WorldWideScience

Sample records for nucleotide sequence determination

  1. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  2. Determination of single nucleotide variants in Escherichia coli DH5α by using short-read sequencing.

    Science.gov (United States)

    Song, Yoseb; Lee, Bo-Rahm; Cho, Suhyung; Cho, Yoo-Bok; Kim, Seon-Won; Kang, Taek Jin; Kim, Sun Chang; Cho, Byung-Kwan

    2015-06-01

    Escherichia coli DH5α is a common laboratory strain that provides an important platform for routine use in cloning and synthetic biology applications. Many synthetic circuits have been constructed and successfully expressed in E. coli DH5α; however, its genome sequence has not been determined yet. Here, we determined E. coli DH5α genome sequence and identified genetic mutations that affect its phenotypic functions by using short-read sequencing. The sequencing results clearly described the genotypes of E. coli DH5α, which aid in further studies using the strain. Additionally, we observed 105 single nucleotide variants (SNVs), 83% of which were detected in protein-coding regions compared to the parental strain E. coli DH1. Interestingly, 23% of the protein-coding regions have mutations in their amino acid residues, whose biological functions were categorized into two-component systems, peptidoglycan biosynthesis and lipopolysaccharide biosynthesis. These results underscore the advantages of E. coli DH5α, which tolerates the components of transformation buffer and expresses foreign plasmids efficiently. Moreover, these SNVs were also observed in the commercially available strain. These data provide the genetic information of E. coli DH5α for its future application in metabolic engineering and synthetic biology. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Cloning of the gene encoding Streptococcin A-FF22, a novel lantibiotic produced by Streptococcus pyogenes, and determination of its nucleotide sequence.

    OpenAIRE

    Hynes, W L; Ferretti, J J; Tagg, J R

    1993-01-01

    Streptococcin A-FF22 (SA-FF22) is a lantibiotic produced by Streptococcus pyogenes FF22. The nucleotide sequence of the SA-FF22 structural gene (scnA) was determined and shown to encode a 51-amino-acid prepeptide. The proteolytic processing site of the SA-FF22 prepeptide differs from that which characterizes other type A lantibiotics.

  4. The international nucleotide sequence database collaboration.

    Science.gov (United States)

    Karsch-Mizrachi, Ilene; Takagi, Toshihisa; Cochrane, Guy

    2018-01-04

    For more than 30 years, the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org/) has been committed to capturing, preserving and providing access to comprehensive public domain nucleotide sequence and associated metadata which enables discovery in biomedicine, biodiversity and biological sciences. Since 1987, the DNA Data Bank of Japan (DDBJ) at the National Institute for Genetics in Mishima, Japan; the European Nucleotide Archive (ENA) at the European Molecular Biology Laboratory's European Bioinformatics Institute (EMBL-EBI) in Hinxton, UK; and GenBank at National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health in Bethesda, Maryland, USA have worked collaboratively to enable access to nucleotide sequence data in standardized formats for the worldwide scientific community. In this article, we reiterate the principles of the INSDC collaboration and briefly summarize the trends of the archival content. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  5. Complete genetic organization and functional aspects of the Escherichia coli S fimbrial adhesin determinant: nucleotide sequence of the genes sfaB, C, D, E, F.

    OpenAIRE

    Schmoll, T.; Morschhäuser, J.; Ott, M.; Ludwig, B.; Van Die, I.; Hacker, Jörg

    2011-01-01

    The S fimbrial adhesin (sfa) determinant of E. co/i comprises nine genes situated on a stretch of 7.9 kilobases (kb) DNA. Here the nucleotide sequence of the genes sfa B and sfaC situated proximal to the main structural gene sfaA is described. Sfa-LacZ fusions show that the two genes are transcribed in opposite directions. The isolation of mutants in the proximal region of the sfa gene cluster, the construction of sfa-phoA gene fusions and subsequent transcomplementation sturlies indicated th...

  6. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  7. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    Expressed Sequence Tags (ESTs) and Single Nucleotide Polymorphisms (SNPs) are providing in depth knowledge in plant biology, breeding and biotechnology. The emergence of many novel molecular marker techniques are changing and accelerating the process of producing mutations in plant molecular biology ...

  8. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32. DOI: http://dx.doi.org/10.4314/njbas.v21i1.4. ISSN 0794-5698. Retrieval and Representation of Nucleotide Sequence of Saccharomyces cerevisiae Cystathionine. Gamma-Lyase (CYS3) Gene in Five Formats. *R. A. Umar, H. Abdullahi and N. Lawal.

  9. Nucleotide Sequencing and Identification of Some Wild Mushrooms

    Directory of Open Access Journals (Sweden)

    Sudip Kumar Das

    2013-01-01

    Full Text Available The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India was amplified using ITS1 (Internal Transcribed Spacers 1 and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base of Amanita hemibapha [CN (Chota Nagpur 1, % identity 99 (JX844716.1], Amanita sp. [CN 2, % identity 98 (JX844763.1], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1], Termitomyces sp. [CN 4, % identity 90 (JF746992.1], Termitomyces sp. [CN 5, % identity 99 (GU001667.1], T. microcarpus [CN 6, % identity 82 (EF421077.1], Termitomyces sp. [CN 7, % identity 76 (JF746993.1], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  10. Nucleotide sequencing and identification of some wild mushrooms.

    Science.gov (United States)

    Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

    2013-01-01

    The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  11. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  12. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  13. Complete nucleotide sequence of Hibiscus infecting Cilevirus Florida isolate and its relationship with closely associated Cileviruses

    Science.gov (United States)

    The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

  14. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  15. Complete nucleotide sequence and organization of the mitogenome ...

    African Journals Online (AJOL)

    Phylogenetic reconstruction using the concatenated 13 amino acid and nucleotide sequences of the protein-coding genes (PCGs) consistently supported a close relationship between Bombycoidea and Geometroidea among six available lepidopteran superfamilies (Tortricoidea, Pyraloidea, Papilionoidea, Bombycoidea, ...

  16. Exact correspondence between walk in nucleotide and protein sequence spaces.

    Directory of Open Access Journals (Sweden)

    Dmitry N Ivankov

    Full Text Available In the course of evolution, genes traverse the nucleotide sequence space, which translates to a trajectory of changes in the protein sequence in protein sequence space. The correspondence between regions of the nucleotide and protein sequence spaces is understood in general but not in detail. One of the unexplored questions is how many sequences a protein can reach with a certain number of nucleotide substitutions in its gene sequence. Here I propose an algorithm to calculate the volume of protein sequence space accessible to a given protein sequence as a function of the number of nucleotide substitutions made in the protein-coding sequence. The algorithm utilizes the power of the dynamic programming approach, and makes all calculations within a couple of seconds on a desktop computer. I apply the algorithm to green fluorescence protein, and get the number of sequences four times higher than estimated before. However, taking into account the astronomically huge size of the protein sequence space, the previous estimate can be considered as acceptable as an order of magnitude estimation. The proposed algorithm has practical applications in the study of evolutionary trajectories in sequence space.

  17. Determination of the Nucleotide Sequences of Heat Shock Operon groESL and the Citrate Synthase Gene (gltA) of Anaplasma (Ehrlichia) platys for Phylogenetic and Diagnostic Studies

    Science.gov (United States)

    Inokuma, Hisashi; Fujii, Kaori; Okuda, Masaru; Onishi, Takafumi; Beaufils, Jean-Pierre; Raoult, Didier; Brouqui, Philippe

    2002-01-01

    The 1,670-bp nucleotide sequence of the heat shock operon groESL and the 1,236-bp sequence of the citrate synthase gene (gltA) of Anaplasma (Ehrlichia) platys were determined. The topology of the groEL- and gltA-based phylogenetic tree was similar to that derived from 16S rRNA gene analyses with distances. Both groESL- and gltA-based PCRs specific to A. platys were also developed based upon the alignment data. PMID:12204973

  18. Complete nucleotide sequence and genome organization of a novel allexivirus from alfalfa (Medicago sativa)

    Science.gov (United States)

    A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...

  19. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    The recent advent of high throughput sequencing of nucleic acids (RNA and DNA) has vastly expanded research into the functional and structural biology of the genome of all living organisms (and even a few dead ones). With this enormous and exponential growth in biological data generation come...... equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......, focusing on oft encountered problems in data processing, such as quality assurance, mapping, normalization, visualization, and interpretation. Presented in the second part are scientific endeavors representing solutions to problems of two sub-genres of next generation sequencing. For the first flavor, RNA-sequencing...

  20. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    stranded DNA binding dyes or fluorophore-labelled ..... Comparative sequence analysis of plant nuclear genomes: microcolinearity and its many exceptions. Plant Cell 12(7):. 1021-1029. Bertone P, Snyder M (2005). Prospects and ...

  1. Nucleotide sequences within the U5 region of the viral RNA genome are the major determinants for an human immunodeficiency virus type 1 to maintain a primer binding site complementary to tRNA(His).

    Science.gov (United States)

    Zhang, Z; Kang, S M; LeBlanc, A; Hajduk, S L; Morrow, C D

    1996-12-15

    The initiation of reverse transcription of the human immunodeficiency virus type 1 (HIV-1) genome requires cellular tRNA(Lys,3) as a primer and occurs at a site in the viral RNA genome, designated as the primer binding site (PBS), which is complementary to the 3'-terminal 18 nucleotides of tRNA(Lys,3). We previously described an HIV-1 virus [designated as HXB2(His-AC)], which contained a sequence within the U5 region complementary to the anticodon region of tRNA(His) in addition to a PBS complementary to the 3'-terminal 18 nucleotides of the tRNA(His). That virus maintained a PBS complementary to tRNA(His) after extended in vitro culture (Wakefield et al., J. Virol. 70, 966-975, 1996). In the present study, we report that subcloning a 200-base-pair DNA fragment encompassing the U5 and PBS regions from an integrated provirus of HXB2(His-AC) back into the wild-type genome (pHXB2) resulted in an infectious virus, designated as HXB2(His-AC-gac), which again stably maintained a PBS complementary to tRNA(His). DNA sequence analysis of the 200-base-pair region revealed only three nucleotide changes from HXB2(His-AC): a T-to-G change at nucleotide 174, a G-to-A change at nucleotide 181, and a T-to-C change at nucleotide 200. The new mutant virus replicated in CD4+ Sup T1 cells similarly to the wild-type virus. Comparison of the nucleotide sequence of nucleocapsid gene of the wild-type and HXB2 (His-AC-gac) virus revealed no differences. Although we found numerous mutations in the reverse transcriptase gene in proviral clones derived from HXB2 (His-AC-gac), no common mutations were found among the 13 clones examined. Comparison of the virion-associated tRNAs of HXB2(His-AC-gac) with those of the wild type revealed that both viruses incorporated a similar subset of cellular tRNAs, with tRNA(Lys,3) being the predominant tRNA found within virions. There was no selective enrichment for tRNA(His) within virions of HXB2(His-AC-gac) virus which selectively use tRNA(His) to

  2. [Tabular excel editor for analysis of aligned nucleotide sequences].

    Science.gov (United States)

    Demkin, V V

    2010-01-01

    Excel platform was used for transition of results of multiple aligned nucleotide sequences obtained using the BLAST network service to the form appropriate for visual analysis and editing. Two macros operators for MS Excel 2007 were constructed. The array of aligned sequences transformed into Excel table and processed using macros operators is more appropriate for analysis than initial html data.

  3. The nucleotide sequence of threonine transfer RNA coded by bacteriophage T4

    International Nuclear Information System (INIS)

    Guthrie, C.; Scholla, C.A.; Yesian, H.; Abelson, J.

    1978-01-01

    The nucleotide sequence of a low molecular weight RNA coded by bacteriophage T4 (and previously identified as species α) has been determined. The molecule is of particular biological interest for its associated biosynthetic properties. This RNA is 76 nucleotides in length, contains eight modified bases, and can be arranged in a cloverleaf configuration common to tRNAs. The anticodon sequence is UGU, which corresponds to the threonine-specific codons ACsub(G)sup(A). The nucleotide sequence was determined primarily by nearest-neighbour analysis of RNA synthesized in vitro using [α- 32 P] nucleoside triphosphates. Using the single-strand specific nuclease S1, two in vivo labelled half-molecules were generated and analysed. This information together with restrictions imposed by nearest-neighbour data, provided a unique linear sequence of nucleotides with the features of secondary structure common to tRNA molecules. (author)

  4. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    The recent advent of high throughput sequencing of nucleic acids (RNA and DNA) has vastly expanded research into the functional and structural biology of the genome of all living organisms (and even a few dead ones). With this enormous and exponential growth in biological data generation come...

  5. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  6. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    ... Journals; Journal of Genetics; Volume 93; Issue 3. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of Occidozyga martensii. En Li Xiaoqiang Li Xiaobing Wu Ge Feng Man Zhang Haitao Shi Lijun Wang Jianping Jiang. Research Article Volume 93 Issue 3 December 2014 pp 631-641 ...

  7. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  8. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  9. Nucleotide sequence and phylogeny of the tet (L) tetracycline resistance determinant encoded by the plasmid pSTE1 from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Schwarz, S.; Cardoso, M.; Wegener, Henrik Caspar

    1992-01-01

    O from Streptococcus mutans were performed. An alignment of Tet amino acid sequence revealed the presence of 30 conserved amino acids among these Tet variants. On the basis of the alignment, a phylogenetic tree was constructed. It demonstrated large evolutionary distances between the Tet M and Tet O...

  10. CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

    Science.gov (United States)

    Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

  11. Long-range macromolecule interaction and “speed reading” long nucleotide sequences in DNA

    International Nuclear Information System (INIS)

    Namiot, V.A.; Anashkina, A.A.; Filatov, I.V.; Tumanyan, V.G.; Esipova, N.G.

    2013-01-01

    Methods based on the phenomenon of the specific long-range interaction between long macromolecules proposed for “speed reading” nucleotide sequences in single DNA molecules. One way is to measure the electric field potential along the preliminary stretched double DNA strand. Another way of information “reading” is to measure deformation of strand elements caused by an electric field that is generated by the “straightening” electrode due to an alternating voltage applied to it. On the base of the obtained information the sequence of nucleotides in the strand could be determined in principle.

  12. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  13. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  14. Nucleotide sequence of the 18S-26S rRNA intergene region of the sea urchin.

    OpenAIRE

    Hindenach, B R; Stafford, D W

    1984-01-01

    The DNA sequence which spans the internal transcribed spacers of a cloned ribosomal transcription unit from the sea urchin, Lytechinus variegatus, has been determined. The region extends from the conserved Eco RI site near the 3' end of the 18S rDNA to a Bam HI site in the 26S rDNA and includes 232 nucleotides coding for 18S rRNA, 367 nucleotides of internal transcribed spacer, 159 nucleotides coding for 5.8S rRNA, 338 nucleotides of internal transcribed spacer, and 505 nucleotides coding for...

  15. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  16. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  17. Nucleotide composition of CO1 sequences in Chelicerata (Arthropoda): detecting new mitogenomic rearrangements.

    Science.gov (United States)

    Arabi, Juliette; Judson, Mark L I; Deharveng, Louis; Lourenço, Wilson R; Cruaud, Corinne; Hassanin, Alexandre

    2012-02-01

    Here we study the evolution of nucleotide composition in third codon-positions of CO1 sequences of Chelicerata, using a phylogenetic framework, based on 180 taxa and three markers (CO1, 18S, and 28S rRNA; 5,218 nt). The analyses of nucleotide composition were also extended to all CO1 sequences of Chelicerata found in GenBank (1,701 taxa). The results show that most species of Chelicerata have a positive strand bias in CO1, i.e., in favor of C nucleotides, including all Amblypygi, Palpigradi, Ricinulei, Solifugae, Uropygi, and Xiphosura. However, several taxa show a negative strand bias, i.e., in favor of G nucleotides: all Scorpiones, Opisthothelae spiders and several taxa within Acari, Opiliones, Pseudoscorpiones, and Pycnogonida. Several reversals of strand-specific bias can be attributed to either a rearrangement of the control region or an inversion of a fragment containing the CO1 gene. Key taxa for which sequencing of complete mitochondrial genomes will be necessary to determine the origin and nature of mtDNA rearrangements involved in the reversals are identified. Acari, Opiliones, Pseudoscorpiones, and Pycnogonida were found to show a strong variability in nucleotide composition. In addition, both mitochondrial and nuclear genomes have been affected by higher substitution rates in Acari and Pseudoscorpiones. The results therefore indicate that these two orders are more liable to fix mutations of all types, including base substitutions, indels, and genomic rearrangements.

  18. Moloney murine sarcoma virus MuSVts110 DNA: cloning, nucleotide sequence, and gene expression.

    Science.gov (United States)

    Huai, L; Chiocca, S M; Gilbreth, M A; Ainsworth, J R; Bishop, L A; Murphy, E C

    1992-09-01

    We have cloned Moloney murine sarcoma virus (MuSV) MuSVts110 DNA by assembly of polymerase chain reaction (PCR)-amplified segments of integrated viral DNA from infected NRK cells (6m2 cells) and determined its complete sequence. Previously, by direct sequencing of MuSVts110 RNA transcribed in 6m2 cells, we established that the thermosensitive RNA splicing phenotype uniquely characteristic of MuSVts110 results from a deletion of 1,487 nucleotides of progenitor MuSV-124 sequences. As anticipated, the sequence obtained in this study contained precisely this same deletion. In addition, several other unexpected sequence differences were found between MuSVts110 and MuSV-124. For example, in the noncoding region upstream of the gag gene, MuSVts110 DNA contained a 52-nucleotide tract typical of murine leukemia virus rather than MuSV-124, suggesting that MuSVts110 originated as a MuSV-helper murine leukemia virus recombinant during reverse transcription rather than from a straightforward deletion within MuSV-124. In addition, both MuSVts110 long terminal repeats contained head-to-tail duplications of eight nucleotides in the U3 region. Finally, seven single-nucleotide substitutions were found scattered throughout MuSVts110 DNA. Three of the nucleotide substitutions were in the gag gene, resulting in one coding change in p15 and one in p30. All of the remaining nucleotide changes were found in the noncoding region between the 5' long terminal repeat and the gag gene. In NIH 3T3 cells transfected with the cloned MuSVts110 DNA, the pattern of viral RNA expression conformed with that observed in cells infected with authentic MuSVts110 virus in that viral RNA splicing was 30 to 40% efficient at growth temperatures between 28 and 33 degrees C but reduced to trace levels above 37 degrees C.

  19. Quantifying single nucleotide variant detection sensitivity in exome sequencing.

    Science.gov (United States)

    Meynert, Alison M; Bicknell, Louise S; Hurles, Matthew E; Jackson, Andrew P; Taylor, Martin S

    2013-06-18

    The targeted capture and sequencing of genomic regions has rapidly demonstrated its utility in genetic studies. Inherent in this technology is considerable heterogeneity of target coverage and this is expected to systematically impact our sensitivity to detect genuine polymorphisms. To fully interpret the polymorphisms identified in a genetic study it is often essential to both detect polymorphisms and to understand where and with what probability real polymorphisms may have been missed. Using down-sampling of 30 deeply sequenced exomes and a set of gold-standard single nucleotide variant (SNV) genotype calls for each sample, we developed an empirical model relating the read depth at a polymorphic site to the probability of calling the correct genotype at that site. We find that measured sensitivity in SNV detection is substantially worse than that predicted from the naive expectation of sampling from a binomial. This calibrated model allows us to produce single nucleotide resolution SNV sensitivity estimates which can be merged to give summary sensitivity measures for any arbitrary partition of the target sequences (nucleotide, exon, gene, pathway, exome). These metrics are directly comparable between platforms and can be combined between samples to give "power estimates" for an entire study. We estimate a local read depth of 13X is required to detect the alleles and genotype of a heterozygous SNV 95% of the time, but only 3X for a homozygous SNV. At a mean on-target read depth of 20X, commonly used for rare disease exome sequencing studies, we predict 5-15% of heterozygous and 1-4% of homozygous SNVs in the targeted regions will be missed. Non-reference alleles in the heterozygote state have a high chance of being missed when commonly applied read coverage thresholds are used despite the widely held assumption that there is good polymorphism detection at these coverage levels. Such alleles are likely to be of functional importance in population based studies of

  20. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    Energy Technology Data Exchange (ETDEWEB)

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA

    2009-02-24

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  1. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  2. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  3. The nucleotide sequences of 5S rRNAs from a fern Dryopteris acuminata and a horsetail Equisetum arvense.

    Science.gov (United States)

    Hori, H; Osawa, S; Takaiwa, F; Sugiura, M

    1984-02-10

    The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average).

  4. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Science.gov (United States)

    Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

    2011-01-01

    Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  5. Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

    Science.gov (United States)

    Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

    2013-06-01

    Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

  6. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  7. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  8. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  9. Combined LC/radiometric method of free nucleotide determination

    International Nuclear Information System (INIS)

    Mego, V.

    1980-01-01

    The combined chromatographic/radiometric method of determining free nucleotides allows their separation on ion exchanger DOWEX within one shift (i.e., 8 hours). A subsequent or parallel determination of activity of individual fractions increases the accuracy of results and gives a dynamic insight into the utilization of inorganic phosphorus by plants. (author)

  10. The nucleotide sequence of 4.5S ribosomal RNA from tobacco chloroplasts.

    OpenAIRE

    Takaiwa, F; Sugiura, M

    1980-01-01

    The nucleotide sequence of tobacco chloroplast 4.5S ribosomal RNA has been determined to be: OHG-A-A-G-G-U-C-A-C-G-G-C-G-A-G-A-C-G-A-G-C-C-G-U-U-U-A-U-C-A-U-U-A-C-G-A-U-A-G-G-U-G-U-C-A-A-G-U-G-G-A-A-G-U-G-C-A-G-U-G-A-U-G-U-A-U-G-C-(G-A)-C-U-G-A-G-G-C-A-U-C-C-U-A-A-C-A-G-A-C-C-G-G-U-A-G-A-C-U-U-G-A-A-COH. The 4.5S RNA is 103 nucleotides long and its 5'-terminus is not phosphorylated.

  11. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  12. Remarkable similarity in genome nucleotide sequences between the Schwarz FF-8 and AIK-C measles virus vaccine strains and apparent nucleotide differences in the phosphoprotein gene.

    Science.gov (United States)

    Ito, Chie; Ohgimoto, Shinji; Kato, Seiichi; Sharma, Luna Bhatta; Ayata, Minoru; Komase, Katsuhiro; Takeuchi, Kaoru; Ihara, Toshiaki; Ogura, Hisashi

    2011-07-01

    The Schwarz FF-8 (FF-8) and AIK-C measles virus vaccine strains are currently used for vaccination in Japan. Here, the complete genome nucleotide sequence of the FF-8 strain has been determined and its genome sequence found to be remarkably similar to that of the AIK-C strain. These two strains are differentiated only by two nucleotide differences in the phosphoprotein gene. Since the FF-8 strain does not possess the amino acid substitutions in the phospho- and fusion proteins which are responsible for the temperature-sensitivity and small syncytium formation phenotypes of the AIK-C strain, respectively, other unidentified common mechanisms likely attenuate both the FF-8 and AIK-C strains. © 2011 The Societies and Blackwell Publishing Asia Pty Ltd.

  13. The nucleotide sequence of two restriction fragments located in the gene AB region of bacteriophage S13.

    NARCIS (Netherlands)

    F.G. Grosveld (Frank); J.H. Spencer

    1977-01-01

    textabstractThe nucleotide sequence of a double stranded DNA fragment from the gene AB region of bacteriophage S13 DNA has been determined. The fragment was isolated as two adjacent shorter fragments by cleavage of S13 replicative form (RF) DNA with restriction endonuclease III from Hemophilus

  14. Complete nucleotide sequence and genome organization of a Cactus virus X strain from Hylocereus undatus (Cactaceae).

    Science.gov (United States)

    Liou, M R; Chen, Y R; Liou, R F

    2004-05-01

    The complete nucleotide sequence of a strain of Cactus virus X (CVX-Hu) isolated from Hylocereus undatus (Cactaceae) has been determined. Excluding the poly(A) tail, the sequence is 6614 nucleotides in length and contains seven open reading frames (ORFs). The genome organization of CVX is similar to that of other potexviruses. ORF1 encodes the putative viral replicase with conserved methyltransferase, helicase, and polymerase motifs. Within ORF1, two other ORFs were located separately in the +2 reading frame, we call these ORF6 and ORF7. ORF2, 3, and 4, which form the "triple gene block" characteristic of the potexviruses, encode proteins with molecular mass of 25, 12, and 7 KDa, respectively. ORF5 encodes the coat protein with an estimated molecular mass of 24 KDa. Sequence analysis indicated that proteins encoded by ORF1-5 display certain degree of homology to the corresponding proteins of other potexviruses. Putative product of ORF6, however, shows no significant similarity to those of other potexviruses. Phylogenetic analyses based on the replicase (the methyltransferase, helicase, and polymerase domains) and coat protein demonstrated a closer relationship of CVX with Bamboo mosaic virus, Cassava common mosaic virus, Foxtail mosaic virus, Papaya mosaic virus, and Plantago asiatica mosaic virus.

  15. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  16. Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array.

    Science.gov (United States)

    Fuller, Carl W; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J; Kasianowicz, John J; Davis, Randy; Roever, Stefan; Church, George M; Ju, Jingyue

    2016-05-10

    DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5'-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods.

  17. The phosphoenolpyruvate carboxylase gene of Corynebacterium glutamicum: molecular cloning, nucleotide sequence, and expression.

    Science.gov (United States)

    Eikmanns, B J; Follettie, M T; Griot, M U; Sinskey, A J

    1989-08-01

    The ppc gene of Corynebacterium glutamicum encoding phosphoenolpyruvate (PEP) carboxylase was isolated by complementation of a ppc mutant of Escherichia coli using a cosmid gene bank of chromosomal C. glutamicum DNA. By subsequent subcloning into the plasmid pUC8 and deletion analysis, the ppc gene could be located on a 3.3 kb SalI fragment. This fragment was able to complement the E. coli ppc mutant and conferred PEP carboxylase activity to the mutant. The complete nucleotide sequence of the ppc gene including 5' and 3' flanking regions has been determined and the primary structure of PEP carboxylase was deduced. The sequence predicts a 919 residue protein product (molecular weight of 103 154) which shows 34% similarity with the respective E. coli enzyme.

  18. Globalizing Genomics: The Origins of the International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Stevens, Hallam

    2017-10-06

    Genomics is increasingly considered a global enterprise - the fact that biological information can flow rapidly around the planet is taken to be important to what genomics is and what it can achieve. However, the large-scale international circulation of nucleotide sequence information did not begin with the Human Genome Project. Efforts to formalize and institutionalize the circulation of sequence information emerged concurrently with the development of centralized facilities for collecting that information. That is, the very first databases build for collecting and sharing DNA sequence information were, from their outset, international collaborative enterprises. This paper describes the origins of the International Nucleotide Sequence Database Collaboration between GenBank in the United States, the European Molecular Biology Laboratory Databank, and the DNA Database of Japan. The technical and social groundwork for the international exchange of nucleotide sequences created the conditions of possibility for imagining nucleotide sequences (and subsequently genomes) as a "global" objects. The "transnationalism" of nucleotide sequence was critical to their ontology - what DNA sequences came to be during the Human Genome Project was deeply influenced by international exchange.

  19. Expression and nucleotide sequence of the Lactobacillus bulgaricus beta-galactosidase gene cloned in Escherichia coli.

    Science.gov (United States)

    Schmidt, B F; Adams, R M; Requadt, C; Power, S; Mainzer, S E

    1989-01-01

    The Lactobacillus bulgaricus beta-galactosidase gene was cloned on a ca. 7-kilobase-pair HindIII fragment in the vector pKK223-3 and expressed in Escherichia coli by using its own promoter. The nucleotide sequence of the gene and approximately 400 bases of 3'- and 5'-flanking sequences was determined. The amino acid sequence of the beta-galactosidase, deduced from the nucleotide sequence of the gene, yielded a monomeric molecular mass of ca. 114 kilodaltons, slightly smaller than the E. coli lacZ and Klebsiella pneumoniae lacZ enzymes but larger than the E. coli evolved (ebgA) beta-galactosidase. The cloned beta-galactosidase was found to be indistinguishable from the native enzyme by several criteria. From amino acid sequence alignments, the L. bulgaricus beta-galactosidase has a 30 to 34% similarity to the E. coli lacZ, E. coli ebgA, and K. pneumoniae lacZ enzymes. There are seven regions of high similarity common to all four of these beta-galactosidases. Also, the putative active-site residues (Glu-461 and Tyr-503 in the E. coli lacZ beta-galactosidase) are conserved in the L. bulgaricus enzyme as well as in the other two beta-galactosidases mentioned above. The conservation of active-site amino acids and the large regions of similarity suggest that all four of these beta-galactosidases evolved from a common ancestral gene. However, these enzymes are quite different from the thermophilic beta-galactosidase encoded by the Bacillus stearothermophilus bgaB gene. PMID:2492511

  20. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    NARCIS (Netherlands)

    Steenbergh, P.H.; Sussenbach, J.S.

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  1. Nucleotide sequence of the 18S-26S rRNA intergene region of the sea urchin.

    Science.gov (United States)

    Hindenach, B R; Stafford, D W

    1984-02-10

    The DNA sequence which spans the internal transcribed spacers of a cloned ribosomal transcription unit from the sea urchin, Lytechinus variegatus, has been determined. The region extends from the conserved Eco RI site near the 3' end of the 18S rDNA to a Bam HI site in the 26S rDNA and includes 232 nucleotides coding for 18S rRNA, 367 nucleotides of internal transcribed spacer, 159 nucleotides coding for 5.8S rRNA, 338 nucleotides of internal transcribed spacer, and 505 nucleotides coding for 26S rRNA. The rRNA coding regions were identified by direct analysis of 3'-labeled 18S and 5.8S rRNA and 5'-labeled 5.8S rRNA, and by sequence homology of the 26S rDNA with yeast and vertebrate 26/28S rRNAs. The internal transcribed spacers are GC-rich, similar to those of vertebrates. The 5.8S and 5' 26S rDNA sequences support a proposed model for a structural domain of the yeast large subunit ribosomal RNA (Veldman et al. [1981] Nucleic Acids Res. 9, 6935-6952).

  2. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    Species classification and sequence accession numbers of amphibian mt genomes used in phylogenetic analyses. Taxon. Species. Family. GenBank no. Archaeobatrachia. Bombina fortinuptialis. Bombinatoridae. AY458591. B. orientalis. Bombinatoridae. AY585338. B. variegata. Bombinatoridae. AY971143. B. maxima.

  3. Applications of High-Throughput Nucleotide Sequencing (PhD)

    DEFF Research Database (Denmark)

    Waage, Johannes

    The recent advent of high throughput sequencing of nucleic acids (RNA and DNA) has vastly expanded research into the functional and structural biology of the genome of all living organisms (and even a few dead ones). With this enormous and exponential growth in biological data generation come...... equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......, focusing on oft encountered problems in data processing, such as quality assurance, mapping, normalization, visualization, and interpretation. Presented in the second part are scientific endeavors representing solutions to problems of two sub-genres of next generation sequencing. For the first flavor, RNA-sequencing...

  4. Applications of High-Throughput Nucleotide Sequencing (PhD)

    DEFF Research Database (Denmark)

    Waage, Johannes

    The recent advent of high throughput sequencing of nucleic acids (RNA and DNA) has vastly expanded research into the functional and structural biology of the genome of all living organisms (and even a few dead ones). With this enormous and exponential growth in biological data generation come...

  5. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  6. Organization and Nucleotide Sequences of Two Lactococcal Bacteriocin Operons

    NARCIS (Netherlands)

    Belkum, Marco J. van; Hayema, Bert Jan; Jeeninga, Rienk E.; Kok, Jan; Venema, Gerard

    Two distinct regions of the Lactococcus lactis subsp. cremoris 9B4 plasmid p9B4-6, each of which specified bacteriocin production as well as immunity, have been sequenced and analyzed by deletion and frameshift mutation analyses. On a 1.8-kb ScaI-ClaI fragment specifying low antagonistic activity,

  7. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  8. Clusters of nucleotide substitutions and insertion/deletion mutations are associated with repeat sequences.

    Directory of Open Access Journals (Sweden)

    Michael J McDonald

    2011-06-01

    Full Text Available The genome-sequencing gold rush has facilitated the use of comparative genomics to uncover patterns of genome evolution, although their causal mechanisms remain elusive. One such trend, ubiquitous to prokarya and eukarya, is the association of insertion/deletion mutations (indels with increases in the nucleotide substitution rate extending over hundreds of base pairs. The prevailing hypothesis is that indels are themselves mutagenic agents. Here, we employ population genomics data from Escherichia coli, Saccharomyces paradoxus, and Drosophila to provide evidence suggesting that it is not the indels per se but the sequence in which indels occur that causes the accumulation of nucleotide substitutions. We found that about two-thirds of indels are closely associated with repeat sequences and that repeat sequence abundance could be used to identify regions of elevated sequence diversity, independently of indels. Moreover, the mutational signature of indel-proximal nucleotide substitutions matches that of error-prone DNA polymerases. We propose that repeat sequences promote an increased probability of replication fork arrest, causing the persistent recruitment of error-prone DNA polymerases to specific sequence regions over evolutionary time scales. Experimental measures of the mutation rates of engineered DNA sequences and analyses of experimentally obtained collections of spontaneous mutations provide molecular evidence supporting our hypothesis. This study uncovers a new role for repeat sequences in genome evolution and provides an explanation of how fine-scale sequence contextual effects influence mutation rates and thereby evolution.

  9. Nucleotide Sequence of the Protective Antigen Gene of Bacillus Anthracis

    Science.gov (United States)

    1988-02-02

    the bands excised, and the DNA extracted with phenol for cloning in M13. 6 Nuclotida sequence analysis. The two fragments were each cloned into phages ...E.c. ToxA a £scherichia coli heat-labile enterotoxin A gene (45) V.c. CTxA - Vibrio ctolerae cholera toxin alfa subunlt gene (28) atotal nurber of specific amino acid residues deduced from p’otective antigen gene.

  10. The nucleotide sequence of histidine tRNA gamma of Drosophila melanogaster.

    OpenAIRE

    Altwegg, M; Kubli, E

    1980-01-01

    The nucleotide sequence of D. melanogaster histidine tRNA gamma was determined to be: pG-G-C-C-G-U-G-A-U-C-G-U-C-psi-A-G-D-G-G-D-D-A-G-G-A-C-C-C-C-A-C-G-psi-U-G-U-G- m1G-C-C-G-U-G-G-U-A-A-C-C-m5C-A-G-G-U-psi-C-G-m1A-A-U-C-C-U-G-G-U-C-A-C-G-G-m5C -A-C-C-AOH. An additional unpaired G is found at the 5' end, and the T in the TpsiC loop is replaced by a U.

  11. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    mt) genome of the round-tongued floating frog, Occidozyga martensii was determined. Although, the base composition and codon usage of O. martensii conformed to the typical vertebrate patterns, this mt genome contained 23 tRNAs (a ...

  12. Nucleotide sequence of the cDNA encoding the precursor of the beta subunit of rat lutropin.

    OpenAIRE

    Chin, W W; Godine, J E; Klein, D R; Chang, A S; Tan, L K; Habener, J F

    1983-01-01

    We have determined the nucleotide sequences of cDNAs encoding the precursor of the beta subunit of rat lutropin, a polypeptide hormone that regulates gonadal function, including the development of gametes and the production of steroid sex hormones. The cDNAs were prepared from poly(A)+ RNA derived from the pituitary glands of rats 4 weeks after ovariectomy and were cloned in bacterial plasmids. Bacterial colonies containing transfected plasmids were screened by hybridization with a 32P-labele...

  13. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Symbols and format to be used... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

  14. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail.

    Science.gov (United States)

    Niraj, Diwesh Kumar; Kumar, Pushpendra; Mishra, Chinmoy; Narayan, Raj; Bhattacharya, Tarun Kumar; Shrivastava, Kush; Bhushan, Bharat; Tiwari, Ashok Kumar; Saxena, Vishesh; Sahoo, Nihar Ranjan; Sharma, Deepak

    2015-12-01

    An attempt has been made to study the Myxovirus resistant (Mx1) gene polymorphism in Japanese quail. In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region), Fragment II of 148 bp (Exon 5 region), Fragment III of 161 bp (Exon 7 region), and Fragment IV of 176 bp (Exon 13 region) of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Out of the four fragments, one fragment (Fragment II) was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV) were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail.

  15. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail

    Directory of Open Access Journals (Sweden)

    Diwesh Kumar Niraj

    2015-12-01

    Full Text Available Aim: An attempt has been made to study the Myxovirus resistant (Mx1 gene polymorphism in Japanese quail. Materials and Methods: In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region, Fragment II of 148 bp (Exon 5 region, Fragment III of 161 bp (Exon 7 region, and Fragment IV of 176 bp (Exon 13 region of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Results: Out of the four fragments, one fragment (Fragment II was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. Conclusion: The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail.

  16. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens

    Directory of Open Access Journals (Sweden)

    Kiyeon Kim

    2017-12-01

    Full Text Available The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth–death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks.

  17. Complete nucleotide sequence of a highly divergent cherry-associated luteovirus (ChALV) isolate from peach in South Korea.

    Science.gov (United States)

    Igori, Davaajargal; Lim, Seungmo; Baek, Dasom; Cho, In Sook; Moon, Jae Sun

    2017-09-01

    We determined the complete genome sequence of a highly divergent South Korean (SK) isolate of a cherry-associated luteovirus (ChALV) from peach. The ChALV-SK genome consists of 5,815 nucleotides, and contains five open reading frames (ORFs). A comparative analysis of the full genome showed only 73.1% nucleotide sequence identity with a recently described ChALV from the Czech Republic (CZ). Amino acid similarities of the individual ORFs between ChALV-SK and other luteoviruses range from 17.3 to 92%, which places the new isolate close to the species demarcation value for luteoviruses. Results show our ChALV-SK isolate to be highly diverged from the ChALV-CZ isolate.

  18. Molecular cloning, nucleotide sequence, and characterization of a 40,000-molecular-weight lipoprotein of Haemophilus somnus.

    OpenAIRE

    Theisen, M; Rioux, C R; Potter, A A

    1992-01-01

    A gene of Haemophilus somnus encoding the major 40,000-molecular-weight antigen (LppA) was cloned on a 2-kb Sau3AI fragment. The nucleotide sequence of the entire DNA insert was determined. One open reading frame, encoding a 247-residue polypeptide with a calculated molecular weight of 27,072, was identified. This reading frame was confirmed by sequencing the fusion joint of two independent IppA::TnphoA gene fusions. The 21 amino-terminal amino acids of the deduced polypeptide showed strong s...

  19. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  20. Nucleotide sequence database comparison for Internal Transcribed Spacer 2 genetic region DNA barcode dermatophyte routine identification.

    Science.gov (United States)

    Normand, A C; Packeu, A; Cassagne, C; Hendrickx, M; Ranque, S; Piarroux, R

    2018-02-28

    Conventional dermatophyte identification is based on morphological features. However, recent studies have proposed to use the nucleotide sequences of the rRNA ITS region as an identification barcode of all fungi, including dermatophytes. Several nucleotide databases are available to compare sequences and thus identify isolates; however, these databases often contain mislabeled sequences that impair sequence-based identification.We evaluated five of these databases on a clinical isolate panel. We selected 292 clinical dermatophyte strains that were prospectively subjected to ITS2 nucleotide sequence analysis. Sequences were analyzed against the databases, and the results were compared to clusters obtained via DNA alignment of sequence segments. The DNA tree served as the identification standard throughout the study.According to the ITS2 sequence identification, the majority of strains (255/292) belonged to the genus Trichophyton , mainly T. rubrum complex (n=184), T. interdigitale (n=40), T. tonsurans (n=26) and T. benhamiae (n=5). Other genera included Microsporum (e.g., M canis (n=21), M. audouinii (n=10) and Nannizzia gypseum (n=3), and Epidermophyton (n=3)). Species-level identification of T. rubrum complex isolates was an issue.Overall, ITS DNA sequencing is a reliable tool to identify dermatophyte species given that a comprehensive and correctly-labeled database is consulted. As many inaccurate identification results exist in the DNA databases used for this study, reference databases must be verified frequently and amended in line with the current revisions of fungal taxonomy. Before describing a new species or adding a new DNA reference to the available databases, its position in the phylogenetic tree must be verified. Copyright © 2018 American Society for Microbiology.

  1. Insights into the Determination of the Templating Nucleotide at the Initiation of φ29 DNA Replication.

    Science.gov (United States)

    del Prado, Alicia; Lázaro, José M; Longás, Elisa; Villar, Laurentino; de Vega, Miguel; Salas, Margarita

    2015-11-06

    Bacteriophage φ29 from Bacillus subtilis starts replication of its terminal protein (TP)-DNA by a protein-priming mechanism. To start replication, the DNA polymerase forms a heterodimer with a free TP that recognizes the replication origins, placed at both 5' ends of the linear chromosome, and initiates replication using as primer the OH-group of Ser-232 of the TP. The initiation of φ29 TP-DNA replication mainly occurs opposite the second nucleotide at the 3' end of the template. Earlier analyses of the template position that directs the initiation reaction were performed using single-stranded and double-stranded oligonucleotides containing the replication origin sequence without the parental TP. Here, we show that the parental TP has no influence in the determination of the nucleotide used as template in the initiation reaction. Previous studies showed that the priming domain of the primer TP determines the template position used for initiation. The results obtained here using mutant TPs at the priming loop where Ser-232 is located indicate that the aromatic residue Phe-230 is one of the determinants that allows the positioning of the penultimate nucleotide at the polymerization active site to direct insertion of the initiator dAMP during the initiation reaction. The role of Phe-230 in limiting the internalization of the template strand in the polymerization active site is discussed. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  3. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  4. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  5. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  6. Nucleotide sequences of ribosomal internal transcribed spacers and their utility in distinguishing closely related Perinereis polychaets (Annelida; Polychaeta; Nereididae).

    Science.gov (United States)

    Chen, Chaolun Allen; Chen, Chang-Po; Fan, Tung-Yung; Yu, Jr-Kai; Hsieh, Hwey-Lian

    2002-01-01

    Nucleotide sequences of a segment of the rRNA transcription unit spanning from the 3' end of the 18S rDNA to the 5' end of 28S rDNA were determined for four species of Perinereis polychaetes: P. aibuhitensis, P. floridana, and two undescribed species, Perinereis sp1 and sp2. The 5.8S rDNA sequences are identical among the four species. Intraspecific variability was low with the Kimura 2-parameter (K2P) distance, ranging from 0 to 0.0138 for ITS1 and 0 to 0.0247 for ITS2. The interspecific nucleotide difference was significantly higher than those within species, with a mean K2P of 0.172 for ITS1 and 0.204 for ITS2, suggesting that comparisons of ITS regions can be used to evaluate the phylogenetic relationships among Perinereis species. Both neighbor-joining and parsimony analyses of ITS variability indicate a close relationship between the two undescribed species of Perinereis. These findings highlight the utility of the ITS sequence in conjunction with other morphological and ecological characters to delineate species boundaries among closely related polychaetes.

  7. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

    Science.gov (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

    1998-07-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  8. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  9. Nucleotide sequence and infectious cDNA clone of the L1 isolate of Pea seed-borne mosaic potyvirus.

    Science.gov (United States)

    Olsen, B S; Johansen, I E

    2001-01-01

    The complete nucleotide sequence of Pea seed-borne mosaic potyvirus isolate L1 has been determined from cloned virus cDNA. The PSbMV L1 genome is 9895 nucleotides in length excluding the poly(A) tail. Computer analysis of the sequence revealed a single long open reading frame (ORF) of 9594 nucleotides. The ORF potentially encodes a polyprotein of 3198 amino acids with a deduced Mr of 363537. Nine putative proteolytic cleavage sites were identified by analogy to consensus sequences and genome arrangement in other potyviruses. Two full-length cDNA clones, p35S-L1-4 and p35S-L1-5, were assembled under control of an enhanced 35S promoter and nopaline synthase terminator. Clone p35S-L1-4 was constructed with four introns and p35S-L1-5 with five introns inserted in the cDNA. Clone p35S-L1-4 was unstable in Escherichia coli often resulting in amplification of plasmids with deletions. Clone p35S-L1-5 was stable and apparently less toxic to Escherichia coli resulting in larger bacterial colonies and higher plasmid yield. Both clones were infectious upon mechanical inoculation of plasmid DNA on susceptible pea cultivars Fjord, Scout, and Brutus. Eight pea genotypes resistant to L1 virus were also resistant to the cDNA derived L1 virus. Both native PSbMV L1 and the cDNA derived virus infected Chenopodium quinoa systemically giving rise to characteristic necrotic lesions on uninoculated leaves.

  10. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  11. Coding assignment and nucleotide sequence of simian rotavirus SA11 gene segment 10: location of glycosylation sites suggests that the signal peptide is not cleaved.

    OpenAIRE

    Both, G W; Siegman, L J; Bellamy, A R; Atkinson, P H

    1983-01-01

    A cloned DNA copy of simian rotavirus SA11 genomic segment 10 was used to confirm the assignment of the nonstructural glycoprotein NCVP5 to this gene. Determination of the nucleotide sequence for gene 10 indicated that NCVP5 is 175 amino acids in length and has an N-terminal hydrophobic region with the characteristics of a signal sequence for membrane translocation. Unexpectedly, this region was also the location for the only two potential glycosylation sites within the molecule, asparagine r...

  12. Complete nucleotide sequence of a virus associated with rusty mottle disease of sweet cherry (Prunus avium).

    Science.gov (United States)

    Villamor, D V; Druffel, K L; Eastwell, K C

    2013-08-01

    Cherry rusty mottle is a disease of sweet cherries first described in 1940 in western North America. Because of the graft-transmissible nature of the disease, a viral nature of the disease was assumed. Here, the complete genomic nucleotide sequences of virus isolates from two trees expressing cherry rusty mottle disease symptoms are characterized; the virus is designated cherry rusty mottle associated virus (CRMaV). The biological and molecular characteristics of this virus in comparison to those of cherry necrotic rusty mottle virus (CNRMV) and cherry green ring mottle virus (CGRMV) are described. CRMaV was subsequently detected in additional sweet cherry trees expressing symptoms of cherry rusty mottle disease.

  13. The complete nucleotide sequence of the mitochondrial genome of Bactrocera minax (Diptera: Tephritidae).

    Science.gov (United States)

    Zhang, Bin; Nardi, Francesco; Hull-Sanders, Helen; Wan, Xuanwu; Liu, Yinghong

    2014-01-01

    The complete 16,043 bp mitochondrial genome (mitogenome) of Bactrocera minax (Diptera: Tephritidae) has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%). Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs). Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD), the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites) and amino acid sequence distance (ASD) were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD) and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T) stretch at the 5' end of the CR followed by a [TA(A)]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front of the

  14. The complete nucleotide sequence of the mitochondrial genome of Bactrocera minax (Diptera: Tephritidae.

    Directory of Open Access Journals (Sweden)

    Bin Zhang

    Full Text Available The complete 16,043 bp mitochondrial genome (mitogenome of Bactrocera minax (Diptera: Tephritidae has been sequenced. The genome encodes 37 genes usually found in insect mitogenomes. The mitogenome information for B. minax was compared to the homologous sequences of Bactrocera oleae, Bactrocera tryoni, Bactrocera philippinensis, Bactrocera carambolae, Bactrocera papayae, Bactrocera dorsalis, Bactrocera correcta, Bactrocera cucurbitae and Ceratitis capitata. The analysis indicated the structure and organization are typical of, and similar to, the nine closely related species mentioned above, although it contains the lowest genome-wide A+T content (67.3%. Four short intergenic spacers with a high degree of conservation among the nine tephritid species mentioned above and B. minax were observed, which also have clear counterparts in the control regions (CRs. Correlation analysis among these ten tephritid species revealed close positive correlation between the A+T content of zero-fold degenerate sites (P0FD, the ratio of nucleotide substitution frequency at P0FD sites to all degenerate sites (zero-fold degenerate sites, two-fold degenerate sites and four-fold degenerate sites and amino acid sequence distance (ASD were found. Further, significant positive correlation was observed between the A+T content of four-fold degenerate sites (P4FD and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites; however, we found significant negative correlation between ASD and the A+T content of P4FD, and the ratio of nucleotide substitution frequency at P4FD sites to all degenerate sites. A higher nucleotide substitution frequency at non-synonymous sites compared to synonymous sites was observed in nad4, the first time that has been observed in an insect mitogenome. A poly(T stretch at the 5' end of the CR followed by a [TA(A]n-like stretch was also found. In addition, a highly conserved G+A-rich sequence block was observed in front

  15. MeCP2 recognizes cytosine methylated tri-nucleotide and di-nucleotide sequences to tune transcription in the mammalian brain.

    Directory of Open Access Journals (Sweden)

    Sabine Lagger

    2017-05-01

    Full Text Available Mutations in the gene encoding the methyl-CG binding protein MeCP2 cause several neurological disorders including Rett syndrome. The di-nucleotide methyl-CG (mCG is the classical MeCP2 DNA recognition sequence, but additional methylated sequence targets have been reported. Here we show by in vitro and in vivo analyses that MeCP2 binding to non-CG methylated sites in brain is largely confined to the tri-nucleotide sequence mCAC. MeCP2 binding to chromosomal DNA in mouse brain is proportional to mCAC + mCG density and unexpectedly defines large genomic domains within which transcription is sensitive to MeCP2 occupancy. Our results suggest that MeCP2 integrates patterns of mCAC and mCG in the brain to restrain transcription of genes critical for neuronal function.

  16. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  17. Nucleotide sequence alignment of hdcA from Gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Maria Diaz

    2016-03-01

    Full Text Available The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]. The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3], which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  18. [Nucleotide sequence of HLA-DQA1 promoter region (QAP) in a lung cancer patient].

    Science.gov (United States)

    Qiu, C; Zhou, W; Song, C

    1996-06-01

    The HLA-DQA1 allele and nucleotide sequence of HLA-DQA1 promoter region (QAP) in a patient with IDDM complicated lung cancer have been identified by PCR/SSCP, PCR/SSCP and PCR/sequencing. The results showed that: (1) All of the lung cancer patient and his family members carried HLA-DQA1* 0301/0501 alleles. (2) a single base substitution G-->A at position -155 and deletion CAA at position -161 to -163 occurred in the patient. These results suggest that the mutation of HLA-DQA1 promoter region may modulate HLA-DQA1 gene expression by trans-acting factors binding to variant cis-acting elements and may be responsible for pathogenesis of lung cancer.

  19. Unique nucleotide sequence-guided assembly of repetitive DNA parts for synthetic biology applications

    Energy Technology Data Exchange (ETDEWEB)

    Torella, JP; Lienert, F; Boehm, CR; Chen, JH; Way, JC; Silver, PA

    2014-08-07

    Recombination-based DNA construction methods, such as Gibson assembly, have made it possible to easily and simultaneously assemble multiple DNA parts, and they hold promise for the development and optimization of metabolic pathways and functional genetic circuits. Over time, however, these pathways and circuits have become more complex, and the increasing need for standardization and insulation of genetic parts has resulted in sequence redundancies-for example, repeated terminator and insulator sequences-that complicate recombination-based assembly. We and others have recently developed DNA assembly methods, which we refer to collectively as unique nucleotide sequence (UNS)-guided assembly, in which individual DNA parts are flanked with UNSs to facilitate the ordered, recombination-based assembly of repetitive sequences. Here we present a detailed protocol for UNS-guided assembly that enables researchers to convert multiple DNA parts into sequenced, correctly assembled constructs, or into high-quality combinatorial libraries in only 2-3 d. If the DNA parts must be generated from scratch, an additional 2-5 d are necessary. This protocol requires no specialized equipment and can easily be implemented by a student with experience in basic cloning techniques.

  20. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Science.gov (United States)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  1. The role of nucleotide sequence in the immune-active structure photochemically induced in double-stranded DNA by ultraviolet irradiation

    International Nuclear Information System (INIS)

    Wakizaka, Akira; Okuhara, Eiji

    1982-01-01

    Pyrimidine, purine, and mixed sequence oligonucleotides from ultraviolet-irradiated DNA were tested for their inhibitory activities on the interaction of [ 3 H]ultraviolet-irradiated DNA with its antibody raised in rabbit. Thymine dimer containing pyrimidine oligonucleotides from irradiated DNA failed to inhibit the interaction, while mixed sequence oligonucleotides, especially those with 8 or more nucleotides, exhibited potent inhibition. Purine clusters from irradiated DNA and mixed sequence oligomers from unirradiated DNA showed no inhibition. Dimerized thymine, which appears to be a critical part of the antigenic determinant, did not inhibit the interaction by itself. The same observations were made for ultraviolet-irradiated thymidine and thymidylic acid. The results suggest that a structure composed of a mixed pyrimidine and purine sequence with a certain chain length seems to be essential for the antigenicity induced in the irradiated DNA. On this nucleotide chain backbone, photochemically modified bases (mostly thymine dimer) can form an immune-active structure. (author)

  2. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  3. [Nucleotide sequences of 5S rRNA genes of polyploid species of wheat and Aegilops species].

    Science.gov (United States)

    Vakhitov, V A; Gimalov, F R; Shumiatskiĭ, G P

    1989-01-01

    Primary structures of 5S rRNA genes and of non-transcribed spacers between them were determined in families of 5S DNA repeats 420 and 500 b.p. long in 8 wheat and Aegilops species. The high conservatism of sequences coding for 5S rRNA, 3'- and 5'-ends of non-transcribed spacers was shown not to depend on the evolutional position, ploidy level and genomic composition of species. The activity of transcription of 5S rRNA cloned genes was determined in vitro. The functional heterogeneity was revealed in each family of repeats due to the existence of exchanges of separate nucleotides within the internal transcription control region. A greater deficiency of CpG dinucleotide was revealed in 5S rRNA genes than in non-transcribed spacers.

  4. Feasibility of mini-sequencing schemes based on nucleotide polymorphisms for microbial identification and population analyses.

    Science.gov (United States)

    Araujo, Ricardo; Eusebio, Nadia; Caramalho, Rita

    2015-03-01

    Practical schemes based on single nucleotide polymorphisms (SNP) have been proposed as alternatives to simplify and replace the molecular methodologies based on the extensive sequencing analysis of genes. SNaPshot mini-sequencing has been progressively experienced during the last decade and represents a fast and robust strategy to analyze critical polymorphisms. Such assays have been proposed to characterize some bacteria and microbial eukaryotes, and its feasibility was now reviewed in the present manuscript. The mini-sequencing schemes showed high discriminatory power and competence for identification of microorganisms, but some specificity errors were still found, particularly for species of the Burkholderia cepacia complex and mycobacteria. SNP assays designed for other goals, e.g., comparison of strains, detection of serotypes, virulence, epidemic, and phylogenetic-related subgroups of isolates, can be very useful by facilitating the investigation of large collections of isolates. The next-generation of SNP assays might consider the inclusion of large number of markers to fully characterize microbial taxonomy and strains; nevertheless, these new technologies are still prone to errors and can largely benefit from integration with well-established mini-sequencing assays. Newly proposed molecular tools should be systematically tested in collections of isolates with high indexes of diversity and guarantee interlaboratorial validation.

