Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

Science.gov (United States)

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

WEB-server for search of a periodicity in amino acid and nucleotide sequences

Science.gov (United States)

E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

2017-12-01

A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

Science.gov (United States)

The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

Energy Technology Data Exchange (ETDEWEB)

Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

1987-02-01

To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

Directory of Open Access Journals (Sweden)

Kouki Yonezawa

Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

Base Sequence Context Effects on Nucleotide Excision Repair

Directory of Open Access Journals (Sweden)

Yuqin Cai

2010-01-01

Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

Science.gov (United States)

Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

2011-01-01

Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

NARCIS (Netherlands)

Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

OpenAIRE

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-01-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

Science.gov (United States)

Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

2012-01-01

We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

Science.gov (United States)

Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

1982-11-11

The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

Energy Technology Data Exchange (ETDEWEB)

Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

1988-03-25

Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

International Nuclear Information System (INIS)

Lo, A.; Yang, H.L.

1990-01-01

This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Madura, K.; Prakash, S.

1986-01-01

The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

Science.gov (United States)

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-04-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

Science.gov (United States)

Richaud, F; Richaud, C; Ratet, P; Patte, J C

1986-01-01

In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

Nucleotide sequence of the human N-myc gene

International Nuclear Information System (INIS)

Stanton, L.W.; Schwab, M.; Bishop, J.M.

1986-01-01

Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

Energy Technology Data Exchange (ETDEWEB)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

NARCIS (Netherlands)

Steenbergh, P.H.; Sussenbach, J.S.

The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

[Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

Science.gov (United States)

Kuznedelov, K D; Timoshkin, O A

1995-01-01

Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

Science.gov (United States)

Hori, H; Osawa, S; Murao, K; Ishikura, H

1980-01-01

The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

Science.gov (United States)

Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2012-07-01

We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

Energy Technology Data Exchange (ETDEWEB)

Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

1988-09-26

The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

The nucleotide sequence of a Polish isolate of Tomato torrado virus.

Science.gov (United States)

Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

2008-12-01

A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

Science.gov (United States)

Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

1992-12-01

The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

International Nuclear Information System (INIS)

Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

1994-01-01

The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

International Nuclear Information System (INIS)

Steenbergh, P.H.

1979-01-01

The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

Science.gov (United States)

Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

2005-05-01

The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

Directory of Open Access Journals (Sweden)

Shui-Lian He

Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

Science.gov (United States)

He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

2015-01-01

Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

The nucleotide sequence of human transition protein 1 cDNA

Energy Technology Data Exchange (ETDEWEB)

Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

Science.gov (United States)

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Sequencing genes in silico using single nucleotide polymorphisms

Directory of Open Access Journals (Sweden)

Zhang Xinyi

2012-01-01

Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

Palindromic nucleotide analysis in human T cell receptor rearrangements.

Directory of Open Access Journals (Sweden)

Santosh K Srivastava

Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

Partial sequence determination of metabolically labeled radioactive proteins and peptides

International Nuclear Information System (INIS)

Anderson, C.W.

1982-01-01

The author has used the sequence analysis of radioactive proteins and peptides to approach several problems during the past few years. They, in collaboration with others, have mapped precisely several adenovirus proteins with respect to the nucleotide sequence of the adenovirus genome; identified hitherto missed proteins encoded by bacteriophage MS2 and by simian virus 40; analyzed the aminoterminal maturation of several virus proteins; determined the cleavage sites for processing of the poliovirus polyprotein; and analyzed the mechanism of frameshifting by excess normal tRNAs during cell-free protein synthesis. This chapter is designed to aid those without prior experience at protein sequence determinations. It is based primarily on the experience gained in the studies cited above, which made use of the Beckman 890 series automated protein sequencers

Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

Science.gov (United States)

Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

2017-12-01

The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

Science.gov (United States)

Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

2018-01-10

Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

Directory of Open Access Journals (Sweden)

Cheng-Chong Chou

2004-11-01

Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

Science.gov (United States)

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

2008-04-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

Science.gov (United States)

Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

2008-01-01

The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

Directory of Open Access Journals (Sweden)

Yu-Hoon Kim

2014-01-01

Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.

An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

Directory of Open Access Journals (Sweden)

Tautz Diethard

2002-03-01

Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

Science.gov (United States)

Li, Hongshan; Dai, Huaguo; Wei, Hui

2005-01-01

A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

Science.gov (United States)

Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

2009-01-01

The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

Directory of Open Access Journals (Sweden)

Boulund Fredrik

2012-12-01

Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

CLONING AND SEQUENCING OF PSEUDOMONAS GENES DETERMINING SODIUM DODECYL-SULFATE BIODEGRADATION

NARCIS (Netherlands)

DAVISON, J; BRUNEL, F; PHANOPOULOS, A; PROZZI, D; TERPSTRA, P

1992-01-01

The nucleotide sequences of two genes involved in sodium dodecyl sulfate (SDS) degradation, by Pseudomonas, have been determined. One of these, sdsA, codes for an alkyl sulfatase (58 957 Da) and has similarity (31.8% identity over a 201-amino acid stretch) to the N terminus of a predicted protein of

Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

NARCIS (Netherlands)

Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

2005-01-01

The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

Science.gov (United States)

Dunn, Joshua G; Weissman, Jonathan S

2016-11-22

Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

Sequence determinants of human microsatellite variability

Directory of Open Access Journals (Sweden)

Jakobsson Mattias

2009-12-01

Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

Science.gov (United States)

Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

2016-03-01

The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

Science.gov (United States)

2010-07-01

... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...

The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

Science.gov (United States)

Hammond, R W; Crosslin, J M

1995-04-01

The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

Science.gov (United States)

Le Gall, O; Candresse, T; Dunez, J

1988-02-01

Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

Science.gov (United States)

Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

2012-09-08

The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

Science.gov (United States)

Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

1998-07-01

An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

Science.gov (United States)

Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

Energy Technology Data Exchange (ETDEWEB)

Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

1988-07-25

The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

Directory of Open Access Journals (Sweden)

White Frank F

2011-07-01

Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

Science.gov (United States)

Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

2012-07-01

Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

Science.gov (United States)

Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

2010-09-01

The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

International Nuclear Information System (INIS)

Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

1988-01-01

Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

Science.gov (United States)

Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

2003-01-01

A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

Science.gov (United States)

Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

2011-04-01

A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1987-01-01

The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

Comparative In silico Study of Sex-Determining Region Y (SRY) Protein Sequences Involved in Sex-Determining.

Science.gov (United States)

Vakili Azghandi, Masoume; Nasiri, Mohammadreza; Shamsa, Ali; Jalali, Mohsen; Shariati, Mohammad Mahdi

2016-04-01

The SRY gene (SRY) provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/) and MEGA6 softwares. The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale) and Tursiopsaduncus (dolphin) have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee) have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

Directory of Open Access Journals (Sweden)

Meiler Arno

2012-09-01

Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

Science.gov (United States)

2012-01-01

Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

International Nuclear Information System (INIS)

Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

1987-01-01

Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

Science.gov (United States)

Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

2015-01-01

Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

Directory of Open Access Journals (Sweden)

Francesca Bertolini

Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

OpenAIRE

Liljeström, P L; Liljeström, P

1987-01-01

Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

Science.gov (United States)

2010-07-01

... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

Science.gov (United States)

Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

1998-01-01

Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

International Nuclear Information System (INIS)

Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

1987-01-01

Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

Science.gov (United States)

Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

2013-07-01

The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

Science.gov (United States)

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

Comparative In silico Study of Sex-Determining Region Y (SRY Protein Sequences Involved in Sex-Determining

Directory of Open Access Journals (Sweden)

Masoume Vakili Azghandi

2016-05-01

Full Text Available Background: The SRY gene (SRY provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Methods: Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/ and MEGA6 softwares. Results: The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale and Tursiopsaduncus (dolphin have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. Conclusion: These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

DEFF Research Database (Denmark)

Leonardsen, L; DeClue, J E; Lybaek, H

1996-01-01

The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

Science.gov (United States)

Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

2002-06-05

The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

Science.gov (United States)

Nishizawa, M; Nishizawa, K

2000-10-01

The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

Energy Technology Data Exchange (ETDEWEB)

Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

2007-02-21

Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

Science.gov (United States)

Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

2004-01-01

Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

Nucleotide sequence analysis of HTLV-I isolated from cerebrospinal fluid of a patient with TSP/HAM: comparison to other HTLV-I isolates.

Science.gov (United States)

Mukhopadhyaya, R; Sadaie, M R

1993-02-01

Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.

Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

Science.gov (United States)

Sánchez-Navarro, J A; Pallás, V

1997-01-01

The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

Science.gov (United States)

Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

2012-10-01

To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

Characterization of Sri Lanka rabies virus isolates using nucleotide sequence analysis of nucleoprotein gene.

Science.gov (United States)

Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L

2001-01-01

Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.

Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

Science.gov (United States)

Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

2014-11-01

In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

Directory of Open Access Journals (Sweden)

Yuki Furuse

2015-11-01

Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

DEFF Research Database (Denmark)

Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

2014-01-01

The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...

Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

NARCIS (Netherlands)

Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

Complete genome sequence of a novel Plum pox virus strain W isolate determined by 454 pyrosequencing.

Science.gov (United States)

Sheveleva, Anna; Kudryavtseva, Anna; Speranskaya, Anna; Belenikin, Maxim; Melnikova, Natalia; Chirkov, Sergei

2013-10-01

The near-complete (99.7 %) genome sequence of a novel Russian Plum pox virus (PPV) isolate Pk, belonging to the strain Winona (W), has been determined by 454 pyrosequencing with the exception of the thirty-one 5'-terminal nucleotides. This region was amplified using 5'RACE kit and sequenced by the Sanger method. Genomic RNA released from immunocaptured PPV particles was employed for generation of cDNA library using TransPlex Whole transcriptome amplification kit (WTA2, Sigma-Aldrich). The entire Pk genome has identity level of 92.8-94.5 % when compared to the complete nucleotide sequences of other PPV-W isolates (W3174, LV-141pl, LV-145bt, and UKR 44189), confirming a high degree of variability within the PPV-W strain. The isolates Pk and LV-141pl are most closely related. The Pk has been found in a wild plum (Prunus domestica) in a new region of Russia indicating widespread dissemination of the PPV-W strain in the European part of the former USSR.

A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

Science.gov (United States)

Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

2002-12-01

There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India

Directory of Open Access Journals (Sweden)

Sukdeb Nandi

2010-03-01

Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India

Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

Science.gov (United States)

Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

2010-01-01

Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

Science.gov (United States)

Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

2018-04-01

Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

Directory of Open Access Journals (Sweden)

Andréia B. Poletto

2008-01-01

Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

Science.gov (United States)

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

Science.gov (United States)

Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

2017-08-01

A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

Four new single nucleotide polymorphisms (SNPs) of toll-like ...

African Journals Online (AJOL)

In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

Science.gov (United States)

Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

2015-02-01

There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

Directory of Open Access Journals (Sweden)

Erena A. Edae

2013-07-01

Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

Science.gov (United States)

Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

2016-01-01

Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

DEFF Research Database (Denmark)

Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

2013-01-01

Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

[Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

Science.gov (United States)

Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

2014-04-01

Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

Science.gov (United States)

Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

2013-01-01

Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

Science.gov (United States)

Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

2017-07-01

DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

International Nuclear Information System (INIS)

Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

1998-01-01

To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

Genetic Relationships among Reptilian and Mammalian Campylobacter fetus Strains Determined by Multilocus Sequence Typing

NARCIS (Netherlands)

Dingle, K.E.; Blaser, M.J.; Tu, Z.C.; Pruckler, J.; Fitzgerald, C.; Bergen, van M.A.P.; Lawson, A.J.; Owen, R.J.; Wagenaar, J.A.

2010-01-01

Reptile Campylobacter fetus isolates and closely related strains causing human disease were characterized by multilocus sequence typing. They shared similar to 90% nucleotide sequence identity with classical mammalian C. fetus, and there was evidence of recombination among members of these two

Main: Nucleotide Analysis [KOME

Lifescience Database Archive (English)

Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

Science.gov (United States)

Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

2010-12-01

Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

Nucleotide sequences of the Erwinia chrysanthemi ogl and pelE genes negatively regulated by the kdgR gene product.

Science.gov (United States)

Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J

1989-12-21

The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)

The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

Science.gov (United States)

Štambuk, Nikola

The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

Sequence determination and analysis of the NSs genes of two tospoviruses.

Science.gov (United States)

Hallwass, Mariana; Leastro, Mikhail O; Lima, Mirtes F; Inoue-Nagata, Alice K; Resende, Renato O

2012-03-01

The tospoviruses groundnut ringspot virus (GRSV) and zucchini lethal chlorosis virus (ZLCV) cause severe losses in many crops, especially in solanaceous and cucurbit species. In this study, the non-structural NSs gene and the 5'UTRs of these two biologically distinct tospoviruses were cloned and sequenced. The NSs sequence of GRSV and ZLCV were both 1,404 nucleotides long. Pairwise comparison showed that the NSs amino acid sequence of GRSV shared 69.6% identity with that of ZLCV and 75.9% identity with that of TSWV, while the NSs sequence of ZLCV and TSWV shared 67.9% identity. Phylogenetic analysis based on NSs sequences confirmed that these viruses cluster in the American clade.

Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

Science.gov (United States)

Wolf, P

1997-10-01

Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

The proviral genome of radiation leukemia virus: Molecular cloning, nucleotide sequence of its long terminal repeat and integration in lymphoma cell DNA

International Nuclear Information System (INIS)

Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.

1985-01-01

The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy

Determination of 5 '-leader sequences from radically disparate strains of porcine reproductive and respiratory syndrome virus reveals the presence of highly conserved sequence motifs

DEFF Research Database (Denmark)

Oleksiewicz, M.B.; Bøtner, Anette; Nielsen, Jens

1999-01-01

We determined the untranslated 5'-leader sequence for three different isolates of porcine reproductive and respiratory syndrome virus (PRRSV): pathogenic European- and American-types, as well as an American-type vaccine strain. 5'-leader from European- and American-type PRRSV differed in length...... (220 and 190 nt, respectively), and exhibited only approximately 50% nucleotide homology. Nevertheless, highly conserved areas were identified in the leader of all 3 PRRSV isolates, which constitute candidate motifs for binding of protein(s) involved in viral replication. These comparative data provide...

Rate-determining Step of Flap Endonuclease 1 (FEN1) Reflects a Kinetic Bias against Long Flaps and Trinucleotide Repeat Sequences.

Science.gov (United States)

Tarantino, Mary E; Bilotti, Katharina; Huang, Ji; Delaney, Sarah

2015-08-21

Flap endonuclease 1 (FEN1) is a structure-specific nuclease responsible for removing 5'-flaps formed during Okazaki fragment maturation and long patch base excision repair. In this work, we use rapid quench flow techniques to examine the rates of 5'-flap removal on DNA substrates of varying length and sequence. Of particular interest are flaps containing trinucleotide repeats (TNR), which have been proposed to affect FEN1 activity and cause genetic instability. We report that FEN1 processes substrates containing flaps of 30 nucleotides or fewer at comparable single-turnover rates. However, for flaps longer than 30 nucleotides, FEN1 kinetically discriminates substrates based on flap length and flap sequence. In particular, FEN1 removes flaps containing TNR sequences at a rate slower than mixed sequence flaps of the same length. Furthermore, multiple-turnover kinetic analysis reveals that the rate-determining step of FEN1 switches as a function of flap length from product release to chemistry (or a step prior to chemistry). These results provide a kinetic perspective on the role of FEN1 in DNA replication and repair and contribute to our understanding of FEN1 in mediating genetic instability of TNR sequences. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

Science.gov (United States)

Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

2017-01-25

The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

NARCIS (Netherlands)

I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

1993-01-01

textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

Directory of Open Access Journals (Sweden)

Jacqueline Morris

2017-12-01

Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

Directory of Open Access Journals (Sweden)

Salem Mohamed

2009-11-01

Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

Science.gov (United States)

Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

2009-11-25

To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

Science.gov (United States)

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-09-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

Directory of Open Access Journals (Sweden)

Moore JE

2006-01-01

Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

Science.gov (United States)

Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

2006-01-01

Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

Science.gov (United States)

Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

2017-07-01

The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

Science.gov (United States)

Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

2016-01-01

Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

Science.gov (United States)

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

An extended sequence specificity for UV-induced DNA damage.

Science.gov (United States)

Chung, Long H; Murray, Vincent

2018-01-01

The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

Condensing the information in DNA with double-headed nucleotides

DEFF Research Database (Denmark)

Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

2017-01-01

A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays

DEFF Research Database (Denmark)

Dobrowolska, G; Boldyreff, B; Issinger, O G

1991-01-01

The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...... subunit and 71% identity to the alpha' subunit of human casein kinase 2....

Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

Science.gov (United States)

Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

2016-06-01

As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

The arabidopsis cyclic nucleotide interactome

KAUST Repository

Donaldson, Lara Elizabeth

2016-05-11

Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

Nucleotide Sequence and Analysis of an orotate transporter-containing plasmid isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410

DEFF Research Database (Denmark)

Defoor, Els Marie Celine; Martinussen, Jan

A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...

JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

Science.gov (United States)

Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

2017-01-01

Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

Science.gov (United States)

Dong, Min; Graham, Mitchell; Yadav, Nehul

2017-01-01

Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

Directory of Open Access Journals (Sweden)

Jieming Shi

Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

Science.gov (United States)

Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

2016-09-01

Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

African Journals Online (AJOL)

Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

Science.gov (United States)

Guo, D; Maiss, E; Adam, G; Casper, R

1995-05-01

The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

Science.gov (United States)

Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

2015-01-01

Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

Quantum-Sequencing: Fast electronic single DNA molecule sequencing

Science.gov (United States)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

Science.gov (United States)

Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

2013-06-01

Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

Nucleotide and deduced amino acid sequence of the envelope gene of the Vasilchenko strain of TBE virus; comparison with other flaviviruses.

Science.gov (United States)

Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A

1993-02-01

A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.

Computational learning on specificity-determining residue-nucleotide interactions

KAUST Repository

Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

2015-01-01

The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

Computational learning on specificity-determining residue-nucleotide interactions

KAUST Repository

Wong, Ka-Chun

2015-11-02

The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

African Journals Online (AJOL)

STORAGESEVER

2009-06-17

Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

Science.gov (United States)

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Single Nucleotide Polymorphism

DEFF Research Database (Denmark)

Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

2014-01-01

Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

Science.gov (United States)

Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

2008-01-01

The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

Data.gov (United States)

US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

Science.gov (United States)

Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

2016-03-22

Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

Science.gov (United States)

Nallaseth, Ferez Soli

The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1

Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

Directory of Open Access Journals (Sweden)

Desirée Villahermosa

2017-05-01

Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

Science.gov (United States)

Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

Science.gov (United States)

Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

2017-09-01

In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

DEFF Research Database (Denmark)

Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili

2013-01-01

In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...

Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.

Science.gov (United States)

Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P

1997-11-01

A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.

Applications of High Throughput Nucleotide Sequencing

DEFF Research Database (Denmark)

Waage, Johannes Eichler

equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

A 19-nucleotide insertion in the leader sequence of avian leukosis virus subgroup J contributes to its replication in vitro but is not related to its pathogenicity in vivo.

Directory of Open Access Journals (Sweden)

Xiaolin Ji

Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.

Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

DEFF Research Database (Denmark)

Liu, Siyang; Huang, Shujia; Rao, Junhua

2015-01-01

present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

Optimization of sequence alignment for simple sequence repeat regions

Directory of Open Access Journals (Sweden)

Ogbonnaya Francis C

2011-07-01

Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic

FASH: A web application for nucleotides sequence search

Directory of Open Access Journals (Sweden)

Chew Paul

2008-05-01

Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

Directory of Open Access Journals (Sweden)

Ji-Sun Park

2015-01-01

Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

The mitochondrial genome sequence of the ciliate Paramecium caudatum reveals a shift in nucleotide composition and codon usage within the genus Paramecium

Directory of Open Access Journals (Sweden)

Berendonk Thomas U

2011-05-01

Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino

The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences

Directory of Open Access Journals (Sweden)

Ivan V. Stepanyan

2017-01-01

Full Text Available The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.

The genomic sequence of cowpea aphid-borne mosaic virus and its similarities with other potyviruses

NARCIS (Netherlands)

Mlotshwa, S.; Verver, J.; Sithole-Niang, I.; Kampen, van T.; Kammen, van A.; Wellink, J.

2002-01-01

The genomic sequence of a Zimbabwe isolate of Cowpea aphid-borne mosaic virus (CABMV-Z) was determined by sequencing overlapping viral cDNA clones generated by RT-PCR using degenerate and/or specific primers. The sequence is 9465 nucleotides in length excluding the 3' terminal poly (A) tail and

Classifying Coding DNA with Nucleotide Statistics

Directory of Open Access Journals (Sweden)

Nicolas Carels

2009-10-01

Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.

