WorldWideScience

Sample records for nucleotide sequence database

  1. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  2. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Science.gov (United States)

    Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

    2011-01-01

    Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  3. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  4. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  5. AgdbNet – antigen sequence database software for bacterial typing

    Directory of Open Access Journals (Sweden)

    Maiden Martin CJ

    2006-06-01

    Full Text Available Abstract Background Bacterial typing schemes based on the sequences of genes encoding surface antigens require databases that provide a uniform, curated, and widely accepted nomenclature of the variants identified. Due to the differences in typing schemes, imposed by the diversity of genes targeted, creating these databases has typically required the writing of one-off code to link the database to a web interface. Here we describe agdbNet, widely applicable web database software that facilitates simultaneous BLAST querying of multiple loci using either nucleotide or peptide sequences. Results Databases are described by XML files that are parsed by a Perl CGI script. Each database can have any number of loci, which may be defined by nucleotide and/or peptide sequences. The software is currently in use on at least five public databases for the typing of Neisseria meningitidis, Campylobacter jejuni and Streptococcus equi and can be set up to query internal isolate tables or suitably-configured external isolate databases, such as those used for multilocus sequence typing. The style of the resulting website can be fully configured by modifying stylesheets and through the use of customised header and footer files that surround the output of the script. Conclusion The software provides a rapid means of setting up customised Internet antigen sequence databases. The flexible configuration options enable typing schemes with differing requirements to be accommodated.

  6. ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

    Science.gov (United States)

    Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

    2012-09-08

    The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  7. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  8. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  9. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Directory of Open Access Journals (Sweden)

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  10. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Science.gov (United States)

    2012-01-01

    Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

  11. Polymorphism Sequence - JSNP | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us JSNP Polymorphism Sequence Data detail Data name Polymorphism Sequence DOI 10.18908/lsdba.nb...dc00114-001 Description of data contents Information on polymorphisms (SNPs and insertions/deletions) and th...se Name database name JSNP_SNP: single nucleotide polymorphism JSNP_InsDel_IND: insertion/deletion JSNP_InsD...ved allele observed 3' Flanking Sequence 3' flanking sequence Offset in Flanking Sequence position of the polymorphism...uence Accession No. accession No. of the sequence for polymorphism screening Offset in Record position of the polymorphism

  12. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  13. muBLASTP: database-indexed protein sequence search on multicore CPUs.

    Science.gov (United States)

    Zhang, Jing; Misra, Sanchit; Wang, Hao; Feng, Wu-Chun

    2016-11-04

    The Basic Local Alignment Search Tool (BLAST) is a fundamental program in the life sciences that searches databases for sequences that are most similar to a query sequence. Currently, the BLAST algorithm utilizes a query-indexed approach. Although many approaches suggest that sequence search with a database index can achieve much higher throughput (e.g., BLAT, SSAHA, and CAFE), they cannot deliver the same level of sensitivity as the query-indexed BLAST, i.e., NCBI BLAST, or they can only support nucleotide sequence search, e.g., MegaBLAST. Due to different challenges and characteristics between query indexing and database indexing, the existing techniques for query-indexed search cannot be used into database indexed search. muBLASTP, a novel database-indexed BLAST for protein sequence search, delivers identical hits returned to NCBI BLAST. On Intel Haswell multicore CPUs, for a single query, the single-threaded muBLASTP achieves up to a 4.41-fold speedup for alignment stages, and up to a 1.75-fold end-to-end speedup over single-threaded NCBI BLAST. For a batch of queries, the multithreaded muBLASTP achieves up to a 5.7-fold speedups for alignment stages, and up to a 4.56-fold end-to-end speedup over multithreaded NCBI BLAST. With a newly designed index structure for protein database and associated optimizations in BLASTP algorithm, we re-factored BLASTP algorithm for modern multicore processors that achieves much higher throughput with acceptable memory footprint for the database index.