  5. Cloning, sequencing and identification of single nucleotide polymorphisms of partial sequence on the porcine CACNA1S gene.

    Science.gov (United States)

    Fang, XiaoMin; Xu, NingYing; Ren, ShouWen

    2008-04-01

    CACNA1S gene encodes the alpha1 subunit of the calcium channel. The mutation of CACNA1S gene can cause hypokalemic periodic paralysis (HypoKPP) and maliglant hyperthermia synarome (MHS) in human beings. Current research on CACNA1S was mainly in human being and model animal, but rarely in livestock and poultry. In this study, Yorkshire pigs (23), Pietrain pigs (30), Jinhua pigs (115) and the second generation (126) of crossbred of Jinhua and Pietrain were used. Primers were designed according to the sequence of human CACNA1S gene and PCR was carried out using pig genome DNA. PCR products were sequenced and compared with that of human, and then single nucleotide polymorphisms (SNPs) were investigated by PCR-SSCP, while PCR-RFLP tests were performed to validate the mutations. Results indicated: (1) the 5211 bp DNA fragments of porcine CACNA1S gene were acquired (GenBank accession number: DQ767693 ) and the identity of the exon region was 82.6% between human and pig; (2) fifty-seven mutations were found within the cloned sequences, among which 24 were in exon region; (3) the results of PCR-RFLP were in accordance with that of PCR-SSCP. According to the EST of porcine CACNA1S gene published in GenBank (Bx914582, Bx666997), 8 of the 11 SNPs identified in the present study were consistent with the base difference between two EST fragments.

  6. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  7. Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

    Directory of Open Access Journals (Sweden)

    Jacqueline Morris

    2017-12-01

    Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

  8. Method of Selection of Bacteria Antibiotic Resistance Genes Based on Clustering of Similar Nucleotide Sequences.

    Science.gov (United States)

    Balashov, I S; Naumov, V A; Borovikov, P I; Gordeev, A B; Dubodelov, D V; Lyubasovskaya, L A; Rodchenko, Yu V; Bystritskii, A A; Aleksandrova, N V; Trofimov, D Yu; Priputnevich, T V

    2017-10-01

    A new method for selection of bacterium antibiotic resistance genes is proposed and tested for solving the problems related to selection of primers for PCR assay. The method implies clustering of similar nucleotide sequences and selection of group primers for all genes of each cluster. Clustering of resistance genes for six groups of antibiotics (aminoglycosides, β-lactams, fluoroquinolones, glycopeptides, macrolides and lincosamides, and fusidic acid) was performed. The method was tested for 81 strains of bacteria of different genera isolated from patients (K. pneumoniae, Staphylococcus spp., S. agalactiae, E. faecalis, E. coli, and G. vaginalis). The results obtained by us are comparable to those in the selection of individual genes; this allows reducing the number of primers necessary for maximum coverage of the known antibiotic resistance genes during PCR analysis.

  9. Enzyme-Linked Electrochemical Detection of PCR-Amplified Nucleotide Sequences Using Disposable Screen-Printed Sensors. Applications in Gene Expression Monitoring

    Directory of Open Access Journals (Sweden)

    Miroslav Fojta

    2008-01-01

    Full Text Available Electrochemical enzyme-linked techniques for sequence-specific DNA sensingare presented. These techniques are based on attachment of streptavidin-alkalinephosphatase conjugate to biotin tags tethered to DNA immobilized at the surface ofdisposable screen-printed carbon electrodes (SPCE, followed by production andelectrochemical determination of an electroactive indicator, 1-naphthol. Via hybridizationof SPCE surface-confined target DNAs with end-biotinylated probes, highly specificdiscrimination between complementary and non-complementary nucleotide sequences wasachieved. The enzyme-linked DNA hybridization assay has been successfully applied inanalysis of PCR-amplified real genomic DNA sequences, as well as in monitoring of planttissue-specific gene expression. In addition, we present an alternative approach involvingsequence-specific incorporation of biotin-labeled nucleotides into DNA by primerextension. Introduction of multiple biotin tags per probe primer resulted in considerableenhancement of the signal intensity and improvement of the specificity of detection.

  10. Determining Candidate Single Nucleotide Polymorphisms in Acquired Laryngotracheal Stenosis.

    Science.gov (United States)

    Anis, Mursalin M; Krynetskaia, Natalia; Zhao, Zhigen; Krynetskiy, Evgeny; Soliman, Ahmed M S

    2018-03-01

    Despite wide adoption of strategies to prevent injury from prolonged intubation and tracheotomy, acquired laryngotracheal stenosis (ALTS) has not disappeared. ALTS' persistence may be due to patient factors that confer unique susceptibility for some. We sought to identify genetic markers in genes associated with wound healing that could be associated with ALTS. Case-control study. One hundred thirty-eight patients were recruited, 53 patients with ALTS and 85 control patients who underwent intubation or tracheotomy without evidence of ALTS. The patients' DNA was isolated from whole blood. Custom primers were designed, and the TaqMan assay employing allele-specific polymerase chain reaction was used to interrogate single nucleotide polymorphisms (SNPs) rs1799750, rs522616, rs2276109, rs2569190, rs1800469, and rs1024611 of candidate wound healing genes MMP1, MMP3, MMP12, CD14, TGFβ1, and MCP1, respectively. A logistic regression model was used to examine the association of candidate gene polymorphisms with the presence or absence of ALTS. All 138 patients were successfully genotyped. No significant association was found between candidate SNPs and development of ALTS in the overall group. However, subgroup analysis within each ethnicity identified SNPs that are associated with ALTS depending upon the ethnic background. Patient factors such as variations in wound healing due to functional SNPs may shed light on the development of ALTS. There may be a difference in susceptibility to developing ALTS in different ethnic backgrounds. These preliminary findings need to be corroborated in larger population studies. 3b. Laryngoscope, 128:E111-E116, 2018. © 2017 The American Laryngological, Rhinological and Otological Society, Inc.

  11. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    Science.gov (United States)

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  12. Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

    Directory of Open Access Journals (Sweden)

    Cheng-Chong Chou

    2004-11-01

    Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

  13. Deciphering mRNA Sequence Determinants of Protein Production Rate

    Science.gov (United States)

    Szavits-Nossan, Juraj; Ciandrini, Luca; Romano, M. Carmen

    2018-03-01

    One of the greatest challenges in biophysical models of translation is to identify coding sequence features that affect the rate of translation and therefore the overall protein production in the cell. We propose an analytic method to solve a translation model based on the inhomogeneous totally asymmetric simple exclusion process, which allows us to unveil simple design principles of nucleotide sequences determining protein production rates. Our solution shows an excellent agreement when compared to numerical genome-wide simulations of S. cerevisiae transcript sequences and predicts that the first 10 codons, which is the ribosome footprint length on the mRNA, together with the value of the initiation rate, are the main determinants of protein production rate under physiological conditions. Finally, we interpret the obtained analytic results based on the evolutionary role of the codons' choice for regulating translation rates and ribosome densities.

  14. Analysis of Complete Nucleotide Sequences of 12 Gossypium Chloroplast Genomes: Origin and Evolution of Allotetraploids

    Science.gov (United States)

    Xu, Qin; Xiong, Guanjun; Li, Pengbo; He, Fei; Huang, Yi; Wang, Kunbo; Li, Zhaohu; Hua, Jinping

    2012-01-01

    Gossypium is the maternal source of extant allotetraploid species and allotetraploids have a monophyletic origin. G. hirsutum AD1 lineages have experienced more sequence variations than other allotetraploids in intergenic regions. The available complete nucleotide sequences of 12 Gossypium chloroplast genomes should facilitate studies to uncover the molecular mechanisms of compartmental co-evolution and speciation of Gossypium allotetraploids. PMID:22876273

  15. The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

    Science.gov (United States)

    Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

    2011-04-01

    A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

  16. Complete nucleotide sequence and gene rearrangement of the mitochondrial genome of the Japanese pond frog Rana nigromaculata.

    Science.gov (United States)

    Sumida, M; Kanamori, Y; Kaneda, H; Kato, Y; Nishioka, M; Hasegawa, M; Yonekawa, H

    2001-10-01

    In this study, we determined the complete nucleotide sequence of the mitochondrial genome of the Japanese pond frog Rana nigromaculata. The length of the sequence of the frog was 17,804 bp, though this was not absolute due to length variation caused by differing numbers of repetitive units in the control regions of individual frogs. The gene content, base composition, and codon usage of the Japanese pond frog conformed to those of typical vertebrate patterns. However, the comparison of gene organization between three amphibian species (Rana, Xenopus and caecilian) provided evidence that the gene arrangement of Rana differs by four tRNA gene positions from that of Xenopus or caecilian, a common gene arrangement in vertebrates. These gene rearrangements are presumed to have occurred by the tandem duplication of a gene region followed by multiple deletions of redundant genes. It is probable that the rearrangements start and end at tRNA genes involved in the initial production of a tandemly duplicated gene region. Putative secondary structures for the 22 tRNAs and the origin of the L-strand replication (OL) are described. Evolutionary relationships were estimated from the concatenated sequences of the 12 proteins encoded in the H-strand of mtDNA among 37 vertebrate species. A quartet-puzzling tree showed that three amphibian species form a monophyletic clade and that the caecilian is a sister group of the monophyletic Anura.

  17. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  18. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  19. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  20. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    Directory of Open Access Journals (Sweden)

    Ji-Sun Park

    2015-01-01

    Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  1. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui

    2012-10-01

    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  2. [Study of a comparative statistical analytical model for nucleotide sequences in the genome of viruses of the Papovaviridae family].

    Science.gov (United States)

    Leopardi, R

    1989-08-01

    In the present study a model for comparative analysis of nucleotide sequences has been developed, in order to evaluate statistical features of nucleotide distribution in DNA strands without any genetic relationship. Every DNA strand has been considered as a finite Markov chain; a matrix, whose elements represent the number of couplings between a nucleotide and the following one in 5'-3' direction, has been used for every DNA strand, and the statistical relationship has been detected by using Kendall's test. The genomes of Polyomavirus (strain A2) and DPV have been analysed by the proposed model; a substantial likeness between the behaviour of nucleotide distribution on all four DNA strands analysed has been shown; the strongest likeness concerned the complementary strands of Polyomavirus as well as the homologous sense strands of both viruses.

  3. Detection, Validation, and Application of Genotyping-by-Sequencing Based Single Nucleotide Polymorphisms in Upland Cotton

    Directory of Open Access Journals (Sweden)

    M. Sariful Islam

    2015-03-01

    Full Text Available The presence of two closely related subgenomes in the allotetraploid Upland cotton, combined with a narrow genetic base of the cultivated varieties, has hindered the identification of polymorphic genetic markers and their use in improving this important crop. Genotyping-by-sequencing (GBS is a rapid way to identify single nucleotide polymorphism (SNP markers; however, these SNPs may be specific to the sequenced cotton lines. Our objective was to obtain a large set of polymorphic SNPs with broad applicability to the cultivated cotton germplasm. We selected 11 diverse cultivars and their random-mated recombinant inbred progeny for SNP marker development via GBS. Two different GBS methodologies were used by Data2Bio (D2B and the Institute for Genome Diversity (IGD to identify 4441 and 1176 polymorphic SNPs with minor allele frequency of ≥0.1, respectively. We further filtered the SNPs and aligned their sequences to the diploid reference genome. We were able to use homeologous SNPs to assign 1071 SNP loci to the At subgenome and 1223 to the Dt subgenome. These filtered SNPs were located in genic regions about twice as frequently as expected by chance. We tested 111 of the SNPs in 154 diverse Upland cotton lines, which confirmed the utility of the SNP markers developed in such approach. Not only were the SNPs identified in the 11 cultivars present in the 154 cotton lines, no two cultivars had identical SNP genotypes. We conclude that GBS can be easily used to discover SNPs in Upland cotton, which can be converted to functional genotypic assays for use in breeding and genetic studies.

  4. Complete nucleotide sequence of a begomovirus associated with satellites molecules infecting a new host Tagetes patula in India.

    Science.gov (United States)

    Marwal, Avinash; Sahu, Anurag Kumar; Choudhary, Devendra Kumar; Gaur, R K

    2013-08-01

    In the year 2012 leaf curl disease was observed on Marigold (Tagetes patula) in Lakshmangrh, Sikar province of India. Affected plants were severely stunted with apical leaf curl and crinkled leaves, symptoms typical of begomovirus infection. This is the first report of complete nucleotide sequence of a begomovirus associated with satellites molecules infecting a new host Tagetes patula in India.

  5. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  6. Nucleotide Sequences of 5'-Terminal Parts of Coat Protein Genes of Various Isolates of NTN Strain of Potato Virus Y

    Czech Academy of Sciences Publication Activity Database

    Čeřovská, Noemi; Moravec, Tomáš; Filigarová, Marie; Petrzik, Karel

    2001-01-01

    Roč. 45, - (2001), s. 55-59 ISSN 0001-723X R&D Projects: GA ČR GA522/01/1121 Institutional research plan: CEZ:AV0Z5038910; CEZ:AV0Z5051902 Keywords : Nucleotide Sequences * NTN Strain of Potato Virus Y Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.644, year: 2001

  7. Nucleotide sequence of the Escherichia coli pyrE gene and of the DNA in front of the protein-coding region

    DEFF Research Database (Denmark)

    Poulsen, Peter; Jensen, Kaj Frank; Valentin-Hansen, Poul

    1983-01-01

    Orotate phosphoribosyltransferase (EC 2.4.2.10) was purified to electrophoretic homogeneity from a strain of Escherichia coli containing the pyrE gene cloned on a multicopy plasmid. The relative molecular masses (Mr) of the native enzyme and its subunit were estimated by means of gel filtration....... From the results the following conclusions may be drawn. Orotate phosphoribosyltransferase is a dimeric protein with subunits of Mr 23 326 consisting of 211 amino acid residues. The pyrE gene is transcribed in a counter-clockwise direction from the E. coli chromosome as an mRNA with a considerable...... and electrophoresis in the presence of dodecyl sulfate. The amino acid sequences at the N and C termini, as well as the amino acid composition, were determined. The nucleotide sequence of the structural pyrE gene, including 394 nucleotide residues preceding the beginning of the coding frame, was also established...

  8. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  9. Nucleotide sequence and developmental expression of Acanthamoeba S-adenosylmethionine synthetase gene.

    Science.gov (United States)

    Ahn, K S; Henney, H R

    1997-03-20

    We have isolated and characterized a cDNA (cDNA1) from an Acanthamoeba cDNA library encoding the enzyme S-adenosylmethionine (SAM) synthetase (ATP: L-methionine S-adenosyltransferase; EC 2.5.1.6). The nucleotide sequence exhibits about 61-73% overall similarity to the corresponding gene of other organisms. The cDNA displays extreme codon bias with a preference for C or G in the third position. A putative initiation site and an ATP-binding site are identified. An amino acid content of 388 and a molecular mass of about 44,000 Daltons are deduced for the enzyme. Putative phosphorylation sites which might be involved in regulation of the enzyme are revealed. The cDNA was expressed in Escherichia coli BL21(DE3), and the identity of the protein product confirmed by Western blotting analysis. Northern analyses of the expression of the Acanthamoeba SAM synthetase gene during development revealed a pronounced reduction in the level of transcripts as amoebae converted to cysts.

  10. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  11. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Science.gov (United States)

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

    2016-03-22

    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  12. Saddlebags: A software interface for submitting full-length HLA allele sequences to the EMBL-ENA nucleotide database.

    Science.gov (United States)

    Matern, B M; Groeneweg, M; Voorter, C E M; Tilanus, M G J

    2018-01-01

    Submission of full-length HLA allele sequences presents a unique challenge, both for high-throughput sequencing laboratories and smaller diagnostic laboratories. HLA's extensive polymorphism means that accurate representation and annotation of allele sequence is of critical importance, and curators of nucleotide databases must establish submission formats to ensure high-quality data and prevent ambiguities. The IPD-IMGT/HLA database is established as the standard repository for HLA sequences, and it is a major goal of the 17th International HLA and Immunogenetics Workshop to fill the IPD-IMGT/HLA database with full-length HLA sequences. The process of preparing sequence annotation and metadata is cumbersome and error prone, and it is desirable to create a straightforward and concise method of preparing sequence submissions. We introduce Saddlebags, a software tool for rapid generation of HLA (novel) full-length allele sequence submissions. HLA allele sequences are submitted first to EMBL European Nucleotide Archive (EMBL-ENA), and metadata is gathered for subsequent preparation of an IPD-IMGT/HLA formatted submission. Combining these steps into a pipeline reduces effort and minimizes errors for submitting laboratories. This software has been used by Maastricht University Medical Center Transplantation Immunology Laboratory to submit 79 novel alleles to EMBL-ENA, and the tool is freely available for the HLA community. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. Determinants of nucleotide-binding selectivity of malic enzyme.

    Directory of Open Access Journals (Sweden)

    Ju-Yi Hsieh

    Full Text Available Malic enzymes have high cofactor selectivity. An isoform-specific distribution of residues 314, 346, 347 and 362 implies that they may play key roles in determining the cofactor specificity. Currently, Glu314, Ser346, Lys347 and Lys362 in human c-NADP-ME were changed to the corresponding residues of human m-NAD(P-ME (Glu, Lys, Tyr and Gln, respectively or Ascaris suum m-NAD-ME (Ala, Ile, Asp and His, respectively. Kinetic data demonstrated that the S346K/K347Y/K362Q c-NADP-ME was transformed into a debilitated NAD⁺-utilizing enzyme, as shown by a severe decrease in catalytic efficiency using NADP⁺ as the cofactor without a significant increase in catalysis using NAD⁺ as the cofactor. However, the S346K/K347Y/K362H enzyme displayed an enhanced value for k(cat,NAD, suggesting that His at residue 362 may be more beneficial than Gln for NAD⁺ binding. Furthermore, the S346I/K347D/K362H mutant had a very large K(m,NADP value compared to other mutants, suggesting that this mutant exclusively utilizes NAD⁺ as its cofactor. Since the S346K/K347Y/K362Q, S346K/K347Y/K362H and S346I/K347D/K362H c-NADP-ME mutants did not show significant reductions in their K(m,NAD values, the E314A mutation was then introduced into these triple mutants. Comparison of the kinetic parameters of each triple-quadruple mutant pair (for example, S346K/K347Y/K362Q versus E314A/S346K/K347Y/K362Q revealed that all of the K(m values for NAD⁺ and NADP(+ of the quadruple mutants were significantly decreased, while either k(cat,NAD or k(cat,NADP was substantially increased. By adding the E314A mutation to these triple mutant enzymes, the E314A/S346K/K347Y/K362Q, E314A/S346K/K347Y/K362H and E314A/S346I/K347D/K362H c-NADP-ME variants are no longer debilitated but become mainly NAD⁺-utilizing enzymes by a considerable increase in catalysis using NAD⁺ as the cofactor. These results suggest that abolishing the repulsive effect of Glu314 in these quadruple mutants increases

  14. Determinants of nucleotide-binding selectivity of malic enzyme.

    Science.gov (United States)

    Hsieh, Ju-Yi; Chen, Meng-Chun; Hung, Hui-Chih

    2011-01-01

    Malic enzymes have high cofactor selectivity. An isoform-specific distribution of residues 314, 346, 347 and 362 implies that they may play key roles in determining the cofactor specificity. Currently, Glu314, Ser346, Lys347 and Lys362 in human c-NADP-ME were changed to the corresponding residues of human m-NAD(P)-ME (Glu, Lys, Tyr and Gln, respectively) or Ascaris suum m-NAD-ME (Ala, Ile, Asp and His, respectively). Kinetic data demonstrated that the S346K/K347Y/K362Q c-NADP-ME was transformed into a debilitated NAD⁺-utilizing enzyme, as shown by a severe decrease in catalytic efficiency using NADP⁺ as the cofactor without a significant increase in catalysis using NAD⁺ as the cofactor. However, the S346K/K347Y/K362H enzyme displayed an enhanced value for k(cat,NAD), suggesting that His at residue 362 may be more beneficial than Gln for NAD⁺ binding. Furthermore, the S346I/K347D/K362H mutant had a very large K(m,NADP) value compared to other mutants, suggesting that this mutant exclusively utilizes NAD⁺ as its cofactor. Since the S346K/K347Y/K362Q, S346K/K347Y/K362H and S346I/K347D/K362H c-NADP-ME mutants did not show significant reductions in their K(m,NAD) values, the E314A mutation was then introduced into these triple mutants. Comparison of the kinetic parameters of each triple-quadruple mutant pair (for example, S346K/K347Y/K362Q versus E314A/S346K/K347Y/K362Q) revealed that all of the K(m) values for NAD⁺ and NADP(+) of the quadruple mutants were significantly decreased, while either k(cat,NAD) or k(cat,NADP) was substantially increased. By adding the E314A mutation to these triple mutant enzymes, the E314A/S346K/K347Y/K362Q, E314A/S346K/K347Y/K362H and E314A/S346I/K347D/K362H c-NADP-ME variants are no longer debilitated but become mainly NAD⁺-utilizing enzymes by a considerable increase in catalysis using NAD⁺ as the cofactor. These results suggest that abolishing the repulsive effect of Glu314 in these quadruple mutants increases the binding

  15. Quality control metrics improve repeatability and reproducibility of single-nucleotide variants derived from whole-genome sequencing.

    Science.gov (United States)

    Zhang, W; Soika, V; Meehan, J; Su, Z; Ge, W; Ng, H W; Perkins, R; Simonyan, V; Tong, W; Hong, H

    2015-08-01

    Although many quality control (QC) methods have been developed to improve the quality of single-nucleotide variants (SNVs) in SNV-calling, QC methods for use subsequent to single-nucleotide polymorphism-calling have not been reported. We developed five QC metrics to improve the quality of SNVs using the whole-genome-sequencing data of a monozygotic twin pair from the Korean Personal Genome Project. The QC metrics improved both repeatability between the monozygotic twin pair and reproducibility between SNV-calling pipelines. We demonstrated the QC metrics improve reproducibility of SNVs derived from not only whole-genome-sequencing data but also whole-exome-sequencing data. The QC metrics are calculated based on the reference genome used in the alignment without accessing the raw and intermediate data or knowing the SNV-calling details. Therefore, the QC metrics can be easily adopted in downstream association analysis.

  16. Inhibition of Cell Growth and Shoot Development by a Specific Nucleotide Sequence in a Noncoding Viroid RNA

    Science.gov (United States)

    Qi, Yijun; Ding, Biao

    2003-01-01

    Viroids are small noncoding and infectious RNAs that replicate autonomously and move systemically throughout an infected plant. The RNAs of the family Pospiviroidae contain a central conserved region (CCR) that has long been thought to be involved in replication. Here, we report that the CCR of Potato spindle tuber viroid (PSTVd) also plays a role in pathogenicity. A U257A change in the CCR converted the intermediate strain PSTVdInt to a lethal strain that caused severe growth stunting and premature death of infected plants. PSTVd with nucleotide U257 changed to C or G did not cause such symptoms. The pathogenic effect of the U257A substitution was abolished by a C259U substitution in the same RNA. Analyses of the pathogenic effects of the U257A substitution in three other PSTVd variants established A257 as a new pathogenicity determinant that functions independently and synergistically with the classic pathogenicity domain. The U257A substitution did not alter PSTVd secondary structure, replication levels, or tissue tropism. The stunted growth of PSTVdIntU257A-infected tomato plants resulted from restricted cell expansion but not cell division or differentiation. This was correlated positively with the downregulated expression of an expansin gene, LeExp2. Our results demonstrate that specific nucleotides in a noncoding, pathogenic RNA have a profound effect in altering distinct cellular responses, which then lead to well-defined alterations in plant growth and developmental patterns. The feasibility of correlating viroid RNA sequence/structure with the altered expression of specific host genes, cellular processes, and developmental patterns makes viroid infection a valuable system in which to investigate host factors for symptom expression and perhaps also to characterize the mechanisms of RNA regulation of gene expression in plants. PMID:12782729

  17. Complete nucleotide sequence of a South African isolate of Grapevine fanleaf virus and its associated satellite RNA.

    Science.gov (United States)

    Lamprecht, Renate L; Spaltman, Monique; Stephan, Dirk; Wetzel, Thierry; Burger, Johan T

    2013-07-17

    The complete sequences of RNA1, RNA2 and satellite RNA have been determined for a South African isolate of Grapevine fanleaf virus (GFLV-SACH44). The two RNAs of GFLV-SACH44 are 7,341 nucleotides (nt) and 3,816 nt in length, respectively, and its satellite RNA (satRNA) is 1,104 nt in length, all excluding the poly(A) tail. Multiple sequence alignment of these sequences showed that GFLV-SACH44 RNA1 and RNA2 were the closest to the South African isolate, GFLV-SAPCS3 (98.2% and 98.6% nt identity, respectively), followed by the French isolate, GFLV-F13 (87.3% and 90.1% nt identity, respectively). Interestingly, the GFLV-SACH44 satRNA is more similar to three Arabis mosaic virus satRNAs (85%-87.4% nt identity) than to the satRNA of GFLV-F13 (81.8% nt identity) and was most distantly related to the satRNA of GFLV-R2 (71.0% nt identity). Full-length infectious clones of GFLV-SACH44 satRNA were constructed. The infectivity of the clones was tested with three nepovirus isolates, GFLV-NW, Arabis mosaic virus (ArMV)-NW and GFLV-SAPCS3. The clones were mechanically inoculated in Chenopodium quinoa and were infectious when co-inoculated with the two GFLV helper viruses, but not when co-inoculated with ArMV-NW.

  18. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L

    2011-06-01

    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  19. An Exploration of the Triplet Periodicity in Nucleotide Sequences with a Mature Self-Adaptive Spectral Rotation Approach

    Directory of Open Access Journals (Sweden)

    Bo Chen

    2014-01-01

    Full Text Available Previously, for predicting coding regions in nucleotide sequences, a self-adaptive spectral rotation (SASR method has been developed, based on a universal statistical feature of the coding regions, named triplet periodicity (TP. It outputs a random walk, that is, TP walk, in the complex plane for the query sequence. Each step in the walk is corresponding to a position in the sequence and generated from a long-term statistic of the TP in the sequence. The coding regions (TP intensive are then visually discriminated from the noncoding ones (without TP, in the TP walk. In this paper, the behaviors of the walks for random nucleotide sequences are further investigated qualitatively. A slightly leftward trend (a negative noise in such walks is observed, which is not reported in the previous SASR literatures. An improved SASR, named the mature SASR, is proposed, in order to eliminate the noise and correct the TP walks. Furthermore, a potential sequence pattern opposite to the TP persistent pattern, that is, the TP antipersistent pattern, is explored. The applications of the algorithms on simulated datasets show their capabilities in detecting such a potential sequence pattern.

  20. Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

    International Nuclear Information System (INIS)

    Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

    1987-01-01

    Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

  1. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  2. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  3. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  4. From next-generation sequencing alignments to accurate comparison and validation of single-nucleotide variants: the pibase software

    Science.gov (United States)

    Forster, Michael; Forster, Peter; Elsharawy, Abdou; Hemmrich, Georg; Kreck, Benjamin; Wittig, Michael; Thomsen, Ingo; Stade, Björn; Barann, Matthias; Ellinghaus, David; Petersen, Britt-Sabina; May, Sandra; Melum, Espen; Schilhabel, Markus B.; Keller, Andreas; Schreiber, Stefan; Rosenstiel, Philip; Franke, Andre

    2013-01-01

    Scientists working with single-nucleotide variants (SNVs), inferred by next-generation sequencing software, often need further information regarding true variants, artifacts and sequence coverage gaps. In clinical diagnostics, e.g. SNVs must usually be validated by visual inspection or several independent SNV-callers. We here demonstrate that 0.5–60% of relevant SNVs might not be detected due to coverage gaps, or might be misidentified. Even low error rates can overwhelm the true biological signal, especially in clinical diagnostics, in research comparing healthy with affected cells, in archaeogenetic dating or in forensics. For these reasons, we have developed a package called pibase, which is applicable to diploid and haploid genome, exome or targeted enrichment data. pibase extracts details on nucleotides from alignment files at user-specified coordinates and identifies reproducible genotypes, if present. In test cases pibase identifies genotypes at 99.98% specificity, 10-fold better than other tools. pibase also provides pair-wise comparisons between healthy and affected cells using nucleotide signals (10-fold more accurately than a genotype-based approach, as we show in our case study of monozygotic twins). This comparison tool also solves the problem of detecting allelic imbalance within heterozygous SNVs in copy number variation loci, or in heterogeneous tumor sequences. PMID:22965131

  5. Codon usage of HIV regulatory genes is not determined by nucleotide composition.

    Science.gov (United States)

    Phakaratsakul, Supinya; Sirihongthong, Thanyaporn; Boonarkart, Chompunuch; Suptawiwat, Ornpreya; Auewarakul, Prasert

    2018-02-01

    Codon usage bias can be a result of either mutational bias or selection for translational efficiency and/or accuracy. Previous data has suggested that nucleotide composition constraint was the main determinant of HIV codon usage, and that nucleotide composition and codon usage were different between the regulatory genes, tat and rev, and other viral genes. It is not clear whether translational selection contributed to the codon usage difference and how nucleotide composition and translational selection interact to determine HIV codon usage. In this study, a model of codon bias due to GC composition with modification for the A-rich third codon position was used to calculate predicted HIV codon frequencies based on its nucleotide composition. The predicted codon usage of each gene was compared with the actual codon frequency. The predicted codon usage based on GC composition matched well with the actual codon frequencies for the structural genes (gag, pol and env). However, the codon usage of the regulatory genes (tat and rev) could not be predicted. Codon usage of the regulatory genes was also relatively unbiased showing the highest effective number of codons (ENC). Moreover, the codon adaptation index (CAI) of the regulatory genes showed better adaptation to human codons when compared to other HIV genes. Therefore, the early expressed genes responsible for regulation of the replication cycle, tat and rev, were more similar to humans in terms of codon usage and GC content than other HIV genes. This may help these genes to be expressed efficiently during the early stages of infection.

  6. Complete nucleotide sequence and organization of the mitogenome of the red-spotted apollo butterfly, Parnassius bremeri (Lepidoptera: Papilionidae) and comparison with other lepidopteran insects.

    Science.gov (United States)

    Kim, Man Il; Baek, Jee Yeon; Kim, Min Jee; Jeong, Heon Cheon; Kim, Ki-Gyoung; Bae, Chang Hwan; Han, Yeon Soo; Jin, Byung Rae; Kim, Iksoo

    2009-10-31

    The 15,389-bp long complete mitogenome of the endangered red-spotted apollo butterfly, Parnassius bremeri (Lepidoptera: Papilionidae) was determined in this study. The start codon for the COI gene in insects has been extensively discussed, and has long remained a matter of some controversy. Herein, we propose that the CGA (arginine) sequence functions as the start codon for the COI gene in lepidopteran insects, on the basis of complete mitogenome sequences of lepidopteran insects, including P. bremeri, as well as additional sequences of the COI start region from a diverse taxonomic range of lepidopteran species (a total of 53 species from 15 families). In our extensive search for a tRNA-like structure in the A+T-rich region, one tRNA(Trp)-like sequence and one tRNA(Leu) (UUR)-like sequence were detected in the P. bremeri A+T-rich region, and one or more tRNA-like structures were detected in the A+T-rich region of the majority of other sequenced lepidopteran insects, thereby indicating that such features occur frequently in the lepidopteran mitogenomes. Phylogenetic analysis using the concatenated 13 amino acid sequences and nucleotide sequences of PCGs of the four macrolepidopteran superfamilies together with the Tortricoidea and Pyraloidea resulted in the successful recovery of a monophyly of Papilionoidea and a monophyly of Bombycoidea. However, the Geometroidea were unexpectedly identified as a sister group of the Bombycoidea, rather than the Papilionoidea.

  7. Complete Nucleotide Sequence and Organization of the Atrazine Catabolic Plasmid pADP-1 from Pseudomonas sp. Strain ADP

    Science.gov (United States)

    Martinez, Betsy; Tomkins, Jeffrey; Wackett, Lawrence P.; Wing, Rod; Sadowsky, Michael J.

    2001-01-01

    The complete 108,845-nucleotide sequence of catabolic plasmid pADP-1 from Pseudomonas sp. strain ADP was determined. Plasmid pADP-1 was previously shown to encode AtzA, AtzB, and AtzC, which catalyze the sequential hydrolytic removal of s-triazine ring substituents from the herbicide atrazine to yield cyanuric acid. Computational analyses indicated that pADP-1 encodes 104 putative open reading frames (ORFs), which are predicted to function in catabolism, transposition, and plasmid maintenance, transfer, and replication. Regions encoding transfer and replication functions of pADP-1 had 80 to 100% amino acid sequence identity to pR751, an IncPβ plasmid previously isolated from Enterobacter aerogenes. pADP-1 was shown to contain a functional mercury resistance operon with 99% identity to Tn5053. Complete copies of transposases with 99% amino acid sequence identity to TnpA from IS1071 and TnpA from Pseudomonas pseudoalcaligenes were identified and flank each of the atzA, atzB, and atzC genes, forming structures resembling nested catabolic transposons. Functional analyses identified three new catabolic genes, atzD, atzE, and atzF, which participate in atrazine catabolism. Crude extracts from Escherichia coli expressing AtzD hydrolyzed cyanuric acid to biuret. AtzD showed 58% amino acid sequence identity to TrzD, a cyanuric acid amidohydrolase, from Pseudomonas sp. strain NRRLB-12227. Two other genes encoding the further catabolism of cyanuric acid, atzE and atzF, reside in a contiguous cluster adjacent to a potential LysR-type transcriptional regulator. E. coli strains bearing atzE and atzF were shown to encode a biuret hydrolase and allophanate hydrolase, respectively. atzDEF are cotranscribed. AtzE and AtzF are members of a common amidase protein family. These data reveal the complete structure of a catabolic plasmid and show that the atrazine catabolic genes are dispersed on three disparate regions of the plasmid. These results begin to provide insight into how

  8. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  9. Complete nucleotide sequence of a functional HLA-DP beta gene and the region between the DP beta 1 and DP alpha 1 genes: comparison of the 5' ends of HLA class II genes.

    OpenAIRE

    Kelly, A; Trowsdale, J

    1985-01-01

    The complete nucleotide sequence of an HLA-DP beta 1 gene and part of the adjacent DP alpha 1 gene, up to and including the signal sequence exon, were determined. The sequence of the DP beta 1 gene identified it as the DPw4 allele. The six exons of the DP beta 1 gene spanned over 11,000 bp of sequence. The arrangement of the gene was broadly analogous to genes of other class II beta chains. The beta 1 exon was flanked by introns of over 4 kb. Comparisons with published sequences of cDNA clone...

  10. CLONING AND SEQUENCING OF PSEUDOMONAS GENES DETERMINING SODIUM DODECYL-SULFATE BIODEGRADATION

    NARCIS (Netherlands)

    DAVISON, J; BRUNEL, F; PHANOPOULOS, A; PROZZI, D; TERPSTRA, P

    1992-01-01

    The nucleotide sequences of two genes involved in sodium dodecyl sulfate (SDS) degradation, by Pseudomonas, have been determined. One of these, sdsA, codes for an alkyl sulfatase (58 957 Da) and has similarity (31.8% identity over a 201-amino acid stretch) to the N terminus of a predicted protein of

  11. Full-length genomic sequence analysis of new subtype 3k hepatitis E virus isolates with 99.97% nucleotide identity obtained from two consecutive acute hepatitis patients in a city in northeast Japan.

    Science.gov (United States)

    Miura, Masahito; Inoue, Jun; Tsuruoka, Mio; Nishizawa, Tsutomu; Nagashima, Shigeo; Takahashi, Masaharu; Shimosegawa, Tooru; Okamoto, Hiroaki

    2017-06-01

    Full-length genomic sequences of hepatitis E virus (HEV) obtained from two consecutive cases of acute self-limiting hepatitis E in a city in northeast Japan were determined. Interestingly, two HEV isolates from each patient shared nucleotide identity of 99.97% in 7 225 nucleotides, and a phylogenetic analysis showed that they formed a cluster of Japanese isolates that is considered as a new HEV subtype 3k. The high similarity of HEV sequences of two isolates from these patients in this study suggested that a subtype 3k HEV strain had spread via a commonly distributed food in the city, possibly pig liver. © 2016 Wiley Periodicals, Inc.

  12. Ab initio electron propagator calculations of transverse conduction through DNA nucleotide bases in 1-nm nanopore corroborate third generation sequencing.

    Science.gov (United States)

    Kletsov, Aleksey A; Glukhovskoy, Evgeny G; Chumakov, Aleksey S; Ortiz, Joseph V

    2016-01-01

    The conduction properties of DNA molecule, particularly its transverse conductance (electron transfer through nucleotide bridges), represent a point of interest for DNA chemistry community, especially for DNA sequencing. However, there is no fully developed first-principles theory for molecular conductance and current that allows one to analyze the transverse flow of electrical charge through a nucleotide base. We theoretically investigate the transverse electron transport through all four DNA nucleotide bases by implementing an unbiased ab initio theoretical approach, namely, the electron propagator theory. The electrical conductance and current through DNA nucleobases (guanine [G], cytosine [C], adenine [A] and thymine [T]) inserted into a model 1-nm Ag-Ag nanogap are calculated. The magnitudes of the calculated conductance and current are ordered in the following hierarchies: gA>gG>gC>gT and IG>IA>IT>IC correspondingly. The new distinguishing parameter for the nucleobase identification is proposed, namely, the onset bias magnitude. Nucleobases exhibit the following hierarchy with respect to this parameter: Vonset(A)DNA translocation through an electrode-equipped nanopore. The results represent interest for the theorists and practitioners in the field of third generation sequencing techniques as well as in the field of DNA chemistry. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Melon Transcriptome Characterization: Simple Sequence Repeats and Single Nucleotide Polymorphisms Discovery for High Throughput Genotyping across the Species

    Directory of Open Access Journals (Sweden)

    José Miguel Blanca

    2011-07-01

    Full Text Available Melon ( L. ranks among the highest-valued fruit crops worldwide. Some genomic tools are available for this crop, including a Sanger transcriptome. We report the generation of 689,054 high-quality expressed sequence tags (ESTs from two 454 sequencing runs, using normalized and nonnormalized complementary DNA (cDNA libraries prepared from four genotypes belonging to the two subspecies and the main commercial types. 454 ESTs were combined with the Sanger available ESTs and de novo assembled into 53,252 unigenes. Over 63% of the unigenes were functionally annotated with Gene Ontology (GO terms and 21% had known orthologs of (L. Heynh. Annotation distribution followed similar tendencies than that reported for , suggesting that the dataset represents a fairly complete melon transcriptome. Furthermore, we identified a set of 3298 unigenes with microsatellite motifs and 14,417 sequences with single nucleotide variants of which 11,655 single nucleotide polymorphism met criteria for use with high-throughput genotyping platforms, and 453 could be detected as cleaved amplified polymorphic sequence (CAPS. A set of markers were validated, 90% of them being polymorphic in a number of variable accessions. This transcriptome provides an invaluable new tool for biological research, more so when it includes transcripts not described previously. It is being used for genome annotation and has provided a large collection of markers that will allow speeding up the process of breeding new melon varieties.

  14. Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

    International Nuclear Information System (INIS)

    Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

    1998-01-01

    To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

  15. Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.

    Directory of Open Access Journals (Sweden)

    Peter Norberg

    Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

  16. Assessment of the labelling accuracy of spanish semipreserved anchovies products by FINS (forensically informative nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Amaya Velasco

    2016-06-01

    Full Text Available Anchovies have been traditionally captured and processed for human consumption for millennia. In the case of Spain, ripened and salted anchovies are a delicacy, which, in some cases, can reach high commercial values. Although there have been a number of studies presenting DNA methodologies for the identification of anchovies, this is one of the first studies investigating the level of mislabelling in this kind of products in Europe. Sixty-three commercial semipreserved anchovy products were collected in different types of food markets in four Spanish cities to check labelling accuracy. Species determination in these commercial products was performed by sequencing two different cyt-b mitochondrial DNA fragments. Results revealed mislabelling levels higher than 15%, what authors consider relatively high considering the importance of the product. The most frequent substitute species was the Argentine anchovy, Engraulis anchoita, which can be interpreted as an economic fraud.

  17. Assessment of the labelling accuracy of spanish semipreserved anchovies products by FINS (forensically informative nucleotide sequencing).

    Science.gov (United States)

    Velasco, Amaya; Aldrey, Anxela; Pérez-Martín, Ricardo I; Sotelo, Carmen G

    2016-06-01

    Anchovies have been traditionally captured and processed for human consumption for millennia. In the case of Spain, ripened and salted anchovies are a delicacy, which, in some cases, can reach high commercial values. Although there have been a number of studies presenting DNA methodologies for the identification of anchovies, this is one of the first studies investigating the level of mislabelling in this kind of products in Europe. Sixty-three commercial semipreserved anchovy products were collected in different types of food markets in four Spanish cities to check labelling accuracy. Species determination in these commercial products was performed by sequencing two different cyt-b mitochondrial DNA fragments. Results revealed mislabelling levels higher than 15%, what authors consider relatively high considering the importance of the product. The most frequent substitute species was the Argentine anchovy, Engraulis anchoita, which can be interpreted as an economic fraud.

  18. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  19. The nucleotide sequence of metallothioneins (MT) in liver of the Kafue lechwe (Kobus leche kafuensis) and their potential as biomarkers of heavy metal pollution of the Kafue River.

    Science.gov (United States)

    M'kandawire, Ethel; Syakalima, Michelo; Muzandu, Kaampwe; Pandey, Girja; Simuunza, Martin; Nakayama, Shouta M M; Kawai, Yusuke K; Ikenaka, Yoshinori; Ishizuka, Mayumi

    2012-09-15

    The study determined heavy metal concentrations and MT1 nucleotide sequence [phylogeny] in liver of the Kafue lechwe. Applicability of MT1 as a biomarker of pollution was assessed. cDNA-encoding sequences for lechwe MT1 were amplified by RT-PCR to characterize the sequence of MT1 which was subjected to BLAST searching at NCBI. Phylogenetic relationships were based on pairwise matrix of sequence divergences calculated by Clustal W. Phylogenetic tree was constructed by NJ method using PHILLIP program. Metals were extracted by acid digestion and concentrations of Cr, Co, Cu, Zn, Cd, Pb, and Ni were determined using an AAS. MT1 mRNA expression levels were measured by quantitative comparative real-time RT-PCR. Lechwe MT1 has a length of 183bp, which encode for MT1 proteins of 61AA, which include 20 cysteines. Nucleotide sequence of lechwe MT1 showed identity with sheep MT (97%) and cattle MT1E (97%). Phylogenetic tree revealed that lechwe MT1 was clustered with sheep MT and cattle MT1E. Cu and Ni concentrations and MT1 mRNA expression levels of lechwe from Blue Lagoon were significantly higher than those from Lochinvar (p<0.05). Concentrations of Cd and Cu, Co and Cu, Co and Pb, Ni and Cu, and Ni and Cr were positively correlated. Spearman's rank correlations also showed positive correlations between Cu and Co concentrations and MT mRNA expression. PCA further suggested that MT mRNA expression was related to Zn and Cd concentrations. Hepatic MT1 mRNA expression in lechwe can be used as biomarker of heavy metal pollution. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. A revised its nucleotide sequence gives a specifity for Smallanthus sonchifolius (Poepp. and Endl. and its products identification

    Directory of Open Access Journals (Sweden)

    Žiarovská Jana

    2013-01-01

    Full Text Available Yacon (Smallanthus sonchifolius is an Andean crop which is very regarded for its benefits for people suffering from diabetes or various digestive or renal disorders. Because no specific Smallanthus sonchifolius identification DNA markers are still known the paper demonstrates ITS regions to be able to detect and differentiate among yacon species and the potential for specific food authentification purposes is reported, too. The newly sequenced ITS of yacon accessions originated in Peru, Ecuador and Bolivia analyse provide the unique sequence site that differs from all of the other yacon species and is recognized by DraIII restriction endonuclease. Restriction cleavadge of the PCR amplified ITSs of the twenty-eight yacon accessions was performed and in all cases the recognition site was confirmed as a typical for Smallanthus sonchifolius . Based on the nucleotide specifity of Smallanthus sonchifolius, ITS sequence the PCR method combined with the restriction clevadge protocol was developed for yacon identification.

  1. Nucleotide sequence of Zygosaccharomyces bailii virus Z: Evidence for +1 programmed ribosomal frameshifting and for assignment to family Amalgaviridae.

    Science.gov (United States)

    Depierreux, Delphine; Vong, Minh; Nibert, Max L

    2016-06-02

    Zygosaccharomyces bailii virus Z (ZbV-Z) is a monosegmented dsRNA virus that infects the yeast Zygosaccharomyces bailii and remains unclassified to date despite its discovery >20years ago. The previously reported nucleotide sequence of ZbV-Z (GenBank AF224490) encompasses two nonoverlapping long ORFs: upstream ORF1 encoding the putative coat protein and downstream ORF2 encoding the RNA-dependent RNA polymerase (RdRp). The lack of overlap between these ORFs raises the question of how the downstream ORF is translated. After examining the previous sequence of ZbV-Z, we predicted that it contains at least one sequencing error to explain the nonoverlapping ORFs, and hence we redetermined the nucleotide sequence of ZbV-Z, derived from the same isolate of Z. bailii as previously studied, to address this prediction. The key finding from our new sequence, which includes several insertions, deletions, and substitutions relative to the previous one, is that ORF2 in fact overlaps ORF1 in the +1 frame. Moreover, a proposed sequence motif for +1 programmed ribosomal frameshifting, previously noted in influenza A viruses, plant amalgaviruses, and others, is also present in the newly identified ORF1-ORF2 overlap region of ZbV-Z. Phylogenetic analyses provided evidence that ZbV-Z represents a distinct taxon most closely related to plant amalgaviruses (genus Amalgavirus, family Amalgaviridae). We conclude that ZbV-Z is the prototype of a new species, which we propose to assign as type species of a new genus of monosegmented dsRNA mycoviruses in family Amalgaviridae. Comparisons involving other unclassified mycoviruses with RdRps apparently related to those of plant amalgaviruses, and having either mono- or bisegmented dsRNA genomes, are also discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

    Data.gov (United States)

    US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

  3. A 1204-single nucleotide polymorphism and insertion-deletion polymorphism panel for massively parallel sequencing analysis of DNA mixtures.

    Science.gov (United States)

    Hwa, Hsiao-Lin; Chung, Wan-Chia; Chen, Pei-Lung; Lin, Chih-Peng; Li, Huei-Ying; Yin, Hsiang-I; Lee, James Chun-I

    2018-01-01

    Massively parallel sequencing (MPS) technology enables the simultaneous analysis of a huge number of single nucleotide polymorphisms (SNPs) and insertion-deletion polymorphisms (indels). MPS also enables the detection of the alleles of minor contributors in a highly unbalanced DNA mixture. In this study, we established a 1204-marker panel optimized for MPS consisting of 987 autosomal markers (964 SNPs and 23 indels), 27 X-chromosome SNPs, 61 Y-chromosome markers (56 SNPs and 5 indels), and 129 mitochondrial SNPs. The DNA samples of six unrelated individuals (two men and four women), 26 nondegraded DNA mixtures (with minor to major ratios of 1:29, 1:39, 1:79, and 1:99), and eight highly artificially degraded DNA mixtures (with minor to major ratios of 1:29, 1:39, 1:79, and 1:99) were analyzed through MPS by using the panel. A scoring system was developed to determine the minor contributors in DNA mixtures based on the genotypes identified using MPS. The genotypes of the 1204 markers were successfully profiled through MPS by using the custom-designed panel. The efficiency of MPS for analyzing these highly degraded samples was lower than that for analyzing nondegraded samples. All minor contributors in the 26 nondegraded and 8 degraded DNA mixtures were accurately assigned using this scoring system based on 964 autosomal SNPs. An association between the observed reads ratio and theoretical ratio of the minor component was noted for nondegraded mixtures. In conclusion, we established a 1204-marker individual identification panel for MPS that successfully analyzed autosomal, X-chromosome, Y-chromosome, and mitochondrial SNPs and indels simultaneously. In combination with the newly developed scoring system, the panel can accurately identify minor contributors in nondegraded and highly degraded DNA mixtures. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Complete nucleotide sequence of Bacillus subtilis (natto) bacteriophage PM1, a phage associated with disruption of food production.

    Science.gov (United States)

    Umene, Kenichi; Shiraishi, Atsushi

    2013-06-01

    "Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.

  5. Nucleotide sequence of medium-chain acyl-CoA dehydrogenase mRNA and its expression in enzyme-deficient human tissue

    Energy Technology Data Exchange (ETDEWEB)

    Kelly, D.P.; Kim, J.J.; Billadello, J.J.; Hainline, B.E.; Chu, T.W.; Strauss, A.W.

    1987-06-01

    Medium-chain acyl-CoA dehydrogenase is one of three similar enzymes that catalyze the initial step of fatty acid ..beta..-oxidation. Definition of the primary structure of MCAD and the tissue distribution of its mRNA is of biochemical and clinical importance because of the recent recognition of inherited MCAD deficiency in humans. The MCAD mRNA nucleotide sequence was determined from two overlapping cDNA clones isolated from human liver and placental cDNA libraries, respectively. The MCAD mRNA includes a 1263-base-pair coding region and a 738-base-pair 3'-nontranslated region. A partial amino acid sequence (137 residues) determined on peptides derived from MCAD purified from porcine liver confirmed the identity of the cDNA clone. Comparison of the amino acid sequence predicted from the human MCAD cDNA with the partial protein sequence of the porcine MCAD revealed a high degree (88%) of interspecies sequence identity. RNA blot analysis shows that MCAD mRNA is expressed in a variety of rat (2.2 kilobases) and human (2.4 kilobases) tissues. Blot hybridization of RNA prepared from cultured skin fibroblasts from a patient with MCAD deficiency disclosed that mRNA was present and of similar size of MCAD mRNA derived from control fibroblasts. The isolation and characterization of MCAD cDNA is an important step in the definition of the defect underlying its metabolic consequences.

  6. Molecular cloning and nucleotide sequence of full-length cDNA for sweet potato catalase mRNA.

    Science.gov (United States)

    Sakajo, S; Nakamura, K; Asahi, T

    1987-06-01

    A nearly full-length cDNA clone for catalase (pCAS01) was obtained through immunological screening of cDNA expression library constructed from size-fractionated poly(A)-rich RNA of wounded sweet potato tuberous roots by Escherichia coli expression vector-primed cDNA synthesis. Two additional catalase cDNA clones (pCAS10 and pCAS13), which contained cDNA inserts slightly longer than that of pCAS01 at their 5'-termini, were identified by colony hybridization of another cDNA library. Those three catalase cDNAs contained primary structures not identical, but closely related, to one another based on their restriction enzyme and RNase cleavage mapping analyses, suggesting that microheterogeneity exists in catalase mRNAs. The cDNA insert of pCAS13 carried the entire catalase coding capacity, since the RNA transcribed in vitro from the cDNA under the SP6 phage promoter directed the synthesis of a catalase polypeptide in the wheat germ in vitro translation assay. The nucleotide sequencing of these catalase cDNAs indicated that 1900-base catalase mRNA contained a coding region of 1476 bases. The amino acid sequence of sweet potato catalase deduced from the nucleotide sequence was 35 amino acids shorter than rat liver catalase [Furuta, S., Hayashi, H., Hijikata, M., Miyazawa, S., Osumi, T. & Hashimoto, T. (1986) Proc. Natl Acad. Sci. USA 83, 313-317]. Although these two sequences showed only 38% homology, the sequences around the amino acid residues implicated in catalytic function, heme ligand or heme contact had been well conserved during evolution.

  7. Nodavirus Coat Protein Imposes Dodecahedral RNA Structure Independent of Nucleotide Sequence and Length†

    Science.gov (United States)

    Tihova, Mariana; Dryden, Kelly A.; Le, Thuc-vy L.; Harvey, Stephen C.; Johnson, John E.; Yeager, Mark; Schneemann, Anette

    2004-01-01

    The nodavirus Flock house virus (FHV) has a bipartite, positive-sense RNA genome that is packaged into an icosahedral particle displaying T=3 symmetry. The high-resolution X-ray structure of FHV has shown that 10 bp of well-ordered, double-stranded RNA are located at each of the 30 twofold axes of the virion, but it is not known which portions of the genome form these duplex regions. The regular distribution of double-stranded RNA in the interior of the virus particle indicates that large regions of the encapsidated genome are engaged in secondary structure interactions. Moreover, the RNA is restricted to a topology that is unlikely to exist during translation or replication. We used electron cryomicroscopy and image reconstruction to determine the structure of four types of FHV particles that differed in RNA and protein content. RNA-capsid interactions were primarily mediated via the N and C termini, which are essential for RNA recognition and particle assembly. A substantial fraction of the packaged nucleic acid, either viral or heterologous, was organized as a dodecahedral cage of duplex RNA. The similarity in tertiary structure suggests that RNA folding is independent of sequence and length. Computational modeling indicated that RNA duplex formation involves both short-range and long-range interactions. We propose that the capsid protein is able to exploit the plasticity of the RNA secondary structures, capturing those that are compatible with the geometry of the dodecahedral cage. PMID:14990708

  8. Effective noninvasive zygosity determination by maternal plasma target region sequencing.

    Directory of Open Access Journals (Sweden)

    Jing Zheng

    Full Text Available BACKGROUND: Currently very few noninvasive molecular genetic approaches are available to determine zygosity for twin pregnancies in clinical laboratories. This study aimed to develop a novel method to determine zygosity by using maternal plasma target region sequencing. METHODS: We constructed a statistic model to calculate the possibility of each zygosity type using likelihood ratios ( Li and empirical dynamic thresholds targeting at 4,524 single nucleotide polymorphisms (SNPs loci on 22 autosomes. Then two dizygotic (DZ twin pregnancies,two monozygotic (MZ twin pregnancies and two singletons were recruited to evaluate the performance of our novel method. Finally we estimated the sensitivity and specificity of the model in silico under different cell-free fetal DNA (cff-DNA concentration and sequence depth. RESULTS/CONCLUSIONS: We obtained 8.90 Gbp sequencing data on average for six clinical samples. Two samples were classified as DZ with L values of 1.891 and 1.554, higher than the dynamic DZ cut-off values of 1.162 and 1.172, respectively. Another two samples were judged as MZ with 0.763 and 0.784 of L values, lower than the MZ cut-off values of 0.903 and 0.918. And the rest two singleton samples were regarded as MZ twins, with L values of 0.639 and 0.757, lower than the MZ cut-off values of 0.921 and 0.799. In silico, the estimated sensitivity of our noninvasive zygosity determination was 99.90% under 10% total cff-DNA concentration with 2 Gbp sequence data. As the cff-DNA concentration increased to 15%, the specificity was as high as 97% with 3.50 Gbp sequence data, much higher than 80% with 10% cff-DNA concentration. SIGNIFICANCE: This study presents the feasibility to noninvasively determine zygosity of twin pregnancy using target region sequencing, and illustrates the sensitivity and specificity under various detecting condition. Our method can act as an alternative approach for zygosity determination of twin pregnancies in clinical

  9. 37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.