Directory of Open Access Journals (Sweden)

Peter Norberg

Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

Cloning, sequencing, and sequence analysis of two novel plasmids from the thermophilic anaerobic bacterium Anaerocellum thermophilum

DEFF Research Database (Denmark)

Clausen, Anders; Mikkelsen, Marie Just; Schrøder, I.

2004-01-01

The nucleotide sequence of two novel plasmids isolated from the extreme thermophilic anaerobic bacterium Anaerocellum thermophilum DSM6725 (A. thermophilum), growing optimally at 70degreesC, has been determined. pBAS2 was found to be a 3653 bp plasmid with a GC content of 43%, and the sequence re...... with highest similarity to DNA repair protein from Campylobacter jejuni (25% aa). Orf34 showed similarity to sigma factors with highest similarity (28% aa) to the sporulation specific Sigma factor, Sigma 28(K) from Bacillus thuringiensis....

Protein and DNA sequence determinants of thermophilic adaptation.

Directory of Open Access Journals (Sweden)

Konstantin B Zeldovich

2007-01-01

Full Text Available There have been considerable attempts in the past to relate phenotypic trait--habitat temperature of organisms--to their genotypes, most importantly compositions of their genomes and proteomes. However, despite accumulation of anecdotal evidence, an exact and conclusive relationship between the former and the latter has been elusive. We present an exhaustive study of the relationship between amino acid composition of proteomes, nucleotide composition of DNA, and optimal growth temperature (OGT of prokaryotes. Based on 204 complete proteomes of archaea and bacteria spanning the temperature range from -10 degrees C to 110 degrees C, we performed an exhaustive enumeration of all possible sets of amino acids and found a set of amino acids whose total fraction in a proteome is correlated, to a remarkable extent, with the OGT. The universal set is Ile, Val, Tyr, Trp, Arg, Glu, Leu (IVYWREL, and the correlation coefficient is as high as 0.93. We also found that the G + C content in 204 complete genomes does not exhibit a significant correlation with OGT (R = -0.10. On the other hand, the fraction of A + G in coding DNA is correlated with temperature, to a considerable extent, due to codon patterns of IVYWREL amino acids. Further, we found strong and independent correlation between OGT and the frequency with which pairs of A and G nucleotides appear as nearest neighbors in genome sequences. This adaptation is achieved via codon bias. These findings present a direct link between principles of proteins structure and stability and evolutionary mechanisms of thermophylic adaptation. On the nucleotide level, the analysis provides an example of how nature utilizes codon bias for evolutionary adaptation to extreme conditions. Together these results provide a complete picture of how compositions of proteomes and genomes in prokaryotes adjust to the extreme conditions of the environment.

Antinociceptive effect of purine nucleotides.

Science.gov (United States)

Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

1996-10-01

The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

RANDNA: a random DNA sequence generator.

Science.gov (United States)

Piva, Francesco; Principato, Giovanni

2006-01-01

Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.

The complete nucleotide sequences of the 5 genetically distinct plastid genomes of Oenothera, subsection Oenothera: II. A microevolutionary view using bioinformatics and formal genetic data.

Science.gov (United States)

Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg

2008-09-01

A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.

Complete genome sequence of pronghorn virus, a pestivirus

Science.gov (United States)

The complete genome sequence of Pronghorn virus, a member of the Pestivirus genus of the Flaviviridae, was determined. The virus, originally isolated from a pronghorn antelope, had a genome of 12,287 nucleotides with a single open reading frame of 11,694 bases encoding 3898 amino acids....

Cloning, sequencing and expression of a xylanase gene from the maize pathogen Helminthosporium turcicum

DEFF Research Database (Denmark)

Degefu, Y.; Paulin, L.; Lübeck, Peter Stephensen

2001-01-01

A gene encoding an endoxylanase from the phytopathogenic fungus Helminthosporium turcicum Pass. was cloned and sequenced. The entire nucleotide sequence of a 1991 bp genomic fragment containing an endoxylanase gene was determined. The xylanase gene of 795 bp, interrupted by two introns of 52 and ...

Mason: a JavaScript web site widget for visualizing and comparing annotated features in nucleotide or protein sequences.

Science.gov (United States)

Jaschob, Daniel; Davis, Trisha N; Riffle, Michael

2015-03-07

Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.

Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

Directory of Open Access Journals (Sweden)

Li Xuehui

2012-10-01

Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

Science.gov (United States)

Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

2018-03-01

Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

Mixed Sequence Reader: A Program for Analyzing DNA Sequences with Heterozygous Base Calling

Science.gov (United States)

Chang, Chun-Tien; Tsai, Chi-Neu; Tang, Chuan Yi; Chen, Chun-Houh; Lian, Jang-Hau; Hu, Chi-Yu; Tsai, Chia-Lung; Chao, Angel; Lai, Chyong-Huey; Wang, Tzu-Hao; Lee, Yun-Shien

2012-01-01

The direct sequencing of PCR products generates heterozygous base-calling fluorescence chromatograms that are useful for identifying single-nucleotide polymorphisms (SNPs), insertion-deletions (indels), short tandem repeats (STRs), and paralogous genes. Indels and STRs can be easily detected using the currently available Indelligent or ShiftDetector programs, which do not search reference sequences. However, the detection of other genomic variants remains a challenge due to the lack of appropriate tools for heterozygous base-calling fluorescence chromatogram data analysis. In this study, we developed a free web-based program, Mixed Sequence Reader (MSR), which can directly analyze heterozygous base-calling fluorescence chromatogram data in .abi file format using comparisons with reference sequences. The heterozygous sequences are identified as two distinct sequences and aligned with reference sequences. Our results showed that MSR may be used to (i) physically locate indel and STR sequences and determine STR copy number by searching NCBI reference sequences; (ii) predict combinations of microsatellite patterns using the Federal Bureau of Investigation Combined DNA Index System (CODIS); (iii) determine human papilloma virus (HPV) genotypes by searching current viral databases in cases of double infections; (iv) estimate the copy number of paralogous genes, such as β-defensin 4 (DEFB4) and its paralog HSPDP3. PMID:22778697

Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

Directory of Open Access Journals (Sweden)

Arehart Eric

2009-03-01

Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

The complete genomic sequence of a tentative new polerovirus identified in barley in South Korea.

Science.gov (United States)

Zhao, Fumei; Lim, Seungmo; Yoo, Ran Hee; Igori, Davaajargal; Kim, Sang-Min; Kwak, Do Yeon; Kim, Sun Lim; Lee, Bong Choon; Moon, Jae Sun

2016-07-01

The complete nucleotide sequence of a new barley polerovirus, tentatively named barley virus G (BVG), which was isolated in Gimje, South Korea, has been determined using an RNA sequencing technique combined with polymerase chain reaction methods. The viral genomic RNA of BVG is 5,620 nucleotides long and contains six typical open reading frames commonly observed in other poleroviruses. Sequence comparisons revealed that BVG is most closely related to maize yellow dwarf virus-RMV, with the highest amino acid identities being less than 90 % for all of the corresponding proteins. These results suggested that BVG is a member of a new species in the genus Polerovirus.

Recommendations to address the difficulties encountered when determining linezolid resistance from whole genome sequencing data.

Science.gov (United States)

Beukers, Alicia G; Hasman, Henrik; Hegstad, Kristin; van Hal, Sebastiaan J

2018-05-29

Mutations associated with linezolid resistance within the V domain of 23S rRNA are annotated using an Escherichia coli numbering system. The 23S rRNA gene varies in length, nucleotide sequence and copy number between bacterial species. Consequently, this numbering system is not intuitive and can lead to confusion when locating mutation sites using whole genome sequencing data. Using the mutation G2576T as an example, we demonstrate the difficulties associated with using the E. coli numbering system. © Crown copyright 2018.

Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

Science.gov (United States)

Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

2016-06-01

Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1.

Science.gov (United States)

Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi

2016-12-01

The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

Supplementary Material for: The arabidopsis cyclic nucleotide interactome

KAUST Repository

Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

2016-01-01

Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

Directory of Open Access Journals (Sweden)

Marcos César Lima de Mendonça

2011-06-01

Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

Identifying a few foot-and-mouth disease virus signature nucleotide strings for computational genotyping

Directory of Open Access Journals (Sweden)

Xu Lizhe

2008-06-01

Full Text Available Abstract Background Serotypes of the Foot-and-Mouth disease viruses (FMDVs were generally determined by biological experiments. The computational genotyping is not well studied even with the availability of whole viral genomes, due to uneven evolution among genes as well as frequent genetic recombination. Naively using sequence comparison for genotyping is only able to achieve a limited extent of success. Results We used 129 FMDV strains with known serotype as training strains to select as many as 140 most serotype-specific nucleotide strings. We then constructed a linear-kernel Support Vector Machine classifier using these 140 strings. Under the leave-one-out cross validation scheme, this classifier was able to assign correct serotype to 127 of these 129 strains, achieving 98.45% accuracy. It also assigned serotype correctly to an independent test set of 83 other FMDV strains downloaded separately from NCBI GenBank. Conclusion Computational genotyping is much faster and much cheaper than the wet-lab based biological experiments, upon the availability of the detailed molecular sequences. The high accuracy of our proposed method suggests the potential of utilizing a few signature nucleotide strings instead of whole genomes to determine the serotypes of novel FMDV strains.

The R package otu2ot for implementing the entropy decomposition of nucleotide variation in sequence data

Directory of Open Access Journals (Sweden)

Alban eRamette

2014-11-01

Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.

Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. lactis DSM 7290, and partial characterization of the enzyme.

Science.gov (United States)

Vongerichten, K F; Klein, J R; Matern, H; Plapp, R

1994-10-01

Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.

The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome

NARCIS (Netherlands)

Chen, X.; IJkel, W.F.J.; Tarchini, R.; Sun, X.; Sandbrink, H.; Wang, H.; Peters, S.; Zuidema, D.; Klein Lankhorst, R.; Vlak, J.M.; Hu, Z.

2001-01-01

The nucleotide sequence of the Helicoverpa armigera single-nucleocapsid nucleopolyhedrovirus (HaSNPV) DNA genome was determined and analysed. The circular genome encompasses 131 403 bp, has a G C content of 39.1 molnd contains five homologous regions with a unique pattern of repeats.

Differential sequence diversity at merozoite surface protein-1 locus of Plasmodium knowlesi from humans and macaques in Thailand.

Science.gov (United States)

Putaporntip, Chaturong; Thongaree, Siriporn; Jongwutiwes, Somchai

2013-08-01

To determine the genetic diversity and potential transmission routes of Plasmodium knowlesi, we analyzed the complete nucleotide sequence of the gene encoding the merozoite surface protein-1 of this simian malaria (Pkmsp-1), an asexual blood-stage vaccine candidate, from naturally infected humans and macaques in Thailand. Analysis of Pkmsp-1 sequences from humans (n=12) and monkeys (n=12) reveals five conserved and four variable domains. Most nucleotide substitutions in conserved domains were dimorphic whereas three of four variable domains contained complex repeats with extensive sequence and size variation. Besides purifying selection in conserved domains, evidence of intragenic recombination scattering across Pkmsp-1 was detected. The number of haplotypes, haplotype diversity, nucleotide diversity and recombination sites of human-derived sequences exceeded that of monkey-derived sequences. Phylogenetic networks based on concatenated conserved sequences of Pkmsp-1 displayed a character pattern that could have arisen from sampling process or the presence of two independent routes of P. knowlesi transmission, i.e. from macaques to human and from human to humans in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

Cloning and sequence analysis of a partial CDS of leptospiral ligA gene in pET-32a - Escherichia coli DH5α system

Directory of Open Access Journals (Sweden)

Manju Soman

2018-04-01

Full Text Available Aim: This study aims at cloning, sequencing, and phylogenetic analysis of a partial CDS of ligA gene in pET-32a - Escherichia coli DH5α system, with the objective of identifying the conserved nature of the ligA gene in the genus Leptospira. Materials and Methods: A partial CDS (nucleotide 1873 to nucleotide 3363 of the ligA gene was amplified from genomic DNA of Leptospira interrogans serovar Canicola by polymerase chain reaction (PCR. The PCR-amplified DNA was cloned into pET-32a vector and transformed into competent E. coli DH5α bacterial cells. The partial ligA gene insert was sequenced and the nucleotide sequences obtained were aligned with the published ligA gene sequences of other Leptospira serovars, using nucleotide BLAST, NCBI. Phylogenetic analysis of the gene sequence was done by maximum likelihood method using Mega 6.06 software. Results: The PCR could amplify the 1491 nucleotide sequence spanning from nucleotide 1873 to nucleotide 3363 of the ligA gene and the partial ligA gene could be successfully cloned in E. coli DH5α cells. The nucleotide sequence when analyzed for homology with the reported gene sequences of other Leptospira serovars was found to have 100% homology to the 1910 bp to 3320 bp sequence of ligA gene of L. interrogans strain Kito serogroup Canicola. The predicted protein consisted of 470 aminoacids. Phylogenetic analysis revealed that the ligA gene was conserved in L. interrogans species. Conclusion: The partial ligA gene could be successfully cloned and sequenced from E. coli DH5α cells. The sequence showed 100% homology to the published ligA gene sequences. The phylogenetic analysis revealed the conserved nature of the ligA gene. Further studies on the expression and immunogenicity of the partial LigA protein need to be carried out to determine its competence as a subunit vaccine candidate.

Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

Science.gov (United States)

Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

2012-01-01

Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

Turn-on fluorescence probes based on pyranine/viologen charge-transfer complexes for the determination of nucleotides

Energy Technology Data Exchange (ETDEWEB)

Schäferling, Michael, E-mail: Michael.schaeferling@utu.fi; Lang, Thomas; Schnettelker, Annette

2014-10-15

The formation of ground state charge-transfer complexes between pyranine (8-hydroxypyrene-1,3,6-trisulfonic acid) and viologen (paraquat) derivatives is utilized for the design of novel fluoroionophores for the determination of phosphate species, particularly of nucleotides. The strong quenching of the pyranine fluorescence by viologen-type charge transfer acceptors can be countermanded if these are functionalized with triethylammonium groups that serve as recognition elements for phosphate anions. We report on the fluorogenic responses of these water-soluble molecular probes in presence of different phosphates. Absorbance measurements give additional information on the charge transfer complex formation and the interaction with nucleotides. The experimental data show that these aggregates form attractive, simple and versatile fluorescence turn-on probes for nucleoside triphosphates. The reversibility of the fluorescence response is demonstrated by means of an enzymatic model assay using ATPase for the decomposition of adenosine triphosphate. - Highlights: • Pyranine/viologen charge-transfer complexes as molecular probe for ATP recognition. • Fluorescence turn on mechanism. • Selective compared to other nucleotides and phosphate anions. • Fast and reversible response applicable to monitor enzymatic reactions.

AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

Science.gov (United States)

Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

2009-01-01

The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

Genome-wide SNP identification by high-throughput sequencing and selective mapping allows sequence assembly positioning using a framework genetic linkage map

Directory of Open Access Journals (Sweden)

Xu Xiangming

2010-12-01

Full Text Available Abstract Background Determining the position and order of contigs and scaffolds from a genome assembly within an organism's genome remains a technical challenge in a majority of sequencing projects. In order to exploit contemporary technologies for DNA sequencing, we developed a strategy for whole genome single nucleotide polymorphism sequencing allowing the positioning of sequence contigs onto a linkage map using the bin mapping method. Results The strategy was tested on a draft genome of the fungal pathogen Venturia inaequalis, the causal agent of apple scab, and further validated using sequence contigs derived from the diploid plant genome Fragaria vesca. Using our novel method we were able to anchor 70% and 92% of sequences assemblies for V. inaequalis and F. vesca, respectively, to genetic linkage maps. Conclusions We demonstrated the utility of this approach by accurately determining the bin map positions of the majority of the large sequence contigs from each genome sequence and validated our method by mapping single sequence repeat markers derived from sequence contigs on a full mapping population.

RNA2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location.

Science.gov (United States)

Serghini, M A; Fuchs, M; Pinck, M; Reinbolt, J; Walter, B; Pinck, L

1990-07-01

The nucleotide sequence of the genomic RNA2 (3774 nucleotides) of grapevine fanleaf virus strain F13 was determined from overlapping cDNA clones and its genetic organization was deduced. Two rapid and efficient methods were used for cDNA cloning of the 5' region of RNA2. The complete sequence contained only one long open reading frame of 3555 nucleotides (1184 codons, 131K product). The analysis of the N-terminal sequence of purified coat protein (CP) and identification of its C-terminal residue have allowed the CP cistron to be precisely positioned within the polyprotein. The CP produced by proteolytic cleavage at the Arg/Gly site between residues 680 and 681 contains 504 amino acids (Mr 56019) and has hydrophobic properties. The Arg/Gly cleavage site deduced by N-terminal amino acid sequence analysis is the first for a nepovirus coat protein and for plant viruses expressing their genomic RNAs by polyprotein synthesis. Comparison of GFLV RNA2 with M RNA of cowpea mosaic comovirus and with RNA2 of two closely related nepoviruses, tomato black ring virus and Hungarian grapevine chrome mosaic virus, showed strong similarities among the 3' non-coding regions but less similarity among the 5' end non-coding sequences than reported among other nepovirus RNAs.

Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

Science.gov (United States)

Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

2004-10-01

flexibility. To determine whether biased reconstructions using optimization methods might affect inferences of functional properties, ancestral primate mitochondrial tRNA sequences were inferred and helix-forming propensities for conserved pairs were evaluated in silico. For ambiguously reconstructed nucleotides at sites with high base composition variability, ancestral tRNA sequences from Bayesian analyses were more compatible with canonical base pairing than were those inferred by other methods. Thus, nucleotide bias in reconstructed sequences apparently can lead to serious bias and inaccuracies in functional predictions.

Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

Science.gov (United States)

Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

2015-11-01

The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

Directory of Open Access Journals (Sweden)

Budzanivska I. G.

2014-03-01

Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

International Nuclear Information System (INIS)

Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.

1987-01-01

The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

Precise detection of de novo single nucleotide variants in human genomes.

Science.gov (United States)

Gómez-Romero, Laura; Palacios-Flores, Kim; Reyes, José; García, Delfino; Boege, Margareta; Dávila, Guillermo; Flores, Margarita; Schatz, Michael C; Palacios, Rafael

2018-05-07

The precise determination of de novo genetic variants has enormous implications across different fields of biology and medicine, particularly personalized medicine. Currently, de novo variations are identified by mapping sample reads from a parent-offspring trio to a reference genome, allowing for a certain degree of differences. While widely used, this approach often introduces false-positive (FP) results due to misaligned reads and mischaracterized sequencing errors. In a previous study, we developed an alternative approach to accurately identify single nucleotide variants (SNVs) using only perfect matches. However, this approach could be applied only to haploid regions of the genome and was computationally intensive. In this study, we present a unique approach, coverage-based single nucleotide variant identification (COBASI), which allows the exploration of the entire genome using second-generation short sequence reads without extensive computing requirements. COBASI identifies SNVs using changes in coverage of exactly matching unique substrings, and is particularly suited for pinpointing de novo SNVs. Unlike other approaches that require population frequencies across hundreds of samples to filter out any methodological biases, COBASI can be applied to detect de novo SNVs within isolated families. We demonstrate this capability through extensive simulation studies and by studying a parent-offspring trio we sequenced using short reads. Experimental validation of all 58 candidate de novo SNVs and a selection of non-de novo SNVs found in the trio confirmed zero FP calls. COBASI is available as open source at https://github.com/Laura-Gomez/COBASI for any researcher to use. Copyright © 2018 the Author(s). Published by PNAS.

Development of a single nucleotide polymorphism (SNP) marker for ...

African Journals Online (AJOL)

The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

Direct, rapid RNA sequence analysis

International Nuclear Information System (INIS)

Peattie, D.A.

1987-01-01

The original methods of RNA sequence analysis were based on enzymatic production and chromatographic separation of overlapping oligonucleotide fragments from within an RNA molecule followed by identification of the mononucleotides comprising the oligomer. Over the past decade the field of nucleic acid sequencing has changed dramatically, however, and RNA molecules now can be sequenced in a variety of more streamlined fashions. Most of the more recent advances in RNA sequencing have involved one-dimensional electrophoretic separation of 32 P-end-labeled oligoribonucleotides on polyacrylamide gels. In this chapter the author discusses two of these methods for determining the nucleotide sequences of RNA molecules rapidly: the chemical method and the enzymatic method. Both methods are direct and degradative, i.e., they rely on fragmatic and chemical approaches should be utilized. The single-strand-specific ribonucleases (A, T 1 , T 2 , and S 1 ) provide an efficient means to locate double-helical regions rapidly, and the chemical reactions provide a means to determine the RNA sequence within these regions. In addition, the chemical reactions allow one to assign interactions to specific atoms and to distinguish secondary interactions from tertiary ones. If the RNA molecule is small enough to be sequenced directly by the enzymatic or chemical method, the probing reactions can be done easily at the same time as sequencing reactions

Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

Science.gov (United States)

Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

2004-09-22

Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

One-Step PCR Sequencing. Final Technical Progress Report for February 15, 1997 - November 30, 2001

Energy Technology Data Exchange (ETDEWEB)

Shaw, B. R.

