichia coli. N-terminal amino acids of this 79-kDa HlyA protein and those of a 65-kDa El Tor cytolysin purified from V. cholerae were Asn-26 and Asn-158, respectively. The 82- and 79-kDa precursors of the 65-kDa mature cytolysin were found in V. cholerae by pulse-chase labeling and Western blot (immunoblot) analysis of hlyA products. Hemolytic activity of the 79-kDa HlyA protein from E. coli was less than 5% that for the 65-kDa cytolysin from V. cholerae. Our results suggest that in V. cholerae, the 82-kDa preprotoxin synthesized in the cytoplasm is secreted through the membranes into the culture medium as the 79-kDa inactive protoxin after cleavage of the signal peptide and is then further processed into the 65-kDa active cytolysin by release of the N-terminal 15-kDa fragment.

  11. A teaching and learning sequence about the interplay of chance and determinism in nonlinear systems

    International Nuclear Information System (INIS)

    Stavrou, D; Duit, R; Komorek, M

    2008-01-01

    A teaching and learning sequence aimed at introducing upper secondary school students to the interplay between chance and determinism in nonlinear systems is presented. Three experiments concerning nonlinear systems (deterministic chaos, self-organization and fractals) and one experiment concerning linear systems are introduced. Thirty upper secondary students' capabilities and difficulties in understanding the scientific point of view were investigated, using a teaching experiment design. The results show that most students were capable of sound explanations concerning the interplay of chance and determinism in nonlinear systems

  12. The complementarity-determining region sequences in IgY antivenom hypervariable regions

    Directory of Open Access Journals (Sweden)

    David Gitirana da Rocha

    2017-08-01

    Full Text Available The data presented in this article are related to the research article entitled "Development of IgY antibodies against anti-snake toxins endowed with highly lethal neutralizing activity" (da Rocha et al., 2017 [1]. Complementarity-determining region (CDR sequences are variable antibody (Ab sequences that respond with specificity, duration and strength to identify and bind to antigen (Ag epitopes. B lymphocytes isolated from hens immunized with Bitis arietans (Ba and anti-Crotalus durissus terrificus (Cdt venoms and expressing high specificity, affinity and toxicity neutralizing antibody titers were used as DNA sources. The VLF1, CDR1, CDR2, VLR1 and CDR3 sequences were validated by BLASTp, and values corresponding to IgY VL and VH anti-Ba or anti-Cdt venoms were identified, registered [Gallus gallus IgY Fv Light chain (GU815099/Gallus gallus IgY Fv Heavy chain (GU815098] and used for molecular modeling of IgY scFv anti-Ba. The resulting CDR1, CDR2 and CDR3 sequences were combined to construct the three - dimensional structure of the Ab paratope.

  13. The genomic sequence of cowpea aphid-borne mosaic virus and its similarities with other potyviruses

    NARCIS (Netherlands)

    Mlotshwa, S.; Verver, J.; Sithole-Niang, I.; Kampen, van T.; Kammen, van A.; Wellink, J.

    2002-01-01

    The genomic sequence of a Zimbabwe isolate of Cowpea aphid-borne mosaic virus (CABMV-Z) was determined by sequencing overlapping viral cDNA clones generated by RT-PCR using degenerate and/or specific primers. The sequence is 9465 nucleotides in length excluding the 3' terminal poly (A) tail and

  14. Neighborhood of 16S rRNA nucleotides U788/U789 in the 30S ribosomal subunit determined by site-directed crosslinking.

    OpenAIRE

    Mundus, D; Wollenzien, P

    1998-01-01

    Site-specific photo crosslinking has been used to investigate the RNA neighborhood of 16S rRNA positions U788/ U789 in Escherichia coli 30S subunits. For these studies, site-specific psoralen (SSP) which contains a sulfhydryl group on a 17 A side chain was first added to nucleotides U788/U789 using a complementary guide DNA by annealing and phototransfer. Modified RNA was purified from the DNA and unmodified RNA. For some experiments, the SSP, which normally crosslinks at an 8 A distance, was...

  15. Determining the cause of recurrent Clostridium difficile infection using whole genome sequencing.

    Science.gov (United States)

    Sim, James Heng Chiak; Truong, Cynthia; Minot, Samuel S; Greenfield, Nick; Budvytiene, Indre; Lohith, Akshar; Anikst, Victoria; Pourmand, Nader; Banaei, Niaz

    2017-01-01

    Understanding the contribution of relapse and reinfection to recurrent Clostridium difficile infection (CDI) has implications for therapy and infection prevention, respectively. We used whole genome sequencing to determine the relation of C. difficile strains isolated from patients with recurrent CDI at an academic medical center in the United States. Thirty-five toxigenic C. difficile isolates from 16 patients with 19 recurrent CDI episodes with median time of 53.5days (range, 13-362) between episodes were whole genome sequenced on the Illumina MiSeq platform. In 84% (16) of recurrences, the cause of recurrence was relapse with prior strain of C. difficile. In 16% (3) of recurrent episodes, reinfection with a new strain of C. difficile was the cause. In conclusion, the majority of CDI recurrences at our institution were due to infection with the same strain rather than infection with a new strain. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  17. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  18. TOMROP: a sequence for determining the longitudinal relaxation time T1 in NMR

    International Nuclear Information System (INIS)

    Graumann, R.; Barfuss, H.; Fischer, H.; Hentschel, D.; Oppelt, A.

    1987-01-01

    We developed the pulse sequence TOMROP (T One by Multiple Read Out Pulses) for determining precisely the spatial distribution of the longitudinal relaxation time T 1 in nuclear magnetic resonance (NMR): a series of small-angle selection pulses is used to read out longitudinal magnetization from its initial state till thermal equilibrium. Hence, one measurement will produce several images with different T 1 weightings whose pixel brilliance depends exponentially from read-out time. T 1 can be determined from these independent of initial magnetization and selection pulse angle. The measuring time corresponds to the time needed in multi-echo imaging for the determination of the transversal relaxation time T 2 . We demonstrate this new method using head images of volunteers produced with a 0.23 T test facility. (orig./HP) [de

  19. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  20. Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays

    DEFF Research Database (Denmark)

    Dobrowolska, G; Boldyreff, B; Issinger, O G

    1991-01-01

    The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...... subunit and 71% identity to the alpha' subunit of human casein kinase 2....

  1. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  2. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  3. Benchmark Evaluation of True Single Molecular Sequencing to Determine Cystic Fibrosis Airway Microbiome Diversity

    Directory of Open Access Journals (Sweden)

    Andrea Hahn

    2018-05-01

    Full Text Available Cystic fibrosis (CF is an autosomal recessive disease associated with recurrent lung infections that can lead to morbidity and mortality. The impact of antibiotics for treatment of acute pulmonary exacerbations on the CF airway microbiome remains unclear with prior studies giving conflicting results and being limited by their use of 16S ribosomal RNA sequencing. Our primary objective was to validate the use of true single molecular sequencing (tSMS and PathoScope in the analysis of the CF airway microbiome. Three control samples were created with differing amounts of Burkholderia cepacia, Pseudomonas aeruginosa, and Prevotella melaninogenica, three common bacteria found in cystic fibrosis lungs. Paired sputa were also obtained from three study participants with CF before and >6 days after initiation of antibiotics. Antibiotic resistant B. cepacia and P. aeruginosa were identified in concurrently obtained respiratory cultures. Direct sequencing was performed using tSMS, and filtered reads were aligned to reference genomes from NCBI using PathoScope and Kraken and unique clade-specific marker genes using MetaPhlAn. A total of 180–518 K of 6–12 million filtered reads were aligned for each sample. Detection of known pathogens in control samples was most successful using PathoScope. In the CF sputa, alpha diversity measures varied based on the alignment method used, but similar trends were found between pre- and post-antibiotic samples. PathoScope outperformed Kraken and MetaPhlAn in our validation study of artificial bacterial community controls and also has advantages over Kraken and MetaPhlAn of being able to determine bacterial strains and the presence of fungal organisms. PathoScope can be confidently used when evaluating metagenomic data to determine CF airway microbiome diversity.

  4. Capsid coding sequences of foot-and-mouth disease viruses are determinants of pathogenicity in pigs

    DEFF Research Database (Denmark)

    Lohse, Louise; Jackson, Terry; Bøtner, Anette

    2012-01-01

    The surface exposed capsid proteins, VP1, VP2 and VP3, of foot-and-mouth disease virus (FMDV) determine its antigenicity and the ability of the virus to interact with host-cell receptors. Hence, modification of these structural proteins may alter the properties of the virus. In the present study we...... compared the pathogenicity of different FMDVs in young pigs. In total 32 pigs, 7-weeks-old, were exposed to virus, either by direct inoculation or through contact with inoculated pigs, using cell culture adapted (O1K B64), chimeric (O1K/A-TUR and O1K/O-UKG) or field strain (O-UKG/34/2001) viruses. The O1K...... coding sequences are determinants of FMDV pathogenicity in pigs....

  5. Cycle-time determination and process control of sequencing batch membrane bioreactors.

    Science.gov (United States)

    Krampe, J

    2013-01-01

    In this paper a method to determine the cycle time for sequencing batch membrane bioreactors (SBMBRs) is introduced. One of the advantages of SBMBRs is the simplicity of adapting them to varying wastewater composition. The benefit of this flexibility can only be fully utilised if the cycle times are optimised for the specific inlet load conditions. This requires either proactive and ongoing operator adjustment or active predictive instrument-based control. Determination of the cycle times for conventional sequencing batch reactor (SBR) plants is usually based on experience. Due to the higher mixed liquor suspended solids concentrations in SBMBRs and the limited experience with their application, a new approach to calculate the cycle time had to be developed. Based on results from a semi-technical pilot plant, the paper presents an approach for calculating the cycle time in relation to the influent concentration according to the Activated Sludge Model No. 1 and the German HSG (Hochschulgruppe) Approach. The approach presented in this paper considers the increased solid contents in the reactor and the resultant shortened reaction times. This allows for an exact calculation of the nitrification and denitrification cycles with a tolerance of only a few minutes. Ultimately the same approach can be used for a predictive control strategy and for conventional SBR plants.

  6. The use of next-generation sequencing for the determination of rare blood group genotypes

    DEFF Research Database (Denmark)

    Jakobsen, M. A.; Dellgren, C.; Sheppard, C.

    2018-01-01

    (SNPs) or single nucleotide variants (SNVs), are limited to detecting only a limited number of known antigens or alleles. NGS methods do not have this limitation. Methods: NGS using Ion torrent Personal Genome Machine (PGM) was performed with a customised Ampliseq panel targeting 15 different blood...

  7. Combining sequence-based prediction methods and circular dichroism and infrared spectroscopic data to improve protein secondary structure determinations

    Directory of Open Access Journals (Sweden)

    Lees Jonathan G

    2008-01-01

    Full Text Available Abstract Background A number of sequence-based methods exist for protein secondary structure prediction. Protein secondary structures can also be determined experimentally from circular dichroism, and infrared spectroscopic data using empirical analysis methods. It has been proposed that comparable accuracy can be obtained from sequence-based predictions as from these biophysical measurements. Here we have examined the secondary structure determination accuracies of sequence prediction methods with the empirically determined values from the spectroscopic data on datasets of proteins for which both crystal structures and spectroscopic data are available. Results In this study we show that the sequence prediction methods have accuracies nearly comparable to those of spectroscopic methods. However, we also demonstrate that combining the spectroscopic and sequences techniques produces significant overall improvements in secondary structure determinations. In addition, combining the extra information content available from synchrotron radiation circular dichroism data with sequence methods also shows improvements. Conclusion Combining sequence prediction with experimentally determined spectroscopic methods for protein secondary structure content significantly enhances the accuracy of the overall results obtained.

  8. Determination of the complete nucleotide sequence of a lupine potyvirus isolate from the Czech Republic reveals that it belongs to a new member of the genus Potyvirus

    Czech Academy of Sciences Publication Activity Database

    Sarkisova, Tatiana; Petrzik, Karel

    2011-01-01

    Roč. 156, č. 1 (2011), s. 167-169 ISSN 0304-8608 R&D Projects: GA MZe QH71145 Institutional research plan: CEZ:AV0Z50510513 Keywords : plants * virus * motif Subject RIV: EE - Microbiology, Virology Impact factor: 2.111, year: 2011

  9. Time sequence determination of parent–daughter radionuclides using gamma-spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Burnett, J. L.; Britton, R. E.; Abrecht, D. G.; Davies, A. V.

    2017-05-06

    The acquisition of time-stamped list (TLIST) data provides additional information useful to gamma-spectrometry analysis. A novel technique is described that uses non-linear least-squares fitting and the Levenberg-Marquardt algorithm to simultaneously determine parent-daughter atoms from time sequence measurements of only the daughter radionuclide. This has been demonstrated for the radioactive decay of short-lived radon progeny (214Pb/214Bi, 212Pb/212Bi) described using the Bateman first-order differential equation. The calculated atoms are in excellent agreement with measured atoms, with a difference of 1.3 – 4.8% for parent atoms and 2.4% - 10.4% for daughter atoms. Measurements are also reported with reduced uncertainty. The technique has potential to redefine gamma-spectrometry analysis.

  10. Effects of IL1B single nucleotide polymorphisms on depressive and anxiety symptoms are determined by severity and type of life stress.

    Science.gov (United States)

    Kovacs, David; Eszlari, Nora; Petschner, Peter; Pap, Dorottya; Vas, Szilvia; Kovacs, Peter; Gonda, Xenia; Juhasz, Gabriella; Bagdy, Gyorgy

    2016-08-01

    Interleukin-1β is one of the main mediators in the cross-talk between the immune system and the central nervous system. Higher interleukin-1β levels are found in mood spectrum disorders, and the stress-induced expression rate of the interleukin-1β gene (IL1B) is altered by polymorphisms in the region. Therefore we examined the effects of rs16944 and rs1143643 single nucleotide polymorphisms (SNPs) within the IL1B gene on depressive and anxiety symptoms, as measured by the Brief Symptom Inventory, in a Hungarian population sample of 1053 persons. Distal and proximal environmental stress factors were also included in our analysis, namely childhood adversity and recent negative life-events. We found that rs16944 minor (A) allele specifically interacted with childhood adversity increasing depressive and anxiety symptoms, while rs1143643's minor (A) allele showed protective effect against depressive symptoms after recent life stress. The genetic main effects of the two SNPs were not significant in the main analysis, but the interaction effects remained significant after correction for multiple testing. In addition, the effect of rs16944 A allele was reversed in a subsample with low-exposure to life stress, suggesting a protective effect against depressive symptoms, in the post hoc analysis. In summary, both of the two IL1B SNPs showed specific environmental stressor-dependent effects on mood disorder symptoms. We also demonstrated that the presence of exposure to childhood adversity changed the direction of the rs16944 effect on depression phenotype. Therefore our results suggest that it is advisable to include environmental factors in genetic association studies when examining the effect of the IL1B gene. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  11. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

    2016-01-01

    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  12. Genome sequence determination and metagenomic characterization of a Dehalococcoides mixed culture grown on cis-1,2-dichloroethene.