  14. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  15. PseudoMLSA: a database for multigenic sequence analysis of Pseudomonas species

    Directory of Open Access Journals (Sweden)

    Lalucat Jorge

    2010-04-01

    Full Text Available Abstract Background The genus Pseudomonas comprises more than 100 species of environmental, clinical, agricultural, and biotechnological interest. Although, the recommended method for discriminating bacterial species is DNA-DNA hybridisation, alternative techniques based on multigenic sequence analysis are becoming a common practice in bacterial species discrimination studies. Since there is not a general criterion for determining which genes are more useful for species resolution; the number of strains and genes analysed is increasing continuously. As a result, sequences of different genes are dispersed throughout several databases. This sequence information needs to be collected in a common database, in order to be useful for future identification-based projects. Description The PseudoMLSA Database is a comprehensive database of multiple gene sequences from strains of Pseudomonas species. The core of the database is composed of selected gene sequences from all Pseudomonas type strains validly assigned to the genus through 2008. The database is aimed to be useful for MultiLocus Sequence Analysis (MLSA procedures, for the identification and characterisation of any Pseudomonas bacterial isolate. The sequences are available for download via a direct connection to the National Center for Biotechnology Information (NCBI. Additionally, the database includes an online BLAST interface for flexible nucleotide queries and similarity searches with the user's datasets, and provides a user-friendly output for easily parsing, navigating, and analysing BLAST results. Conclusions The PseudoMLSA database amasses strains and sequence information of validly described Pseudomonas species, and allows free querying of the database via a user-friendly, web-based interface available at http://www.uib.es/microbiologiaBD/Welcome.html. The web-based platform enables easy retrieval at strain or gene sequence information level; including references to published peer

  16. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  17. Final Technical Report on the Genome Sequence DataBase (GSDB): DE-FG03 95 ER 62062 September 1997-September 1999

    Energy Technology Data Exchange (ETDEWEB)

    Harger, Carol A.

    1999-10-28

    Since September 1997 NCGR has produced two web-based tools for researchers to use to access and analyze data in the Genome Sequence DataBase (GSDB). These tools are: Sequence Viewer, a nucleotide sequence and annotation visualization tool, and MAR-Finder, a tool that predicts, base upon statistical inferences, the location of matrix attachment regions (MARS) within a nucleotide sequence. [The annual report for June 1996 to August 1997 is included as an attachment to this final report.

  18. The VirusBanker database uses a Java program to allow flexible searching through Bunyaviridae sequences.

    Science.gov (United States)

    Fourment, Mathieu; Gibbs, Mark J

    2008-02-05

    Viruses of the Bunyaviridae have segmented negative-stranded RNA genomes and several of them cause significant disease. Many partial sequences have been obtained from the segments so that GenBank searches give complex results. Sequence databases usually use HTML pages to mediate remote sorting, but this approach can be limiting and may discourage a user from exploring a database. The VirusBanker database contains Bunyaviridae sequences and alignments and is presented as two spreadsheets generated by a Java program that interacts with a MySQL database on a server. Sequences are displayed in rows and may be sorted using information that is displayed in columns and includes data relating to the segment, gene, protein, species, strain, sequence length, terminal sequence and date and country of isolation. Bunyaviridae sequences and alignments may be downloaded from the second spreadsheet with titles defined by the user from the columns, or viewed when passed directly to the sequence editor, Jalview. VirusBanker allows large datasets of aligned nucleotide and protein sequences from the Bunyaviridae to be compiled and winnowed rapidly using criteria that are formulated heuristically.

  19. The World Bacterial Biogeography and Biodiversity through Databases: A Case Study of NCBI Nucleotide Database and GBIF Database

    Directory of Open Access Journals (Sweden)

    Okba Selama

    2013-01-01

    Full Text Available Databases are an essential tool and resource within the field of bioinformatics. The primary aim of this study was to generate an overview of global bacterial biodiversity and biogeography using available data from the two largest public online databases, NCBI Nucleotide and GBIF. The secondary aim was to highlight the contribution each geographic area has to each database. The basis for data analysis of this study was the metadata provided by both databases, mainly, the taxonomy and the geographical area origin of isolation of the microorganism (record. These were directly obtained from GBIF through the online interface, while E-utilities and Python were used in combination with a programmatic web service access to obtain data from the NCBI Nucleotide Database. Results indicate that the American continent, and more specifically the USA, is the top contributor, while Africa and Antarctica are less well represented. This highlights the imbalance of exploration within these areas rather than any reduction in biodiversity. This study describes a novel approach to generating global scale patterns of bacterial biodiversity and biogeography and indicates that the Proteobacteria are the most abundant and widely distributed phylum within both databases.