2004-04-16

We investigated new chemistries and alternate approaches for direct gene sequencing and detection based on the properties of boron-substituted nucleotides as chain delimiters in lieu of conventional chain terminators. Chain terminators, such as the widely used Sanger dideoxynucleotide truncators, stop DNA synthesis during replication and hence are incompatible with further PCR amplification. Chain delimiters, on the other hand, are chemically-modified, ''stealth'' nucleotides that act like normal nucleotides in DNA synthesis and PCR amplification, but can be unmasked following chain extension and exponential amplification. Specifically, chain delimiters give rise to an alternative sequencing strategy based on selective degradation of DNA chains generated by PCR amplification with modified nucleotides. The method as originally devised employed template-directed enzymatic, random incorporation of small amounts of boron-modified nucleotides (e.g., 2'-deoxynucleoside 5'-alpha-[P-borano]- triphosphates) during PCR amplification. Rather than incorporation of dideoxy chain terminators, which are less efficiently incorporated in PCR-based amplification than natural deoxynucleotides, our method is based on selective incorporation and exonuclease degradation of DNA chains generated by efficient PCR amplification of chemically-modified ''stealth'' nucleotides. The stealth nucleotides have a boranophosphate group instead of a normal phosphate, yet behave like normal nucleotides during PCR-amplification. The unique feature of our method is that the position of the stealth nucleotide, and hence DNA sequencing fragments, are revealed at the desired, appropriate moment following PCR amplification. During the current grant period, a variety of new boron-modified nucleotides were synthesized, and new chemistries and enzymatic methods and combinations thereof were explored to improve the method and study the effects of borane modified

Species characterization in the genus Pestivirus according to palindromic nucleotide substitutions in the 5'-untranslated region.

Science.gov (United States)

Giangaspero, Massimo; Harasawa, Ryô

2011-06-01

The palindromic nucleotide substitutions (PNS) at the three variable loci (V1, V2 and V3) in the 5'-untranslated region (UTR) of the Pestivirus genome have been considered for taxonomical segregation of the species, through the evaluation of 534 strains. On the basis of qualitative and quantitative secondary structure characteristics, species have been identified within the genus, determining genetic distances between species isolates, clarifying borderline and multirelated sequences, and characterizing and clustering the Pestivirus strains showing unexpected genomic sequences. Nine genomic groups have been identified: the species Bovine viral diarrhea virus 1 (BVDV-1), Bovine viral diarrhea virus 2 (BVDV-2), Border disease virus (BDV) and Classical swine fever virus (CSFV) and the tentative species Pronghorn, Giraffe, Bovine viral diarrhea virus 3 (BVDV-3) (HoBi group), Border disease virus 2 (BDV-2) (Italian small ruminant isolates) and Bungowannah. Palindromic positions have been characterized according to changes in nucleotide base-pairs identifying low variable positions (LVP) including base-pairs present in less than 80% of the genus. The determination of divergence between single strain sequences or genetic groups was obtained easily by comparing base-pairing combinations from aligned secondary structures. This provided clear information such as the level of heterogeneity within a species, the relatedness between species, or facilitating the characterization and clustering of specific strains. The BVDV-1 and BDV species resulted heterogeneous, showing isolates located on a borderline in the species. Within the BVDV-2 species, two main genogroups were identified, with strains showing common sequence characteristics to both groups (multirelated strains). They could be allocated correctly by quantitative analysis. Similarly, the relation between CSFV and BDV species appeared very clearly. Also in this case, ambiguous strain sequences could be clustered in the

Expressed sequence tags (ESTs) and single nucleotide ...

African Journals Online (AJOL)

SERVER

2008-02-19

Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.

Retrieval and Representation of Nucleotide Sequence of ...

African Journals Online (AJOL)

Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...

The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

Science.gov (United States)

Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

1995-05-01

The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

Analysis of the intronic single nucleotide polymorphism rs#466452 of the nephrin gene in patients with diabetic nephropathy

Directory of Open Access Journals (Sweden)

RODRIGO GONZÁLEZ

2009-01-01

Full Text Available We present the analysis of an intronic polymorphism of the nephrin gene and its relationship to the development of diabetic nephropathy in a study of diabetes type 1 and type 2 patients. The frequency of the single nucleotide polymorphism rs#466452 in the nephrin gene was determined in 231 patients and control subjects. The C/T status of the polymorphism was assessed using restriction enzyme digestions and the nephrin transcript from a kidney biopsy was examined. Association between the polymorphism and clinical parameters was evaluated using multivaríate correspondence analysis. A bioinformatics analysis of the single nucleotide polymorphism rs#466452 suggested the appearance of a splicing enhancer sequence in intron 24 of the nephrin gene and a modification of proteins that bind to this sequence. However, no change in the splicing of a nephrin transcript from a renal biopsy was found. No association was found between the polymorphism and diabetes or degree of renal damage in diabetes type 1 or 2 patients. The single nucleotide polymorphism rs#466452 of the nephrin gene seems to be neutral in relation to diabetes and the development of diabetic nephropathy, and does not affect the splicing of a nephrin transcript, in spite of a splicing enhancer site.

Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

International Nuclear Information System (INIS)

Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

1988-01-01

The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

Directory of Open Access Journals (Sweden)

Steven Y C Tong

Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

Science.gov (United States)

Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

2014-11-01

Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine.

Science.gov (United States)

Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun

2016-10-01

As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.

Complete sequence of RNA1 of grapevine Anatolian ringspot virus.

Science.gov (United States)

Digiaro, Michele; Nahdi, Sabrine; Elbeaino, Toufic

2012-10-01

The nucleotide sequence of RNA1 of grapevine Anatolian ringspot virus (GARSV), a nepovirus of subgroup B, was determined from cDNA clones. It is 7,288 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame (ORF), extending from nucleotides 272 to 7001, encoding a polypeptide of 2,243 amino acids with a predicted molecular mass of 250 kDa. The primary structure of the polyprotein, compared with that of other viral polyproteins, revealed the presence of all the characteristic domains of members of the order Picornavirales, i.e., the NTP-binding protein (1B(Hel)), the viral genome-linked protein (1C(VPg)), the proteinase (1D(Prot)), the RNA-dependent RNA polymerase (1E(Pol)), and of the protease cofactor (1A(Pro-cof)) shared by members of the subfamily Comovirinae within the family Secoviridae. The cleavage sites predicted within the polyprotein were found to be in agreement with those previously reported for nepoviruses of subgroup B, processing from 1A to 1E proteins of 67, 64, 3, 23 and 92 kDa, respectively. The RNA1-encoded polyprotein (p1) shared the highest amino acid sequence identity (66 %) with tomato black ring virus (TBRV) and beet ringspot virus (BRSV). The 5'- and 3'-noncoding regions (NCRs) of GARSV-RNA1 shared 89 % and 95 % nucleotide sequence identity respectively with the corresponding regions in RNA2. Phylogenetic analysis confirmed the close relationship of GARSV to members of subgroup B of the genus Nepovirus.

Sequence specificity and biological consequences of drugs that bind covalently in the minor groove of DNA

International Nuclear Information System (INIS)

Hurley, L.H.; Needham-VanDevanter, D.R.

1986-01-01

DNA ligands which bind within the minor groove of DNA exhibit varying degrees of sequence selectivity. Factors which contribute to nucleotide sequence recognition by minor groove ligands have been extensively investigated. Electrostatic interactions, ligand and DNA dehydration energies, hydrophobic interactions and steric factors all play significant roles in sequence selectivity in the minor groove. Interestingly, ligand recognition of nucleotide sequence in the minor groove does not involve significant hydrogen bonding. This is in sharp contrast to cellular enzyme and protein recognition of nucleotide sequence, which is achieved in the major groove via specific hydrogen bond formation between individual bases and the ligand. The ability to read nucleotide sequence via hydrogen bonding allows precise binding of proteins to specific DNA sequences. Minor groove ligands examined to date exhibit a much lower sequence specificity, generally binding to a subset of possible sequences, rather than a single sequence. 19 refs., 7 figs

Applications of High-Throughput Nucleotide Sequencing (PhD)

DEFF Research Database (Denmark)

Waage, Johannes

equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

Ion torrent personal genome machine sequencing for genomic typing of Neisseria meningitidis for rapid determination of multiple layers of typing information.

Science.gov (United States)

Vogel, Ulrich; Szczepanowski, Rafael; Claus, Heike; Jünemann, Sebastian; Prior, Karola; Harmsen, Dag

2012-06-01

Neisseria meningitidis causes invasive meningococcal disease in infants, toddlers, and adolescents worldwide. DNA sequence-based typing, including multilocus sequence typing, analysis of genetic determinants of antibiotic resistance, and sequence typing of vaccine antigens, has become the standard for molecular epidemiology of the organism. However, PCR of multiple targets and consecutive Sanger sequencing provide logistic constraints to reference laboratories. Taking advantage of the recent development of benchtop next-generation sequencers (NGSs) and of BIGSdb, a database accommodating and analyzing genome sequence data, we therefore explored the feasibility and accuracy of Ion Torrent Personal Genome Machine (PGM) sequencing for genomic typing of meningococci. Three strains from a previous meningococcus serogroup B community outbreak were selected to compare conventional typing results with data generated by semiconductor chip-based sequencing. In addition, sequencing of the meningococcal type strain MC58 provided information about the general performance of the technology. The PGM technology generated sequence information for all target genes addressed. The results were 100% concordant with conventional typing results, with no further editing being necessary. In addition, the amount of typing information, i.e., nucleotides and target genes analyzed, could be substantially increased by the combined use of genome sequencing and BIGSdb compared to conventional methods. In the near future, affordable and fast benchtop NGS machines like the PGM might enable reference laboratories to switch to genomic typing on a routine basis. This will reduce workloads and rapidly provide information for laboratory surveillance, outbreak investigation, assessment of vaccine preventability, and antibiotic resistance gene monitoring.

Multi-locus genotyping of bottom fermenting yeasts by single nucleotide polymorphisms indicative of brewing characteristics.

Science.gov (United States)

Ikushima, Shigehito; Tateishi, Yoshiyuki; Kanai, Keiko; Shimada, Emiko; Tanaka, Misa; Ishiguro, Tatsuji; Mizutani, Satoru; Kobayashi, Osamu

2012-04-01

Yeast plays a capital role in brewing fermentation and has a direct impact on flavor and aroma. For the evaluation of competent brewing strains during quality control or development of novel strains it is standard practice to perform fermentation tests, which are costly and time-consuming. Here, we have categorized DNA markers which enable to distinguish and to screen brewing strains more efficiently than ever before. Sequence analysis at 289 loci in the genomes of six bottom fermenting Saccharomyces pastorianus strains revealed that 30 loci contained single nucleotide polymorphisms (SNPs). By determining the nucleotide sequences at the SNP-loci in 26 other S. pastorianus strains and 20 strains of the top fermenting yeast Saccharomyces cerevisiae, almost all these strains could be discriminated solely on the basis of the SNPs. By comparing the fermentative phenotypes of these strains we found that some DNA markers showed a strong association with brewing characteristics, such as the production of ethyl acetate and hydrogen sulphide (H2S). Therefore, the DNA markers we identified will facilitate quality control and the efficient development of brewing yeast strains. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

NARCIS (Netherlands)

Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

Nature and distribution of feline sarcoma virus nucleotide sequences.

Science.gov (United States)

Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

1979-01-01

The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

Directory of Open Access Journals (Sweden)

Suravajhala P

2017-06-01

Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

Science.gov (United States)

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

Science.gov (United States)

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of

Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

Science.gov (United States)

Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

2011-12-01

Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Sequence of cDNAs for mammalian H2A. Z, an evolutionarily diverged but highly conserved basal histone H2A isoprotein species

Energy Technology Data Exchange (ETDEWEB)

Hatch, C L; Bonner, W M

1988-02-11

The nucleotide sequences of cDNAs for the evolutionarily diverged but highly conserved basal H2A isoprotein, H2A.Z, have been determined for the rat, cow, and human. As a basal histone, H2A.Z is synthesized throughout the cell cycle at a constant rate, unlinked to DNA replication, and at a much lower rate in quiescent cells. Each of the cDNA isolates encodes the entire H2A.Z polypeptide. The human isolate is about 1.0 kilobases long. It contains a coding region of 387 nucleotides flanked by 106 nucleotides of 5'UTR and 376 nucleotides of 3'UTR, which contains a polyadenylation signal followed by a poly A tail. The bovine and rat cDNAs have 97 and 94% nucleotide positional identity to the human cDNA in the coding region and 98% in the proximal 376 nucleotides of the 3'UTR which includes the polyadenylation signal. A potential stem-forming sequence imbedded in a direct repeat is found centered at 261 nucleotides into the 3'UTR. Each of the cDNA clones could be transcribed and translated in vitro to yield H2A.Z protein. The mammalian H2A.Z cDNA coding sequences are approximately 80% similar to those in chicken and 75% to those in sea urchin.

Cytogenetic Diversity of Simple Sequences Repeats in Morphotypes of Brassica rapa ssp. chinensis.

Science.gov (United States)

Zheng, Jin-Shuang; Sun, Cheng-Zhen; Zhang, Shu-Ning; Hou, Xi-Lin; Bonnema, Guusje

2016-01-01

A significant fraction of the nuclear DNA of all eukaryotes is comprised of simple sequence repeats (SSRs). Although these sequences are widely used for studying genetic variation, linkage mapping and evolution, little attention had been paid to the chromosomal distribution and cytogenetic diversity of these sequences. In this paper, we report the distribution characterization of mono-, di-, and tri-nucleotide SSRs in Brassica rapa ssp. chinensis. Fluorescence in situ hybridization was used to characterize the cytogenetic diversity of SSRs among morphotypes of B. rapa ssp. chinensis. The proportion of different SSR motifs varied among morphotypes of B. rapa ssp. chinensis, with tri-nucleotide SSRs being more prevalent in the genome of B. rapa ssp. chinensis. We determined the chromosomal locations of mono-, di-, and tri-nucleotide repeat loci. The results showed that the chromosomal distribution of SSRs in the different morphotypes is non-random and motif-dependent, and allowed us to characterize the relative variability in terms of SSR numbers and similar chromosomal distributions in centromeric/peri-centromeric heterochromatin. The differences between SSR repeats with respect to abundance and distribution indicate that SSRs are a driving force in the genomic evolution of B. rapa species. Our results provide a comprehensive view of the SSR sequence distribution and evolution for comparison among morphotypes B. rapa ssp. chinensis.

Complete nucleotide sequence of pGA45, a 140,698-bp incFIIY plasmid encoding blaIMI-3-mediated carbapenem resistance, from river sediment

Directory of Open Access Journals (Sweden)

Bingjun eDang

2016-02-01

Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.

Nostoc PCC7524, a cyanobacterium which contains five sequence-specific deoxyribonucleases

NARCIS (Netherlands)

Reaston, J.; Duybesteyn, M.G.C.; Waard, Adrian de

1982-01-01

Five nucleotide sequence-specific deoxyribonucleases present in cell-free extracts of the filamentous cyanobacterium Nostoc PCC7524 have been purified and characterized. One of these enzymes, designated Nsp(7524)I cleaves at a new kind of nucleotide sequence i.e. 5'-PuCATG λ Py-3'. The other four

Recurrence plot analysis of DNA sequences

Energy Technology Data Exchange (ETDEWEB)

Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn

2004-11-15

Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.

Clinical and molecular characterization of a cohort of patients with novel nucleotide alterations of the Dystrophin gene detected by direct sequencing

Directory of Open Access Journals (Sweden)

Corti Stefania

2011-03-01

Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects

Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

Science.gov (United States)

Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

2014-07-04

Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

Genome sequencing and analysis reveals possible determinants of Staphylococcus aureus nasal carriage

Directory of Open Access Journals (Sweden)

Cole Alexander M

2008-09-01

Full Text Available Abstract Background Nasal carriage of Staphylococcus aureus is a major risk factor in clinical and community settings due to the range of etiologies caused by the organism. We have identified unique immunological and ultrastructural properties associated with nasal carriage isolates denoting a role for bacterial factors in nasal carriage. However, despite extensive molecular level characterizations by several groups suggesting factors necessary for colonization on nasal epithelium, genetic determinants of nasal carriage are unknown. Herein, we have set a genomic foundation for unraveling the bacterial determinants of nasal carriage in S. aureus. Results MLST analysis revealed no lineage specific differences between carrier and non-carrier strains suggesting a role for mobile genetic elements. We completely sequenced a model carrier isolate (D30 and a model non-carrier strain (930918-3 to identify differential gene content. Comparison revealed the presence of 84 genes unique to the carrier strain and strongly suggests a role for Type VII secretion systems in nasal carriage. These genes, along with a putative pathogenicity island (SaPIBov present uniquely in the carrier strains are likely important in affecting carriage. Further, PCR-based genotyping of other clinical isolates for a specific subset of these 84 genes raise the possibility of nasal carriage being caused by multiple gene sets. Conclusion Our data suggest that carriage is likely a heterogeneic phenotypic trait and implies a role for nucleotide level polymorphism in carriage. Complete genome level analyses of multiple carriage strains of S. aureus will be important in clarifying molecular determinants of S. aureus nasal carriage.

Prospects of biomolecule sequencing with the techniques of translocation through nanopores: A review

International Nuclear Information System (INIS)

Nosik, V. L.; Rudakova, E. B.

2013-01-01

The interest in the functional properties of biomolecules in native solutions (in particular, their interaction with membranes) constantly increases with accumulation of data on the macromolecular structure, obtained by X-ray diffraction (with synchrotron radiation sources), nuclear magnetic resonance, and mass spectrometry; this interest is closely related to the development of new technologies of sequencing (i.e., determining the sequence of nucleotides in DNA biomolecule). One of the most promising “physical” approaches to sequencing is the application of methods based on the use of nanochannels or nanopores, through which biomolecules pass in ionic solutions under an electric field applied. A nanopore provides spatial localization of molecules and makes it possible to detect a signal (electric, fluorescent, etc.) from an individual nucleotide. In view of the development of new high-intensity pulsed X-ray sources, the popularity of fluorescence analysis constantly increases. The existing methods for simulating the motion of biomolecules and interpreting their structure, sequencing techniques, and the prospects of further development of investigations in this field are discussed

Complete Genome Sequence of the Soybean Symbiont Bradyrhizobium japonicum Strain USDA6T

Directory of Open Access Journals (Sweden)

Nobukazu Uchiike

2011-10-01

Full Text Available The complete nucleotide sequence of the genome of the soybean symbiont Bradyrhizobium japonicum strain USDA6T was determined. The genome of USDA6T is a single circular chromosome of 9,207,384 bp. The genome size is similar to that of the genome of another soybean symbiont, B. japonicum USDA110 (9,105,828 bp. Comparison of the whole-genome sequences of USDA6T and USDA110 showed colinearity of major regions in the two genomes, although a large inversion exists between them. A significantly high level of sequence conservation was detected in three regions on each genome. The gene constitution and nucleotide sequence features in these three regions indicate that they may have been derived from a symbiosis island. An ancestral, large symbiosis island, approximately 860 kb in total size, appears to have been split into these three regions by unknown large-scale genome rearrangements. The two integration events responsible for this appear to have taken place independently, but through comparable mechanisms, in both genomes.

Serological and genetic characterisation of bovine respiratory syncytial virus (BRSV) indicates that Danish isolates belong to the intermediate subgroup: no evidence of a selective effect on the variability of G protein nucleotide sequence by prior cell culture adaption and passages in cell culture

DEFF Research Database (Denmark)

Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.

1998-01-01

on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar......Danish isolates of bovine respiratory syncytial virus (BRSV) were characterised by nucleotide sequencing of the G glycoprotein and by their reactivity with a panel of monoclonal antibodies (MAbs). Among the six Danish isolates, the overall sequence divergence ranged between 0 and 3...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...

Detection of a divergent variant of grapevine virus F by next-generation sequencing.

Science.gov (United States)

Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

2015-08-01

The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

Predicting protein-binding RNA nucleotides with consideration of binding partners.