    Science.gov (United States)

    Yohda, Masafumi; Yagi, Osami; Takechi, Ayane; Kitajima, Mizuki; Matsuda, Hisashi; Miyamura, Naoaki; Aizawa, Tomoko; Nakajima, Mutsuyasu; Sunairi, Michio; Daiba, Akito; Miyajima, Takashi; Teruya, Morimi; Teruya, Kuniko; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Juan, Ayaka; Nakano, Kazuma; Aoyama, Misako; Terabayashi, Yasunobu; Satou, Kazuhito; Hirano, Takashi

    2015-07-01

    A Dehalococcoides-containing bacterial consortium that performed dechlorination of 0.20 mM cis-1,2-dichloroethene to ethene in 14 days was obtained from the sediment mud of the lotus field. To obtain detailed information of the consortium, the metagenome was analyzed using the short-read next-generation sequencer SOLiD 3. Matching the obtained sequence tags with the reference genome sequences indicated that the Dehalococcoides sp. in the consortium was highly homologous to Dehalococcoides mccartyi CBDB1 and BAV1. Sequence comparison with the reference sequence constructed from 16S rRNA gene sequences in a public database showed the presence of Sedimentibacter, Sulfurospirillum, Clostridium, Desulfovibrio, Parabacteroides, Alistipes, Eubacterium, Peptostreptococcus and Proteocatella in addition to Dehalococcoides sp. After further enrichment, the members of the consortium were narrowed down to almost three species. Finally, the full-length circular genome sequence of the Dehalococcoides sp. in the consortium, D. mccartyi IBARAKI, was determined by analyzing the metagenome with the single-molecule DNA sequencer PacBio RS. The accuracy of the sequence was confirmed by matching it to the tag sequences obtained by SOLiD 3. The genome is 1,451,062 nt and the number of CDS is 1566, which includes 3 rRNA genes and 47 tRNA genes. There exist twenty-eight RDase genes that are accompanied by the genes for anchor proteins. The genome exhibits significant sequence identity with other Dehalococcoides spp. throughout the genome, but there exists significant difference in the distribution RDase genes. The combination of a short-read next-generation DNA sequencer and a long-read single-molecule DNA sequencer gives detailed information of a bacterial consortium. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  13. OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

    Science.gov (United States)

    Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

    2016-02-01

    Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

  14. Creation and structure determination of an artificial protein with three complete sequence repeats

    Energy Technology Data Exchange (ETDEWEB)

    Adachi, Motoyasu, E-mail: adachi.motoyasu@jaea.go.jp; Shimizu, Rumi; Kuroki, Ryota [Japan Atomic Energy Agency, Shirakatashirane 2-4, Nakagun Tokaimura, Ibaraki 319-1195 (Japan); Blaber, Michael [Japan Atomic Energy Agency, Shirakatashirane 2-4, Nakagun Tokaimura, Ibaraki 319-1195 (Japan); Florida State University, Tallahassee, FL 32306-4300 (United States)

    2013-11-01

    An artificial protein with three complete sequence repeats was created and the structure was determined by X-ray crystallography. The structure showed threefold symmetry even though there is an amino- and carboxy-terminal. The artificial protein with threefold symmetry may be useful as a scaffold to capture small materials with C3 symmetry. Symfoil-4P is a de novo protein exhibiting the threefold symmetrical β-trefoil fold designed based on the human acidic fibroblast growth factor. First three asparagine–glycine sequences of Symfoil-4P are replaced with glutamine–glycine (Symfoil-QG) or serine–glycine (Symfoil-SG) sequences protecting from deamidation, and His-Symfoil-II was prepared by introducing a protease digestion site into Symfoil-QG so that Symfoil-II has three complete repeats after removal of the N-terminal histidine tag. The Symfoil-QG and SG and His-Symfoil-II proteins were expressed in Eschericha coli as soluble protein, and purified by nickel affinity chromatography. Symfoil-II was further purified by anion-exchange chromatography after removing the HisTag by proteolysis. Both Symfoil-QG and Symfoil-II were crystallized in 0.1 M Tris-HCl buffer (pH 7.0) containing 1.8 M ammonium sulfate as precipitant at 293 K; several crystal forms were observed for Symfoil-QG and II. The maximum diffraction of Symfoil-QG and II crystals were 1.5 and 1.1 Å resolution, respectively. The Symfoil-II without histidine tag diffracted better than Symfoil-QG with N-terminal histidine tag. Although the crystal packing of Symfoil-II is slightly different from Symfoil-QG and other crystals of Symfoil derivatives having the N-terminal histidine tag, the refined crystal structure of Symfoil-II showed pseudo-threefold symmetry as expected from other Symfoils. Since the removal of the unstructured N-terminal histidine tag did not affect the threefold structure of Symfoil, the improvement of diffraction quality of Symfoil-II may be caused by molecular characteristics of

  15. The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

    Science.gov (United States)

    Khoe, Clairine V; Chung, Long H; Murray, Vincent

    2018-06-01

    The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  16. The Implementation of "The n-term" Formula to Improve Student Ability in Determining the Rules of a Numeric Sequence

    Science.gov (United States)

    In'am, Akhsanul; Hajar, Siti

    2013-01-01

    A good-quality teacher may determines a good-quality learning, thus good-quality students will be the results. In order to have a good-quality learning, a lot of strategies and methods can be adopted. The objective of this research is to improve students' ability in determining the rules of a numeric sequence and analysing the effectiveness of the…

  17. The determination of high-resolution spatio-temporal glacier motion fields from time-lapse sequences

    Science.gov (United States)

    Schwalbe, Ellen; Maas, Hans-Gerd

    2017-12-01

    This paper presents a comprehensive method for the determination of glacier surface motion vector fields at high spatial and temporal resolution. These vector fields can be derived from monocular terrestrial camera image sequences and are a valuable data source for glaciological analysis of the motion behaviour of glaciers. The measurement concepts for the acquisition of image sequences are presented, and an automated monoscopic image sequence processing chain is developed. Motion vector fields can be derived with high precision by applying automatic subpixel-accuracy image matching techniques on grey value patterns in the image sequences. Well-established matching techniques have been adapted to the special characteristics of the glacier data in order to achieve high reliability in automatic image sequence processing, including the handling of moving shadows as well as motion effects induced by small instabilities in the camera set-up. Suitable geo-referencing techniques were developed to transform image measurements into a reference coordinate system.The result of monoscopic image sequence analysis is a dense raster of glacier surface point trajectories for each image sequence. Each translation vector component in these trajectories can be determined with an accuracy of a few centimetres for points at a distance of several kilometres from the camera. Extensive practical validation experiments have shown that motion vector and trajectory fields derived from monocular image sequences can be used for the determination of high-resolution velocity fields of glaciers, including the analysis of tidal effects on glacier movement, the investigation of a glacier's motion behaviour during calving events, the determination of the position and migration of the grounding line and the detection of subglacial channels during glacier lake outburst floods.

  18. Cloning, sequencing and expression of a xylanase gene from the maize pathogen Helminthosporium turcicum

    DEFF Research Database (Denmark)

    Degefu, Y.; Paulin, L.; Lübeck, Peter Stephensen

    2001-01-01

    A gene encoding an endoxylanase from the phytopathogenic fungus Helminthosporium turcicum Pass. was cloned and sequenced. The entire nucleotide sequence of a 1991 bp genomic fragment containing an endoxylanase gene was determined. The xylanase gene of 795 bp, interrupted by two introns of 52 and ...

  19. Capsid coding sequences of foot-and-mouth disease viruses are determinants of pathogenicity in pigs.

    Science.gov (United States)

    Lohse, Louise; Jackson, Terry; Bøtner, Anette; Belsham, Graham J

    2012-05-24

    The surface exposed capsid proteins, VP1, VP2 and VP3, of foot-and-mouth disease virus (FMDV) determine its antigenicity and the ability of the virus to interact with host-cell receptors. Hence, modification of these structural proteins may alter the properties of the virus.In the present study we compared the pathogenicity of different FMDVs in young pigs. In total 32 pigs, 7-weeks-old, were exposed to virus, either by direct inoculation or through contact with inoculated pigs, using cell culture adapted (O1K B64), chimeric (O1K/A-TUR and O1K/O-UKG) or field strain (O-UKG/34/2001) viruses. The O1K B64 virus and the two chimeric viruses are identical to each other except for the capsid coding region.Animals exposed to O1K B64 did not exhibit signs of disease, while pigs exposed to each of the other viruses showed typical clinical signs of foot-and-mouth disease (FMD). All pigs infected with the O1K/O-UKG chimera or the field strain (O-UKG/34/2001) developed fulminant disease. Furthermore, 3 of 4 in-contact pigs exposed to the O1K/O-UKG virus died in the acute phase of infection, likely from myocardial infection. However, in the group exposed to the O1K/A-TUR chimeric virus, only 1 pig showed symptoms of disease within the time frame of the experiment (10 days). All pigs that developed clinical disease showed a high level of viral RNA in serum and infected pigs that survived the acute phase of infection developed a serotype specific antibody response. It is concluded that the capsid coding sequences are determinants of FMDV pathogenicity in pigs.

  20. Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

    Science.gov (United States)

    Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

    2017-07-01

    The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

  1. UET: a database of evolutionarily-predicted functional determinants of protein sequences that cluster as functional sites in protein structures.

    Science.gov (United States)

    Lua, Rhonald C; Wilson, Stephen J; Konecki, Daniel M; Wilkins, Angela D; Venner, Eric; Morgan, Daniel H; Lichtarge, Olivier

    2016-01-04

    The structure and function of proteins underlie most aspects of biology and their mutational perturbations often cause disease. To identify the molecular determinants of function as well as targets for drugs, it is central to characterize the important residues and how they cluster to form functional sites. The Evolutionary Trace (ET) achieves this by ranking the functional and structural importance of the protein sequence positions. ET uses evolutionary distances to estimate functional distances and correlates genotype variations with those in the fitness phenotype. Thus, ET ranks are worse for sequence positions that vary among evolutionarily closer homologs but better for positions that vary mostly among distant homologs. This approach identifies functional determinants, predicts function, guides the mutational redesign of functional and allosteric specificity, and interprets the action of coding sequence variations in proteins, people and populations. Now, the UET database offers pre-computed ET analyses for the protein structure databank, and on-the-fly analysis of any protein sequence. A web interface retrieves ET rankings of sequence positions and maps results to a structure to identify functionally important regions. This UET database integrates several ways of viewing the results on the protein sequence or structure and can be found at http://mammoth.bcm.tmc.edu/uet/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  3. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  4. The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome

    NARCIS (Netherlands)

    Chen, X.; IJkel, W.F.J.; Tarchini, R.; Sun, X.; Sandbrink, H.; Wang, H.; Peters, S.; Zuidema, D.; Klein Lankhorst, R.; Vlak, J.M.; Hu, Z.

    2001-01-01

    The nucleotide sequence of the Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HaSNPV) DNA genome was determined and analysed. The circular genome encompasses 131 403 bp, has a G C content of 39.1 molnd contains five homologous regions with a unique pattern of repeats.

  5. Complete genome sequence of pronghorn virus, a pestivirus

    Science.gov (United States)

    The complete genome sequence of Pronghorn virus, a member of the Pestivirus genus of the Flaviviridae, was determined. The virus, originally isolated from a pronghorn antelope, had a genome of 12,287 nucleotides with a single open reading frame of 11,694 bases encoding 3898 amino acids....

  6. Direct, rapid RNA sequence analysis

    International Nuclear Information System (INIS)

    Peattie, D.A.

    1987-01-01

    The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

  7. Rapid determination of anti-tuberculosis drug resistance from whole-genome sequences

    KAUST Repository

    Coll, Francesc; McNerney, Ruth; Preston, Mark D; Guerra-Assunç ã o, José Afonso; Warry, Andrew; Hill-Cawthorne, Grant A.; Mallard, Kim; Nair, Mridul; Miranda, Anabela; Alves, Adriana; Perdigã o, Joã o; Viveiros, Miguel; Portugal, Isabel; Hasan, Zahra; Hasan, Rumina; Glynn, Judith R; Martin, Nigel; Pain, Arnab; Clark, Taane G

    2015-01-01

    Mycobacterium tuberculosis drug resistance (DR) challenges effective tuberculosis disease control. Current molecular tests examine limited numbers of mutations, and although whole genome sequencing approaches could fully characterise DR, data

  8. Nucleotide sequence, organization and expression of rdgA and rdgB genes that regulate pectin lyase production in the plant pathogenic bacterium Erwinia carotovora subsp. carotovora in response to DNA-damaging agents.

    Science.gov (United States)

    Liu, Y; Chatterjee, A; Chatterjee, A K

    1994-12-01

    In most soft-rotting Erwinia spp., including E. carotovora subsp. carotovora strain 71 (Ecc71), production of the plant cell wall degrading enzyme pectin lyase (Pnl) is activated by DNA-damaging agents such as mitomycin C (MC). Induction of Pnl production in Ecc71 requires a functional recA gene and the rdg locus. DNA sequencing and RNA analyses revealed that the rdg locus contains two regulatory genes, rdgA and rdgB, in separate transcriptional units. There is high homology between RdgA and repressors of lambdoid phages, specially phi 80. RdgB, however, has significant homology with transcriptional activators of Mu phage. Both RdgA and RdgB are also predicted to possess helix-turn-helix motifs. By replacing the rdgB promoter with the IPTG-inducible tac promoter, we have determined that rdgB by itself can activate Pnl production in Escherichia coli. However, deletion analysis of rdg+ DNA indicated that, when driven by their native promoters, functions of both rdgA and rdgB are required for the induction of pnlA expression by MC treatment. While rdgB transcription occurs only after MC treatment, a substantial level of rdgA mRNA is detected in the absence of MC treatment. Moreover, upon induction with MC, a new rdgA mRNA species, initiated from a different start site, is produced at a high level. Thus, the two closely linked rdgA and rdgB genes, required for the regulation of Pnl production, are expressed differently in Ecc71.