  20. Final Technical Report on the Genome Sequence DataBase (GSDB): DE-FG03 95 ER 62062 September 1997-September 1999; FINAL

    International Nuclear Information System (INIS)

    Harger, Carol A.

    1999-01-01

    Since September 1997 NCGR has produced two web-based tools for researchers to use to access and analyze data in the Genome Sequence DataBase (GSDB). These tools are: Sequence Viewer, a nucleotide sequence and annotation visualization tool, and MAR-Finder, a tool that predicts, base upon statistical inferences, the location of matrix attachment regions (MARS) within a nucleotide sequence.[The annual report for June 1996 to August 1997 is included as an attachment to this final report.

  1. Mouse SNP Miner: an annotated database of mouse functional single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ramensky Vasily E

    2007-01-01

    Full Text Available Abstract Background The mapping of quantitative trait loci in rat and mouse has been extremely successful in identifying chromosomal regions associated with human disease-related phenotypes. However, identifying the specific phenotype-causing DNA sequence variations within a quantitative trait locus has been much more difficult. The recent availability of genomic sequence from several mouse inbred strains (including C57BL/6J, 129X1/SvJ, 129S1/SvImJ, A/J, and DBA/2J has made it possible to catalog DNA sequence differences within a quantitative trait locus derived from crosses between these strains. However, even for well-defined quantitative trait loci ( Description To help identify functional DNA sequence variations within quantitative trait loci we have used the Ensembl annotated genome sequence to compile a database of mouse single nucleotide polymorphisms (SNPs that are predicted to cause missense, nonsense, frameshift, or splice site mutations (available at http://bioinfo.embl.it/SnpApplet/. For missense mutations we have used the PolyPhen and PANTHER algorithms to predict whether amino acid changes are likely to disrupt protein function. Conclusion We have developed a database of mouse SNPs predicted to cause missense, nonsense, frameshift, and splice-site mutations. Our analysis revealed that 20% and 14% of missense SNPs are likely to be deleterious according to PolyPhen and PANTHER, respectively, and 6% are considered deleterious by both algorithms. The database also provides gene expression and functional annotations from the Symatlas, Gene Ontology, and OMIM databases to further assess candidate phenotype-causing mutations. To demonstrate its utility, we show that Mouse SNP Miner successfully finds a previously identified candidate SNP in the taste receptor, Tas1r3, that underlies sucrose preference in the C57BL/6J strain. We also use Mouse SNP Miner to derive a list of candidate phenotype-causing mutations within a previously

  2. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  3. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  4. PSSRdb: a relational database of polymorphic simple sequence repeats extracted from prokaryotic genomes.

    Science.gov (United States)

    Kumar, Pankaj; Chaitanya, Pasumarthy S; Nagarajaram, Hampapathalu A

    2011-01-01

    PSSRdb (Polymorphic Simple Sequence Repeats database) (http://www.cdfd.org.in/PSSRdb/) is a relational database of polymorphic simple sequence repeats (PSSRs) extracted from 85 different species of prokaryotes. Simple sequence repeats (SSRs) are the tandem repeats of nucleotide motifs of the sizes 1-6 bp and are highly polymorphic. SSR mutations in and around coding regions affect transcription and translation of genes. Such changes underpin phase variations and antigenic variations seen in some bacteria. Although SSR-mediated phase variation and antigenic variations have been well-studied in some bacteria there seems a lot of other species of prokaryotes yet to be investigated for SSR mediated adaptive and other evolutionary advantages. As a part of our on-going studies on SSR polymorphism in prokaryotes we compared the genome sequences of various strains and isolates available for 85 different species of prokaryotes and extracted a number of SSRs showing length variations and created a relational database called PSSRdb. This database gives useful information such as location of PSSRs in genomes, length variation across genomes, the regions harboring PSSRs, etc. The information provided in this database is very useful for further research and analysis of SSRs in prokaryotes.