Science.gov (United States)

Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook

2015-06-01

In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in

FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.

Science.gov (United States)

Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A

2016-06-13

Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.

Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

Directory of Open Access Journals (Sweden)

Simon Reed

2012-09-01

Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

Global sequence diversity of the lactate dehydrogenase gene in Plasmodium falciparum.

Science.gov (United States)

Simpalipan, Phumin; Pattaradilokrat, Sittiporn; Harnyuttanakorn, Pongchai

2018-01-09

Antigen-detecting rapid diagnostic tests (RDTs) have been recommended by the World Health Organization for use in remote areas to improve malaria case management. Lactate dehydrogenase (LDH) of Plasmodium falciparum is one of the main parasite antigens employed by various commercial RDTs. It has been hypothesized that the poor detection of LDH-based RDTs is attributed in part to the sequence diversity of the gene. To test this, the present study aimed to investigate the genetic diversity of the P. falciparum ldh gene in Thailand and to construct the map of LDH sequence diversity in P. falciparum populations worldwide. The ldh gene was sequenced for 50 P. falciparum isolates in Thailand and compared with hundreds of sequences from P. falciparum populations worldwide. Several indices of molecular variation were calculated, including the proportion of polymorphic sites, the average nucleotide diversity index (π), and the haplotype diversity index (H). Tests of positive selection and neutrality tests were performed to determine signatures of natural selection on the gene. Mean genetic distance within and between species of Plasmodium ldh was analysed to infer evolutionary relationships. Nucleotide sequences of P. falciparum ldh could be classified into 9 alleles, encoding 5 isoforms of LDH. L1a was the most common allelic type and was distributed in P. falciparum populations worldwide. Plasmodium falciparum ldh sequences were highly conserved, with haplotype and nucleotide diversity values of 0.203 and 0.0004, respectively. The extremely low genetic diversity was maintained by purifying selection, likely due to functional constraints. Phylogenetic analysis inferred the close genetic relationship of P. falciparum to malaria parasites of great apes, rather than to other human malaria parasites. This study revealed the global genetic variation of the ldh gene in P. falciparum, providing knowledge for improving detection of LDH-based RDTs and supporting the candidacy of

Radiation-induced germ-line mutations detected by a direct comparison of parents and children DNA sequences containing SNPs

International Nuclear Information System (INIS)

Morimyo, M.; Hongo, E.; Higashi, T.; Wu, J.; Matsumoto, I.; Okamoto, M.; Kawano, A.; Tsuji, S.

2003-01-01

Full text: Germ-line mutation is detected in mice but not in humans. To estimate genetic risk of humans, a new approach to extrapolate from animal data to humans or to directly detect radiation-induced mutations in man is expected. We have developed a new method to detect germ-line mutations by directly comparing DNA sequences of parents and children. The nucleotide sequences among mouse strains are almost identical except SNP markers that are detected at 1/1000 frequency. When gamma-irradiated male mice are mated with female mice, heterogeneous nucleotide sequences induced in children DNA are a candidate of mutation, whose assignment can be done by SNP analysis. This system can easily detect all types of mutations such as transition, transversion, frameshift and deletion induced by radiation and can be applied to humans having genetically heterogeneous nucleotide sequences and many SNP markers. C3H male mice of 8 weeks of gestation were irradiated with gamma rays of 3 and 1 Gy and after 3 weeks, they were mated with the same aged C57BL female mice. After 3 weeks breeding, DNA was extracted from parents and children mice. The nucleotide sequences of 150 STS markers containing 300-900 bp and SNPs of parents and children DNA were determined by a direct sequencing; amplification of STS markers by Taq DNA polymerase, purification of PCR products, and DNA sequencing with a dye-terminator method. At each radiation dose, a total amount of 5 Mb DNA sequences were examined to detect radiation-induced mutations. We could find 6 deletions in 3 Gy irradiated mice but not in 1 Gy and control mice. The mutation frequency was about 4.0 x 10 -7 /bp/ Gy or 1.6 x 10 -4 /locus/Gy, and suggested the non-linear increase of mutation rate with dose

Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

NARCIS (Netherlands)

Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

2011-01-01

We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1986-01-01

In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

Science.gov (United States)

The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

Complete nucleotide sequence of Bacillus subtilis (natto) bacteriophage PM1, a phage associated with disruption of food production.

Science.gov (United States)

Umene, Kenichi; Shiraishi, Atsushi

2013-06-01

"Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.

Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

DEFF Research Database (Denmark)

Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

2017-01-01

Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

Mitochondria as determinant of nucleotide pools and chromosomal stability

DEFF Research Database (Denmark)

Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

2007-01-01

Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

Directory of Open Access Journals (Sweden)

Lakshya Veer Singh

2013-06-01

Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

Directory of Open Access Journals (Sweden)

Souche Erika L

2011-06-01

Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

Genetic differentiation between fake abalone and genuine Haliotis species using the forensically informative nucleotide sequencing (FINS) method.

Science.gov (United States)

Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S

2011-05-25

Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.

The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3.

Science.gov (United States)

Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio

2005-12-20

Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.

Nucleotide sequence of a human tRNA gene heterocluster

International Nuclear Information System (INIS)

Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

1986-01-01

Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

Directory of Open Access Journals (Sweden)

Jonas Binladen

2007-02-01

Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

BlockLogo: Visualization of peptide and sequence motif conservation

DEFF Research Database (Denmark)

Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian

2013-01-01

BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, se...

The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

Science.gov (United States)

Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

2014-01-01

Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

International Nuclear Information System (INIS)

Xiong Gang; Wang, X.R.

2005-01-01

The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

Science.gov (United States)

The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

Complete mitochondrial genome sequences of Brassica rapa (Chinese cabbage and mizuna), and intraspecific differentiation of cytoplasm in B. rapa and Brassica juncea.

Science.gov (United States)

Hatono, Saki; Nishimura, Kaori; Murakami, Yoko; Tsujimura, Mai; Yamagishi, Hiroshi

2017-09-01

The complete sequence of the mitochondrial genome was determined for two cultivars of Brassica rapa . After determining the sequence of a Chinese cabbage variety, 'Oushou hakusai', the sequence of a mizuna variety, 'Chusei shiroguki sensuji kyomizuna', was mapped against the sequence of Chinese cabbage. The precise sequences where the two varieties demonstrated variation were ascertained by direct sequencing. It was found that the mitochondrial genomes of the two varieties are identical over 219,775 bp, with a single nucleotide polymorphism (SNP) between the genomes. Because B. rapa is the maternal species of an amphidiploid crop species, Brassica juncea , the distribution of the SNP was observed both in B. rapa and B. juncea . While the mizuna type SNP was restricted mainly to cultivars of mizuna (japonica group) in B. rapa , the mizuna type was widely distributed in B. juncea . The finding that the two Brassica species have these SNP types in common suggests that the nucleotide substitution occurred in wild B. rapa before both mitotypes were domesticated. It was further inferred that the interspecific hybridization between B. rapa and B. nigra took place twice and resulted in the two mitotypes of cultivated B. juncea .

Noninvasive prenatal paternity testing (NIPAT) through maternal plasma DNA sequencing

DEFF Research Database (Denmark)

Jiang, Haojun; Xie, Yifan; Li, Xuchao

2016-01-01

developed a noninvasive prenatal paternity testing (NIPAT) based on SNP typing with maternal plasma DNA sequencing. We evaluated the influence factors (minor allele frequency (MAF), the number of total SNP, fetal fraction and effective sequencing depth) and designed three different selective SNP panels......Short tandem repeats (STRs) and single nucleotide polymorphisms (SNPs) have been already used to perform noninvasive prenatal paternity testing from maternal plasma DNA. The frequently used technologies were PCR followed by capillary electrophoresis and SNP typing array, respectively. Here, we...... paternity test using STR multiplex system. Our study here proved that the maternal plasma DNA sequencing-based technology is feasible and accurate in determining paternity, which may provide an alternative in forensic application in the future....

Whole exome sequencing identifies novel mutation in eight Chinese children with isolated tetralogy of Fallot.

Science.gov (United States)

Liu, Lin; Wang, Hong-Dan; Cui, Cun-Ying; Qin, Yun-Yun; Fan, Tai-Bing; Peng, Bang-Tian; Zhang, Lian-Zhong; Wang, Cheng-Zeng

2017-12-05

Tetralogy of Fallot is the most common cyanotic congenital heart disease. However, its pathogenesis remains to be clarified. The purpose of this study was to identify the genetic variants in Tetralogy of Fallot by whole exome sequencing. Whole exome sequencing was performed among eight small families with Tetralogy of Fallot. Differential single nucleotide polymorphisms and small InDels were found by alignment within families and between families and then were verified by Sanger sequencing. Tetralogy of Fallot-related genes were determined by analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases. A total of sixteen differential single nucleotide polymorphisms loci and eight differential small InDels were discovered. The sixteen differential single nucleotide polymorphisms loci were located on Chr 1, 2, 4, 5, 11, 12, 15, 22 and X. Among the sixteen single nucleotide polymorphisms loci, six has not been reported. The eight differential small InDels were located on Chr 2, 4, 9, 12, 17, 19 and X, whereas of the eight differential small InDels, two has not been reported. Analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases revealed that PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 were associated with Tetralogy of Fallot. Our findings identify PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 mutations as underlying genetic causes of isolated tetralogy of Fallot.

Sequence exploration reveals information bias among molecular markers used in phylogenetic reconstruction for Colletotrichum species.

Science.gov (United States)

Rampersad, Sephra N; Hosein, Fazeeda N; Carrington, Christine Vf

2014-01-01

The Colletotrichum gloeosporioides species complex is among the most destructive fungal plant pathogens in the world, however, identification of isolates of quarantine importance to the intra-specific level is confounded by a number of factors that affect phylogenetic reconstruction. Information bias and quality parameters were investigated to determine whether nucleotide sequence alignments and phylogenetic trees accurately reflect the genetic diversity and phylogenetic relatedness of individuals. Sequence exploration of GAPDH, ACT, TUB2 and ITS markers indicated that the query sequences had different patterns of nucleotide substitution but were without evidence of base substitution saturation. Regions of high entropy were much more dispersed in the ACT and GAPDH marker alignments than for the ITS and TUB2 markers. A discernible bimodal gap in the genetic distance frequency histograms was produced for the ACT and GAPDH markers which indicated successful separation of intra- and inter-specific sequences in the data set. Overall, analyses indicated clear differences in the ability of these markers to phylogenetically separate individuals to the intra-specific level which coincided with information bias.

The complete genome sequence of a virus associated with cotton blue disease, cotton leafroll dwarf virus, confirms that it is a new member of the genus Polerovirus.

Science.gov (United States)

Distéfano, Ana J; Bonacic Kresic, Ivan; Hopp, H Esteban

2010-11-01

Cotton blue disease is the most important virus disease of cotton in the southern part of America. The complete nucleotide sequence of the ssRNA genome of the cotton blue disease-associated virus was determined for the first time. It comprised 5,866 nucleotides, and the deduced genomic organization resembled that of members of the genus Polerovirus. Sequence homology comparison and phylogenetic analysis confirm that this virus (previous proposed name cotton leafroll dwarf virus) is a member of a new species within the genus Polerovirus.

NUCLEOTIDES IN INFANT FEEDING

Directory of Open Access Journals (Sweden)

L.G. Mamonova

2007-01-01

Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics

Science.gov (United States)

Anwar, R; Booth, A; Churchill, A J; Markham, A F

1996-01-01

The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

Analysis and comparison of fragrant gene sequence in some rice cultivars

Directory of Open Access Journals (Sweden)

Karami Noushafarin

2016-01-01

Full Text Available It is known that the fragrant trait in rice (Oryza sativa L. is largely controlled by fgr gene on chromosome 8 and it has been specified that the existence of an 8 bp deletion and three single nucleotide polymorphism (SNP in exon 7 is effective on this trait. In this study, sequence alignment analysis of fgr exon7 on chromosome 8 for 11 different fragrant and non-fragrant cultivars revealed that 5 aromatic rice cultivars carried 3 SNPs and 8 bp deletion in exon7 which terminates prematurely at a TAA stop codon. However, 5 of the non-aromatics showed a sequence identical to the published Nipponbare, being non-fragrant Japonica variety sequence. An exception among them was Bejar, which had 8 bp deletion and 3SNPs but it was non-aromatic. Sequencing can determine nucleotide alignment of a gene and give beneficial information about gene function. In silico prediction showed proteins sequences alignment of fgr gene for Khazar and Domsiah genotypes were different. Betaine aldehyde dehydrogenase complete enzyme belongs to Khazar non-fragrant genotype that has complete length and 503 amino acids while non-functional BADH2 enzyme for Domsiah fragrant genotype has 251 amino acids that result in accumulate 2-acetyl-1-pyrroline (2AP and produces aroma in fragrant genotypes.

Comparing whole-genome sequencing with Sanger sequencing for spa typing of methicillin-resistant Staphylococcus aureus.

Science.gov (United States)

Bartels, Mette Damkjær; Petersen, Andreas; Worning, Peder; Nielsen, Jesper Boye; Larner-Svensson, Hanna; Johansen, Helle Krogh; Andersen, Leif Percival; Jarløv, Jens Otto; Boye, Kit; Larsen, Anders Rhod; Westh, Henrik

2014-12-01

spa typing of methicillin-resistant Staphylococcus aureus (MRSA) has traditionally been done by PCR amplification and Sanger sequencing of the spa repeat region. At Hvidovre Hospital, Denmark, whole-genome sequencing (WGS) of all MRSA isolates has been performed routinely since January 2013, and an in-house analysis pipeline determines the spa types. Due to national surveillance, all MRSA isolates are sent to Statens Serum Institut, where the spa type is determined by PCR and Sanger sequencing. The purpose of this study was to evaluate the reliability of the spa types obtained by 150-bp paired-end Illumina WGS. MRSA isolates from new MRSA patients in 2013 (n = 699) in the capital region of Denmark were included. We found a 97% agreement between spa types obtained by the two methods. All isolates achieved a spa type by both methods. Nineteen isolates differed in spa types by the two methods, in most cases due to the lack of 24-bp repeats in the whole-genome-sequenced isolates. These related but incorrect spa types should have no consequence in outbreak investigations, since all epidemiologically linked isolates, regardless of spa type, will be included in the single nucleotide polymorphism (SNP) analysis. This will reveal the close relatedness of the spa types. In conclusion, our data show that WGS is a reliable method to determine the spa type of MRSA. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

Science.gov (United States)

Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

2017-01-01

Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

Nucleotide Metabolism

DEFF Research Database (Denmark)

Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

2011-01-01

Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

Statistical properties of nucleotides in human chromosomes 21 and 22

International Nuclear Information System (INIS)

Zhang Linxi; Sun Tingting

2005-01-01

In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

Bioinformatic Analysis of Deleterious Non-Synonymous Single Nucleotide Polymorphisms (nsSNPs in the Coding Regions of Human Prion Protein Gene (PRNP

Directory of Open Access Journals (Sweden)

Kourosh Bamdad

2016-12-01

Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion:  Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.

A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

Science.gov (United States)

Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

2016-08-01

Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

Simulating efficiently the evolution of DNA sequences.

Science.gov (United States)

Schöniger, M; von Haeseler, A

1995-02-01

Two menu-driven FORTRAN programs are described that simulate the evolution of DNA sequences in accordance with a user-specified model. This general stochastic model allows for an arbitrary stationary nucleotide composition and any transition-transversion bias during the process of base substitution. In addition, the user may define any hypothetical model tree according to which a family of sequences evolves. The programs suggest the computationally most inexpensive approach to generate nucleotide substitutions. Either reproducible or non-repeatable simulations, depending on the method of initializing the pseudo-random number generator, can be performed. The corresponding options are offered by the interface menu.

Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

International Nuclear Information System (INIS)

Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.

2003-01-01

Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

Strain-specific and pooled genome sequences for populations of Drosophila melanogaster from three continents.

Science.gov (United States)

Bergman, Casey M; Haddrill, Penelope R

2015-01-01

To contribute to our general understanding of the evolutionary forces that shape variation in genome sequences in nature, we have sequenced genomes from 50 isofemale lines and six pooled samples from populations of Drosophila melanogaster on three continents. Analysis of raw and reference-mapped reads indicates the quality of these genomic sequence data is very high. Comparison of the predicted and experimentally-determined Wolbachia infection status of these samples suggests that strain or sample swaps are unlikely to have occurred in the generation of these data. Genome sequences are freely available in the European Nucleotide Archive under accession ERP009059. Isofemale lines can be obtained from the Drosophila Species Stock Center.

Complete genome sequence of Paris mosaic necrosis virus, a distinct member of the genus Potyvirus

Science.gov (United States)

The complete genomic sequence of a novel potyvirus was determined from Paris polyphylla var. yunnanensis. Its genomic RNA consists of 9,660 nucleotides (nt) excluding the 3’-terminal poly (A) tail, containing a single open reading frame (ORF) encoding a large polyprotein. The virus shares 52.1-69.7%...

Order and correlations in genomic DNA sequences. The spectral approach

International Nuclear Information System (INIS)

Lobzin, Vasilii V; Chechetkin, Vladimir R

2000-01-01

The structural analysis of genomic DNA sequences is discussed in the framework of the spectral approach, which is sufficiently universal due to the reciprocal correspondence and mutual complementarity of Fourier transform length scales. The spectral characteristics of random sequences of the same nucleotide composition possess the property of self-averaging for relatively short sequences of length M≥100-300. Comparison with the characteristics of random sequences determines the statistical significance of the structural features observed. Apart from traditional applications to the search for hidden periodicities, spectral methods are also efficient in studying mutual correlations in DNA sequences. By combining spectra for structure factors and correlation functions, not only integral correlations can be estimated but also their origin identified. Using the structural spectral entropy approach, the regularity of a sequence can be quantitatively assessed. A brief introduction to the problem is also presented and other major methods of DNA sequence analysis described. (reviews of topical problems)

Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

Directory of Open Access Journals (Sweden)

Nedenia Bonvino Stafuzza

Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

Complete genome sequence of switchgrass mosaic virus, a member of a proposed new species in the genus Marafivirus.

Science.gov (United States)

Agindotan, Bright O; Gray, Michael E; Hammond, Rosemarie W; Bradley, Carl A

2012-09-01

The complete genome sequence of a virus recently detected in switchgrass (Panicum virgatum) was determined and found to be closely related to that of maize rayado fino virus (MRFV), genus Marafivirus, family Tymoviridae. The genomic RNA is 6408 nucleotides long. It contains three predicted open reading frames (ORFs 1-3), encoding proteins of 227 kDa, 43.9 kDa, and 31.5 kDa, compared to two ORFs (1 and 2) for MRFV. The complete genome shares 76 % sequence identity with MRFV. The nucleotide sequence of ORF2 of this virus and the amino acid sequence of its encoded protein are 49 % and 77 % identical, respectively, to those of MRFV. The virus-encoded polyprotein and capsid protein aa sequences are 83 % and 74-80 % identical, respectively, to those of MRFV. Although closely related to MRFV, the amino acid sequence of its capsid protein (CP) forms a clade that is separate from that of MRFV. Based on the International Committee on Taxonomy of Viruses (ICTV) sequence-related criteria for delineation of species within the genus Marafivirus, the virus qualifies as a member of a new species, and the name Switchgrass mosaic virus (SwMV) is proposed.

Recovering probabilities for nucleotide trimming processes for T cell receptor TRA and TRG V-J junctions analyzed with IMGT tools

Directory of Open Access Journals (Sweden)

Lefranc Marie-Paule

2008-10-01

Full Text Available Abstract Background Nucleotides are trimmed from the ends of variable (V, diversity (D and joining (J genes during immunoglobulin (IG and T cell receptor (TR rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT® sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output". However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." Results A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA and TR gamma (TRG V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT®, the international ImMunoGeneTics information system®, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. Conclusion By

Recovering probabilities for nucleotide trimming processes for T cell receptor TRA and TRG V-J junctions analyzed with IMGT tools.