  9. The Purine Bias of Coding Sequences is Determined by Physicochemical Constraints on Proteins.

    Science.gov (United States)

    Ponce de Leon, Miguel; de Miranda, Antonio Basilio; Alvarez-Valin, Fernando; Carels, Nicolas

    2014-01-01

    For this report, we analyzed protein secondary structures in relation to the statistics of three nucleotide codon positions. The purpose of this investigation was to find which properties of the ribosome, tRNA or protein level, could explain the purine bias (Rrr) as it is observed in coding DNA. We found that the Rrr pattern is the consequence of a regularity (the codon structure) resulting from physicochemical constraints on proteins and thermodynamic constraints on ribosomal machinery. The physicochemical constraints on proteins mainly come from the hydropathy and molecular weight (MW) of secondary structures as well as the energy cost of amino acid synthesis. These constraints appear through a network of statistical correlations, such as (i) the cost of amino acid synthesis, which is in favor of a higher level of guanine in the first codon position, (ii) the constructive contribution of hydropathy alternation in proteins, (iii) the spatial organization of secondary structure in proteins according to solvent accessibility, (iv) the spatial organization of secondary structure according to amino acid hydropathy, (v) the statistical correlation of MW with protein secondary structures and their overall hydropathy, (vi) the statistical correlation of thymine in the second codon position with hydropathy and the energy cost of amino acid synthesis, and (vii) the statistical correlation of adenine in the second codon position with amino acid complexity and the MW of secondary protein structures. Amino acid physicochemical properties and functional constraints on proteins constitute a code that is translated into a purine bias within the coding DNA via tRNAs. In that sense, the Rrr pattern within coding DNA is the effect of information transfer on nucleotide composition from protein to DNA by selection according to the codon positions. Thus, coding DNA structure and ribosomal machinery co-evolved to minimize the energy cost of protein coding given the functional

  10. Draft Genome Sequence of Neisseria gonorrhoeae Strain NG_869 with Penicillin, Tetracycline and Ciprofloxacin Resistance Determinants Isolated from Malaysia

    OpenAIRE

    Ang, Geik Yong; Yu, Choo Yee; Yong, Delicia Ann; Cheong, Yuet Meng; Yin, Wai-Fong; Chan, Kok-Gan

    2016-01-01

    Gonorrhea is a sexually transmitted infection caused by Neisseria gonorrhoeae and the increasing reports of multidrug-resistant gonococcal isolates are a global public health care concern. Herein, we report the genome sequence of N. gonorrhoeae strain NG_869 isolated from Malaysia which may provide insights into the drug resistance determinants in gonococcal bacteria.

  11. Proceedings of the relevance of mass spectrometry to DNA sequence determination: Research needs for the Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    Edmonds, C.G.; Smith, R.D. (Pacific Northwest Lab., Richland, WA (USA)); Smith, L.M. (Wisconsin Univ., Madison, WI (USA))

    1990-11-01

    A workshop was sponsored for the US Department of Energy (DOE), Office of Health and Environmental Research by Pacific Northwest Laboratory, April 4--5, 1990, in Seattle, Washington, to examine the potential role of mass spectrometry in the joint DOE/National Institutes of Health (NIH) Human Genome Program. The workshop was occasioned by recent developments in mass spectrometry that are providing new levels for selectivity, sensitivity, and, in particular, new methods of ionization appropriate for large biopolymers such as DNA. During discussions, three general mass spectrometric approaches to the determination of DNA sequence were considered: (1) the mass spectrometric detection of isotopic labels from DNA sequencing mixtures separated using gel electrophoresis, (2) the direct mass spectrometric analysis from direct ionization of unfractionated sequencing mixtures where the measured mass of the constituents functions to identify and order the base sequence (replacing separation by gel electrophoresis), and (3) an approach in which a single highly charged molecular ion of a large DNA segment produced is rapidly sequenced in an ion cyclotron resonance ion trap. The consensus of the workshop was that, on the basis of the new developments, mass spectrometry has the potential to provide the substantial increases in sequencing speed required for the Human Genome Program. 66 refs., 3 tabs.

  12. The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

    Science.gov (United States)

    Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

    2016-07-01

    The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

  13. Default cycle phases determined after modifying discrete DNA sequences in plant cells

    International Nuclear Information System (INIS)

    Sans, J.; Leyton, C.

    1997-01-01

    After bromosubstituting DNA sequences replicated in the first, second, or third part of the S phase, in Allium cepa L. meristematic cells, radiation at 313 nm wavelength under anoxia allowed ascription of different sequences to both the positive and negative regulation of some cycle phase transitions. The present report shows that the radiation forced cells in late G 1 phase to advance into S, while those in G 2 remained in G 2 and cells in prophase returned to G 2 when both sets of sequences involved in the positive and negative controls were bromosubstituted and later irradiated. In this way, not only G 2 but also the S phase behaved as cycle phases where cells accumulated by default when signals of different sign functionally cancelled out. The treatment did not halt the rates of replication or transcription of plant bromosubstituted DNA. The irradiation under hypoxia apparently prevents the binding of regulatory proteins to Br-DNA. (author)

  14. Rapid determination of anti-tuberculosis drug resistance from whole-genome sequences

    KAUST Repository

    Coll, Francesc

    2015-05-27

    Mycobacterium tuberculosis drug resistance (DR) challenges effective tuberculosis disease control. Current molecular tests examine limited numbers of mutations, and although whole genome sequencing approaches could fully characterise DR, data complexity has restricted their clinical application. A library (1,325 mutations) predictive of DR for 15 anti-tuberculosis drugs was compiled and validated for 11 of them using genomic-phenotypic data from 792 strains. A rapid online ‘TB-Profiler’ tool was developed to report DR and strain-type profiles directly from raw sequences. Using our DR mutation library, in silico diagnostic accuracy was superior to some commercial diagnostics and alternative databases. The library will facilitate sequence-based drug-susceptibility testing.

  15. Nucleotide sequence of soybean chloroplast DNA regions which contain the psb A and trn H genes and cover the ends of the large single copy region and one end of the inverted repeats.

    Science.gov (United States)

    Spielmann, A; Stutz, E

    1983-10-25

    The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.

  16. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  17. Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

    Science.gov (United States)

    Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

    2017-01-25

    The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

  18. MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing

    DEFF Research Database (Denmark)

    Nielsen, M; Hansen, J H; Hedegaard, J

    2010-01-01

    levels of 212 annotated miRNA genes, thereby providing a thorough account of the miRNA transcriptome in porcine muscle tissue. The expression levels displayed a very large range, as reflected by the number of sequence reads, which varied from single counts for rare miRNAs to several million reads...

  19. Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

    Science.gov (United States)

    Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

    2014-01-01

    The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

  20. Determination of Elizabethkingia Diversity by MALDI-TOF Mass Spectrometry and Whole-Genome Sequencing

    DEFF Research Database (Denmark)

    Eriksen, Helle Brander; Gumpert, Heidi; Faurholt, Cecilie Haase

    2017-01-01

    In a hospital-acquired infection with multidrug-resistant Elizabethkingia, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and 16S rRNA gene analysis identified the pathogen as Elizabethkingia miricola. Whole-genome sequencing, genus-level core genome analysis, and in...

  1. 16S ribosomal RNA sequence analysis for determination of phylogenetic relationship among methylotrophs.

    Science.gov (United States)

    Tsuji, K; Tsien, H C; Hanson, R S; DePalma, S R; Scholtz, R; LaRoche, S

    1990-01-01

    16S ribosomal RNAs (rRNA) of 12 methylotrophic bacteria have been almost completely sequenced to establish their phylogenetic relationships. Methylotrophs that are physiologically related are phylogenetically diverse and are scattered among the purple eubacteria (class Proteobacteria). Group I methylotrophs can be classified in the beta- and the gamma-subdivisions and group II methylotrophs in the alpha-subdivision of the purple eubacteria, respectively. Pink-pigmented facultative and non-pigmented obligate group II methylotrophs form two distinctly separate branches within the alpha-subdivision. The secondary structures of the 16S rRNA sequences of 'Methylocystis parvus' strain OBBP, 'Methylosinus trichosporium' strain OB3b, 'Methylosporovibrio methanica' strain 81Z and Hyphomicrobium sp. strain DM2 are similar, and these non-pigmented obligate group II methylotrophs form one tight cluster in the alpha-subdivision. The pink-pigmented facultative methylotrophs, Methylobacterium extorquens strain AM1, Methylobacterium sp. strain DM4 and Methylobacterium organophilum strain XX form another cluster within the alpha-subdivision. Although similar in phenotypic characteristics, Methylobacterium organophilum strain XX and Methylobacterium extorquens strain AM1 are clearly distinguishable by their 16S rRNA sequences. The group I methylotrophs, Methylophilus methylotrophus strain AS1 and methylotrophic species DM11, which do not utilize methane, are similar in 16S rRNA sequence to bacteria in the beta-subdivision. The methane-utilizing, obligate group I methanotrophs, Methylococcus capsulatus strain BATH and Methylomonas methanica, are placed in the gamma-subdivision. The results demonstrate that it is possible to distinguish and classify the methylotrophic bacteria using 16S rRNA sequence analysis.

  2. Phylogeny of the genus Haemophilus as determined by comparison of partial infB sequences

    DEFF Research Database (Denmark)

    Hedegaard, J; Okkels, H; Bruun, B

    2001-01-01

    A 453 bp fragment of infB, the gene encoding translation initiation factor 2, was sequenced and compared from 66 clinical isolates and type strains of Haemophilus species and related bacteria. Analysis of the partial infB sequences obtained suggested that the human isolates dependent on X and V...... factor, H. influenzae, H. haemolyticus, H. aegyptius and some cryptic genospecies of H. influenzae, were closely related to each other. H. parainfluenzae constituted a heterogeneous group within the boundaries of the genus, whereas H. aphrophilus/paraphrophilus and Actinobacillus actinomycetemcomitans...... were only remotely related to the type species of the genus Haemophilus H. parahaemolyticus and H. paraphrohaemolyticus took up an intermediary position and may not belong in the genus Haemophilus sensu stricto. Ambiguous results were obtained with seven isolates tentatively identified as H. segnis...

  3. Use of Four Next-Generation Sequencing Platforms to Determine HIV-1 Coreceptor Tropism

    Czech Academy of Sciences Publication Activity Database

    Archer, J.; Weber, Jan; Henry, K.; Winner, D.; Gibson, R.; Lee, L.; Paxinos, E.; Arts, E. J.; Robertson, D. L.; Mimms, L.; Quinones-Mateu, M. E.

    2012-01-01

    Roč. 7, č. 11 (2012), e49602/1-e49602/17 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) LK11207 Institutional research plan: CEZ:AV0Z40550506 Keywords : HIV-1 tropism * V3 region * deep sequencing Subject RIV: EE - Microbiology, Virology Impact factor: 3.730, year: 2012 http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0049602

  4. Optimization of sequence alignment for simple sequence repeat regions

    Directory of Open Access Journals (Sweden)

    Ogbonnaya Francis C

    2011-07-01

    Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic

  5. WebScipio: An online tool for the determination of gene structures using protein sequences

    Directory of Open Access Journals (Sweden)

    Waack Stephan

    2008-09-01

    Full Text Available Abstract Background Obtaining the gene structure for a given protein encoding gene is an important step in many analyses. A software suited for this task should be readily accessible, accurate, easy to handle and should provide the user with a coherent representation of the most probable gene structure. It should be rigorous enough to optimise features on the level of single bases and at the same time flexible enough to allow for cross-species searches. Results WebScipio, a web interface to the Scipio software, allows a user to obtain the corresponding coding sequence structure of a here given a query protein sequence that belongs to an already assembled eukaryotic genome. The resulting gene structure is presented in various human readable formats like a schematic representation, and a detailed alignment of the query and the target sequence highlighting any discrepancies. WebScipio can also be used to identify and characterise the gene structures of homologs in related organisms. In addition, it offers a web service for integration with other programs. Conclusion WebScipio is a tool that allows users to get a high-quality gene structure prediction from a protein query. It offers more than 250 eukaryotic genomes that can be searched and produces predictions that are close to what can be achieved by manual annotation, for in-species and cross-species searches alike. WebScipio is freely accessible at http://www.webscipio.org.

  6. Large-scale determination of sequence, structure, and function relationships in cytosolic glutathione transferases across the biosphere.

    Science.gov (United States)

    Mashiyama, Susan T; Malabanan, M Merced; Akiva, Eyal; Bhosle, Rahul; Branch, Megan C; Hillerich, Brandan; Jagessar, Kevin; Kim, Jungwook; Patskovsky, Yury; Seidel, Ronald D; Stead, Mark; Toro, Rafael; Vetting, Matthew W; Almo, Steven C; Armstrong, Richard N; Babbitt, Patricia C

    2014-04-01

    The cytosolic glutathione transferase (cytGST) superfamily comprises more than 13,000 nonredundant sequences found throughout the biosphere. Their key roles in metabolism and defense against oxidative damage have led to thousands of studies over several decades. Despite this attention, little is known about the physiological reactions they catalyze and most of the substrates used to assay cytGSTs are synthetic compounds. A deeper understanding of relationships across the superfamily could provide new clues about their functions. To establish a foundation for expanded classification of cytGSTs, we generated similarity-based subgroupings for the entire superfamily. Using the resulting sequence similarity networks, we chose targets that broadly covered unknown functions and report here experimental results confirming GST-like activity for 82 of them, along with 37 new 3D structures determined for 27 targets. These new data, along with experimentally known GST reactions and structures reported in the literature, were painted onto the networks to generate a global view of their sequence-structure-function relationships. The results show how proteins of both known and unknown function relate to each other across the entire superfamily and reveal that the great majority of cytGSTs have not been experimentally characterized or annotated by canonical class. A mapping of taxonomic classes across the superfamily indicates that many taxa are represented in each subgroup and highlights challenges for classification of superfamily sequences into functionally relevant classes. Experimental determination of disulfide bond reductase activity in many diverse subgroups illustrate a theme common for many reaction types. Finally, sequence comparison between an enzyme that catalyzes a reductive dechlorination reaction relevant to bioremediation efforts with some of its closest homologs reveals differences among them likely to be associated with evolution of this unusual reaction

  7. Large-scale determination of sequence, structure, and function relationships in cytosolic glutathione transferases across the biosphere.