  5. A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection.

    Science.gov (United States)

    Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S

    2018-01-01

    Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have

  6. The VirusBanker database uses a Java program to allow flexible searching through Bunyaviridae sequences

    Directory of Open Access Journals (Sweden)

    Gibbs Mark J

    2008-02-01

    Full Text Available Abstract Background Viruses of the Bunyaviridae have segmented negative-stranded RNA genomes and several of them cause significant disease. Many partial sequences have been obtained from the segments so that GenBank searches give complex results. Sequence databases usually use HTML pages to mediate remote sorting, but this approach can be limiting and may discourage a user from exploring a database. Results The VirusBanker database contains Bunyaviridae sequences and alignments and is presented as two spreadsheets generated by a Java program that interacts with a MySQL database on a server. Sequences are displayed in rows and may be sorted using information that is displayed in columns and includes data relating to the segment, gene, protein, species, strain, sequence length, terminal sequence and date and country of isolation. Bunyaviridae sequences and alignments may be downloaded from the second spreadsheet with titles defined by the user from the columns, or viewed when passed directly to the sequence editor, Jalview. Conclusion VirusBanker allows large datasets of aligned nucleotide and protein sequences from the Bunyaviridae to be compiled and winnowed rapidly using criteria that are formulated heuristically.

  7. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  8. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  9. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  10. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  11. Database Description - ASTRA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name ASTRA Alternative n...tics Journal Search: Contact address Database classification Nucleotide Sequence Databases - Gene structure,...3702 Taxonomy Name: Oryza sativa Taxonomy ID: 4530 Database description The database represents classified p...(10):1211-6. External Links: Original website information Database maintenance site National Institute of Ad... for user registration Not available About This Database Database Description Dow

  12. Compressing DNA sequence databases with coil

    Directory of Open Access Journals (Sweden)

    Hendy Michael D

    2008-05-01

    Full Text Available Abstract Background Publicly available DNA sequence databases such as GenBank are large, and are growing at an exponential rate. The sheer volume of data being dealt with presents serious storage and data communications problems. Currently, sequence data is usually kept in large "flat files," which are then compressed using standard Lempel-Ziv (gzip compression – an approach which rarely achieves good compression ratios. While much research has been done on compressing individual DNA sequences, surprisingly little has focused on the compression of entire databases of such sequences. In this study we introduce the sequence database compression software coil. Results We have designed and implemented a portable software package, coil, for compressing and decompressing DNA sequence databases based on the idea of edit-tree coding. coil is geared towards achieving high compression ratios at the expense of execution time and memory usage during compression – the compression time represents a "one-off investment" whose cost is quickly amortised if the resulting compressed file is transmitted many times. Decompression requires little memory and is extremely fast. We demonstrate a 5% improvement in compression ratio over state-of-the-art general-purpose compression tools for a large GenBank database file containing Expressed Sequence Tag (EST data. Finally, coil can efficiently encode incremental additions to a sequence database. Conclusion coil presents a compelling alternative to conventional compression of flat files for the storage and distribution of DNA sequence databases having a narrow distribution of sequence lengths, such as EST data. Increasing compression levels for databases having a wide distribution of sequence lengths is a direction for future work.