Science.gov (United States)

Bleakley, Kevin; Lefranc, Marie-Paule; Biau, Gérard

2008-10-02

Nucleotides are trimmed from the ends of variable (V), diversity (D) and joining (J) genes during immunoglobulin (IG) and T cell receptor (TR) rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides) of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output"). However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA) and TR gamma (TRG) V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT, the international ImMunoGeneTics information system, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. By using trimming of rearranged TR genes as a benchmark, we

Chaos game representation (CGR)-walk model for DNA sequences

International Nuclear Information System (INIS)

Jie, Gao; Zhen-Yuan, Xu

2009-01-01

Chaos game representation (CGR) is an iterative mapping technique that processes sequences of units, such as nucleotides in a DNA sequence or amino acids in a protein, in order to determine the coordinates of their positions in a continuous space. This distribution of positions has two features: one is unique, and the other is source sequence that can be recovered from the coordinates so that the distance between positions may serve as a measure of similarity between the corresponding sequences. A CGR-walk model is proposed based on CGR coordinates for the DNA sequences. The CGR coordinates are converted into a time series, and a long-memory ARFIMA (p, d, q) model, where ARFIMA stands for autoregressive fractionally integrated moving average, is introduced into the DNA sequence analysis. This model is applied to simulating real CGR-walk sequence data of ten genomic sequences. Remarkably long-range correlations are uncovered in the data, and the results from these models are reasonably fitted with those from the ARFIMA (p, d, q) model. (cross-disciplinary physics and related areas of science and technology)

Purification and primary structure determination of human lysosomal dipeptidase.

Science.gov (United States)

Dolenc, Iztok; Mihelic, Marko

2003-02-01

The lysosomal metallopeptidase is an enzyme that acts preferentially on dipeptides with unsubstituted N- and C-termini. Its activity is highest in slightly acidic pH. Here we describe the isolation and characterization of lysosomal dipeptidase from human kidney. The isolated enzyme has the amino-terminal sequence DVAKAIINLAVY and is a homodimer with a molecular mass of 100 kDa. So far no amino acid sequence has been determined for this metallopeptidase. The complete primary structure as deduced from the nucleotide sequence revealed that the isolated dipeptidase is similar to blood plasma glutamate carboxypeptidase.

Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

Science.gov (United States)

Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

2009-08-01

The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

Science.gov (United States)

Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

2017-09-01

There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

Complete nucleotide sequence of CTX-M-15-plasmids from clinical Escherichia coli isolates: insertional events of transposons and insertion sequences.

Directory of Open Access Journals (Sweden)

Annemieke Smet

Full Text Available BACKGROUND: CTX-M-producing Escherichia coli strains are regarded as major global pathogens. METHODOLOGY/PRINCIPAL FINDINGS: The nucleotide sequence of three plasmids (pEC_B24: 73801-bp; pEC_L8: 118525-bp and pEC_L46: 144871-bp from Escherichia coli isolates obtained from patients with urinary tract infections and one plasmid (pEC_Bactec: 92970-bp from an Escherichia coli strain isolated from the joint of a horse with arthritis were determined. Plasmid pEC_Bactec belongs to the IncI1 group and carries two resistance genes: bla(TEM-1 and bla(CTX-M-15. It shares more than 90% homology with a previously published bla(CTX-M-plasmid from E. coli of human origin. Plasmid pEC_B24 belongs to the IncFII group whereas plasmids pEC_L8 and pEC_L46 represent a fusion of two replicons of type FII and FIA. On the pEC_B24 backbone, two resistance genes, bla(TEM-1 and bla(CTX-M-15, were found. Six resistance genes, bla(TEM-1, bla(CTX-M-15, bla(OXA-1, aac6'-lb-cr, tetA and catB4, were detected on the pEC_L8 backbone. The same antimicrobial drug resistance genes, with the exception of tetA, were also identified on the pEC_L46 backbone. Genome analysis of all 4 plasmids studied provides evidence of a seemingly frequent transposition event of the bla(CTX-M-15-ISEcp1 element. This element seems to have a preferred insertion site at the tnpA gene of a bla(TEM-carrying Tn3-like transposon, the latter itself being inserted by a transposition event. The IS26-composite transposon, which contains the bla(OXA-1, aac6'-lb-cr and catB4 genes, was inserted into plasmids pEC_L8 and pEC_L46 by homologous recombination rather than a transposition event. Results obtained for pEC_L46 indicated that IS26 also plays an important role in structural rearrangements of the plasmid backbone and seems to facilitate the mobilisation of fragments from other plasmids. CONCLUSIONS: Collectively, these data suggests that IS26 together with ISEcp1 could play a critical role in the evolution of

Preparation of protected nucleotides usable in oligonucleotide synthesis

International Nuclear Information System (INIS)

Debiard, Jean-Pascal

1983-01-01

After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.

Directory of Open Access Journals (Sweden)

Enying Zhang

Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.

Use of four next-generation sequencing platforms to determine HIV-1 coreceptor tropism.

Science.gov (United States)

Archer, John; Weber, Jan; Henry, Kenneth; Winner, Dane; Gibson, Richard; Lee, Lawrence; Paxinos, Ellen; Arts, Eric J; Robertson, David L; Mimms, Larry; Quiñones-Mateu, Miguel E

2012-01-01

HIV-1 coreceptor tropism assays are required to rule out the presence of CXCR4-tropic (non-R5) viruses prior treatment with CCR5 antagonists. Phenotypic (e.g., Trofile™, Monogram Biosciences) and genotypic (e.g., population sequencing linked to bioinformatic algorithms) assays are the most widely used. Although several next-generation sequencing (NGS) platforms are available, to date all published deep sequencing HIV-1 tropism studies have used the 454™ Life Sciences/Roche platform. In this study, HIV-1 co-receptor usage was predicted for twelve patients scheduled to start a maraviroc-based antiretroviral regimen. The V3 region of the HIV-1 env gene was sequenced using four NGS platforms: 454™, PacBio® RS (Pacific Biosciences), Illumina®, and Ion Torrent™ (Life Technologies). Cross-platform variation was evaluated, including number of reads, read length and error rates. HIV-1 tropism was inferred using Geno2Pheno, Web PSSM, and the 11/24/25 rule and compared with Trofile™ and virologic response to antiretroviral therapy. Error rates related to insertions/deletions (indels) and nucleotide substitutions introduced by the four NGS platforms were low compared to the actual HIV-1 sequence variation. Each platform detected all major virus variants within the HIV-1 population with similar frequencies. Identification of non-R5 viruses was comparable among the four platforms, with minor differences attributable to the algorithms used to infer HIV-1 tropism. All NGS platforms showed similar concordance with virologic response to the maraviroc-based regimen (75% to 80% range depending on the algorithm used), compared to Trofile (80%) and population sequencing (70%). In conclusion, all four NGS platforms were able to detect minority non-R5 variants at comparable levels suggesting that any NGS-based method can be used to predict HIV-1 coreceptor usage.

Use of four next-generation sequencing platforms to determine HIV-1 coreceptor tropism.

Directory of Open Access Journals (Sweden)

John Archer

Full Text Available HIV-1 coreceptor tropism assays are required to rule out the presence of CXCR4-tropic (non-R5 viruses prior treatment with CCR5 antagonists. Phenotypic (e.g., Trofile™, Monogram Biosciences and genotypic (e.g., population sequencing linked to bioinformatic algorithms assays are the most widely used. Although several next-generation sequencing (NGS platforms are available, to date all published deep sequencing HIV-1 tropism studies have used the 454™ Life Sciences/Roche platform. In this study, HIV-1 co-receptor usage was predicted for twelve patients scheduled to start a maraviroc-based antiretroviral regimen. The V3 region of the HIV-1 env gene was sequenced using four NGS platforms: 454™, PacBio® RS (Pacific Biosciences, Illumina®, and Ion Torrent™ (Life Technologies. Cross-platform variation was evaluated, including number of reads, read length and error rates. HIV-1 tropism was inferred using Geno2Pheno, Web PSSM, and the 11/24/25 rule and compared with Trofile™ and virologic response to antiretroviral therapy. Error rates related to insertions/deletions (indels and nucleotide substitutions introduced by the four NGS platforms were low compared to the actual HIV-1 sequence variation. Each platform detected all major virus variants within the HIV-1 population with similar frequencies. Identification of non-R5 viruses was comparable among the four platforms, with minor differences attributable to the algorithms used to infer HIV-1 tropism. All NGS platforms showed similar concordance with virologic response to the maraviroc-based regimen (75% to 80% range depending on the algorithm used, compared to Trofile (80% and population sequencing (70%. In conclusion, all four NGS platforms were able to detect minority non-R5 variants at comparable levels suggesting that any NGS-based method can be used to predict HIV-1 coreceptor usage.

LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E

DEFF Research Database (Denmark)

Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael

2002-01-01

Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....

Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

Energy Technology Data Exchange (ETDEWEB)

Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

1988-07-25

Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

Science.gov (United States)

Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

2014-01-01

Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

First Complete Genome Sequence of Papaya ringspot virus-W Isolated from a Gourd in the United States.

Science.gov (United States)

Ali, Akhtar

2017-01-12

In the United States, the Papaya ringspot virus was first reported from papaya in Florida in 1949. Here, we determined the first complete genome sequence (10,302 nucleotides) of a Papaya ringspot virus-W isolate, which was collected from a commercial field of gourd in Tulsa, OK. Copyright © 2017 Ali.

Low-coverage MiSeq next generation sequencing reveals the mitochondrial genome of the Eastern Rock Lobster, Sagmariasus verreauxi.

Science.gov (United States)

Doyle, Stephen R; Griffith, Ian S; Murphy, Nick P; Strugnell, Jan M

2015-01-01

The complete mitochondrial genome of the Eastern Rock lobster, Sagmariasus verreauxi, is reported for the first time. Using low-coverage, long read MiSeq next generation sequencing, we constructed and determined the mtDNA genome organization of the 15,470 bp sequence from two isolates from Eastern Tasmania, Australia and Northern New Zealand, and identified 46 polymorphic nucleotides between the two sequences. This genome sequence and its genetic polymorphisms will likely be useful in understanding the distribution and population connectivity of the Eastern Rock Lobster, and in the fisheries management of this commercially important species.

Polymorphisms in promoter sequences of MDM2, p53, and p16INK4a genes in normal Japanese individuals

Directory of Open Access Journals (Sweden)

Yasuhito Ohsaka

2010-01-01

Full Text Available Research has been conducted to identify sequence polymorphisms of gene promoter regions in patients and control subjects, including normal individuals, and to determine the influence of these polymorphisms on transcriptional regulation in cells that express wild-type or mutant p53. In this study we isolated genomic DNA from whole blood of healthy Japanese individuals and sequenced the promoter regions of the MDM2, p53, and p16INK4a genes. We identified polymorphisms comprising 3 nucleotide substitutions at exon 1 and intron 1 regions of the MDM2 gene and 1 nucleotide insertion at a poly(C nucleotide position in the p53 gene. The Japanese individuals also exhibited p16INK4a polymorphisms at several positions, including position -191. Reporter gene analysis by using luciferase revealed that the polymorphisms of MDM2, p53, and p16INK4a differentially altered luciferase activities in several cell lines, including the Colo320DM, U251, and T98G cell lines expressing mutant p53. Our results indicate that the promoter sequences of these genes differ among normal Japanese individuals and that polymorphisms can alter gene transcription activity.

Comparison of two Next Generation sequencing platforms for full genome sequencing of Classical Swine Fever Virus

DEFF Research Database (Denmark)

Fahnøe, Ulrik; Pedersen, Anders Gorm; Höper, Dirk

2013-01-01

to the consensus sequence. Additionally, we got an average sequence depth for the genome of 4000 for the Iontorrent PGM and 400 for the FLX platform making the mapping suitable for single nucleotide variant (SNV) detection. The analysis revealed a single non-silent SNV A10665G leading to the amino acid change D......Next Generation Sequencing (NGS) is becoming more adopted into viral research and will be the preferred technology in the years to come. We have recently sequenced several strains of Classical Swine Fever Virus (CSFV) by NGS on both Genome Sequencer FLX (GS FLX) and Iontorrent PGM platforms...

RareVar: A Framework for Detecting Low-Frequency Single-Nucleotide Variants.

Science.gov (United States)

Hao, Yangyang; Xuei, Xiaoling; Li, Lang; Nakshatri, Harikrishna; Edenberg, Howard J; Liu, Yunlong

2017-07-01

Accurate identification of low-frequency somatic point mutations in tumor samples has important clinical utilities. Although high-throughput sequencing technology enables capturing such variants while sequencing primary tumor samples, our ability for accurate detection is compromised when the variant frequency is close to the sequencer error rate. Most current experimental and bioinformatic strategies target mutations with ≥5% allele frequency, which limits our ability to understand the cancer etiology and tumor evolution. We present an experimental and computational modeling framework, RareVar, to reliably identify low-frequency single-nucleotide variants from high-throughput sequencing data under standard experimental protocols. RareVar protocol includes a benchmark design by pooling DNAs from already sequenced individuals at various concentrations to target variants at desired frequencies, 0.5%-3% in our case. By applying a generalized, linear model-based, position-specific error model, followed by machine-learning-based variant calibration, our approach outperforms existing methods. Our method can be applied on most capture and sequencing platforms without modifying the experimental protocol.

Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

Science.gov (United States)

Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

2004-01-01

The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

Sequence variations in the FAD2 gene in seeded pumpkins.

Science.gov (United States)

Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

2015-12-21

Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

Structure, sequence and expression of the hepatitis delta (δ) viral genome

Science.gov (United States)

Wang, Kang-Sheng; Choo, Qui-Lim; Weiner, Amy J.; Ou, Jing-Hsiung; Najarian, Richard C.; Thayer, Richard M.; Mullenbach, Guy T.; Denniston, Katherine J.; Gerin, John L.; Houghton, Michael

1986-10-01

Biochemical and electron microscopic data indicate that the human hepatitis δ viral agent contains a covalently closed circular and single-stranded RNA genome that has certain similarities with viroid-like agents from plants. The sequence of the viral genome (1,678 nucleotides) has been determined and an open reading frame within the complementary strand has been shown to encode an antigen that binds specifically to antisera from patients with chronic hepatitis δ viral infections.

Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

KAUST Repository

Zhang, Zhang

2010-11-08

Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

KAUST Repository

Zhang, Zhang; Yu, Jun

2010-01-01

Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

Science.gov (United States)

Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

2015-01-01

The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

DEFF Research Database (Denmark)

Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

2007-01-01

BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

Science.gov (United States)

Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

2011-01-01

To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

Science.gov (United States)

Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

2014-03-01

Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

Science.gov (United States)

Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

2017-07-01

DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

Whole-genome sequencing of a laboratory-evolved yeast strain

Directory of Open Access Journals (Sweden)

Dunham Maitreya J

2010-02-01

Full Text Available Abstract Background Experimental evolution of microbial populations provides a unique opportunity to study evolutionary adaptation in response to controlled selective pressures. However, until recently it has been difficult to identify the precise genetic changes underlying adaptation at a genome-wide scale. New DNA sequencing technologies now allow the genome of parental and evolved strains of microorganisms to be rapidly determined. Results We sequenced >93.5% of the genome of a laboratory-evolved strain of the yeast Saccharomyces cerevisiae and its ancestor at >28× depth. Both single nucleotide polymorphisms and copy number amplifications were found, with specific gains over array-based methodologies previously used to analyze these genomes. Applying a segmentation algorithm to quantify structural changes, we determined the approximate genomic boundaries of a 5× gene amplification. These boundaries guided the recovery of breakpoint sequences, which provide insights into the nature of a complex genomic rearrangement. Conclusions This study suggests that whole-genome sequencing can provide a rapid approach to uncover the genetic basis of evolutionary adaptations, with further applications in the study of laboratory selections and mutagenesis screens. In addition, we show how single-end, short read sequencing data can provide detailed information about structural rearrangements, and generate predictions about the genomic features and processes that underlie genome plasticity.

MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.

Science.gov (United States)

Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon

2016-03-01

Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.

Cloning and sequencing of the gene coding for alcohol dehydrogenase of Bacillus stearothermophilus and rational shift of the optimum pH.

OpenAIRE

Sakoda, H; Imanaka, T

1992-01-01

Using Bacillus subtilis as a host and pTB524 as a vector plasmid, we cloned the thermostable alcohol dehydrogenase (ADH-T) gene (adhT) from Bacillus stearothermophilus NCA1503 and determined its nucleotide sequence. The deduced amino acid sequence (337 amino acids) was compared with the sequences of ADHs from four different origins. The amino acid residues responsible for the catalytic activity of horse liver ADH had been clarified on the basis of three-dimensional structure. Since those cata...

Using high-throughput barcode sequencing to efficiently map connectomes.

Science.gov (United States)

Peikon, Ian D; Kebschull, Justus M; Vagin, Vasily V; Ravens, Diana I; Sun, Yu-Chi; Brouzes, Eric; Corrêa, Ivan R; Bressan, Dario; Zador, Anthony M

2017-07-07

The function of a neural circuit is determined by the details of its synaptic connections. At present, the only available method for determining a neural wiring diagram with single synapse precision-a 'connectome'-is based on imaging methods that are slow, labor-intensive and expensive. Here, we present SYNseq, a method for converting the connectome into a form that can exploit the speed and low cost of modern high-throughput DNA sequencing. In SYNseq, each neuron is labeled with a unique random nucleotide sequence-an RNA 'barcode'-which is targeted to the synapse using engineered proteins. Barcodes in pre- and postsynaptic neurons are then associated through protein-protein crosslinking across the synapse, extracted from the tissue, and joined into a form suitable for sequencing. Although our failure to develop an efficient barcode joining scheme precludes the widespread application of this approach, we expect that with further development SYNseq will enable tracing of complex circuits at high speed and low cost. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Complete genome sequences of two strains of Treponema pallidum subsp. pertenue from Ghana, Africa: Identical genome sequences in samples isolated more than 7 years apart.

Directory of Open Access Journals (Sweden)

Michal Strouhal

2017-09-01

Full Text Available Treponema pallidum subsp. pertenue (TPE is the causative agent of yaws, a multi-stage disease, endemic in tropical regions of Africa, Asia, Oceania, and South America. To date, four TPE strains have been completely sequenced including three TPE strains of human origin (Samoa D, CDC-2, and Gauthier and one TPE strain (Fribourg-Blanc isolated from a baboon. All TPE strains are highly similar to T. pallidum subsp. pallidum (TPA strains. The mutation rate in syphilis and related treponemes has not been experimentally determined yet.Complete genomes of two TPE strains, CDC 2575 and Ghana-051, that infected patients in Ghana and were isolated in 1980 and 1988, respectively, were sequenced and analyzed. Both strains had identical consensus genome nucleotide sequences raising the question whether TPE CDC 2575 and Ghana-051 represent two different strains. Several lines of evidence support the fact that both strains represent independent samples including regions showing intrastrain heterogeneity (13 and 5 intrastrain heterogeneous sites in TPE Ghana-051 and TPE CDC 2575, respectively. Four of these heterogeneous sites were found in both genomes but the frequency of alternative alleles differed. The identical consensus genome sequences were used to estimate the upper limit of the yaws treponeme evolution rate, which was 4.1 x 10-10 nucleotide changes per site per generation.The estimated upper limit for the mutation rate of TPE was slightly lower than the mutation rate of E. coli, which was determined during a long-term experiment. Given the known diversity between TPA and TPE genomes and the assumption that both TPA and TPE have a similar mutation rate, the most recent common ancestor of syphilis and yaws treponemes appears to be more than ten thousand years old and likely even older.

Masking as an effective quality control method for next-generation sequencing data analysis.

Science.gov (United States)

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

[Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese Ferret-Badger) in Zhejiang province].

Science.gov (United States)

Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing

2009-08-01

Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers

Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human monoclonal antibody with broad reactivity to malignant tumor cells

Energy Technology Data Exchange (ETDEWEB)

Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)

1989-06-12

The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.

Symbolic complexity for nucleotide sequences: a sign of the genome structure

International Nuclear Information System (INIS)

Salgado-García, R; Ugalde, E

2016-01-01

We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)

Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

Science.gov (United States)

McAllister, Christine A; Miller, Allison J

2016-07-01

Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

Science.gov (United States)

Chen, Sherry Xi; Seelig, Georg

2016-04-20

Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

Science.gov (United States)

Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

2015-05-30

Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

Science.gov (United States)

Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

2016-01-01

Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

Co-operation between Polymerases and Nucleotide Synthetases in the RNA World.

Directory of Open Access Journals (Sweden)

Ye Eun Kim

2016-11-01

Full Text Available It is believed that life passed through an RNA World stage in which replication was sustained by catalytic RNAs (ribozymes. The two most obvious types of ribozymes are a polymerase, which uses a neighbouring strand as a template to make a complementary sequence to the template, and a nucleotide synthetase, which synthesizes monomers for use by the polymerase. When a chemical source of monomers is available, the polymerase can survive on its own. When the chemical supply of monomers is too low, nucleotide production by the synthetase is essential and the two ribozymes can only survive when they are together. Here we consider a computational model to investigate conditions under which coexistence and cooperation of these two types of ribozymes is possible. The model considers six types of strands: the two functional sequences, the complementary strands to these sequences (which are required as templates, and non-functional mutants of the two sequences (which act as parasites. Strands are distributed on a two-dimensional lattice. Polymerases replicate strands on neighbouring sites and synthetases produce monomers that diffuse in the local neighbourhood. We show that coexistence of unlinked polymerases and synthetases is possible in this spatial model under conditions in which neither sequence could survive alone; hence, there is a selective force for increasing complexity. Coexistence is dependent on the relative lengths of the two functional strands, the strand diffusion rate, the monomer diffusion rate, and the rate of deleterious mutations. The sensitivity of this two-ribozyme system suggests that evolution of a system of many types of ribozymes would be difficult in a purely spatial model with unlinked genes. We therefore speculate that linkage of genes onto mini-chromosomes and encapsulation of strands in protocells would have been important fairly early in the history of life as a means of enabling more complex systems to evolve.