    Directory of Open Access Journals (Sweden)

    Susan T Mashiyama

    2014-04-01

    Full Text Available The cytosolic glutathione transferase (cytGST superfamily comprises more than 13,000 nonredundant sequences found throughout the biosphere. Their key roles in metabolism and defense against oxidative damage have led to thousands of studies over several decades. Despite this attention, little is known about the physiological reactions they catalyze and most of the substrates used to assay cytGSTs are synthetic compounds. A deeper understanding of relationships across the superfamily could provide new clues about their functions. To establish a foundation for expanded classification of cytGSTs, we generated similarity-based subgroupings for the entire superfamily. Using the resulting sequence similarity networks, we chose targets that broadly covered unknown functions and report here experimental results confirming GST-like activity for 82 of them, along with 37 new 3D structures determined for 27 targets. These new data, along with experimentally known GST reactions and structures reported in the literature, were painted onto the networks to generate a global view of their sequence-structure-function relationships. The results show how proteins of both known and unknown function relate to each other across the entire superfamily and reveal that the great majority of cytGSTs have not been experimentally characterized or annotated by canonical class. A mapping of taxonomic classes across the superfamily indicates that many taxa are represented in each subgroup and highlights challenges for classification of superfamily sequences into functionally relevant classes. Experimental determination of disulfide bond reductase activity in many diverse subgroups illustrate a theme common for many reaction types. Finally, sequence comparison between an enzyme that catalyzes a reductive dechlorination reaction relevant to bioremediation efforts with some of its closest homologs reveals differences among them likely to be associated with evolution of this

  8. Determining Clostridium difficile intra-taxa diversity by mining multilocus sequence typing databases.

    Science.gov (United States)

    Muñoz, Marina; Ríos-Chaparro, Dora Inés; Patarroyo, Manuel Alfonso; Ramírez, Juan David

    2017-03-14

    Multilocus sequence typing (MLST) is a highly discriminatory typing strategy; it is reproducible and scalable. There is a MLST scheme for Clostridium difficile (CD), a gram positive bacillus causing different pathologies of the gastrointestinal tract. This work was aimed at describing the frequency of sequence types (STs) and Clades (C) reported and evalute the intra-taxa diversity in the CD MLST database (CD-MLST-db) using an MLSA approach. Analysis of 1778 available isolates showed that clade 1 (C1) was the most frequent worldwide (57.7%), followed by C2 (29.1%). Regarding sequence types (STs), it was found that ST-1, belonging to C2, was the most frequent. The isolates analysed came from 17 countries, mostly from the United Kingdom (UK) (1541 STs, 87.0%). The diversity of the seven housekeeping genes in the MLST scheme was evaluated, and alleles from the profiles (STs), for identifying CD population structure. It was found that adk and atpA are conserved genes allowing a limited amount of clusters to be discriminated; however, different genes such as drx, glyA and particularly sodA showed high diversity indexes and grouped CD populations in many clusters, suggesting that these genes' contribution to CD typing should be revised. It was identified that CD STs reported to date have a mostly clonal population structure with foreseen events of recombination; however, one group of STs was not assigned to a clade being highly different containing at least nine well-supported clusters, suggesting a greater amount of clades for CD. This study shows the usefulness of CD-MLST-db as a tool for studying CD distribution and population structure, identifying the need for reviewing the usefulness of sodA as housekeeping gene within the MLST scheme and suggesting the existence of a greater amount of CD clades. The study also shows the plausible exchange of genetic material between STs, contributing towards intra-taxa genetic diversity.

  9. Cardiorespiratory Kinetics Determined by Pseudo-Random Binary Sequences - Comparisons between Walking and Cycling.

    Science.gov (United States)

    Koschate, J; Drescher, U; Thieschäfer, L; Heine, O; Baum, K; Hoffmann, U

    2016-12-01

    This study aims to compare cardiorespiratory kinetics as a response to a standardised work rate protocol with pseudo-random binary sequences between cycling and walking in young healthy subjects. Muscular and pulmonary oxygen uptake (V̇O 2 ) kinetics as well as heart rate kinetics were expected to be similar for walking and cycling. Cardiac data and V̇O 2 of 23 healthy young subjects were measured in response to pseudo-random binary sequences. Kinetics were assessed applying time series analysis. Higher maxima of cross-correlation functions between work rate and the respective parameter indicate faster kinetics responses. Muscular V̇O 2 kinetics were estimated from heart rate and pulmonary V̇O 2 using a circulatory model. Muscular (walking vs. cycling [mean±SD in arbitrary units]: 0.40±0.08 vs. 0.41±0.08) and pulmonary V̇O 2 kinetics (0.35±0.06 vs. 0.35±0.06) were not different, although the time courses of the cross-correlation functions of pulmonary V̇O 2 showed unexpected biphasic responses. Heart rate kinetics (0.50±0.14 vs. 0.40±0.14; P=0.017) was faster for walking. Regarding the biphasic cross-correlation functions of pulmonary V̇O 2 during walking, the assessment of muscular V̇O 2 kinetics via pseudo-random binary sequences requires a circulatory model to account for cardio-dynamic distortions. Faster heart rate kinetics for walking should be considered by comparing results from cycle and treadmill ergometry. © Georg Thieme Verlag KG Stuttgart · New York.

  10. Systematic main sequence photometry of globular cluster stars for age determination

    International Nuclear Information System (INIS)

    Alcaino, G.; Liller, W.

    1984-01-01

    The individual photometric study of the coeval stars in globular clusters presents one of the best observational tests of the stellar evolution theory. Our own globular cluster system provides fundamental clues to the dynamical and chemical evolutionary history of the galaxy, and the study of their ages give a lower limit to the age of the galaxy as well as to that of the universe. The authors have undertaken a systematic research program, and discuss the ages deduced by fitting main sequence photometry to theoretical isochrones of six galactic globular clusters: M4, M22, M30, NGC 288, NGC 3201 and NGC 6397. (Auth.)

  11. [Clonage of the "malA" region of "Escherichia coli" K12: nucleotide sequence of the regulatory region and the promoters, identification and purification of the MalT-activator protein (author's transl)].

    Science.gov (United States)

    Raibaud, O; Débarbouillé, M; Cossart, P

    1982-01-01

    A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.

  12. Genetic polymorphisms of Echinococcus tapeworms in China as determined by mitochondrial and nuclear DNA sequences

    Science.gov (United States)

    Nakao, Minoru; Li, Tiaoying; Han, Xiumin; Ma, Xiumin; Xiao, Ning; Qiu, Jiamin; Wang, Hu; Yanagida, Tetsuya; Mamuti, Wulamu; Wen, Hao; Moro, Pedro L.; Giraudoux, Patrick; Craig, Philip S.; Ito, Akira

    2009-01-01

    The genetic polymorphisms of Echinococcus spp. in the eastern Tibetan Plateau and the Xinjiang Uyghur Autonomous Region were evaluated by DNA sequencing analyses of genes for mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear elongation factor-1 alpha (ef1a). We collected 68 isolates of Echinococcus granulosus sensu stricto (s.s.) from Xinjiang and 113 isolates of E. granulosus s. s., 49 isolates of Echinococcus multilocularis and 34 isolates of Echinococcus shiquicus from the Tibetan Plateau. The results of molecular identification by mitochondrial and nuclear markers were identical, suggesting the infrequency of introgressive hybridization. A considerable intraspecific variation was detected in mitochondrial cox1 sequences. The parsimonious network of cox1 haplotypes showed star-like features in E. granulosus s. s. and E. multilocularis, but a divergent feature in E. shiquicus. The cox1 neutrality indexes computed by Tajima's D and Fu's Fs tests showed high negative values in E. granulosus s. s. and E. multilocularis, indicating significant deviations from neutrality. In contrast, the low positive values of both tests were obtained in E. shiquicus. These results suggest the following hypotheses: (i) recent founder effects arose in E. granulosus and E. multilocularis after introducing particular individuals into the endemic areas by anthropogenic movement or natural migration of host mammals, and (ii) the ancestor of E. shiquicus was segregated into the Tibetan Plateau by colonizing alpine mammals and its mitochondrial locus has evolved without bottleneck effects. PMID:19800346

  13. Mechanisms of Linezolid Resistance among Coagulase-Negative Staphylococci Determined by Whole-Genome Sequencing

    Science.gov (United States)

    Tewhey, Ryan; Gu, Bing; Kelesidis, Theodoros; Charlton, Carmen; Bobenchik, April; Hindler, Janet; Schork, Nicholas J.

    2014-01-01

    ABSTRACT Linezolid resistance is uncommon among staphylococci, but approximately 2% of clinical isolates of coagulase-negative staphylococci (CoNS) may exhibit resistance to linezolid (MIC, ≥8 µg/ml). We performed whole-genome sequencing (WGS) to characterize the resistance mechanisms and genetic backgrounds of 28 linezolid-resistant CoNS (21 Staphylococcus epidermidis isolates and 7 Staphylococcus haemolyticus isolates) obtained from blood cultures at a large teaching health system in California between 2007 and 2012. The following well-characterized mutations associated with linezolid resistance were identified in the 23S rRNA: G2576U, G2447U, and U2504A, along with the mutation C2534U. Mutations in the L3 and L4 riboproteins, at sites previously associated with linezolid resistance, were also identified in 20 isolates. The majority of isolates harbored more than one mutation in the 23S rRNA and L3 and L4 genes. In addition, the cfr methylase gene was found in almost half (48%) of S. epidermidis isolates. cfr had been only rarely identified in staphylococci in the United States prior to this study. Isolates of the same sequence type were identified with unique mutations associated with linezolid resistance, suggesting independent acquisition of linezolid resistance in each isolate. PMID:24915435

  14. A machine learning model to determine the accuracy of variant calls in capture-based next generation sequencing.

    Science.gov (United States)

    van den Akker, Jeroen; Mishne, Gilad; Zimmer, Anjali D; Zhou, Alicia Y

    2018-04-17

    Next generation sequencing (NGS) has become a common technology for clinical genetic tests. The quality of NGS calls varies widely and is influenced by features like reference sequence characteristics, read depth, and mapping accuracy. With recent advances in NGS technology and software tools, the majority of variants called using NGS alone are in fact accurate and reliable. However, a small subset of difficult-to-call variants that still do require orthogonal confirmation exist. For this reason, many clinical laboratories confirm NGS results using orthogonal technologies such as Sanger sequencing. Here, we report the development of a deterministic machine-learning-based model to differentiate between these two types of variant calls: those that do not require confirmation using an orthogonal technology (high confidence), and those that require additional quality testing (low confidence). This approach allows reliable NGS-based calling in a clinical setting by identifying the few important variant calls that require orthogonal confirmation. We developed and tested the model using a set of 7179 variants identified by a targeted NGS panel and re-tested by Sanger sequencing. The model incorporated several signals of sequence characteristics and call quality to determine if a variant was identified at high or low confidence. The model was tuned to eliminate false positives, defined as variants that were called by NGS but not confirmed by Sanger sequencing. The model achieved very high accuracy: 99.4% (95% confidence interval: +/- 0.03%). It categorized 92.2% (6622/7179) of the variants as high confidence, and 100% of these were confirmed to be present by Sanger sequencing. Among the variants that were categorized as low confidence, defined as NGS calls of low quality that are likely to be artifacts, 92.1% (513/557) were found to be not present by Sanger sequencing. This work shows that NGS data contains sufficient characteristics for a machine-learning-based model to

  15. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  16. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  17. Killer Immunoglobulin-Like Receptor Allele Determination Using Next-Generation Sequencing Technology

    Directory of Open Access Journals (Sweden)

    Bercelin Maniangou

    2017-05-01

    Full Text Available The impact of natural killer (NK cell alloreactivity on hematopoietic stem cell transplantation (HSCT outcome is still debated due to the complexity of graft parameters, HLA class I environment, the nature of killer cell immunoglobulin-like receptor (KIR/KIR ligand genetic combinations studied, and KIR+ NK cell repertoire size. KIR genes are known to be polymorphic in terms of gene content, copy number variation, and number of alleles. These allelic polymorphisms may impact both the phenotype and function of KIR+ NK cells. We, therefore, speculate that polymorphisms may alter donor KIR+ NK cell phenotype/function thus modulating post-HSCT KIR+ NK cell alloreactivity. To investigate KIR allele polymorphisms of all KIR genes, we developed a next-generation sequencing (NGS technology on a MiSeq platform. To ensure the reliability and specificity of our method, genomic DNA from well-characterized cell lines were used; high-resolution KIR typing results obtained were then compared to those previously reported. Two different bioinformatic pipelines were used allowing the attribution of sequencing reads to specific KIR genes and the assignment of KIR alleles for each KIR gene. Our results demonstrated successful long-range KIR gene amplifications of all reference samples using intergenic KIR primers. The alignment of reads to the human genome reference (hg19 using BiRD pipeline or visualization of data using Profiler software demonstrated that all KIR genes were completely sequenced with a sufficient read depth (mean 317× for all loci and a high percentage of mapping (mean 93% for all loci. Comparison of high-resolution KIR typing obtained to those published data using exome capture resulted in a reported concordance rate of 95% for centromeric and telomeric KIR genes. Overall, our results suggest that NGS can be used to investigate the broad KIR allelic polymorphism. Hence, these data improve our knowledge, not only on KIR+ NK cell alloreactivity in

  18. MR diffusion weighted imaging of gastric cancer: b-value determination and comparison with routine sequences

    International Nuclear Information System (INIS)

    Zhao Xiaopeng; Tang Lei; Sun Yingshi; Li Jie; Cao Kun

    2007-01-01

    Objective: To choose the optimal b-values for the DWI of gastric cancer (GC), and investigate the value of DWI in the diagnosis of GCs. Methods: MRI examinations (T 1 WI, T 2 WI, and DWI) were performed on 31 patients with gastric cancer. Three diffusion-weighted sequences were designed with different b values, including 300 s/mm 2 (low), 600 s/mm 2 (intermediate), and 1000 s/mm 2 (high). Free water grade was used to evaluate the suppression of content in gastric lumen. Background contrast grade was used to evaluate the discriminating ability of different sequences between GC and nearby tissues. The ADCs of GCs, nearby gastric wall region, and free water in gastric lumen were measured. SNR Ca , CNR Ca-GW and SIR CaGW of high b-value DWI and routine MRI sequences were evaluated and compared. Results: The signal intensity of free water in gastric lumen decreased as b-value increased, and the SIR were 8.11± 0.77 (b=300 s/mm 2 ), 2.70±0.35 (b=600 s/mm 2 ), and 1.13±0.22 (b=1000 s/mm 2 ) (F55.368, P 2 =16.692, P 2 =9.923, P -3 mm 2 /s, (1.43±0.41) x 10 -3 mm 2 /s, and (1.18±0.25) x 10 -3 mm 2 /s; (F=12.066, P 1 WI (CNR: 12.46 vs. 2.35, Z=-3.746, P 2 WI (CNR: 12.46 vs. 3.92, Z=-3.518, P 2 ) is reasonable for DWI of GCs, which can reflect diffusion condition of water molecules more accurately, suppress signal of content in gastric lumen, and possess higher contrast. DWI can be a supplementary method of routine MRI examination for better demonstration of gastric cancers. (authors)

  19. Primary structure of human pancreatic protease E determined by sequence analysis of the cloned mRNA

    International Nuclear Information System (INIS)

    Shen, W.; Fletcher, T.S.; Largman, C.