    Science.gov (United States)

    2010-07-01

    ... Colombettes; 1211 Geneva 20 Switzerland. Copies may also be inspected at the National Archives and Records... number of SEQ ID NOs, whether followed by a sequence or by the code “000.” (d) Where the description or... identifier, preceded by “SEQ ID NO:” in the text of the description or claims, even if the sequence is also...

  10. Novel nucleotide sequence motifs that produce hotspots of meiotic recombination in Schizosaccharomyces pombe.

    Science.gov (United States)

    Steiner, Walter W; Steiner, Estelle M; Girvin, Angela R; Plewik, Lauren E

    2009-06-01

    In many organisms, including yeasts and humans, meiotic recombination is initiated preferentially at a limited number of sites in the genome referred to as recombination hotspots. Predicting precisely the location of most hotspots has remained elusive. In this study, we tested the hypothesis that hotspots can result from multiple different sequence motifs. We devised a method to rapidly screen many short random oligonucleotide sequences for hotspot activity in the fission yeast Schizosaccharomyces pombe and produced a library of approximately 500 unique 15- and 30-bp sequences containing hotspots. The frequency of hotspots found suggests that there may be a relatively large number of different sequence motifs that produce hotspots. Within our sequence library, we found many shorter 6- to 10-bp motifs that occurred multiple times, many of which produced hotspots when reconstructed in vivo. On the basis of sequence similarity, we were able to group those hotspots into five different sequence families. At least one of the novel hotspots we found appears to be a target for a transcription factor, as it requires that factor for its hotspot activity. We propose that many hotspots in S. pombe, and perhaps other organisms, result from simple sequence motifs, some of which are identified here.

  11. Sequence determination of protected oligodeoxyribonucleotides containing phosphotriester linkages by californium-252 plasma desorption mass spectrometry.

    Science.gov (United States)

    McNeal, C J; Narang, S A; Macfarlane, R D; Hsiung, H M; Brousseau, R

    1980-01-01

    A mass spectrometric method for determining the sequence and molecular weight of protected oligodeoxyribonucleotides is described. By using the method of 252Cf plasma desorption mass spectrometry [Macfarlane, R. D. & Torgerson, D. F. (1976) Science 191, 920--925], positive-ion mass spectra were obtained for a series of protected oligonucleotides extending to a decanucleotide; the spectra were dominated by the presence of the oligonucleotide molecular ion. The negative-ion mass spectra were characterized by a nested set of fragment ions extending from the 3'- or 5'-terminal nucleotide to the opposite terminal nucleotide, thereby identifying the sequence. The utility of this method has been demonstrated by the sequence determination of protected tetra-, penta-, and hexanucleotides synthesized by the improved phosphotriester method. PMID:6928675

  12. Targeted capture enrichment and sequencing identifies extensive nucleotide variation in the turkey MHC-B.

    Science.gov (United States)

    Reed, Kent M; Mendoza, Kristelle M; Settlage, Robert E

    2016-03-01

    Variation in the major histocompatibility complex (MHC) is increasingly associated with disease susceptibility and resistance in avian species of agricultural importance. This variation includes sequence polymorphisms but also structural differences (gene rearrangement) and copy number variation (CNV). The MHC has now been described for multiple galliform species including the best defined assemblies of the chicken (Gallus gallus) and domestic turkey (Meleagris gallopavo). Using this sequence resource, this study applied high-throughput sequencing to investigate MHC variation in turkeys of North America (NA turkeys). An MHC-specific SureSelect (Agilent) capture array was developed, and libraries were created for 14 turkeys representing domestic (commercial bred), heritage breed, and wild turkeys. In addition, a representative of the Ocellated turkey (M. ocellata) and chicken (G. gallus) was included to test cross-species applicability of the capture array allowing for identification of new species-specific polymorphisms. Libraries were hybridized to ∼12 K cRNA baits and the resulting pools were sequenced. On average, 98% of processed reads mapped to the turkey whole genome sequence and 53% to the MHC target. In addition to the MHC, capture hybridization recovered sequences corresponding to other MHC regions. Sequence alignment and de novo assembly indicated the presence of several additional BG genes in the turkey with evidence for CNV. Variant detection identified an average of 2245 polymorphisms per individual for the NA turkeys, 3012 for the Ocellated turkey, and 462 variants in the chicken (RJF-256). This study provides an extensive sequence resource for examining MHC variation and its relation to health of this agriculturally important group of birds.

  13. Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

    Science.gov (United States)

    Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

    2012-10-01

    To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

  14. Integrating multiple genomic data to predict disease-causing nonsynonymous single nucleotide variants in exome sequencing studies.

    Directory of Open Access Journals (Sweden)

    Jiaxin Wu

    2014-03-01

    Full Text Available Exome sequencing has been widely used in detecting pathogenic nonsynonymous single nucleotide variants (SNVs for human inherited diseases. However, traditional statistical genetics methods are ineffective in analyzing exome sequencing data, due to such facts as the large number of sequenced variants, the presence of non-negligible fraction of pathogenic rare variants or de novo mutations, and the limited size of affected and normal populations. Indeed, prevalent applications of exome sequencing have been appealing for an effective computational method for identifying causative nonsynonymous SNVs from a large number of sequenced variants. Here, we propose a bioinformatics approach called SPRING (Snv PRioritization via the INtegration of Genomic data for identifying pathogenic nonsynonymous SNVs for a given query disease. Based on six functional effect scores calculated by existing methods (SIFT, PolyPhen2, LRT, MutationTaster, GERP and PhyloP and five association scores derived from a variety of genomic data sources (gene ontology, protein-protein interactions, protein sequences, protein domain annotations and gene pathway annotations, SPRING calculates the statistical significance that an SNV is causative for a query disease and hence provides a means of prioritizing candidate SNVs. With a series of comprehensive validation experiments, we demonstrate that SPRING is valid for diseases whose genetic bases are either partly known or completely unknown and effective for diseases with a variety of inheritance styles. In applications of our method to real exome sequencing data sets, we show the capability of SPRING in detecting causative de novo mutations for autism, epileptic encephalopathies and intellectual disability. We further provide an online service, the standalone software and genome-wide predictions of causative SNVs for 5,080 diseases at http://bioinfo.au.tsinghua.edu.cn/spring.

  15. Novel technologies applied to the nucleotide sequencing and comparative sequence analysis of the genomes of infectious agents in veterinary medicine.

    Science.gov (United States)

    Granberg, F; Bálint, Á; Belák, S

    2016-04-01

    Next-generation sequencing (NGS), also referred to as deep, high-throughput or massively parallel sequencing, is a powerful new tool that can be used for the complex diagnosis and intensive monitoring of infectious disease in veterinary medicine. NGS technologies are also being increasingly used to study the aetiology, genomics, evolution and epidemiology of infectious disease, as well as host-pathogen interactions and other aspects of infection biology. This review briefly summarises recent progress and achievements in this field by first introducing a range of novel techniques and then presenting examples of NGS applications in veterinary infection biology. Various work steps and processes for sampling and sample preparation, sequence analysis and comparative genomics, and improving the accuracy of genomic prediction are discussed, as are bioinformatics requirements. Examples of sequencing-based applications and comparative genomics in veterinary medicine are then provided. This review is based on novel references selected from the literature and on experiences of the World Organisation for Animal Health (OIE) Collaborating Centre for the Biotechnology-based Diagnosis of Infectious Diseases in Veterinary Medicine, Uppsala, Sweden.

  16. Mason: a JavaScript web site widget for visualizing and comparing annotated features in nucleotide or protein sequences.

    Science.gov (United States)

    Jaschob, Daniel; Davis, Trisha N; Riffle, Michael

    2015-03-07

    Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.

  17. Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

    Science.gov (United States)

    Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

    2008-01-01

    During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

  18. Selection, Recombination and History in a Parasitic Flatworm (Echinococcus Inferred from Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    KL Haag

    1998-09-01

    Full Text Available Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli and four strains of E. granulosus (cattle, horse, pig and sheep strains were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1. The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised

  19. Symbolic complexity for nucleotide sequences: a sign of the genome structure

    International Nuclear Information System (INIS)

    Salgado-García, R; Ugalde, E

    2016-01-01

    We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)

  20. Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

    1997-01-01

    A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

  1. Patterns of nucleotide sequence variation in ICAM1 and TNF genes ...

    Indian Academy of Sciences (India)

    We have studied DNA sequence variation in and around the genes ICAM1 and TNF, which play functional and correlated roles in inflammatory processes and immune cell responses, in 12 diverse ethnic groups of India, with a view to investigating the relative roles of demographic history and natural selection in shaping the ...

  2. Use of whole genome sequencing to determine the microevolution of Mycobacterium tuberculosis during an outbreak.

    Science.gov (United States)

    Kato-Maeda, Midori; Ho, Christine; Passarelli, Ben; Banaei, Niaz; Grinsdale, Jennifer; Flores, Laura; Anderson, Jillian; Murray, Megan; Rose, Graham; Kawamura, L Masae; Pourmand, Nader; Tariq, Muhammad A; Gagneux, Sebastien; Hopewell, Philip C

    2013-01-01

    Current tools available to study the molecular epidemiology of tuberculosis do not provide information about the directionality and sequence of transmission for tuberculosis cases occurring over a short period of time, such as during an outbreak. Recently, whole genome sequencing has been used to study molecular epidemiology of Mycobacterium tuberculosis over short time periods. To describe the microevolution of M. tuberculosis during an outbreak caused by one drug-susceptible strain. METHOD AND MEASUREMENTS: We included 9 patients with tuberculosis diagnosed during a period of 22 months, from a population-based study of the molecular epidemiology in San Francisco. Whole genome sequencing was performed using Illumina's sequencing by synthesis technology. A custom program written in Python was used to determine single nucleotide polymorphisms which were confirmed by PCR product Sanger sequencing. We obtained an average of 95.7% (94.1-96.9%) coverage for each isolate and an average fold read depth of 73 (1 to 250). We found 7 single nucleotide polymorphisms among the 9 isolates. The single nucleotide polymorphisms data confirmed all except one known epidemiological link. The outbreak strain resulted in 5 bacterial variants originating from the index case A1 with 0-2 mutations per transmission event that resulted in a secondary case. Whole genome sequencing analysis from a recent outbreak of tuberculosis enabled us to identify microevolutionary events observable during transmission, to determine 0-2 single nucleotide polymorphisms per transmission event that resulted in a secondary case, and to identify new epidemiologic links in the chain of transmission.

  3. Molecular phylogeny of Vincetoxicum (Apocynaceae-Asclepiadoideae) based on the nucleotide sequences of cpDNA and nrDNA.

    Science.gov (United States)

    Yamashiro, Tadashi; Fukuda, Tatsuya; Yokoyama, Jun; Maki, Masayuki

    2004-05-01

    Molecular phylogenetic analyses of Vincetoxicum and Tylophora (Apocynaceae-Asclepiadoideae) were conducted based on the nucleotide sequences of cpDNA (two intergenic spacers of trnL (UAA)-trnF (GAA) and psbA-trnH and three introns, i.e., atpF, trnG (UCC) and trnL (UAA)), and nrDNA (ITS and ETS regions). Our phylogenetic analysis revealed two monophyletic groups; one consisted of seven taxa of Tylophora and Vincetoxicum inamoenum, Vincetoxicum magnificum and Vincetoxicum macrophyllum (Clade I) and the other consisted of 17 accessions of Vincetoxicum (Clade II). The monophyly of the genus Vincetoxicum was not supported. Although many nucleotide substitutions were observed in Clade I, the genetic differentiation within Clade II was small. Low genetic diversification but considerable morphological divergence suggests that the species in Clade II had undergone rapid diversification. Although most species in Clade I have tiny flowers, those in Clade II have larger and more nectariferous ones. Thus, we hypothesized that the rapid morphological radiation in Clade II may have been due to the gaining of floral characters such as large flowers and large amounts of nectar corresponding to diverse pollinators.

  4. Sequence analysis of selected nucleotide sequences of abortogenic isolate of Equine Herpesvirus 1 and changes caused by serial passage in vitro

    Directory of Open Access Journals (Sweden)

    Dobromila Molinková

    2012-01-01

    Full Text Available The aim of this work was to isolate the abortogenic virus strain of Equine Herpesvirus 1 representing the current infection situation in the Czech Republic, describe it at the molecular level with accent on genes coding viral glycoproteins and observe the changes caused by the passaging of the virus on a cell culture. In 2009, an isolate of equine herpesvirus 1 was obtained from an abortion case in a mare from a herd affected by abortion storm. The virus identification was performed using the PCR method. The virus was isolated on the RK 13 cell line and after 6 passages in vitro the stability of sequences of selected sections of the virus genome was assessed and compared with the original field isolate. The virus sequences were also compared with known sequences of the abortogenic reference virus strain (V592 and with other known viral strains. One point mutation in a nucleotide sequence coding glycoprotein G was found, distinguishing the field isolate from V592. One point mutation in the gene for glycoprotein C was passage-induced. It was noted that the virus during the passage on RK13 cell line in the monitored sections was stable and is a suitable starting material for next experiments.

  5. Comparison of Two Massively Parallel Sequencing Platforms using 83 Single Nucleotide Polymorphisms for Human Identification

    OpenAIRE

    Apaga, Dame Loveliness T.; Dennis, Sheila E.; Salvador, Jazelyn M.; Calacal, Gayvelline C.; De Ungria, Maria Corazon A.

    2017-01-01

    The potential of Massively Parallel Sequencing (MPS) technology to vastly expand the capabilities of human identification led to the emergence of different MPS platforms that use forensically relevant genetic markers. Two of the MPS platforms that are currently available are the MiSeq? FGx? Forensic Genomics System (Illumina) and the HID-Ion Personal Genome Machine (PGM)? (Thermo Fisher Scientific). These are coupled with the ForenSeq? DNA Signature Prep kit (Illumina) and the HID-Ion AmpliSe...

  6. Complete nucleotide sequences and virion particle association of two satellite RNAs of panicum mosaic virus.

    Science.gov (United States)

    Pyle, Jesse D; Monis, Judit; Scholthof, Karen-Beth

    2017-08-15

    Over six decades ago, panicum mosaic virus (PMV) was identified as the first viral pathogen of cultivated switchgrass (Panicum virgatum). Subsequently, PMV was demonstrated to support the replication of both a satellite RNA virus (SPMV) and satellite RNA (satRNA) agents during natural infections of host grasses. In this study, we report the isolation and full-length sequences of two PMV satRNAs identified in 1988 from St. Augustinegrass (Stenotaphrum secundatum) and centipedegrass (Eremochloa ophiuroides) hosts. Each of these satellites have sequence relatedness at their 5'- and 3'-ends. In addition, satC has a region of ∼100 nt complementary to the 3'-end of the PMV genome. These agents are associated with purified virions of SPMV infections. Additionally, satS and satC RNAs contain conserved in-frame open reading frames in the complementary-sense sequences that could potentially generate 6.6- and 7.9-kDa proteins, respectively. In protoplasts and plants satS is infectious, when co-inoculated with the PMV RNA alone or PMV+SPMV RNAs, and negatively affects their accumulation. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Genetic diversity of Argentina tomato varieties revealed by morphological traits, simple sequence repeat, and single nucleotide polymorphism markers

    International Nuclear Information System (INIS)

    Xiaorong, H.U.; Yang, W.

    2012-01-01

    Twenty-six morphological traits as well as 47 single nucleotide polymorphism and simple sequence repeat markers were used to investigate genetic variation in 67 tomato (Solanum lycopersicum L.) varieties collected from Argentina between 1932 and 1974. Approximately 65.0% of the morphological traits and 55.3% of the molecular markers showed polymorphisms in the 67 varieties. Average taxonomic distance between any two varieties ranged from 0.6643 to 1.1776, while Nei's genetic distance varied from 0 to 0.2022. Cluster analysis indicated that 67 varieties could be grouped into three clusters at both morphological and molecular levels. The varieties collected before 1960 had larger genetic variation than those collected after 1960. (author)

  8. Telomeres of the linear chromosomes of Lyme disease spirochaetes: nucleotide sequence and possible exchange with linear plasmid telomeres.

    Science.gov (United States)

    Casjens, S; Murphy, M; DeLange, M; Sampson, L; van Vugt, R; Huang, W M

    1997-11-01

    Bacteria of the spirochaete genus Borrelia have linear chromosomes about 950 kbp in size. We report here that these linear chromosomes have covalently closed hairpin structures at their termini that are similar but not identical to those reported for linear plasmids carried by these organisms. Nucleotide sequence analysis of the chromosomal telomeric regions indicates that unique, apparently functional genes lie within a few hundred bp of each of the telomeres, and that there is an imperfect 26 bp inverted repeat at the two telomeres. In addition, we characterize a major chromosomal length polymorphism within the right telomeric regions of various Borrelia isolates, and show that sequences similar to those near the right telomere are often found on linear plasmids in B. burgdorferi (sensu stricto) isolates from nature. Sequences similar to a number of other regions of the chromosome, including those near the left telomere, were not found on B. burgdorferi plasmids. These observations suggest that there has been historical exchange of genetic information between the linear plasmids and the right end of the linear chromosome.

  9. Nucleotide sequence of atpB, rbcL, trnR, dedB and psaI chloroplast genes from a fern Angiopteris lygodiifolia: a possible emergence of Spermatophyta lineage before the separation of Bryophyta and Pteridophyta.

    Science.gov (United States)

    Yoshinaga, K; Kubota, Y; Ishii, T; Wada, K

    1992-01-01

    To elucidate the evolutionary relationship between the Spermatophyta, Pteridophyta and Bryophyta, we cloned a fragment of chloroplast DNA from the fern Angiopteris lygodiifolia (Pteridophyta) and determined its nucleotide sequence. The fragment contained the atpB, rbcL, trnR-CCG, dedB and psaI genes. Comparisons of the deduced amino acid and nucleotide sequences of these genes from the three plant groups indicate that Angiopteris sequences are more closely related to those of Bryophyta species (85% identity on average) than to those of seed plants (76% identity on average), supporting a hypothesis that the Bryophyta and Pteridophyta diverged more recently from one another than their common progenitor diverged from that of the Spermatophyta.

  10. [Natural nucleotide polymorphism of the Srlk gene that determines salt stress tolerance in alfalfa (Medicago sativa L)].

    Science.gov (United States)

    Vishnevskaia, M S; Pavlov, A V; Dziubenko, E A; Dziubenko, N I; Potokina, E K

    2014-04-01

    Based on legume genome syntheny, the nucleotide sequence of Srlk gene, key role of which in response to salt stress was demonstrated for the model species Medicago truncatula, was identified in the major forage and siderate crop alfalfa (Medicago sativa). In twelve alfalfa samples originating from regions with contrasting growing conditions, 19 SNPs were revealed in the Srlk gene. For two nonsynonymous SNPs, molecular markers were designed that could be further used to analyze the association between Srlk gene nucleotide polymorphism and the variability in salt stress tolerance among alfalfa cultivars.

  11. The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

    International Nuclear Information System (INIS)

    Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

    2003-01-01

    The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

  12. Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

    Science.gov (United States)

    Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

    2003-01-01

    A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

  13. Update on Pneumocystis carinii f. sp. hominis typing based on nucleotide sequence variations in internal transcribed spacer regions of rRNA genes

    DEFF Research Database (Denmark)

    Lee, C H; Helweg-Larsen, J; Tang, X

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from...... the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types...... are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study....

  14. Identification and nucleotide sequence of the thymidine kinase gene of Shope fibroma virus

    International Nuclear Information System (INIS)

    Upton, C.; McFadden, G.

    1986-01-01

    The thymidine kinase (TK) gene of Shope fibroma virus (SFV), a tumorigenic leporipoxvirus, was localized within the viral genome with degenerate oligonucleotide probes. These probes were constructed to two regions of high sequence conservation between the vaccinia virus TK gene and those of several known eucaryotic cellular TK genes, including human, mouse, hamster, and chicken TK genes. The oligonucleotide probes initially localized the SFV TK gene 50 kilobases (kb) from the right terminus of the 160-kb SFV genome within the 9.5-kb BamHI-HindIII fragment E. Fine-mapping analysis indicated that the TK Gene was within a 1.2-kb AvaI-HaeIII fragment, and DNA sequencing of this region revealed an open reading frame capable of encoding a polypeptide of 187 amino acids possessing considerable homology to the TK genes of the vaccinia, variola, and monkeypox orthopoxviruses and also to a variety of cellular TK genes. Homology matrix analysis and homology scores suggest that the SFV TK gene has diverged significantly from its counterpart members in the orthopoxvirus genus. Nevertheless, the presence of conserved upstream open reading frames on the 5' side of all of the poxvirus TK genes indicates a similarity of functional organization between the orthopoxviruses and leporipoxviruses. These data suggest a common ancestral origin for at least some of the unique internal regions of the leporipoxviruses and orthopoxviruses as exemplified by SFV and vaccinia virus, respectively

  15. The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.

    Directory of Open Access Journals (Sweden)

    Fang Lü

    Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.

  16. The gene for indole-3-acetyl-L-aspartic acid hydrolase from Enterobacter agglomerans: molecular cloning, nucleotide sequence, and expression in Escherichia coli.

    Science.gov (United States)

    Chou, J C; Mulbry, W W; Cohen, J D

    1998-08-01

    A 5.5-kb DNA fragment containing the indole-3-acetyl-aspartic acid (IAA-asp) hydrolase gene (iaaspH) was isolated from Enterobacter agglomerans strain GK12 using a hybridization probe based on the N-terminal amino acid sequence of the protein. The DNA sequence of a 2.4-kb region of this fragment was determined and revealed a 1311-nucleotide ORF large enough to encode the 45-kDa IAA-asp hydrolase. A 1.5-kb DNA fragment containing iaaspH was subcloned into the Escherichia coli expression plasmid pTTQ8 to yield plasmid pJCC2. Extracts of IPTG-induced E. coli cultures containing the pJCC2 recombinant plasmid showed IAA-asp hydrolase levels 5 to 10-fold higher than those in E. agglomerans extracts. Homology searches revealed that the IAA-asp hydrolase was similar to a variety of amidohydrolases. In addition, IAA-asp hydrolase showed 70% sequence identity to a putative thermostable carboxypeptidase of E. coli.

  17. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

    2013-01-01

    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu......Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers...... for the European eel using the RAD sequencing approach that was simultaneously identified and scored in a genome-wide scan of 30 individuals. Whereas genomic resources are increasingly becoming available for this species, including the recent release of a draft genome, no genome-wide set of SNP markers...

  18. Nucleotide and protein sequences for dog masticatory tropomyosin identify a novel Tpm4 gene product.

    Science.gov (United States)

    Brundage, Elizabeth A; Biesiadecki, Brandon J; Reiser, Peter J

    2015-10-01

    Jaw-closing muscles of several vertebrate species, including members of Carnivora, express a unique, "masticatory", isoform of myosin heavy chain, along with isoforms of other myofibrillar proteins that are not expressed in most other muscles. It is generally believed that the complement of myofibrillar isoforms in these muscles serves high force generation for capturing live prey, breaking down tough plant material and defensive biting. A unique isoform of tropomyosin (Tpm) was reported to be expressed in cat jaw-closing muscle, based upon two-dimensional gel mobility, peptide mapping, and immunohistochemistry. The objective of this study was to obtain protein and gene sequence information for this unique Tpm isoform. Samples of masseter (a jaw-closing muscle), tibialis (predominantly fast-twitch fibers), and the deep lateral gastrocnemius (predominantly slow-twitch fibers) were obtained from adult dogs. Expressed Tpm isoforms were cloned and sequencing yielded cDNAs that were identical to genomic predicted striated muscle Tpm1.1St(a,b,b,a) (historically referred to as αTpm), Tpm2.2St(a,b,b,a) (βTpm) and Tpm3.12St(a,b,b,a) (γTpm) isoforms (nomenclature reflects predominant tissue expression ("St"-striated muscle) and exon splicing pattern), as well as a novel 284 amino acid isoform observed in jaw-closing muscle that is identical to a genomic predicted product of the Tpm4 gene (δTpm) family. The novel isoform is designated as Tpm4.3St(a,b,b,a). The myofibrillar Tpm isoform expressed in dog masseter exhibits a unique electrophoretic mobility on gels containing 6 M urea, compared to other skeletal Tpm isoforms. To validate that the cloned Tpm4.3 isoform is the Tpm expressed in dog masseter, E. coli-expressed Tpm4.3 was electrophoresed in the presence of urea. Results demonstrate that Tpm4.3 has identical electrophoretic mobility to the unique dog masseter Tpm isoform and is of different mobility from that of muscle Tpm1.1, Tpm2.2 and Tpm3.12 isoforms. We

  19. Nucleotide sequence analysis of NIPBL gene in Indian Cornelia de Lange syndrome cases.

    Science.gov (United States)

    Bajaj, Shailesh; Ranade, Suvidya; Gambhir, Prakash

    2013-01-01

    Cornelia de Lange syndrome (CdLS) is a multisystem developmental disorder in children. The disorder is caused mainly due to mutations in Nipped-B-like protein. The molecular data for CdLS is available from developed countries, but not available in developing countries like India. In the present study, the hotspot region of NIPBL gene was screened by Polymerase Chain Reaction which includes exon 2, 22, 42, and a biggest exon 10, in six CdLS patients and ten controls. The method adopted in present study was amplification of the target exon by using polymerase chain reaction, qualitative confirmation of amplicons by Agarose Gel Electrophoresis and use of amplicons for Conformation Sensitive Gel Electrophoresis to find heteroduplex formation followed by sequencing. We report two polymorphisms in the studied region of gene NIPBL. The polymorphisms are in the region of intron 1 and in exon 10. The polymorphism C/A is present in intron 1 region and polymorphism T/G in exon 10. The intronic region polymorphism may have a role in intron splicing whereas the polymorphism in exon 10 results in amino acid change (Val to Gly). These polymorphisms are disease associated as these are found in CdLS patients only and not in controls.

  20. Comparison of Two Massively Parallel Sequencing Platforms using 83 Single Nucleotide Polymorphisms for Human Identification.

    Science.gov (United States)

    Apaga, Dame Loveliness T; Dennis, Sheila E; Salvador, Jazelyn M; Calacal, Gayvelline C; De Ungria, Maria Corazon A

    2017-03-24

    The potential of Massively Parallel Sequencing (MPS) technology to vastly expand the capabilities of human identification led to the emergence of different MPS platforms that use forensically relevant genetic markers. Two of the MPS platforms that are currently available are the MiSeq ® FGx™ Forensic Genomics System (Illumina) and the HID-Ion Personal Genome Machine (PGM)™ (Thermo Fisher Scientific). These are coupled with the ForenSeq™ DNA Signature Prep kit (Illumina) and the HID-Ion AmpliSeq™ Identity Panel (Thermo Fisher Scientific), respectively. In this study, we compared the genotyping performance of the two MPS systems based on 83 SNP markers that are present in both MPS marker panels. Results show that MiSeq ® FGx™ has greater sample-to-sample variation than the HID-Ion PGM™ in terms of read counts for all the 83 SNP markers. Allele coverage ratio (ACR) values show generally balanced heterozygous reads for both platforms. Two and four SNP markers from the MiSeq ® FGx™ and HID-Ion PGM™, respectively, have average ACR values lower than the recommended value of 0.67. Comparison of genotype calls showed 99.7% concordance between the two platforms.

  1. Nucleotide sequence analyses of the MRP1 gene in four populations suggest negative selection on its coding region

    Directory of Open Access Journals (Sweden)

    Ryan Stephen

    2006-05-01

    Full Text Available Abstract Background The MRP1 gene encodes the 190 kDa multidrug resistance-associated protein 1 (MRP1/ABCC1 and effluxes diverse drugs and xenobiotics. Sequence variations within this gene might account for differences in drug response in different individuals. To facilitate association studies of this gene with diseases and/or drug response, exons and flanking introns of MRP1 were screened for polymorphisms in 142 DNA samples from four different populations. Results Seventy-one polymorphisms, including 60 biallelic single nucleotide polymorphisms (SNPs, ten insertions/deletions (indel and one short tandem repeat (STR were identified. Thirty-four of these polymorphisms have not been previously reported. Interestingly, the STR polymorphism at the 5' untranslated region (5'UTR occurs at high but different frequencies in the different populations. Frequencies of common polymorphisms in our populations were comparable to those of similar populations in HAPMAP or Perlegen. Nucleotide diversity indices indicated that the coding region of MRP1 may have undergone negative selection or recent population expansion. SNPs E10/1299 G>T (R433S and E16/2012 G>T (G671V which occur at low frequency in only one or two of four populations examined were predicted to be functionally deleterious and hence are likely to be under negative selection. Conclusion Through in silico approaches, we identified two rare SNPs that are potentially negatively selected. These SNPs may be useful for studies associating this gene with rare events including adverse drug reactions.

  2. Forensically informative nucleotide sequencing (FINS) for the first time authentication of Indian Varanus species: implication in wildlife forensics and conservation.

    Science.gov (United States)

    Rajpoot, Ankita; Kumar, Ved Prakash; Bahuguna, Archana; Kumar, Dhyanendra

    2017-11-01

    Monitor lizards are Varanus species widely distributed, endangered reptile in the IUCN red data list. In India, based on the morphological and ecological characteristic, it is divided into four species viz. Bengal monitor lizard, Yellow monitor lizard, Desert monitor lizard and Water monitor lizard. These four species listed as Schedule I species in Indian Wildlife (Protection) Act 1972. This paper first attempt to present Forensically Informative Nucleotide Sequencing (FINS) for the Indian Varanus based on three mitochondrial genes. The molecular framework will be useful for the identification of Indian Varanus species and trade products derived from monitors and as such, have important applications for wildlife management and conservation. Here, we used known 14 individual skin pieces of four species of monitor lizards; the partial fragment of three mitochondrial genes (Cyt b, 12S rRNA, and 16S rRNA) were amplified for genetic study. In Cyt b, 12S rRNA and 16s rRNA, we observed, 5, 5 and 4 Haplotypes; 71, 69, and 43 Variables sites; 90, 89, and 50 Parsimony Informative sites within four species of Indian monitor lizards, respectively. Despite it, the nucleotide composition was T 26.4, C 32.8, A 29.2 and G11.6; T 18.8, C 29.7, A 34.0 and G 17.5; T 21.7, C 27.3, A 32.5 and G 18.5 in Cyt b, 12S rRNA and 16S rRNA, respectively. The neighbor joining phylogenetic tree and maximum parsimony tree of three mitochondrial genes, showed similar results and reveal that, there are two major clades are present in Indian monitor lizards.

  3. Neuropeptidergic Signaling in the American Lobster Homarus americanus: New Insights from High-Throughput Nucleotide Sequencing.

    Directory of Open Access Journals (Sweden)

    Andrew E Christie

    Full Text Available Peptides are the largest and most diverse class of molecules used for neurochemical communication, playing key roles in the control of essentially all aspects of physiology and behavior. The American lobster, Homarus americanus, is a crustacean of commercial and biomedical importance; lobster growth and reproduction are under neuropeptidergic control, and portions of the lobster nervous system serve as models for understanding the general principles underlying rhythmic motor behavior (including peptidergic neuromodulation. While a number of neuropeptides have been identified from H. americanus, and the effects of some have been investigated at the cellular/systems levels, little is currently known about the molecular components of neuropeptidergic signaling in the lobster. Here, a H. americanus neural transcriptome was generated and mined for sequences encoding putative peptide precursors and receptors; 35 precursor- and 41 receptor-encoding transcripts were identified. We predicted 194 distinct neuropeptides from the deduced precursor proteins, including members of the adipokinetic hormone-corazonin-like peptide, allatostatin A, allatostatin C, bursicon, CCHamide, corazonin, crustacean cardioactive peptide, crustacean hyperglycemic hormone (CHH, CHH precursor-related peptide, diuretic hormone 31, diuretic hormone 44, eclosion hormone, FLRFamide, GSEFLamide, insulin-like peptide, intocin, leucokinin, myosuppressin, neuroparsin, neuropeptide F, orcokinin, pigment dispersing hormone, proctolin, pyrokinin, SIFamide, sulfakinin and tachykinin-related peptide families. While some of the predicted peptides are known H. americanus isoforms, most are novel identifications, more than doubling the extant lobster neuropeptidome. The deduced receptor proteins are the first descriptions of H. americanus neuropeptide receptors, and include ones for most of the peptide groups mentioned earlier, as well as those for ecdysis-triggering hormone, red pigment

  4. Metric representation of DNA sequences.

    Science.gov (United States)

    Wu, Z B

    2000-07-01

    A metric representation of DNA sequences is borrowed from symbolic dynamics. In view of this method, the pattern seen in the chaos game representation of DNA sequences is explained as the suppression of certain nucleotide strings in the DNA sequences. Frequencies of short nucleotide strings and suppression of the shortest ones in the DNA sequences can be determined by using the metric representation.

  5. Completion of the nucleotide sequence of the central region of Tn5 confirms the presence of three resistance genes.

    OpenAIRE

    Mazodier, P; Cossart, P; Giraud, E; Gasser, F

    1985-01-01

    The DNA sequence of the region located downstream from the kanamycin resistance gene of Tn5 up to the right inverted repeat IS50R has been determined. This completes the determination of the sequence of Tn5 which is 5818 bp long. The 2.7 Kb central region contains three resistance genes: the kanamycin-neomycin resistance gene, a gene coding for resistance to CL990 an antimitotic-antibiotic compound of the bleomycin family and a third gene that confers streptomycin resistance in some bacterial...

  6. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Directory of Open Access Journals (Sweden)

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  7. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  8. A resource of single-nucleotide polymorphisms for rainbow trout generated by restriction-site associated DNA sequencing of doubled haploids

    Science.gov (United States)

    Salmonid genomes are considered to be in a pseudo-tetraploid state as a result of an evolutionarily recent genome duplication event. This situation complicates single nucleotide polymorphism (SNP) discovery in rainbow trout as many putative SNPs are actually paralogous sequence variants (PSVs) and ...

  9. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

    Science.gov (United States)

    Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2014-11-01

    In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

  10. Average nucleotide identity of genome sequences supports the description of Rhizobium lentis sp. nov., Rhizobium bangladeshense sp. nov. and Rhizobium binae sp. nov. from lentil (Lens culinaris) nodules.

    Science.gov (United States)

    Rashid, M Harun-or; Young, J Peter W; Everall, Isobel; Clercx, Pia; Willems, Anne; Santhosh Braun, Markus; Wink, Michael

    2015-09-01

    Rhizobial strains isolated from effective root nodules of field-grown lentil (Lens culinaris) from different parts of Bangladesh were previously analysed using sequences of the 16S rRNA gene, three housekeeping genes (recA, atpD and glnII) and three nodulation genes (nodA, nodC and nodD), DNA fingerprinting and phenotypic characterization. Analysis of housekeeping gene sequences and DNA fingerprints indicated that the strains belonged to three novel clades in the genus Rhizobium. In present study, a representative strain from each clade was further characterized by determination of cellular fatty acid compositions, carbon substrate utilization patterns and DNA-DNA hybridization and average nucleotide identity (ANI) analyses from whole-genome sequences. DNA-DNA hybridization showed 50-62% relatedness to their closest relatives (the type strains of Rhizobium etli and Rhizobium phaseoli) and 50-60% relatedness to each other. These results were further supported by ANI values, based on genome sequencing, which were 87-92% with their close relatives and 88-89% with each other. On the basis of these results, three novel species, Rhizobium lentis sp. nov. (type strain BLR27(T) = LMG 28441(T) = DSM 29286(T)), Rhizobium bangladeshense sp. nov. (type strain BLR175(T) = LMG 28442(T) = DSM 29287(T)) and Rhizobium binae sp. nov. (type strain BLR195(T) = LMG 28443(T) = DSM 29288(T)), are proposed. These species share common nodulation genes (nodA, nodC and nodD) that are similar to those of the symbiovar viciae.

  11. Nucleotide sequence and characterization of toxR: a gene involved in exotoxin A regulation in Pseudomonas aeruginosa.

    Science.gov (United States)

    Wozniak, D J; Cram, D C; Daniels, C J; Galloway, D R

    1987-01-01

    We have previously reported the discovery and subsequent cloning of a regulatory gene, designated toxR, which appears to regulate the expression of the exotoxin A (ETA) structural gene toxA. Subsequent work by this laboratory has resulted in the subcloning of the toxR gene and its transfer to a high copy number plasmid (pGW28). Functional analysis of the toxR gene using a Tn5 insertion along with toxR deletions indicates that inactivation of toxR results in a dramatic reduction of ETA production. Nucleotide sequence analysis of pGW28 has revealed a 675 bp major open reading frame (225 codons) which could encode for a protein of 24,626 daltons. Using S1 nuclease mapping, the toxR RNA transcript has been shown to originate 20 bp upstream of the presumptive translation initiation codon. Experiments using a toxA specific probe have revealed the the toxR gene product appears to regulate the expression of ETA at the transcriptional level. Images PMID:3031589

  12. Empirical Comparison of Simple Sequence Repeats and Single Nucleotide Polymorphisms in Assessment of Maize Diversity and Relatedness

    Science.gov (United States)

    Hamblin, Martha T.; Warburton, Marilyn L.; Buckler, Edward S.

    2007-01-01

    While Simple Sequence Repeats (SSRs) are extremely useful genetic markers, recent advances in technology have produced a shift toward use of single nucleotide polymorphisms (SNPs). The different mutational properties of these two classes of markers result in differences in heterozygosities and allele frequencies that may have implications for their use in assessing relatedness and evaluation of genetic diversity. We compared analyses based on 89 SSRs (primarily dinucleotide repeats) to analyses based on 847 SNPs in individuals from the same 259 inbred maize lines, which had been chosen to represent the diversity available among current and historic lines used in breeding. The SSRs performed better at clustering germplasm into populations than did a set of 847 SNPs or 554 SNP haplotypes, and SSRs provided more resolution in measuring genetic distance based on allele-sharing. Except for closely related pairs of individuals, measures of distance based on SSRs were only weakly correlated with measures of distance based on SNPs. Our results suggest that 1) large numbers of SNP loci will be required to replace highly polymorphic SSRs in studies of diversity and relatedness and 2) relatedness among highly-diverged maize lines is difficult to measure accurately regardless of the marker system. PMID:18159250

  13. Genetic differentiation between fake abalone and genuine Haliotis species using the forensically informative nucleotide sequencing (FINS) method.

    Science.gov (United States)

    Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S

    2011-05-25

    Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.

  14. Nucleotide sequence analysis of a human monoclonal antibody TONO-1 with cytotoxic potential for T-leukemia/lymphoma cells.

    Science.gov (United States)

    Numasaki, M; Nakamura, K; Fukuoka, Y; Saeki, H; Hanai, N; Kudo, T

    2001-01-15

    A human monoclonal antibody (HuMab) TONO-1 (IgM, lambda) recognizes cell surface antigens associated primarily with human T-leukemia/lymphoma cells. In this study, we investigated the reactivity against T-leukemia/lymphoma cells in detail, cytotoxic potential and primary nucleotide and deduced amino acid sequences of the rearranged heavy and light chains of the HuMab TONO-1. Expression of the molecules (TONO-1 Ags) detected by a HuMab TONO-1 was significantly heterogeneous even in the same T-leukemia/lymphoma cell lines HPB-MLT and MOLT-4F. The flow cytometric curves showed an unusual broad-based spread of fluorescence intensity. HuMab TONO-1 was shown to have the ability to kill the T-leukernia/lymphoma cells efficiently in the presence of rabbit complements. However, HuMab TONO-1 did not demonstrate significant antibody-dependent cellular cytotoxic activity. Furthermore, HuMab TONO-1 heavy and light chain variable regions were cloned, sequenced and analyzed. HuMab TONO-1 uses a V(H) gene member of the V(H)IV gene family V(H)71-4, and is productively rearranged with the germ line D(H) gene D(XP')1, and the germ line J(H)5 gene with multiple somatic mutations. HuMab TONO-1 Vlambda belongs to the lambda light chain variable subgroup I family and is derived from the Vlambdalc germ line gene Humlv1042, and germ line gene Jlambda1 without somatic mutations. The results reveal that the production of HuMab TONO-1, with cytotoxic potential for human T-leukemia/lymphoma cells, is achieved by rearrangement of the V(H)71-4/Humlv1042 germ line variable region gene combination, that is associated with the autoimmune repertoire.

  15. Analysis of mitochondrial control region nucleotide sequences from Baffin Bay beluga, (Delphinapterus leucas: detecting pods or sub-populations?

    Directory of Open Access Journals (Sweden)

    Per Jakob Palsbøll

    2002-07-01

    Full Text Available We report the results of an analysis of the variation in the nucleotide sequence of the mitochondrial control region obtained in 218 samples collected from belugas, Delphinapterus leucas, around the Baffin Bay. We detected multiple instances of significant heterogeneity in the distribution of genetic variation among the analyzed mitochondrial control region sequences on a spatial as well as temporal scale indicating a high degree of maternal population structure. The detection of significant levels of heterogeneity between samples collected in different years but within the same area and season was unexpected. Re-examination of earlier results presented by Brown Gladden and coworkers also revealed temporal genetic heterogeneity within the one area where sufficient (n>15 samples were collected in multiple years. These findings suggest that non-random breeding and maternally directed site-fidelity are not the sole causes of genetic heterogeneity among belugas but that a matrilineal pod structure might cause significant levels of genetic heterogeneity as well, even within the same area. We propose that a maternal pod structure, which has been shown to be the cause of significant genetic heterogeneity in other odontocetes, may add to the overall level of heterogeneity in the maternally inherited DNA and hence that much of the spatial heterogeneity observed in this and previous studies might be attributed to pod rather than population structure. Our findings suggest that it is important to estimate the contribution of pod structure to overall heterogeneity before defining populations or management units in order to avoid interpreting heterogeneity due to sampling of different pods as different populations/management units.

  16. Nucleotide sequence of an external transcribed spacer in Xenopus laevis rDNA: sequences flanking the 5' and 3' ends of 18S rRNA are non-complementary.

    OpenAIRE

    Maden, B E; Moss, M; Salim, M

    1982-01-01

    We have sequenced the external transcribed spacer (ETS) of a ribosomal transcription unit from Xenopus laevis, together with sections of the preceding non-transcribed spacer. Our analysis was carried out on the same cloned transcription unit as that from which the internal transcribed spacers (ITS) were previously sequenced. The ETS is approximately 712 nucleotides long and, like the ITS regions, is generally very rich in C plus G. Features of the sequence include an excess of oligo-C tracts ...

  17. A Comprehensive Experiment for Molecular Biology: Determination of Single Nucleotide Polymorphism in Human REV3 Gene Using PCR-RFLP

    Science.gov (United States)

    Zhang, Xu; Shao, Meng; Gao, Lu; Zhao, Yuanyuan; Sun, Zixuan; Zhou, Liping; Yan, Yongmin; Shao, Qixiang; Xu, Wenrong; Qian, Hui

    2017-01-01

    Laboratory exercise is helpful for medical students to understand the basic principles of molecular biology and to learn about the practical applications of molecular biology. We have designed a lab course on molecular biology about the determination of single nucleotide polymorphism (SNP) in human REV3 gene, the product of which is a subunit of…

  18. The mitochondrial genome sequence of the ciliate Paramecium caudatum reveals a shift in nucleotide composition and codon usage within the genus Paramecium

    Directory of Open Access Journals (Sweden)

    Berendonk Thomas U

    2011-05-01

    Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino

  19. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  20. Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

    Science.gov (United States)

    Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

    2014-11-01

    Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  1. Regulation of nif gene expression in Enterobacter agglomerans: nucleotide sequence of the nifLA operon and influence of temperature and ammonium on its transcription.

    Science.gov (United States)

    Siddavattam, D; Steibl, H D; Kreutzer, R; Klingmüller, W

    1995-12-20

    The nucleotide sequence of a plasmid-borne 3.9 kb XhoI-SmaI fragment comprising the 3'-region of the nifM gene, the nifL and nifA genes and the 5'-region of nifB gene of Enterobacter agglomerans was determined. The genes were identified by their homology to the corresponding nif genes of Klebsiella pneumoniae. A typical sigma 54-dependent promoter and a consensus NtrC-binding motif were identified upstream of nifL. The predicted amino acid sequence of NifL showed close similarities to NifL of K. pneumoniae and Azotobacter vinelandii. However, no histidine residue was found to correspond to histidine-304 of A. vinelandii NifL, which had been proposed to be required for the repressor activity of NifL. The NifA sequence with a putative DNA binding motif (Q(x3) A(x3) G(x5)I) and an ATP binding site in the C-terminal and central domains, respectively, resembles that of other known NifA proteins. The function of the nifL and nifA genes was demonstrated in vivo using a binary plasmid system by their ability to activate a nifH promoter-lacZ fusion at different temperatures and concentrations of NH4+. Maximal promoter activity occurred at 25 degrees C, and it appears that the sensitivity of NifA to elevated temperatures is independent of NifL. The expression of nifL inhibited promoter activity in the presence of NifA when the initial NH4+ concentration in the medium exceeded 4 mM.

  2. Protein structure determination using metagenome sequence data.

    Science.gov (United States)

    Ovchinnikov, Sergey; Park, Hahnbeom; Varghese, Neha; Huang, Po-Ssu; Pavlopoulos, Georgios A; Kim, David E; Kamisetty, Hetunandan; Kyrpides, Nikos C; Baker, David

    2017-01-20

    Despite decades of work by structural biologists, there are still ~5200 protein families with unknown structure outside the range of comparative modeling. We show that Rosetta structure prediction guided by residue-residue contacts inferred from evolutionary information can accurately model proteins that belong to large families and that metagenome sequence data more than triple the number of protein families with sufficient sequences for accurate modeling. We then integrate metagenome data, contact-based structure matching, and Rosetta structure calculations to generate models for 614 protein families with currently unknown structures; 206 are membrane proteins and 137 have folds not represented in the Protein Data Bank. This approach provides the representative models for large protein families originally envisioned as the goal of the Protein Structure Initiative at a fraction of the cost. Copyright © 2017, American Association for the Advancement of Science.

  3. Insertion sequence element single nucleotide polymorphism typing provides insights into the population structure and evolution of Mycobacterium ulcerans across Africa.

    Science.gov (United States)

    Vandelannoote, Koen; Jordaens, Kurt; Bomans, Pieter; Leirs, Herwig; Durnez, Lies; Affolabi, Dissou; Sopoh, Ghislain; Aguiar, Julia; Phanzu, Delphin Mavinga; Kibadi, Kapay; Eyangoh, Sara; Manou, Louis Bayonne; Phillips, Richard Odame; Adjei, Ohene; Ablordey, Anthony; Rigouts, Leen; Portaels, Françoise; Eddyani, Miriam; de Jong, Bouke C

    2014-02-01

    Buruli ulcer is an indolent, slowly progressing necrotizing disease of the skin caused by infection with Mycobacterium ulcerans. In the present study, we applied a redesigned technique to a vast panel of M. ulcerans disease isolates and clinical samples originating from multiple African disease foci in order to (i) gain fundamental insights into the population structure and evolutionary history of the pathogen and (ii) disentangle the phylogeographic relationships within the genetically conserved cluster of African M. ulcerans. Our analyses identified 23 different African insertion sequence element single nucleotide polymorphism (ISE-SNP) types that dominate in different areas where Buruli ulcer is endemic. These ISE-SNP types appear to be the initial stages of clonal diversification from a common, possibly ancestral ISE-SNP type. ISE-SNP types were found unevenly distributed over the greater West African hydrological drainage basins. Our findings suggest that geographical barriers bordering the basins to some extent prevented bacterial gene flow between basins and that this resulted in independent focal transmission clusters associated with the hydrological drainage areas. Different phylogenetic methods yielded two well-supported sister clades within the African ISE-SNP types. The ISE-SNP types from the "pan-African clade" were found to be widespread throughout Africa, while the ISE-SNP types of the "Gabonese/Cameroonian clade" were much rarer and found in a more restricted area, which suggested that the latter clade evolved more recently. Additionally, the Gabonese/Cameroonian clade was found to form a strongly supported monophyletic group with Papua New Guinean ISE-SNP type 8, which is unrelated to other Southeast Asian ISE-SNP types.

  4. Single nucleotide polymorphism discovery in cutthroat trout subspecies using genome reduction, barcoding, and 454 pyro-sequencing

    Directory of Open Access Journals (Sweden)

    Houston Derek D

    2012-12-01

    Full Text Available Abstract Background Salmonids are popular sport fishes, and as such have been subjected to widespread stocking throughout western North America. Historically, stocking was done with little regard for genetic variation among populations and has resulted in genetic mixing among species and subspecies in many areas, thus putting the genetic integrity of native salmonid populations at risk and creating a need to assess the genetic constitution of native salmonid populations. Cutthroat trout is a salmonid species with pronounced geographic structure (there are 10 extant subspecies and a recent history of hybridization with introduced rainbow trout in many populations. Genetic admixture has also occurred among cutthroat trout subspecies in areas where introductions have brought two or more subspecies into contact. Consequently, management agencies have increased their efforts to evaluate the genetic composition of cutthroat trout populations to identify populations that remain uncompromised and manage them accordingly, but additional genetic markers are needed to do so effectively. Here we used genome reduction, MID-barcoding, and 454-pyrosequencing to discover single nucleotide polymorphisms that differentiate cutthroat trout subspecies and can be used as a rapid, cost-effective method to characterize the genetic composition of cutthroat trout populations. Results Thirty cutthroat and six rainbow trout individuals were subjected to genome reduction and next-generation sequencing. A total of 1,499,670 reads averaging 379 base pairs in length were generated by 454-pyrosequencing, resulting in 569,060,077 total base pairs sequenced. A total of 43,558 putative SNPs were identified, and of those, 125 SNP primers were developed that successfully amplified 96 cutthroat trout and rainbow trout individuals. These SNP loci were able to differentiate most cutthroat trout subspecies using distance methods and Structure analyses. Conclusions Genomic and

  5. The Entire Nucleotide Sequence of Friend-Related and Paralysis-Inducing PVC-441 Murine Leukemia Virus (MuLV) and Its Comparison with Those of PVC-211 MuLV and Friend MuLV

    OpenAIRE

    Tanaka, Atsushi; Oka, Kiyomasa; Tanaka, Keiji; Jinno, Atsushi; Ruscetti, Sandra K.; Kai, Kazushige

    1998-01-01

    PVC-441 murine leukemia virus (MuLV) is a member of the PVC group of Friend MuLV (F-MuLV)-derived neuropathogenic retroviruses. In order to determine the molecular basis for the difference in neuropathogenicity between PVC-441 and the previously characterized PVC-211 MuLVs, the entire nucleotide sequence of PVC-441 MuLV was determined and compared with those of PVC-211 and F-MuLV. The results suggest that PVC-441 and PVC-211 MuLVs were formed as a result of random mutations of F-MuLV and deve...

  6. The use of next-generation sequencing for the determination of rare blood group genotypes

    DEFF Research Database (Denmark)

    Jakobsen, M. A.; Dellgren, C.; Sheppard, C.

    2018-01-01

    Objectives: Next-generation sequencing (NGS) for the determination of rare blood group genotypes was tested in 72 individuals from different ethnicities. Background: Traditional serological-based antigen detection methods, as well as genotyping based on specific single nucleotide polymorphisms...... (SNPs) or single nucleotide variants (SNVs), are limited to detecting only a limited number of known antigens or alleles. NGS methods do not have this limitation. Methods: NGS using Ion torrent Personal Genome Machine (PGM) was performed with a customised Ampliseq panel targeting 15 different blood...... genotypes using commercial SNP assays. However, particularly for the Kidd, Duffy and Lutheran blood group systems, several SNVs were detected by the NGS assay that revealed additional coding information compared to other methods. Furthermore, the NGS assay allowed for the detection of genotypes related...

  7. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek

    2015-01-01

    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  8. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  9. Complete nucleotide sequence of a plasmid containing the botulinum neurotoxin gene in Clostridium botulinum type B strain 111 isolated from an infant patient in Japan.

    Science.gov (United States)

    Hosomi, Koji; Sakaguchi, Yoshihiko; Kohda, Tomoko; Gotoh, Kazuyoshi; Motooka, Daisuke; Nakamura, Shota; Umeda, Kaoru; Iida, Tetsuya; Kozaki, Shunji; Mukamoto, Masafumi

    2014-12-01

    Botulinum neurotoxins (BoNTs) are highly potent toxins that are produced by Clostridium botulinum. We determined the complete nucleotide sequence of a plasmid containing the botulinum neurotoxin gene in C. botulinum type B strain 111 in order to obtain an insight into the toxigenicity and evolution of the bont gene in C. botulinum. Group I C. botulinum type B strain 111 was isolated from the first case of infant botulism in Japan in 1995. In previous studies, botulinum neurotoxin subtype B2 (BoNT/B2) produced by strain 111 exhibited different antigenic properties from those of authentic BoNT/B1 produced by strain Okra. We have recently shown that the isolates of strain 111 that lost toxigenicity were cured of the plasmid containing the bont/B2 gene. In the present study, the plasmid (named pCB111) was circular 265,575 bp double-stranded DNA and contained 332 predicted open reading frames (ORFs). 85 gene products of these ORFs could be functionally assigned on the basis of sequence homology to known proteins. The bont/B2 complex genes were located on pCB111 and some gene products may be involved in the conjugative plasmid transfer and horizontal transfer of bont genes. pCB111 was similar to previously identified plasmids containing bont/B1, /B5, or/A3 complex genes in other group I C. botulinum strains. It was suggested that these plasmids had been derived from a common ancestor and had played important roles for the bont gene transfer between C. botulinum.