  13. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  14. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  15. EuMicroSatdb: A database for microsatellites in the sequenced genomes of eukaryotes

    Directory of Open Access Journals (Sweden)

    Grover Atul

    2007-07-01

    Full Text Available Abstract Background Microsatellites have immense utility as molecular markers in different fields like genome characterization and mapping, phylogeny and evolutionary biology. Existing microsatellite databases are of limited utility for experimental and computational biologists with regard to their content and information output. EuMicroSatdb (Eukaryotic MicroSatellite database http://ipu.ac.in/usbt/EuMicroSatdb.htm is a web based relational database for easy and efficient positional mining of microsatellites from sequenced eukaryotic genomes. Description A user friendly web interface has been developed for microsatellite data retrieval using Active Server Pages (ASP. The backend database codes for data extraction and assembly have been written using Perl based scripts and C++. Precise need based microsatellites data retrieval is possible using different input parameters like microsatellite type (simple perfect or compound perfect, repeat unit length (mono- to hexa-nucleotide, repeat number, microsatellite length and chromosomal location in the genome. Furthermore, information about clustering of different microsatellites in the genome can also be retrieved. Finally, to facilitate primer designing for PCR amplification of any desired microsatellite locus, 200 bp upstream and downstream sequences are provided. Conclusion The database allows easy systematic retrieval of comprehensive information about simple and compound microsatellites, microsatellite clusters and their locus coordinates in 31 sequenced eukaryotic genomes. The information content of the database is useful in different areas of research like gene tagging, genome mapping, population genetics, germplasm characterization and in understanding microsatellite dynamics in eukaryotic genomes.

  16. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  17. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  18. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Database Description - RMG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ase Description General information of database Database name RMG Alternative name ...raki 305-8602, Japan National Institute of Agrobiological Sciences E-mail : Database... classification Nucleotide Sequence Databases Organism Taxonomy Name: Oryza sativa Japonica Group Taxonomy ID: 39947 Database...rnal: Mol Genet Genomics (2002) 268: 434–445 External Links: Original website information Database...available URL of Web services - Need for user registration Not available About This Database Database Descri

  20. Database Description - KAIKOcDNA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us KAIKOcDNA Database Description General information of database Database name KAIKOcDNA Alter...National Institute of Agrobiological Sciences Akiya Jouraku E-mail : Database cla...ssification Nucleotide Sequence Databases Organism Taxonomy Name: Bombyx mori Taxonomy ID: 7091 Database des...rnal: G3 (Bethesda) / 2013, Sep / vol.9 External Links: Original website information Database maintenance si...available URL of Web services - Need for user registration Not available About This Database Database

  1. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  2. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  3. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  4. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  5. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  6. gEVE: a genome-based endogenous viral element database provides comprehensive viral protein-coding sequences in mammalian genomes.

    Science.gov (United States)

    Nakagawa, So; Takahashi, Mahoko Ueda

    2016-01-01

    In mammals, approximately 10% of genome sequences correspond to endogenous viral elements (EVEs), which are derived from ancient viral infections of germ cells. Although most EVEs have been inactivated, some open reading frames (ORFs) of EVEs obtained functions in the hosts. However, EVE ORFs usually remain unannotated in the genomes, and no databases are available for EVE ORFs. To investigate the function and evolution of EVEs in mammalian genomes, we developed EVE ORF databases for 20 genomes of 19 mammalian species. A total of 736,771 non-overlapping EVE ORFs were identified and archived in a database named gEVE (http://geve.med.u-tokai.ac.jp). The gEVE database provides nucleotide and amino acid sequences, genomic loci and functional annotations of EVE ORFs for all 20 genomes. In analyzing RNA-seq data with the gEVE database, we successfully identified the expressed EVE genes, suggesting that the gEVE database facilitates studies of the genomic analyses of various mammalian species.Database URL: http://geve.med.u-tokai.ac.jp. © The Author(s) 2016. Published by Oxford University Press.