    1987-01-01

    Although protease E was isolated from human pancreas over 10 years ago, its amino acid sequence and relationship to the elastases have not been established. The authors report the isolation of a cDNA clone for human pancreatic protease E and determination of the nucleic acid sequence coding for the protein. The deduced amino acid sequence contains all of the features common to serine proteases. The substrate binding region is highly homologous to those of porcine and rat elastases 1, explaining the similar specificity for alanine reported for protease E and these elastases. However, the amino acid sequence outside the substrate binding region is less than 50% conserved, and there is a striking difference in the overall net charge for protease E (6-) and elastases 1 (8+). These findings confirm that protease E is a new member of the serine protease family. They have attempted to identify amino acid residues important for the interaction between elastases and elastin by examining the amino acid sequence differences between elastases and protease E. In addition to the large number of surface charge changes which are outside the substrate binding region, there are several changes which might be crucial for elastolysis: Leu-73/Arg-73; Arg-217A/Ala-217A; Arg-65A/Gln-65A; and the presence of two new cysteine residues (Cys-98 and Cys-99B) which computer modeling studies predict could form a new disulfide bond, not previously observed for serine proteases. They also present evidence which suggests that human pancreas does not synthesize a basic, alanine-specific elastase similar to porcine elastase 1

  20. Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358

    International Nuclear Information System (INIS)

    Griffin, H.G.; Foster, T.J.; Silver, S.; Misra, T.K.

    1987-01-01

    The broad-spectrum mercurial-resistance plasmid pDU1358 was analyzed by cloning the resistance determinants and preparing a physical and genetic map of a 45-kilobase (kb) region of the plasmid that contains two separate mercurial-resistance operons that mapped about 20 kb apart. One encoded narrow-spectrum mercurial resistance to Hg 2+ and a few organomercurials; the other specified broad-spectrum resistance to phenylmercury and additional organomercurials. Each determinant governed mercurial transport functions. Southern DNA x DNA hybridization experiments using gene-specific probes from the plasmid R100 mer operon indicated close homology with the R100 deteminant. The 2153 base pairs of the promoter-distal part of the broad-spectrum Hg 2+ -resistance operon of pDU1358 were sequenced. This region included the 3'-terminal part of the merA gene, merD, unidentified reading frame URF1, and a part of URF2 homologous to previously sequenced determinants of plasmid R100. Between the merA and merD genes, an open reading frame encoding a 212 amino acid polypeptide was identified as the merB gene that determines the enzyme organomercurial lyase that cleaves the C-Hg bond of phenylmercury

  1. On the determination of the He abundance distribution in globular clusters from the width of the main sequence

    Science.gov (United States)

    Cassisi, Santi; Salaris, Maurizio; Pietrinferni, Adriano; Hyder, David

    2017-01-01

    One crucial piece of information to study the origin of multiple stellar populations in globular clusters is the range of initial helium abundances ΔY amongst the sub-populations hosted by each cluster. These estimates are commonly obtained by measuring the width in colour of the unevolved main sequence in an optical colour-magnitude diagram (CMD). The measured colour spread is then compared with predictions from theoretical stellar isochrones with varying initial He abundances to determine ΔY. The availability of UV/optical magnitudes, thanks to the Hubble Space Telescope UV Legacy Survey of Galactic GCs project, will allow the homogeneous determination of ΔY for a large Galactic globular cluster sample. From a theoretical point of view, accurate UV CMDs can efficiently disentangle the various sub-populations, and main sequence colour differences in the ACS F606W - (F606W - F814W) diagram allow an estimate of ΔY. We demonstrate that from a theoretical perspective, the (F606W - F814W) colour is an extremely reliable He-abundance indicator. The derivative dY/d(F606W - F814W), computed at a fixed luminosity along the unevolved main sequence, is largely insensitive to the physical assumptions made in stellar model computations, being more sensitive to the choice of the bolometric correction scale, and is only slightly dependent on the adopted set of stellar models. From a theoretical point of view, the (F606W - F814W) colour width of the cluster main sequence is therefore a robust diagnostic of the ΔY range.

  2. Fast skeletal muscle transcriptome of the Gilthead sea bream (Sparus aurata determined by next generation sequencing

    Directory of Open Access Journals (Sweden)

    Garcia de la serrana Daniel

    2012-05-01

    Full Text Available Abstract Background The gilthead sea bream (Sparus aurata L. occurs around the Mediterranean and along Eastern Atlantic coasts from Great Britain to Senegal. It is tolerant of a wide range of temperatures and salinities and is often found in brackish coastal lagoons and estuarine areas, particularly early in its life cycle. Gilthead sea bream are extensively cultivated in the Mediterranean with an annual production of 125,000 metric tonnes. Here we present a de novo assembly of the fast skeletal muscle transcriptome of gilthead sea bream using 454 reads and identify gene paralogues, splice variants and microsatellite repeats. An annotated transcriptome of the skeletal muscle will facilitate understanding of the genetic and molecular basis of traits linked to production in this economically important species. Results Around 2.7 million reads of mRNA sequence data were generated from the fast myotomal of adult fish (~2 kg and juvenile fish (~0.09 kg that had been either fed to satiation, fasted for 3-5d or transferred to low (11°C or high (33°C temperatures for 3-5d. Newbler v2.5 assembly resulted in 43,461 isotigs >100 bp. The number of sequences annotated by searching protein and gene ontology databases was 10,465. The average coverage of the annotated isotigs was x40 containing 5655 unique gene IDs and 785 full-length cDNAs coding for proteins containing 58–1536 amino acids. The v2.5 assembly was found to be of good quality based on validation using 200 full-length cDNAs from GenBank. Annotated isotigs from the reference transcriptome were attributable to 344 KEGG pathway maps. We identified 26 gene paralogues (20 of them teleost-specific and 43 splice variants, of which 12 had functional domains missing that were likely to affect their biological function. Many key transcription factors, signaling molecules and structural proteins necessary for myogenesis and muscle growth have been identified. Physiological status affected the

  3. Order and correlations in genomic DNA sequences. The spectral approach

    International Nuclear Information System (INIS)

    Lobzin, Vasilii V; Chechetkin, Vladimir R

    2000-01-01

    The structural analysis of genomic DNA sequences is discussed in the framework of the spectral approach, which is sufficiently universal due to the reciprocal correspondence and mutual complementarity of Fourier transform length scales. The spectral characteristics of random sequences of the same nucleotide composition possess the property of self-averaging for relatively short sequences of length M≥100-300. Comparison with the characteristics of random sequences determines the statistical significance of the structural features observed. Apart from traditional applications to the search for hidden periodicities, spectral methods are also efficient in studying mutual correlations in DNA sequences. By combining spectra for structure factors and correlation functions, not only integral correlations can be estimated but also their origin identified. Using the structural spectral entropy approach, the regularity of a sequence can be quantitatively assessed. A brief introduction to the problem is also presented and other major methods of DNA sequence analysis described. (reviews of topical problems)

  4. Noninvasive Antenatal Determination of Fetal Blood Group Using Next-Generation Sequencing

    DEFF Research Database (Denmark)

    Rieneck, Klaus; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2016-01-01

    Hemolytic disease of the fetus and newborn (HDFN) is a condition characterized by a decreased lifespan of fetal red blood cells caused by maternally produced allospecific antibodies transferred to the fetus during pregnancy. The antibodies bind to the corresponding blood group antigens on fetal r......NGS analysis holds advantages over polymerase chain reaction (PCR) determination based on allele specific amplification....

  5. Complete nucleotide sequences and construction of full-length infectious cDNA clones of Cucumber green mottle virus (CGMMV) in a versatile newly developed binary vector including both 35S and T7 promoters

    Science.gov (United States)

    Seed-transmitted viruses have caused significant damage to watermelon crops in Korea in recent years, with Cucumber green mottle mosaic virus (CGMMV) infection widespread as a result of infected seed lots. To determine the likely origin of CGMMV infection, we collected CGMMV isolates from watermelon...

  6. Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics

    Science.gov (United States)

    Anwar, R; Booth, A; Churchill, A J; Markham, A F

    1996-01-01

    The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

  7. Determination of Shift/Bias in Digital Aerial Triangulation of UAV Imagery Sequences

    Science.gov (United States)

    Wierzbicki, Damian

    2017-12-01

    Currently UAV Photogrammetry is characterized a largely automated and efficient data processing. Depicting from the low altitude more often gains on the meaning in the uses of applications as: cities mapping, corridor mapping, road and pipeline inspections or mapping of large areas e.g. forests. Additionally, high-resolution video image (HD and bigger) is more often use for depicting from the low altitude from one side it lets deliver a lot of details and characteristics of ground surfaces features, and from the other side is presenting new challenges in the data processing. Therefore, determination of elements of external orientation plays a substantial role the detail of Digital Terrain Models and artefact-free ortophoto generation. Parallel a research on the quality of acquired images from UAV and above the quality of products e.g. orthophotos are conducted. Despite so fast development UAV photogrammetry still exists the necessity of accomplishment Automatic Aerial Triangulation (AAT) on the basis of the observations GPS/INS and via ground control points. During low altitude photogrammetric flight, the approximate elements of external orientation registered by UAV are burdened with the influence of some shift/bias errors. In this article, methods of determination shift/bias error are presented. In the process of the digital aerial triangulation two solutions are applied. In the first method shift/bias error was determined together with the drift/bias error, elements of external orientation and coordinates of ground control points. In the second method shift/bias error was determined together with the elements of external orientation, coordinates of ground control points and drift/bias error equals 0. When two methods were compared the difference for shift/bias error is more than ±0.01 m for all terrain coordinates XYZ.

  8. Primary and secondary structural determinants in the receptor binding sequence β-(38-57) from human luteinizing hormone

    International Nuclear Information System (INIS)

    Keutmann, H.T.; Charlesworth, M.C.; Kitzmann, K.; Mason, K.A.; Johnson, L.; Ryan, R.J.

    1988-01-01

    The intercysteine loop sequence 38-57 in the β subunit has been shown to be a determinant for expression of biological activity in human lutropin (hLH) and choriogonadotropin (hCG). Together with other sequences, the 38-57 region may contribute to a multicomponent receptor binding domain in hLH/hCG. Because the structural features influencing activity in this important region are not easy to evaluate in the full-length subunit, the authors have used analogues of hLHβ-(38-57) prepared by solid-phase synthesis. The peptides were tested for inhibition of 125 I-labeled hCG binding to rat ovarian membrane receptors. Secondary structure was analyzed by circular dichroism (CD) and by reactivity with antibodies to the native 38-57 peptide. An analogue lacking the 38-57 disulfide linkage retained 20% receptor binding and full immunoreactivity. Far-ultraviolet CD profiles were essentially identical with those of the disulfide-intact peptide; a transition from 10% to 30% α-helix in 90% trifluoroethanol was characteristic of both. The peptide thus appears not to require the disulfide bridge to retain a looped conformation with amphipathic secondary structure. An essential positive charge at position 43 was shown by complete loss of activity upon substitution of Asp or Ala for the Arg found in all known species of LH. These results indicate that the 38-57 sequence is a relatively rigid and structurally autonomous region, not merely a series of residues constrained passively into a loop by a disulfide linkage. It includes segments of ordered structure, probably including both amphipathic helical and turn sequences. Evidence from studies of other hormones suggests that this region may be important to binding and specificity in the glycoprotein hormones as a group

  9. Lack of close relationship between three strains of human rhinoviruses as determined by their RNA sequences.

    Science.gov (United States)

    Yin, F H; Lonberg-Holm, K; Chan, S P

    1973-07-01

    The possible genomic homologies between three serotypes of human rhinoviruses (HRV 1A, HRV 2, and HRV 14) were investigated. First we confirmed that these viruses were unrelated by the criterion of the absence of common antigenic determinants on the surfaces of the native virions, as detected by cross-neutralization of complementfixation. RNA-RNA hybridization was then examined with purified, highly radioactive, double-stranded, replicative-form RNA and excess single-stranded virion RNA. Single-stranded RNA showed 100% homology with the minus strand from the replicative-form RNA of the same type of virus. HRV 1A, HRV 2, and HRV 14 showed low intertypic homologies; these were not significantly greater than those found between the rhinoviruses and polivirus, which were used as a negative control. The immunological relationship and the RNA homology between HRV 1A and HRV 1B were also examined by the above techniques. It was confirmed that HRV 1A and HRV 1B share some surface determinants and it was also found that HRV 1B RNA shares 70% homology with HRV 1A RNA.

  10. Cloning, sequencing, and sequence analysis of two novel plasmids from the thermophilic anaerobic bacterium Anaerocellum thermophilum

    DEFF Research Database (Denmark)

    Clausen, Anders; Mikkelsen, Marie Just; Schrøder, I.

    2004-01-01

    The nucleotide sequence of two novel plasmids isolated from the extreme thermophilic anaerobic bacterium Anaerocellum thermophilum DSM6725 (A. thermophilum), growing optimally at 70degreesC, has been determined. pBAS2 was found to be a 3653 bp plasmid with a GC content of 43%, and the sequence re...... with highest similarity to DNA repair protein from Campylobacter jejuni (25% aa). Orf34 showed similarity to sigma factors with highest similarity (28% aa) to the sporulation specific Sigma factor, Sigma 28(K) from Bacillus thuringiensis....

  11. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  12. An extended sequence specificity for UV-induced DNA damage.

    Science.gov (United States)

    Chung, Long H; Murray, Vincent

    2018-01-01

    The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  13. Identifying a few foot-and-mouth disease virus signature nucleotide strings for computational genotyping

    Directory of Open Access Journals (Sweden)

    Xu Lizhe

    2008-06-01

    Full Text Available Abstract Background Serotypes of the Foot-and-Mouth disease viruses (FMDVs were generally determined by biological experiments. The computational genotyping is not well studied even with the availability of whole viral genomes, due to uneven evolution among genes as well as frequent genetic recombination. Naively using sequence comparison for genotyping is only able to achieve a limited extent of success. Results We used 129 FMDV strains with known serotype as training strains to select as many as 140 most serotype-specific nucleotide strings. We then constructed a linear-kernel Support Vector Machine classifier using these 140 strings. Under the leave-one-out cross validation scheme, this classifier was able to assign correct serotype to 127 of these 129 strains, achieving 98.45% accuracy. It also assigned serotype correctly to an independent test set of 83 other FMDV strains downloaded separately from NCBI GenBank. Conclusion Computational genotyping is much faster and much cheaper than the wet-lab based biological experiments, upon the availability of the detailed molecular sequences. The high accuracy of our proposed method suggests the potential of utilizing a few signature nucleotide strings instead of whole genomes to determine the serotypes of novel FMDV strains.

  14. IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    Science.gov (United States)

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

  15. IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    Science.gov (United States)

    The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

  16. Complete genome sequence of Paris mosaic necrosis virus, a distinct member of the genus Potyvirus

    Science.gov (United States)

    The complete genomic sequence of a novel potyvirus was determined from Paris polyphylla var. yunnanensis. Its genomic RNA consists of 9,660 nucleotides (nt) excluding the 3’-terminal poly (A) tail, containing a single open reading frame (ORF) encoding a large polyprotein. The virus shares 52.1-69.7%...