Intra-species sequence comparisons for annotating genomes

Energy Technology Data Exchange (ETDEWEB)

Boffelli, Dario; Weer, Claire V.; Weng, Li; Lewis, Keith D.; Shoukry, Malak I.; Pachter, Lior; Keys, David N.; Rubin, Edward M.

2004-07-15

Analysis of sequence variation among members of a single species offers a potential approach to identify functional DNA elements responsible for biological features unique to that species. Due to its high rate of allelic polymorphism and ease of genetic manipulability, we chose the sea squirt, Ciona intestinalis, to explore intra-species sequence comparisons for genome annotation. A large number of C. intestinalis specimens were collected from four continents and a set of genomic intervals amplified, resequenced and analyzed to determine the mutation rates at each nucleotide in the sequence. We found that regions with low mutation rates efficiently demarcated functionally constrained sequences: these include a set of noncoding elements, which we showed in C intestinalis transgenic assays to act as tissue-specific enhancers, as well as the location of coding sequences. This illustrates that comparisons of multiple members of a species can be used for genome annotation, suggesting a path for the annotation of the sequenced genomes of organisms occupying uncharacterized phylogenetic branches of the animal kingdom and raises the possibility that the resequencing of a large number of Homo sapiens individuals might be used to annotate the human genome and identify sequences defining traits unique to our species. The sequence data from this study has been submitted to GenBank under accession nos. AY667278-AY667407.

Exploring the correlation between the sequence composition of the nucleotide binding G5 loop of the FeoB GTPase domain (NFeoB) and intrinsic rate of GDP release.

Science.gov (United States)

Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika

2014-12-12

GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.

Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.

Directory of Open Access Journals (Sweden)

Waikhom Bimolata

Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.

Sequence walkers: a graphical method to display how binding proteins interact with DNA or RNA sequences | Center for Cancer Research

Science.gov (United States)

A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of each letter shows the contribution of that base to the average sequence conservation of the binding site, as represented by a sequence logo.

Methods for decoding Cas9 protospacer adjacent motif (PAM) sequences: A brief overview.

Science.gov (United States)

Karvelis, Tautvydas; Gasiunas, Giedrius; Siksnys, Virginijus

2017-05-15

Recently the Cas9, an RNA guided DNA endonuclease, emerged as a powerful tool for targeted genome manipulations. Cas9 protein can be reprogrammed to cleave, bind or nick any DNA target by simply changing crRNA sequence, however a short nucleotide sequence, termed PAM, is required to initiate crRNA hybridization to the DNA target. PAM sequence is recognized by Cas9 protein and must be determined experimentally for each Cas9 variant. Exploration of Cas9 orthologs could offer a diversity of PAM sequences and novel biochemical properties that may be beneficial for genome editing applications. Here we briefly review and compare Cas9 PAM identification assays that can be adopted for other PAM-dependent CRISPR-Cas systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Population genetic implications from sequence variation in four Y chromosome genes.

Science.gov (United States)

Shen, P; Wang, F; Underhill, P A; Franco, C; Yang, W H; Roxas, A; Sung, R; Lin, A A; Hyman, R W; Vollrath, D; Davis, R W; Cavalli-Sforza, L L; Oefner, P J

2000-06-20

Some insight into human evolution has been gained from the sequencing of four Y chromosome genes. Primary genomic sequencing determined gene SMCY to be composed of 27 exons that comprise 4,620 bp of coding sequence. The unfinished sequencing of the 5' portion of gene UTY1 was completed by primer walking, and a total of 20 exons were found. By using denaturing HPLC, these two genes, as well as DBY and DFFRY, were screened for polymorphic sites in 53-72 representatives of the five continents. A total of 98 variants were found, yielding nucleotide diversity estimates of 2.45 x 10(-5), 5. 07 x 10(-5), and 8.54 x 10(-5) for the coding regions of SMCY, DFFRY, and UTY1, respectively, with no variant having been observed in DBY. In agreement with most autosomal genes, diversity estimates for the noncoding regions were about 2- to 3-fold higher and ranged from 9. 16 x 10(-5) to 14.2 x 10(-5) for the four genes. Analysis of the frequencies of derived alleles for all four genes showed that they more closely fit the expectation of a Luria-Delbrück distribution than a distribution expected under a constant population size model, providing evidence for exponential population growth. Pairwise nucleotide mismatch distributions date the occurrence of population expansion to approximately 28,000 years ago. This estimate is in accord with the spread of Aurignacian technology and the disappearance of the Neanderthals.

Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

KAUST Repository

Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M

2018-01-01

Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

KAUST Repository

Teng, Haotian

2018-04-10

Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

Complete genome sequence and phylogenetic analyses of an aquabirnavirus isolated from a diseased marbled eel culture in Taiwan.

Science.gov (United States)

Wen, Chiu-Ming

2017-08-01

An aquabirnavirus was isolated from diseased marbled eels (Anguilla marmorata; MEIPNV1310) with gill haemorrhages and associated mortality. Its genome segment sequences were obtained through next-generation sequencing and compared with published aquabirnavirus sequences. The results indicated that the genome sequence of MEIPNV1310 contains segment A (3099 nucleotides) and segment B (2789 nucleotides). Phylogenetic analysis showed that MEIPNV1310 is closely related to the infectious pancreatic necrosis Ab strain within genogroup II. This genome sequence is beneficial for studying the geographic distribution and evolution of aquabirnaviruses.

Biomolecule Sequencer: Next-Generation DNA Sequencing Technology for In-Flight Environmental Monitoring, Research, and Beyond

Science.gov (United States)

Smith, David J.; Burton, Aaron; Castro-Wallace, Sarah; John, Kristen; Stahl, Sarah E.; Dworkin, Jason Peter; Lupisella, Mark L.

2016-01-01

On the International Space Station (ISS), technologies capable of rapid microbial identification and disease diagnostics are not currently available. NASA still relies upon sample return for comprehensive, molecular-based sample characterization. Next-generation DNA sequencing is a powerful approach for identifying microorganisms in air, water, and surfaces onboard spacecraft. The Biomolecule Sequencer payload, manifested to SpaceX-9 and scheduled on the Increment 4748 research plan (June 2016), will assess the functionality of a commercially-available next-generation DNA sequencer in the microgravity environment of ISS. The MinION device from Oxford Nanopore Technologies (Oxford, UK) measures picoamp changes in electrical current dependent on nucleotide sequences of the DNA strand migrating through nanopores in the system. The hardware is exceptionally small (9.5 x 3.2 x 1.6 cm), lightweight (120 grams), and powered only by a USB connection. For the ISS technology demonstration, the Biomolecule Sequencer will be powered by a Microsoft Surface Pro3. Ground-prepared samples containing lambda bacteriophage, Escherichia coli, and mouse genomic DNA, will be launched and stored frozen on the ISS until experiment initiation. Immediately prior to sequencing, a crew member will collect and thaw frozen DNA samples, connect the sequencer to the Surface Pro3, inject thawed samples into a MinION flow cell, and initiate sequencing. At the completion of the sequencing run, data will be downlinked for ground analysis. Identical, synchronous ground controls will be used for data comparisons to determine sequencer functionality, run-time sequence, current dynamics, and overall accuracy. We will present our latest results from the ISS flight experiment the first time DNA has ever been sequenced in space and discuss the many potential applications of the Biomolecule Sequencer for environmental monitoring, medical diagnostics, higher fidelity and more adaptable Space Biology Human

[Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

Science.gov (United States)

Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

2010-01-01

Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses

Complete genome sequence of a proposed new tymovirus, tomato blistering mosaic virus.

Science.gov (United States)

Nicolini, Cícero; Inoue-Nagata, Alice Kazuko; Nagata, Tatsuya

2015-02-01

In a previous work, a distinct tymovirus infecting tomato plants in Brazil was reported and tentatively named tomato blistering mosaic virus (ToBMV). In this study, the complete genome sequence of ToBMV was determined and shown to have a size of 6277 nucleotides and three ORFs: ORF 1 encodes the replication-complex polyprotein, ORF 2 the movement protein, and ORF 3 the coat protein. The cleavage sites of the replication-complex polyprotein (GS/LP and VAG/QSP) of ToBMV were predicted by alignment analysis of amino acid sequences of other tymoviruses. In the phylogenetic tree, ToBMV clustered with the tymoviruses that infect solanaceous hosts.

repDNA: a Python package to generate various modes of feature vectors for DNA sequences by incorporating user-defined physicochemical properties and sequence-order effects.

Science.gov (United States)

Liu, Bin; Liu, Fule; Fang, Longyun; Wang, Xiaolong; Chou, Kuo-Chen

2015-04-15

In order to develop powerful computational predictors for identifying the biological features or attributes of DNAs, one of the most challenging problems is to find a suitable approach to effectively represent the DNA sequences. To facilitate the studies of DNAs and nucleotides, we developed a Python package called representations of DNAs (repDNA) for generating the widely used features reflecting the physicochemical properties and sequence-order effects of DNAs and nucleotides. There are three feature groups composed of 15 features. The first group calculates three nucleic acid composition features describing the local sequence information by means of kmers; the second group calculates six autocorrelation features describing the level of correlation between two oligonucleotides along a DNA sequence in terms of their specific physicochemical properties; the third group calculates six pseudo nucleotide composition features, which can be used to represent a DNA sequence with a discrete model or vector yet still keep considerable sequence-order information via the physicochemical properties of its constituent oligonucleotides. In addition, these features can be easily calculated based on both the built-in and user-defined properties via using repDNA. The repDNA Python package is freely accessible to the public at http://bioinformatics.hitsz.edu.cn/repDNA/. bliu@insun.hit.edu.cn or kcchou@gordonlifescience.org Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Molecular phylogeny of ateline new world monkeys (Platyrrhini, atelinae) based on gamma-globin gene sequences: evidence that brachyteles is the sister group of lagothrix.

Science.gov (United States)

Meireles, C M; Czelusniak, J; Schneider, M P; Muniz, J A; Brigido, M C; Ferreira, H S; Goodman, M

1999-06-01

Nucleotide sequences, each spanning approximately 7 kb of the contiguous gamma1 and gamma2 globin genomic loci, were determined for seven species representing all extant genera (Ateles, Lagothrix, Brachyteles, and Alouatta) of the New World monkey subfamily Atelinae. After aligning these seven ateline sequences with outgroup sequences from several other primate (non-ateline) genera, they were analyzed by maximum parsimony, maximum likelihood, and neighbor-joining algorithms. All three analyzes estimated the same phylogenetic relationships: [Alouatta [Ateles (Brachyteles, Lagothrix)

Phylogenomics of Phrynosomatid Lizards: Conflicting Signals from Sequence Capture versus Restriction Site Associated DNA Sequencing

Science.gov (United States)

Leaché, Adam D.; Chavez, Andreas S.; Jones, Leonard N.; Grummer, Jared A.; Gottscho, Andrew D.; Linkem, Charles W.

2015-01-01

Sequence capture and restriction site associated DNA sequencing (RADseq) are popular methods for obtaining large numbers of loci for phylogenetic analysis. These methods are typically used to collect data at different evolutionary timescales; sequence capture is primarily used for obtaining conserved loci, whereas RADseq is designed for discovering single nucleotide polymorphisms (SNPs) suitable for population genetic or phylogeographic analyses. Phylogenetic questions that span both “recent” and “deep” timescales could benefit from either type of data, but studies that directly compare the two approaches are lacking. We compared phylogenies estimated from sequence capture and double digest RADseq (ddRADseq) data for North American phrynosomatid lizards, a species-rich and diverse group containing nine genera that began diversifying approximately 55 Ma. Sequence capture resulted in 584 loci that provided a consistent and strong phylogeny using concatenation and species tree inference. However, the phylogeny estimated from the ddRADseq data was sensitive to the bioinformatics steps used for determining homology, detecting paralogs, and filtering missing data. The topological conflicts among the SNP trees were not restricted to any particular timescale, but instead were associated with short internal branches. Species tree analysis of the largest SNP assembly, which also included the most missing data, supported a topology that matched the sequence capture tree. This preferred phylogeny provides strong support for the paraphyly of the earless lizard genera Holbrookia and Cophosaurus, suggesting that the earless morphology either evolved twice or evolved once and was subsequently lost in Callisaurus. PMID:25663487

Determination of Trichuris skrjabini by sequencing of the ITS1-5.8S-ITS2 segment of the ribosomal DNA: comparative molecular study of different species of trichurids.

Science.gov (United States)

Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C

2004-06-01

Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.

Identification of cyclic nucleotide gated channels using regular expressions

KAUST Repository

Zelman, Alice K.

2013-09-03

Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

The SWISS-PROT protein sequence data bank: current status.

OpenAIRE

Bairoch, A; Boeckmann, B

1994-01-01

SWISS-PROT is an annotated protein sequence database established in 1986 and maintained collaboratively, since 1988, by the Department of Medical Biochemistry of the University of Geneva and the EMBL Data Library. The SWISS-PROT protein sequence data bank consist of sequence entries. Sequence entries are composed of different lines types, each with their own format. For standardization purposes the format of SWISS-PROT follows as closely as possible that of the EMBL Nucleotide Sequence Databa...

Determination of genetic relatedness from low-coverage human genome sequences using pedigree simulations.

Science.gov (United States)

Martin, Michael D; Jay, Flora; Castellano, Sergi; Slatkin, Montgomery

2017-08-01

We develop and evaluate methods for inferring relatedness among individuals from low-coverage DNA sequences of their genomes, with particular emphasis on sequences obtained from fossil remains. We suggest the major factors complicating the determination of relatedness among ancient individuals are sequencing depth, the number of overlapping sites, the sequencing error rate and the presence of contamination from present-day genetic sources. We develop a theoretical model that facilitates the exploration of these factors and their relative effects, via measurement of pairwise genetic distances, without calling genotypes, and determine the power to infer relatedness under various scenarios of varying sequencing depth, present-day contamination and sequencing error. The model is validated by a simulation study as well as the analysis of aligned sequences from present-day human genomes. We then apply the method to the recently published genome sequences of ancient Europeans, developing a statistical treatment to determine confidence in assigned relatedness that is, in some cases, more precise than previously reported. As the majority of ancient specimens are from animals, this method would be applicable to investigate kinship in nonhuman remains. The developed software grups (Genetic Relatedness Using Pedigree Simulations) is implemented in Python and freely available. © 2017 John Wiley & Sons Ltd.

Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

Science.gov (United States)

Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

2000-02-01

A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

Electrical detection and quantification of single and mixed DNA nucleotides in suspension

Science.gov (United States)

Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

2016-09-01

High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

Completed sequence and corrected annotation of the genome of maize Iranian mosaic virus.

Science.gov (United States)

Ghorbani, Abozar; Izadpanah, Keramatollah; Dietzgen, Ralf G

2018-03-01

Maize Iranian mosaic virus (MIMV) is a negative-sense single-stranded RNA virus that is classified in the genus Nucleorhabdovirus, family Rhabdoviridae. The MIMV genome contains six open reading frames (ORFs) that encode in 3΄ to 5΄ order the nucleocapsid protein (N), phosphoprotein (P), putative movement protein (P3), matrix protein (M), glycoprotein (G) and RNA-dependent RNA polymerase (L). In this study, we determined the first complete genome sequence of MIMV using Illumina RNA-Seq and 3'/5' RACE. MIMV genome ('Fars' isolate) is 12,426 nucleotides in length. Unexpectedly, the predicted N gene ORF of this isolate and of four other Iranian isolates is 143 nucleotides shorter than that of the MIMV coding-complete reference isolate 'Shiraz 1' (Genbank NC_011542), possibly due to a minor error in the previous sequence. Genetic variability among the N, P, P3 and G ORFs of Iranian MIMV isolates was limited, but highest in the G gene ORF. Phylogenetic analysis of complete nucleorhabdovirus genomes demonstrated a close evolutionary relationship between MIMV, maize mosaic virus and taro vein chlorosis virus.

[Reconstruction of long polynucleotide sequences from fragments using the Iskra-226 personal computer

Science.gov (United States)

Kostetskiĭ, P V; Dobrova, I E

1988-04-01

An algorithm for reconstructing long DNA sequences, i.e. arranging all overlapping gel readings in the contigs, and the corresponding BASIC programme for personal computer "Iskra-226" (USSR) are described. The contig construction begins with the search for all fragments overlapping the basic (longest) one follower by determination of coordinates of 5' ends of the overlapping fragments. Then the gel reading with minimal 5' end coordinate and the gel reading with maximal 3' end coordinate are selected and used as basic ones at the next assembly steps. The procedure is finished when no gel reading overlapping the basic one can be found. All gel readings entered the contig are ignored at the next steps of the assembly. Finally, one or several contigs consisted of DNA fragments are obtained. Effectiveness of the algorithm was tested on a model based on the multiple assembly of the nucleotide sequence, encoding the Na, K-ATPase alpha-subunit of pig kidney. The programme does not call for user's participation and can comprise contigs up to 10,000 nucleotides long.

Horse domestication and conservation genetics of Przewalski's horse inferred from sex chromosomal and autosomal sequences.

Science.gov (United States)

Lau, Allison N; Peng, Lei; Goto, Hiroki; Chemnick, Leona; Ryder, Oliver A; Makova, Kateryna D

2009-01-01

Despite their ability to interbreed and produce fertile offspring, there is continued disagreement about the genetic relationship of the domestic horse (Equus caballus) to its endangered wild relative, Przewalski's horse (Equus przewalskii). Analyses have differed as to whether or not Przewalski's horse is placed phylogenetically as a separate sister group to domestic horses. Because Przewalski's horse and domestic horse are so closely related, genetic data can also be used to infer domestication-specific differences between the two. To investigate the genetic relationship of Przewalski's horse to the domestic horse and to address whether evolution of the domestic horse is driven by males or females, five homologous introns (a total of approximately 3 kb) were sequenced on the X and Y chromosomes in two Przewalski's horses and three breeds of domestic horses: Arabian horse, Mongolian domestic horse, and Dartmoor pony. Five autosomal introns (a total of approximately 6 kb) were sequenced for these horses as well. The sequences of sex chromosomal and autosomal introns were used to determine nucleotide diversity and the forces driving evolution in these species. As a result, X chromosomal and autosomal data do not place Przewalski's horses in a separate clade within phylogenetic trees for horses, suggesting a close relationship between domestic and Przewalski's horses. It was also found that there was a lack of nucleotide diversity on the Y chromosome and higher nucleotide diversity than expected on the X chromosome in domestic horses as compared with the Y chromosome and autosomes. This supports the hypothesis that very few male horses along with numerous female horses founded the various domestic horse breeds. Patterns of nucleotide diversity among different types of chromosomes were distinct for Przewalski's in contrast to domestic horses, supporting unique evolutionary histories of the two species.

Genetic diversity of Taenia hydatigena in the northern part of the West Bank, Palestine as determined by mitochondrial DNA sequences.

Science.gov (United States)

Adwan, Kamel; Jayousi, Alaa; Abuseir, Sameh; Abbasi, Ibrahim; Adwan, Ghaleb; Jarrar, Naser

2018-06-26

Cysticercus tenuicollis is the metacestode of canine tapeworm Taenia hydatigena, which has been reported in domestic and wild ruminants and is causing veterinary and economic losses in the meat industry. This study was conducted to determine the sequence variation in the mitochondrial cytochrome c oxidase subunit 1 (coxl) gene in 20 isolates of T. hydatigena metacestodes (cysticercus tenuicollis) collected from northern West Bank in Palestine. Nine haplotypes were detected, with one prevailing (55%). The total haplotype diversity (0.705) and the total nucleotide diversity (0.0045) displayed low genetic diversity among our isolates. Haplotype analysis showed a star-shaped network with a centrally positioned common haplotype. The Tajima's D, and Fu and Li's statistics in cysticercus tenuicollis population of this region showed a negative value, indicating deviations from neutrality and both suggested recent population expansion for the population. The findings of this study would greatly help to implement control and preventive measures for T. hydatigena larvae infection in Palestine.