  10. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds

    OpenAIRE

    Stafuzza, Nedenia Bonvino; Zerlotini, Adhemar; Lobo, Francisco Pereira; Yamagishi, Michel Eduardo Beleza; Chud, Tatiane Cristina Seleguim; Caetano, Alexandre Rodrigues; Munari, Dan?sio Prado; Garrick, Dorian J.; Machado, Marco Antonio; Martins, Marta Fonseca; Carvalho, Maria Raquel; Cole, John Bruce; Barbosa da Silva, Marcos Vinicius Gualberto

    2017-01-01

    Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose), Gyr, Girolando and Holstein (dairy production). A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs) and 3,828,041 insertions/deletions (InDels) were detected in the samples, of whi...

  11. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Importance of purine and pyrimidine content of local nucleotide sequences (six bases long) for evolution of the human immunodeficiency virus type 1.

    Science.gov (United States)

    Doi, H

    1991-10-15

    Human immunodeficiency virus type 1 evolves rapidly, and random base change is thought to act as a major factor in this evolution. However, segments of the viral genome differ in their variability: there is the highly variable env gene, particularly hypervariable regions located within env, and, in contrast, the conservative gag and pol genes. Computer analysis of the nucleotide sequences of human immunodeficiency virus type 1 isolates reveals that base substitution in this virus is nonrandom and affected by local nucleotide sequences. Certain local sequences 6 base pairs long are excessively frequent in the hypervariable regions. These sequences exhibit base-substitution hotspots at specific positions in their 6 bases. The hotspots tend to be nonsilent letters of codons in the hypervariable regions--thus leading to marked amino acid substitutions there. Conversely, in the conservative gag and pol genes the hotspots tend to be silent letters because of a difference in codon frame from the hypervariable regions. Furthermore, base substitutions in the local sequences that frequently appear in the conservative genes occurred at a low level, even within the variable env. Thus, despite the high variability of this virus, the conservative genes and their products could be conserved. These may be some of the strategies evolved in human immunodeficiency virus type 1 to allow for positive-selection pressures, such as the host immune system, and negative-selection pressures on the conservative gene products.

  13. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Liu, Siyang; Huang, Shujia; Rao, Junhua

    2015-01-01

    present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

  14. Complete nucleotide sequence of the Coturnix chinensis (blue-breasted quail) mitochondrial genome and a phylogenetic analysis with related species.

    Science.gov (United States)

    Nishibori, M; Tsudzuki, M; Hayashi, T; Yamamoto, Y; Yasue, H

    2002-01-01

    Coturnix chinensis (blue-breasted quail) has been classically grouped in Galliformes Phasianidae Coturnix, based on morphologic features and biochemical evidence. Since the blue-breasted quail has the smallest body size among the species of Galliformes, in addition to a short generation time and an excellent reproductive performance, it is a possible model fowl for breeding and physiological studies of the Coturnix japonica (Japanese quail) and Gallus gallus domesticus (chicken), which are classified in the same family as blue-breasted quail. However, since its phylogenetic position in the family Phasianidae has not been determined conclusively, the sequence of the entire blue-breasted quail mitochondria (mt) genome was obtained to provide genetic information for phylogenetic analysis in the present study. The blue-breasted quail mtDNA was found to be a circular DNA of 16,687 base pairs (bp) with the same genomic structure as the mtDNAs of Japanese quail and chicken, though it is smaller than Japanese quail and chicken mtDNAs by 10 bp and 88 bp, respectively. The sequence identity of all mitochondrial genes, including those for 12S and 16S ribosomal RNAs, between blue-breasted quail and Japanese quail ranged from 84.5% to 93.5%; between blue-breasted quail and chicken, sequence identity ranged from 78.0% to 89.6%. In order to obtain information on the phylogenetic position of blue-breasted quail in Galliformes Phasianidae, the 2,184 bp sequence comprising NADH dehydrogenase subunit 2 and cytochrome b genes available for eight species in Galliformes [Japanese quail, chicken, Gallus varius (green junglefowl), Bambusicola thoracica (Chinese bamboo partridge), Pavo cristatus (Indian peafowl), Perdix perdix (gray partridge), Phasianus colchicus (ring-neck pheasant), and Tympanchus phasianellus (sharp-tailed grouse)] together with that of Aythya americana (redhead) were examined using a maximum likelihood (ML) method. The ML analyses on the first/second codon positions

  15. Protein and DNA sequence determinants of thermophilic adaptation.

    Directory of Open Access Journals (Sweden)

    Konstantin B Zeldovich

    2007-01-01

    Full Text Available There have been considerable attempts in the past to relate phenotypic trait--habitat temperature of organisms--to their genotypes, most importantly compositions of their genomes and proteomes. However, despite accumulation of anecdotal evidence, an exact and conclusive relationship between the former and the latter has been elusive. We present an exhaustive study of the relationship between amino acid composition of proteomes, nucleotide composition of DNA, and optimal growth temperature (OGT of prokaryotes. Based on 204 complete proteomes of archaea and bacteria spanning the temperature range from -10 degrees C to 110 degrees C, we performed an exhaustive enumeration of all possible sets of amino acids and found a set of amino acids whose total fraction in a proteome is correlated, to a remarkable extent, with the OGT. The universal set is Ile, Val, Tyr, Trp, Arg, Glu, Leu (IVYWREL, and the correlation coefficient is as high as 0.93. We also found that the G + C content in 204 complete genomes does not exhibit a significant correlation with OGT (R = -0.10. On the other hand, the fraction of A + G in coding DNA is correlated with temperature, to a considerable extent, due to codon patterns of IVYWREL amino acids. Further, we found strong and independent correlation between OGT and the frequency with which pairs of A and G nucleotides appear as nearest neighbors in genome sequences. This adaptation is achieved via codon bias. These findings present a direct link between principles of proteins structure and stability and evolutionary mechanisms of thermophylic adaptation. On the nucleotide level, the analysis provides an example of how nature utilizes codon bias for evolutionary adaptation to extreme conditions. Together these results provide a complete picture of how compositions of proteomes and genomes in prokaryotes adjust to the extreme conditions of the environment.

  16. Effect of intercalator substituent and nucleotide sequence on the stability of DNA- and RNA-naphthalimide complexes.

    Science.gov (United States)

    Johnson, Charles A; Hudson, Graham A; Hardebeck, Laura K E; Jolley, Elizabeth A; Ren, Yi; Lewis, Michael; Znosko, Brent M

    2015-07-01

    DNA intercalators are commonly used as anti-cancer and anti-tumor agents. As a result, it is imperative to understand how changes in intercalator structure affect binding affinity to DNA. Amonafide and mitonafide, two naphthalimide derivatives that are active against HeLa and KB cells in vitro, were previously shown to intercalate into DNA. Here, a systematic study was undertaken to change the 3-substituent on the aromatic intercalator 1,8-naphthalimide to determine how 11 different functional groups with a variety of physical and electronic properties affect binding of the naphthalimide to DNA and RNA duplexes of different sequence compositions and lengths. Wavelength scans, NMR titrations, and circular dichroism were used to investigate the binding mode of 1,8-naphthalimide derivatives to short synthetic DNA. Optical melting experiments were used to measure the change in melting temperature of the DNA and RNA duplexes due to intercalation, which ranged from 0 to 19.4°C. Thermal stabilities were affected by changing the substituent, and several patterns and idiosyncrasies were identified. By systematically varying the 3-substituent, the binding strength of the same derivative to various DNA and RNA duplexes was compared. The binding strength of different derivatives to the same DNA and RNA sequences was also compared. The results of these comparisons shed light on the complexities of site specificity and binding strength in DNA-intercalator complexes. For example, the consequences of adding a 5'-TpG-3' or 5'-GpT-3' step to a duplex is dependent on the sequence composition of the duplex. When added to a poly-AT duplex, naphthalimide binding was enhanced by 5.6-11.5°C, but when added to a poly-GC duplex, naphthalimide binding was diminished by 3.2-6.9°C. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  18. Characterisation of purified parvalbumin from five fish species and nucleotide sequencing of this major allergen from Pacific pilchard, Sardinops sagax.

    Science.gov (United States)

    Beale, Janine E; Jeebhay, Mohamed F; Lopata, Andreas L

    2009-09-01

    IgE-mediated allergic reaction to seafood is a common cause of food allergy including anaphylactic reactions. Parvalbumin, the major fish allergen, has been shown to display IgE cross-reactivity among fish species consumed predominantly in Europe and the Far East. However, cross-reactivity studies of parvalbumin from fish species widely consumed in the Southern hemisphere are limited as is data relating to immunological and molecular characterisation. In this study, antigenic cross-reactivity and the presence of oligomers and isomers of parvalbumin from five highly consumed fish species in Southern Africa were assessed by immunoblotting using purified parvalbumin and crude fish extracts. Pilchard (Sardinops sagax) parvalbumin was found to display the strongest IgE reactivity among 10 fish-allergic consumers. The cDNA sequence of the beta-form of pilchard parvalbumin was determined and designated Sar sa 1.0101 (accession number FM177701 EMBL/GenBank/DDBJ databases). Oligomeric forms of parvalbumin were observed in all fish species using a monoclonal anti-parvalbumin antibody and subject's sera. Isoforms varied between approximately 10-13 kDa. A highly cross-reactive allergenic isoform of parvalbumin was identified and sequenced, providing a successful primary step towards the generation of a recombinant form that could be used for diagnostic and potential therapeutic use in allergic individuals.

  19. Noninvasive Antenatal Determination of Fetal Blood Group Using Next-Generation Sequencing

    DEFF Research Database (Denmark)

    Rieneck, Klaus; Clausen, Frederik Banch; Dziegiel, Morten Hanefeld

    2016-01-01

    Hemolytic disease of the fetus and newborn (HDFN) is a condition characterized by a decreased lifespan of fetal red blood cells caused by maternally produced allospecific antibodies transferred to the fetus during pregnancy. The antibodies bind to the corresponding blood group antigens on fetal red...... blood cells and induce hemolysis. Cell-free DNA derived fromthe conceptus circulates in maternal blood. Using next-generation sequencing (NGS), it can be determined if this cell-free fetalDNA encodes the corresponding blood group antigen that is the target of the maternal allospecific antibodies....... This determination carries no risk to the fetus. It is important to determine if the fetus is at risk of hemolysis to enable timely intervention. Many tests for blood groups are based solely on the presence or absence of a single nucleotide polymorphism (SNP). Antenatal determination of fetal blood group by...

  20. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  1. wzi Gene Sequencing, a Rapid Method for Determination of Capsular Type for Klebsiella Strains

    Science.gov (United States)

    Passet, Virginie; Haugaard, Anita Björk; Babosan, Anamaria; Kassis-Chikhani, Najiby; Struve, Carsten; Decré, Dominique

    2013-01-01

    Pathogens of the genus Klebsiella have been classified into distinct capsular (K) types for nearly a century. K typing of Klebsiella species still has important applications in epidemiology and clinical microbiology, but the serological method has strong practical limitations. Our objective was to evaluate the sequencing of wzi, a gene conserved in all capsular types of Klebsiella pneumoniae that codes for an outer membrane protein involved in capsule attachment to the cell surface, as a simple and rapid method for the prediction of K type. The sequencing of a 447-nucleotide region of wzi distinguished the K-type reference strains with only nine exceptions. A reference wzi sequence database was created by the inclusion of multiple strains representing K types associated with high virulence and multidrug resistance. A collection of 119 prospective clinical isolates of K. pneumoniae were then analyzed in parallel by wzi sequencing and classical K typing. Whereas K typing achieved typeability for 81% and discrimination for 94.4% of the isolates, these figures were 98.1% and 98.3%, respectively, for wzi sequencing. The prediction of K type once the wzi allele was known was 94%. wzi sequencing is a rapid and simple method for the determination of the K types of most K. pneumoniae clinical isolates. PMID:24088853

  2. Clinical and molecular characterization of a cohort of patients with novel nucleotide alterations of the Dystrophin gene detected by direct sequencing

    Directory of Open Access Journals (Sweden)

    Corti Stefania

    2011-03-01

    Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects

  3. Turn-on fluorescence probes based on pyranine/viologen charge-transfer complexes for the determination of nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Schäferling, Michael, E-mail: Michael.schaeferling@utu.fi; Lang, Thomas; Schnettelker, Annette

    2014-10-15

    The formation of ground state charge-transfer complexes between pyranine (8-hydroxypyrene-1,3,6-trisulfonic acid) and viologen (paraquat) derivatives is utilized for the design of novel fluoroionophores for the determination of phosphate species, particularly of nucleotides. The strong quenching of the pyranine fluorescence by viologen-type charge transfer acceptors can be countermanded if these are functionalized with triethylammonium groups that serve as recognition elements for phosphate anions. We report on the fluorogenic responses of these water-soluble molecular probes in presence of different phosphates. Absorbance measurements give additional information on the charge transfer complex formation and the interaction with nucleotides. The experimental data show that these aggregates form attractive, simple and versatile fluorescence turn-on probes for nucleoside triphosphates. The reversibility of the fluorescence response is demonstrated by means of an enzymatic model assay using ATPase for the decomposition of adenosine triphosphate. - Highlights: • Pyranine/viologen charge-transfer complexes as molecular probe for ATP recognition. • Fluorescence turn on mechanism. • Selective compared to other nucleotides and phosphate anions. • Fast and reversible response applicable to monitor enzymatic reactions.

  4. Recombination-Independent Recognition of DNA Homology for Repeat-Induced Point Mutation (RIP Is Modulated by the Underlying Nucleotide Sequence.

    Directory of Open Access Journals (Sweden)

    Eugene Gladyshev

    2016-05-01

    Full Text Available Haploid germline nuclei of many filamentous fungi have the capacity to detect homologous nucleotide sequences present on the same or different chromosomes. Once recognized, such sequences can undergo cytosine methylation or cytosine-to-thymine mutation specifically over the extent of shared homology. In Neurospora crassa this process is known as Repeat-Induced Point mutation (RIP. Previously, we showed that RIP did not require MEI-3, the only RecA homolog in Neurospora, and that it could detect homologous trinucleotides interspersed with a matching periodicity of 11 or 12 base-pairs along participating chromosomal segments. This pattern was consistent with a mechanism of homology recognition that involved direct interactions between co-aligned double-stranded (ds DNA molecules, where sequence-specific dsDNA/dsDNA contacts could be established using no more than one triplet per turn. In the present study we have further explored the DNA sequence requirements for RIP. In our previous work, interspersed homologies were always examined in the context of a relatively long adjoining region of perfect homology. Using a new repeat system lacking this strong interaction, we now show that interspersed homologies with overall sequence identity of only 36% can be efficiently detected by RIP in the absence of any perfect homology. Furthermore, in this new system, where the total amount of homology is near the critical threshold required for RIP, the nucleotide composition of participating DNA molecules is identified as an important factor. Our results specifically pinpoint the triplet 5'-GAC-3' as a particularly efficient unit of homology recognition. Finally, we present experimental evidence that the process of homology sensing can be uncoupled from the downstream mutation. Taken together, our results advance the notion that sequence information can be compared directly between double-stranded DNA molecules during RIP and, potentially, in other processes

  5. Comparative In silico Study of Sex-Determining Region Y (SRY) Protein Sequences Involved in Sex-Determining.

    Science.gov (United States)

    Vakili Azghandi, Masoume; Nasiri, Mohammadreza; Shamsa, Ali; Jalali, Mohsen; Shariati, Mohammad Mahdi

    2016-04-01

    The SRY gene (SRY) provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/) and MEGA6 softwares. The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale) and Tursiopsaduncus (dolphin) have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee) have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

  6. Comparative In silico Study of Sex-Determining Region Y (SRY Protein Sequences Involved in Sex-Determining

    Directory of Open Access Journals (Sweden)

    Masoume Vakili Azghandi

    2016-05-01

    Full Text Available Background: The SRY gene (SRY provides instructions for making a transcription factor called the sex-determining region Y protein. The sex-determining region Y protein causes a fetus to develop as a male. In this study, SRY of 15 spices included of human, chimpanzee, dog, pig, rat, cattle, buffalo, goat, sheep, horse, zebra, frog, urial, dolphin and killer whale were used for determine of bioinformatic differences. Methods: Nucleotide sequences of SRY were retrieved from the NCBI databank. Bioinformatic analysis of SRY is done by CLC Main Workbench version 5.5 and ClustalW (http:/www.ebi.ac.uk/clustalw/ and MEGA6 softwares. Results: The multiple sequence alignment results indicated that SRY protein sequences from Orcinus orca (killer whale and Tursiopsaduncus (dolphin have least genetic distance of 0.33 in these 15 species and are 99.67% identical at the amino acid level. Homosapiens and Pantroglodytes (chimpanzee have the next lowest genetic distance of 1.35 and are 98.65% identical at the amino acid level. Conclusion: These findings indicate that the SRY proteins are conserved in the 15 species, and their evolutionary relationships are similar.

  7. Nucleotide sequence of an external transcribed spacer in Xenopus laevis rDNA: sequences flanking the 5' and 3' ends of 18S rRNA are non-complementary.

    Science.gov (United States)

    Maden, B E; Moss, M; Salim, M

    1982-04-10

    We have sequenced the external transcribed spacer (ETS) of a ribosomal transcription unit from Xenopus laevis, together with sections of the preceding non-transcribed spacer. Our analysis was carried out on the same cloned transcription unit as that from which the internal transcribed spacers (ITS) were previously sequenced. The ETS is approximately 712 nucleotides long and, like the ITS regions, is generally very rich in C plus G. Features of the sequence include an excess of oligo-C tracts over oligo-G tracts and a tract of 37 nucleotides consisting almost entirely of G and A residues. Parts of the sequence can give rise to stable internal secondary structures. However, in contrast to Escherichia coli, there is no potential for major base-pairing between the 18S flanking regions of the ETS and ITS. Further findings are that there are no initiation (ATG) codons in the ETS and that, as in other X.laevis rDNA cloned units, the sequence preceding the ETS is duplicated, with a few changes, in the "Bam island" sequence of the non-transcribed spacer.

  8. Identification and nucleotide sequence of a gene in equine herpesvirus 1 analogous to the herpes simplex virus gene encoding the major envelope glycoprotein gB.

    Science.gov (United States)

    Whalley, J M; Robertson, G R; Scott, N A; Hudson, G C; Bell, C W; Woodworth, L M

    1989-02-01

    A gene in equine herpesvirus 1 (EHV-1; equine abortion virus) equivalent to the gB glycoprotein gene of herpes simplex virus (HSV) has been identified by DNA hybridization and nucleotide sequencing. A 4.3 kbp EHV-1 PstI-ClaI sequence (0.40 to 0.43 map units) contained an open reading frame flanked by appropriate control elements and was capable of encoding a polypeptide of 980 amino acids. This had 50 to 60% identity over a 617 amino acid conserved region with the gB gene products of HSV and three other alphaherpesviruses, and 20 to 30% identity with those of human cytomegalovirus and Epstein-Barr virus. Analysis of the amino acid sequence predicts a long signal peptide, hydrophobic and hydrophilic domains and N-glycosylation sites, and has identified a probable internal proteolytic cleavage site. The EHV-1 gB open reading frame appears to be overlapped at its 5' end by 135 nucleotides of the 3' end of an upstream open reading frame the potential translation product of which has approximately 50% identity with HSV gene ICP 18.5 and VZV gene 30 products.

  9. Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

    2016-09-01

    Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

  10. Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

    DEFF Research Database (Denmark)

    Jutkina, Jekaterina; Hansen, Lars H.; Li, Lili

    2013-01-01

    In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...... predicted to encode proteins, among them genes for catabolism of toluene, plasmid replication, maintenance and conjugative transfer. ORFs encoding proteins with putative functions in stress response, transposition and site- ...

  11. Complete nucleotide sequence of pGA45, a 140,698-bp incFIIY plasmid encoding blaIMI-3-mediated carbapenem resistance, from river sediment

    Directory of Open Access Journals (Sweden)

    Bingjun eDang

    2016-02-01

    Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.

  12. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  13. Nucleotide sequence analyses of coat protein gene of peanut stunt virus isolates from alfalfa and different hosts show a new tentative subgroup from Iran.

    Science.gov (United States)

    Amid-Motlagh, Mohammad Hadi; Massumi, Hossein; Heydarnejad, Jahangir; Mehrvar, Mohsen; Hajimorad, Mohammad Reza

    2017-09-01

    Alfalfa cultivars grown in 14 provinces in Iran were surveyed for the relative incidence of peanut stunt virus (PSV) during 2013-2016. PSV were detected in 41.89% of symptomatic alfalfa samples and a few alternate hosts by plate-trapped antigen ELISA. Among other hosts tested only Chenopodium album , Robinia pseudoacacia and Arachis hypogaea were found naturally infected with PSV. Twenty five isolates of PSV were chosen for biological and molecular characterizations based on their geographical distributions. There was not any differences in experimental host range of these isolates; however, variation in systemic symptoms observed on Nicotiana glutinosa . Total RNA from 25 of viral isolates were subjected to reverse transcription polymerase chain reaction analysis using primers directed against coat protein (CP) gene. The CP genes of 25 Iranian PSV isolates were either 651 or 666 nucleotides long. The nucleotide and amino acid identities for CP gene among Iranian PSV isolates were 79.3-99.7 and 72-100%, respectively. They also shared between 67.4 and 82.4% pairwise nucleotide identity with other PSV isolates reported elsewhere in the world. Phylogenetic analyses of CP gene sequences showed formation of a new subgroup comprising only the Iranian isolates. Natural infection of a few alternate hosts with PSV is reported for the first time from Iran.

  14. Identification and Analysis of Informative Single Nucleotide Polymorphisms in 16S rRNA Gene Sequences of the Bacillus cereus Group.

    Science.gov (United States)

    Hakovirta, Janetta R; Prezioso, Samantha; Hodge, David; Pillai, Segaran P; Weigel, Linda M

    2016-11-01

    Analysis of 16S rRNA genes is important for phylogenetic classification of known and novel bacterial genera and species and for detection of uncultivable bacteria. PCR amplification of 16S rRNA genes with universal primers produces a mixture of amplicons from all rRNA operons in the genome, and the sequence data generally yield a consensus sequence. Here we describe valuable data that are missing from consensus sequences, variable effects on sequence data generated from nonidentical 16S rRNA amplicons, and the appearance of data displayed by different software programs. These effects are illustrated by analysis of 16S rRNA genes from 50 strains of the Bacillus cereus group, i.e., Bacillus anthracis, Bacillus cereus, Bacillus mycoides, and Bacillus thuringiensis These species have 11 to 14 rRNA operons, and sequence variability occurs among the multiple 16S rRNA genes. A single nucleotide polymorphism (SNP) previously reported to be specific to B. anthracis was detected in some B. cereus strains. However, a different SNP, at position 1139, was identified as being specific to B. anthracis, which is a biothreat agent with high mortality rates. Compared with visual analysis of the electropherograms, basecaller software frequently missed gene sequence variations or could not identify variant bases due to overlapping basecalls. Accurate detection of 16S rRNA gene sequences that include intragenomic variations can improve discrimination among closely related species, improve the utility of 16S rRNA databases, and facilitate rapid bacterial identification by targeted DNA sequence analysis or by whole-genome sequencing performed by clinical or reference laboratories. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  15. Complete nucleotide sequence of little cherry virus 1 (LChV-1) infecting sweet cherry in China

    Science.gov (United States)

    Little cherry virus 1 (LChV-1), associated with little cherry disease (LCD), has a significant impact on fruit quality of infected sweet cherry trees. We report the full genome sequence of an isolate of LChV-1 from China, detected by small RNA deep sequencing and amplified by overlapping RT-PCR. The...

  16. The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

    Science.gov (United States)

    Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

    1995-05-01

    The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

  17. A 19-nucleotide insertion in the leader sequence of avian leukosis virus subgroup J contributes to its replication in vitro but is not related to its pathogenicity in vivo.

    Directory of Open Access Journals (Sweden)

    Xiaolin Ji

    Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.

  18. Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

    Science.gov (United States)

    Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

    2018-03-01

    Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

  19. Computational identification and experimental characterization of substrate binding determinants of nucleotide pyrophosphatase/phosphodiesterase 7

    Directory of Open Access Journals (Sweden)

    Parrill Abby L

    2011-12-01

    Full Text Available Abstract Background Nucleotide pyrophosphatase/phosphodiesterase 7 (NPP7 is the only member of the mammalian NPP enzyme family that has been confirmed to act as a sphingomyelinase, hydrolyzing sphingomyelin (SM to form phosphocholine and ceramide. NPP7 additionally hydrolyzes lysophosphatidylcholine (LPC, a substrate preference shared with the NPP2/autotaxin(ATX and NPP6 mammalian family members. This study utilizes a synergistic combination of molecular modeling validated by experimental site-directed mutagenesis to explore the molecular basis for the unique ability of NPP7 to hydrolyze SM. Results The catalytic function of NPP7 against SM, LPC, platelet activating factor (PAF and para-nitrophenylphosphorylcholine (pNPPC is impaired in the F275A mutant relative to wild type NPP7, but different impacts are noted for mutations at other sites. These results are consistent with a previously described role of F275 to interact with the choline headgroup, where all substrates share a common functionality. The L107F mutation showed enhanced hydrolysis of LPC, PAF and pNPPC but reduced hydrolysis of SM. Modeling suggests this difference can be explained by the gain of cation-pi interactions with the choline headgroups of all four substrates, opposed by increased steric crowding against the sphingoid tail of SM. Modeling also revealed that the long and flexible hydrophobic tails of substrates exhibit considerable dynamic flexibility in the binding pocket, reducing the entropic penalty that might otherwise be incurred upon substrate binding. Conclusions Substrate recognition by NPP7 includes several important contributions, ranging from cation-pi interactions between F275 and the choline headgroup of all substrates, to tail-group binding pockets that accommodate the inherent flexibility of the lipid hydrophobic tails. Two contributions to the unique ability of NPP7 to hydrolyze SM were identified. First, the second hydrophobic tail of SM occupies a second

  20. Complete nucleotide sequence and genome analysis of bacteriophage BFK20 — A lytic phage of the industrial producer Brevibacterium flavum

    Czech Academy of Sciences Publication Activity Database

    Bukovska, G.; Klucar, L.; Vlček, Čestmír; Adamovic, J.; Turna, J.; Timko, J.

    2006-01-01

    Roč. 348, č. 1 (2006), s. 57-71 ISSN 0042-6822 Grant - others:Slovenská akademie věd(SK) VEGA2/5068/25; Science and Technology Assistance Agency(SK) APVT-51-025004 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bacteriophage * Complete genome sequence * Sequence analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.525, year: 2006

  1. Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

    International Nuclear Information System (INIS)

    Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.

    1987-01-01

    The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

  2. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  3. Complete nucleotide sequence, genome organization, and biological properties of human immunodeficiency virus type 1 in vivo: evidence for limited defectiveness and complementation.

    Science.gov (United States)

    Li, Y; Hui, H; Burgess, C J; Price, R W; Sharp, P M; Hahn, B H; Shaw, G M

    1992-11-01

    Previous studies of the genetic and biologic characteristics of human immunodeficiency virus type 1 (HIV-1) have by necessity used tissue culture-derived virus. We recently reported the molecular cloning of four full-length HIV-1 genomes directly from uncultured human brain tissue (Y. Li, J. C. Kappes, J. A. Conway, R. W. Price, G. M. Shaw, and B. H. Hahn, J. Virol. 65:3973-3985, 1991). In this report, we describe the biologic properties of these four clones and the complete nucleotide sequences and genome organization of two of them. Clones HIV-1YU-2 and HIV-1YU-10 were 9,174 and 9,176 nucleotides in length, differed by 0.26% in nucleotide sequence, and except for a frameshift mutation in the pol gene in HIV-1YU-10, contained open reading frames corresponding to 5'-gag-pol-vif-vpr-tat-rev-vpu-env-nef-3' flanked by long terminal repeats. HIV-1YU-2 was fully replication competent, while HIV-1YU-10 and two other clones, HIV-1YU-21 and HIV-1YU-32, were defective. All three defective clones, however, when transfected into Cos-1 cells in any pairwise combination, yielded virions that were replication competent and transmissible by cell-free passage. The cellular host range of HIV-1YU-2 was strictly limited to primary T lymphocytes and monocyte-macrophages, a property conferred by its external envelope glycoprotein. Phylogenetic analyses of HIV-1YU-2 gene sequences revealed this virus to be a member of the North American/European HIV-1 subgroup, with specific similarity to other monocyte-tropic viruses in its V3 envelope amino acid sequence. These results indicate that HIV-1 infection of brain is characterized by the persistence of mixtures of fully competent, minimally defective, and more substantially altered viral forms and that complementation among them is readily attainable. In addition, the limited degree of genotypic heterogeneity observed among HIV-1YU and other brain-derived viruses and their preferential tropism for monocyte-macrophages suggest that viral

  4. Molecular study and nucleotide sequencing of Chlamydia abortus isolated from aborted sheep fetuses ewes of Alborz province

    Directory of Open Access Journals (Sweden)

    amirreza ebadi

    2015-02-01

    Full Text Available Chlamydia is an obligate intracellular and gram negative coccobacilli and one of the most important causes of abortion in ruminants especially in ewes. This investigation was performed with the purpose of molecular study and sequencing of Chlamydia abortus isolated from aborted sheep fetuses of Alborz Province. In this study, DNA extraction was performed on 100 samples from aborted fetuses of 32 sheep flocks from different areas of Alborz province. Then using specific primers of gene IGS-Sr- RNA, polymerase chain reaction was conducted and 10 samples were selected randomly from the positive cases were sent to Macrogene company in Korea for sequencing. In this study, 37 samples from a total of 100 aborted fetuses were positive for Chlamydia abortus. After sequencing, more than 99 percent of the positive samples were similar with sequences in gene bank. The sequencing results indicated that the samples were very similar to isolates LN554882/1, AF051935/1 and CR848038/1 of the gene bank and were in the same cluster. Also, this investigation indicated that Chlamydia abortus is one of the main reasons of ewe abortion in Alborz province.

  5. Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. lactis DSM 7290, and partial characterization of the enzyme.

    Science.gov (United States)

    Vongerichten, K F; Klein, J R; Matern, H; Plapp, R

    1994-10-01

    Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.

  6. Nucleotide sequence and genome organization of a member of a new and distinct Caulimovirus species from dahlia.

    Science.gov (United States)

    Pappu, H R; Druffel, K L; Miglino, R; van Schadewijk, A R

    2008-01-01

    A distinct caulimovirus, associated with dahlia mosaic, was cloned and sequenced. The caulimovirus, tentatively designated as dahlia common mosaic virus (DCMV), had a double-stranded DNA genome of ca. 8 kb. The genome organization of DCMV was found to be typical of members of the genus Caulimovirus and consisted of six major open reading frames (ORFs), ORFs I-VI, and one minor ORF, ORF VII. Sequence comparisons with the DNA genomes of two known caulimoviruses isolated from dahlia, Dahlia mosaic virus (DMV) and an endogenous caulimovirus, DMV-D10, showed that DCMV is a member of a distinct caulimovirus species, with sequence identities among various ORFs ranging from 25 to 80%.

  7. Complete Nucleotide Sequences of Two VIM-1-Encoding Plasmids from Klebsiella pneumoniae and Leclercia adecarboxylata Isolates of Czech Origin.

    Science.gov (United States)

    Papousek, Ivo; Papagiannitsis, Costas C; Medvecky, Matej; Hrabak, Jaroslav; Dolejska, Monika

    2017-05-01

    Two multidrug resistance (MDR) plasmids, carrying the VIM-1-encoding integron In110, were characterized. Plasmid pLec-476cz (311,758 bp), from a Leclercia adecarboxylata isolate, consisted of an IncHI1 backbone, a MDR region, and two accessory elements. Plasmid pKpn-431cz (142,876 bp), from a sequence type 323 (ST323) Klebsiella pneumoniae isolate, comprised IncFII Y -derived and pKPN3-like sequences and a mosaic region. A 40,400-bp sequence of pKpn-431cz was identical to the MDR region of pLec-476cz, indicating the en bloc acquisition of the VIM-1-encoding region from one plasmid by the other. Copyright © 2017 American Society for Microbiology.

  8. Nucleotide sequence and genetic organization of a 7.3 kb region (map unit 47 to 52.5) of Autographa californica nuclear polyhedrosis virus fragment EcoRI-C

    NARCIS (Netherlands)

    Kool, M.; Broer, R.; Zuidema, D.; Goldbach, R. W.; Vlak, J. M.

    1994-01-01

    The nucleotide sequence and genetic organization of a 7297 bp region within the EcoRI-C fragment of Autographa californica multiple nucleocapsid nuclear polyhedrosis virus (AcMNPV) are presented. Eight putative open reading frames were found and their respective amino acid sequences compared with a

  9. Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

    DEFF Research Database (Denmark)

    Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

    1991-01-01

    After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...

  10. Cloning, Nucleotide Sequencing and Bioinformatics Study of NcSRS2 Gene, an Immunogen from Iranian Isolate of Neospora Caninum

    Directory of Open Access Journals (Sweden)

    M Soltani

    2013-03-01

    Full Text Available Background: Neosporosis is caused by an obligate intracellular parasitic protozoa Neospora caninum which infect variety of hosts. NcSRS2 is an immuno-dominant antigen of N. caninum which is consi­dered as one of the most promising targets for a recombinant or DNA vaccine against neosporosis. As no study has been carried out to identify the molecular structure of N. caninum in Iran, as first step, we prepared a scheme to identify this gene in this parasite in Iran.Methods: Tachyzoite total RNA was extracted and cDNA was synthesized and NcSRS2 gene was amplified using cDNA as template. Then the PCR product was cloned into pTZ57R/T vector and transformed into E. coli (DH5α strain. Finally, the recombinant plasmid was extracted from trans­formed E. coli and sequenced. Bioinformatics analysis also carried out.Results: The PCR product of NcSRS2 gene was sequenced and recorded in GenBank. The deduced amino acid sequence of NcSRS2 in current study was compared with other N. caninum NcSRS2 and showed some identities and differences.Conclusion: NcSRS2 gene of N. caninum successfully cloned in pTZ57R/T. Recombinant plasmid was confirmed by sequencing, colony PCR and enzymatic digestion. It is ready to express recombi­nant protein for further studies.

  11. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    International Nuclear Information System (INIS)

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

    1988-01-01

    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  12. Direct Determination of Six Cytokinin Nucleotide Monophosphates in Coconut Flesh by Reversed-Phase Liquid Chromatography-Tandem Mass Spectrometry.

    Science.gov (United States)

    Cao, Zhao-Yun; Ma, You-Ning; Sun, Li-Hua; Mou, Ren-Xiang; Zhu, Zhi-Wei; Chen, Ming-Xue

    2017-11-15

    Coconut contains many uncharacterized cytokinins that have important physiological effects in plants and humans. In this work, a method based on liquid chromatography-tandem mass spectrometry was developed for identification and quantification of six cytokinin nucleotide monophosphates in coconut flesh. Excellent separation was achieved using a low-coverage C18 bonded-phase column with an acidic mobile phase, which greatly improved the retention of target compounds. To enable high-throughput analysis, a single-step solid-phase extraction using mixed-mode anion-exchange cartridges was employed for sample preparation. This proved to be an effective method to minimize matrix effects and ensure high selectivity. The limits of detection varied from 0.06 to 0.3 ng/mL, and the limits of quantification ranged from 0.2 to 1.0 ng/mL. The linearity was statistically verified over 2 orders of magnitude, giving a coefficient of determination (R 2 ) greater than 0.9981. The mean recoveries were from 81 to 108%; the intraday precision (n = 6) was less than 11%; and the interday precision (n = 11) was within 14%. The developed method was applied to the determination of cytokinin nucleotide monophosphates in coconut flesh samples, and four of them were successfully identified and quantified. The results showed that trans-zeatin riboside-5'-monophosphate was the dominant cytokinin, with a concentration of 2.7-34.2 ng/g, followed by N 6 -isopentenyladenosine-5'-monophosphate (≤12.9 ng/g), while the concentrations of cis-zeatin riboside-5'-monophosphate and dihydrozeatin riboside-5'-monophosphate were less than 2.2 and 4.9 ng/g, respectively.

  13. Complete nucleotide sequences of seven soybean mosaic viruses (SMV), isolated from wild soybeans (Glycine soja) in China.

    Science.gov (United States)

    Chen, Yun-Xia; Wu, Mian; Ma, Fang-Fang; Chen, Jian-Qun; Wang, Bin

    2017-03-01

    Soybean mosaic virus (SMV) is a devastating plant virus classified in the family Potyviridae, and known to infect cultivated soybeans (Glycine max). In this study, seven new SMVs were isolated from wild soybean samples and analyzed by whole-genome sequencing. An updated SMV phylogeny was built with the seven new and 83 known SMV genomic sequences. Results showed that three northeastern SMV isolates were distributed in clade III and IV, while four southern SMVs were grouped together in clade II and all contained a recombinant BCMV fragment (~900 bp) in the upstream part of the genome. This work revealed that wild soybeans in China also act as important SMV hosts and play a role in the transmission and diversity of SMVs.

  14. Purification, enzymatic characterization, and nucleotide sequence of a high-isoelectric-point alpha-glucosidase from barley malt

    DEFF Research Database (Denmark)

    Frandsen, T P; Lok, F; Mirgorodskaya, E

    2000-01-01

    in the transition state complex. Mass spectrometry of tryptic fragments assigned the 92-kD protein to a barley cDNA (GenBank accession no. U22450) that appears to encode an alpha-glucosidase. A corresponding sequence (HvAgl97; GenBank accession no. AF118226) was isolated from a genomic phage library using a c......DNA fragment from a barley cDNA library. HvAgl97 encodes a putative 96.6-kD protein of 879 amino acids with 93.8% identity to the protein deduced from U22450. The sequence contains two active site motifs of glycoside hydrolase family 31. Three introns of 86 to 4,286 bp interrupt the coding region. The four...

  15. Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

    International Nuclear Information System (INIS)

    Xiong Gang; Wang, X.R.

    2005-01-01

    The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

  16. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Directory of Open Access Journals (Sweden)

    Elizabeth N. Krueger

    2013-07-01

    Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.

  17. The influence of selection on the evolutionary distance estimated from the base changes observed between homologous nucleotide sequences.

    Science.gov (United States)

    Otsuka, J; Kawai, Y; Sugaya, N

    2001-11-21

    In most studies of molecular evolution, the nucleotide base at a site is assumed to change with the apparent rate under functional constraint, and the comparison of base changes between homologous genes is thought to yield the evolutionary distance corresponding to the site-average change rate multiplied by the divergence time. However, this view is not sufficiently successful in estimating the divergence time of species, but mostly results in the construction of tree topology without a time-scale. In the present paper, this problem is investigated theoretically by considering that observed base changes are the results of comparing the survivals through selection of mutated bases. In the case of weak selection, the time course of base changes due to mutation and selection can be obtained analytically, leading to a theoretical equation showing how the selection has influence on the evolutionary distance estimated from the enumeration of base changes. This result provides a new method for estimating the divergence time more accurately from the observed base changes by evaluating both the strength of selection and the mutation rate. The validity of this method is verified by analysing the base changes observed at the third codon positions of amino acid residues with four-fold codon degeneracy in the protein genes of mammalian mitochondria; i.e. the ratios of estimated divergence times are fairly well consistent with a series of fossil records of mammals. Throughout this analysis, it is also suggested that the mutation rates in mitochondrial genomes are almost the same in different lineages of mammals and that the lineage-specific base-change rates indicated previously are due to the selection probably arising from the preference of transfer RNAs to codons.

  18. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolism...

  19. TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine.

    Science.gov (United States)

    Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun

    2016-10-01

    As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.

  20. Single-nucleotide variant in multiple copies of a deleted in azoospermia (DAZ) sequence - a human Y chromosome quantitative polymorphism.

    Science.gov (United States)

    Szmulewicz, Martin N; Ruiz, Luis M; Reategui, Erika P; Hussini, Saeed; Herrera, Rene J

    2002-01-01

    The evolution of the deleted in azoospermia (DAZ) gene family supports prevalent theories on the origin and development of sex chromosomes and sexual dimorphism. The ancestral DAZL gene in human chromosome 3 is known to be involved in germline development of both males and females. The available phylogenetic data suggest that some time after the divergence of the New World and Old World monkey lineages, the DAZL gene, which is found in all mammals, was copied to the Y chromosome of an ancestor to the Old World monkeys, but not New World monkeys. In modern man, the Y-linked DAZ gene complex is located on the distal part of the q arm. It is thought that after being copied to the Y chromosome, and after the divergence of the human and great ape lineages, the DAZ gene in the former underwent internal rearrangements. This included tandem duplications as well as a T > C transition altering an MboI restriction enzyme site in a duplicated sequence. In this study, we report on the ratios of MboI-/MboI+ variant sequences in individuals from seven worldwide human populations (Basque, Benin, Egypt, Formosa, Kungurtug, Oman and Rwanda) in the DAZ complex. The ratio of PCR MboI- and MboI+ amplicons can be used to characterize individuals and populations. Our results show a nonrandom distribution of MboI-/MboI+ sequence ratios in all populations examined, as well as significant differences in ratios between populations when compared pairwise. The multiple ratios imply that there have been more than one recent reorganization events at this locus. Considering the dynamic nature of this locus and its involvement in male fertility, we investigated the extent and distribution of this polymorphism. Copyright 2002 S. Karger AG, Basel

  1. Meta-analysis of sequence-based association studies across three cattle breeds reveals 25 QTL for fat and protein percentages in milk at nucleotide resolution.

    Science.gov (United States)

    Pausch, Hubert; Emmerling, Reiner; Gredler-Grandl, Birgit; Fries, Ruedi; Daetwyler, Hans D; Goddard, Michael E

    2017-11-09

    Genotyping and whole-genome sequencing data have been generated for hundreds of thousands of cattle. International consortia used these data to compile imputation reference panels that facilitate the imputation of sequence variant genotypes for animals that have been genotyped using dense microarrays. Association studies with imputed sequence variant genotypes allow for the characterization of quantitative trait loci (QTL) at nucleotide resolution particularly when individuals from several breeds are included in the mapping populations. We imputed genotypes for 28 million sequence variants in 17,229 cattle of the Braunvieh, Fleckvieh and Holstein breeds in order to compile large mapping populations that provide high power to identify QTL for milk production traits. Association tests between imputed sequence variant genotypes and fat and protein percentages in milk uncovered between six and thirteen QTL (P < 1e-8) per breed. Eight of the detected QTL were significant in more than one breed. We combined the results across breeds using meta-analysis and identified a total of 25 QTL including six that were not significant in the within-breed association studies. Two missense mutations in the ABCG2 (p.Y581S, rs43702337, P = 4.3e-34) and GHR (p.F279Y, rs385640152, P = 1.6e-74) genes were the top variants at QTL on chromosomes 6 and 20. Another known causal missense mutation in the DGAT1 gene (p.A232K, rs109326954, P = 8.4e-1436) was the second top variant at a QTL on chromosome 14 but its allelic substitution effects were inconsistent across breeds. It turned out that the conflicting allelic substitution effects resulted from flaws in the imputed genotypes due to the use of a multi-breed reference population for genotype imputation. Many QTL for milk production traits segregate across breeds and across-breed meta-analysis has greater power to detect such QTL than within-breed association testing. Association testing between imputed sequence variant genotypes and

  2. Ambiguous allele combinations in HLA Class I and Class II sequence-based typing: when precise nucleotide sequencing leads to imprecise allele identification

    Directory of Open Access Journals (Sweden)

    Larsen Paula

    2004-09-01

    Full Text Available Abstract Sequence-based typing (SBT is one of the most comprehensive methods utilized for HLA typing. However, one of the inherent problems with this typing method is the interpretation of ambiguous allele combinations which occur when two or more different allele combinations produce identical sequences. The purpose of this study is to investigate the probability of this occurrence. We performed HLA-A,-B SBT for Exons 2 and 3 on 676 donors. Samples were analyzed with a capillary sequencer. The racial distribution of the donors was as follows: 615-Caucasian, 13-Asian, 23-African American, 17-Hispanic and 8-Unknown. 672 donors were analyzed for HLA-A locus ambiguities and 666 donors were analyzed for HLA-B locus ambiguities. At the HLA-A locus a total of 548 total ambiguous allele combinations were identified (548/1344 = 41%. Most (278/548 = 51% of these ambiguities were due to the fact that Exon 4 analysis was not performed. At the HLA-B locus 322 total ambiguous allele combinations were found (322/1332 = 24%. The HLA-B*07/08/15/27/35/44 antigens, common in Caucasians, produced a large portion of the ambiguities (279/322 = 87%. A large portion of HLA-A and B ambiguous allele combinations can be addressed by utilizing a group-specific primary amplification approach to produce an unambiguous homozygous sequence. Therefore, although the prevalence of ambiguous allele combinations is high, if the resolution of these ambiguities is clinically warranted, methods exist to compensate for this problem.

  3. 'Genome order index' should not be used for defining compositional constraints in nucleotide sequences - a case study of the Z-curve

    Directory of Open Access Journals (Sweden)

    Josić Krešimir

    2010-02-01

    Full Text Available Abstract Background The Z-curve is a three dimensional representation of DNA sequences proposed over a decade ago and has been extensively applied to sequence segmentation, horizontal gene transfer detection, and sequence analysis. Based on the Z-curve, a "genome order index," was proposed, which is defined as S = a2+ c2+t2+g2, where a, c, t, and g are the nucleotide frequencies of A, C, T, and G, respectively. This index was found to be smaller than 1/3 for almost all tested genomes, which was taken as support for the existence of a constraint on genome composition. A geometric explanation for this constraint has been suggested. Each genome was represented by a point P whose distance from the four faces of a regular tetrahedron was given by the frequencies a, c, t, and g. They claimed that an inscribed sphere of radius r = 1/ contains almost all points corresponding to various genomes, implying that S r2. The distribution of the points P obtained by S was studied using the Z-curve. Results In this work, we studied the basic properties of the Z-curve using the "genome order index" as a case study. We show that (1 the calculation of the radius of the inscribed sphere of a regular tetrahedron is incorrect, (2 the S index is narrowly distributed, (3 based on the second parity rule, the S index can be derived directly from the Shannon entropy and is, therefore, redundant, and (4 the Z-curve suffers from over dimensionality, and the dimension stands for GC content alone suffices to represent any given genome. Conclusion The "genome order index" S does not represent a constraint on nucleotide composition. Moreover, S can be easily computed from the Gini-Simpson index and be directly derived from entropy and is redundant. Overall, the Z-curve and S are over-complicated measures to GC content and Shannon H index, respectively. Reviewers This article was reviewed by Claus Wilke, Joel Bader, Marek Kimmel and Uladzislau Hryshkevich (nominated by Itai Yanai.

  4. Genetic relatedness among indigenous rice varieties in the Eastern Himalayan region based on nucleotide sequences of the Waxy gene.

    Science.gov (United States)

    Choudhury, Baharul I; Khan, Mohammed L; Dayanandan, Selvadurai

    2014-12-29

    Indigenous rice varieties in the Eastern Himalayan region of Northeast India are traditionally classified into sali, boro and jum ecotypes based on geographical locality and the season of cultivation. In this study, we used DNA sequence data from the Waxy (Wx) gene to infer the genetic relatedness among indigenous rice varieties in Northeast India and to assess the genetic distinctiveness of ecotypes. The results of all three analyses (Bayesian, Maximum Parsimony and Neighbor Joining) were congruent and revealed two genetically distinct clusters of rice varieties in the region. The large group comprised several varieties of sali and boro ecotypes, and all agronomically improved varieties. The small group consisted of only traditionally cultivated indigenous rice varieties, which included one boro, few sali and all jum varieties. The fixation index analysis revealed a very low level of differentiation between sali and boro (F(ST) = 0.005), moderate differentiation between sali and jum (F(ST) = 0.108) and high differentiation between jum and boro (F(ST) = 0.230) ecotypes. The genetic relatedness analyses revealed that sali, boro and jum ecotypes are genetically heterogeneous, and the current classification based on cultivation type is not congruent with the genetic background of rice varieties. Indigenous rice varieties chosen from genetically distinct clusters could be used in breeding programs to improve genetic gain through heterosis, while maintaining high genetic diversity.

  5. Nucleotide sequence and functional analysis of the tet (M)-carrying conjugative transposon Tn5251 of Streptococcus pneumoniae.

    Science.gov (United States)

    Santoro, Francesco; Oggioni, Marco R; Pozzi, Gianni; Iannelli, Francesco

    2010-07-01

    The Tn916-like genetic element Tn5251 is part of the composite conjugative transposon (CTn) Tn5253 of Streptococcus pneumoniae, a 64.5-kb chromosomal element originally called Omega(cat-tet) BM6001. DNA sequence analysis showed that Tn5251 is 18 033-bp long and contains 22 ORFs, 20 of which have the same direction of transcription. Annotation was possible for 11 out of 22 ORFs, including the tet(M) tetracycline resistance gene and int and xis involved in the integration/excision process. Autonomous copies of Tn5251 were generated during matings of Tn5253-containing donors with S. pneumoniae and Enterococcus faecalis. Tn5251 was shown to integrate at different sites in the bacterial chromosome. It behaves as a fully functional CTn capable of independent conjugal transfer to a variety of bacterial species including S. pneumoniae, Streptococcus gordonii, Streptococcus pyogenes, Streptococcus agalactiae, E. faecalis and Bacillus subtilis. The excision of Tn5251 produces a circular intermediate and a deletion in Tn5253 at a level of 1.2 copies per 10(5) chromosomes.

  6. Population genetic structure in farm and feral American mink (Neovison vison) inferred from RAD sequencing-generated single nucleotide polymorphisms.

    Science.gov (United States)

    Thirstrup, J P; Ruiz-Gonzalez, A; Pujolar, J M; Larsen, P F; Jensen, J; Randi, E; Zalewski, A; Pertoldi, C

    2015-08-01

    Feral American mink populations (), derived from mink farms, are widespread in Europe. In this study we investigated genetic diversity and genetic differentiation between feral and farm mink using a panel of genetic markers (194 SNP) generated from RAD sequencing data. Sampling included a total of 211 individuals from 14 populations, 4 feral and 10 from farms, the latter including a total of 7 color types (Brown, Black, Mahogany, Sapphire, White, Pearl, and Silver). Our study revealed similar low levels of genetic diversity in both farm and feral mink. Results are consistent with small effective population size as a consequence of line selection in the farms and founder effects of a few escapees from the farms in feral populations. Moderately high genetic differentiation was found between farm and feral animals, suggesting a scenario in which wild populations were founded from farm escapes a few decades ago. Currently, escapes and gene flow are probably limited. Genetic differentiation was higher among farm color types than among farms, consistent with line selection using few individuals to create the lines. Finally, no indications of inbreeding were found in either farm or feral samples, with significant negative values found in most farm samples, showing farms are successful in avoiding inbreeding.

  7. Characterization of the transcriptome, nucleotide sequence polymorphism, and natural selection in the desert adapted mouse Peromyscus eremicus

    Directory of Open Access Journals (Sweden)

    Matthew D. MacManes

    2014-10-01

    Full Text Available As a direct result of intense heat and aridity, deserts are thought to be among the most harsh of environments, particularly for their mammalian inhabitants. Given that osmoregulation can be challenging for these animals, with failure resulting in death, strong selection should be observed on genes related to the maintenance of water and solute balance. One such animal, Peromyscus eremicus, is native to the desert regions of the southwest United States and may live its entire life without oral fluid intake. As a first step toward understanding the genetics that underlie this phenotype, we present a characterization of the P. eremicus transcriptome. We assay four tissues (kidney, liver, brain, testes from a single individual and supplement this with population level renal transcriptome sequencing from 15 additional animals. We identified a set of transcripts undergoing both purifying and balancing selection based on estimates of Tajima’s D. In addition, we used the branch-site test to identify a transcript—Slc2a9, likely related to desert osmoregulation—undergoing enhanced selection in P. eremicus relative to a set of related non-desert rodents.

  8. Purification, enzymatic characterization, and nucleotide sequence of a high-isoelectric-point alpha-glucosidase from barley malt

    DEFF Research Database (Denmark)

    Frandsen, T P; Lok, F; Mirgorodskaya, E

    2000-01-01

    .5, and catalyzed the hydrolysis by a retaining mechanism, as shown by nuclear magnetic resonance. Acarbose was a strong inhibitor (K(i) = 1.5 microM). Molecular recognition revealed that all OH-groups in the non-reducing ring and OH-3 in the reducing ring of maltose formed important hydrogen bonds to the enzyme......High-isoelectric-point (pI) alpha-glucosidase was purified 7, 300-fold from an extract of barley (Hordeum vulgare) malt by ammonium sulfate fractionation, ion-exchange, and butyl-Sepharose chromatography. The enzyme had high activity toward maltose (k(cat) = 25 s(-1)), with an optimum at pH 4......DNA fragment from a barley cDNA library. HvAgl97 encodes a putative 96.6-kD protein of 879 amino acids with 93.8% identity to the protein deduced from U22450. The sequence contains two active site motifs of glycoside hydrolase family 31. Three introns of 86 to 4,286 bp interrupt the coding region. The four...

  9. Diagnosis of bovine foot and mouth disease virus by real-time polymerase chain reaction and nucleotide sequencing from outbreak herd samples in Ilesha Baruba, Kwara state, Nigeria

    Directory of Open Access Journals (Sweden)

    Olatunde Hamza Olabode

    2014-10-01

    Full Text Available Aim: Molecular diagnosis of bovine foot and mouth disease virus (FMDV from outbreak herd in Bukaru-Rontuwa, Sinawu/Tumbunya ward of Ilesha Baruba, in Kwara state-Nigeria was conducted to establish the associated serotypes and disease control plan. Materials and Methods: Purposive study was conducted in cattle outbreak herds during the dry season of January-March, 2011. Random sampling of blood and observed epithelial tissues was collected, stored in accordance with standard methods and subjected to RNA extraction and real-time reverse transcription polymerase chain reaction (rRT-PCR. Positive samples for FMDV were further subjected to reverse transcription polymerase chain reaction (RT-PCR, nucleotide sequencing using sequence primers of serotypes O, A, SAT 1-3 and gel electrophoresis. Obtained data were interpreted based on NCBI BLASTN program. Results: Foot and mouth disease (FMD-RNA extract was not found in all the blood tested with beta-actin range of Ct = 30-34. rRT-PCR assay showed two positive samples with Ct values of 18.79 and 15.28. Gel electrophoresis identified sequenced PCR amplicons as serotype A and SAT 2 respectively. Direct product sequencing confirmed SAT 2 serotype was closely related to SAT 2 isolate LIB/7/2003. Cloned RT-PCR product in pGEM-T easy vector confirmed serotype A as closely related to sequence of A/NIG/21/2009, though multiple NIG/2009 sequences were also identified as closely related. Both isolates showed marked genetic homogeneity with >93% genetic identity in the VP1 region which confirmed heterogeneity and antigenic variation nature of FMDV. Conclusion: Quasi species and subtypes of FMD serotypes A and SAT 2 similar to A/NIG/21/2009 and SAT 2/LIB/7/2003 respectively caused the reported FMD outbreaks in Fulani livestock herds investigated. A combined real-time and optimized RT-PCR protocols that would facilitate effective and timely FMD outbreak control plan based on identified serotypes is thus suggested.