  17. Rationalization and Design of the Complementarity Determining Region Sequences in an Antibody-Antigen Recognition Interface

    Science.gov (United States)

    Chen, Ing-Chien; Lee, Yu-Ching; Chen, Jun-Bo; Tsai, Keng-Chang; Chen, Ching-Tai; Chang, Jeng-Yih; Yang, Ei-Wen; Hsu, Po-Chiang; Jian, Jhih-Wei; Hsu, Hung-Ju; Chang, Hung-Ju; Hsu, Wen-Lian; Huang, Kai-Fa; Ma, Alex Che; Yang, An-Suei

    2012-01-01

    Protein-protein interactions are critical determinants in biological systems. Engineered proteins binding to specific areas on protein surfaces could lead to therapeutics or diagnostics for treating diseases in humans. But designing epitope-specific protein-protein interactions with computational atomistic interaction free energy remains a difficult challenge. Here we show that, with the antibody-VEGF (vascular endothelial growth factor) interaction as a model system, the experimentally observed amino acid preferences in the antibody-antigen interface can be rationalized with 3-dimensional distributions of interacting atoms derived from the database of protein structures. Machine learning models established on the rationalization can be generalized to design amino acid preferences in antibody-antigen interfaces, for which the experimental validations are tractable with current high throughput synthetic antibody display technologies. Leave-one-out cross validation on the benchmark system yielded the accuracy, precision, recall (sensitivity) and specificity of the overall binary predictions to be 0.69, 0.45, 0.63, and 0.71 respectively, and the overall Matthews correlation coefficient of the 20 amino acid types in the 24 interface CDR positions was 0.312. The structure-based computational antibody design methodology was further tested with other antibodies binding to VEGF. The results indicate that the methodology could provide alternatives to the current antibody technologies based on animal immune systems in engineering therapeutic and diagnostic antibodies against predetermined antigen epitopes. PMID:22457753

  18. Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.

    Science.gov (United States)

    Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P

    1997-11-01

    A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.

  19. Determining the diet of larvae of western rock lobster (Panulirus cygnus using high-throughput DNA sequencing techniques.

    Directory of Open Access Journals (Sweden)

    Richard O'Rorke

    Full Text Available The Western Australian rock lobster fishery has been both a highly productive and sustainable fishery. However, a recent dramatic and unexplained decline in post-larval recruitment threatens this sustainability. Our lack of knowledge of key processes in lobster larval ecology, such as their position in the food web, limits our ability to determine what underpins this decline. The present study uses a high-throughput amplicon sequencing approach on DNA obtained from the hepatopancreas of larvae to discover significant prey items. Two short regions of the 18S rRNA gene were amplified under the presence of lobster specific PNA to prevent lobster amplification and to improve prey amplification. In the resulting sequences either little prey was recovered, indicating that the larval gut was empty, or there was a high number of reads originating from multiple zooplankton taxa. The most abundant reads included colonial Radiolaria, Thaliacea, Actinopterygii, Hydrozoa and Sagittoidea, which supports the hypothesis that the larvae feed on multiple groups of mostly transparent gelatinous zooplankton. This hypothesis has prevailed as it has been tentatively inferred from the physiology of larvae, captive feeding trials and co-occurrence in situ. However, these prey have not been observed in the larval gut as traditional microscopic techniques cannot discern between transparent and gelatinous prey items in the gut. High-throughput amplicon sequencing of gut DNA has enabled us to classify these otherwise undetectable prey. The dominance of the colonial radiolarians among the gut contents is intriguing in that this group has been historically difficult to quantify in the water column, which may explain why they have not been connected to larval diet previously. Our results indicate that a PCR based technique is a very successful approach to identify the most abundant taxa in the natural diet of lobster larvae.

  20. Mixed Sequence Reader: A Program for Analyzing DNA Sequences with Heterozygous Base Calling

    Science.gov (United States)

    Chang, Chun-Tien; Tsai, Chi-Neu; Tang, Chuan Yi; Chen, Chun-Houh; Lian, Jang-Hau; Hu, Chi-Yu; Tsai, Chia-Lung; Chao, Angel; Lai, Chyong-Huey; Wang, Tzu-Hao; Lee, Yun-Shien

    2012-01-01

    The direct sequencing of PCR products generates heterozygous base-calling fluorescence chromatograms that are useful for identifying single-nucleotide polymorphisms (SNPs), insertion-deletions (indels), short tandem repeats (STRs), and paralogous genes. Indels and STRs can be easily detected using the currently available Indelligent or ShiftDetector programs, which do not search reference sequences. However, the detection of other genomic variants remains a challenge due to the lack of appropriate tools for heterozygous base-calling fluorescence chromatogram data analysis. In this study, we developed a free web-based program, Mixed Sequence Reader (MSR), which can directly analyze heterozygous base-calling fluorescence chromatogram data in .abi file format using comparisons with reference sequences. The heterozygous sequences are identified as two distinct sequences and aligned with reference sequences. Our results showed that MSR may be used to (i) physically locate indel and STR sequences and determine STR copy number by searching NCBI reference sequences; (ii) predict combinations of microsatellite patterns using the Federal Bureau of Investigation Combined DNA Index System (CODIS); (iii) determine human papilloma virus (HPV) genotypes by searching current viral databases in cases of double infections; (iv) estimate the copy number of paralogous genes, such as β-defensin 4 (DEFB4) and its paralog HSPDP3. PMID:22778697

  1. Analysis of the intronic single nucleotide polymorphism rs#466452 of the nephrin gene in patients with diabetic nephropathy

    Directory of Open Access Journals (Sweden)

    RODRIGO GONZÁLEZ

    2009-01-01

    Full Text Available We present the analysis of an intronic polymorphism of the nephrin gene and its relationship to the development of diabetic nephropathy in a study of diabetes type 1 and type 2 patients. The frequency of the single nucleotide polymorphism rs#466452 in the nephrin gene was determined in 231 patients and control subjects. The C/T status of the polymorphism was assessed using restriction enzyme digestions and the nephrin transcript from a kidney biopsy was examined. Association between the polymorphism and clinical parameters was evaluated using multivaríate correspondence analysis. A bioinformatics analysis of the single nucleotide polymorphism rs#466452 suggested the appearance of a splicing enhancer sequence in intron 24 of the nephrin gene and a modification of proteins that bind to this sequence. However, no change in the splicing of a nephrin transcript from a renal biopsy was found. No association was found between the polymorphism and diabetes or degree of renal damage in diabetes type 1 or 2 patients. The single nucleotide polymorphism rs#466452 of the nephrin gene seems to be neutral in relation to diabetes and the development of diabetic nephropathy, and does not affect the splicing of a nephrin transcript, in spite of a splicing enhancer site.

  2. Sequence of cDNAs for mammalian H2A. Z, an evolutionarily diverged but highly conserved basal histone H2A isoprotein species

    Energy Technology Data Exchange (ETDEWEB)

    Hatch, C L; Bonner, W M

    1988-02-11

    The nucleotide sequences of cDNAs for the evolutionarily diverged but highly conserved basal H2A isoprotein, H2A.Z, have been determined for the rat, cow, and human. As a basal histone, H2A.Z is synthesized throughout the cell cycle at a constant rate, unlinked to DNA replication, and at a much lower rate in quiescent cells. Each of the cDNA isolates encodes the entire H2A.Z polypeptide. The human isolate is about 1.0 kilobases long. It contains a coding region of 387 nucleotides flanked by 106 nucleotides of 5'UTR and 376 nucleotides of 3'UTR, which contains a polyadenylation signal followed by a poly A tail. The bovine and rat cDNAs have 97 and 94% nucleotide positional identity to the human cDNA in the coding region and 98% in the proximal 376 nucleotides of the 3'UTR which includes the polyadenylation signal. A potential stem-forming sequence imbedded in a direct repeat is found centered at 261 nucleotides into the 3'UTR. Each of the cDNA clones could be transcribed and translated in vitro to yield H2A.Z protein. The mammalian H2A.Z cDNA coding sequences are approximately 80% similar to those in chicken and 75% to those in sea urchin.

  3. Whole-genome sequencing identifies EN1 as a determinant of bone density and fracture

    DEFF Research Database (Denmark)

    Zheng, Hou-Feng; Forgetta, Vincenzo; Hsu, Yi-Hsiang

    2015-01-01

    . Associations for BMD were derived from whole-genome sequencing (n = 2,882 from UK10K (ref. 10); a population-based genome sequencing consortium), whole-exome sequencing (n = 3,549), deep imputation of genotyped samples using a combined UK10K/1000 Genomes reference panel (n = 26,534), and de novo replication...

  4. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    3Chengdu Institute of Biology, Chinese Academy of Sciences, Chengdu 610041, People's Republic of China ... of these rearrangements involve tRNA genes, ND5 gene and ... ncbi.nlm.nih.gov/projects/Sequin/download/seq_win_download.

  5. Complete nucleotide sequence and organization of the mitogenome ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-02-01

    Feb 1, 2010 ... In this study, the complete mitochondrial genome (mitogenome) of E. autonoe was .... skew” was calculated for the PCGs between two strands and the ..... codon stem and 7 bp in the anticodon loop, but also con- tained a ...

  6. Complete nucleotide sequence and organization of the mitogenome ...

    African Journals Online (AJOL)

    ... genes (PCGs) consistently supported a close relationship between Bombycoidea and Geometroidea among six available lepidopteran superfamilies (Tortricoidea, Pyraloidea, Papilionoidea, Bombycoidea, Geometroidea and Noctuoidea). Among the true butterflies (Pieridae, Nymphalidae, Lycaenidae and Papilionidae), ...

  7. Identification of physicochemical selective pressure on protein encoding nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Sainudiin Raazesh

    2006-03-01

    Full Text Available Abstract Background Statistical methods for identifying positively selected sites in protein coding regions are one of the most commonly used tools in evolutionary bioinformatics. However, they have been limited by not taking the physiochemical properties of amino acids into account. Results We develop a new codon-based likelihood model for detecting site-specific selection pressures acting on specific physicochemical properties. Nonsynonymous substitutions are divided into substitutions that differ with respect to the physicochemical properties of interest, and those that do not. The substitution rates of these two types of changes, relative to the synonymous substitution rate, are then described by two parameters, γ and ω respectively. The new model allows us to perform likelihood ratio tests for positive selection acting on specific physicochemical properties of interest. The new method is first used to analyze simulated data and is shown to have good power and accuracy in detecting physicochemical selective pressure. We then re-analyze data from the class-I alleles of the human Major Histocompatibility Complex (MHC and from the abalone sperm lysine. Conclusion Our new method allows a more flexible framework to identify selection pressure on particular physicochemical properties.

  8. Determination of the full-genome sequence of hepatitis E virus (HEV) SAAS-FX17 and use as a reference to identify putative HEV genotype 4 virulence determinants.

    Science.gov (United States)

    Zhu, Yumin; Yu, Xiaoming; Huang, Fenfen; Yu, Ruisong; Dong, Shijuan; Si, Fusheng; Zhang, Yuanshu; Li, Zhen

    2012-11-08

    Four major genotypes of hepatitis E virus (HEV), the causative agent of hepatitis E, have so far been recognized. While genotypes 3 and 4 are both zoonotic, the disease symptoms caused by the latter tend to be more severe. To examine if specific nucleotide/amino acid variations between genotypes 3 and 4 play a role in determining the severity of hepatitis E disease, the complete genome of one swine HEV genotype 4 isolate, SAAS-FX17, was determined and compared with other genotype 4 and genotype 3 genomes to identify putative HEV genotype 4 virulence determinants. A total of 42 conformable nt/aa variations between genotype 3 and 4 HEVs were detected, of which 19 were proposed to be potential disease severity determinants for genotype 4 strains. One potential determinant was located in each of the 5'-UTR and 3'-UTR, 3 and 12 within ORF1 and ORF2 respectively, and 2 in the junction region.

  9. Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics.

    Science.gov (United States)

    Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu

    2012-04-01

    Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  11. Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

    Science.gov (United States)

    Bergman, Casey M; Haddrill, Penelope R

    2015-01-01

    To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center.

  12. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  13. Determination of Trichuris skrjabini by sequencing of the ITS1-5.8S-ITS2 segment of the ribosomal DNA: comparative molecular study of different species of trichurids.

    Science.gov (United States)

    Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C

    2004-06-01

    Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.

  14. Molecular phylogeny of ateline new world monkeys (Platyrrhini, atelinae) based on gamma-globin gene sequences: evidence that brachyteles is the sister group of lagothrix.

    Science.gov (United States)

    Meireles, C M; Czelusniak, J; Schneider, M P; Muniz, J A; Brigido, M C; Ferreira, H S; Goodman, M

    1999-06-01

    Nucleotide sequences, each spanning approximately 7 kb of the contiguous gamma1 and gamma2 globin genomic loci, were determined for seven species representing all extant genera (Ateles, Lagothrix, Brachyteles, and Alouatta) of the New World monkey subfamily Atelinae. After aligning these seven ateline sequences with outgroup sequences from several other primate (non-ateline) genera, they were analyzed by maximum parsimony, maximum likelihood, and neighbor-joining algorithms. All three analyzes estimated the same phylogenetic relationships: [Alouatta [Ateles (Brachyteles, Lagothrix)

  15. Target-dependent enrichment of virions determines the reduction of high-throughput sequencing in virus discovery.

    Directory of Open Access Journals (Sweden)

    Randi Holm Jensen

    Full Text Available Viral infections cause many different diseases stemming both from well-characterized viral pathogens but also from emerging viruses, and the search for novel viruses continues to be of great importance. High-throughput sequencing is an important technology for this purpose. However, viral nucleic acids often constitute a minute proportion of the total genetic material in a sample from infected tissue. Techniques to enrich viral targets in high-throughput sequencing have been reported, but the sensitivity of such methods is not well established. This study compares different library preparation techniques targeting both DNA and RNA with and without virion enrichment. By optimizing the selection of intact virus particles, both by physical and enzymatic approaches, we assessed the effectiveness of the specific enrichment of viral sequences as compared to non-enriched sample preparations by selectively looking for and counting read sequences obtained from shotgun sequencing. Using shotgun sequencing of total DNA or RNA, viral targets were detected at concentrations corresponding to the predicted level, providing a foundation for estimating the effectiveness of virion enrichment. Virion enrichment typically produced a 1000-fold increase in the proportion of DNA virus sequences. For RNA virions the gain was less pronounced with a maximum 13-fold increase. This enrichment varied between the different sample concentrations, with no clear trend. Despite that less sequencing was required to identify target sequences, it was not evident from our data that a lower detection level was achieved by virion enrichment compared to shotgun sequencing.