A set of tetra-nucleotide core motif SSR markers for efficient identification of potato (Solanum tuberosum) cultivars.

Science.gov (United States)

Kishine, Masahiro; Tsutsumi, Katsuji; Kitta, Kazumi

2017-12-01

Simple sequence repeat (SSR) is a popular tool for individual fingerprinting. The long-core motif (e.g. tetra-, penta-, and hexa-nucleotide) simple sequence repeats (SSRs) are preferred because they make it easier to separate and distinguish neighbor alleles. In the present study, a new set of 8 tetra-nucleotide SSRs in potato ( Solanum tuberosum ) is reported. By using these 8 markers, 72 out of 76 cultivars obtained from Japan and the United States were clearly discriminated, while two pairs, both of which arose from natural variation, showed identical profiles. The combined probability of identity between two random cultivars for the set of 8 SSR markers was estimated to be 1.10 × 10 -8 , confirming the usefulness of the proposed SSR markers for fingerprinting analyses of potato.

Sequence analysis of putative swrW gene required for surfactant ...

African Journals Online (AJOL)

Serratia marcescens produces biosurfactant serrawettin, essential for its population migration behavior. Serrawettin W1 was revealed to be an antibiotic serratamolide that makes it significant for deoxyribonucleic acid (DNA) and protein sequence analysis. Four nucleotide and amino-acid sequences from local strains ...

Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

Science.gov (United States)

Zhang, Xueru; McGown, Linda B

2013-06-01

DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

Directory of Open Access Journals (Sweden)

Tobias Fromme

2018-02-01

Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

Templated sequence insertion polymorphisms in the human genome

Science.gov (United States)

Onozawa, Masahiro; Aplan, Peter

2016-11-01

Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

Spreadsheet macros for coloring sequence alignments.

Science.gov (United States)

Haygood, M G

1993-12-01

This article describes a set of Microsoft Excel macros designed to color amino acid and nucleotide sequence alignments for review and preparation of visual aids. The colored alignments can then be modified to emphasize features of interest. Procedures for importing and coloring sequences are described. The macro file adds a new menu to the menu bar containing sequence-related commands to enable users unfamiliar with Excel to use the macros more readily. The macros were designed for use with Macintosh computers but will also run with the DOS version of Excel.

Recombination-dependent replication and gene conversion homogenize repeat sequences and diversify plastid genome structure.

Science.gov (United States)

Ruhlman, Tracey A; Zhang, Jin; Blazier, John C; Sabir, Jamal S M; Jansen, Robert K

2017-04-01

There is a misinterpretation in the literature regarding the variable orientation of the small single copy region of plastid genomes (plastomes). The common phenomenon of small and large single copy inversion, hypothesized to occur through intramolecular recombination between inverted repeats (IR) in a circular, single unit-genome, in fact, more likely occurs through recombination-dependent replication (RDR) of linear plastome templates. If RDR can be primed through both intra- and intermolecular recombination, then this mechanism could not only create inversion isomers of so-called single copy regions, but also an array of alternative sequence arrangements. We used Illumina paired-end and PacBio single-molecule real-time (SMRT) sequences to characterize repeat structure in the plastome of Monsonia emarginata (Geraniaceae). We used OrgConv and inspected nucleotide alignments to infer ancestral nucleotides and identify gene conversion among repeats and mapped long (>1 kb) SMRT reads against the unit-genome assembly to identify alternative sequence arrangements. Although M. emarginata lacks the canonical IR, we found that large repeats (>1 kilobase; kb) represent ∼22% of the plastome nucleotide content. Among the largest repeats (>2 kb), we identified GC-biased gene conversion and mapping filtered, long SMRT reads to the M. emarginata unit-genome assembly revealed alternative, substoichiometric sequence arrangements. We offer a model based on RDR and gene conversion between long repeated sequences in the M. emarginata plastome and provide support that both intra-and intermolecular recombination between large repeats, particularly in repeat-rich plastomes, varies unit-genome structure while homogenizing the nucleotide sequence of repeats. © 2017 Botanical Society of America.

Complete Genome Sequence of Frog virus 3, Isolated from a Strawberry Poison Frog (Oophaga pumilio) Imported from Nicaragua into the Netherlands

NARCIS (Netherlands)

Saucedo, Bernardo; Hughes, Joseph; van Beurden, Steven J; Suárez, Nicolás M; Haenen, Olga L M; Voorbergen-Laarman, Michal A; Gröne, Andrea; Kik, Marja J L

2017-01-01

Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

Complete genome sequence of frog virus 3, isolated from a strawberry poison frog (Oophaga pumilio) imported from nicaragua into the Netherlands

NARCIS (Netherlands)

Saucedo, Bernardo; Hughes, Joseph; Beurden, van Steven J.; Suárez, Nicolás M.; Haenen, Olga L.M.; Voorbergen-Laarman, Michal; Gröne, Andrea; Kika, Marja J.L.

2017-01-01

Frog virus 3 was isolated from a strawberry poison frog (Oophaga pumilio) imported from Nicaragua via Germany to the Netherlands, and its complete genome sequence was determined. Frog virus 3 isolate Op/2015/Netherlands/UU3150324001 is 107,183 bp long and has a nucleotide similarity of 98.26% to the

Whole Genome Sequences of Three Treponema pallidum ssp. pertenue Strains: Yaws and Syphilis Treponemes Differ in Less than 0.2% of the Genome Sequence

Science.gov (United States)

Chen, Lei; Pospíšilová, Petra; Strouhal, Michal; Qin, Xiang; Mikalová, Lenka; Norris, Steven J.; Muzny, Donna M.; Gibbs, Richard A.; Fulton, Lucinda L.; Sodergren, Erica; Weinstock, George M.; Šmajs, David

2012-01-01

Background The yaws treponemes, Treponema pallidum ssp. pertenue (TPE) strains, are closely related to syphilis causing strains of Treponema pallidum ssp. pallidum (TPA). Both yaws and syphilis are distinguished on the basis of epidemiological characteristics, clinical symptoms, and several genetic signatures of the corresponding causative agents. Methodology/Principal Findings To precisely define genetic differences between TPA and TPE, high-quality whole genome sequences of three TPE strains (Samoa D, CDC-2, Gauthier) were determined using next-generation sequencing techniques. TPE genome sequences were compared to four genomes of TPA strains (Nichols, DAL-1, SS14, Chicago). The genome structure was identical in all three TPE strains with similar length ranging between 1,139,330 bp and 1,139,744 bp. No major genome rearrangements were found when compared to the four TPA genomes. The whole genome nucleotide divergence (dA) between TPA and TPE subspecies was 4.7 and 4.8 times higher than the observed nucleotide diversity (π) among TPA and TPE strains, respectively, corresponding to 99.8% identity between TPA and TPE genomes. A set of 97 (9.9%) TPE genes encoded proteins containing two or more amino acid replacements or other major sequence changes. The TPE divergent genes were mostly from the group encoding potential virulence factors and genes encoding proteins with unknown function. Conclusions/Significance Hypothetical genes, with genetic differences, consistently found between TPE and TPA strains are candidates for syphilitic treponemes virulence factors. Seventeen TPE genes were predicted under positive selection, and eleven of them coded either for predicted exported proteins or membrane proteins suggesting their possible association with the cell surface. Sequence changes between TPE and TPA strains and changes specific to individual strains represent suitable targets for subspecies- and strain-specific molecular diagnostics. PMID:22292095

16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

Science.gov (United States)

Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo

2002-12-01

The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

Science.gov (United States)

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

Deep Sequence Analysis of Non-Small Cell Lung Cancer: Integrated Analysis of Gene Expression, Alternative Splicing, and Single Nucleotide Variations in Lung Adenocarcinomas with and without Oncogenic KRAS Mutations

International Nuclear Information System (INIS)

Kalari, Krishna R.; Rossell, David; Necela, Brian M.; Asmann, Yan W.; Nair, Asha

2012-01-01

KRAS mutations are highly prevalent in non-small cell lung cancer (NSCLC), and tumors harboring these mutations tend to be aggressive and resistant to chemotherapy. We used next-generation sequencing technology to identify pathways that are specifically altered in lung tumors harboring a KRAS mutation. Paired-end RNA-sequencing of 15 primary lung adenocarcinoma tumors (8 harboring mutant KRAS and 7 with wild-type KRAS) were performed. Sequences were mapped to the human genome, and genomic features, including differentially expressed genes, alternate splicing isoforms and single nucleotide variants, were determined for tumors with and without KRAS mutation using a variety of computational methods. Network analysis was carried out on genes showing differential expression (374 genes), alternate splicing (259 genes), and SNV-related changes (65 genes) in NSCLC tumors harboring a KRAS mutation. Genes exhibiting two or more connections from the lung adenocarcinoma network were used to carry out integrated pathway analysis. The most significant signaling pathways identified through this analysis were the NFκB, ERK1/2, and AKT pathways. A 27 gene mutant KRAS-specific sub network was extracted based on gene–gene connections from the integrated network, and interrogated for druggable targets. Our results confirm previous evidence that mutant KRAS tumors exhibit activated NFκB, ERK1/2, and AKT pathways and may be preferentially sensitive to target therapeutics toward these pathways. In addition, our analysis indicates novel, previously unappreciated links between mutant KRAS and the TNFR and PPARγ signaling pathways, suggesting that targeted PPARγ antagonists and TNFR inhibitors may be useful therapeutic strategies for treatment of mutant KRAS lung tumors. Our study is the first to integrate genomic features from RNA-Seq data from NSCLC and to define a first draft genomic landscape model that is unique to tumors with oncogenic KRAS mutations.

Sequence analysis of the internal transcribed spacer (ITS) region reveals a novel clade of Ichthyophonus sp. from rainbow trout.

Science.gov (United States)

Rasmussen, C; Purcell, M K; Gregg, J L; LaPatra, S E; Winton, J R; Hershberger, P K

2010-03-09

The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of approximately 740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).

Unveiling Mycoplasma hyopneumoniae Promoters: Sequence Definition and Genomic Distribution

Science.gov (United States)

Weber, Shana de Souto; Sant'Anna, Fernando Hayashi; Schrank, Irene Silveira

2012-01-01

Several Mycoplasma species have had their genome completely sequenced, including four strains of the swine pathogen Mycoplasma hyopneumoniae. Nevertheless, little is known about the nucleotide sequences that control transcriptional initiation in these microorganisms. Therefore, with the objective of investigating the promoter sequences of M. hyopneumoniae, 23 transcriptional start sites (TSSs) of distinct genes were mapped. A pattern that resembles the σ70 promoter −10 element was found upstream of the TSSs. However, no −35 element was distinguished. Instead, an AT-rich periodic signal was identified. About half of the experimentally defined promoters contained the motif 5′-TRTGn-3′, which was identical to the −16 element usually found in Gram-positive bacteria. The defined promoters were utilized to build position-specific scoring matrices in order to scan putative promoters upstream of all coding sequences (CDSs) in the M. hyopneumoniae genome. Two hundred and one signals were found associated with 169 CDSs. Most of these sequences were located within 100 nucleotides of the start codons. This study has shown that the number of promoter-like sequences in the M. hyopneumoniae genome is more frequent than expected by chance, indicating that most of the sequences detected are probably biologically functional. PMID:22334569

Structural determination of functional units of the nucleotide binding domain (NBD94 of the reticulocyte binding protein Py235 of Plasmodium yoelii.

Directory of Open Access Journals (Sweden)

Ardina Grüber

2010-02-01

Full Text Available Invasion of the red blood cells (RBC by the merozoite of malaria parasites involves a large number of receptor ligand interactions. The reticulocyte binding protein homologue family (RH plays an important role in erythrocyte recognition as well as virulence. Recently, it has been shown that members of RH in addition to receptor binding may also have a role as ATP/ADP sensor. A 94 kDa region named Nucleotide-Binding Domain 94 (NBD94 of Plasmodium yoelii YM, representative of the putative nucleotide binding region of RH, has been demonstrated to bind ATP and ADP selectively. Binding of ATP or ADP induced nucleotide-dependent structural changes in the C-terminal hinge-region of NBD94, and directly impacted on the RBC binding ability of RH.In order to find the smallest structural unit, able to bind nucleotides, and its coupling module, the hinge region, three truncated domains of NBD94 have been generated, termed NBD94(444-547, NBD94(566-663 and NBD94(674-793, respectively. Using fluorescence correlation spectroscopy NBD94(444-547 has been identified to form the smallest nucleotide binding segment, sensitive for ATP and ADP, which became inhibited by 4-Chloro-7-nitrobenzofurazan. The shape of NBD94(444-547 in solution was calculated from small-angle X-ray scattering data, revealing an elongated molecule, comprised of two globular domains, connected by a spiral segment of about 73.1 A in length. The high quality of the constructs, forming the hinge-region, NBD94(566-663 and NBD94(674-793 enabled to determine the first crystallographic and solution structure, respectively. The crystal structure of NBD94(566-663 consists of two helices with 97.8 A and 48.6 A in length, linked by a loop. By comparison, the low resolution structure of NBD94(674-793 in solution represents a chair-like shape with three architectural segments.These structures give the first insight into how nucleotide binding impacts on the overall structure of RH and demonstrates the

Final Technical Report on the Genome Sequence DataBase (GSDB): DE-FG03 95 ER 62062 September 1997-September 1999

Energy Technology Data Exchange (ETDEWEB)

Harger, Carol A.

1999-10-28

Since September 1997 NCGR has produced two web-based tools for researchers to use to access and analyze data in the Genome Sequence DataBase (GSDB). These tools are: Sequence Viewer, a nucleotide sequence and annotation visualization tool, and MAR-Finder, a tool that predicts, base upon statistical inferences, the location of matrix attachment regions (MARS) within a nucleotide sequence. [The annual report for June 1996 to August 1997 is included as an attachment to this final report.

Zseq: An Approach for Preprocessing Next-Generation Sequencing Data.

Science.gov (United States)

Alkhateeb, Abedalrhman; Rueda, Luis

2017-08-01

Next-generation sequencing technology generates a huge number of reads (short sequences), which contain a vast amount of genomic data. The sequencing process, however, comes with artifacts. Preprocessing of sequences is mandatory for further downstream analysis. We present Zseq, a linear method that identifies the most informative genomic sequences and reduces the number of biased sequences, sequence duplications, and ambiguous nucleotides. Zseq finds the complexity of the sequences by counting the number of unique k-mers in each sequence as its corresponding score and also takes into the account other factors such as ambiguous nucleotides or high GC-content percentage in k-mers. Based on a z-score threshold, Zseq sweeps through the sequences again and filters those with a z-score less than the user-defined threshold. Zseq algorithm is able to provide a better mapping rate; it reduces the number of ambiguous bases significantly in comparison with other methods. Evaluation of the filtered reads has been conducted by aligning the reads and assembling the transcripts using the reference genome as well as de novo assembly. The assembled transcripts show a better discriminative ability to separate cancer and normal samples in comparison with another state-of-the-art method. Moreover, de novo assembled transcripts from the reads filtered by Zseq have longer genomic sequences than other tested methods. Estimating the threshold of the cutoff point is introduced using labeling rules with optimistic results.

Population genetic analysis of shotgun assemblies of genomic sequences from multiple individuals

DEFF Research Database (Denmark)

Hellmann, Ines; Mang, Yuan; Gu, Zhiping

2008-01-01

We introduce a simple, broadly applicable method for obtaining estimates of nucleotide diversity from genomic shotgun sequencing data. The method takes into account the special nature of these data: random sampling of genomic segments from one or more individuals and a relatively high error rate...... for individual reads. Applying this method to data from the Celera human genome sequencing and SNP discovery project, we obtain estimates of nucleotide diversity in windows spanning the human genome and show that the diversity to divergence ratio is reduced in regions of low recombination. Furthermore, we show...

Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa

Directory of Open Access Journals (Sweden)

Shahin Arwa

2012-11-01

Full Text Available Abstract Background Bulbous flowers such as lily and tulip (Liliaceae family are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Results Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups and among the three monocot species: lily, tulip, and rice (6,900 groups were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Conclusions

Generation and analysis of expressed sequence tags in the extreme large genomes Lilium and Tulipa.

Science.gov (United States)

Shahin, Arwa; van Kaauwen, Martijn; Esselink, Danny; Bargsten, Joachim W; van Tuyl, Jaap M; Visser, Richard G F; Arens, Paul

2012-11-20

Bulbous flowers such as lily and tulip (Liliaceae family) are monocot perennial herbs that are economically very important ornamental plants worldwide. However, there are hardly any genetic studies performed and genomic resources are lacking. To build genomic resources and develop tools to speed up the breeding in both crops, next generation sequencing was implemented. We sequenced and assembled transcriptomes of four lily and five tulip genotypes using 454 pyro-sequencing technology. Successfully, we developed the first set of 81,791 contigs with an average length of 514 bp for tulip, and enriched the very limited number of 3,329 available ESTs (Expressed Sequence Tags) for lily with 52,172 contigs with an average length of 555 bp. The contigs together with singletons covered on average 37% of lily and 39% of tulip estimated transcriptome. Mining lily and tulip sequence data for SSRs (Simple Sequence Repeats) showed that di-nucleotide repeats were twice more abundant in UTRs (UnTranslated Regions) compared to coding regions, while tri-nucleotide repeats were equally spread over coding and UTR regions. Two sets of single nucleotide polymorphism (SNP) markers suitable for high throughput genotyping were developed. In the first set, no SNPs flanking the target SNP (50 bp on either side) were allowed. In the second set, one SNP in the flanking regions was allowed, which resulted in a 2 to 3 fold increase in SNP marker numbers compared with the first set. Orthologous groups between the two flower bulbs: lily and tulip (12,017 groups) and among the three monocot species: lily, tulip, and rice (6,900 groups) were determined using OrthoMCL. Orthologous groups were screened for common SNP markers and EST-SSRs to study synteny between lily and tulip, which resulted in 113 common SNP markers and 292 common EST-SSR. Lily and tulip contigs generated were annotated and described according to Gene Ontology terminology. Two transcriptome sets were built that are valuable

Genome sequence variation in the constricta strain dramatically alters the protein interaction and localization map of Potato yellow dwarf virus

Science.gov (United States)

The genome sequence of the constricta strain of Potato yellow dwarf virus (CYDV) was determined to be 12,792 nucleotides long and organized into seven open reading frames with the gene order 3’-N-X-P-Y-M-G-L-5’, which encodes the nucleocapsid, phosphoprotein, movement, matrix, glycoprotein and RNA-d...

Subnanomole detection and quantitation of high specific activity 32P-nucleotides

International Nuclear Information System (INIS)

Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

1991-01-01

Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

Hydrophilic interaction ultra-high performance liquid chromatography coupled with triple quadrupole mass spectrometry for determination of nucleotides, nucleosides and nucleobases in Ziziphus plants.

Science.gov (United States)

Guo, Sheng; Duan, Jin-ao; Qian, Dawei; Wang, Hanqing; Tang, Yuping; Qian, Yefei; Wu, Dawei; Su, Shulan; Shang, Erxin

2013-08-02

In this study, a rapid and sensitive analytical method was developed for the determination of 20 nucleobases, nucleosides and nucleotides in Ziziphus plants at trace levels by using hydrophilic interaction ultra-high performance liquid chromatography coupled with triple-quadrupole tandem mass spectrometry (HILIC-UHPLC-TQ-MS/MS) in multiple-reaction monitoring (MRM) mode. Under the optimized chromatographic conditions, good separation for 20 target compounds were obtained on a UHPLC Amide column with sub-2μm particles within 10min. The overall LODs and LOQs were between 0.11-3.12ngmL(-1) and 0.29-12.48ngmL(-1) for the 20 analytes, respectively. It is the first report about simultaneous analysis of nucleobases, nucleosides and nucleotides in medicinal plants using HILIC-UHPLC-TQ-MS/MS method, which affords good linearity, precision, repeatability and accuracy. The developed method was successfully applied to Ziziphus plant (Z. jujuba, Z. jujuba var. spinosa and Z. mauritiana) samples. The analysis showed that the fruits and leaves of Ziziphus plants are rich in nucleosides and nucleobases as well as nucleotides, and could be selected as the healthy food resources. Our results in present study suggest that HILIC-UHPLC-TQ-MS/MS method could be employed as a useful tool for quality assessment of the samples from the Ziziphus plants as well as other medicinal plants or food samples using nucleotides, nucleosides and nucleobases as markers. Copyright © 2013 Elsevier B.V. All rights reserved.