  10. DNA Sequence Variation and Selection of Tag Single-Nucleotide Polymorphisms at Candidate Genes for Drought-Stress Response in Pinus taeda L.

    Science.gov (United States)

    González-Martínez, Santiago C.; Ersoz, Elhan; Brown, Garth R.; Wheeler, Nicholas C.; Neale, David B.

    2006-01-01

    Genetic association studies are rapidly becoming the experimental approach of choice to dissect complex traits, including tolerance to drought stress, which is the most common cause of mortality and yield losses in forest trees. Optimization of association mapping requires knowledge of the patterns of nucleotide diversity and linkage disequilibrium and the selection of suitable polymorphisms for genotyping. Moreover, standard neutrality tests applied to DNA sequence variation data can be used to select candidate genes or amino acid sites that are putatively under selection for association mapping. In this article, we study the pattern of polymorphism of 18 candidate genes for drought-stress response in Pinus taeda L., an important tree crop. Data analyses based on a set of 21 putatively neutral nuclear microsatellites did not show population genetic structure or genomewide departures from neutrality. Candidate genes had moderate average nucleotide diversity at silent sites (πsil = 0.00853), varying 100-fold among single genes. The level of within-gene LD was low, with an average pairwise r2 of 0.30, decaying rapidly from ∼0.50 to ∼0.20 at 800 bp. No apparent LD among genes was found. A selective sweep may have occurred at the early-response-to-drought-3 (erd3) gene, although population expansion can also explain our results and evidence for selection was not conclusive. One other gene, ccoaomt-1, a methylating enzyme involved in lignification, showed dimorphism (i.e., two highly divergent haplotype lineages at equal frequency), which is commonly associated with the long-term action of balancing selection. Finally, a set of haplotype-tagging SNPs (htSNPs) was selected. Using htSNPs, a reduction of genotyping effort of ∼30–40%, while sampling most common allelic variants, can be gained in our ongoing association studies for drought tolerance in pine. PMID:16387885

  11. Nucleotide Variability at Its Limit? Insights into the Number and Evolutionary Dynamics of the Sex-Determining Specificities of the Honey Bee Apis mellifera

    Science.gov (United States)

    Lechner, Sarah; Ferretti, Luca; Schöning, Caspar; Kinuthia, Wanja; Willemsen, David; Hasselmann, Martin

    2014-01-01

    Deciphering the evolutionary processes driving nucleotide variation in multiallelic genes is limited by the number of genetic systems in which such genes occur. The complementary sex determiner (csd) gene in the honey bee Apis mellifera is an informative example for studying allelic diversity and the underlying evolutionary forces in a well-described model of balancing selection. Acting as the primary signal of sex determination, diploid individuals heterozygous for csd develop into females, whereas csd homozygotes are diploid males that have zero fitness. Examining 77 of the functional heterozygous csd allele pairs, we established a combinatorical criteria that provide insights into the minimum number of amino acid differences among those pairs. Given a data set of 244 csd sequences, we show that the total number of csd alleles found in A. mellifera ranges from 53 (locally) to 87 (worldwide), which is much higher than was previously reported (20). Using a coupon-collector model, we extrapolate the presence of in total 116–145 csd alleles worldwide. The hypervariable region (HVR) is of particular importance in determining csd allele specificity, and we provide for this region evidence of high evolutionary rate for length differences exceeding those of microsatellites. The proportion of amino acids driven by positive selection and the rate of nonsynonymous substitutions in the HVR-flanking regions reach values close to 1 but differ with respect to the HVR length. Using a model of csd coalescence, we identified the high originating rate of csd specificities as a major evolutionary force, leading to an origin of a novel csd allele every 400,000 years. The csd polymorphism frequencies in natural populations indicate an excess of new mutations, whereas signs of ancestral transspecies polymorphism can still be detected. This study provides a comprehensive view of the enormous diversity and the evolutionary forces shaping a multiallelic gene. PMID:24170493

  12. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...

  13. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Science.gov (United States)

    Stafuzza, Nedenia Bonvino; Zerlotini, Adhemar; Lobo, Francisco Pereira; Yamagishi, Michel Eduardo Beleza; Chud, Tatiane Cristina Seleguim; Caetano, Alexandre Rodrigues; Munari, Danísio Prado; Garrick, Dorian J; Machado, Marco Antonio; Martins, Marta Fonseca; Carvalho, Maria Raquel; Cole, John Bruce; Barbosa da Silva, Marcos Vinicius Gualberto

    2017-01-01

    Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose), Gyr, Girolando and Holstein (dairy production). A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs) and 3,828,041 insertions/deletions (InDels) were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  14. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  15. Nucleotide sequence of the leading region adjacent to the origin of transfer on plasmid F and its conservation among conjugative plasmids.

    Science.gov (United States)

    Loh, S; Cram, D; Skurray, R

    1989-10-01

    The leading region of the Escherichia coli K12 F plasmid is the first segment of DNA to be transferred into the recipient cell during conjugal transfer. We report the nucleotide sequence of the 64.20-66.77F portion of the leading region immediately adjacent to the origin of transfer, oriT. The 2582 bp region encodes three open reading frames, ORF95, ORF169 and ORF273; the product of ORF273, is equivalent in size and map location to the 35 kDa protein, 6d, previously described (Cram et al. 1984). S1 nuclease analyses of mRNA transcripts have identified a potential promoter for ORF95 and ORF273 and indicated that these ORFs are transcribed as a single transcript; in contrast, ORF169 appears to be transcribed from two overlapping promoters on the complementary DNA strand. The products of ORF95 and ORF273 are mainly hydrophilic and are probably located in the cytoplasm. ORF273 shares some homology with DNA-binding proteins. There is a signal peptide sequence at the NH2-terminus of ORF169 and the mature form of ORF169 probably resides in the periplasm due to its hydrophilic nature. Both ORF273 and ORF169 are well conserved among conjugative F-like and a few non-F-like plasmids. On the other hand, ORF95 sequences are only present on some of these plasmids. Several primosome and integration host factor recognition sites are present implicating this region in DNA metabolism and/or replication functions.

  16. Determining physical constraints in transcriptional initiationcomplexes using DNA sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Shultzaberger, Ryan K.; Chiang, Derek Y.; Moses, Alan M.; Eisen,Michael B.

    2007-07-01

    Eukaryotic gene expression is often under the control ofcooperatively acting transcription factors whose binding is limited bystructural constraints. By determining these structural constraints, wecan understand the "rules" that define functional cooperativity.Conversely, by understanding the rules of binding, we can inferstructural characteristics. We have developed an information theory basedmethod for approximating the physical limitations of cooperativeinteractions by comparing sequence analysis to microarray expressiondata. When applied to the coordinated binding of the sulfur amino acidregulatory protein Met4 by Cbf1 and Met31, we were able to create acombinatorial model that can correctly identify Met4 regulatedgenes.

  17. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  18. Detection of Culex flavivirus and Aedes flavivirus nucleotide sequences in mosquitoes from parks in the city of São Paulo, Brazil.

    Science.gov (United States)

    Fernandes, Licia Natal; de Paula, Marcia Bicudo; Araújo, Alessandra Bergamo; Gonçalves, Elisabeth Fernandes Bertoletti; Romano, Camila Malta; Natal, Delsio; Malafronte, Rosely dos Santos; Marrelli, Mauro Toledo; Levi, José Eduardo

    2016-05-01

    The dengue viruses are widespread in Brazil and are a major public health concern. Other flaviviruses also cause diseases in humans, although on a smaller scale. The city of São Paulo is in a highly urbanized area with few green spaces apart from its parks, which are used for recreation and where potential vertebrate hosts and mosquito vectors of pathogenic Flavivirus species can be found. Although this scenario can contribute to the transmission of Flavivirus to humans, little is known about the circulation of members of this genus in these areas. In light of this, the present study sought to identify Flavivirus infection in mosquitoes (Diptera: Culicidae) collected in parks in the city of São Paulo. Seven parks in different sectors of the city were selected. Monthly mosquito collections were carried out in each park from March 2011 to February 2012 using aspiration and traps (Shannon and CD C-CO2). Nucleic acids were extracted from the mosquitoes collected and used for reverse-transcriptase and real-time polymerase chain reactions with genus-specific primers targeting a 200-nucleotide region in the Flavivirus NS5 gene. Positive samples were sequenced, and phylogenetic analyses were performed. Culex and Aedes were the most frequent genera of Culicidae collected. Culex flavivirus (CxFV)-related and Aedes flavivirus (AEFV)- related nucleotide sequences were detected in 17 pools of Culex and two pools of Aedes mosquitoes, respectively, among the 818 pools of non-engorged females analyzed. To the best of our knowledge, this is the first report of CxFV and AEFV in the city of São Paulo and Latin America, respectively. Both viruses are insect- specific flaviviruses, a group known to replicate only in mosquito cells and induce a cytopathic effect in some situations. Hence, our data suggests that CxFV and AEFV are present in Culex and Aedes mosquitoes, respectively, in parks in the city of São Paulo. Even though Flavivirus species of medical importance were not

  19. Genetic diversity in domesticated soybean (Glycine max) and its wild progenitor (Glycine soja) for simple sequence repeat and single-nucleotide polymorphism loci.

    Science.gov (United States)

    Li, Ying-Hui; Li, Wei; Zhang, Chen; Yang, Liang; Chang, Ru-Zhen; Gaut, Brandon S; Qiu, Li-Juan

    2010-10-01

    • The study of genetic diversity between a crop and its wild relatives may yield fundamental insights into evolutionary history and the process of domestication. • In this study, we genotyped a sample of 303 accessions of domesticated soybean (Glycine max) and its wild progenitor Glycine soja with 99 microsatellite markers and 554 single-nucleotide polymorphism (SNP) markers. • The simple sequence repeat (SSR) loci averaged 21.5 alleles per locus and overall Nei's gene diversity of 0.77. The SNPs had substantially lower genetic diversity (0.35) than SSRs. A SSR analyses indicated that G. soja exhibited higher diversity than G. max, but SNPs provided a slightly different snapshot of diversity between the two taxa. For both marker types, the primary division of genetic diversity was between the wild and domesticated accessions. Within taxa, G. max consisted of four geographic regions in China. G. soja formed six subgroups. Genealogical analyses indicated that cultivated soybean tended to form a monophyletic clade with respect to G. soja. • G. soja and G. max represent distinct germplasm pools. Limited evidence of admixture was discovered between these two species. Overall, our analyses are consistent with the origin of G. max from regions along the Yellow River of China.

  20. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2018-01-01

    Full Text Available Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  1. DIYABC v2.0: a software to make approximate Bayesian computation inferences about population history using single nucleotide polymorphism, DNA sequence and microsatellite data.

    Science.gov (United States)

    Cornuet, Jean-Marie; Pudlo, Pierre; Veyssier, Julien; Dehne-Garcia, Alexandre; Gautier, Mathieu; Leblois, Raphaël; Marin, Jean-Michel; Estoup, Arnaud

    2014-04-15

    DIYABC is a software package for a comprehensive analysis of population history using approximate Bayesian computation on DNA polymorphism data. Version 2.0 implements a number of new features and analytical methods. It allows (i) the analysis of single nucleotide polymorphism data at large number of loci, apart from microsatellite and DNA sequence data, (ii) efficient Bayesian model choice using linear discriminant analysis on summary statistics and (iii) the serial launching of multiple post-processing analyses. DIYABC v2.0 also includes a user-friendly graphical interface with various new options. It can be run on three operating systems: GNU/Linux, Microsoft Windows and Apple Os X. Freely available with a detailed notice document and example projects to academic users at http://www1.montpellier.inra.fr/CBGP/diyabc CONTACT: estoup@supagro.inra.fr Supplementary information: Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  2. Molecular Comparison and Evolutionary Analyses of VP1 Nucleotide Sequences of New African Human Enterovirus 71 Isolates Reveal a Wide Genetic Diversity

    Science.gov (United States)

    Nougairède, Antoine; Joffret, Marie-Line; Deshpande, Jagadish M.; Dubot-Pérès, Audrey; Héraud, Jean-Michel

    2014-01-01

    Most circulating strains of Human enterovirus 71 (EV-A71) have been classified primarily into three genogroups (A to C) on the basis of genetic divergence between the 1D gene, which encodes the VP1 capsid protein. The aim of the present study was to provide further insights into the diversity of the EV-A71 genogroups following the recent description of highly divergent isolates, in particular those from African countries, including Madagascar. We classified recent EV-A71 isolates by a large comparison of 3,346 VP1 nucleotidic sequences collected from GenBank. Analysis of genetic distances and phylogenetic investigations indicated that some recently-reported isolates did not fall into the genogroups A-C and clustered into three additional genogroups, including one Indian genogroup (genogroup D) and 2 African ones (E and F). Our Bayesian phylogenetic analysis provided consistent data showing that the genogroup D isolates share a recent common ancestor with the members of genogroup E, while the isolates of genogroup F evolved from a recent common ancestor shared with the members of the genogroup B. Our results reveal the wide diversity that exists among EV-A71 isolates and suggest that the number of circulating genogroups is probably underestimated, particularly in developing countries where EV-A71 epidemiology has been poorly studied. PMID:24598878

  3. Domain structures and molecular evolution of class I and class II major histocompatibility gene complex (MHC) products deduced from amino acid and nucleotide sequence homologies

    Science.gov (United States)

    Ohnishi, Koji

    1984-12-01

    Domain structures of class I and class II MHC products were analyzed from a viewpoint of amino acid and nucleotide sequence homologies. Alignment statistics revealed that class I (transplantation) antigen H chains consist of four mutually homologous domains, and that class II (HLA-DR) antigen β and α chains are both composed of three mutually homologous ones. The N-terminal three and two domains of class I and class II (both β and α) gene products, respectively, all of which being ˜90 residues long, were concluded to be homologous to β2-microglobulin (β2M). The membraneembedded C-terminal shorter domains of these MHC products were also found to be homologous to one another and to the third domain of class I H chains. Class I H chains were found to be more closely related to class II α chains than to class II β chains. Based on these findings, an exon duplication history from a common ancestral gene encoding a β2M-like primodial protein of one-domain-length up to the contemporary MHC products was proposed.

  4. Whole Genome and Core Genome Multilocus Sequence Typing and Single Nucleotide Polymorphism Analyses of Listeria monocytogenes Isolates Associated with an Outbreak Linked to Cheese, United States, 2013

    Science.gov (United States)

    Luo, Yan; Carleton, Heather; Timme, Ruth; Melka, David; Muruvanda, Tim; Wang, Charles; Kastanis, George; Katz, Lee S.; Turner, Lauren; Fritzinger, Angela; Moore, Terence; Stones, Robert; Blankenship, Joseph; Salter, Monique; Parish, Mickey; Hammack, Thomas S.; Evans, Peter S.; Tarr, Cheryl L.; Allard, Marc W.; Strain, Errol A.; Brown, Eric W.

    2017-01-01

    ABSTRACT Epidemiological findings of a listeriosis outbreak in 2013 implicated Hispanic-style cheese produced by company A, and pulsed-field gel electrophoresis (PFGE) and whole genome sequencing (WGS) were performed on clinical isolates and representative isolates collected from company A cheese and environmental samples during the investigation. The results strengthened the evidence for cheese as the vehicle. Surveillance sampling and WGS 3 months later revealed that the equipment purchased by company B from company A yielded an environmental isolate highly similar to all outbreak isolates. The whole genome and core genome multilocus sequence typing and single nucleotide polymorphism (SNP) analyses results were compared to demonstrate the maximum discriminatory power obtained by using multiple analyses, which were needed to differentiate outbreak-associated isolates from a PFGE-indistinguishable isolate collected in a nonimplicated food source in 2012. This unrelated isolate differed from the outbreak isolates by only 7 to 14 SNPs, and as a result, the minimum spanning tree from the whole genome analyses and certain variant calling approach and phylogenetic algorithm for core genome-based analyses could not provide differentiation between unrelated isolates. Our data also suggest that SNP/allele counts should always be combined with WGS clustering analysis generated by phylogenetically meaningful algorithms on a sufficient number of isolates, and the SNP/allele threshold alone does not provide sufficient evidence to delineate an outbreak. The putative prophages were conserved across all the outbreak isolates. All outbreak isolates belonged to clonal complex 5 and serotype 1/2b and had an identical inlA sequence which did not have premature stop codons. IMPORTANCE In this outbreak, multiple analytical approaches were used for maximum discriminatory power. A PFGE-matched, epidemiologically unrelated isolate had high genetic similarity to the outbreak

  5. Comparing Enterovirus 71 with Coxsackievirus A16 by analyzing nucleotide sequences and antigenicity of recombinant proteins of VP1s and VP4s

    Directory of Open Access Journals (Sweden)

    Sun Yu

    2011-11-01

    Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.

  6. Nucleotide sequencing and analysis of 16S rDNA and 16S-23S rDNA internal spacer region (ISR) of Taylorella equigenitalis, as an important pathogen for contagious equine metritis (CEM).

    Science.gov (United States)

    Kagawa, S; Nagano, Y; Tazumi, A; Murayama, O; Millar, B C; Moore, J E; Matsuda, M

    2006-05-01

    The primer set for 16S rDNA amplified an amplicon of about 1500 bp in length for three strains of Taylorella equigenitalis (NCTC11184(T), Kentucky188 and EQ59). Sequence differences of the 16S rDNA among the six sequences, including three reference sequences, occurred at only a few nucleotide positions and thus, an extremely high sequence similarity of the 16S rDNA was first demonstrated among the six sequences. In addition, the primer set for 16S-23S rDNA internal spacer region (ISR) amplified two amplicons about 1300 bp and 1200 bp in length for the three strains. The ISRs were estimated to be about 920 bp in length for large ISR-A and about 830 bp for small ISR-B. Sequence alignment of the ISR-A and ISR-B demonstrated about 10 base differences between NCTC11184(T) and EQ59 and between Kentucky188 and EQ59. However, only minor sequence differences were demonstrated between the ISR-A and ISR-B from NCTC11184(T) and Kentucky188, respectively. A typical order of the intercistronic tRNAs with the 29 nucleotide spacer of 5'-16S rDNA-tRNA(Ile)-tRNA(Ala)-23S rDNA-3' was demonstrated in the all ISRs. The ISRs may be useful for the discrimination amongst isolates of T. equigenitalis if sequencing is employed.

  7. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    Science.gov (United States)

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  8. Deep sequence analysis of non-small cell lung cancer: Integrated analysis of gene expression, alternative splicing, and single nucleotide variations in lung adenocarcinomas with and without oncogenic KRAS mutations

    Directory of Open Access Journals (Sweden)

    Krishna R Kalari

    2012-02-01

    Full Text Available KRAS mutations are highly prevalent in non-small cell lung cancer (NSCLC, and tumors harboring these mutations tend to be aggressive and resistant to chemotherapy. We used next-generation sequencing technology to identify pathways that are specifically altered in lung tumors harboring a KRAS mutation. Paired-end RNA-sequencing of 15 primary lung adenocarcinoma tumors (8 harboring mutant KRAS and 7 with wild-type KRAS were performed. Sequences were mapped to the human genome, and genomic features, including differentially expressed genes, alternate splicing isoforms and single nucleotide variants, were determined for tumors with and without KRAS mutation using a variety of computational methods. Network analysis was carried out on genes showing differential expression (374 genes, alternate splicing (259 genes and SNV-related changes (65 genes in NSCLC tumors harboring a KRAS mutation. Genes exhibiting two or more connections from the lung adenocarcinoma network were used to carry out integrated pathway analysis. The most significant signaling pathways identified through this analysis were the NFkB, ERK1/2 and AKT pathways. A 27 gene mutant KRAS-specific sub network was extracted based on gene-gene connections within the integrated network, and interrogated for druggable targets. Our results confirm previous evidence that mutant KRAS tumors exhibit activated NFkB, ERK1/2 and AKT pathways and may be preferentially sensitive to target therapeutics toward these pathways. In addition, our analysis indicates novel, previously unappreciated links between mutant KRAS and the TNFR and PPARγ signaling pathways, suggesting that targeted PPARγ antagonists and TNFR inhibitors may be useful therapeutic strategies for treatment of mutant KRAS lung tumors. Our study is the first to integrate genomic features from RNA-Seq data from NSCLC and to define a first draft genomic landscape model that is unique to tumors with oncogenic KRAS mutations.

  9. Deep Sequence Analysis of Non-Small Cell Lung Cancer: Integrated Analysis of Gene Expression, Alternative Splicing, and Single Nucleotide Variations in Lung Adenocarcinomas with and without Oncogenic KRAS Mutations

    International Nuclear Information System (INIS)

    Kalari, Krishna R.; Rossell, David; Necela, Brian M.; Asmann, Yan W.; Nair, Asha

    2012-01-01

    KRAS mutations are highly prevalent in non-small cell lung cancer (NSCLC), and tumors harboring these mutations tend to be aggressive and resistant to chemotherapy. We used next-generation sequencing technology to identify pathways that are specifically altered in lung tumors harboring a KRAS mutation. Paired-end RNA-sequencing of 15 primary lung adenocarcinoma tumors (8 harboring mutant KRAS and 7 with wild-type KRAS) were performed. Sequences were mapped to the human genome, and genomic features, including differentially expressed genes, alternate splicing isoforms and single nucleotide variants, were determined for tumors with and without KRAS mutation using a variety of computational methods. Network analysis was carried out on genes showing differential expression (374 genes), alternate splicing (259 genes), and SNV-related changes (65 genes) in NSCLC tumors harboring a KRAS mutation. Genes exhibiting two or more connections from the lung adenocarcinoma network were used to carry out integrated pathway analysis. The most significant signaling pathways identified through this analysis were the NFκB, ERK1/2, and AKT pathways. A 27 gene mutant KRAS-specific sub network was extracted based on gene–gene connections from the integrated network, and interrogated for druggable targets. Our results confirm previous evidence that mutant KRAS tumors exhibit activated NFκB, ERK1/2, and AKT pathways and may be preferentially sensitive to target therapeutics toward these pathways. In addition, our analysis indicates novel, previously unappreciated links between mutant KRAS and the TNFR and PPARγ signaling pathways, suggesting that targeted PPARγ antagonists and TNFR inhibitors may be useful therapeutic strategies for treatment of mutant KRAS lung tumors. Our study is the first to integrate genomic features from RNA-Seq data from NSCLC and to define a first draft genomic landscape model that is unique to tumors with oncogenic KRAS mutations.

  10. Isolation, characterization, and nucleotide sequence of the Streptococcus mutans mannitol-phosphate dehydrogenase gene and the mannitol-specific factor III gene of the phosphoenolpyruvate phosphotransferase system.

    Science.gov (United States)

    Honeyman, A L; Curtiss, R

    1992-08-01

    Streptococcus mutans, the causative agent of dental caries, utilizes carbohydrates by means of the phosphoenolpyruvate-dependent phosphotransferase system (PTS). The PTS facilitates vectorial translocation of metabolizable carbohydrates to form the corresponding sugar-phosphates, which are subsequently converted to glycolytic intermediates. The PTS consists of both sugar-specific and sugar-independent components. Complementation of an Escherichia coli mtlD mutation with a streptococcal recombinant DNA library allowed isolation of the mannitol-1-phosphate dehydrogenase gene (mtlD) and the adjacent sugar-specific mannitol factor III gene (mtlF) from S. mutans. Subsequent transposon mutagenesis of the complementing DNA fragment with Tn5seq1 defined the region that encodes the mtlD-complementing activity, the streptococcal mtlD gene. Nucleotide sequence analysis of this region revealed two complete open reading frames (ORFs) from within the streptococcal mannitol PTS operon. One ORF encodes the mtlD gene product, a 43.0-kDa protein which exhibits similarity to the E. coli and Enterococcus faecalis mannitol-1-phosphate dehydrogenases. The second ORF encodes a 15.8-kDa protein which exhibits similarity to mannitol factor III proteins from several bacterial species. In vitro transcription-translation assays were used to produce proteins of the sizes predicted by the streptococcal ORFs. These data indicate that the S. mutans mannitol PTS utilizes an enzyme II-factor III complex similar to the mannitol system found in other gram-positive organisms, as opposed to that of E. coli, which utilizes an independent enzyme II system.

  11. Complete nucleotide sequences and construction of full-length infectious cDNA clones of cucumber green mottle mosaic virus (CGMMV) in a versatile newly developed binary vector including both 35S and T7 promoters.

    Science.gov (United States)

    Park, Chan-Hwan; Ju, Hye-Kyoung; Han, Jae-Yeong; Park, Jong-Seo; Kim, Ik-Hyun; Seo, Eun-Young; Kim, Jung-Kyu; Hammond, John; Lim, Hyoun-Sub

    2017-04-01

    Seed-transmitted viruses have caused significant damage to watermelon crops in Korea in recent years, with cucumber green mottle mosaic virus (CGMMV) infection widespread as a result of infected seed lots. To determine the likely origin of CGMMV infection, we collected CGMMV isolates from watermelon and melon fields and generated full-length infectious cDNA clones. The full-length cDNAs were cloned into newly constructed binary vector pJY, which includes both the 35S and T7 promoters for versatile usage (agroinfiltration and in vitro RNA transcription) and a modified hepatitis delta virus ribozyme sequence to precisely cleave RNA transcripts at the 3' end of the tobamovirus genome. Three CGMMV isolates (OMpj, Wpj, and Mpj) were separately evaluated for infectivity in Nicotiana benthamiana, demonstrated by either Agroinfiltration or inoculation with in vitro RNA transcripts. CGMMV nucleotide identities to other tobamoviruses were calculated from pairwise alignments using DNAMAN. CGMMV identities were 49.89% to tobacco mosaic virus; 49.85% to pepper mild mottle virus; 50.47% to tomato mosaic virus; 60.9% to zucchini green mottle mosaic virus; and 60.96% to kyuri green mottle mosaic virus, confirming that CGMMV is a distinct species most similar to other cucurbit-infecting tobamoviruses. We further performed phylogenetic analysis to determine relationships of our new Korean CGMMV isolates to previously characterized isolates from Canada, China, India, Israel, Japan, Korea, Russia, Spain, and Taiwan available from NCBI. Analysis of CGMMV amino acid sequences showed three major clades, broadly typified as 'Russian,' 'Israeli,' and 'Asian' groups. All of our new Korean isolates fell within the 'Asian' clade. Neither the 128 nor 186 kDa RdRps of the three new isolates showed any detectable gene silencing suppressor function.

  12. Molecular inversion probes equipped with discontinuous rolling cycle amplification for targeting nucleotide variants: Determining SMN1 and SMN2 genes in diagnosis of spinal muscular atrophy.

    Science.gov (United States)

    Kou, Hwang-Shang; Wang, Chun-Chi

    2017-07-18

    The novel techniques of molecular inversion probes (MIPs) combined with discontinuous rolling cycle amplification (DRCA) was developed for determination of the multi-nucleotide variants at single base. The different-length MIPs, a padlock-probe based technology, are designed to simultaneously recognize the identical nucleotide variants. After ligation and DRCA, the different-length genetic products representing the certain genotypes could be simply determined by the short-end capillary electrophoresis (CE) method. By using MIPs-DRCA method, the various gene dosages of SMN1 and SMN2 genes in homologous or heterologous subjects were successfully quantified for diagnosis of spinal muscular atrophy (SMA). The length of the MIP for SMN1 gene was 106 bp, and for SMN2 gene was 86 bp. After method optimization, the MIP products of SMN1 and SMN2 were well separated with the resolution of 1.13 ± 0.17 (n = 3) within 10 min. There were total of 56 DNA blind samples analyzed by this strategy, including 38 wild types, 12 carriers and 6 SMA patients, and the data of gene dosages was corresponding to those analyzed by conformation sensitive CE and denatured high performance liquid chromatography (DHPLC) methods. This MIPs-DRCA method which could be applied to simultaneously genotype multi nucleotide variants at single base, such as K-ras gene, was very feasible for determination of genetic diseases in clinical. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Retroviral DNA Sequences as a Means for Determining Ancient Diets.

    Directory of Open Access Journals (Sweden)

    Jessica I Rivera-Perez

    Full Text Available For ages, specialists from varying fields have studied the diets of the primeval inhabitants of our planet, detecting diet remains in archaeological specimens using a range of morphological and biochemical methods. As of recent, metagenomic ancient DNA studies have allowed for the comparison of the fecal and gut microbiomes associated to archaeological specimens from various regions of the world; however the complex dynamics represented in those microbial communities still remain unclear. Theoretically, similar to eukaryote DNA the presence of genes from key microbes or enzymes, as well as the presence of DNA from viruses specific to key organisms, may suggest the ingestion of specific diet components. In this study we demonstrate that ancient virus DNA obtained from coprolites also provides information reconstructing the host's diet, as inferred from sequences obtained from pre-Columbian coprolites. This depicts a novel and reliable approach to determine new components as well as validate the previously suggested diets of extinct cultures and animals. Furthermore, to our knowledge this represents the first description of the eukaryotic viral diversity found in paleofaeces belonging to pre-Columbian cultures.

  14. Ion torrent personal genome machine sequencing for genomic typing of Neisseria meningitidis for rapid determination of multiple layers of typing information.

    Science.gov (United States)

    Vogel, Ulrich; Szczepanowski, Rafael; Claus, Heike; Jünemann, Sebastian; Prior, Karola; Harmsen, Dag

    2012-06-01

    Neisseria meningitidis causes invasive meningococcal disease in infants, toddlers, and adolescents worldwide. DNA sequence-based typing, including multilocus sequence typing, analysis of genetic determinants of antibiotic resistance, and sequence typing of vaccine antigens, has become the standard for molecular epidemiology of the organism. However, PCR of multiple targets and consecutive Sanger sequencing provide logistic constraints to reference laboratories. Taking advantage of the recent development of benchtop next-generation sequencers (NGSs) and of BIGSdb, a database accommodating and analyzing genome sequence data, we therefore explored the feasibility and accuracy of Ion Torrent Personal Genome Machine (PGM) sequencing for genomic typing of meningococci. Three strains from a previous meningococcus serogroup B community outbreak were selected to compare conventional typing results with data generated by semiconductor chip-based sequencing. In addition, sequencing of the meningococcal type strain MC58 provided information about the general performance of the technology. The PGM technology generated sequence information for all target genes addressed. The results were 100% concordant with conventional typing results, with no further editing being necessary. In addition, the amount of typing information, i.e., nucleotides and target genes analyzed, could be substantially increased by the combined use of genome sequencing and BIGSdb compared to conventional methods. In the near future, affordable and fast benchtop NGS machines like the PGM might enable reference laboratories to switch to genomic typing on a routine basis. This will reduce workloads and rapidly provide information for laboratory surveillance, outbreak investigation, assessment of vaccine preventability, and antibiotic resistance gene monitoring.

  15. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Directory of Open Access Journals (Sweden)

    Mullen Michael P

    2011-01-01

    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  16. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα)-encoding (GNAS) genomic imprinting domain are associated with performance traits

    Science.gov (United States)

    2011-01-01

    Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs) spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS) domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486) were located upstream of the GNAS gene, while one SNP (rs41694646) was located in the second intron of the GNAS gene. The final SNP (rs41694656) was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646) is associated (P ≤ 0.05) with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf) and gestation length. Association (P ≤ 0.01) with direct calving difficulty (i.e. due to calf size) and maternal calving difficulty (i.e. due to the maternal pelvic width size) was also observed at the rs43101491 SNP. Following

  17. Equine herpesvirus 1 (EHV-1) nucleotide polymorphism determination using formalin fixed tissues in EHV-1 induced abortions and myelopathies with real-time PCR and pyrosequencing.

    Science.gov (United States)

    Tewari, Deepanker; Del Piero, Fabio; Cieply, Stephen; Feria, Willard; Acland, Helen

    2013-11-01

    Equine herpesvirus-1 (EHV-1) strains with a single point mutation at the 2254 nucleotide position with a G2254 constitution within the DNA polymerase gene are associated strongly with equine myeloencephalopathies. Infections with non-neuropathogenic EHV-1 strains without the G2254 nucleotide but with an A2254 nucleotide are associated less frequently with equine neurologic disease. A retrospective study utilizing DNA extracted from formalin fixed paraffin embedded tissues was conducted with real time PCR and pyrosequencing, to determine the infecting EHV-1 strains. Infection with EHV-1 A2254 and or G2254 strain was detected with real time PCR, and was confirmed with a rapid pyrosequencing technique. Pyrosequencing was useful in at least 2 cases where real time PCR was equivocal in determining the infecting EHV-1 strain type. The strain with G2254 mutation was detected in 9.4% of 21 studied abortion cases, and in 86.6% of 15 neurologic cases. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Determination of nucleosides and nucleotides in baby foods by hydrophilic interaction chromatography coupled to tandem mass spectrometry in the presence of hydrophilic ion-pairing reagents.

    Science.gov (United States)

    Mateos-Vivas, María; Rodríguez-Gonzalo, Encarnación; Domínguez-Álvarez, Javier; García-Gómez, Diego; Carabias-Martínez, Rita

    2016-11-15

    In this work we propose a rapid and efficient method for the joint determination of nucleosides and nucleotides in dairy and non-dairy baby foods based on hydrophilic interaction chromatography coupled to tandem mass spectrometry in the presence of diethylammonium (DEA) as a hydrophilic ion-pairing reagent (IP-HILIC-MS/MS). Sample treatment of the baby food included dilution with water and centrifugal ultrafiltration (CUF) with an additional washing step that notably improved the global performance of the process. Later dilution of the extract with acetonitrile allowed adequate separation in the HILIC system. With the proposed treatment, we obtained extraction recoveries higher than 80% and, additionally, no matrix effects were observed. The CUF-IP-HILIC-MS/MS method was validated according to the 2002/657/EC decision and was used for the quantification of nucleotides and nucleosides in sixteen samples of commercial baby foods. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  20. Immunohistochemical staining patterns of p53 can serve as a surrogate marker for TP53 mutations in ovarian carcinoma: an immunohistochemical and nucleotide sequencing analysis.

    Science.gov (United States)

    Yemelyanova, Anna; Vang, Russell; Kshirsagar, Malti; Lu, Dan; Marks, Morgan A; Shih, Ie Ming; Kurman, Robert J

    2011-09-01

    Immunohistochemical staining for p53 is used as a surrogate for mutational analysis in the diagnostic workup of carcinomas of multiple sites including ovarian cancers. Strong and diffuse immunoexpression of p53 is generally interpreted as likely indicating a TP53 gene mutation. The immunoprofile that correlates with wild-type TP53, however, is not as clear. In particular, the significance of completely negative immunostaining is controversial. The aim of this study was to clarify the relationship of the immunohistochemical expression of p53 with the mutational status of the TP53 gene in ovarian cancer. A total of 57 ovarian carcinomas (43 high-grade serous ovarian/peritoneal carcinomas, 2 malignant mesodermal mixed tumors (carcinosarcomas), 2 low-grade serous carcinomas, 4 clear cell carcinomas, 1 well-differentiated endometrioid carcinoma, and 5 carcinomas with mixed epithelial differentiation) were analyzed for TP53 mutations by nucleotide sequencing (exons 4-9), and subjected to immunohistochemical analysis of p53 expression. Thirty six tumors contained functional mutations and 13 had wild type TP53. Five tumors were found to harbor known TP53 polymorphism and changes in the intron region were detected in three. Tumors with wild-type TP53 displayed a wide range of immunolabeling patterns, with the most common pattern showing ≤10% of positive cells in 6 cases (46%). Mutant TP53 was associated with 60-100% positive cells in 23 cases (64% of cases). This pattern of staining was also seen in three cases with wild-type TP53. Tumors that were completely negative (0% cells staining) had a mutation of TP53 in 65% of cases and wild-type TP53 in 11%. Combining two immunohistochemical labeling patterns associated with TP53 mutations (0% and 60-100% positive cells), correctly identified a mutation in 94% of cases (Povarian carcinomas. In addition to a strong and diffuse pattern of p53 expression (in greater than 60% of cells), complete absence of p53 immunoexpression is

  1. Analysis of complete nucleotide sequences of Angolan hepatitis B virus isolates reveals the existence of a separate lineage within genotype E.

    Directory of Open Access Journals (Sweden)

    Barbara V Lago

    Full Text Available Hepatitis B virus genotype E (HBV/E is highly prevalent in Western Africa. In this work, 30 HBV/E isolates from HBsAg positive Angolans (staff and visitors of a private hospital in Luanda were genetically characterized: 16 of them were completely sequenced and the pre-S/S sequences of the remaining 14 were determined. A high proportion (12/30, 40% of subjects tested positive for both HBsAg and anti-HBs markers. Deduced amino acid sequences revealed the existence of specific substitutions and deletions in the B- and T-cell epitopes of the surface antigen (pre-S1- and pre-S2 regions of the virus isolates derived from 8/12 individuals with concurrent HBsAg/anti-HBs. Phylogenetic analysis performed with 231 HBV/E full-length sequences, including 16 from this study, showed that all isolates from Angola, Namibia and the Democratic Republic of Congo (n = 28 clustered in a separate lineage, divergent from the HBV/E isolates from nine other African countries, namely Cameroon, Central African Republic, Côte d'Ivoire, Ghana, Guinea, Madagascar, Niger, Nigeria and Sudan, with a Bayesian posterior probability of 1. Five specific mutations, namely small S protein T57I, polymerase Q177H, G245W and M612L, and X protein V30L, were observed in 79-96% of the isolates of the separate lineage, compared to a frequency of 0-12% among the other HBV/E African isolates.

  2. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  3. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    and briefly describe the methods that are preferred for SNP typing in forensic genetics. In addition, we will illustrate how SNPs can be used as investigative leads in the police investigation by discussing the use of ancestry informative markers and forensic DNA phenotyping. Modern DNA sequencing......Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... technologies (also called next generation sequencing or NGS) have the potential to completely transform forensic genetic investigations as we know them today. Here, we will make a short introduction to NGS and explain how NGS may combine analysis of the traditional forensic genetic markers with analysis...

  4. The conformation of 23S rRNA nucleotide A2058 determines its recognition by the ErmE methyltransferase

    DEFF Research Database (Denmark)

    Vester, B; Hansen, L H; Douthwaite, S

    1995-01-01

    The ErmE methyltransferase confers resistance to MLS antibiotics by specifically dimethylating adenine 2058 (A2058, Escherichia coli numbering) in bacterial 23S rRNA. To define nucleotides in the rRNA that are part of the motif recognized by ErmE, we investigated both in vivo and in vitro...... the effects of mutations around position A2058 on methylation. Mutagenizing A2058 (to G or U) completely abolishes methylation of 23S rRNA by ErmE. No methylation occurred at other sites in the rRNA, demonstrating the fidelity of ErmE for A2058. Breaking the neighboring G2057-C2611 Watson-Crick base pair...... and it was shown that the A2057 and U2611 mutations alone and in combination alter the reactivity of A2058 and adjacent bases. However, mutagenizing position G-->A2032 in an adjacent loop, which has been implicated to interact with A2058, alters neither the ErmE methylation at A2058 nor the accessibility...

  5. Determining and comparing protein function in Bacterial genome sequences

    DEFF Research Database (Denmark)

    Vesth, Tammi Camilla

    annotation of genes – the descriptions assigned to genes that describe the likely function of the encoded proteins. This process is limited by several factors, including the definition of a function which can be more or less specific as well as how many genes can actually be assigned a function based...... of proteins were clustered based on sequence domains so that each group represented a protein function. Each function was then modeled using Arti- ficial Neural Networks (ANN) and the model was evaluated based on its ability to identify true positives and negatives, that is proteins with or without...... the function of the model. The models were used to annotate a number of proteins without functional annotations and predicted functions for 98% of the genes. Evaluation of the precision of the method was performed, using data from the Critical Assessment of Functional Annotation (CAFA) project, and correct...

  6. Complete sequence determination of a novel reptile iridovirus isolated from soft-shelled turtle and evolutionary analysis of Iridoviridae

    Directory of Open Access Journals (Sweden)

    Wang Xiujie

    2009-05-01

    Full Text Available Abstract Background Soft-shelled turtle iridovirus (STIV is the causative agent of severe systemic diseases in cultured soft-shelled turtles (Trionyx sinensis. To our knowledge, the only molecular information available on STIV mainly concerns the highly conserved STIV major capsid protein. The complete sequence of the STIV genome is not yet available. Therefore, determining the genome sequence of STIV and providing a detailed bioinformatic analysis of its genome content and evolution status will facilitate further understanding of the taxonomic elements of STIV and the molecular mechanisms of reptile iridovirus pathogenesis. Results We determined the complete nucleotide sequence of the STIV genome using 454 Life Science sequencing technology. The STIV genome is 105 890 bp in length with a base composition of 55.1% G+C. Computer assisted analysis revealed that the STIV genome contains 105 potential open reading frames (ORFs, which encode polypeptides ranging from 40 to 1,294 amino acids and 20 microRNA candidates. Among the putative proteins, 20 share homology with the ancestral proteins of the nuclear and cytoplasmic large DNA viruses (NCLDVs. Comparative genomic analysis showed that STIV has the highest degree of sequence conservation and a colinear arrangement of genes with frog virus 3 (FV3, followed by Tiger frog virus (TFV, Ambystoma tigrinum virus (ATV, Singapore grouper iridovirus (SGIV, Grouper iridovirus (GIV and other iridovirus isolates. Phylogenetic analysis based on conserved core genes and complete genome sequence of STIV with other virus genomes was performed. Moreover, analysis of the gene gain-and-loss events in the family Iridoviridae suggested that the genes encoded by iridoviruses have evolved for favoring adaptation to different natural host species. Conclusion This study has provided the complete genome sequence of STIV. Phylogenetic analysis suggested that STIV and FV3 are strains of the same viral species belonging to the

  7. Capillary electrophoresis coupled to mass spectrometry employing hexafluoro-2-propanol for the determination of nucleosides and nucleotide mono-, di- and tri-phosphates in baby foods.

    Science.gov (United States)

    Mateos-Vivas, María; Domínguez-Álvarez, Javier; Rodríguez-Gonzalo, Encarnación; Carabias-Martínez, Rita

    2017-10-15

    The present work describes a method for the simultaneous determination of unmodified nucleosides and nucleotide mono-, di- and tri-phosphates by capillary electrophoresis coupled to mass spectrometry (CE-MS). The use of hexafluoro-2-propanol (HFIP) in the separation medium, and as an additive to the sheath liquid of the electrospray interface (ESI), generated a highly efficient and sensitive method. Instrumental limits of detection in the range of 14-53ngmL -1 for nucleosides and 7-23, 20-49 and 64-124ngmL -1 for nucleotide mono-, di-, and tri-phosphates, respectively, were found. Sample treatment involved diluting an aliquot of baby food with ultra-high quality water and applying centrifugation-assisted ultrafiltration (CUF). The proposed method was validated and used to analyse a variety of baby food samples (16 in total) such as fish, meat, fruits, and baby dairy desserts that may endogenously contain these analytes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Population Dynamics of Staphylococcus aureus in Cystic Fibrosis Patients To Determine Transmission Events by Use of Whole-Genome Sequencing.

    Science.gov (United States)

    Ankrum, Andrea; Hall, Barry G

    2017-07-01

    Strict infection control practices have been implemented for health care visits by cystic fibrosis (CF) patients in an attempt to prevent transmission of important pathogens. This study used whole-genome sequencing (WGS) to determine strain relatedness and assess population dynamics of Staphylococcus aureus isolates from a cohort of CF patients as assessed by strain relatedness. A total of 311 S. aureus isolates were collected from respiratory cultures of 115 CF patients during a 22-month study period. Whole-genome sequencing was performed, and using single nucleotide polymorphism (SNP) analysis, phylogenetic trees were assembled to determine relatedness between isolates. Methicillin-resistant Staphylococcus aureus (MRSA) phenotypes were predicted using PPFS2 and compared to the observed phenotype. The accumulation of SNPs in multiple isolates obtained over time from the same patient was examined to determine if a genomic molecular clock could be calculated. Pairs of isolates with ≤71 SNP differences were considered to be the "same" strain. All of the "same" strain isolates were either from the same patient or siblings pairs. There were 47 examples of patients being superinfected with an unrelated strain. The predicted MRSA phenotype was accurate in all but three isolates. Mutation rates were unable to be determined because the branching order in the phylogenetic tree was inconsistent with the order of isolation. The observation that transmissions were identified between sibling patients shows that WGS is an effective tool for determining transmission between patients. The observation that transmission only occurred between siblings suggests that Staphylococcus aureus acquisition in our CF population occurred outside the hospital environment and indicates that current infection prevention efforts appear effective. Copyright © 2017 American Society for Microbiology.

  9. DNA authentication of Plantago Herb based on nucleotide sequences of 18S-28S rRNA internal transcribed spacer region.

    Science.gov (United States)

    Sahin, Fatma Pinar; Yamashita, Hiromi; Guo, Yahong; Terasaka, Kazuyoshi; Kondo, Toshiya; Yamamoto, Yutaka; Shimada, Hiroshi; Fujita, Masao; Kawasaki, Takeshi; Sakai, Eiji; Tanaka, Toshihiro; Goda, Yukihiro; Mizukami, Hajime

    2007-07-01

    Internal transcribed spacer (ITS) regions of nuclear ribosomal RNA gene were amplified from 23 plant- and herbarium specimens belonging to eight Plantago species (P. asiatica, P. depressa, P. major, P. erosa, P. hostifolia, P. camtschatica, P. virginica and P. lanceolata). Sequence comparison indicated that these Plantago species could be identified based on the sequence type of the ITS locus. Sequence analysis of the ITS regions amplified from the crude drug Plantago Herb obtained in the markets indicated that all the drugs from Japan were derived from P. asiatica whereas the samples obtained in China were originated from various Plantago species including P. asiatica, P. depressa, P. major and P. erosa.

  10. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    The plastid genome regions of two intergenic spacers, psbA–trnH and trnL–trnF, were sequenced to study the nucleotide diversity and phylogenetic relationships among Gladiolus cultivars. Nucleotide diversity of psbA–trnH region was higher than trnL–trnF region of chloroplast. We employed Bayesian, maximum ...

  11. Peptide and nucleotide sequences of rat CD4 (W3/25) antigen: evidence for derivation from a structure with four immunoglobulin-related domains

    International Nuclear Information System (INIS)

    Clark, S.J.; Jefferies, W.A.; Barclay, A.N.; Gagnon, J.; Williams, A.F.

    1987-01-01

    The rat W3/25 antigen was the first marker antigen of helper T lymphocytes to be identified. Subsequently, the human OKT4 antigen (now called CD4) was described, and cell distribution and functional data suggested that W3/25 and OKT4 antigens were homologous. This is now confirmed by the matching of peptide sequences from W3/25 antigen with sequence predicted from rat cDNA clones detected by cross-hybridization with a cDNA probe for human CD4. Analysis of the two sequences suggests an evolutionary origin from a structure with four immunoglobulin-related domains, although only domain 1 at the NH 2 terminus meets the standard criteria for an immunoglobulin-related sequence. CD4 domains 2 and 4 contain disulfide bonds but seem like truncated immunoglobulin domains, whereas domain 3 may have a pattern of β-strands like an immunoglobulin variable domain, but without the disulfide bond

  12. The nucleotide sequence of the Desulfovibrio gigas desulforedoxin gene indicates that the Desulfovibrio vulgaris rbo gene originated from a gene fusion event.

    OpenAIRE

    Brumlik, M J; Leroy, G; Bruschi, M; Voordouw, G

    1990-01-01

    Expression of the rbo gene from Desulfovibrio vulgaris Hildenborough in Escherichia coli minicells and Western blotting (immunoblotting) of Desulfovibrio cell extracts with antibodies raised against a synthetic peptide indicated the presence of a 14-kDa polypeptide product, as expected from the gene sequence. Cloning and sequencing of the gene (dsr) for desulforedoxin, a 4-kDa redox protein from Desulfovibrio gigas, showed that it is formed by expression of an autonomous gene of 111 bp, not b...

  13. Human heart cytochrome c oxidase subunit VIII. Purification and determination of the complete amino acid sequence

    NARCIS (Netherlands)

    van Kuilenburg, A. B.; Muijsers, A. O.; Demol, H.; Dekker, H. L.; van Beeumen, J. J.

    1988-01-01

    Subunit VIII was purified from a preparation of the human heart cytochrome c oxidase and its complete amino acid sequence was determined. The sequence proved to be much more related to that of the bovine liver oxidase subunit VIII than to that found in bovine heart. Our finding of a 'liver-type'

  14. Targeted genomic enrichment and sequencing of CyHV-3 from carp tissues confirms low nucleotide diversity and mixed genotype infections

    Directory of Open Access Journals (Sweden)

    Saliha Hammoumi

    2016-09-01

    Full Text Available Koi herpesvirus disease (KHVD is an emerging disease that causes mass mortality in koi and common carp, Cyprinus carpio L. Its causative agent is Cyprinid herpesvirus 3 (CyHV-3, also known as koi herpesvirus (KHV. Although data on the pathogenesis of this deadly virus is relatively abundant in the literature, still little is known about its genomic diversity and about the molecular mechanisms that lead to such a high virulence. In this context, we developed a new strategy for sequencing full-length CyHV-3 genomes directly from infected fish tissues. Total genomic DNA extracted from carp gill tissue was specifically enriched with CyHV-3 sequences through hybridization to a set of nearly 2 million overlapping probes designed to cover the entire genome length, using KHV-J sequence (GenBank accession number AP008984 as reference. Applied to 7 CyHV-3 specimens from Poland and Indonesia, this targeted genomic enrichment enabled recovery of the full genomes with >99.9% reference coverage. The enrichment rate was directly correlated to the estimated number of viral copies contained in the DNA extracts used for library preparation, which varied between ∼5000 and ∼2×107. The average sequencing depth was >200 for all samples, thus allowing the search for variants with high confidence. Sequence analyses highlighted a significant proportion of intra-specimen sequence heterogeneity, suggesting the presence of mixed infections in all investigated fish. They also showed that inter-specimen genetic diversity at the genome scale was very low (>99.95% of sequence identity. By enabling full genome comparisons directly from infected fish tissues, this new method will be valuable to trace outbreaks rapidly and at a reasonable cost, and in turn to understand the transmission routes of CyHV-3.

  15. Nucleotide sequence of the goat embryonic alpha globin gene (zeta) and linkage and evolutionary analysis of the complete alpha globin cluster.

    Science.gov (United States)

    Wernke, S M; Lingrel, J B

    1986-12-05

    In previous studies we identified and sequenced clones containing two adult alpha globin genes of the goat. Additional studies have revealed the presence of an embryonic alpha globin gene termed zeta. Sequence analysis of the gene shows that it is the largest mammalian or avian globin gene cloned to date. Its unusual size is mainly due to a 14 base-pair tandem repeat sequence in its first intron. A similar sequence is also found in the first intron of the human zeta gene. The goat zeta coding sequence differs greatly from that of the adult alpha, particularly at amino acid position 38, where it codes for the amino acid replacement of Gln for Thr. This change may confer a higher intrinsic O2 affinity on the zeta globin protein, ensuring a sufficient O2 supply for the developing goat embryo. The cloning and sequencing of this gene completes the alpha globin locus of the goat, composed of three genes in the following order 5'-zeta-I alpha-II alpha-3'. Evolutionary comparisons of the goat alpha locus with other amphibian, avian and mammalian loci reveal several interesting features. Statistical analysis confirms the hypothesis that the embryonic alpha gene is much older (400 million years) than the embryonic beta gene (200 million years), and that it is descended from a primordial gene, whose present-day counterpart is the Xenopus larval alpha globin gene. Our results also suggest that after the divergence of the avian line, the alpha A gene converted the alpha D gene during the evolution of the pre-mammalian line. The alpha D globin gene remains unconverted in the avian line, potentially because of insertion/deletion sequences that may prevent any gene conversion event. The divergence rates of specific globin genes have been analyzed and found to form an essentially straight line, in agreement with the neutralist view of evolution.

  16. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  17. Whole-Genome Bisulfite Sequencing for the Analysis of Genome-Wide DNA Methylation and Hydroxymethylation Patterns at Single-Nucleotide Resolution.

    Science.gov (United States)

    Kernaleguen, Magali; Daviaud, Christian; Shen, Yimin; Bonnet, Eric; Renault, Victor; Deleuze, Jean-François; Mauger, Florence; Tost, Jörg

    2018-01-01

    The analysis of genome-wide epigenomic alterations including DNA methylation and hydroxymethylation has become a subject of intensive research for many biological and disease-associated investigations. Whole-genome bisulfite sequencing (WGBS) using next-generation sequencing technologies is currently considered as the gold standard for a comprehensive and quantitative analysis of DNA methylation throughout the genome. However, bisulfite conversion does not allow distinguishing between cytosine methylation and hydroxymethylation requiring an additional chemical or enzymatic step to identify hydroxymethylated cytosines. Here we provide two detailed protocols based on commercial kits for the preparation of sequencing libraries for the comprehensive whole-genome analysis of DNA methylation and/or hydroxymethylation. If only DNA methylation is of interest, sequencing libraries can be constructed from limited amounts of input DNA by ligation of methylated adaptors to the fragmented DNA prior to bisulfite conversion. For samples with significant levels of hydroxymethylation such as stem cells or brain tissue, we describe the protocol of oxidative bisulfite sequencing (OxBs-seq), which in its current version uses a post-bisulfite adaptor tagging (PBAT) approach. Two methylomes need to be generated: a classic methylome following bisulfite conversion and analyzing both methylated and hydroxymethylated cytosines and a methylome analyzing only methylated cytosines, respectively. We also provide a step-by-step description of the data analysis using publicly available bioinformatic tools. The described protocols have been successfully applied to different human samples and yield robust and reproducible results.

  18. Determining mutant spectra of three RNA viral samples using ultra-deep sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H

    2012-06-06

    RNA viruses have extremely high mutation rates that enable the virus to adapt to new host environments and even jump from one species to another. As part of a viral transmission study, three viral samples collected from naturally infected animals were sequenced using Illumina paired-end technology at ultra-deep coverage. In order to determine the mutant spectra within the viral quasispecies, it is critical to understand the sequencing error rates and control for false positive calls of viral variants (point mutantations). I will estimate the sequencing error rate from two control sequences and characterize the mutant spectra in the natural samples with this error rate.