  7. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  8. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  9. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  10. GarlicESTdb: an online database and mining tool for garlic EST sequences

    Directory of Open Access Journals (Sweden)

    Choi Sang-Haeng

    2009-05-01

    Full Text Available Abstract Background Allium sativum., commonly known as garlic, is a species in the onion genus (Allium, which is a large and diverse one containing over 1,250 species. Its close relatives include chives, onion, leek and shallot. Garlic has been used throughout recorded history for culinary, medicinal use and health benefits. Currently, the interest in garlic is highly increasing due to nutritional and pharmaceutical value including high blood pressure and cholesterol, atherosclerosis and cancer. For all that, there are no comprehensive databases available for Expressed Sequence Tags(EST of garlic for gene discovery and future efforts of genome annotation. That is why we developed a new garlic database and applications to enable comprehensive analysis of garlic gene expression. Description GarlicESTdb is an integrated database and mining tool for large-scale garlic (Allium sativum EST sequencing. A total of 21,595 ESTs collected from an in-house cDNA library were used to construct the database. The analysis pipeline is an automated system written in JAVA and consists of the following components: automatic preprocessing of EST reads, assembly of raw sequences, annotation of the assembled sequences, storage of the analyzed information into MySQL databases, and graphic display of all processed data. A web application was implemented with the latest J2EE (Java 2 Platform Enterprise Edition software technology (JSP/EJB/JavaServlet for browsing and querying the database, for creation of dynamic web pages on the client side, and for mapping annotated enzymes to KEGG pathways, the AJAX framework was also used partially. The online resources, such as putative annotation, single nucleotide polymorphisms (SNP and tandem repeat data sets, can be searched by text, explored on the website, searched using BLAST, and downloaded. To archive more significant BLAST results, a curation system was introduced with which biologists can easily edit best-hit annotation

  11. GarlicESTdb: an online database and mining tool for garlic EST sequences.

    Science.gov (United States)

    Kim, Dae-Won; Jung, Tae-Sung; Nam, Seong-Hyeuk; Kwon, Hyuk-Ryul; Kim, Aeri; Chae, Sung-Hwa; Choi, Sang-Haeng; Kim, Dong-Wook; Kim, Ryong Nam; Park, Hong-Seog

    2009-05-18

    Allium sativum., commonly known as garlic, is a species in the onion genus (Allium), which is a large and diverse one containing over 1,250 species. Its close relatives include chives, onion, leek and shallot. Garlic has been used throughout recorded history for culinary, medicinal use and health benefits. Currently, the interest in garlic is highly increasing due to nutritional and pharmaceutical value including high blood pressure and cholesterol, atherosclerosis and cancer. For all that, there are no comprehensive databases available for Expressed Sequence Tags(EST) of garlic for gene discovery and future efforts of genome annotation. That is why we developed a new garlic database and applications to enable comprehensive analysis of garlic gene expression. GarlicESTdb is an integrated database and mining tool for large-scale garlic (Allium sativum) EST sequencing. A total of 21,595 ESTs collected from an in-house cDNA library were used to construct the database. The analysis pipeline is an automated system written in JAVA and consists of the following components: automatic preprocessing of EST reads, assembly of raw sequences, annotation of the assembled sequences, storage of the analyzed information into MySQL databases, and graphic display of all processed data. A web application was implemented with the latest J2EE (Java 2 Platform Enterprise Edition) software technology (JSP/EJB/JavaServlet) for browsing and querying the database, for creation of dynamic web pages on the client side, and for mapping annotated enzymes to KEGG pathways, the AJAX framework was also used partially. The online resources, such as putative annotation, single nucleotide polymorphisms (SNP) and tandem repeat data sets, can be searched by text, explored on the website, searched using BLAST, and downloaded. To archive more significant BLAST results, a curation system was introduced with which biologists can easily edit best-hit annotation information for others to view. The Garlic

  12. The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

    Science.gov (United States)

    Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

    2014-01-01

    Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

  13. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  14. MIPS: a database for genomes and protein sequences.