  16. First Complete Genome Sequence of Papaya ringspot virus-W Isolated from a Gourd in the United States.

    Science.gov (United States)

    Ali, Akhtar

    2017-01-12

    In the United States, the Papaya ringspot virus was first reported from papaya in Florida in 1949. Here, we determined the first complete genome sequence (10,302 nucleotides) of a Papaya ringspot virus-W isolate, which was collected from a commercial field of gourd in Tulsa, OK. Copyright © 2017 Ali.

  17. Genome sequence variation in the constricta strain dramatically alters the protein interaction and localization map of Potato yellow dwarf virus

    Science.gov (United States)

    The genome sequence of the constricta strain of Potato yellow dwarf virus (CYDV) was determined to be 12,792 nucleotides long and organized into seven open reading frames with the gene order 3’-N-X-P-Y-M-G-L-5’, which encodes the nucleocapsid, phosphoprotein, movement, matrix, glycoprotein and RNA-d...

  18. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  19. Genetic characterization of Brazilian bovine viral diarrhea virus isolates by partial nucleotide sequencing of the 5'-UTR region Caracterização genética de amostras brasileiras do vírus da diarréia viral bovina através do seqüenciamento parcial da Região 5'UTR

    Directory of Open Access Journals (Sweden)

    Adriana Cortez

    2006-12-01

    Full Text Available Nineteen isolates of bovine viral diarrhea virus (BVDV from Brazil were genetically characterized through partial nucleotide sequencing and analysis of the 5'UTR region. The isolates were grouped as BVDV-1 (11/19, BVDV-2 (6/19 or "atypical" pestivirus (2/19. Among the BVDV-1, eight isolates were classified as subgenotype BVDV-1a, whereas most (4 out of 6 BVDV-2 belonged to subgenotype 2b. Two isolates from aborted fetuses were not classified into any genetic group, being considered atypical BVDVs. Genetic diversity among Brazilian BVDV isolates may be responsible for vaccination and diag-nostic failure and therefore may influence the control strategies for BVDV infection in the country.Dezenove amostras do vírus da diarréia viral bovina (BVDV foram caracterizadas geneticamente através do seqüenciamento parcial de nucleotídeos da Região 5'UTR. As amostras foram agrupadas em BVDV-1 (11/19, BVDV-2 (6/19 e num terceiro grupo de amostras denominadas "atípicas" (2/19. Das onze amostras genotipadas como BVDV-1, oito amostras foram sub-genotipadas como BVDV-1a, enquanto que a maioria (4/6 das amostras de BVDV-2 foi agrupada como BVDV-2b. Duas amostras provenientes de fetos bovinos abortados foram classificadas como atípicas, não BVDV-1 e 2. A presença da diversidade genética de BVDV detectada nas amostras estudadas pode ser responsável por falhas vacinais e de diagnóstico e deve influenciar nas estratégias de controle do BVDV aplicadas nas diferentes regiões brasileiras.

  20. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  1. Sequence requirements of the HIV-1 protease flap region determined by saturation mutagenesis and kinetic analysis of flap mutants

    Science.gov (United States)

    Shao, Wei; Everitt, Lorraine; Manchester, Marianne; Loeb, Daniel D.; Hutchison, Clyde A.; Swanstrom, Ronald

    1997-01-01

    The retroviral proteases (PRs) have a structural feature called the flap, which consists of a short antiparallel β-sheet with a turn. The flap extends over the substrate binding cleft and must be flexible to allow entry and exit of the polypeptide substrates and products. We analyzed the sequence requirements of the amino acids within the flap region (positions 46–56) of the HIV-1 PR. The phenotypes of 131 substitution mutants were determined using a bacterial expression system. Four of the mutant PRs with mutations in different regions of the flap were selected for kinetic analysis. Our phenotypic analysis, considered in the context of published structures of the HIV-1 PR with a bound substrate analogs, shows that: (i) Met-46 and Phe-53 participate in hydrophobic interactions on the solvent-exposed face of the flap; (ii) Ile-47, Ile-54, and Val-56 participate in hydrophobic interactions on the inner face of the flap; (iii) Ile-50 has hydrophobic interactions at the distance of both the δ and γ carbons; (iv) the three glycine residues in the β-turn of the flap are virtually intolerant of substitutions. Among these mutant PRs, we have identified changes in both kcat and Km. These results establish the nature of the side chain requirements at each position in the flap and document a role for the flap in both substrate binding and catalysis. PMID:9122179

  2. Toxic Cyanobacterial Bloom Triggers in Missisquoi Bay, Lake Champlain, as Determined by Next-Generation Sequencing and Quantitative PCR

    Directory of Open Access Journals (Sweden)

    Nathalie Fortin

    2015-05-01

    Full Text Available Missisquoi Bay (MB is a temperate eutrophic freshwater lake that frequently experiences toxic Microcystis-dominated cyanobacterial blooms. Non-point sources are responsible for the high concentrations of phosphorus and nitrogen in the bay. This study combined data from environmental parameters, E. coli counts, high-throughput sequencing of 16S rRNA gene amplicons, quantitative PCR (16S rRNA and mcyD genes and toxin analyses to identify the main bloom-promoting factors. In 2009, nutrient concentrations correlated with E. coli counts, abundance of total cyanobacterial cells, Microcystis 16S rRNA and mcyD genes and intracellular microcystin. Total and dissolved phosphorus also correlated significantly with rainfall. The major cyanobacterial taxa were members of the orders Chroococcales and Nostocales. The genus Microcystis was the main mcyD-carrier and main microcystin producer. Our results suggested that increasing nutrient concentrations and total nitrogen:total phosphorus (TN:TP ratios approaching 11:1, coupled with an increase in temperature, promoted Microcystis-dominated toxic blooms. Although the importance of nutrient ratios and absolute concentrations on cyanobacterial and Microcystis dynamics have been documented in other laboratories, an optimum TN:TP ratio for Microcystis dominance has not been previously observed in situ. This observation provides further support that nutrient ratios are an important determinant of species composition in natural phytoplankton assemblages.

  3. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  4. Hydration of swelling clays: multi-scale sequence of hydration and determination of macroscopic energies from microscopic properties; Hydratation des argiles gonflantes: sequence d'hydratation multi-echelle determination des energies macroscopiques a partir des proprietes microscopiques

    Energy Technology Data Exchange (ETDEWEB)

    Salles, F

    2006-10-15

    Smectites have interesting properties which make them potential candidates for engineered barriers in deep geological nuclear waste repository: low permeability, swelling and cations retention. The subject of this thesis consists in the determination of the relationship between hydration properties, swelling properties and cations mobility in relation with confinement properties of clayey materials. The aim is to understand and to predict the behaviour of water in smectites, following two research orientations: the mechanistic aspects and the energetic aspects of the hydration of smectites. We worked on the Na-Ca montmorillonite contained in the MX80 bentonite, with the exchanged homo ionic structure (saturated with alkaline cations and calcium cations). The approach crosses the various scales (microscopic, mesoscopic and macroscopic) and implied the study of the various components of the system (layer-cation-water), by using original experimental methods (thermo-poro-metry and electric conductivity for various relative humidities (RH) and electrostatic calculations. Initially, the dry state is defined by SCTA (scanning calorimetry thermal analysis). Then a classical characterization of the smectite porosity for the dry state is carried out using mercury intrusion and nitrogen adsorption. We evidenced the existence of a meso-porosity which radius varies from 2 to 10 nm depending on the compensating cation. The thermo-poro-metry and conductivity experiments performed at various hydration states made it possible to follow the increase in the pore sizes and the cations mobility as a function of the hydration state. We highlight in particular the existence of an osmotic mesoscopic swelling for low RH (approximately 50-60%RH for Li and Na). By combining the results of thermo-poro-metry, X-ray diffraction and electric conductivity, we are able to propose a complete hydration sequence for each cation, showing the crucial role of the compensating cation in the hydration of

  5. Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

  6. Comparison of different pulse sequences for in vivo determination of T1 relaxation times in the human brain

    DEFF Research Database (Denmark)

    Kjaer, L; Henriksen, O

    1988-01-01

    ). T1 measurements were performed on the human brain using a whole body MR scanner operating at 1.5 tesla. Three different pulse sequences were compared including two 6-points inversion recovery (IR) sequences with TR = 2.0 s and 4.0, respectively, and a 12-points partial saturation inversion recovery...

  7. Cloning and sequence analysis of a partial CDS of leptospiral ligA gene in pET-32a - Escherichia coli DH5α system

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2018-04-01

    Full Text Available Aim: This study aims at cloning, sequencing, and phylogenetic analysis of a partial CDS of ligA gene in pET-32a - Escherichia coli DH5α system, with the objective of identifying the conserved nature of the ligA gene in the genus Leptospira. Materials and Methods: A partial CDS (nucleotide 1873 to nucleotide 3363 of the ligA gene was amplified from genomic DNA of Leptospira interrogans serovar Canicola by polymerase chain reaction (PCR. The PCR-amplified DNA was cloned into pET-32a vector and transformed into competent E. coli DH5α bacterial cells. The partial ligA gene insert was sequenced and the nucleotide sequences obtained were aligned with the published ligA gene sequences of other Leptospira serovars, using nucleotide BLAST, NCBI. Phylogenetic analysis of the gene sequence was done by maximum likelihood method using Mega 6.06 software. Results: The PCR could amplify the 1491 nucleotide sequence spanning from nucleotide 1873 to nucleotide 3363 of the ligA gene and the partial ligA gene could be successfully cloned in E. coli DH5α cells. The nucleotide sequence when analyzed for homology with the reported gene sequences of other Leptospira serovars was found to have 100% homology to the 1910 bp to 3320 bp sequence of ligA gene of L. interrogans strain Kito serogroup Canicola. The predicted protein consisted of 470 aminoacids. Phylogenetic analysis revealed that the ligA gene was conserved in L. interrogans species. Conclusion: The partial ligA gene could be successfully cloned and sequenced from E. coli DH5α cells. The sequence showed 100% homology to the published ligA gene sequences. The phylogenetic analysis revealed the conserved nature of the ligA gene. Further studies on the expression and immunogenicity of the partial LigA protein need to be carried out to determine its competence as a subunit vaccine candidate.

  8. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Recurrence plot analysis of DNA sequences

    Energy Technology Data Exchange (ETDEWEB)

    Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn

    2004-11-15

    Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.

  10. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  11. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Science.gov (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  12. Hydration of swelling clays: multi-scale sequence of hydration and determination of macroscopic energies from microscopic properties

    International Nuclear Information System (INIS)

    Salles, F.

    2006-10-01

    Smectites have interesting properties which make them potential candidates for engineered barriers in deep geological nuclear waste repository: low permeability, swelling and cations retention. The subject of this thesis consists in the determination of the relationship between hydration properties, swelling properties and cations mobility in relation with confinement properties of clayey materials. The aim is to understand and to predict the behaviour of water in smectites, following two research orientations: the mechanistic aspects and the energetic aspects of the hydration of smectites. We worked on the Na-Ca montmorillonite contained in the MX80 bentonite, with the exchanged homo ionic structure (saturated with alkaline cations and calcium cations). The approach crosses the various scales (microscopic, mesoscopic and macroscopic) and implied the study of the various components of the system (layer-cation-water), by using original experimental methods (thermo-poro-metry and electric conductivity for various relative humidities (RH) and electrostatic calculations. Initially, the dry state is defined by SCTA (scanning calorimetry thermal analysis). Then a classical characterization of the smectite porosity for the dry state is carried out using mercury intrusion and nitrogen adsorption. We evidenced the existence of a meso-porosity which radius varies from 2 to 10 nm depending on the compensating cation. The thermo-poro-metry and conductivity experiments performed at various hydration states made it possible to follow the increase in the pore sizes and the cations mobility as a function of the hydration state. We highlight in particular the existence of an osmotic mesoscopic swelling for low RH (approximately 50-60%RH for Li and Na). By combining the results of thermo-poro-metry, X-ray diffraction and electric conductivity, we are able to propose a complete hydration sequence for each cation, showing the crucial role of the compensating cation in the hydration of

  13. Species characterization in the genus Pestivirus according to palindromic nucleotide substitutions in the 5'-untranslated region.

    Science.gov (United States)

    Giangaspero, Massimo; Harasawa, Ryô

    2011-06-01

    The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the

  14. SEGMENTATION OF ENVIRONMENTAL TIME LAPSE IMAGE SEQUENCES FOR THE DETERMINATION OF SHORE LINES CAPTURED BY HAND-HELD SMARTPHONE CAMERAS

    Directory of Open Access Journals (Sweden)

    M. Kröhnert

    2017-09-01

    Full Text Available The relevance of globally environmental issues gains importance since the last years with still rising trends. Especially disastrous floods may cause in serious damage within very short times. Although conventional gauging stations provide reliable information about prevailing water levels, they are highly cost-intensive and thus just sparsely installed. Smartphones with inbuilt cameras, powerful processing units and low-cost positioning systems seem to be very suitable wide-spread measurement devices that could be used for geo-crowdsourcing purposes. Thus, we aim for the development of a versatile mobile water level measurement system to establish a densified hydrological network of water levels with high spatial and temporal resolution. This paper addresses a key issue of the entire system: the detection of running water shore lines in smartphone images. Flowing water never appears equally in close-range images even if the extrinsics remain unchanged. Its non-rigid behavior impedes the use of good practices for image segmentation as a prerequisite for water line detection. Consequently, we use a hand-held time lapse image sequence instead of a single image that provides the time component to determine a spatio-temporal texture image. Using a region growing concept, the texture is analyzed for immutable shore and dynamic water areas. Finally, the prevalent shore line is examined by the resultant shapes. For method validation, various study areas are observed from several distances covering urban and rural flowing waters with different characteristics. Future work provides a transformation of the water line into object space by image-to-geometry intersection.

  15. Segmentation of Environmental Time Lapse Image Sequences for the Determination of Shore Lines Captured by Hand-Held Smartphone Cameras

    Science.gov (United States)

    Kröhnert, M.; Meichsner, R.

    2017-09-01

    The relevance of globally environmental issues gains importance since the last years with still rising trends. Especially disastrous floods may cause in serious damage within very short times. Although conventional gauging stations provide reliable information about prevailing water levels, they are highly cost-intensive and thus just sparsely installed. Smartphones with inbuilt cameras, powerful processing units and low-cost positioning systems seem to be very suitable wide-spread measurement devices that could be used for geo-crowdsourcing purposes. Thus, we aim for the development of a versatile mobile water level measurement system to establish a densified hydrological network of water levels with high spatial and temporal resolution. This paper addresses a key issue of the entire system: the detection of running water shore lines in smartphone images. Flowing water never appears equally in close-range images even if the extrinsics remain unchanged. Its non-rigid behavior impedes the use of good practices for image segmentation as a prerequisite for water line detection. Consequently, we use a hand-held time lapse image sequence instead of a single image that provides the time component to determine a spatio-temporal texture image. Using a region growing concept, the texture is analyzed for immutable shore and dynamic water areas. Finally, the prevalent shore line is examined by the resultant shapes. For method validation, various study areas are observed from several distances covering urban and rural flowing waters with different characteristics. Future work provides a transformation of the water line into object space by image-to-geometry intersection.