  19. Water buffalo kappa-casein gene sequence

    Directory of Open Access Journals (Sweden)

    A. Mancusi

    2010-02-01

    Full Text Available The aim of the present work was to determine the nucleotide sequence of the water buffalo CSN3 gene (κ-casein. Two overlapping clones from a genomic water buffalo library were sequenced. The sequence comprises the five exons, the relative introns, 1057 nt at the 5’ end of the gene and 476 nt downstream the polyadenylation site. In order to identify polymorphisms responsible for amino acid differences, all the five exons from 10 genetically unrelated water buffaloes were sequenced. The comparison of the obtained sequences confirmed the two single nucleotide polymorphisms already reported in literature at the fourth exon: T versus C at codon 135 (IleATC versus ThrACC and the silent mutation T versus C at codon 136. The comparison of the promoter sequences of two animals homozygous for 135Thr and 135Ile respectively, evidenced 3 single nucleotide polymorphisms that could alter the expression of the gene.

  20. Computer Simulation of the Determination of Amino Acid Sequences in Polypeptides

    Science.gov (United States)

    Daubert, Stephen D.; Sontum, Stephen F.

    1977-01-01

    Describes a computer program that generates a random string of amino acids and guides the student in determining the correct sequence of a given protein by using experimental analytic data for that protein. (MLH)

  1. The soybean-Phytophthora resistance locus Rps1-k encompasses coiled coil-nucleotide binding-leucine rich repeat-like genes and repetitive sequences

    Directory of Open Access Journals (Sweden)

    Bhattacharyya Madan K

    2008-03-01

    Full Text Available Abstract Background A series of Rps (resistance to Pytophthora sojae genes have been protecting soybean from the root and stem rot disease caused by the Oomycete pathogen, Phytophthora sojae. Five Rps genes were mapped to the Rps1 locus located near the 28 cM map position on molecular linkage group N of the composite genetic soybean map. Among these five genes, Rps1-k was introgressed from the cultivar, Kingwa. Rps1-k has been providing stable and broad-spectrum Phytophthora resistance in the major soybean-producing regions of the United States. Rps1-k has been mapped and isolated. More than one functional Rps1-k gene was identified from the Rps1-k locus. The clustering feature at the Rps1-k locus might have facilitated the expansion of Rps1-k gene numbers and the generation of new recognition specificities. The Rps1-k region was sequenced to understand the possible evolutionary steps that shaped the generation of Phytophthora resistance genes in soybean. Results Here the analyses of sequences of three overlapping BAC clones containing the 184,111 bp Rps1-k region are reported. A shotgun sequencing strategy was applied in sequencing the BAC contig. Sequence analysis predicted a few full-length genes including two Rps1-k genes, Rps1-k-1 and Rps1-k-2. Previously reported Rps1-k-3 from this genomic region 1 was evolved through intramolecular recombination between Rps1-k-1 and Rps1-k-2 in Escherichia coli. The majority of the predicted genes are truncated and therefore most likely they are nonfunctional. A member of a highly abundant retroelement, SIRE1, was identified from the Rps1-k region. The Rps1-k region is primarily composed of repetitive sequences. Sixteen simple repeat and 63 tandem repeat sequences were identified from the locus. Conclusion These data indicate that the Rps1 locus is located in a gene-poor region. The abundance of repetitive sequences in the Rps1-k region suggested that the location of this locus is in or near a

  2. Determination of genetic relatedness from low-coverage human genome sequences using pedigree simulations.

    Science.gov (United States)

    Martin, Michael D; Jay, Flora; Castellano, Sergi; Slatkin, Montgomery

    2017-08-01

    We develop and evaluate methods for inferring relatedness among individuals from low-coverage DNA sequences of their genomes, with particular emphasis on sequences obtained from fossil remains. We suggest the major factors complicating the determination of relatedness among ancient individuals are sequencing depth, the number of overlapping sites, the sequencing error rate and the presence of contamination from present-day genetic sources. We develop a theoretical model that facilitates the exploration of these factors and their relative effects, via measurement of pairwise genetic distances, without calling genotypes, and determine the power to infer relatedness under various scenarios of varying sequencing depth, present-day contamination and sequencing error. The model is validated by a simulation study as well as the analysis of aligned sequences from present-day human genomes. We then apply the method to the recently published genome sequences of ancient Europeans, developing a statistical treatment to determine confidence in assigned relatedness that is, in some cases, more precise than previously reported. As the majority of ancient specimens are from animals, this method would be applicable to investigate kinship in nonhuman remains. The developed software grups (Genetic Relatedness Using Pedigree Simulations) is implemented in Python and freely available. © 2017 John Wiley & Sons Ltd.

  3. Population genetic structure in farm and feral American mink (Neovison vison) inferred from RAD sequencing-generated single nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Thirstrup, Janne Pia; Ruiz-Gonzalez, Aritz; Pujolar, José Martin

    2015-01-01

    Feral American mink populations (Neovison vison), derived from mink farms, are widespread in Europe. In this study we investigated genetic diversity and genetic differentiation between feral and farm mink using a panel of genetic markers (194 SNP) generated from RAD sequencing data. Sampling incl...

  4. NUCLEOTIDE SEQUENCING AND TRANSCRIPTIONAL MAPPING OF THE GENES ENCODING BIPHENYL DIOXYGENASE, A MULTICOM- PONENT POLYCHLORINATED-BIPHENYL-DEGRADING ENZYME IN PSEUDOMONAS STRAIN LB400

    Science.gov (United States)

    The DNA region encoding biphenyl dioxygenase, the first enzyme in the biphenyl-polychlorinated biphenyl degradation pathway of Pseudomonas species strain LB400, was sequenced. Six open reading frames were identified, four of which are homologous to the components of toluene dioxy...

  5. A STUDY ON DETERMINING THE REFERENCE SPREADING SEQUENCES FOR A DS/CDMACOMMUNICATION SYSTEM

    Directory of Open Access Journals (Sweden)

    Cebrail ÇİFTLİKLİ

    2002-02-01

    Full Text Available In a direct sequence/code division multiple access (DS/CDMA system, the role of the spreading sequences (codes is crucial since the multiple access interference (MAI is the main performance limitation. In this study, we propose an accurate criterion which enables the determination of the reference spreading codes which yield lower bit error rates (BER's in a given code set for a DS/CDMA system using despreading sequences weighted by stepping chip waveforms. The numerical results show that the spreading codes determined by the proposed criterion are the most suitable codes for using as references.

  6. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    OpenAIRE

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van, L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily extensible. We present a genome annotation system for prokaryote genomes, which is well tested and readily adaptable to different tasks. The modular system was developed using an object-oriented approac...

  7. Mapping and validation of the major sex-determining region in Nile tilapia (Oreochromis niloticus L. Using RAD sequencing.

    Directory of Open Access Journals (Sweden)

    Christos Palaiokostas

    Full Text Available Sex in Oreochromis niloticus (Nile tilapia is principally determined by an XX/XY locus but other genetic and environmental factors also influence sex ratio. Restriction Associated DNA (RAD sequencing was used in two families derived from crossing XY males with females from an isogenic clonal line, in order to identify Single Nucleotide Polymorphisms (SNPs and map the sex-determining region(s. We constructed a linkage map with 3,802 SNPs, which corresponded to 3,280 informative markers, and identified a major sex-determining region on linkage group 1, explaining nearly 96% of the phenotypic variance. This sex-determining region was mapped in a 2 cM interval, corresponding to approximately 1.2 Mb in the O. niloticus draft genome. In order to validate this, a diverse family (4 families; 96 individuals in total and population (40 broodstock individuals test panel were genotyped for five of the SNPs showing the highest association with phenotypic sex. From the expanded data set, SNPs Oni23063 and Oni28137 showed the highest association, which persisted both in the case of family and population data. Across the entire dataset all females were found to be homozygous for these two SNPs. Males were heterozygous, with the exception of five individuals in the population and two in the family dataset. These fish possessed the homozygous genotype expected of females. Progeny sex ratios (over 95% females from two of the males with the "female" genotype indicated that they were neomales (XX males. Sex reversal induced by elevated temperature during sexual differentiation also resulted in phenotypic males with the "female" genotype. This study narrows down the region containing the main sex-determining locus, and provides genetic markers tightly linked to this locus, with an association that persisted across the population. These markers will be of use in refining the production of genetically male O. niloticus for aquaculture.

  8. Sequence of PSE-2 beta-lactamase.

    OpenAIRE

    Huovinen, P; Huovinen, S; Jacoby, G A

    1988-01-01

    The nucleotide sequence of PSE-2 beta-lactamase, an enzyme that readily hydrolyzes both carbenicillin and oxacillin, has been determined. The deduced sequence of 266 amino acids contained 93 residues identical to those of OXA-2 beta-lactamase and the Ser-Thr-Phe-Lys tetrad also found in the active site of TEM-1 beta-lactamase.

  9. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    317. 2.4 cDNA sequencing and analysis. The nucleotide sequence of the cloned H. fossilis GH. cDNA was determined by Sanger's dideoxy chain termi- nation method, using Perkin Elmer bigdye terminator kit in an ABI Prism 377 automated DNA sequencer. All other computational analysis of the GH cDNA was done using.

  10. MiR-RACE, a new efficient approach to determine the precise sequences of computationally identified trifoliate orange (Poncirus trifoliata microRNAs.

    Directory of Open Access Journals (Sweden)

    Changnian Song

    Full Text Available BACKGROUND: Among the hundreds of genes encoding miRNAs in plants reported, much more were predicted by numerous computational methods. However, unlike protein-coding genes defined by start and stop codons, the ends of miRNA molecules do not have characteristics that can be used to define the mature miRNAs exactly, which made computational miRNA prediction methods often cannot predict the accurate location of the mature miRNA in a precursor with nucleotide-level precision. To our knowledge, there haven't been reports about comprehensive strategies determining the precise sequences, especially two termini, of these miRNAs. METHODS: In this study, we report an efficient method to determine the precise sequences of computationally predicted microRNAs (miRNAs that combines miRNA-enriched library preparation, two specific 5' and 3' miRNA RACE (miR-RACE PCR reactions, and sequence-directed cloning, in which the most challenging step is the two specific gene specific primers designed for the two RACE reactions. miRNA-mediated mRNA cleavage by RLM-5' RACE and sequencing were carried out to validate the miRNAs detected. Real-time PCR was used to analyze the expression of each miRNA. RESULTS: The efficiency of this newly developed method was validated using nine trifoliate orange (Poncirus trifoliata miRNAs predicted computationally. The miRNAs computationally identified were validated by miR-RACE and sequencing. Quantitative analysis showed that they have variable expression. Eight target genes have been experimentally verified by detection of the miRNA-mediated mRNA cleavage in Poncirus trifoliate. CONCLUSION: The efficient and powerful approach developed herein can be successfully used to validate the sequences of miRNAs, especially the termini, which depict the complete miRNA sequence in the computationally predicted precursor.

  11. Molecular relationships in Encephalartos (Zamiaceae, Cycadales) based on nucleotide sequences of nuclear ITS 1&2, rbcL, and genomic ISSR fingerprinting.

    Science.gov (United States)

    Treutlein, J; Vorster, P; Wink, M

    2005-01-01

    The cycad genus Encephalartos is restricted to Africa and is threatened with extinction in most of its range. Total DNA was extracted from 51, i.e., 78 %, of the described species of Encephalartos. The accessions were sampled from the furthest western occurrence of the genus in Nigeria, via Sudan and Uganda, to southern South Africa. The sequences of nuclear ribosomal internal transcribed spacer regions 1 and 2 (ITS 1&2), the chloroplast encoded rbcL gene, and ISSR genomic fingerprinting were employed to resolve the molecular history and the relationships within the genus. Sequence alignment, as well as ISSR fingerprinting, data show low genetic variation among all analysed accessions, indicating diversification within the Pliocene/Pleistocene. ITS 1&2 data agree well with morphological and geographical characters and resolved three major genetic clusters with overlapping distribution ranges in eastern South Africa. This area, that contains the largest diversity of genotypes of Encephalartos, may have served as a Pliocene/Pleistocene refugium.

  12. Nucleotide sequence of pOLA52: a conjugative IncX1 plasmid from Escherichia coli which enables biofilm formation and multidrug efflux

    DEFF Research Database (Denmark)

    Norman, Anders; Hansen, Lars H.; She, Qunxin

    2008-01-01

    The large conjugative multidrug resistance (MDR) plasmid pOLA52 was sequenced and annotated. The plasmid encodes two phenotypes normally associated with the chromosomes of opportunistic pathogens, namely MDR via a resistance-nodulation-division (RND)-type efflux-pump (oqxAB), and the formation of...... and Tn6011) that seemed to originate from Klebsiella pneumoniae, thus demonstrating the capability of IncX1 plasmids of facilitating lateral transfer of gene cassettes between different Enterobacteriaceae.......The large conjugative multidrug resistance (MDR) plasmid pOLA52 was sequenced and annotated. The plasmid encodes two phenotypes normally associated with the chromosomes of opportunistic pathogens, namely MDR via a resistance-nodulation-division (RND)-type efflux-pump (oqxAB), and the formation...... of type 3 fimbriae (mrkABCDF). The plasmid was found to be 51,602 bp long with 68 putative genes. About half of the plasmid constituted a conserved IncX1-type backbone with predicted regions for conjugation, replication and partitioning, as well as a toxin/antitoxin (TA) plasmid addiction system...

  13. The AplI restriction-modification system in an edible cyanobacterium, Arthrospira (Spirulina) platensis NIES-39, recognizes the nucleotide sequence 5'-CTGCAG-3'.

    Science.gov (United States)

    Shiraishi, Hideaki; Tabuse, Yosuke

    2013-01-01

    The degradation of foreign DNAs by restriction enzymes in an edible cyanobacterium, Arthrospira platensis, is a potential barrier for gene-transfer experiments in this economically valuable organism. We overproduced in Escherichia coli the proteins involved in a putative restriction-modification system of A. platensis NIES-39. The protein produced from the putative type II restriction enzyme gene NIES39_K04640 exhibited an endonuclease activity that cleaved DNA within the sequence 5'-CTGCAG-3' between the A at the fifth position and the G at the sixth position. We designated this enzyme AplI. The protein from the adjacent gene NIES39_K04650, which encodes a putative DNA (cytosine-5-)-methyltransferase, rendered DNA molecules resistant to AplI by modifying the C at the fourth position (but not the C at the first position) in the recognition sequence. This modification enzyme, M.AplI, should be useful for converting DNA molecules into AplI-resistant forms for use in gene-transfer experiments. A summary of restriction enzymes in various Arthrospira strains is also presented in this paper.

  14. Maximum likelihood and Bayesian analyses of a combined nucleotide sequence dataset for genetic characterization of a novel pestivirus, SVA/cont-08.

    Science.gov (United States)

    Liu, Lihong; Xia, Hongyan; Baule, Claudia; Belák, Sándor

    2009-01-01

    Bovine viral diarrhoea virus 1 (BVDV-1) and Bovine viral diarrhoea virus 2 (BVDV-2) are two recognised bovine pestivirus species of the genus Pestivirus. Recently, a pestivirus, termed SVA/cont-08, was detected in a batch of contaminated foetal calf serum originating from South America. Comparative sequence analysis showed that the SVA/cont-08 virus shares 15-28% higher sequence identity to pestivirus D32/00_'HoBi' than to members of BVDV-1 and BVDV-2. In order to reveal the phylogenetic relationship of SVA/cont-08 with other pestiviruses, a molecular dataset of 30 pestiviruses and 1,896 characters, comprising the 5'UTR, N(pro) and E2 gene regions, was analysed by two methods: maximum likelihood and Bayesian approach. An identical, well-supported tree topology was observed, where four pestiviruses (SVA/cont-08, D32/00_'HoBi', CH-KaHo/cont, and Th/04_KhonKaen) formed a monophyletic clade that is closely related to the BVDV-1 and BVDV-2 clades. The strategy applied in this study is useful for classifying novel pestiviruses in the future.

  15. Targeted Amplicon Sequencing for Single-Nucleotide-Polymorphism Genotyping of Attaching and Effacing Escherichia coli O26:H11 Cattle Strains via a High-Throughput Library Preparation Technique.

    Science.gov (United States)

    Ison, Sarah A; Delannoy, Sabine; Bugarel, Marie; Nagaraja, Tiruvoor G; Renter, David G; den Bakker, Henk C; Nightingale, Kendra K; Fach, Patrick; Loneragan, Guy H

    2016-01-15

    Enterohemorrhagic Escherichia coli (EHEC) O26:H11, a serotype within Shiga toxin-producing E. coli (STEC) that causes severe human disease, has been considered to have evolved from attaching and effacing E. coli (AEEC) O26:H11 through the acquisition of a Shiga toxin-encoding gene. Targeted amplicon sequencing using next-generation sequencing technology of 48 phylogenetically informative single-nucleotide polymorphisms (SNPs) and three SNPs differentiating Shiga toxin-positive (stx-positive) strains from Shiga toxin-negative (stx-negative) strains were used to infer the phylogenetic relationships of 178 E. coli O26:H11 strains (6 stx-positive strains and 172 stx-negative AEEC strains) from cattle feces to 7 publically available genomes of human clinical strains. The AEEC cattle strains displayed synonymous SNP genotypes with stx2-positive sequence type 29 (ST29) human O26:H11 strains, while stx1 ST21 human and cattle strains clustered separately, demonstrating the close phylogenetic relatedness of these Shiga toxin-negative AEEC cattle strains and human clinical strains. With the exception of seven stx-negative strains, five of which contained espK, three stx-related SNPs differentiated the STEC strains from non-STEC strains, supporting the hypothesis that these AEEC cattle strains could serve as a potential reservoir for new or existing pathogenic human strains. Our results support the idea that targeted amplicon sequencing for SNP genotyping expedites strain identification and genetic characterization of E. coli O26:H11, which is important for food safety and public health. Copyright © 2016 Ison et al.

  16. Identification and sequence determination of a novel double-stranded RNA mycovirus from the entomopathogenic fungus Beauveria bassiana.

    Science.gov (United States)

    Kotta-Loizou, Ioly; Sipkova, Jana; Coutts, Robert H A

    2015-03-01

    An isolate of the entomopathogenic fungus Beauveria bassiana was found to contain five double-stranded (ds) RNA elements ranging from 1.5 to more than 3 kbp. The complete sequence of the largest dsRNA element is described here. Analysis of the RdRp nucleotide sequence reveals its similarity to unclassified dsRNA elements, such as Alternaria longipes dsRNA virus 1, and its distant relationship to the RNA-dependent RNA polymerases of members of the family Partitiviridae.

  17. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  18. The complete genome sequences of two isolates of potato black ringspot virus and their relationship to other isolates and nepoviruses

    NARCIS (Netherlands)

    Souza Richards, R.; Adams, I.P.; Kreuze, J.F.; Souza, de J.; Cuellar, W.; Dullemans, A.M.; Vlugt, van der R.A.A.; Glover, R.; Hany, U.; Dickinson, M.; Boonham, N.

    2014-01-01

    The complete nucleotide sequences of RNA 1 and RNA 2 of the nepovirus potato black ringspot virus (PBRSV) from two different isolates were determined, as well as partial sequences from two additional isolates. RNA1 is 7,579-7,598 nucleotides long and contains one single open reading frame (ORF),

  19. Identification of Single-Nucleotide Polymorphic Loci Associated with Biomass Yield under Water Deficit in Alfalfa (Medicago sativa L. Using Genome-Wide Sequencing and Association Mapping

    Directory of Open Access Journals (Sweden)

    Long-Xi Yu

    2017-06-01

    Full Text Available Alfalfa is a worldwide grown forage crop and is important due to its high biomass production and nutritional value. However, the production of alfalfa is challenged by adverse environmental factors such as drought and other stresses. Developing drought resistance alfalfa is an important breeding target for enhancing alfalfa productivity in arid and semi-arid regions. In the present study, we used genotyping-by-sequencing and genome-wide association to identify marker loci associated with biomass yield under drought in the field in a panel of diverse germplasm of alfalfa. A total of 28 markers at 22 genetic loci were associated with yield under water deficit, whereas only four markers associated with the same trait under well-watered condition. Comparisons of marker-trait associations between water deficit and well-watered conditions showed non-similarity except one. Most of the markers were identical across harvest periods within the treatment, although different levels of significance were found among the three harvests. The loci associated with biomass yield under water deficit located throughout all chromosomes in the alfalfa genome agreed with previous reports. Our results suggest that biomass yield under drought is a complex quantitative trait with polygenic inheritance and may involve a different mechanism compared to that of non-stress. BLAST searches of the flanking sequences of the associated loci against DNA databases revealed several stress-responsive genes linked to the drought resistance loci, including leucine-rich repeat receptor-like kinase, B3 DNA-binding domain protein, translation initiation factor IF2, and phospholipase-like protein. With further investigation, those markers closely linked to drought resistance can be used for MAS to accelerate the development of new alfalfa cultivars with improved resistance to drought and other abiotic stresses.

  20. A reporter system coupled with high-throughput sequencing unveils key bacterial transcription and translation determinants.

    Science.gov (United States)

    Yus, Eva; Yang, Jae-Seong; Sogues, Adrià; Serrano, Luis

    2017-08-28

    Quantitative analysis of the sequence determinants of transcription and translation regulation is relevant for systems and synthetic biology. To identify these determinants, researchers have developed different methods of screening random libraries using fluorescent reporters or antibiotic resistance genes. Here, we have implemented a generic approach called ELM-seq (expression level monitoring by DNA methylation) that overcomes the technical limitations of such classic reporters. ELM-seq uses DamID (Escherichia coli DNA adenine methylase as a reporter coupled with methylation-sensitive restriction enzyme digestion and high-throughput sequencing) to enable in vivo quantitative analyses of upstream regulatory sequences. Using the genome-reduced bacterium Mycoplasma pneumoniae, we show that ELM-seq has a large dynamic range and causes minimal toxicity. We use ELM-seq to determine key sequences (known and putatively novel) of promoter and untranslated regions that influence transcription and translation efficiency. Applying ELM-seq to other organisms will help us to further understand gene expression and guide synthetic biology.Quantitative analysis of how DNA sequence determines transcription and translation regulation is of interest to systems and synthetic biologists. Here the authors present ELM-seq, which uses Dam activity as reporter for high-throughput analysis of promoter and 5'-UTR regions.

  1. Rapid, High-Throughput Identification of Anthrax-Causing and Emetic Bacillus cereus Group Genome Assemblies via BTyper, a Computational Tool for Virulence-Based Classification of Bacillus cereus Group Isolates by Using Nucleotide Sequencing Data

    Science.gov (United States)

    Carroll, Laura M.; Miller, Rachel A.; Wiedmann, Martin

    2017-01-01

    ABSTRACT The Bacillus cereus group comprises nine species, several of which are pathogenic. Differentiating between isolates that may cause disease and those that do not is a matter of public health and economic importance, but it can be particularly challenging due to the high genomic similarity within the group. To this end, we have developed BTyper, a computational tool that employs a combination of (i) virulence gene-based typing, (ii) multilocus sequence typing (MLST), (iii) panC clade typing, and (iv) rpoB allelic typing to rapidly classify B. cereus group isolates using nucleotide sequencing data. BTyper was applied to a set of 662 B. cereus group genome assemblies to (i) identify anthrax-associated genes in non-B. anthracis members of the B. cereus group, and (ii) identify assemblies from B. cereus group strains with emetic potential. With BTyper, the anthrax toxin genes cya, lef, and pagA were detected in 8 genomes classified by the NCBI as B. cereus that clustered into two distinct groups using k-medoids clustering, while either the B. anthracis poly-γ-d-glutamate capsule biosynthesis genes capABCDE or the hyaluronic acid capsule hasA gene was detected in an additional 16 assemblies classified as either B. cereus or Bacillus thuringiensis isolated from clinical, environmental, and food sources. The emetic toxin genes cesABCD were detected in 24 assemblies belonging to panC clades III and VI that had been isolated from food, clinical, and environmental settings. The command line version of BTyper is available at https://github.com/lmc297/BTyper. In addition, BMiner, a companion application for analyzing multiple BTyper output files in aggregate, can be found at https://github.com/lmc297/BMiner. IMPORTANCE Bacillus cereus is a foodborne pathogen that is estimated to cause tens of thousands of illnesses each year in the United States alone. Even with molecular methods, it can be difficult to distinguish nonpathogenic B. cereus group isolates from their

  2. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae) based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments.

    Science.gov (United States)

    Wang, Zhaoshan; Du, Shuhui; Dayanandan, Selvadurai; Wang, Dongsheng; Zeng, Yanfei; Zhang, Jianguo

    2014-01-01

    Populus (Salicaceae) is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1) the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2) three advanced sections (Populus, Aigeiros and Tacamahaca) are of hybrid origin; (3) species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4) many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  3. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments.

    Directory of Open Access Journals (Sweden)

    Zhaoshan Wang

    Full Text Available Populus (Salicaceae is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1 the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2 three advanced sections (Populus, Aigeiros and Tacamahaca are of hybrid origin; (3 species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4 many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  4. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  5. Characteristics of the tomato nuclear genome as determined by sequencing undermethylated EcoRI digested fragments

    DEFF Research Database (Denmark)

    Wang, Y.; van der Hoeven, R. S.; Nielsen, Rasmus

    2005-01-01

    A collection of 9,990 single-pass nuclear genomic sequences, corresponding to 5 Mb of tomato DNA, were obtained using methylation filtration (MF) strategy and reduced to 7,053 unique undermethylated genomic islands (UGIs) distributed as follows: (1) 59% non-coding sequences, (2) 28% coding...... sequences, (3) 12% transposons-96% of which are class I retroelements, and (4) 1% organellar sequences integrated into the nuclear genome over the past approximately 100 million years. A more detailed analysis of coding UGIs indicates that the unmethylated portion of tomato genes extends as far as 676 bp...... upstream and 766 bp downstream of coding regions with an average of 174 and 171 bp, respectively. Based on the analysis of the UGI copy distribution, the undermethylated portion of the tomato genome is determined to account for the majority of the unmethylated genes in the genome and is estimated...

  6. Preliminary Study on Determining the Sequence of Intersecting Lines by Fluorescence Technique.

    Science.gov (United States)

    Li, Biao; Ouyang, Guo Liang; Zhao, Peng Nan

    2018-03-01

    The determination of the sequence of intersecting lines is an important part of questioned document examinations. A fluorescence technique was used to determine the sequence of heterogeneous intersecting lines produced using inkpad ink, stamp-pad ink, ballpoint pens, gel pens, fountain pens, colorants of carbon paper, photocopiers, laser printers, and inkjet printers. A SteREO Discovery.V20 equipped with the ZEN Blue Lite software was chosen to perform the tests.As the results obtained from the study were positive under most conditions, the fluorescence technique was found to be very successful in determining the sequence of intersecting lines from ballpoint pen, gel pen, fountain pen, photocopier, laser and inkjet printers, and inkpad inks. The method was also successful in determining the sequence of intersecting lines from ballpoint pen, photocopier, laser printer, and stamp-pad inks under most conditions. The technique was not successful in determining the order of crossing lines blending together. © 2017 American Academy of Forensic Sciences.

  7. Characterization of the Complete Nucleotide Sequences of IncA/C2 Plasmids Carrying In809-Like Integrons from Enterobacteriaceae Isolates of Wildlife Origin.

    Science.gov (United States)

    Papagiannitsis, Costas C; Kutilova, Iva; Medvecky, Matej; Hrabak, Jaroslav; Dolejska, Monika

    2017-09-01

    A total of 18 Enterobacteriaceae (17 from gulls and 1 from a clinical sample) collected from Australia, carrying IncA/C plasmids with the IMP-encoding In809-like integrons, were studied. Seven plasmids, being representatives of different origins, plasmid sizes, replicon combinations, and resistance genes, were completely sequenced. Plasmid pEc158, identified in a clinical Escherichia coli ST752 isolate, showed extensive similarity to type 2 IncA/C 2 plasmids. pEc158 carried none of the bla CMY-2 -like region or ARI-B and ARI-A regions, while it contained a hybrid transposon structure. The six remaining plasmids, which were of wildlife origin, were highly similar to each other and probably were fusion derivatives of type 1 and type 2 A/C 2 plasmids. The latter plasmids contained an ARI-B region and hybrid transposon structures. In all plasmids, hybrid transposon structures containing In809-like integrons were inserted 3,434 bp downstream of the rhs2 start codon. In all cases, the one outermost 38-bp inverted repeat (IR) of the transposon was associated with the Tn 1696 tnp module, while the other outermost 38-bp IR of the transposon was associated with either a Tn 6317 -like module or a Tn 21 mer module. However, the internal structure of the transposon and the resistance genes were different in each plasmid. These findings indicated that, for the specific periods of time and settings, different IncA/C 2 plasmid types carrying In809-like elements circulated among isolates of wildlife and clinical origins. Additionally, they provided the basis for speculations regarding the reshuffling of IncA/C 2 plasmids with In809-like integrons and confirmed the rapid evolution of IncA/C 2 plasmid lineages. Copyright © 2017 American Society for Microbiology.

  8. Curriculum Viewed as a Binary System: An Approach to the Determination of Sequence. A Project Report.

    Science.gov (United States)

    Renckly, Thomas R.; Orwig, Gary

    A description of the development and application of a hierarchical/binary model by which a curriculum may be analyzed to determine alternative instructional sequences given particular instructional objectives and limiting constraints forms the body of this report. The background of the project as part of an effort by the U.S. Navy Recruiting…

  9. Rapid molecular diagnostics of severe primary immunodeficiency determined by using targeted next-generation sequencing.

    Science.gov (United States)

    Yu, Hui; Zhang, Victor Wei; Stray-Pedersen, Asbjørg; Hanson, Imelda Celine; Forbes, Lisa R; de la Morena, M Teresa; Chinn, Ivan K; Gorman, Elizabeth; Mendelsohn, Nancy J; Pozos, Tamara; Wiszniewski, Wojciech; Nicholas, Sarah K; Yates, Anne B; Moore, Lindsey E; Berge, Knut Erik; Sorte, Hanne; Bayer, Diana K; ALZahrani, Daifulah; Geha, Raif S; Feng, Yanming; Wang, Guoli; Orange, Jordan S; Lupski, James R; Wang, Jing; Wong, Lee-Jun

    2016-10-01

    Primary immunodeficiency diseases (PIDDs) are inherited disorders of the immune system. The most severe form, severe combined immunodeficiency (SCID), presents with profound deficiencies of T cells, B cells, or both at birth. If not treated promptly, affected patients usually do not live beyond infancy because of infections. Genetic heterogeneity of SCID frequently delays the diagnosis; a specific diagnosis is crucial for life-saving treatment and optimal management. We developed a next-generation sequencing (NGS)-based multigene-targeted panel for SCID and other severe PIDDs requiring rapid therapeutic actions in a clinical laboratory setting. The target gene capture/NGS assay provides an average read depth of approximately 1000×. The deep coverage facilitates simultaneous detection of single nucleotide variants and exonic copy number variants in one comprehensive assessment. Exons with insufficient coverage (diagnostic yield of severe primary immunodeficiency. Establishing a molecular diagnosis enables early immune reconstitution through prompt therapeutic intervention and guides management for improved long-term quality of life. Copyright © 2016 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

  10. Phylogenetic position of Taylorella equigenitalis determined by analysis of amplified 16S ribosomal DNA sequences.

    Science.gov (United States)

    Bleumink-Pluym, N M; van Dijk, L; van Vliet, A H; van der Giessen, J W; van der Zeijst, B A

    1993-07-01

    The 16S ribosomal DNA sequence of Taylorella equigenitalis (formerly Haemophilus equigenitalis), the causative organism of contagious equine metritis, was determined. A phylogenetic analysis of this sequence revealed a phylogenetic position of T. equigenitalis in the beta subclass of the class Proteobacteria apart from the position of Haemophilus influenzae, which belongs to the gamma subclass of Proteobacteria. A close phylogenetic relationship among T. equigenitalis, Alcaligenes xylosoxidans, and Bordetella bronchiseptica was detected; Spirillum volutans and Chromobacterium fluviatile (Iodobacter fluviatile) were in the same group but slightly removed. This relationship is surprising in view of the considerable differences in the G + C contents of the genomes of these bacteria.

  11. Determination of the melon chloroplast and mitochondrial genome sequences reveals that the largest reported mitochondrial genome in plants contains a significant amount of DNA having a nuclear origin

    Directory of Open Access Journals (Sweden)

    Aranda Miguel A

    2011-08-01

    Full Text Available Abstract Background The melon belongs to the Cucurbitaceae family, whose economic importance among vegetable crops is second only to Solanaceae. The melon has a small genome size (454 Mb, which makes it suitable for molecular and genetic studies. Despite similar nuclear and chloroplast genome sizes, cucurbits show great variation when their mitochondrial genomes are compared. The melon possesses the largest plant mitochondrial genome, as much as eight times larger than that of other cucurbits. Results The nucleotide sequences of the melon chloroplast and mitochondrial genomes were determined. The chloroplast genome (156,017 bp included 132 genes, with 98 single-copy genes dispersed between the small (SSC and large (LSC single-copy regions and 17 duplicated genes in the inverted repeat regions (IRa and IRb. A comparison of the cucumber and melon chloroplast genomes showed differences in only approximately 5% of nucleotides, mainly due to short indels and SNPs. Additionally, 2.74 Mb of mitochondrial sequence, accounting for 95% of the estimated mitochondrial genome size, were assembled into five scaffolds and four additional unscaffolded contigs. An 84% of the mitochondrial genome is contained in a single scaffold. The gene-coding region accounted for 1.7% (45,926 bp of the total sequence, including 51 protein-coding genes, 4 conserved ORFs, 3 rRNA genes and 24 tRNA genes. Despite the differences observed in the mitochondrial genome sizes of cucurbit species, Citrullus lanatus (379 kb, Cucurbita pepo (983 kb and Cucumis melo (2,740 kb share 120 kb of sequence, including the predicted protein-coding regions. Nevertheless, melon contained a high number of repetitive sequences and a high content of DNA of nuclear origin, which represented 42% and 47% of the total sequence, respectively. Conclusions Whereas the size and gene organisation of chloroplast genomes are similar among the cucurbit species, mitochondrial genomes show a wide variety of sizes

  12. Determination of the melon chloroplast and mitochondrial genome sequences reveals that the largest reported mitochondrial genome in plants contains a significant amount of DNA having a nuclear origin.

    Science.gov (United States)

    Rodríguez-Moreno, Luis; González, Víctor M; Benjak, Andrej; Martí, M Carmen; Puigdomènech, Pere; Aranda, Miguel A; Garcia-Mas, Jordi

    2011-08-20

    The melon belongs to the Cucurbitaceae family, whose economic importance among vegetable crops is second only to Solanaceae. The melon has a small genome size (454 Mb), which makes it suitable for molecular and genetic studies. Despite similar nuclear and chloroplast genome sizes, cucurbits show great variation when their mitochondrial genomes are compared. The melon possesses the largest plant mitochondrial genome, as much as eight times larger than that of other cucurbits. The nucleotide sequences of the melon chloroplast and mitochondrial genomes were determined. The chloroplast genome (156,017 bp) included 132 genes, with 98 single-copy genes dispersed between the small (SSC) and large (LSC) single-copy regions and 17 duplicated genes in the inverted repeat regions (IRa and IRb). A comparison of the cucumber and melon chloroplast genomes showed differences in only approximately 5% of nucleotides, mainly due to short indels and SNPs. Additionally, 2.74 Mb of mitochondrial sequence, accounting for 95% of the estimated mitochondrial genome size, were assembled into five scaffolds and four additional unscaffolded contigs. An 84% of the mitochondrial genome is contained in a single scaffold. The gene-coding region accounted for 1.7% (45,926 bp) of the total sequence, including 51 protein-coding genes, 4 conserved ORFs, 3 rRNA genes and 24 tRNA genes. Despite the differences observed in the mitochondrial genome sizes of cucurbit species, Citrullus lanatus (379 kb), Cucurbita pepo (983 kb) and Cucumis melo (2,740 kb) share 120 kb of sequence, including the predicted protein-coding regions. Nevertheless, melon contained a high number of repetitive sequences and a high content of DNA of nuclear origin, which represented 42% and 47% of the total sequence, respectively. Whereas the size and gene organisation of chloroplast genomes are similar among the cucurbit species, mitochondrial genomes show a wide variety of sizes, with a non-conserved structure both in gene number

  13. Whole exome sequencing and single nucleotide polymorphism array analyses to identify germline alterations in genes associated with testosterone metabolism in a patient with androgen insensitivity syndrome and early-onset colorectal cancer.

    Science.gov (United States)

    Disciglio, Vittoria; Devecchi, Andrea; Palumbo, Orazio; Carella, Massimo; Penso, Donata; Milione, Massimo; Valle, Giorgio; Pierotti, Marco Alessandro; Vitellaro, Marco; Bertario, Lucio; Canevari, Silvana; Signoroni, Stefano; De Cecco, Loris

    2016-06-07

    Androgen insensitivity syndrome (AIS), a disorder of sexual development in 46, XY individuals, is caused by loss-of-function mutations in the androgen receptor (AR) gene. A variety of tumors have been reported in association with AIS, but no cases with colorectal cancer (CRC) have been described. Here, we present a male patient with AIS who developed multiple early-onset CRCs and his pedigree. His first cousin was diagnosed with AIS and harbored the same AR gene mutation, but with no signs of CRC. The difference in clinical management for the two patients was that testosterone treatment was given to the proband for a much longer time compared with the cousin. The CRC family history was negative, and no germline mutations in well-known CRC-related genes were identified. A single nucleotide polymorphism array revealed a microduplication on chromosome 22q11.22 that encompassed a microRNA potentially related to CRC pathogenesis. In the proband, whole exome sequencing identified a polymorphism in an oncogene and 13 rare loss-of-function variants, of which two were in CRC-related genes and four were in genes associated with other human cancers. By pathway analysis, all inherited germline genetic events were connected in a unique network whose alteration in the proband, together with continuous testosterone stimulation, may have played a role in CRC pathogenesis.

  14. Brief communication Complete nucleotide sequence analysis of ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR

    21.1, 28.9, 24.4 and 25.6, respectively (Frowd and Tremaine. 1977). Like most of the polyadenylated monopartite positive-strand RNA viruses, the open reading frame (ORF) coding for the viral coat protein (CP) is located at the 3´ end. (Chia et al 1992). The putative polyadenylation signal, the. AATAAA motif, is found in the ...

  15. Determination of the sequence of intersecting lines using Focused Ion Beam/Scanning Electron Microscope.

    Science.gov (United States)

    Kim, Jiye; Kim, MinJung; An, JinWook; Kim, Yunje

    2016-05-01

    The aim of this study was to verify that the combination of focused ion beam (FIB) and scanning electron microscope/energy-dispersive X-ray (SEM/EDX) could be applied to determine the sequence of line crossings. The samples were transferred into FIB/SEM for FIB milling and an imaging operation. EDX was able to explore the chemical components and the corresponding elemental distribution in the intersection. The technique was successful in determining the sequence of heterogeneous line intersections produced using gel pens and red sealing ink with highest success rate (100% correctness). These observations show that the FIB/SEM was the appropriate instrument for an overall examination of document. © 2016 American Academy of Forensic Sciences.

  16. A teaching and learning sequence about the interplay of chance and determinism in nonlinear systems

    International Nuclear Information System (INIS)

    Stavrou, D; Duit, R; Komorek, M

    2008-01-01

    A teaching and learning sequence aimed at introducing upper secondary school students to the interplay between chance and determinism in nonlinear systems is presented. Three experiments concerning nonlinear systems (deterministic chaos, self-organization and fractals) and one experiment concerning linear systems are introduced. Thirty upper secondary students' capabilities and difficulties in understanding the scientific point of view were investigated, using a teaching experiment design. The results show that most students were capable of sound explanations concerning the interplay of chance and determinism in nonlinear systems

  17. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    2008-07-01

    Full Text Available The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated.Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis.Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  18. The complementarity-determining region sequences in IgY antivenom hypervariable regions

    Directory of Open Access Journals (Sweden)

    David Gitirana da Rocha

    2017-08-01

    Full Text Available The data presented in this article are related to the research article entitled "Development of IgY antibodies against anti-snake toxins endowed with highly lethal neutralizing activity" (da Rocha et al., 2017 [1]. Complementarity-determining region (CDR sequences are variable antibody (Ab sequences that respond with specificity, duration and strength to identify and bind to antigen (Ag epitopes. B lymphocytes isolated from hens immunized with Bitis arietans (Ba and anti-Crotalus durissus terrificus (Cdt venoms and expressing high specificity, affinity and toxicity neutralizing antibody titers were used as DNA sources. The VLF1, CDR1, CDR2, VLR1 and CDR3 sequences were validated by BLASTp, and values corresponding to IgY VL and VH anti-Ba or anti-Cdt venoms were identified, registered [Gallus gallus IgY Fv Light chain (GU815099/Gallus gallus IgY Fv Heavy chain (GU815098] and used for molecular modeling of IgY scFv anti-Ba. The resulting CDR1, CDR2 and CDR3 sequences were combined to construct the three - dimensional structure of the Ab paratope.

  19. Cloning and sequence determination of a gene encoding an osmotin-like protein from strawberry (Fragaria X ananassa Duch.).

    Science.gov (United States)

    Wu, J; Khan, A A; Shih CY, T; Shih, D S

    2001-12-01

    Osmotin and osmotin-like proteins (OLPs) are pathogenesis-related (PR) proteins, whose synthesis is normally stimulated upon infection of plants by pathogens. A strawberry genomic clone containing an osmotin-like protein (OLP) gene was isolated and sequenced. This clone contains an open reading frame of 681 nucleotides without any intron. The predicted amino acid sequence of the protein shares high degrees of homology with a number of other OLPs and related proteins, of which several are known to have antifungal activities. Southern hybridization analysis of strawberry genomic DNA suggested that the OLP is coded by a multi-gene family. Results from reverse transcriptase-polymerase chain reaction indicated that this OLP gene is expressed in uninfected strawberry plants.

  20. Reproducibility of Variant Calls in Replicate Next Generation Sequencing Experiments.

    Directory of Open Access Journals (Sweden)

    Yuan Qi

    Full Text Available Nucleotide alterations detected by next generation sequencing are not always true biological changes but could represent sequencing errors. Even highly accurate methods can yield substantial error rates when applied to millions of nucleotides. In this study, we examined the reproducibility of nucleotide variant calls in replicate sequencing experiments of the same genomic DNA. We performed targeted sequencing of all known human protein kinase genes (kinome (~3.2 Mb using the SOLiD v4 platform. Seventeen breast cancer samples were sequenced in duplicate (n=14 or triplicate (n=3 to assess concordance of all calls and single nucleotide variant (SNV calls. The concordance rates over the entire sequenced region were >99.99%, while the concordance rates for SNVs were 54.3-75.5%. There was substantial variation in basic sequencing metrics from experiment to experiment. The type of nucleotide substitution and genomic location of the variant had little impact on concordance but concordance increased with coverage level, variant allele count (VAC, variant allele frequency (VAF, variant allele quality and p-value of SNV-call. The most important determinants of concordance were VAC and VAF. Even using the highest stringency of QC metrics the reproducibility of SNV calls was around 80% suggesting that erroneous variant calling can be as high as 20-40% in a single experiment. The sequence data have been deposited into the European Genome-phenome Archive (EGA with accession number EGAS00001000826.

  1. Reproducibility of Variant Calls in Replicate Next Generation Sequencing Experiments

    Science.gov (United States)

    Qi, Yuan; Liu, Xiuping; Liu, Chang-gong; Wang, Bailing; Hess, Kenneth R.; Symmans, W. Fraser; Shi, Weiwei; Pusztai, Lajos

    2015-01-01

    Nucleotide alterations detected by next generation sequencing are not always true biological changes but could represent sequencing errors. Even highly accurate methods can yield substantial error rates when applied to millions of nucleotides. In this study, we examined the reproducibility of nucleotide variant calls in replicate sequencing experiments of the same genomic DNA. We performed targeted sequencing of all known human protein kinase genes (kinome) (~3.2 Mb) using the SOLiD v4 platform. Seventeen breast cancer samples were sequenced in duplicate (n=14) or triplicate (n=3) to assess concordance of all calls and single nucleotide variant (SNV) calls. The concordance rates over the entire sequenced region were >99.99%, while the concordance rates for SNVs were 54.3-75.5%. There was substantial variation in basic sequencing metrics from experiment to experiment. The type of nucleotide substitution and genomic location of the variant had little impact on concordance but concordance increased with coverage level, variant allele count (VAC), variant allele frequency (VAF), variant allele quality and p-value of SNV-call. The most important determinants of concordance were VAC and VAF. Even using the highest stringency of QC metrics the reproducibility of SNV calls was around 80% suggesting that erroneous variant calling can be as high as 20-40% in a single experiment. The sequence data have been deposited into the European Genome-phenome Archive (EGA) with accession number EGAS00001000826. PMID:26136146

  2. Partial DNA sequencing of Douglas-fir cDNAs used in RFLP mapping

    Science.gov (United States)

    K.D. Jermstad; D.L. Bassoni; C.S. Kinlaw; D.B. Neale

    1998-01-01

    DNA sequences from 87 Douglas-fir (Pseudotsuga menziesii [Mirb.] Franco) cDNA RFLP probes were determined. Sequences were submitted to the GenBank dbEST database and searched for similarity against nucleotide and protein databases using the BLASTn and BLASTx programs. Twenty-one sequences (24%) were assigned putative functions; 18 of which...

  3. Determination of RET Sequence Variation in an MEN2 Unaffected Cohort Using Multiple-Sample Pooling and Next-Generation Sequencing

    Directory of Open Access Journals (Sweden)

    R. L. Margraf

    2012-01-01

    Full Text Available Multisample, nonindexed pooling combined with next-generation sequencing (NGS was used to discover RET proto-oncogene sequence variation within a cohort known to be unaffected by multiple endocrine neoplasia type 2 (MEN2. DNA samples (113 Caucasians, 23 persons of other ethnicities were amplified for RET intron 9 to intron 16 and then divided into 5 pools of <30 samples each before library prep and NGS. Two controls were included in this study, a single sample and a pool of 50 samples that had been previously sequenced by the same NGS methods. All 59 variants previously detected in the 50-pool control were present. Of the 61 variants detected in the unaffected cohort, 20 variants were novel changes. Several variants were validated by high-resolution melting analysis and Sanger sequencing, and their allelic frequencies correlated well with those determined by NGS. The results from this unaffected cohort will be added to the RET MEN2 database.

  4. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  5. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  6. Cycle-time determination and process control of sequencing batch membrane bioreactors.

    Science.gov (United States)

    Krampe, J

    2013-01-01

    In this paper a method to determine the cycle time for sequencing batch membrane bioreactors (SBMBRs) is introduced. One of the advantages of SBMBRs is the simplicity of adapting them to varying wastewater composition. The benefit of this flexibility can only be fully utilised if the cycle times are optimised for the specific inlet load conditions. This requires either proactive and ongoing operator adjustment or active predictive instrument-based control. Determination of the cycle times for conventional sequencing batch reactor (SBR) plants is usually based on experience. Due to the higher mixed liquor suspended solids concentrations in SBMBRs and the limited experience with their application, a new approach to calculate the cycle time had to be developed. Based on results from a semi-technical pilot plant, the paper presents an approach for calculating the cycle time in relation to the influent concentration according to the Activated Sludge Model No. 1 and the German HSG (Hochschulgruppe) Approach. The approach presented in this paper considers the increased solid contents in the reactor and the resultant shortened reaction times. This allows for an exact calculation of the nitrification and denitrification cycles with a tolerance of only a few minutes. Ultimately the same approach can be used for a predictive control strategy and for conventional SBR plants.

  7. Genome Sequences of Three Apple chlorotic leaf spot virus Isolates from Hawthorns in China

    OpenAIRE

    Guo, Wei; Zheng, Wenyan; Wang, Mei; Li, Xiaohong; Ma, Yue; Dai, Hongyan

    2016-01-01

    The genome sequences of Apple chlorotic leaf spot virus (ACLSV) isolates from three accessions of hawthorns (Crataegus pinnatifida) grown at Shenyang Agricultural University were determined using Illumina RNA-seq. To confirm the assembly data from the de novo sequencing, two ACLSV genomic sequences (SY01 and SY02) were sequenced using the Sanger method. The SY01 and SY02 sequences obtained with the Sanger method showed 99.5% and 99.7% nucleotide identity with the transcriptome data, respectiv...

  8. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  9. Determinants of antigenicity and specificity in immune response for protein sequences

    Directory of Open Access Journals (Sweden)

    Li Cheng

    2011-06-01

    . Conclusions Together our results suggest that antigenicity is a local property of the protein sequences and that protein sequence properties of composition, secondary structure, solvent accessibility and evolutionary conservation are the determinants of antigenicity and specificity in immune response. Moreover, specificity in immune response could also be accurately predicted for large protein regions without the knowledge of the protein tertiary structure or the presence of discontinuous epitopes. The dataset prepared in this work and the classifier models are available for download at https://sites.google.com/site/oracleclassifiers/.

  10. Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays

    DEFF Research Database (Denmark)

    Dobrowolska, G; Boldyreff, B; Issinger, O G

    1991-01-01

    The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...... subunit and 71% identity to the alpha' subunit of human casein kinase 2....

  11. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis.

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, J E; Millar, B C

    2006-01-06

    At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  12. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  13. Combining sequence-based prediction methods and circular dichroism and infrared spectroscopic data to improve protein secondary structure determinations.

    Science.gov (United States)

    Lees, Jonathan G; Janes, Robert W

    2008-01-15

    A number of sequence-based methods exist for protein secondary structure prediction. Protein secondary structures can also be determined experimentally from circular dichroism, and infrared spectroscopic data using empirical analysis methods. It has been proposed that comparable accuracy can be obtained from sequence-based predictions as from these biophysical measurements. Here we have examined the secondary structure determination accuracies of sequence prediction methods with the empirically determined values from the spectroscopic data on datasets of proteins for which both crystal structures and spectroscopic data are available. In this study we show that the sequence prediction methods have accuracies nearly comparable to those of spectroscopic methods. However, we also demonstrate that combining the spectroscopic and sequences techniques produces significant overall improvements in secondary structure determinations. In addition, combining the extra information content available from synchrotron radiation circular dichroism data with sequence methods also shows improvements. Combining sequence prediction with experimentally determined spectroscopic methods for protein secondary structure content significantly enhances the accuracy of the overall results obtained.

  14. Combining sequence-based prediction methods and circular dichroism and infrared spectroscopic data to improve protein secondary structure determinations

    Directory of Open Access Journals (Sweden)

    Lees Jonathan G

    2008-01-01

    Full Text Available Abstract Background A number of sequence-based methods exist for protein secondary structure prediction. Protein secondary structures can also be determined experimentally from circular dichroism, and infrared spectroscopic data using empirical analysis methods. It has been proposed that comparable accuracy can be obtained from sequence-based predictions as from these biophysical measurements. Here we have examined the secondary structure determination accuracies of sequence prediction methods with the empirically determined values from the spectroscopic data on datasets of proteins for which both crystal structures and spectroscopic data are available. Results In this study we show that the sequence prediction methods have accuracies nearly comparable to those of spectroscopic methods. However, we also demonstrate that combining the spectroscopic and sequences techniques produces significant overall improvements in secondary structure determinations. In addition, combining the extra information content available from synchrotron radiation circular dichroism data with sequence methods also shows improvements. Conclusion Combining sequence prediction with experimentally determined spectroscopic methods for protein secondary structure content significantly enhances the accuracy of the overall results obtained.

  15. Whole-exome sequencing enables rapid determination of xeroderma pigmentosum molecular etiology.

    Directory of Open Access Journals (Sweden)

    Oscar Ortega-Recalde

    Full Text Available Xeroderma pigmentosum (XP is a rare autosomal recessive disorder characterized by extreme sensitivity to actinic pigmentation changes in the skin and increased incidence of skin cancer. In some cases, patients are affected by neurological alterations. XP is caused by mutations in 8 distinct genes (XPA through XPG and XPV. The XP-V (variant subtype of the disease results from mutations in a gene (XPV, also named POLH which encodes for Polη, a member of the Y-DNA polymerase family. Although the presence and severity of skin and neurological dysfunctions differ between XP subtypes, there are overlapping clinical features among subtypes such that the sub-type cannot be deduced from the clinical features. In this study, in order to overcome this drawback, we undertook whole-exome sequencing in two XP sibs and their father. We identified a novel homozygous nonsense mutation (c.897T>G, p.Y299X in POLH which causes the disease. Our results demonstrate that next generation sequencing is a powerful approach to rapid determination of XP genetic etiology.

  16. Whole-exome sequencing enables rapid determination of xeroderma pigmentosum molecular etiology.

    Science.gov (United States)

    Ortega-Recalde, Oscar; Vergara, Jéssica Inés; Fonseca, Dora Janeth; Ríos, Xiomara; Mosquera, Hernando; Bermúdez, Olga María; Medina, Claudia Liliana; Vargas, Clara Inés; Pallares, Argemiro Enrique; Restrepo, Carlos Martín; Laissue, Paul

    2014-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder characterized by extreme sensitivity to actinic pigmentation changes in the skin and increased incidence of skin cancer. In some cases, patients are affected by neurological alterations. XP is caused by mutations in 8 distinct genes (XPA through XPG and XPV). The XP-V (variant) subtype of the disease results from mutations in a gene (XPV, also named POLH) which encodes for Polη, a member of the Y-DNA polymerase family. Although the presence and severity of skin and neurological dysfunctions differ between XP subtypes, there are overlapping clinical features among subtypes such that the sub-type cannot be deduced from the clinical features. In this study, in order to overcome this drawback, we undertook whole-exome sequencing in two XP sibs and their father. We identified a novel homozygous nonsense mutation (c.897T>G, p.Y299X) in POLH which causes the disease. Our results demonstrate that next generation sequencing is a powerful approach to rapid determination of XP genetic etiology.

  17. Capsid coding sequences of foot-and-mouth disease viruses are determinants of pathogenicity in pigs

    DEFF Research Database (Denmark)

    Lohse, Louise; Jackson, Terry; Bøtner, Anette

    2012-01-01

    compared the pathogenicity of different FMDVs in young pigs. In total 32 pigs, 7-weeks-old, were exposed to virus, either by direct inoculation or through contact with inoculated pigs, using cell culture adapted (O1K B64), chimeric (O1K/A-TUR and O1K/O-UKG) or field strain (O-UKG/34/2001) viruses. The O1K...... B64 virus and the two chimeric viruses are identical to each other except for the capsid coding region. Animals exposed to O1K B64 did not exhibit signs of disease, while pigs exposed to each of the other viruses showed typical clinical signs of foot-and-mouth disease (FMD). All pigs infected...... coding sequences are determinants of FMDV pathogenicity in pigs....