    Science.gov (United States)

    Mewes, H W; Frishman, D; Güldener, U; Mannhaupt, G; Mayer, K; Mokrejs, M; Morgenstern, B; Münsterkötter, M; Rudd, S; Weil, B

    2002-01-01

    The Munich Information Center for Protein Sequences (MIPS-GSF, Neuherberg, Germany) continues to provide genome-related information in a systematic way. MIPS supports both national and European sequencing and functional analysis projects, develops and maintains automatically generated and manually annotated genome-specific databases, develops systematic classification schemes for the functional annotation of protein sequences, and provides tools for the comprehensive analysis of protein sequences. This report updates the information on the yeast genome (CYGD), the Neurospora crassa genome (MNCDB), the databases for the comprehensive set of genomes (PEDANT genomes), the database of annotated human EST clusters (HIB), the database of complete cDNAs from the DHGP (German Human Genome Project), as well as the project specific databases for the GABI (Genome Analysis in Plants) and HNB (Helmholtz-Netzwerk Bioinformatik) networks. The Arabidospsis thaliana database (MATDB), the database of mitochondrial proteins (MITOP) and our contribution to the PIR International Protein Sequence Database have been described elsewhere [Schoof et al. (2002) Nucleic Acids Res., 30, 91-93; Scharfe et al. (2000) Nucleic Acids Res., 28, 155-158; Barker et al. (2001) Nucleic Acids Res., 29, 29-32]. All databases described, the protein analysis tools provided and the detailed descriptions of our projects can be accessed through the MIPS World Wide Web server (http://mips.gsf.de).

  15. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  16. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  17. Genome Sequence Databases (Overview): Sequencing and Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  18. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  19. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  20. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  1. Winnowing sequences from a database search.

    Science.gov (United States)

    Berman, P; Zhang, Z; Wolf, Y I; Koonin, E V; Miller, W

    2000-01-01

    In database searches for sequence similarity, matches to a distinct sequence region (e.g., protein domain) are frequently obscured by numerous matches to another region of the same sequence. In order to cope with this problem, algorithms are developed to discard redundant matches. One model for this problem begins with a list of intervals, each with an associated score; each interval gives the range of positions in the query sequence that align to a database sequence, and the score is that of the alignment. If interval I is contained in interval J, and I's score is less than J's, then I is said to be dominated by J. The problem is then to identify each interval that is dominated by at least K other intervals, where K is a given level of "tolerable redundancy." An algorithm is developed to solve the problem in O(N log N) time and O(N*) space, where N is the number of intervals and N* is a precisely defined value that never exceeds N and is frequently much smaller. This criterion for discarding database hits has been implemented in the Blast program, as illustrated herein with examples. Several variations and extensions of this approach are also described.

  2. MIPS: a database for protein sequences and complete genomes.

    Science.gov (United States)

    Mewes, H W; Hani, J; Pfeiffer, F; Frishman, D

    1998-01-01

    The MIPS group [Munich Information Center for Protein Sequences of the German National Center for Environment and Health (GSF)] at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, is involved in a number of data collection activities, including a comprehensive database of the yeast genome, a database reflecting the progress in sequencing the Arabidopsis thaliana genome, the systematic analysis of other small genomes and the collection of protein sequence data within the framework of the PIR-International Protein Sequence Database (described elsewhere in this volume). Through its WWW server (http://www.mips.biochem.mpg.de ) MIPS provides access to a variety of generic databases, including a database of protein families as well as automatically generated data by the systematic application of sequence analysis algorithms. The yeast genome sequence and its related information was also compiled on CD-ROM to provide dynamic interactive access to the 16 chromosomes of the first eukaryotic genome unraveled. PMID:9399795

  3. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  4. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  5. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  6. Using SQL Databases for Sequence Similarity Searching and Analysis.

    Science.gov (United States)

    Pearson, William R; Mackey, Aaron J

    2017-09-13

    Relational databases can integrate diverse types of information and manage large sets of similarity search results, greatly simplifying genome-scale analyses. By focusing on taxonomic subsets of sequences, relational databases can reduce the size and redundancy of sequence libraries and improve the statistical significance of homologs. In addition, by loading similarity search results into a relational database, it becomes possible to explore and summarize the relationships between all of the proteins in an organism and those in other biological kingdoms. This unit describes how to use relational databases to improve the efficiency of sequence similarity searching and demonstrates various large-scale genomic analyses of homology-related data. It also describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. The unit also introduces search_demo, a database that stores sequence similarity search results. The search_demo database is then used to explore the evolutionary relationships between E. coli proteins and proteins in other organisms in a large-scale comparative genomic analysis. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  7. Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

    Science.gov (United States)

    Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

    2009-04-01

    We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

  8. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  9. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    Science.gov (United States)

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  10. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  11. Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

    Directory of Open Access Journals (Sweden)

    Cheng-Chong Chou

    2004-11-01

    Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

  12. Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Yu-Hoon Kim

    2014-01-01

    Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.