  16. Precise detection of de novo single nucleotide variants in human genomes.

    Science.gov (United States)

    Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael

    2018-05-07

    The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.

  17. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal

    1983-01-01

    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  18. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  19. The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

    Science.gov (United States)

    Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

    2014-01-01

    Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

  20. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  1. Gene flow for Echinococcus granulosus metapopulations determined by mitochondrial sequences: A reliable approach for reflecting epidemiological drift of parasite among neighboring countries.

    Science.gov (United States)

    Mahami-Oskouei, Mahmoud; Kaseb-Yazdanparast, Azam; Spotin, Adel; Shahbazi, Abbas; Adibpour, Mohammad; Ahmadpour, Ehsan; Ghabouli-Mehrabani, Nader

    2016-12-01

    In genetic diversity and population structure of Echinococcus granulosus, the gene flow can illustrate how the Echinococcus isolates have epidemiologically drifted among endemic neighboring countries. 51 isolates of hydatid cysts were collected from human, dog, cattle and sheep in northwest Iran, where placed co-border with Turkey. DNA samples were extracted, amplified and subjected to sequence analysis of NADH dehydrogenase subunit 1 (nad1) and cytochrome oxidase subunit 1 (cox1) genes. As well, sequences of Echinococcus at east to the southeast regions of Turkey were retrieved from GenBank database for the cox1 gene. The confirmed isolates were grouped as G1 (n = 74) and G3 (n = 6) genotypes. 31 unique haplotypes were identified inferred by the analyzed sequences of cox1 among two distinct populations. A parsimonious network of the sequence haplotypes displayed star-like features in the overall population containing TUR1, IR15 and IR22 as the most common haplotypes. According to AMOVA test, the high value of haplotype diversity (0.94758-0.98901) of E. granulosus was reflected the total genetic variability within populations while nucleotide diversity was low (0.00727-0.01046) in Iranian and Turkish metapopulations. Neutrality indices of the cox1 were shown negative values (-15.078 to -10.057) in Echinococcus populations which indicating a significant divergence from neutrality. A pairwise fixation index (Fst) as a degree of gene flow was partially high value for all populations (0.151). The statistically Fst value indicates that E. granulosus sensu stricto (G1-G3) are genetically moderate differentiated among Iranian and Turkish isolates. The occurrence of TUR1 and IR15 elucidate that there is possibly the dawn of domestication due to transfer of alleles between populations through the diffusion of stock raising or anthropogenic movements. To evaluate the hypothetical evolutionary scenario, further exploration is necessitated to analyze isolates from

  2. Low-coverage MiSeq next generation sequencing reveals the mitochondrial genome of the Eastern Rock Lobster, Sagmariasus verreauxi.

    Science.gov (United States)

    Doyle, Stephen R; Griffith, Ian S; Murphy, Nick P; Strugnell, Jan M

    2015-01-01

    The complete mitochondrial genome of the Eastern Rock lobster, Sagmariasus verreauxi, is reported for the first time. Using low-coverage, long read MiSeq next generation sequencing, we constructed and determined the mtDNA genome organization of the 15,470 bp sequence from two isolates from Eastern Tasmania, Australia and Northern New Zealand, and identified 46 polymorphic nucleotides between the two sequences. This genome sequence and its genetic polymorphisms will likely be useful in understanding the distribution and population connectivity of the Eastern Rock Lobster, and in the fisheries management of this commercially important species.

  3. The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

    2010-11-01

    Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

  4. Determination of vitality in myocardial infarction. Comparison of single- and multi-slice MRI techniques with TurboFlash and TrueFISP sequences

    International Nuclear Information System (INIS)

    Huber, A.; Schoenberg, S.O.; Spannagl, B.; Rieber, J.; Klauss, V.; Reiser, M.F.

    2004-01-01

    The aim of the study was to compare the diagnostic accuracy in imaging viability of the myocardium with a multislice inversions recovery 2D single shot TrueFISP sequence and an established inversion recovery TurboFlash sequence. Twelve patients with myocardial infarction were examined at a 1.5 tesla MR system (Sonata, Siemens, Medical Systems) 10 min after application of a single dose multihance (0,1 mmol/kg body weight) with a 2D multislice technique (inversion recovery single shot TrueFISP), that allows to image the entire short axis during one breathhold and a 2D single slice technique (inversion recovery TurboFlash), that requires one breathhold per slice. Signal intensity was determined in normal myocardium, in the infarcted myocardium and in the left ventricle. The contrast/noise ratio of normal and infarcted myocardium was determined. The areas of hyperintense infarction were compared for both sequence techniques. The multislice single shot 2D IR-TrueFisp sequence has a lower contrast/noise ratio than the IR-TurboFlash sequence (mean values 6.9 vs. 12.5) for viable and non viable myocardium. The assessment of the volume of the infarction is possible with excellent correlation of both techniques (r=0.97, p [de

  5. Molecular cloning and characterization of genes required for nucleotide excision repair in yeast

    International Nuclear Information System (INIS)

    Friedberg, E.C.

    1987-01-01

    Nucleotide excision repair in the yeast S. cerevisiae is a complex process which involves a large number of genes. At least five of these genes (RAD1, RAD2, RAD3, RAD4 and RAD10) are absolutely required for this process and mutations in any of these genes result in no detectable excision repair in vivo. In order to understand the function of these genes in DNA repair, the authors isolated a number of them by screening a yeast genomic library for recombinant plasmids which complement the phentoype of sensitivity to ultraviolet (UV) radiation imparted to mutant strains. A plasmid containing the RAD4 gene was isolated by an alternative strategy which will be discussed. The cloned genes have been extensively characterized. It has been determined that the RAD3 gene is essential for the viability of haploid yeast cells in the absence of DNA damage. The RAD2 gene is inducible by treatment of cells with a variety of DNA-damaging agents, including UV radiation and ionizing radiation. The RAD10 gene shares considerable amino acid sequence homology with a cloned gene involved in nucleotide excision repair in human cells. Yeast is a particularly versatile organism for studying gene function by molecular and genetic approaches and emphasis is placed on many of the techniques used in the present studies

  6. The roles of the RIIβ linker and N-terminal cyclic nucleotide-binding domain in determining the unique structures of the type IIβ protein kinase A: a small angle x-ray and neutron scattering study.

    Science.gov (United States)

    Blumenthal, Donald K; Copps, Jeffrey; Smith-Nguyen, Eric V; Zhang, Ping; Heller, William T; Taylor, Susan S

    2014-10-10

    Protein kinase A (PKA) is ubiquitously expressed and is responsible for regulating many important cellular functions in response to changes in intracellular cAMP concentrations. The PKA holoenzyme is a tetramer (R2:C2), with a regulatory subunit homodimer (R2) that binds and inhibits two catalytic (C) subunits; binding of cAMP to the regulatory subunit homodimer causes activation of the catalytic subunits. Four different R subunit isoforms exist in mammalian cells, and these confer different structural features, subcellular localization, and biochemical properties upon the PKA holoenzymes they form. The holoenzyme containing RIIβ is structurally unique in that the type IIβ holoenzyme is much more compact than the free RIIβ homodimer. We have used small angle x-ray scattering and small angle neutron scattering to study the solution structure and subunit organization of a holoenzyme containing an RIIβ C-terminal deletion mutant (RIIβ(1-280)), which is missing the C-terminal cAMP-binding domain to better understand the structural organization of the type IIβ holoenzyme and the RIIβ domains that contribute to stabilizing the holoenzyme conformation. Our results demonstrate that compaction of the type IIβ holoenzyme does not require the C-terminal cAMP-binding domain but rather involves large structural rearrangements within the linker and N-terminal cyclic nucleotide-binding domain of the RIIβ homodimer. The structural rearrangements are significantly greater than seen previously with RIIα and are likely to be important in mediating short range and long range interdomain and intersubunit interactions that uniquely regulate the activity of the type IIβ isoform of PKA. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  8. Population Genetic Structure of Listeria monocytogenes Strains as Determined by Pulsed-Field Gel Electrophoresis and Multilocus Sequence Typing

    DEFF Research Database (Denmark)

    Henri, Clémentine; Félix, Benjamin; Guillier, Laurent

    2016-01-01

    on the basis of different pulsed-field gel electrophoresis (PFGE) clusters, serotypes, and strain origins and typed by multilocus sequence typing (MLST), and the MLST results were supplemented with MLST data available from Institut Pasteur, representing human and additional food strains from France....... The distribution of sequence types (STs) was compared between food and clinical strains on a panel of 675 strains. High congruence between PFGE and MLST was found. Out of 73 PFGE clusters, the two most prevalent corresponded to ST9 and ST121. Using original statistical analysis, we demonstrated that (i...

  9. Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

    Science.gov (United States)

    Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

    2008-01-01

    The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

  10. RANDNA: a random DNA sequence generator.

    Science.gov (United States)

    Piva, Francesco; Principato, Giovanni

    2006-01-01

    Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.

  11. NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

    Directory of Open Access Journals (Sweden)

    Lakshya Veer Singh

    2013-06-01

    Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

  12. Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

    Science.gov (United States)

    Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

    2013-05-01

    In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

  13. The evolution and population structure of Lactobacillus fermentum from different naturally fermented products as determined by multilocus sequence typing (MLST).

    Science.gov (United States)

    Dan, Tong; Liu, Wenjun; Song, Yuqin; Xu, Haiyan; Menghe, Bilige; Zhang, Heping; Sun, Zhihong

    2015-05-20

    Lactobacillus fermentum is economically important in the production and preservation of fermented foods. A repeatable and discriminative typing method was devised to characterize L. fermentum at the molecular level. The multilocus sequence typing (MLST) scheme developed was based on analysis of the internal sequence of 11 housekeeping gene fragments (clpX, dnaA, dnaK, groEL, murC, murE, pepX, pyrG, recA, rpoB, and uvrC). MLST analysis of 203 isolates of L. fermentum from Mongolia and seven provinces/ autonomous regions in China identified 57 sequence types (ST), 27 of which were represented by only a single isolate, indicating high genetic diversity. Phylogenetic analyses based on the sequence of the 11 housekeeping gene fragments indicated that the L. fermentum isolates analyzed belonged to two major groups. A standardized index of association (I A (S)) indicated a weak clonal population structure in L. fermentum. Split decomposition analysis indicated that recombination played an important role in generating the genetic diversity observed in L. fermentum. The results from the minimum spanning tree strongly suggested that evolution of L. fermentum STs was not correlated with geography or food-type. The MLST scheme developed will be valuable for further studies on the evolution and population structure of L. fermentum isolates used in food products.

  14. Genome Sequence Databases (Overview): Sequencing and Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  15. Livebearing or egg-laying mammals: 27 decisive nucleotides of FAM168.

    Science.gov (United States)

    Pramanik, Subrata; Kutzner, Arne; Heese, Klaus

    2017-05-23

    In the present study, we determine comprehensive molecular phylogenetic relationships of the novel myelin-associated neurite-outgrowth inhibitor (MANI) gene across the entire eukaryotic lineage. Combined computational genomic and proteomic sequence analyses revealed MANI as one of the two members of the novel family with sequence similarity 168 member (FAM168) genes, consisting of FAM168A and FAM168B, having distinct genetic differences that illustrate diversification in its biological function and genetic taxonomy across the phylogenetic tree. Phylogenetic analyses based on coding sequences of these FAM168 genes revealed that they are paralogs and that the earliest emergence of these genes occurred in jawed vertebrates such as Callorhinchus milii. Surprisingly, these two genes are absent in other chordates that have a notochord at some stage in their lives, such as branchiostoma and tunicates. In the context of phylogenetic relationships among eukaryotic species, our results demonstrate the presence of FAM168 orthologs in vertebrates ranging from Callorhinchus milii to Homo sapiens, displaying distinct taxonomic clusters, comprised of fish, amphibians, reptiles, birds, and mammals. Analyses of individual FAM168 exons in our sample provide new insights into the molecular relationships between FAM168A and FAM168B (MANI) on the one hand and livebearing and egg-laying mammals on the other hand, demonstrating that a distinctive intermediate exon 4, comprised of 27 nucleotides, appears suddenly only in FAM168A and there in the livebearing mammals only but is absent from all other species including the egg-laying mammals.

  16. MUREIN-METABOLIZING ENZYMES FROM ESCHERICHIA-COLI - SEQUENCE-ANALYSIS AND CONTROLLED OVEREXPRESSION OF THE SLT GENE, WHICH ENCODES THE SOLUBLE LYTIC TRANSGLYCOSYLASE

    NARCIS (Netherlands)

    ENGEL, H; KAZEMIER, B; KECK, W

    The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or

  17. Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal A; Gröne, Andrea; Kik, Marja J L

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  18. Complete genome sequence of frog virus 3, isolated from a strawberry poison frog (Oophaga pumilio) imported from nicaragua into the Netherlands

    NARCIS (Netherlands)

    Saucedo, Bernardo; Hughes, Joseph; Beurden, van Steven J.; Suárez, Nicolás M.; Haenen, Olga L.M.; Voorbergen-Laarman, Michal; Gröne, Andrea; Kika, Marja J.L.

    2017-01-01

    Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

  19. Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

    Science.gov (United States)

    Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

    2000-02-01

    A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

  20. Genome-wide DNA methylation maps in follicular lymphoma cells determined by methylation-enriched bisulfite sequencing.

    Directory of Open Access Journals (Sweden)

    Jeong-Hyeon Choi

    Full Text Available BACKGROUND: Follicular lymphoma (FL is a form of non-Hodgkin's lymphoma (NHL that arises from germinal center (GC B-cells. Despite the significant advances in immunotherapy, FL is still not curable. Beyond transcriptional profiling and genomics datasets, there currently is no epigenome-scale dataset or integrative biology approach that can adequately model this disease and therefore identify novel mechanisms and targets for successful prevention and treatment of FL. METHODOLOGY/PRINCIPAL FINDINGS: We performed methylation-enriched genome-wide bisulfite sequencing of FL cells and normal CD19(+ B-cells using 454 sequencing technology. The methylated DNA fragments were enriched with methyl-binding proteins, treated with bisulfite, and sequenced using the Roche-454 GS FLX sequencer. The total number of bases covered in the human genome was 18.2 and 49.3 million including 726,003 and 1.3 million CpGs in FL and CD19(+ B-cells, respectively. 11,971 and 7,882 methylated regions of interest (MRIs were identified respectively. The genome-wide distribution of these MRIs displayed significant differences between FL and normal B-cells. A reverse trend in the distribution of MRIs between the promoter and the gene body was observed in FL and CD19(+ B-cells. The MRIs identifi