  18. Determination of the sequence of line crossings by means of 3D laser profilometry

    Science.gov (United States)

    Schirripa Spagnolo, Giuseppe; Simonetti, Carla; Cozzella, Lorenzo

    2005-09-01

    The determination of the sequence of line crossings is still a current problem in the field of forensic documents examination. This paper presents the potentiality of the 3D micro-topography to resolve the writing order of signatures (if partially superimposed), to detect the tampering of manuscripts (if the added inscription superimposes itself on parts already written), to analyze pressure variation, and to identify strokes in handwritten. The system used, in this paper for creating 3D micro-topography, is based on conoscopic holography. It is a non-contact three-dimensional measuring system that allows producing holograms, even with incoherent light, with fringe periods that can be measured precisely to determine the exact distance to the point measured. This technique is suitable to obtain 3D micro-topography with high resolution also on surfaces with unevenness reflectivity (which is usual on the surface of the handwritten document). The proposed technique is able to obtained 3D profile in non-invading way. Therefore, the original draft do not be physically or chemically modified, allowing the possibility of multi-analysis in different time, also in case of forensic analysis with the necessity to preserving the original sample. The experiments performed with line crossings data base show that the proposed method is able of "positive identification" of writing sequence in the majority of the tests. When we have not had a positive identification, the result has been "inconclusive". The proposed technique, if correctly used, does not supply "false positive" or "probable" identifications. The possible results are only: "positive identification" and "inconclusive".

  19. Determining cardiac velocity fields and intraventricular pressure distribution from a sequence of ultrafast CT cardiac images.

    Science.gov (United States)

    Song, S M; Leahy, R M; Boyd, D P; Brundage, B H; Napel, S

    1994-01-01

    A method of computing the velocity field and pressure distribution from a sequence of ultrafast CT (UFCT) cardiac images is demonstrated. UFCT multi-slice cine imaging gives a series of tomographic slices covering the volume of the heart at a rate of 17 frames per second. The complete volume data set can be modeled using equations of continuum theory and through regularization, velocity vectors of both blood and tissue can be determined at each voxel in the volume. The authors present a technique to determine the pressure distribution throughout the volume of the left ventricle using the computed velocity field. A numerical algorithm is developed by discretizing the pressure Poisson equation (PPE), which Is based on the Navier-Stokes equation. The algorithm is evaluated using a mathematical phantom of known velocity and pressure-Couette flow. It is shown that the algorithm based on the PPE can reconstruct the pressure distribution using only the velocity data. Furthermore, the PPE is shown to be robust in the presence of noise. The velocity field and pressure distribution derived from a UFCT study of a patient are also presented.

  20. Creation and structure determination of an artificial protein with three complete sequence repeats

    Energy Technology Data Exchange (ETDEWEB)

    Adachi, Motoyasu, E-mail: adachi.motoyasu@jaea.go.jp; Shimizu, Rumi; Kuroki, Ryota [Japan Atomic Energy Agency, Shirakatashirane 2-4, Nakagun Tokaimura, Ibaraki 319-1195 (Japan); Blaber, Michael [Japan Atomic Energy Agency, Shirakatashirane 2-4, Nakagun Tokaimura, Ibaraki 319-1195 (Japan); Florida State University, Tallahassee, FL 32306-4300 (United States)

    2013-11-01

    An artificial protein with three complete sequence repeats was created and the structure was determined by X-ray crystallography. The structure showed threefold symmetry even though there is an amino- and carboxy-terminal. The artificial protein with threefold symmetry may be useful as a scaffold to capture small materials with C3 symmetry. Symfoil-4P is a de novo protein exhibiting the threefold symmetrical β-trefoil fold designed based on the human acidic fibroblast growth factor. First three asparagine–glycine sequences of Symfoil-4P are replaced with glutamine–glycine (Symfoil-QG) or serine–glycine (Symfoil-SG) sequences protecting from deamidation, and His-Symfoil-II was prepared by introducing a protease digestion site into Symfoil-QG so that Symfoil-II has three complete repeats after removal of the N-terminal histidine tag. The Symfoil-QG and SG and His-Symfoil-II proteins were expressed in Eschericha coli as soluble protein, and purified by nickel affinity chromatography. Symfoil-II was further purified by anion-exchange chromatography after removing the HisTag by proteolysis. Both Symfoil-QG and Symfoil-II were crystallized in 0.1 M Tris-HCl buffer (pH 7.0) containing 1.8 M ammonium sulfate as precipitant at 293 K; several crystal forms were observed for Symfoil-QG and II. The maximum diffraction of Symfoil-QG and II crystals were 1.5 and 1.1 Å resolution, respectively. The Symfoil-II without histidine tag diffracted better than Symfoil-QG with N-terminal histidine tag. Although the crystal packing of Symfoil-II is slightly different from Symfoil-QG and other crystals of Symfoil derivatives having the N-terminal histidine tag, the refined crystal structure of Symfoil-II showed pseudo-threefold symmetry as expected from other Symfoils. Since the removal of the unstructured N-terminal histidine tag did not affect the threefold structure of Symfoil, the improvement of diffraction quality of Symfoil-II may be caused by molecular characteristics of

  1. The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.

    Science.gov (United States)

    He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang

    2011-06-01

    The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.

  2. OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

    Science.gov (United States)

    Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

    2016-02-01

    Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

  3. Serological and genetic characterisation of bovine respiratory syncytial virus (BRSV) indicates that Danish isolates belong to the intermediate subgroup: no evidence of a selective effect on the variability of G protein nucleotide sequence by prior cell culture adaption and passages in cell culture

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.

    1998-01-01

    , respectively. Phylogenetic analysis showed that the Danish isolates formed three lineages within a separate branch of the phylogenetic tree. Nevertheless, the Danish isolates were closely related to the 220-69Bel isolate, the prototype of the intermediate antigenic subgroup. The sequencing of the extracellular...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...... on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar...

  4. Comparison of different pulse sequences for in vivo determination of T1 relaxation times in the human brain

    DEFF Research Database (Denmark)

    Kjaer, L; Henriksen, O

    1988-01-01

    Quantitative in vivo determination of T1 relaxation times by magnetic resonance imaging (MRI) is hampered by several potential sources of error. This study focused on the influence of the radiofrequency pulse sequences applied with special attention to the significance of the repetition time (TR......). T1 measurements were performed on the human brain using a whole body MR scanner operating at 1.5 tesla. Three different pulse sequences were compared including two 6-points inversion recovery (IR) sequences with TR = 2.0 s and 4.0, respectively, and a 12-points partial saturation inversion recovery...

  5. The determination of high-resolution spatio-temporal glacier motion fields from time-lapse sequences

    Science.gov (United States)

    Schwalbe, Ellen; Maas, Hans-Gerd

    2017-12-01

    This paper presents a comprehensive method for the determination of glacier surface motion vector fields at high spatial and temporal resolution. These vector fields can be derived from monocular terrestrial camera image sequences and are a valuable data source for glaciological analysis of the motion behaviour of glaciers. The measurement concepts for the acquisition of image sequences are presented, and an automated monoscopic image sequence processing chain is developed. Motion vector fields can be derived with high precision by applying automatic subpixel-accuracy image matching techniques on grey value patterns in the image sequences. Well-established matching techniques have been adapted to the special characteristics of the glacier data in order to achieve high reliability in automatic image sequence processing, including the handling of moving shadows as well as motion effects induced by small instabilities in the camera set-up. Suitable geo-referencing techniques were developed to transform image measurements into a reference coordinate system.The result of monoscopic image sequence analysis is a dense raster of glacier surface point trajectories for each image sequence. Each translation vector component in these trajectories can be determined with an accuracy of a few centimetres for points at a distance of several kilometres from the camera. Extensive practical validation experiments have shown that motion vector and trajectory fields derived from monocular image sequences can be used for the determination of high-resolution velocity fields of glaciers, including the analysis of tidal effects on glacier movement, the investigation of a glacier's motion behaviour during calving events, the determination of the position and migration of the grounding line and the detection of subglacial channels during glacier lake outburst floods.

  6. Insert sequence length determines transfection efficiency and gene expression levels in bicistronic mammalian expression vectors

    OpenAIRE

    Payne, Andrew J; Gerdes, Bryan C; Kaja, Simon; Koulen, Peter

    2013-01-01

    Bicistronic expression vectors have been widely used for co-expression studies since the initial discovery of the internal ribosome entry site (IRES) about 25 years ago. IRES sequences allow the 5’ cap-independent initiation of translation of multiple genes on a single messenger RNA strand. Using a commercially available mammalian expression vector containing an IRES sequence with a 3’ green fluorescent protein fluorescent marker, we found that sequence length of the gene of interest expresse...

  7. Using whole-genome sequencing to determine appropriate streptomycin epidemiological cutoffs for Salmonella and Escherichia coli.

    Science.gov (United States)

    Tyson, Gregory H; Li, Cong; Ayers, Sherry; McDermott, Patrick F; Zhao, Shaohua

    2016-02-01

    For Enterobacteriaceae such as Salmonella spp. and Escherichia coli, no unified interpretive resistance criteria exist for streptomycin, an epidemiologically important antibiotic. As part of the National Antimicrobial Resistance Monitoring System, we had previously used a minimum inhibitory concentration of ≥ 64 μg mL(-1) as an epidemiological cutoff value (ECV) to define non-wild-type isolates. To identify whether this ECV correlated with genetic determinants of resistance, we performed whole-genome sequencing of 463 Salmonella and E. coli isolates to identify streptomycin resistance genotypes. From this analysis, we found that using a streptomycin resistance breakpoint of ≥ 64 μg mL(-1) classified over 20% of strains possessing aadA or strA/strB resistance genes as wild-type. Therefore, to improve the concordance between genotypic and phenotypic data, we propose reducing the phenotypic cutoff values to ≥ 32 μg mL(-1) for both Salmonella and E. coli, to be used widely as ECVs to categorize non-wild-type isolates. Published by Oxford University Press on behalf of FEMS 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  8. Population Structure and Properties of Candida albicans, as Determined by Multilocus Sequence Typing†

    Science.gov (United States)

    Tavanti, Arianna; Davidson, Amanda D.; Fordyce, Mark J.; Gow, Neil A. R.; Maiden, Martin C. J.; Odds, Frank C.

    2005-01-01

    We submitted a panel of 416 isolates of Candida albicans from separate sources to multilocus sequence typing (MLST). The data generated determined a population structure in which four major clades of closely related isolates were delineated, together with eight minor clades comprising five or more isolates. By Fisher's exact test, a statistically significant association was found between particular clades and the anatomical source, geographical source, ABC genotype, decade of isolation, and homozygosity versus heterozygosity at the mating type-like locus (MTL) of the isolates in the clade. However, these associations may have been influenced by confounding variables, since in a univariate analysis of variance, only the clade associations with ABC type and anatomical source emerged as statistically significant, providing the first indication of possible differences between C. albicans strain type clades and their propensity to infect or colonize different anatomical locations. There were no significant differences between clades with respect to distributions of isolates resistant to fluconazole, itraconazole, or flucytosine. However, the majority of flucytosine-resistant isolates belonged to clade 1, and these isolates, but not flucytosine-resistant isolates in other clades, bore a unique mutation in the FUR1 gene that probably accounts for their resistance. A significantly higher proportion of isolates resistant to fluconazole, itraconazole, and flucytosine were homozygous at the MTL, suggesting that antifungal pressure may trigger a common mechanism that leads both to resistance and to MTL homozygosity. The utility of MLST for determining clade assignments of clinical isolates will form the basis for strain selection for future research into C. albicans virulence. PMID:16272493

  9. Characterization of North American Armillaria species: Genetic relationships determined by ribosomal DNA sequences and AFLP markers

    Science.gov (United States)

    M. -S. Kim; N. B. Klopfenstein; J. W. Hanna; G. I. McDonald

    2006-01-01

    Phylogenetic and genetic relationships among 10 North American Armillaria species were analysed using sequence data from ribosomal DNA (rDNA), including intergenic spacer (IGS-1), internal transcribed spacers with associated 5.8S (ITS + 5.8S), and nuclear large subunit rDNA (nLSU), and amplified fragment length polymorphism (AFLP) markers. Based on rDNA sequence data,...

  10. The iceLogo web server and SOAP service for determining protein consensus sequences.

    Science.gov (United States)

    Maddelein, Davy; Colaert, Niklaas; Buchanan, Iain; Hulstaert, Niels; Gevaert, Kris; Martens, Lennart

    2015-07-01

    The iceLogo web server and SOAP service implement the previously published iceLogo algorithm. iceLogo builds on probability theory to visualize protein consensus sequences in a format resembling sequence logos. Peptide sequences are compared against a reference sequence set that can be tailored to the studied system and the used protocol. As such, not only over- but also underrepresented residues can be visualized in a statistically sound manner, which further allows the user to easily analyse and interpret conserved sequence patterns in proteins. The web application and SOAP service can be found free and open to all users without the need for a login on http://iomics.ugent.be/icelogoserver/main.html. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Complete Genomic Sequence of Maize Rough Dwarf Virus, a Fijivirus Transmitted by the Small Brown Planthopper

    OpenAIRE

    Lv, Mingfang; Xie, Li; Yang, Jian; Chen, Jianping; Zhang, Heng-Mu

    2016-01-01

    The nucleotide sequences of the 10 genomic segments of an Italian isolate of maize rough dwarf virus (MRDV) were determined. This first complete genomic sequence of MRDV will help understand the phylogenetic relationships among group 2 fijiviruses and especially the closely related rice black-streaked dwarf virus, which is also found to naturally infect maize.

  12. Sequence analysis of the mitochondrial genomes from Dutch pedigrees with Leber hereditary optic neuropathy

    NARCIS (Netherlands)

    Howell, Neil; Oostra, Roelof-Jan; Bolhuis, Piet A.; Spruijt, Liesbeth; Clarke, Lorne A.; Mackey, David A.; Preston, Gwen; Herrnstadt, Corinna

    2003-01-01

    The complete mitochondrial DNA (mtDNA) sequences for 63 Dutch pedigrees with Leber hereditary optic neuropathy (LHON) were determined, 56 of which carried one of the classic LHON mutations at nucleotide (nt) 3460, 11778, or 14484. Analysis of these sequences indicated that there were several

  13. Multilocus Sequence Analysis of Housekeeping Genes and Antigenic Determinant Genes in Bordetella pertussis Strains Isolated in Korea.

    Science.gov (United States)

    Jung, Sang-Oun; Moon, Yu Mi; Kim, So-Hyeon; Sung, Hwa Young; Kwon, Seung-Jik; Kang, Yeon Ho; Yu, Jae Yon

    2011-09-01

    To confirm genotype diversities of clinical isolates of Bordetella pertussis and to evaluate the risk of pertussis outbreak in Korea. Seven housekeeping genes and 10 antigenic determinant genes from clinical B. pertussis isolates were analyzed by Multilocus sequence typing (MLST). More variant pattern was observed in antigenic determinant genes. Especially, PtxS1 gene was the most variant gene; five genotypes were observed from eight global genotypes. In the bacterial type, the number of observed sequence types in the isolates was seven and the most frequent form was type 1 (79.6%). This major sequence type also showed a time-dependent transition pattern. Older isolates (1968 and 1975) showed type 1 and 6 in housekeeping genes and antigenic determinant genes, respectively. However, these were changed to type 2 and 1 in isolates 1999-2008. This transition was mainly attributed to genotype change of PtxS1 and Fim3 gene; the tendency of genotype change was to avoid vaccine-derived genotype. In addition, there was second transition in 2009. In this period, only the sequence type of antigenic determinant genes was changed to type 2. Based Upon Related Sequence Types (BURST) analysis confirmed that there were two clonal complexes (ACCI and ACCII) in the Korean isolates. Moreover, the recently increased sequence type was revealed as AST2 derived from AST 3 in ACCI. Genotype changes in Korean distributing strains are still progressing and there was a specific driving force in antigenic determinant genes. Therefore continuous surveillance of genotype change of the distributing strains should be performed to confirm interrelationship of genotype change with vaccine immunity.

  14. Proofreading of misincorporated nucleotides in DNA transcription

    International Nuclear Information System (INIS)

    Voliotis, Margaritis; Liverpool, Tanniemola B; Cohen, Netta; Molina-París, Carmen

    2012-01-01

    The accuracy of DNA transcription is crucial for the proper functioning of the cell. Although RNA polymerases demonstrate selectivity for correct nucleotides, additional active mechanisms of transcriptional error correction are required to achieve observed levels of fidelity. Recent experimental findings have shed light on a particular mechanism of transcriptional error correction involving: (i) diffusive translocation of the RNA polymerase along the DNA (backtracking) and (ii) irreversible RNA cleavage. This mechanism achieves preferential cleavage of misincorporated nucleotides by biasing the local rates of translocation. Here, we study how misincorporated nucleotides affect backtracking dynamics and how this effect determines the level of transcriptional fidelity. We consider backtracking as a diffusive process in a periodic, one-dimensional energy landscape, which at a coarse-grained level gives rise to a hopping process between neighbouring local minima. We propose a model for how misincorporated nucleotides deform this energy landscape and hence affect the hopping rates. In particular, we show that this model can be used to derive both the theoretical limit on the fidelity (i.e. the minimum fraction of misincorporated nucleotides) and the actual fidelity relative to this optimum, achieved for specific combinations of the cleavage and polymerization rates. Finally, we study how external factors influencing backtracking dynamics affect transcriptional fidelity. We show that biologically relevant loads, similar to those exerted by nucleosomes or other transcriptional barriers, increase error correction. (paper)

  15. HLA-F coding and regulatory segments variability determined by massively parallel sequencing procedures in a Brazilian population sample.

    Science.gov (United States)

    Lima, Thálitta Hetamaro Ayala; Buttura, Renato Vidal; Donadi, Eduardo Antônio; Veiga-Castelli, Luciana Caricati; Mendes-Junior, Celso Teixeira; Castelli, Erick C

    2016-10-01

    Human Leucocyte Antigen F (HLA-F) is a non-classical HLA class I gene distinguished from its classical counterparts by low allelic polymorphism and distinctive expression patterns. Its exact function remains unknown. It is believed that HLA-F has tolerogenic and immune modulatory properties. Currently, there is little information regarding the HLA-F allelic variation among human populations and the available studies have evaluated only a fraction of the HLA-F gene segment and/or have searched for known alleles only. Here we present a strategy to evaluate the complete HLA-F variability including its 5' upstream, coding and 3' downstream segments by using massively parallel sequencing procedures. HLA-F variability was surveyed on 196 individuals from the Brazilian Southeast. The results indicate that the HLA-F gene is indeed conserved at the protein level, where thirty coding haplotypes or coding alleles were detected, encoding only four different HLA-F full-length protein molecules. Moreover, a same protein molecule is encoded by 82.45% of all coding alleles detected in this Brazilian population sample. However, the HLA-F nucleotide and haplotype variability is much higher than our current knowledge both in Brazilians and considering the 1000 Genomes Project data. This protein conservation is probably a consequence of the key role of HLA-F in the immune system physiology. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  16. The white spot syndrome virus DNA genome sequence

    NARCIS (Netherlands)

    Hulten, van M.C.W.; Witteveldt, J.; Peters, S.; Kloosterboer, N.; Tarchini, R.; Fiers, M.; Sandbrink, H.; Klein Lankhorst, R.; Vlak, J.M.

    2001-01-01

    White spot syndrome virus (WSSV) is at present a major scourge to worldwide shrimp cultivation. We have determined the entire sequence of the double-stranded, circular DNA genome of WSSV, which contains 292,967 nucleotides encompassing 184 major open reading frames (ORFs). Only 6 f the WSSV ORFs

  17. Complete genome sequence of pronghorn virus, a pestivirus

    Science.gov (United States)

    The complete genome sequence of Pronghorn virus, a member of the Pestivirus genus of the Flaviviridae, was determined. The virus, originally isolated from a pronghorn antelope, had a genome of 12,287 nucleotides with a single open reading frame of 11,694 bases encoding 3898 amino acids....

  18. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  19. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  20. Phylogeny of the genus Haemophilus as determined by comparison of partial infB sequences

    DEFF Research Database (Denmark)

    Hedegaard, J; Okkels, H; Bruun, B

    2001-01-01

    A 453 bp fragment of infB, the gene encoding translation initiation factor 2, was sequenced and compared from 66 clinical isolates and type strains of Haemophilus species and related bacteria. Analysis of the partial infB sequences obtained suggested that the human isolates dependent on X and V...... factor, H. influenzae, H. haemolyticus, H. aegyptius and some cryptic genospecies of H. influenzae, were closely related to each other. H. parainfluenzae constituted a heterogeneous group within the boundaries of the genus, whereas H. aphrophilus/paraphrophilus and Actinobacillus actinomycetemcomitans......, which fell into two discrete clusters. The delineation of 'Haemophilus sensu stricto' as suggested by infB analysis supports previous results obtained by DNA hybridization, in contrast to the delineation inferred from 16S rRNA sequence comparison....

  1. Rapid determination of anti-tuberculosis drug resistance from whole-genome sequences

    KAUST Repository

    Coll, Francesc

    2015-05-27

    Mycobacterium tuberculosis drug resistance (DR) challenges effective tuberculosis disease control. Current molecular tests examine limited numbers of mutations, and although whole genome sequencing approaches could fully characterise DR, data complexity has restricted their clinical application. A library (1,325 mutations) predictive of DR for 15 anti-tuberculosis drugs was compiled and validated for 11 of them using genomic-phenotypic data from 792 strains. A rapid online ‘TB-Profiler’ tool was developed to report DR and strain-type profiles directly from raw sequences. Using our DR mutation library, in silico diagnostic accuracy was superior to some commercial diagnostics and alternative databases. The library will facilitate sequence-based drug-susceptibility testing.

  2. Coding and spacer sequences in the 5.8S-2S region of Sciara coprophila ribosomal DNA.

    OpenAIRE

    Jordan, B R; Latil-Damotte, M; Jourdan, R

    1980-01-01

    The sequence of 436 nucleotides around the region coding for 5.8S RNA in the Sciara coprophila rDNA transcription unit (1) has been determined. Regions coding for 5.8S and 2S RNAs have been identified; they are 80 - 90% homologous to the corresponding Drosophila sequences and are separated by a 22 nucleotide long spacer. This sequence as well as the two before the 5.8 and after the 2S coding region are very different from the corresponding Drosophila sequences. The main features reported in t...

  3. Potentiality of 3D laser profilometry to determine the sequence of homogenous crossing lines on questioned documents.

    Science.gov (United States)

    Spagnolo, Giuseppe Schirripa

    2006-12-20

    The determination of the sequence of line crossings is still a current problem in the field of forensic documents examination. Optical examination, lifting technique, ESDA technique, and electron microscopy are the most widely used methods for the determination of the writing order of crossing texts. However, at present many examinations of intersecting lines result in an inconclusive opinion, particularly if the same type and colour of ink is involved. This paper presents the potentiality of the 3D laser profilometry, which has been to determine the chronological sequence of homogenous "crossing lines". The laser profilometry, illustrated in this paper, has been developed on a conoscopic holography based system. It is a non-contact three-dimensional measuring system that allows producing holograms, even with incoherent light, with fringe periods that can be measured precisely to determine the exact distance to the point measured. This technique is suitable to obtain a 3D micro-topography with high resolution also on surfaces with unevenness reflectivity (usual for the paper surface). The proposed technique is able to obtained 3D profile in non-invading way. Therefore, the original draft are not physically or chemically modified, allowing a multi-analysis in different times. The experiments performed with line crossings database show that the proposed method is able of "positive identification" of writing sequence in the majority of the tests. In absence of a positive identification, the result has been "inconclusive" (no false determination did occur in this work).

  4. Sequence variation in the androgen receptor gene is not a common determinant of male sexual orientation

    Energy Technology Data Exchange (ETDEWEB)

    Macke, J.P.; Nathans, J.; King, V.L. (Johns Hopkins Univ., Baltimore, MD (United States)); Hu, N.; Hu, S.; Hamer, D.; Bailey, M. (Northwestern Univ., Evanston, IL (United States)); Brown, T. (Johns Hopkins Univ. School of Hygiene and Public Health, Baltimore, MD (United States))

    1993-10-01

    To test the hypothesis that DNA sequence variation in the androgen receptor gene plays a causal role in the development of male sexual orientation, the authors have (1) measured the degree of concordance of androgen receptor alleles in 36 pairs of homosexual brothers, (2) compared the lengths of polyglutamine and polyglycine tracts in the amino-terminal domain of the androgen receptor in a sample of 197 homosexual males and 213 unselected subjects, and (3) screened the entire androgen receptor coding region for sequence variation by PCR and denaturing gradient-gel electrophoresis (DGGE) and/or single-strand conformation polymorphism analysis in 20 homosexual males with homosexual or bisexual brothers and one homosexual male with no homosexual brothers, and screened the amino-terminal domain of the receptor for sequence variation in an additional 44 homosexual males, 37 of whom had one or more first- or second-degree male relatives who were either homosexual or bisexual. These analyses show that (1) homosexual brothers are as likely to be discordant as concordant for androgen receptor alleles; (2) there are no large-scale differences between the distributions of polyglycine or polyglutamine tract lengths in the homosexual and control groups; and (3) coding region sequence variation is not commonly found within the androgen receptor gene of homosexual men. The DGGE screen identified two rare amino acid substitutions, ser[sup 205] -to-arg and glu[sup 793]-to-asp, the biological significance of which is unknown. 32 refs., 2 figs., 2 tabs.

  5. Determination of Elizabethkingia Diversity by MALDI-TOF Mass Spectrometry and Whole-Genome Sequencing

    DEFF Research Database (Denmark)

    Eriksen, Helle Brander; Gumpert, Heidi; Faurholt, Cecilie Haase

    2017-01-01

    In a hospital-acquired infection with multidrug-resistant Elizabethkingia, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry and 16S rRNA gene analysis identified the pathogen as Elizabethkingia miricola. Whole-genome sequencing, genus-level core genome analysis, and in...

  6. Dickeya species relatedness and clade structure determined by comparison of recA sequences.

    Science.gov (United States)

    Parkinson, Neil; Stead, David; Bew, Janice; Heeney, John; Tsror Lahkim, Leah; Elphinstone, John

    2009-10-01

    Using sequences from the recA locus, we have produced a phylogeny of 188 Dickeya strains from culture collections and identified species relatedness and subspecies clade structure within the genus. Of the six recognized species, Dickeya paradisiaca, D. chrysanthemi and D. zeae were discriminated with long branch lengths. The clade containing the D. paradisiaca type strain included just one additional strain, isolated from banana in Colombia. Strains isolated from Chrysanthemum and Parthenium species made up most of the clade containing the D. chrysanthemi type strain, and the host range of this species was extended to include potato. The D. zeae clade had the largest number of sequevars and branched into two major sister clades that contained all of the Zea mays isolates, and were identified as phylotypes PI and PII. The host range was increased from six to 13 species, including potato. The recA sequence of an Australian sugar-cane strain was sufficiently distinct to rank as a new species-level branch. In contrast to these species, Dickeya dadantii, D. dianthicola and D. dieffenbachiae were distinguished with shorter branch lengths, indicating relatively closer relatedness. The recA sequence for the type strain of D. dadantii clustered separately from other strains of the species. However, sequence comparison of three additional loci revealed that the D. dadantii type strain grouped together with the six other D. dadantii strains that were sequenced. Analysis of all four loci indicated that the D. dadantii strains were most closely related to D. dieffenbachiae. Three further branches (DUC-1, -2 and -3) were associated with these three species, which all diverged from a common origin and can be considered as a species complex. The large clade containing the D. dianthicola type strain comprised 58 strains and had little sequence diversity. One sequevar accounted for the majority of these strains, which were isolated nearly exclusively from eight hosts from Europe

  7. Characterization of the Escherichia coli prsA1-encoded mutant phosphoribosylpyrophosphate synthetase identifies a divalent cation-nucleotide binding site

    DEFF Research Database (Denmark)

    Bower, Stanley G.; Harlow, Kenneth W.; Switzer, Robert L.

    1989-01-01

    by chemical determination of the amino acid sequence of a tryptic peptide derived from the purified mutant enzyme. The mutation lies at the N-terminal end of a 16 residue sequence that is highly conserved in E. coli, Bacillus subtilis, and rat PRPP synthetases and has the following consensus sequence......The prsA1 allele, specifying a mutant Escherichia coli phosphoribosylpyrophosphate (PRPP) synthetase, has been cloned. The mutation was shown by nucleotide sequence analysis to result from substitution of Asp-128 (GAT) in the wild type by Ala (GCT) in prsA1. This alteration was confirmed...

  8. Mapping of a major osteomagenic determinant of murine leukemia virus RFB-14 to non-long terminal repeat sequences

    DEFF Research Database (Denmark)

    Østergaard, Mette; Pedersen, Lene; Schmidt, Jörg

    1997-01-01

    the pathogenic potential of recombinant viruses between RFB-14 and the nonosteomagenic, highly leukemogenic SL3-3 MuLV. The recombinants were constructed so as to reveal whether a major determinant of osteomagenicity maps to sequences within or outside the long terminal repeats (LTR). Our data show that a major...... determinant of the osteoma-inducing potential of RFB-14 MuLV maps to the non-LTR region of the genome. Furthermore, we demonstrate that a strong determinant of leukemogenicity is harbored by the non-LTR region of SL3-3 MuLV....

  9. Molecular characterization of the L1 gene of papillomaviruses in epithelial lesions of cats and comparative analysis with corresponding gene sequences of human and feline papillomaviruses.

    Science.gov (United States)

    Anis, Eman A; O'Neill, Sarah H; Newkirk, Kim M; Brahmbhatt, Rupal A; Abd-Eldaim, Mohamed; Frank, Linda A; Kania, Stephen A

    2010-12-01

    To characterize the L1 gene of papillomaviruses detected in epithelial lesions of cats and to determine the relationship between those L1 gene nucleotide sequences and known L1 gene sequences of human and feline papillomaviruses. 10 tissue samples of epithelial lesions from 8 cats. DNA was extracted from tissue samples. Primers were designed to amplify the L1 gene of papillomaviruses. Amplicons of DNA were sequenced; nucleotide sequences were compared with known L1 gene nucleotide sequences of papillomaviruses and used for phylogenetic analysis. Tissue samples were obtained from lesions (diagnosed as dysplasia [n=1], squamous cell carcinoma in situ [3], or squamous cell carcinoma [6]) of the skin (9) and oral mucosa [1]. Two amplicons had 99% homology with the L1 gene nucleotide sequence of human papillomavirus type 38b subtype FA125. Another amplicon had 84% homology with the L1 gene nucleotide sequence of human papillomavirus type 80 and was considered to be a new type of papillomavirus. Phylogenetic tree analysis revealed that these 3 papillomaviruses were grouped into 2 clades that were not similar to the clades of Felis domesticus papillomavirus type 1 or F domesticus papillomavirus type 2 (FdPV2). The remaining 7 amplicons had 98% to 100% homology with the L1 gene nucleotide sequence of FdPV2. Phylogenetic tree analysis revealed that those 7 papillomaviruses were grouped nto a single clade with FdPV2. Results support the likelihood of transmission of papillomaviruses between humans and cats.

  10. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  11. Phylogeny of the genus Haemophilus as determined by comparison of partial infB sequences

    DEFF Research Database (Denmark)

    Hedegaard, J; Okkels, H; Bruun, B

    2001-01-01

    A 453 bp fragment of infB, the gene encoding translation initiation factor 2, was sequenced and compared from 66 clinical isolates and type strains of Haemophilus species and related bacteria. Analysis of the partial infB sequences obtained suggested that the human isolates dependent on X and V...... factor, H. influenzae, H. haemolyticus, H. aegyptius and some cryptic genospecies of H. influenzae, were closely related to each other. H. parainfluenzae constituted a heterogeneous group within the boundaries of the genus, whereas H. aphrophilus/paraphrophilus and Actinobacillus actinomycetemcomitans...... were only remotely related to the type species of the genus Haemophilus H. parahaemolyticus and H. paraphrohaemolyticus took up an intermediary position and may not belong in the genus Haemophilus sensu stricto. Ambiguous results were obtained with seven isolates tentatively identified as H. segnis...

  12. DNA Sequence of Cutinase Gene Isolated from Spilocaea oleagina as Determined by PCR

    OpenAIRE

    Matsuda, Yoshinori; Toyoda, Hideyoshi; Morii, Naho; Graniti, Antonio; Ouchi, Seiji

    1998-01-01

    [Synopsis] In this study, partial cutinase genes were cloned from Spilocaea oleagina and four different formae specials of Fusarium oxysporum (lycopersici, melonis, spinaciae and fragariae) by using PCR method. The reported amino acid sequences were aligned with DNA Data Bank of Japan (DDBJ), and highly conserved amino acid regions were selected to construct specific primers of cutinase genes. Chromosomal DNA of S. oleagina was isolated and used for template of PCR to amplify cutinase genes. ...

  13. Genetic Relationship among Three Subspecies of Oncorhynchus masou Determined by Mitochondrial DNA Sequence Analysis

    OpenAIRE

    Ichiro, Oohara; Toshio, Okazaki; National Research Institute of Aquaculture; National Research Institute of Aquaculture

    1996-01-01

    It is generally accepted that there are 3 subspecies of Oncorhynchus masou in Japan, namely, Masu salmon (Oncorhynchus masou masou (Brevoort)), Amago salmon (O. masou ishikawae Jordan & McGregor), and Biwa salmon (O. masou rhodurus Jordan & McGregor or O. masou subsp. Kimura). Since the genetic relationship of these three taxa is not well known, there has been considerable confusion over their nomenclature. We have clarified the genetic relationship among these three taxa by partially sequenc...

  14. Use of Four Next-Generation Sequencing Platforms to Determine HIV-1 Coreceptor Tropism

    Czech Academy of Sciences Publication Activity Database

    Archer, J.; Weber, Jan; Henry, K.; Winner, D.; Gibson, R.; Lee, L.; Paxinos, E.; Arts, E. J.; Robertson, D. L.; Mimms, L.; Quinones-Mateu, M. E.

    2012-01-01

    Roč. 7, č. 11 (2012), e49602/1-e49602/17 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) LK11207 Institutional research plan: CEZ:AV0Z40550506 Keywords : HIV -1 tropism * V3 region * deep sequencing Subject RIV: EE - Microbiology, Virology Impact factor: 3.730, year: 2012 http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0049602

  15. MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing

    DEFF Research Database (Denmark)

    Nielsen, M; Hansen, J H; Hedegaard, J

    2010-01-01

    MicroRNAs (miRNA) are short single-stranded RNA molecules that regulate gene expression post-transcriptionally by binding to complementary sequences in the 3' untranslated region (3' UTR) of target mRNAs. MiRNAs participate in the regulation of myogenesis, and identification of the complete set o...... that highly expressed miRNAs are involved in skeletal muscle development and regeneration, signal transduction, cell-cell and cell-extracellular matrix communication and neural development and function....

  16. Determining peptide sequence effects that control the size, structure, and function of nanoparticles.

    Science.gov (United States)

    Coppage, Ryan; Slocik, Joseph M; Briggs, Beverly D; Frenkel, Anatoly I; Naik, Rajesh R; Knecht, Marc R

    2012-02-28

    The ability to tune the size, shape, and composition of nanomaterials at length scales particle morphology through controlling the biotic/abiotic interface. Here we demonstrate the ability to finely tune the size, surface structure, and functionality of single-crystal Pd nanoparticles between 2 and 3 nm using materials directing peptides. This was achieved by selectively altering the peptide sequence to change the binding motif, which in turn modifies the surface structure of the particles. The materials were fully characterized before and after reduction using atomically resolved spectroscopic and microscopic analyses, which indicated that the coordination environment prior to reduction significantly affects the structure of the final nanoparticles. Additionally, changes to the particle surface structure, as a function of peptide sequence, can allow for chloride ion coordination that alters the catalytic abilities of the materials for the C-C coupling Stille reaction. These results suggest that peptide-based approaches may be able to achieve control over the structure/function relationship of nanomaterials where the peptide sequence could be used to selectivity tune such capabilities.

  17. Isothermal microcalorimetry as a quality by design tool to determine optimal blending sequences.

    Science.gov (United States)

    Al-Hallak, M H D Kamal; Azarmi, Shirzad; Xu, Zhenghe; Maham, Yadollah; Löbenberg, Raimar

    2010-09-01

    This study was designed to assess the value of isothermal microcalorimetry (ITMC) as a quality by design (QbD) tool to optimize blending conditions during tablet preparation. Powder mixtures that contain microcrystalline cellulose (MCC), dibasic calcium phosphate dihydrate (DCPD), and prednisone were prepared as 1:1:1 ratios using different blending sequences. ITMC was used to monitor the thermal activity of the powder mixtures before and after each blending process. Differential scanning calorimetry (DSC) and X-ray powder diffraction (XRPD) were performed on all final powder mixtures. Final powder mixtures were used to prepare tablets with 10 mg prednisone content, and dissolution tests were performed on all tablet formulations. Using ITMC, it was observed that the powder mixtures had different thermal activity depending on the blending sequences of the ingredients. All mixtures prepared by mixing prednisone with DCPD in the first stage were associated with relatively fast and significant heat exchange. In contrast, mixing prednisone with MCC in the first step resulted in slower heat exchange. Powder mixture with high thermal activity showed extra DSC peaks, and their dissolution was generally slower compared to the other tablets. Blending is considered as a critical parameter in tablet preparation. This study showed that ITMC is a simple and efficient tool to monitor solid-state reactions between excipients and prednisone depending on blending sequences. ITMC has the potential to be used in QbD approaches to optimize blending parameters for prednisone tablets.

  18. Strain Typing and Determination of Population Structure of Candida krusei by Multilocus Sequence Typing▿

    Science.gov (United States)

    Jacobsen, Mette D.; Gow, Neil A. R.; Maiden, Martin C. J.; Shaw, Duncan J.; Odds, Frank C.

    2007-01-01

    A multilocus sequence typing (MLST) scheme for Candida krusei was devised, based on sequencing of six gene fragments of the species. The existence of heterozygous results for each of the six fragments sequenced confirms that C. krusei is diploid for at least part of its genome. The C. krusei MLST scheme had a discriminatory index of 0.998, making this system ideal for strain typing of C. krusei clinical isolates. MLST data for 122 independent C. krusei isolates from a range of geographical sources were analyzed by eBURST, structure, and the unweighted-pair group method using average linkages to derive a population structure comprising four subtype strain clusters. There was no evidence of geographical associations with particular subtypes. Data for pairs of isolates from seven patients showed that each patient was colonized and/or infected with strain types that were indistinguishable by MLST. The C. krusei MLST database can be accessed online at http://pubmlst.org/ckrusei/. PMID:17122025

  19. Large-scale determination of sequence, structure, and function relationships in cytosolic glutathione transferases across the biosphere.

    Directory of Open Access Journals (Sweden)

    Susan T Mashiyama

    2014-04-01

    Full Text Available The cytosolic glutathione transferase (cytGST superfamily comprises more than 13,000 nonredundant sequences found throughout the biosphere. Their key roles in metabolism and defense against oxidative damage have led to thousands of studies over several decades. Despite this attention, little is known about the physiological reactions they catalyze and most of the substrates used to assay cytGSTs are synthetic compounds. A deeper understanding of relationships across the superfamily could provide new clues about their functions. To establish a foundation for expanded classification of cytGSTs, we generated similarity-based subgroupings for the entire superfamily. Using the resulting sequence similarity networks, we chose targets that broadly covered unknown functions and report here experimental results confirming GST-like activity for 82 of them, along with 37 new 3D structures determined for 27 targets. These new data, along with experimentally known GST reactions and structures reported in the literature, were painted onto the networks to generate a global view of their sequence-structure-function relationships. The results show how proteins of both known and unknown function relate to each other across the entire superfamily and reveal that the great majority of cytGSTs have not been experimentally characterized or annotated by canonical class. A mapping of taxonomic classes across the superfamily indicates that many taxa are represented in each subgroup and highlights challenges for classification of superfamily sequences into functionally relevant classes. Experimental determination of disulfide bond reductase activity in many diverse subgroups illustrate a theme common for many reaction types. Finally, sequence comparison between an enzyme that catalyzes a reductive dechlorination reaction relevant to bioremediation efforts with some of its closest homologs reveals differences among them likely to be associated with evolution of this

  20. Cardiorespiratory Kinetics Determined by Pseudo-Random Binary Sequences - Comparisons between Walking and Cycling.

    Science.gov (United States)

    Koschate, J; Drescher, U; Thieschäfer, L; Heine, O; Baum, K; Hoffmann, U

    2016-12-01

    This study aims to compare cardiorespiratory kinetics as a response to a standardised work rate protocol with pseudo-random binary sequences between cycling and walking in young healthy subjects. Muscular and pulmonary oxygen uptake (V̇O 2 ) kinetics as well as heart rate kinetics were expected to be similar for walking and cycling. Cardiac data and V̇O 2 of 23 healthy young subjects were measured in response to pseudo-random binary sequences. Kinetics were assessed applying time series analysis. Higher maxima of cross-correlation functions between work rate and the respective parameter indicate faster kinetics responses. Muscular V̇O 2 kinetics were estimated from heart rate and pulmonary V̇O 2 using a circulatory model. Muscular (walking vs. cycling [mean±SD in arbitrary units]: 0.40±0.08 vs. 0.41±0.08) and pulmonary V̇O 2 kinetics (0.35±0.06 vs. 0.35±0.06) were not different, although the time courses of the cross-correlation functions of pulmonary V̇O 2 showed unexpected biphasic responses. Heart rate kinetics (0.50±0.14 vs. 0.40±0.14; P=0.017) was faster for walking. Regarding the biphasic cross-correlation functions of pulmonary V̇O 2 during walking, the assessment of muscular V̇O 2 kinetics via pseudo-random binary sequences requires a circulatory model to account for cardio-dynamic distortions. Faster heart rate kinetics for walking should be considered by comparing results from cycle and treadmill ergometry. © Georg Thieme Verlag KG Stuttgart · New York.

  1. Determining Clostridium difficile intra-taxa diversity by mining multilocus sequence typing databases.

    Science.gov (United States)

    Muñoz, Marina; Ríos-Chaparro, Dora Inés; Patarroyo, Manuel Alfonso; Ramírez, Juan David

    2017-03-14

    Multilocus sequence typing (MLST) is a highly discriminatory typing strategy; it is reproducible and scalable. There is a MLST scheme for Clostridium difficile (CD), a gram positive bacillus causing different pathologies of the gastrointestinal tract. This work was aimed at describing the frequency of sequence types (STs) and Clades (C) reported and evalute the intra-taxa diversity in the CD MLST database (CD-MLST-db) using an MLSA approach. Analysis of 1778 available isolates showed that clade 1 (C1) was the most frequent worldwide (57.7%), followed by C2 (29.1%). Regarding sequence types (STs), it was found that ST-1, belonging to C2, was the most frequent. The isolates analysed came from 17 countries, mostly from the United Kingdom (UK) (1541 STs, 87.0%). The diversity of the seven housekeeping genes in the MLST scheme was evaluated, and alleles from the profiles (STs), for identifying CD population structure. It was found that adk and atpA are conserved genes allowing a limited amount of clusters to be discriminated; however, different genes such as drx, glyA and particularly sodA showed high diversity indexes and grouped CD populations in many clusters, suggesting that these genes' contribution to CD typing should be revised. It was identified that CD STs reported to date have a mostly clonal population structure with foreseen events of recombination; however, one group of STs was not assigned to a clade being highly different containing at least nine well-supported clusters, suggesting a greater amount of clades for CD. This study shows the usefulness of CD-MLST-db as a tool for studying CD distribution and population structure, identifying the need for reviewing the usefulness of sodA as housekeeping gene within the MLST scheme and suggesting the existence of a greater amount of CD clades. The study also shows the plausible exchange of genetic material between STs, contributing towards intra-taxa genetic diversity.

  2. Site amplification in Wellington city, New Zealand, determined from analysis of recent earthquake sequences

    Science.gov (United States)

    Kaiser, A. E.; Francois-Holden, C.; Benites, R. A.

    2016-12-01

    New Zealand's capital city of Wellington lies astride the Pacific-Australian plate boundary in an area of high seismic hazard. Several large crustal faults capable of generating earthquakes of magnitude >7 cut through the region, and the subduction interface lies at relatively shallow depths ( 25 km) below. The central city is situated on an alluvial basin with variable bedrock depth capable of generating complex 3D site amplification. Furthermore, much of the rest of the city is spread across high topographic relief with the potential for significant local topographic and basin edge effects. In 2013, the Cook Strait earthquake sequence produced the highest ground shaking experienced in the region in recent decades, and included two earthquakes of Mw 6.6 situated approximately 50km from Wellington. Peak ground accelerations recorded during the sequence ranged up to 0.2g during both major events and spectral accelerations recorded in the central city ranged up to approximately 20-30% of the current building design level. Ground motions during the Cook Strait sequence in Wellington were highly variable and strongly dependent on the local site conditions. We use this new data to present an analysis of local ground motion effects in terms of amplification and polarization using horizontal-to-vertical and site-to-reference spectral ratios calculated for a range of Wellington stations spanning rock to deep soil conditions. We also investigate horizontal and vertical site amplification using a spectral inversion technique to separate source, path and site influences on ground motion. Our results are generally in good agreement with existing microzonation maps, however, some differences may result from the complex role of 3D bedrock and surface topography in the region.

  3. Bias in ligation-based small RNA sequencing library construction is determined by adaptor and RNA structure.

    Directory of Open Access Journals (Sweden)

    Ryan T Fuchs

    Full Text Available High-throughput sequencing (HTS has become a powerful tool for the detection of and sequence characterization of microRNAs (miRNA and other small RNAs (sRNA. Unfortunately, the use of HTS data to determine the relative quantity of different miRNAs in a sample has been shown to be inconsistent with quantitative PCR and Northern Blot results. Several recent studies have concluded that the major contributor to this inconsistency is bias introduced during the construction of sRNA libraries for HTS and that the bias is primarily derived from the adaptor ligation steps, specifically where single stranded adaptors are sequentially ligated to the 3' and 5'-end of sRNAs using T4 RNA ligases. In this study we investigated the effects of ligation bias by using a pool of randomized ligation substrates, defined mixtures of miRNA sequences and several combinations of adaptors in HTS library construction. We show that like the 3' adaptor ligation step, the 5' adaptor ligation is also biased, not because of primary sequence, but instead due to secondary structures of the two ligation substrates. We find that multiple secondary structural factors influence final representation in HTS results. Our results provide insight about the nature of ligation bias and allowed us to design adaptors that reduce ligation bias and produce HTS results that more accurately reflect the actual concentrations of miRNAs in the defined starting material.

  4. Whole-genome sequencing identifies EN1 as a determinant of bone density and fracture

    Science.gov (United States)

    Zheng, Hou-Feng; Forgetta, Vincenzo; Hsu, Yi-Hsiang; Estrada, Karol; Rosello-Diez, Alberto; Leo, Paul J; Dahia, Chitra L; Park-Min, Kyung Hyun; Tobias, Jonathan H; Kooperberg, Charles; Kleinman, Aaron; Styrkarsdottir, Unnur; Liu, Ching-Ti; Uggla, Charlotta; Evans, Daniel S; Nielson, Carrie M; Walter, Klaudia; Pettersson-Kymmer, Ulrika; McCarthy, Shane; Eriksson, Joel; Kwan, Tony; Jhamai, Mila; Trajanoska, Katerina; Memari, Yasin; Min, Josine; Huang, Jie; Danecek, Petr; Wilmot, Beth; Li, Rui; Chou, Wen-Chi; Mokry, Lauren E; Moayyeri, Alireza; Claussnitzer, Melina; Cheng, Chia-Ho; Cheung, Warren; Medina-Gómez, Carolina; Ge, Bing; Chen, Shu-Huang; Choi, Kwangbom; Oei, Ling; Fraser, James; Kraaij, Robert; Hibbs, Matthew A; Gregson, Celia L; Paquette, Denis; Hofman, Albert; Wibom, Carl; Tranah, Gregory J; Marshall, Mhairi; Gardiner, Brooke B; Cremin, Katie; Auer, Paul; Hsu, Li; Ring, Sue; Tung, Joyce Y; Thorleifsson, Gudmar; Enneman, Anke W; van Schoor, Natasja M; de Groot, Lisette C.P.G.M.; van der Velde, Nathalie; Melin, Beatrice; Kemp, John P; Christiansen, Claus; Sayers, Adrian; Zhou, Yanhua; Calderari, Sophie; van Rooij, Jeroen; Carlson, Chris; Peters, Ulrike; Berlivet, Soizik; Dostie, Josée; Uitterlinden, Andre G; Williams, Stephen R.; Farber, Charles; Grinberg, Daniel; LaCroix, Andrea Z; Haessler, Jeff; Chasman, Daniel I; Giulianini, Franco; Rose, Lynda M; Ridker, Paul M; Eisman, John A; Nguyen, Tuan V; Center, Jacqueline R; Nogues, Xavier; Garcia-Giralt, Natalia; Launer, Lenore L; Gudnason, Vilmunder; Mellström, Dan; Vandenput, Liesbeth; Karlsson, Magnus K; Ljunggren, Östen; Svensson, Olle; Hallmans, Göran; Rousseau, François; Giroux, Sylvie; Bussière, Johanne; Arp, Pascal P; Koromani, Fjorda; Prince, Richard L; Lewis, Joshua R; Langdahl, Bente L; Hermann, A Pernille; Jensen, Jens-Erik B; Kaptoge, Stephen; Khaw, Kay-Tee; Reeve, Jonathan; Formosa, Melissa M; Xuereb-Anastasi, Angela; Åkesson, Kristina; McGuigan, Fiona E; Garg, Gaurav; Olmos, Jose M; Zarrabeitia, Maria T; Riancho, Jose A; Ralston, Stuart H; Alonso, Nerea; Jiang, Xi; Goltzman, David; Pastinen, Tomi; Grundberg, Elin; Gauguier, Dominique; Orwoll, Eric S; Karasik, David; Davey-Smith, George; Smith, Albert V; Siggeirsdottir, Kristin; Harris, Tamara B; Zillikens, M Carola; van Meurs, Joyce BJ; Thorsteinsdottir, Unnur; Maurano, Matthew T; Timpson, Nicholas J; Soranzo, Nicole; Durbin, Richard; Wilson, Scott G; Ntzani, Evangelia E; Brown, Matthew A; Stefansson, Kari; Hinds, David A; Spector, Tim; Cupples, L Adrienne; Ohlsson, Claes; Greenwood, Celia MT; Jackson, Rebecca D; Rowe, David W; Loomis, Cynthia A; Evans, David M; Ackert-Bicknell, Cheryl L; Joyner, Alexandra L; Duncan, Emma L; Kiel, Douglas P; Rivadeneira, Fernando; Richards, J Brent

    2016-01-01

    SUMMARY The extent to which low-frequency (minor allele frequency [MAF] between 1–5%) and rare (MAF ≤ 1%) variants contribute to complex traits and disease in the general population is largely unknown. Bone mineral density (BMD) is highly heritable, is a major predictor of osteoporotic fractures and has been previously associated with common genetic variants1–8, and rare, population-specific, coding variants9. Here we identify novel non-coding genetic variants with large effects on BMD (ntotal = 53,236) and fracture (ntotal = 508,253) in individuals of European ancestry from the general population. Associations for BMD were derived from whole-genome sequencing (n=2,882 from UK10K), whole-exome sequencing (n= 3,549), deep imputation of genotyped samples using a combined UK10K/1000Genomes reference panel (n=26,534), and de-novo replication genotyping (n= 20,271). We identified a low-frequency non-coding variant near a novel locus, EN1, with an effect size 4-fold larger than the mean of previously reported common variants for lumbar spine BMD8 (rs11692564[T], MAF = 1.7%, replication effect size = +0.20 standard deviations [SD], Pmeta = 2×10−14), which was also associated with a decreased risk of fracture (OR = 0.85; P = 2×10−11; ncases = 98,742 and ncontrols = 409,511). Using an En1Cre/flox mouse model, we observed that conditional loss of En1 results in low bone mass, likely as a consequence of high bone turn-over. We also identified a novel low-frequency non-coding variant with large effects on BMD near WNT16 (rs148771817[T], MAF = 1.1%, replication effect size = +0.39 SD, Pmeta = 1×10−11). In general, there was an excess of association signals arising from deleterious coding and conserved non-coding variants. These findings provide evidence that low-frequency non-coding variants have large effects on BMD and fracture, thereby providing rationale for whole-genome sequencing and improved imputation reference panels to study the genetic architecture of

  5. Killer Immunoglobulin-Like Receptor Allele Determination Using Next-Generation Sequencing Technology

    Directory of Open Access Journals (Sweden)

    Bercelin Maniangou

    2017-05-01

    Full Text Available The impact of natural killer (NK cell alloreactivity on hematopoietic stem cell transplantation (HSCT outcome is still debated due to the complexity of graft parameters, HLA class I environment, the nature of killer cell immunoglobulin-like receptor (KIR/KIR ligand genetic combinations studied, and KIR+ NK cell repertoire size. KIR genes are known to be polymorphic in terms of gene content, copy number variation, and number of alleles. These allelic polymorphisms may impact both the phenotype and function of KIR+ NK cells. We, therefore, speculate that polymorphisms may alter donor KIR+ NK cell phenotype/function thus modulating post-HSCT KIR+ NK cell alloreactivity. To investigate KIR allele polymorphisms of all KIR genes, we developed a next-generation sequencing (NGS technology on a MiSeq platform. To ensure the reliability and specificity of our method, genomic DNA from well-characterized cell lines were used; high-resolution KIR typing results obtained were then compared to those previously reported. Two different bioinformatic pipelines were used allowing the attribution of sequencing reads to specific KIR genes and the assignment of KIR alleles for each KIR gene. Our results demonstrated successful long-range KIR gene amplifications of all reference samples using intergenic KIR primers. The alignment of reads to the human genome reference (hg19 using BiRD pipeline or visualization of data using Profiler software demonstrated that all KIR genes were completely sequenced with a sufficient read depth (mean 317× for all loci and a high percentage of mapping (mean 93% for all loci. Comparison of high-resolution KIR typing obtained to those published data using exome capture resulted in a reported concordance rate of 95% for centromeric and telomeric KIR genes. Overall, our results suggest that NGS can be used to investigate the broad KIR allelic polymorphism. Hence, these data improve our knowledge, not only on KIR+ NK cell alloreactivity in

  6. Structure of mouse rRNA precursors. Complete sequence and potential folding of the spacer regions between 18S and 28S rRNA.