MUREIN-METABOLIZING ENZYMES FROM ESCHERICHIA-COLI - SEQUENCE-ANALYSIS AND CONTROLLED OVEREXPRESSION OF THE SLT GENE, WHICH ENCODES THE SOLUBLE LYTIC TRANSGLYCOSYLASE

NARCIS (Netherlands)

ENGEL, H; KAZEMIER, B; KECK, W

The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or

Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.

Directory of Open Access Journals (Sweden)

Jason D Thompson

Full Text Available Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.

Winnowing DNA for rare sequences: highly specific sequence and methylation based enrichment.

Science.gov (United States)

Thompson, Jason D; Shibahara, Gosuke; Rajan, Sweta; Pel, Joel; Marziali, Andre

2012-01-01

Rare mutations in cell populations are known to be hallmarks of many diseases and cancers. Similarly, differential DNA methylation patterns arise in rare cell populations with diagnostic potential such as fetal cells circulating in maternal blood. Unfortunately, the frequency of alleles with diagnostic potential, relative to wild-type background sequence, is often well below the frequency of errors in currently available methods for sequence analysis, including very high throughput DNA sequencing. We demonstrate a DNA preparation and purification method that through non-linear electrophoretic separation in media containing oligonucleotide probes, achieves 10,000 fold enrichment of target DNA with single nucleotide specificity, and 100 fold enrichment of unmodified methylated DNA differing from the background by the methylation of a single cytosine residue.

Complete sequence of Fig fleck-associated virus, a novel member of the family Tymoviridae.

Science.gov (United States)

Elbeaino, Toufic; Digiaro, Michele; Martelli, Giovanni P

2011-11-01

The complete nucleotide sequence and the genome organization were determined of a novel virus, tentatively named Fig fleck-associated virus (FFkaV). The viral genome is a positive-sense, single-stranded RNA 7046 nucleotides in size excluding the 3'-terminal poly(A) tract, and comprising two open reading frames. ORF1 encodes a polypeptide of 2161 amino acids (p240), which contains the signatures of replication-associated proteins and the coat protein cistron (p24) at its 3' end. ORF2 codes for a 461 amino acid protein (p50) identified as a putative movement proteins (MP). In phylogenetic trees constructed with sequences of the putative polymerase and CP proteins FFkaV consistently groups with members of the genus Maculavirus, family Tymoviridae. However, the genome organization diverges from that of the two completely sequenced maculaviruses, Grapevine fleck virus (GFkV) and Bombix mori Macula-like virus (BmMLV), as it exhibits a structure resembling that of Maize rayado fino virus (MRFV), the type species of the genus Marafivirus and of Olive latent virus 3 (OLV-3), an unclassified virus in the family Tymoviridae. FFkaV was found in field-grown figs from six Mediterranean countries with an incidence ranging from 15% to 25%. Copyright © 2011 Elsevier B.V. All rights reserved.

The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses.

Science.gov (United States)

Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen

2013-01-01

The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).

The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

Directory of Open Access Journals (Sweden)

Elizabeth N. Krueger

2013-07-01

Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.

A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

Science.gov (United States)

Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

2012-01-01

Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

Science.gov (United States)

Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

2012-02-03

Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

Directory of Open Access Journals (Sweden)

Martin Beránek

2012-01-01

Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

Comparative analyses of two Geraniaceae transcriptomes using next-generation sequencing.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Mower, Jeffrey P; Jansen, Robert K

2013-12-29

Organelle genomes of Geraniaceae exhibit several unusual evolutionary phenomena compared to other angiosperm families including accelerated nucleotide substitution rates, widespread gene loss, reduced RNA editing, and extensive genomic rearrangements. Since most organelle-encoded proteins function in multi-subunit complexes that also contain nuclear-encoded proteins, it is likely that the atypical organellar phenomena affect the evolution of nuclear genes encoding organellar proteins. To begin to unravel the complex co-evolutionary interplay between organellar and nuclear genomes in this family, we sequenced nuclear transcriptomes of two species, Geranium maderense and Pelargonium x hortorum. Normalized cDNA libraries of G. maderense and P. x hortorum were used for transcriptome sequencing. Five assemblers (MIRA, Newbler, SOAPdenovo, SOAPdenovo-trans [SOAPtrans], Trinity) and two next-generation technologies (454 and Illumina) were compared to determine the optimal transcriptome sequencing approach. Trinity provided the highest quality assembly of Illumina data with the deepest transcriptome coverage. An analysis to determine the amount of sequencing needed for de novo assembly revealed diminishing returns of coverage and quality with data sets larger than sixty million Illumina paired end reads for both species. The G. maderense and P. x hortorum transcriptomes contained fewer transcripts encoding the PLS subclass of PPR proteins relative to other angiosperms, consistent with reduced mitochondrial RNA editing activity in Geraniaceae. In addition, transcripts for all six plastid targeted sigma factors were identified in both transcriptomes, suggesting that one of the highly divergent rpoA-like ORFs in the P. x hortorum plastid genome is functional. The findings support the use of the Illumina platform and assemblers optimized for transcriptome assembly, such as Trinity or SOAPtrans, to generate high-quality de novo transcriptomes with broad coverage. In addition

NU-IN: Nucleotide evolution and input module for the EvolSimulator genome simulation platform

Directory of Open Access Journals (Sweden)

Barker Michael S

2010-08-01

Full Text Available Abstract Background There is increasing demand to test hypotheses that contrast the evolution of genes and gene families among genomes, using simulations that work across these levels of organization. The EvolSimulator program was developed recently to provide a highly flexible platform for forward simulations of amino acid evolution in multiple related lineages of haploid genomes, permitting copy number variation and lateral gene transfer. Synonymous nucleotide evolution is not currently supported, however, and would be highly advantageous for comparisons to full genome, transcriptome, and single nucleotide polymorphism (SNP datasets. In addition, EvolSimulator creates new genomes for each simulation, and does not allow the input of user-specified sequences and gene family information, limiting the incorporation of further biological realism and/or user manipulations of the data. Findings We present modified C++ source code for the EvolSimulator platform, which we provide as the extension module NU-IN. With NU-IN, synonymous and non-synonymous nucleotide evolution is fully implemented, and the user has the ability to use real or previously-simulated sequence data to initiate a simulation of one or more lineages. Gene family membership can be optionally specified, as well as gene retention probabilities that model biased gene retention. We provide PERL scripts to assist the user in deriving this information from previous simulations. We demonstrate the features of NU-IN by simulating genome duplication (polyploidy in the presence of ongoing copy number variation in an evolving lineage. This example is initiated with real genomic data, and produces output that we analyse directly with existing bioinformatic pipelines. Conclusions The NU-IN extension module is a publicly available open source software (GNU GPLv3 license extension to EvolSimulator. With the NU-IN module, users are now able to simulate both drift and selection at the nucleotide

Final Technical Report on the Genome Sequence DataBase (GSDB): DE-FG03 95 ER 62062 September 1997-September 1999; FINAL

International Nuclear Information System (INIS)

Harger, Carol A.

1999-01-01

Since September 1997 NCGR has produced two web-based tools for researchers to use to access and analyze data in the Genome Sequence DataBase (GSDB). These tools are: Sequence Viewer, a nucleotide sequence and annotation visualization tool, and MAR-Finder, a tool that predicts, base upon statistical inferences, the location of matrix attachment regions (MARS) within a nucleotide sequence.[The annual report for June 1996 to August 1997 is included as an attachment to this final report.

CodonLogo: a sequence logo-based viewer for codon patterns.

Science.gov (United States)

Sharma, Virag; Murphy, David P; Provan, Gregory; Baranov, Pavel V

2012-07-15

Conserved patterns across a multiple sequence alignment can be visualized by generating sequence logos. Sequence logos show each column in the alignment as stacks of symbol(s) where the height of a stack is proportional to its informational content, whereas the height of each symbol within the stack is proportional to its frequency in the column. Sequence logos use symbols of either nucleotide or amino acid alphabets. However, certain regulatory signals in messenger RNA (mRNA) act as combinations of codons. Yet no tool is available for visualization of conserved codon patterns. We present the first application which allows visualization of conserved regions in a multiple sequence alignment in the context of codons. CodonLogo is based on WebLogo3 and uses the same heuristics but treats codons as inseparable units of a 64-letter alphabet. CodonLogo can discriminate patterns of codon conservation from patterns of nucleotide conservation that appear indistinguishable in standard sequence logos. The CodonLogo source code and its implementation (in a local version of the Galaxy Browser) are available at http://recode.ucc.ie/CodonLogo and through the Galaxy Tool Shed at http://toolshed.g2.bx.psu.edu/.

Human Chromosome 7: DNA Sequence and Biology

OpenAIRE

Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.

2003-01-01

DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...

Meta-analysis of sequence-based association studies across three cattle breeds reveals 25 QTL for fat and protein percentages in milk at nucleotide resolution.

Science.gov (United States)

Pausch, Hubert; Emmerling, Reiner; Gredler-Grandl, Birgit; Fries, Ruedi; Daetwyler, Hans D; Goddard, Michael E

2017-11-09

Genotyping and whole-genome sequencing data have been generated for hundreds of thousands of cattle. International consortia used these data to compile imputation reference panels that facilitate the imputation of sequence variant genotypes for animals that have been genotyped using dense microarrays. Association studies with imputed sequence variant genotypes allow for the characterization of quantitative trait loci (QTL) at nucleotide resolution particularly when individuals from several breeds are included in the mapping populations. We imputed genotypes for 28 million sequence variants in 17,229 cattle of the Braunvieh, Fleckvieh and Holstein breeds in order to compile large mapping populations that provide high power to identify QTL for milk production traits. Association tests between imputed sequence variant genotypes and fat and protein percentages in milk uncovered between six and thirteen QTL (P < 1e-8) per breed. Eight of the detected QTL were significant in more than one breed. We combined the results across breeds using meta-analysis and identified a total of 25 QTL including six that were not significant in the within-breed association studies. Two missense mutations in the ABCG2 (p.Y581S, rs43702337, P = 4.3e-34) and GHR (p.F279Y, rs385640152, P = 1.6e-74) genes were the top variants at QTL on chromosomes 6 and 20. Another known causal missense mutation in the DGAT1 gene (p.A232K, rs109326954, P = 8.4e-1436) was the second top variant at a QTL on chromosome 14 but its allelic substitution effects were inconsistent across breeds. It turned out that the conflicting allelic substitution effects resulted from flaws in the imputed genotypes due to the use of a multi-breed reference population for genotype imputation. Many QTL for milk production traits segregate across breeds and across-breed meta-analysis has greater power to detect such QTL than within-breed association testing. Association testing between imputed sequence variant genotypes and

Molecular identification based on ITS sequences for Kappaphycus and Eucheuma cultivated in China

Science.gov (United States)

Zhao, Sufen; He, Peimin

2011-11-01

The systematic classification of the Eucheumatoideae is difficult because of their variable morphology and interpretation of reproductive structures. Kappaphycus and Eucheuma specimens cultivated on the Hainan and Fujian coast of China were introduced from Vietnam, the Philippines and Indonesia. Combined with morphological characteristics, all Kappaphycus and Eucheuma cultivated strains were identified by internal transcribed spacer (ITS) sequences. The phylogenetic tree was constructed using neighbor-joining and maximum likelihood methods. The results indicate that different ITS sequence lengths occurred in the different genera and species. An obvious difference in morphology could be found in the protuberance shape between Kappaphycus and Eucheuma. The protuberance in Eucheuma was thorn-like and in Kappaphycus was wartlike or papillate. Their ITS sequence lengths differed significantly in nucleotide variation rates up to 58.55%-63.90%. All nucleotide variations occurred in the ITS1 and ITS2 regions except for five nucleotide transversions in the 5.8S rDNA region. In addition, the difference was at the branches among congeneric species. Kappaphycus sp. had branches with small buds, while K. alvarezii did not have such a feature. The nucleotide variation rates varied from 7.02% to 7.48% among species; within the same species of the clades it was K. alvarezii, Kappaphycus sp., and E. denticulatum. The results indicate that ITS sequence analysis was an effective way for identification of interspecies and intraspecies phylogenetic relationships and might provide a clue for molecular identification of algal Eucheumatoideae.

Molecular diagnosis of lyssaviruses and sequence comparison of Australian bat lyssavirus samples.

Science.gov (United States)

Foord, A J; Heine, H G; Pritchard, L I; Lunt, R A; Newberry, K M; Rootes, C L; Boyle, D B

2006-07-01

To evaluate and implement molecular diagnostic tests for the detection of lyssaviruses in Australia. A published hemi-nested reverse transcriptase polymerase chain reaction (RT-PCR) for the detection of all lyssavirus genotypes was modified to a fully nested RT-PCR format and compared with the original assay. TaqMan assays for the detection of Australian bat lyssavirus (ABLV) were compared with both the nested and hemi-nested RT-PCR assays. The sequences of RT-PCR products were determined to assess sequence variations of the target region (nucleocapsid gene) in samples of ABLV originating from different regions. The nested RT-PCR assay was highly analytically specific, and at least as analytically sensitive as the hemi-nested assay. The TaqMan assays were highly analytically specific and more analytically sensitive than either RT-PCR assay, with a detection level of approximately 10 genome equivalents per microl. Sequence of the first 544 nucleotides of the nucleocapsid protein coding sequence was obtained from all samples of ABLV received at Australian Animal Health Laboratory during the study period. The nested RT-PCR provided a means for molecular diagnosis of all tested genotypes of lyssavirus including classical rabies virus and Australian bat lyssavirus. The published TaqMan assay proved to be superior to the RT-PCR assays for the detection of ABLV in terms of analytical sensitivity. The TaqMan assay would also be faster and cross contamination is less likely. Nucleotide sequence analyses of samples of ABLV from a wide geographical range in Australia demonstrated the conserved nature of this region of the genome and therefore the suitability of this region for molecular diagnosis.

"Shovel-ready" Sequences as a Stimulus for the Next Generation of Life Scientists.

Science.gov (United States)

Boyle, Michael D

2010-01-01

Genomics and bioinformatics are dynamic fields well-suited for capturing the imagination of undergraduates in both research laboratories and classrooms. Currently, raw nucleotide sequence is being provided, as part of several genomics research initiatives, for undergraduate research and teaching. These initiatives could be easily extended and much more effective if the source of the sequenced material and the subsequent focus of the data analysis were aligned with the research interests of individual faculty at undergraduate institutions. By judicious use of surplus capacity in existing nucleotide sequencing cores, raw sequence data could be generated to support ongoing research efforts involving undergraduates. This would allow these students to participate actively in discovery research, with a goal of making novel contributions to their field through original research while nurturing the next generation of talented research scientists.

Sequence imputation of HPV16 genomes for genetic association studies.

Directory of Open Access Journals (Sweden)

Benjamin Smith

Full Text Available Human Papillomavirus type 16 (HPV16 causes over half of all cervical cancer and some HPV16 variants are more oncogenic than others. The genetic basis for the extraordinary oncogenic properties of HPV16 compared to other HPVs is unknown. In addition, we neither know which nucleotides vary across and within HPV types and lineages, nor which of the single nucleotide polymorphisms (SNPs determine oncogenicity.A reference set of 62 HPV16 complete genome sequences was established and used to examine patterns of evolutionary relatedness amongst variants using a pairwise identity heatmap and HPV16 phylogeny. A BLAST-based algorithm was developed to impute complete genome data from partial sequence information using the reference database. To interrogate the oncogenic risk of determined and imputed HPV16 SNPs, odds-ratios for each SNP were calculated in a case-control viral genome-wide association study (VWAS using biopsy confirmed high-grade cervix neoplasia and self-limited HPV16 infections from Guanacaste, Costa Rica.HPV16 variants display evolutionarily stable lineages that contain conserved diagnostic SNPs. The imputation algorithm indicated that an average of 97.5±1.03% of SNPs could be accurately imputed. The VWAS revealed specific HPV16 viral SNPs associated with variant lineages and elevated odds ratios; however, individual causal SNPs could not be distinguished with certainty due to the nature of HPV evolution.Conserved and lineage-specific SNPs can be imputed with a high degree of accuracy from limited viral polymorphic data due to the lack of recombination and the stochastic mechanism of variation accumulation in the HPV genome. However, to determine the role of novel variants or non-lineage-specific SNPs by VWAS will require direct sequence analysis. The investigation of patterns of genetic variation and the identification of diagnostic SNPs for lineages of HPV16 variants provides a valuable resource for future studies of HPV16

Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

Directory of Open Access Journals (Sweden)

Joon-Ho Lee

2014-09-01

Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

SEQUENCING OF FLAX LIS-1 INSERTION SITE IN THE ALBIDUM GENOTYPE

Directory of Open Access Journals (Sweden)

Jana Žiarovská

2012-12-01

Full Text Available The paper presents a methodology of identifying the insertion site of LIS-1-1 (Linum Insertion Sequence 1 element in flax Albidum variety when growing under the in vitro combined with environmental stress conditions. Abiotic stress was induced by a reduced nutrient content in a growth medium. The LIS-1 insertion site amplification was reaLIS-1ed using the forward LIS-L: 5'-GGG CAG TTT AAC TGT AAC GAA - 3 'and revers LIS-R: 5'-GCT TGG ATT TAG ACT TGG CAA C - 3' primers by PCR. PCR product was sequenced by direct sequencing method to proove the nucleotide sequence for matching with database LIS-1 sequence. A comparison has been matched with the sequence of the amplified segment in the database for all nucleotides except the 11-position in the 5'-3 ' direction, where instead of the three adenine pair is a couple in the Albidum variety. Changes caused by mobile elements or insertion sequences result in common flax in variability that can be used for the purposes of development of effective marker identification or environment based markers development.

Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

Directory of Open Access Journals (Sweden)

Kei-ichi Morita

Full Text Available Gorlin syndrome (GS is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs. In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals, whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

Science.gov (United States)

Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

2015-01-01

Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

DNA sequences from the quagga, an extinct member of the horse family.

Science.gov (United States)

Higuchi, R; Bowman, B; Freiberger, M; Ryder, O A; Wilson, A C

To determine whether DNA survives and can be recovered from the remains of extinct creatures, we have examined dried muscle from a museum specimen of the quagga, a zebra-like species (Equus quagga) that became extinct in 1883 (ref. 1). We report that DNA was extracted from this tissue in amounts approaching 1% of that expected from fresh muscle, and that the DNA was of relatively low molecular weight. Among the many clones obtained from the quagga DNA, two containing pieces of mitochondrial DNA (mtDNA) were sequenced. These sequences, comprising 229 nucleotide pairs, differ by 12 base substitutions from the corresponding sequences of mtDNA from a mountain zebra, an extant member of the genus Equus. The number, nature and locations of the substitutions imply that there has been little or no postmortem modification of the quagga DNA sequences, and that the two species had a common ancestor 3-4 Myr ago, consistent with fossil evidence concerning the age of the genus Equus.

Molecular cloning and characterization of genes required for nucleotide excision repair in yeast

International Nuclear Information System (INIS)

Friedberg, E.C.

1987-01-01

Nucleotide excision repair in the yeast S. cerevisiae is a complex process which involves a large number of genes. At least five of these genes (RAD1, RAD2, RAD3, RAD4 and RAD10) are absolutely required for this process and mutations in any of these genes result in no detectable excision repair in vivo. In order to understand the function of these genes in DNA repair, the authors isolated a number of them by screening a yeast genomic library for recombinant plasmids which complement the phentoype of sensitivity to ultraviolet (UV) radiation imparted to mutant strains. A plasmid containing the RAD4 gene was isolated by an alternative strategy which will be discussed. The cloned genes have been extensively characterized. It has been determined that the RAD3 gene is essential for the viability of haploid yeast cells in the absence of DNA damage. The RAD2 gene is inducible by treatment of cells with a variety of DNA-damaging agents, including UV radiation and ionizing radiation. The RAD10 gene shares considerable amino acid sequence homology with a cloned gene involved in nucleotide excision repair in human cells. Yeast is a particularly versatile organism for studying gene function by molecular and genetic approaches and emphasis is placed on many of the techniques used in the present studies

Assembling a dual purpose TaqMan-based panel of single-nucleotide polymorphism markers in rainbow trout and steelhead (Oncorhynchus mykiss) for association mapping and population genetics analysis

DEFF Research Database (Denmark)

Hansen, Mette H H; Young, Sewall; Jørgensen, Hanne Birgitte Hede

2011-01-01

We establish a TaqMan-based assay panel for genotyping single-nucleotide polymorphisms in rainbow trout and steelhead (Oncorhynchus mykiss). We develop 22 novel single-nucleotide polymorphism markers based on new steelhead sequence data and on assays from sister taxa. Additionally, we adapt 154 p...