    OpenAIRE

    Michot, B; Bachellerie, J P; Raynal, F

    1983-01-01

    We have determined the complete nucleotide sequence of the regions of mouse ribosomal RNA transcription unit which separate mature rRNA genes. These internal transcribed spacers (ITS) are excised from rRNA precursor during ribosome biosynthesis. ITS 1, between 18S and 5.8S rRNA genes, is 999 nucleotides long. ITS 2, between 5.8S and 28S rRNA genes, is 1089 nucleotides long. Both spacers are very rich in G + C, 70 and 74% respectively. Mouse sequences have been compared with the other availabl...

  7. Enzymatic cleavage of type II restriction endonucleases on the 2'-O-methyl nucleotide and phosphorothioate substituted DNA.

    Directory of Open Access Journals (Sweden)

    Guojie Zhao

    Full Text Available The effects of nucleotide analogue substitution on the cleavage efficiencies of type II restriction endonucleases have been investigated. Six restriction endonucleases (EcoRV, SpeI, XbaI, XhoI, PstI and SphI were investigated respectively regarding their cleavage when substrates were substituted by 2'-O-methyl nucleotide (2'-OMeN and phosphorothioate (PS. Substitutions were made in the recognition sequence and the two nucleotides flanking the recognition sequence for each endonuclease. The endonuclease cleavage efficiencies were determined using FRET-based assay. Results demonstrated a position-dependent inhibitory effect of substitution on the cleavage efficiency for all the six endonucleases. In general, the 2'-OMeN substitutions had greater impact than the PS substitutions on the enzymatic activities. Nucleotides of optimal substitutions for protection against RE cleavage were identified. Experimental results and conclusions in this study facilitate our insight into the DNA-protein interactions and the enzymatic cleavage mechanism, particularly for those whose detailed structure information is not available. In addition, the information could benefit the development of bioengineering and synthetic biology.

  8. Enzymatic cleavage of type II restriction endonucleases on the 2'-O-methyl nucleotide and phosphorothioate substituted DNA.

    Science.gov (United States)

    Zhao, Guojie; Li, Jun; Tong, Zhaoxue; Zhao, Bin; Mu, Runqing; Guan, Yifu

    2013-01-01

    The effects of nucleotide analogue substitution on the cleavage efficiencies of type II restriction endonucleases have been investigated. Six restriction endonucleases (EcoRV, SpeI, XbaI, XhoI, PstI and SphI) were investigated respectively regarding their cleavage when substrates were substituted by 2'-O-methyl nucleotide (2'-OMeN) and phosphorothioate (PS). Substitutions were made in the recognition sequence and the two nucleotides flanking the recognition sequence for each endonuclease. The endonuclease cleavage efficiencies were determined using FRET-based assay. Results demonstrated a position-dependent inhibitory effect of substitution on the cleavage efficiency for all the six endonucleases. In general, the 2'-OMeN substitutions had greater impact than the PS substitutions on the enzymatic activities. Nucleotides of optimal substitutions for protection against RE cleavage were identified. Experimental results and conclusions in this study facilitate our insight into the DNA-protein interactions and the enzymatic cleavage mechanism, particularly for those whose detailed structure information is not available. In addition, the information could benefit the development of bioengineering and synthetic biology.

  9. Cloning and DNA sequence of the mercuric- and organomercurial-resistance determinants of plasmid pDU1358

    International Nuclear Information System (INIS)

    Griffin, H.G.; Foster, T.J.; Silver, S.; Misra, T.K.

    1987-01-01

    The broad-spectrum mercurial-resistance plasmid pDU1358 was analyzed by cloning the resistance determinants and preparing a physical and genetic map of a 45-kilobase (kb) region of the plasmid that contains two separate mercurial-resistance operons that mapped about 20 kb apart. One encoded narrow-spectrum mercurial resistance to Hg 2+ and a few organomercurials; the other specified broad-spectrum resistance to phenylmercury and additional organomercurials. Each determinant governed mercurial transport functions. Southern DNA x DNA hybridization experiments using gene-specific probes from the plasmid R100 mer operon indicated close homology with the R100 deteminant. The 2153 base pairs of the promoter-distal part of the broad-spectrum Hg 2+ -resistance operon of pDU1358 were sequenced. This region included the 3'-terminal part of the merA gene, merD, unidentified reading frame URF1, and a part of URF2 homologous to previously sequenced determinants of plasmid R100. Between the merA and merD genes, an open reading frame encoding a 212 amino acid polypeptide was identified as the merB gene that determines the enzyme organomercurial lyase that cleaves the C-Hg bond of phenylmercury

  10. Image analysis for DNA sequencing

    International Nuclear Information System (INIS)

    Palaniappan, K.; Huang, T.S.

    1991-01-01

    This paper reports that there is a great deal of interest in automating the process of DNA (deoxyribonucleic acid) sequencing to support the analysis of genomic DNA such as the Human and Mouse Genome projects. In one class of gel-based sequencing protocols autoradiograph images are generated in the final step and usually require manual interpretation to reconstruct the DNA sequence represented by the image. The need to handle a large volume of sequence information necessitates automation of the manual autoradiograph reading step through image analysis in order to reduce the length of time required to obtain sequence data and reduce transcription errors. Various adaptive image enhancement, segmentation and alignment methods were applied to autoradiograph images. The methods are adaptive to the local characteristics of the image such as noise, background signal, or presence of edges. Once the two-dimensional data is converted to a set of aligned one-dimensional profiles waveform analysis is used to determine the location of each band which represents one nucleotide in the sequence. Different classification strategies including a rule-based approach are investigated to map the profile signals, augmented with the original two-dimensional image data as necessary, to textual DNA sequence information

  11. On the determination of the He abundance distribution in globular clusters from the width of the main sequence

    Science.gov (United States)

    Cassisi, Santi; Salaris, Maurizio; Pietrinferni, Adriano; Hyder, David

    2017-01-01

    One crucial piece of information to study the origin of multiple stellar populations in globular clusters is the range of initial helium abundances ΔY amongst the sub-populations hosted by each cluster. These estimates are commonly obtained by measuring the width in colour of the unevolved main sequence in an optical colour-magnitude diagram (CMD). The measured colour spread is then compared with predictions from theoretical stellar isochrones with varying initial He abundances to determine ΔY. The availability of UV/optical magnitudes, thanks to the Hubble Space Telescope UV Legacy Survey of Galactic GCs project, will allow the homogeneous determination of ΔY for a large Galactic globular cluster sample. From a theoretical point of view, accurate UV CMDs can efficiently disentangle the various sub-populations, and main sequence colour differences in the ACS F606W - (F606W - F814W) diagram allow an estimate of ΔY. We demonstrate that from a theoretical perspective, the (F606W - F814W) colour is an extremely reliable He-abundance indicator. The derivative dY/d(F606W - F814W), computed at a fixed luminosity along the unevolved main sequence, is largely insensitive to the physical assumptions made in stellar model computations, being more sensitive to the choice of the bolometric correction scale, and is only slightly dependent on the adopted set of stellar models. From a theoretical point of view, the (F606W - F814W) colour width of the cluster main sequence is therefore a robust diagnostic of the ΔY range.

  12. [Clonage of the "malA" region of "Escherichia coli" K12: nucleotide sequence of the regulatory region and the promoters, identification and purification of the MalT-activator protein (author's transl)].

    Science.gov (United States)

    Raibaud, O; Débarbouillé, M; Cossart, P

    1982-01-01

    A 5,800-bp (base pair) HindIII-EcoRI DNA fragment containing malT, the positive regulator gene of the maltose regulon, and most of malP, the structural gene for maltodextrin phosphorylase, was cloned into pBR322. A sequence of 802 bp was established in a DNA segment containing the promotor for malPQ and the promoter for malT. A total of 611 bp separates the initiation codons for these two genes, which are transcribed in opposite directions. The malT product was identified as a 94,000 dalton polypeptide.

  13. Fast skeletal muscle transcriptome of the Gilthead sea bream (Sparus aurata determined by next generation sequencing

    Directory of Open Access Journals (Sweden)

    Garcia de la serrana Daniel

    2012-05-01

    Full Text Available Abstract Background The gilthead sea bream (Sparus aurata L. occurs around the Mediterranean and along Eastern Atlantic coasts from Great Britain to Senegal. It is tolerant of a wide range of temperatures and salinities and is often found in brackish coastal lagoons and estuarine areas, particularly early in its life cycle. Gilthead sea bream are extensively cultivated in the Mediterranean with an annual production of 125,000 metric tonnes. Here we present a de novo assembly of the fast skeletal muscle transcriptome of gilthead sea bream using 454 reads and identify gene paralogues, splice variants and microsatellite repeats. An annotated transcriptome of the skeletal muscle will facilitate understanding of the genetic and molecular basis of traits linked to production in this economically important species. Results Around 2.7 million reads of mRNA sequence data were generated from the fast myotomal of adult fish (~2 kg and juvenile fish (~0.09 kg that had been either fed to satiation, fasted for 3-5d or transferred to low (11°C or high (33°C temperatures for 3-5d. Newbler v2.5 assembly resulted in 43,461 isotigs >100 bp. The number of sequences annotated by searching protein and gene ontology databases was 10,465. The average coverage of the annotated isotigs was x40 containing 5655 unique gene IDs and 785 full-length cDNAs coding for proteins containing 58–1536 amino acids. The v2.5 assembly was found to be of good quality based on validation using 200 full-length cDNAs from GenBank. Annotated isotigs from the reference transcriptome were attributable to 344 KEGG pathway maps. We identified 26 gene paralogues (20 of them teleost-specific and 43 splice variants, of which 12 had functional domains missing that were likely to affect their biological function. Many key transcription factors, signaling molecules and structural proteins necessary for myogenesis and muscle growth have been identified. Physiological status affected the

  14. Coccidioides species determination: does sequence analysis agree with restriction fragment length polymorphism?

    Science.gov (United States)

    Johnson, Suzanne M; Carlson, Erin L; Pappagianis, Demosthenes

    2015-06-01

    Fifteen Coccidioides isolates were previously examined for genetic diversity using restriction fragment length polymorphism (RFLP); two fragment patterns were observed. Two isolates demonstrated one banding pattern (designated RFLP group I), while the remaining 13 isolates demonstrated a second pattern (designated RFLP group II). Recently, molecular studies supported the division of the genera Coccidioides into two species: Coccidioides posadasii and Coccidioides immitis. It has been assumed that the species division corresponds to the RFLP grouping. We tested this hypothesis by amplifying the ribosomal DNA internal transcribed spacer region as well as the dioxygenase, serine proteinase, and urease genes from 13 isolates previously examined by RFLP and then sequencing the PCR products. The appropriate species for each isolate was assigned using phylogenetically informative sites. The RFLP grouping agreed with the Coccidioides species assignment for all but one isolate, which may represent a hybrid. In addition, polymorphic sites among the four genes examined were in agreement for species assignment such that analysis of a single gene may be sufficient for species assignment.

  15. Supervised multivariate analysis of sequence groups to identify specificity determining residues

    Directory of Open Access Journals (Sweden)

    Higgins Desmond G

    2007-04-01

    Full Text Available Abstract Background Proteins that evolve from a common ancestor can change functionality over time, and it is important to be able identify residues that cause this change. In this paper we show how a supervised multivariate statistical method, Between Group Analysis (BGA, can be used to identify these residues from families of proteins with different substrate specifities using multiple sequence alignments. Results We demonstrate the usefulness of this method on three different test cases. Two of these test cases, the Lactate/Malate dehydrogenase family and Nucleotidyl Cyclases, consist of two functional groups. The other family, Serine Proteases consists of three groups. BGA was used to analyse and visualise these three families using two different encoding schemes for the amino acids. Conclusion This overall combination of methods in this paper is powerful and flexible while being computationally very fast and simple. BGA is especially useful because it can be used to analyse any number of functional classes. In the examples we used in this paper, we have only used 2 or 3 classes for demonstration purposes but any number can be used and visualised.

  16. Nucleotide variation at the dopa decarboxylase (Ddc) gene in ...

    Indian Academy of Sciences (India)

    We studied nucleotide sequence variation at the gene coding for dopa decarboxylase (Ddc) in seven populations of Drosophila melanogaster. Strength and pattern of linkage disequilibrium are somewhat distinct in the extensively sampled Spanish and Raleigh populations. In the Spanish population, a few sites are in ...

  17. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  18. Nucleotide variation at the methionine synthase locus in an ...

    African Journals Online (AJOL)

    Nucleotide variation at the methionine synthase (MetE) locus within and among populations of an endangered forest tree Fokienia hodginsii in Vietnam was investigated in the present study. A total of 12 populations were sampled across Vietnam. The length of the sequenced locus varied from 1567 to 1559 bp. A total of 42 ...

  19. Determination of disease phenotypes and pathogenic variants from exome sequence data in the CAGI 4 gene panel challenge.

    Science.gov (United States)

    Kundu, Kunal; Pal, Lipika R; Yin, Yizhou; Moult, John

    2017-09-01

    The use of gene panel sequence for diagnostic and prognostic testing is now widespread, but there are so far few objective tests of methods to interpret these data. We describe the design and implementation of a gene panel sequencing data analysis pipeline (VarP) and its assessment in a CAGI4 community experiment. The method was applied to clinical gene panel sequencing data of 106 patients, with the goal of determining which of 14 disease classes each patient has and the corresponding causative variant(s). The disease class was correctly identified for 36 cases, including 10 where the original clinical pipeline did not find causative variants. For a further seven cases, we found strong evidence of an alternative disease to that tested. Many of the potentially causative variants are missense, with no previous association with disease, and these proved the hardest to correctly assign pathogenicity or otherwise. Post analysis showed that three-dimensional structure data could have helped for up to half of these cases. Over-reliance on HGMD annotation led to a number of incorrect disease assignments. We used a largely ad hoc method to assign probabilities of pathogenicity for each variant, and there is much work still to be done in this area. © 2017 The Authors. **Human Mutation published by Wiley Periodicals, Inc.

  20. Determination of Shift/Bias in Digital Aerial Triangulation of UAV Imagery Sequences

    Science.gov (United States)

    Wierzbicki, Damian

    2017-12-01

    Currently UAV Photogrammetry is characterized a largely automated and efficient data processing. Depicting from the low altitude more often gains on the meaning in the uses of applications as: cities mapping, corridor mapping, road and pipeline inspections or mapping of large areas e.g. forests. Additionally, high-resolution video image (HD and bigger) is more often use for depicting from the low altitude from one side it lets deliver a lot of details and characteristics of ground surfaces features, and from the other side is presenting new challenges in the data processing. Therefore, determination of elements of external orientation plays a substantial role the detail of Digital Terrain Models and artefact-free ortophoto generation. Parallel a research on the quality of acquired images from UAV and above the quality of products e.g. orthophotos are conducted. Despite so fast development UAV photogrammetry still exists the necessity of accomplishment Automatic Aerial Triangulation (AAT) on the basis of the observations GPS/INS and via ground control points. During low altitude photogrammetric flight, the approximate elements of external orientation registered by UAV are burdened with the influence of some shift/bias errors. In this article, methods of determination shift/bias error are presented. In the process of the digital aerial triangulation two solutions are applied. In the first method shift/bias error was determined together with the drift/bias error, elements of external orientation and coordinates of ground control points. In the second method shift/bias error was determined together with the elements of external orientation, coordinates of ground control points and drift/bias error equals 0. When two methods were compared the difference for shift/bias error is more than ±0.01 m for all terrain coordinates XYZ.

  1. Order and correlations in genomic DNA sequences. The spectral approach

    International Nuclear Information System (INIS)

    Lobzin, Vasilii V; Chechetkin, Vladimir R

    2000-01-01

    The structural analysis of genomic DNA sequences is discussed in the framework of the spectral approach, which is sufficiently universal due to the reciprocal correspondence and mutual complementarity of Fourier transform length scales. The spectral characteristics of random sequences of the same nucleotide composition possess the property of self-averaging for relatively short sequences of length M≥100-300. Comparison with the characteristics of random sequences determines the statistical significance of the structural features observed. Apart from traditional applications to the search for hidden periodicities, spectral methods are also efficient in studying mutual correlations in DNA sequences. By combining spectra for structure factors and correlation functions, not only integral correlations can be estimated but also their origin identified. Using the structural spectral entropy approach, the regularity of a sequence can be quantitatively assessed. A brief introduction to the problem is also presented and other major methods of DNA sequence analysis described. (reviews of topical problems)

  2. Cyclic nucleotide content of tobacco BY-2 cells.

    Science.gov (United States)

    Richards, Helen; Das, Swadipa; Smith, Christopher J; Pereira, Louisa; Geisbrecht, Alan; Devitt, Nicola J; Games, David E; van Geyschem, Jan; Gareth Brenton, A; Newton, Russell P

    2002-11-01

    The cyclic nucleotide content of cultured tobacco bright yellow-2 (BY-2) cells was determined, after freeze-killing, perchlorate extraction and sequential chromatography, by radioimmunoassay. The identities of the putative cyclic nucleotides, adenosine 3',5'-cyclic monophosphate (cyclic AMP), guanosine 3',5'-cyclic monophosphate (cyclic GMP) and cytidine 3',5'-cyclic monophosphate (cyclic CMP) were unambiguously confirmed by tandem mass spectrometry. The potential of BY-2 cell cultures as a model system for future investigations of cyclic nucleotide function in higher plants is discussed.

  3. Common and specific genomic sequences of avian and human extraintestinal pathogenic Escherichia coli as determined by genomic subtractive hybridization

    Directory of Open Access Journals (Sweden)

    Nolan Lisa K

    2007-08-01

    Full Text Available Abstract Background Suppression subtractive hybridization (SSH strategy was used with extraintestinal pathogenic Escherichia coli (EXPEC that cause avian colibacillosis (avian pathogenic E. coli or APEC and human urinary tract infections (uropathogenic E. coli or UPEC to determine if they possessed genes that were host and/or niche specific. Both APEC and UPEC isolates were used as tester and driver strains in 4 different SSHs in order to obtain APEC- and UPEC-specific subtraction fragments (SFs. Results These procedures yielded a total of 136 tester-specific SFs of which 85 were APEC-derived and 51 were UPEC-derived. Most of the APEC-derived SFs were associated with plasmids; whereas, the majority of UPEC-derived sequences matched to the bacterial chromosome. We further determined the distribution of these tester-derived sequences in a collection of UPEC and APEC isolates using polymerase chain reaction techniques. Plasmid-borne, APEC-derived sequences (tsh, cvaB, traR, traC and sopB were predominantly present in APEC, as compared to UPEC. Of the UPEC-derived SFs, those encoding hemolysin D and F1C major and minor fimbrial subunits were present only in UPEC. However, two UPEC-derived SFs that showed strong similarity to the uropathgenic-specific protein gene (usp occurred in APEC, demonstrating that usp is not specific to UPEC. Conclusion This study provides evidence of the genetic variability of ExPEC as well as genomic similarities between UPEC and APEC; it did not identify any single marker that would dictate host and/or niche specificity in APEC or UPEC. However, further studies on the genes that encode putative or hypothetical proteins might offer important insight into the pathogenesis of disease, as caused by these two ExPEC.

  4. Detection of streptomycin resistance in Mycobacterium tuberculosis clinical isolates from China as determined by denaturing HPLC analysis and DNA sequencing.

    Science.gov (United States)

    Shi, Ruiru; Zhang, Jianyuan; Li, Chuanyou; Kazumi, Yuko; Sugawara, Isamu

    2007-01-01

    China is regarded by the World Health Organization as a major hot-spot region for Mycobacterium tuberculosis infection. Streptomycin has been deployed in China for over 50 years and is still widely used for tuberculosis treatment. We have developed a denaturing HPLC (DHPLC) method for detecting various gene mutations conferring drug resistance in M. tuberculosis. The present study focused on rpsL and rrs mutation analysis. Two hundred and fifteen M. tuberculosis clinical isolates (115 proved to be streptomycin-resistant and 100 susceptible by a routine proportional method) from China were tested to determine the streptomycin minimal inhibitory concentration (MIC), and subjected to DHPLC and concurrent DNA sequencing to determine rpsL and rrs mutations. The results showed that 85.2% (98/115) of streptomycin-resistant isolates harbored rpsL or rrs mutation, while rpsL mutation (76.5%, 88/115) dominated. MIC of 98 mutated isolates revealed no close correlation between mutation types and levels of streptomycin resistance. No mutation was found in any of the susceptible isolates. The DHPLC results were completely consistent with those of sequencing. The DHPLC method devised in this study can be regarded as a useful and powerful tool for detection of streptomycin resistance. This is the first report to describe DHPLC analysis of mutations in the rpsL and rrs genes of M. tuberculosis in a large number of clinical isolates.

  5. Microsporidia: Why Make Nucleotides if You Can Steal Them?

    Directory of Open Access Journals (Sweden)

    Paul Dean

    2016-11-01

    Full Text Available Microsporidia are strict obligate intracellular parasites that infect a wide range of eukaryotes including humans and economically important fish and insects. Surviving and flourishing inside another eukaryotic cell is a very specialised lifestyle that requires evolutionary innovation. Genome sequence analyses show that microsporidia have lost most of the genes needed for making primary metabolites, such as amino acids and nucleotides, and also that they have only a limited capacity for making adenosine triphosphate (ATP. Since microsporidia cannot grow and replicate without the enormous amounts of energy and nucleotide building blocks needed for protein, DNA, and RNA biosynthesis, they must have evolved ways of stealing these substrates from the infected host cell. Providing they can do this, genome analyses suggest that microsporidia have the enzyme repertoire needed to use and regenerate the imported nucleotides efficiently. Recent functional studies suggest that a critical innovation for adapting to intracellular life was the acquisition by lateral gene transfer of nucleotide transport (NTT proteins that are now present in multiple copies in all microsporidian genomes. These proteins are expressed on the parasite surface and allow microsporidia to steal ATP and other purine nucleotides for energy and biosynthesis from their host. However, it remains unclear how other essential metabolites, such as pyrimidine nucleotides, are acquired. Transcriptomic and experimental studies suggest that microsporidia might manipulate host cell metabolism and cell biological processes to promote nucleotide synthesis and to maximise the potential for ATP and nucleotide import. In this review, we summarise recent genomic and functional data relating to how microsporidia exploit their hosts for energy and building blocks needed for growth and nucleic acid metabolism and we identify some remaining outstanding questions.

  6. Pyrosequencing: sequence typing at the speed of light.

    Science.gov (United States)

    Diggle, Matthew A; Clarke, Stuart C

    2004-10-01

    Nucleotide sequencing is an established method for gaining information relating to partial gene, whole gene, or whole genome sequence. Here we describe some of the background leading to the advent of modern nucleotide sequencing and how it has led to the development of Pyrosequencing, a relatively new method for real-time nucleotide sequencing. In particular, we describe how this method can be used for typing bacterial pathogens.

  7. Rationalization and Design of the Complementarity Determining Region Sequences in an Antibody-Antigen Recognition Interface

    Science.gov (United States)

    Chen, Ing-Chien; Lee, Yu-Ching; Chen, Jun-Bo; Tsai, Keng-Chang; Chen, Ching-Tai; Chang, Jeng-Yih; Yang, Ei-Wen; Hsu, Po-Chiang; Jian, Jhih-Wei; Hsu, Hung-Ju; Chang, Hung-Ju; Hsu, Wen-Lian; Huang, Kai-Fa; Ma, Alex Che; Yang, An-Suei

    2012-01-01

    Protein-protein interactions are critical determinants in biological systems. Engineered proteins binding to specific areas on protein surfaces could lead to therapeutics or diagnostics for treating diseases in humans. But designing epitope-specific protein-protein interactions with computational atomistic interaction free energy remains a difficult challenge. Here we show that, with the antibody-VEGF (vascular endothelial growth factor) interaction as a model system, the experimentally observed amino acid preferences in the antibody-antigen interface can be rationalized with 3-dimensional distributions of interacting atoms derived from the database of protein structures. Machine learning models established on the rationalization can be generalized to design amino acid preferences in antibody-antigen interfaces, for which the experimental validations are tractable with current high throughput synthetic antibody display technologies. Leave-one-out cross validation on the benchmark system yielded the accuracy, precision, recall (sensitivity) and specificity of the overall binary predictions to be 0.69, 0.45, 0.63, and 0.71 respectively, and the overall Matthews correlation coefficient of the 20 amino acid types in the 24 interface CDR positions was 0.312. The structure-based computational antibody design methodology was further tested with other antibodies binding to VEGF. The results indicate that the methodology could provide alternatives to the current antibody technologies based on animal immune systems in engineering therapeutic and diagnostic antibodies against predetermined antigen epitopes. PMID:22457753

  8. Determination of inter- and intra-species genetic relationships among six Eucalyptus species based on inter-simple sequence repeats (ISSR).

    Science.gov (United States)

    Balasaravanan, T; Chezhian, P; Kamalakannan, R; Ghosh, M; Yasodha, R; Varghese, M; Gurumurthi, K

    2005-10-01

    Eucalyptus is the most economically important hardwood plantation tree cultivated in tropical and subtropical countries. Inter-simple sequence repeat (ISSR) markers were used to evaluate genetic relationships within and between individuals of six Eucalyptus species. A total of 583 loci (265 to 1535 bp) were amplified from 149 individuals belonging to the six Eucalyptus species using seven ISSR primers (two to three nucleotide repeats anchored with one or two nucleotides at the 3' or 5' region). The ISSR fragments indicated significant polymorphism and genetic diversity among the individuals. Cluster analysis and principal component analysis revealed the occurrence of wide genetic diversity among populations of E. tereticornis Sm., E. camaldulensis Dehnh. and E. urophylla S.T. Blake and narrow genetic diversity among populations of E. citriodora Hook. and E. grandis W. Hill ex Maiden. Genetic diversity was high in E. tereticornis Sm. (47.27%) and low in E. citriodora (18.64%). Maximum Nei's genetic identity (0.897) was observed between E. camaldulensis and E. tereticornis species, whereas maximum genetic diversity (0.286) was found between individuals of E. citriodora and E. grandis.

  9. Determining the diet of larvae of western rock lobster (Panulirus cygnus using high-throughput DNA sequencing techniques.

    Directory of Open Access Journals (Sweden)

    Richard O'Rorke

    Full Text Available The Western Australian rock lobster fishery has been both a highly productive and sustainable fishery. However, a recent dramatic and unexplained decline in post-larval recruitment threatens this sustainability. Our lack of knowledge of key processes in lobster larval ecology, such as their position in the food web, limits our ability to determine what underpins this decline. The present study uses a high-throughput amplicon sequencing approach on DNA obtained from the hepatopancreas of larvae to discover significant prey items. Two short regions of the 18S rRNA gene were amplified under the presence of lobster specific PNA to prevent lobster amplification and to improve prey amplification. In the resulting sequences either little prey was recovered, indicating that the larval gut was empty, or there was a high number of reads originating from multiple zooplankton taxa. The most abundant reads included colonial Radiolaria, Thaliacea, Actinopterygii, Hydrozoa and Sagittoidea, which supports the hypothesis that the larvae feed on multiple groups of mostly transparent gelatinous zooplankton. This hypothesis has prevailed as it has been tentatively inferred from the physiology of larvae, captive feeding trials and co-occurrence in situ. However, these prey have not been observed in the larval gut as traditional microscopic techniques cannot discern between transparent and gelatinous prey items in the gut. High-throughput amplicon sequencing of gut DNA has enabled us to classify these otherwise undetectable prey. The dominance of the colonial radiolarians among the gut contents is intriguing in that this group has been historically difficult to quantify in the water column, which may explain why they have not been connected to larval diet previously. Our results indicate that a PCR based technique is a very successful approach to identify the most abundant taxa in the natural diet of lobster larvae.

  10. An extended sequence specificity for UV-induced DNA damage.

    Science.gov (United States)

    Chung, Long H; Murray, Vincent

    2018-01-01

    The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  11. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  12. Genome Sequences of Three Apple chlorotic leaf spot virus Isolates from Hawthorns in China.

    Directory of Open Access Journals (Sweden)

    Wei Guo

    Full Text Available The genome sequences of Apple chlorotic leaf spot virus (ACLSV isolates from three accessions of hawthorns (Crataegus pinnatifida grown at Shenyang Agricultural University were determined using Illumina RNA-seq. To confirm the assembly data from the de novo sequencing, two ACLSV genomic sequences (SY01 and SY02 were sequenced using the Sanger method. The SY01 and SY02 sequences obtained with the Sanger method showed 99.5% and 99.7% nucleotide identity with the transcriptome data, respectively. The genome sequences of the hawthorn isolates SY01, SY02 and SY03 (GenBank accession nos. KM207212, KU870524 and KU870525, respectively consisted of 7,543, 7,561 and 7,545 nucleotides, respectively, excluding poly-adenylated tails. Sequence analysis revealed that these hawthorn isolates shared an overall nucleotide identity of 82.8-92.1% and showed the highest identity of 90.3% for isolate YH (GenBank accession no. KC935955 from pear and the lowest identity of 67.7% for isolate TaTao5 (GenBank accession no. EU223295 from peach. Hawthorn isolate sequences were similar to those of 'B6 type' ACLSV. The relationship between ACLSV isolates largely depends upon the host species. This represents the first comparative study of the genome sequences of ACLSV isolates from hawthorns.

  13. Genome Sequences of Three Apple chlorotic leaf spot virus Isolates from Hawthorns in China.

    Science.gov (United States)

    Guo, Wei; Zheng, Wenyan; Wang, Mei; Li, Xiaohong; Ma, Yue; Dai, Hongyan

    2016-01-01

    The genome sequences of Apple chlorotic leaf spot virus (ACLSV) isolates from three accessions of hawthorns (Crataegus pinnatifida) grown at Shenyang Agricultural University were determined using Illumina RNA-seq. To confirm the assembly data from the de novo sequencing, two ACLSV genomic sequences (SY01 and SY02) were sequenced using the Sanger method. The SY01 and SY02 sequences obtained with the Sanger method showed 99.5% and 99.7% nucleotide identity with the transcriptome data, respectively. The genome sequences of the hawthorn isolates SY01, SY02 and SY03 (GenBank accession nos. KM207212, KU870524 and KU870525, respectively) consisted of 7,543, 7,561 and 7,545 nucleotides, respectively, excluding poly-adenylated tails. Sequence analysis revealed that these hawthorn isolates shared an overall nucleotide identity of 82.8-92.1% and showed the highest identity of 90.3% for isolate YH (GenBank accession no. KC935955) from pear and the lowest identity of 67.7% for isolate TaTao5 (GenBank accession no. EU223295) from peach. Hawthorn isolate sequences were similar to those of 'B6 type' ACLSV. The relationship between ACLSV isolates largely depends upon the host species. This represents the first comparative study of the genome sequences of ACLSV isolates from hawthorns.

  14. IDENTIFICATION OF PUTATIVE SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    Science.gov (United States)

    The nucleotide sequence of a c 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachbotrys and the related genus Memnoniella. This information was used to infer the phylogenetic relatio...

  15. IDENTIFICATION OF SEQUENCE SPECIFIC PCR PRIMERS FOR DETECTION OF THE TOXIGENIC FUNGAL SPECIES STACHYBOTRYS CHARTARUM

    Science.gov (United States)

    The nucleotide sequence of a 936 bp segment of the nuclear rRNA gene operon was determined for the toxigenic fungal species Stachybotrys chartarum and for other species of Stachybotrys and the related genus Memnoniella. This information was used to infer the phylogenitic relati...

  16. Complete genome sequence of Paris mosaic necrosis virus, a distinct member of the genus Potyvirus

    Science.gov (United States)

    The complete genomic sequence of a novel potyvirus was determined from Paris polyphylla var. yunnanensis. Its genomic RNA consists of 9,660 nucleotides (nt) excluding the 3’-terminal poly (A) tail, containing a single open reading frame (ORF) encoding a large polyprotein. The virus shares 52.1-69.7%...

  17. Updating our view of organelle genome nucleotide landscape

    Directory of Open Access Journals (Sweden)

    David Roy Smith

    2012-09-01

    Full Text Available Organelle genomes show remarkable variation in architecture and coding content, yet their nucleotide composition is relatively unvarying across the eukaryotic domain, with most having a high adenine and thymine (AT content. Recent studies, however, have uncovered guanine and cytosine (GC-rich mitochondrial and plastid genomes. These sequences come from a small but eclectic list of species, including certain green plants and animals. Here, I review GC-rich organelle DNAs and the insights they have provided into the evolution of nucleotide landscape. I emphasize that GC-biased mitochondrial and plastid DNAs are more widespread than once thought, sometimes occurring together in the same species, and suggest that the forces biasing their nucleotide content can differ both among and within lineages, and may be associated with specific genome architectural features and life history traits.

  18. Evolution of DNA sequencing.

    Science.gov (United States)

    Tipu, Hamid Nawaz; Shabbir, Ambreen

    2015-03-01

    Sanger and coworkers introduced DNA sequencing in 1970s for the first time. It principally relied on termination of growing nucleotide chain when a dideoxythymidine triphosphate (ddTTP) was inserted in it. Detection of terminated sequences was done radiographically on Polyacrylamide Gel Electrophoresis (PAGE). Improvements that have evolved over time in original Sanger sequencing include replacement of radiography with fluorescence, use of separate fluorescent markers for each nucleotide, use of capillary electrophoresis instead of polyacrylamide gel electrophoresis and then introduction of capillary array electrophoresis. However, this technique suffered from few inherent limitations like decreased sensitivity for low level mutant alleles, complexities in analyzing highly polymorphic regions like Major Histocompatibility Complex (MHC) and high DNA concentrations required. Several Next Generation Sequencing (NGS) technologies have been introduced by Roche, Illumina and other commercial manufacturers that tend to overcome Sanger sequencing limitations and have been reviewed. Introduction of NGS in clinical research and medical diagnostics is expected to change entire diagnostic approach. These include study of cancer variants, detection of minimal residual disease, exome sequencing, detection of Single Nucleotide Polymorphisms (SNPs) and their disease association, epigenetic regulation of gene expression and sequencing of microorganisms genome.

  19. Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.

    Science.gov (United States)

    Ermert, Susanne; Marx, Andreas; Hacker, Stephan M

    2017-04-01

    Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.

  20. Determining the physical processes behind four large eruptions in rapid sequence in the San Juan caldera cluster (Colorado, USA)

    Science.gov (United States)

    Curry, Adam; Caricchi, Luca; Lipman, Peter

    2017-04-01

    Large, explosive volcanic eruptions can have both immediate and long-term negative effects on human societies. Statistical analyses of volcanic eruptions show that the frequency of the largest eruptions on Earth (> ˜450 km3) differs from that observed for smaller eruptions, suggesting different physical processes leading to eruption. This project will characterize the petrography, whole-rock geochemistry, mineral chemistry, and zircon geochronology of four caldera-forming ignimbrites from the San Juan caldera cluster, Colorado, to determine the physical processes leading to eruption. We collected outflow samples along stratigraphy of the three caldera-forming ignimbrites of the San Luis caldera complex: the Nelson Mountain Tuff (>500 km3), Cebolla Creek Tuff (˜250 km3), and Rat Creek Tuff (˜150 km3); and we collected samples of both outflow and intracaldera facies of the Snowshoe Mountain Tuff (>500 km3), which formed the Creede caldera. Single-crystal sanidine 40Ar/39Ar ages show that these eruptions occurred in rapid succession between 26.91 ± 0.02 Ma (Rat Creek) and 26.87 ± 0.02 Ma (Snowshoe Mountain), providing a unique opportunity to investigate the physical processes leading to a rapid sequence of large, explosive volcanic eruptions. Recent studies show that the average flux of magma is an important parameter in determining the frequency and magnitude of volcanic eruptions. High-precision isotope-dilution thermal ionization mass spectrometry (ID-TIMS) zircon geochronology will be performed to determine magma fluxes, and cross-correlation of chemical profiles in minerals will be performed to determine the periodicity of magma recharge that preceded these eruptions. Our project intends to combine these findings with similar data from other volcanic regions around the world to identify physical processes controlling the regional and global frequency-magnitude relationships of volcanic eruptions.

  1. Next-generation sequencing

    DEFF Research Database (Denmark)

    Rieneck, Klaus; Bak, Mads; Jønson, Lars

    2013-01-01

    the feasibility of predicting the fetal KEL1 phenotype using next-generation sequencing (NGS) technology. STUDY DESIGN AND METHODS: The KEL1/2 single-nucleotide polymorphism was polymerase chain reaction (PCR) amplified with one adjoining base, and the PCR product was sequenced using a genome analyzer (GAIIx......, Illumina); several millions of PCR sequences were analyzed. RESULTS: The results demonstrated the feasibility of diagnosing the fetal KEL1 or KEL2 blood group from cell-free DNA purified from maternal plasma. CONCLUSION: This method requires only one primer pair, and the large amount of sequence...

  2. A Markovian analysis of bacterial genome sequence constraints

    Directory of Open Access Journals (Sweden)

    Aaron D. Skewes

    2013-08-01

    Full Text Available The arrangement of nucleotides within a bacterial chromosome is influenced by numerous factors. The degeneracy of the third codon within each reading frame allows some flexibility of nucleotide selection; however, the third nucleotide in the triplet of each codon is at least partly determined by the preceding two. This is most evident in organisms with a strong G + C bias, as the degenerate codon must contribute disproportionately to maintaining that bias. Therefore, a correlation exists between the first two nucleotides and the third in all open reading frames. If the arrangement of nucleotides in a bacterial chromosome is represented as a Markov process, we would expect that the correlation would be completely captured by a second-order Markov model and an increase in the order of the model (e.g., third-, fourth-…order would not capture any additional uncertainty in the process. In this manuscript, we present the results of a comprehensive study of the Markov property that exists in the DNA sequences of 906 bacterial chromosomes. All of the 906 bacterial chromosomes studied exhibit a statistically significant Markov property that extends beyond second-order, and therefore cannot be fully explained by codon usage. An unrooted tree containing all 906 bacterial chromosomes based on their transition probability matrices of third-order shares ∼25% similarity to a tree based on sequence homologies of 16S rRNA sequences. This congruence to the 16S rRNA tree is greater than for trees based on lower-order models (e.g., second-order, and higher-order models result in diminishing improvements in congruence. A nucleotide correlation most likely exists within every bacterial chromosome that extends past three nucleotides. This correlation places significant limits on the number of nucleotide sequences that can represent probable bacterial chromosomes. Transition matrix usage is largely conserved by taxa, indicating that this property is likely

  3. Hospital Epidemiology of Methicillin-Resistant Staphylococcus aureus in a Tertiary Care Hospital in Moshi, Tanzania, as Determined by Whole Genome Sequencing

    DEFF Research Database (Denmark)

    Kumburu, Happiness H.; Sonda, Tolbert; Leekitcharoenphon, Pimlapas

    2018-01-01

    Objective. To determine molecular epidemiology of methicillin-resistant S. aureus in Tanzania using whole genome sequencing. Methods. DNA from 33 Staphylococcus species was recovered from subcultured archived Staphylococcus isolates. Whole genome sequencing was performed on IlluminaMiseq using pa...... in Moshi are highly diverse and epidemiologically unrelated. Temporal phylogenetic analysis provided better resolution on transmission and introduction of MRSA and it may be important to include this in future routines....... paired-end 2x250 bp protocol. Raw sequence data were analyzed using online tools. Results. Full susceptibility to vancomycin and chloramphenicol was observed. Thirteen isolates (43.3%) resisted cefoxitin and other antimicrobials tested. Multilocus sequence typing revealed 13 different sequence types...

  4. Analysis of the intronic single nucleotide polymorphism rs#466452 of the nephrin gene in patients with diabetic nephropathy

    Directory of Open Access Journals (Sweden)

    RODRIGO GONZÁLEZ

    2009-01-01

    Full Text Available We present the analysis of an intronic polymorphism of the nephrin gene and its relationship to the development of diabetic nephropathy in a study of diabetes type 1 and type 2 patients. The frequency of the single nucleotide polymorphism rs#466452 in the nephrin gene was determined in 231 patients and control subjects. The C/T status of the polymorphism was assessed using restriction enzyme digestions and the nephrin transcript from a kidney biopsy was examined. Association between the polymorphism and clinical parameters was evaluated using multivaríate correspondence analysis. A bioinformatics analysis of the single nucleotide polymorphism rs#466452 suggested the appearance of a splicing enhancer sequence in intron 24 of the nephrin gene and a modification of proteins that bind to this sequence. However, no change in the splicing of a nephrin transcript from a renal biopsy was found. No association was found between the polymorphism and diabetes or degree of renal damage in diabetes type 1 or 2 patients. The single nucleotide polymorphism rs#466452 of the nephrin gene seems to be neutral in relation to diabetes and the development of diabetic nephropathy, and does not affect the splicing of a nephrin transcript, in spite of a splicing enhancer site.

  5. Content discovery and retrieval services at the European Nucleotide Archive.

    Science.gov (United States)

    Silvester, Nicole; Alako, Blaise; Amid, Clara; Cerdeño-Tárraga, Ana; Cleland, Iain; Gibson, Richard; Goodgame, Neil; Ten Hoopen, Petra; Kay, Simon; Leinonen, Rasko; Li, Weizhong; Liu, Xin; Lopez, Rodrigo; Pakseresht, Nima; Pallreddy, Swapna; Plaister, Sheila; Radhakrishnan, Rajesh; Rossello, Marc; Senf, Alexander; Smirnov, Dmitriy; Toribio, Ana Luisa; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy

    2015-01-01

    The European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena) is Europe's primary resource for nucleotide sequence information. With the growing volume and diversity of public sequencing data comes the need for increased sophistication in data organisation, presentation and search services so as to maximise its discoverability and usability. In response to this, ENA has been introducing and improving checklists for use during submission and expanding its search facilities to provide targeted search results. Here, we give a brief update on ENA content and some major developments undertaken in data submission services during 2014. We then describe in more detail the services we offer for data discovery and retrieval. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Complete nucleotide sequence and gene rearrangement of the ...

    Indian Academy of Sciences (India)

    Engineering, Yokohama, Japan). The complete mtDNA se- quence of O. martensii reported in this paper was deposited in GenBank under the accession number GU177877. Molecular phylogenetic analyses. In an attempt to further confirm the phylogenetic rela- tions within Neobatrachia and the phylogenetic position of.

  7. DNA polymerase having modified nucleotide binding site for DNA sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles

    1997-01-01

    Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

  8. Complete nucleotide sequence analysis of Cymbidium mosaic virus ...

    Indian Academy of Sciences (India)

    Different sets of primers were used for the amplification of different regions of the genome through RT-PCR and the amplified genes were cloned in a suitable vector. The full genome of the Indian isolate of CymMV from Phaius tankervilliae shares 96–97% similarity with isolates reported from other countries. It was found that ...

  9. Target-dependent enrichment of virions determines the reduction of high-throughput sequencing in virus discovery.

    Directory of Open Access Journals (Sweden)

    Randi Holm Jensen

    Full Text Available Viral infections cause many different diseases stemming both from well-characterized viral pathogens but also from emerging viruses, and the search for novel viruses continues to be of great importance. High-throughput sequencing is an important technology for this purpose. However, viral nucleic acids often constitute a minute proportion of the total genetic material in a sample from infected tissue. Techniques to enrich viral targets in high-throughput sequencing have been reported, but the sensitivity of such methods is not well established. This study compares different library preparation techniques targeting both DNA and RNA with and without virion enrichment. By optimizing the selection of intact virus particles, both by physical and enzymatic approaches, we assessed the effectiveness of the specific enrichment of viral sequences as compared to non-enriched sample preparations by selectively looking for and counting read sequences obtained from shotgun sequencing. Using shotgun sequencing of total DNA or RNA, viral targets were detected at concentrations corresponding to the predicted level, providing a foundation for estimating the effectiveness of virion enrichment. Virion enrichment typically produced a 1000-fold increase in the proportion of DNA virus sequences. For RNA virions the gain was less pronounced with a maximum 13-fold increase. This enrichment varied between the different sample concentrations, with no clear trend. Despite that less sequencing was required to identify target sequences, it was not evident from our data that a lower detection level was achieved by virion enrichment compared to shotgun sequencing.

  10. Single-nucleotide mutation matrix: a new model for predicting the NF-κB DNA binding sites.

    Science.gov (United States)

    Du, Wenxin; Gao, Jing; Wang, Tingting; Wang, Jinke

    2014-01-01

    In this study, we established a single nucleotide mutation matrix (SNMM) model based on the relative binding affinities of NF-κB p50 homodimer to a wild-type binding site (GGGACTTTCC) and its all single-nucleotide mutants detected with the double-stranded DNA microarray. We evaluated this model by scoring different groups of 10-bp DNA sequences with this model and analyzing the correlations between the scores and the relative binding affinities detected with three wet experiments, including the electrophoresis mobility shift assay (EMSA), the protein-binding microarray (PBM) and the systematic evolution of ligands by exponential enrichment-sequencing (SELEX-Seq). The results revealed that the SNMM scores were strongly correlated with the detected binding affinities. We also scored the DNA sequences with other three models, including the principal coordinate (PC) model, the position weight matrix scoring algorithm (PWMSA) model and the Match model, and analyzed the correlations between the scores and the detected binding affinities. In comparison with these models, the SNMM model achieved reliable results. We finally determined 0.747 as the optimal threshold for predicting the NF-κB DNA-binding sites with the SNMM model. The SNMM model thus provides a new alternative model for scoring the relative binding affinities of NF-κB to the 10-bp DNA sequences and predicting the NF-κB DNA-binding sites.

  11. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  12. Genome sequencing by direct imaging x-ray color holography. Appendix A

    Energy Technology Data Exchange (ETDEWEB)

    Haddad, W.; Boyer, K.; Solem, J.C.; Rhodes, C.K. [MCR Technology Corp., Chicago, IL (United States); Moriarty, R.M. [Illinois Univ., Chicago, IL (United States)

    1989-12-31

    Currently available techniques for sequencing DNA are inadequate for oligonucleotides of length greater than 600 nucleotides and are most effective in the 300 nucleotide range. Automated sequencers are now available which use, basically, the Sanger dideoxy termination method. The sequencing rates of these conventional methods are extremely low and involve very labor intensive procedures, requiring on the order of two man-years of effort for the determination of the sequence of a single 100 kilobase segment. Since the full human genetic complement is of vast size, representing {approximately} 3 {times} 10{sup 9} bases, a fast and accurate method for DNA sequencing is needed. Therefore, we set as a goal a sequencing rate in the range of {approximately} 10{sup 2} bp/s with an accuracy of {approximately} 1 error per 10{sup 6} bases, a value exceeding that set by the fidelity of current enzymatic processes. These values would permit the accurate determination of the sequence of the full human genome in one year. An approach involving rapid direct imaging of large segments of DNA is desired. A properly constructed x-ray Fourier-transform holographic microscope appears to combine these features. A basic x-ray holographic instrument has been designed. This concept, with appropriate modifications, and the use of presently available x-ray sources, appears applicable to the task of genome sequencing with a resulting rate of sequence determination in the range of {approximately} 10{sup 2} bp/s.

  13. Molecular phylogeny of ateline new world monkeys (Platyrrhini, atelinae) based on gamma-globin gene sequences: evidence that brachyteles is the sister group of lagothrix.

    Science.gov (United States)

    Meireles, C M; Czelusniak, J; Schneider, M P; Muniz, J A; Brigido, M C; Ferreira, H S; Goodman, M

    1999-06-01

    Nucleotide sequences, each spanning approximately 7 kb of the contiguous gamma1 and gamma2 globin genomic loci, were determined for seven species representing all extant genera (Ateles, Lagothrix, Brachyteles, and Alouatta) of the New World monkey subfamily Atelinae. After aligning these seven ateline sequences with outgroup sequences from several other primate (non-ateline) genera, they were analyzed by maximum parsimony, maximum likelihood, and neighbor-joining algorithms. All three analyzes estimated the same phylogenetic relationships: [Alouatta [Ateles (Brachyteles, Lagothrix)

  14. Sequence requirements of the HIV-1 protease flap region determined by saturation mutagenesis and kinetic analysis of flap mutants

    Science.gov (United States)

    Shao, Wei; Everitt, Lorraine; Manchester, Marianne; Loeb, Daniel D.; Hutchison, Clyde A.; Swanstrom, Ronald

    1997-01-01

    The retroviral proteases (PRs) have a structural feature called the flap, which consists of a short antiparallel β-sheet with a turn. The flap extends over the substrate binding cleft and must be flexible to allow entry and exit of the polypeptide substrates and products. We analyzed the sequence requirements of the amino acids within the flap region (positions 46–56) of the HIV-1 PR. The phenotypes of 131 substitution mutants were determined using a bacterial expression system. Four of the mutant PRs with mutations in different regions of the flap were selected for kinetic analysis. Our phenotypic analysis, considered in the context of published structures of the HIV-1 PR with a bound substrate analogs, shows that: (i) Met-46 and Phe-53 participate in hydrophobic interactions on the solvent-exposed face of the flap; (ii) Ile-47, Ile-54, and Val-56 participate in hydrophobic interactions on the inner face of the flap; (iii) Ile-50 has hydrophobic interactions at the distance of both the δ and γ carbons; (iv) the three glycine residues in the β-turn of the flap are virtually intolerant of substitutions. Among these mutant PRs, we have identified changes in both kcat and Km. These results establish the nature of the side chain requirements at each position in the flap and document a role for the flap in both substrate binding and catalysis. PMID:9122179

  15. Using iterative fragment assembly and progressive sequence truncation to facilitate phasing and crystal structure determination of distantly related proteins.

    Science.gov (United States)

    Wang, Yan; Virtanen, Jouko; Xue, Zhidong; Tesmer, John J G; Zhang, Yang

    2016-05-01

    Molecular replacement (MR) often requires templates with high homology to solve the phase problem in X-ray crystallography. I-TASSER-MR has been developed to test whether the success rate for structure determination of distant-homology proteins could be improved by a combination of iterative fragmental structure-assembly simulations with progressive sequence truncation designed to trim regions with high variation. The pipeline was tested on two independent protein sets consisting of 61 proteins from CASP8 and 100 high-resolution proteins from the PDB. After excluding homologous templates, I-TASSER generated full-length models with an average TM-score of 0.773, which is 12% higher than the best threading templates. Using these as search models, I-TASSER-MR found correct MR solutions for 95 of 161 targets as judged by having a TFZ of >8 or with the final structure closer to the native than the initial search models. The success rate was 16% higher than when using the best threading templates. I-TASSER-MR was also applied to 14 protein targets from structure genomics centers. Seven of these were successfully solved by I-TASSER-MR. These results confirm that advanced structure assembly and progressive structural editing can significantly improve the success rate of MR for targets with distant homology to proteins of known structure.

  16. Dna Sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  17. Hydration of swelling clays: multi-scale sequence of hydration and determination of macroscopic energies from microscopic properties; Hydratation des argiles gonflantes: sequence d'hydratation multi-echelle determination des energies macroscopiques a partir des proprietes microscopiques

    Energy Technology Data Exchange (ETDEWEB)

    Salles, F

    2006-10-15

    Smectites have interesting properties which make them potential candidates for engineered barriers in deep geological nuclear waste repository: low permeability, swelling and cations retention. The subject of this thesis consists in the determination of the relationship between hydration properties, swelling properties and cations mobility in relation with confinement properties of clayey materials. The aim is to understand and to predict the behaviour of water in smectites, following two research orientations: the mechanistic aspects and the energetic aspects of the hydration of smectites. We worked on the Na-Ca montmorillonite contained in the MX80 bentonite, with the exchanged homo ionic structure (saturated with alkaline cations and calcium cations). The approach crosses the various scales (microscopic, mesoscopic and macroscopic) and implied the study of the various components of the system (layer-cation-water), by using original experimental methods (thermo-poro-metry and electric conductivity for various relative humidities (RH) and electrostatic calculations. Initially, the dry state is defined by SCTA (scanning calorimetry thermal analysis). Then a classical characterization of the smectite porosity for the dry state is carried out using mercury intrusion and nitrogen adsorption. We evidenced the existence of a meso-porosity which radius varies from 2 to 10 nm depending on the compensating cation. The thermo-poro-metry and conductivity experiments performed at various hydration states made it possible to follow the increase in the pore sizes and the cations mobility as a function of the hydration state. We highlight in particular the existence of an osmotic mesoscopic swelling for low RH (approximately 50-60%RH for Li and Na). By combining the results of thermo-poro-metry, X-ray diffraction and electric conductivity, we are able to propose a complete hydration sequence for each cation, showing the crucial role of the compensating cation in the hydration of

  18. Construction of Porphyra yezoensis pure line from protoplasts and its 18S rDNA sequence determination

    Science.gov (United States)

    Liu, Hongquan; Yu, Wengong; Dai, Jixun; Gong, Qianhong; Shi, Xiaochong; Yang, Kunfeng

    2004-04-01

    The wild Porphyra yezoensis collected from the Qingdao coast was used to prepare protoplasts by enzyme digestion. The pure line was constructed by cultivating the protoplasts. The 18S rDNA of the P. yezoensis pure line was cloned and sequenced. Sequence analysis was executed for this sequence and other 22 sequences retrieved from GenBank. A phylogenetic tree was constructed using the neighbor-joining method. The results revealed a high diversity of 18S rDNA sequences in genus Porphyra and the considerable variation of 18S rDNA sequences in different strains of the same species P. yezoensis and P. tenera. Significant difference of 18S rDNA sequence was observed between P. yezoensis from Qingdao, China, and the two strains of P. yezoensis from Japan, but the three strains of P. yezoensis formed a stable clade in the phylogenetic tree. These results indicate the possibility of interspecies and intraspecies discrimination of Porphyra using the 18S rDNA sequences.

  19. Determination of cDNA and genomic DNA sequences of hevamine, a chitinase from the rubber tree Hevea brasiliensis

    NARCIS (Netherlands)

    Bokma, E; Spiering, M; Chow, KS; Mulder, PPMFA; Subroto, T; Beintema, JJ

    Hevamine is a chitinase from the rubber tree Hevea brasiliensis and belongs to the family 18 glycosyl hydrolases. This paper describes the cloning of hevamine DNA and cDNA sequences. Hevamine contains a signal peptide at the N-terminus and a putative vacuolar targeting sequence at the C-terminus

  20. Comparison of different pulse sequences for in vivo determination of T1 relaxation times in the human brain

    DEFF Research Database (Denmark)

    Kjaer, L; Henriksen, O

    1988-01-01

    ). T1 measurements were performed on the human brain using a whole body MR scanner operating at 1.5 tesla. Three different pulse sequences were compared including two 6-points inversion recovery (IR) sequences with TR = 2.0 s and 4.0, respectively, and a 12-points partial saturation inversion recovery...