  13. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  14. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  15. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  16. Study of event sequence database for a nuclear power domain

    International Nuclear Information System (INIS)

    Kusumi, Yoshiaki

    1998-01-01

    A retrieval engine developed to extract event sequences from an accident information database using a time series retrieval formula expressed with ordered retrieval terms is explored. This engine outputs not only a sequence which completely matches with a time series retrieval formula, but also sequence which approximately matches the formula (fuzzy retrieval). An event sequence database in which records consist of three ordered parameters, namely the causal event, the process and result. Then the database is used to assess the feasibility of this engine and favorable results were obtained. (author)

  17. High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

  18. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  19. Comparative high-throughput transcriptome sequencing and development of SiESTa, the Silene EST annotation database

    Directory of Open Access Journals (Sweden)

    Marais Gabriel AB

    2011-07-01

    Full Text Available Abstract Background The genus Silene is widely used as a model system for addressing ecological and evolutionary questions in plants, but advances in using the genus as a model system are impeded by the lack of available resources for studying its genome. Massively parallel sequencing cDNA has recently developed into an efficient method for characterizing the transcriptomes of non-model organisms, generating massive amounts of data that enable the study of multiple species in a comparative framework. The sequences generated provide an excellent resource for identifying expressed genes, characterizing functional variation and developing molecular markers, thereby laying the foundations for future studies on gene sequence and gene expression divergence. Here, we report the results of a comparative transcriptome sequencing study of eight individuals representing four Silene and one Dianthus species as outgroup. All sequences and annotations have been deposited in a newly developed and publicly available database called SiESTa, the Silene EST annotation database. Results A total of 1,041,122 EST reads were generated in two runs on a Roche GS-FLX 454 pyrosequencing platform. EST reads were analyzed separately for all eight individuals sequenced and were assembled into contigs using TGICL. These were annotated with results from BLASTX searches and Gene Ontology (GO terms, and thousands of single-nucleotide polymorphisms (SNPs were characterized. Unassembled reads were kept as singletons and together with the contigs contributed to the unigenes characterized in each individual. The high quality of unigenes is evidenced by the proportion (49% that have significant hits in similarity searches with the A. thaliana proteome. The SiESTa database is accessible at http://www.siesta.ethz.ch. Conclusion The sequence collections established in the present study provide an important genomic resource for four Silene and one Dianthus species and will help to

  20. Comparative high-throughput transcriptome sequencing and development of SiESTa, the Silene EST annotation database

    Science.gov (United States)

    2011-01-01

    Background The genus Silene is widely used as a model system for addressing ecological and evolutionary questions in plants, but advances in using the genus as a model system are impeded by the lack of available resources for studying its genome. Massively parallel sequencing cDNA has recently developed into an efficient method for characterizing the transcriptomes of non-model organisms, generating massive amounts of data that enable the study of multiple species in a comparative framework. The sequences generated provide an excellent resource for identifying expressed genes, characterizing functional variation and developing molecular markers, thereby laying the foundations for future studies on gene sequence and gene expression divergence. Here, we report the results of a comparative transcriptome sequencing study of eight individuals representing four Silene and one Dianthus species as outgroup. All sequences and annotations have been deposited in a newly developed and publicly available database called SiESTa, the Silene EST annotation database. Results A total of 1,041,122 EST reads were generated in two runs on a Roche GS-FLX 454 pyrosequencing platform. EST reads were analyzed separately for all eight individuals sequenced and were assembled into contigs using TGICL. These were annotated with results from BLASTX searches and Gene Ontology (GO) terms, and thousands of single-nucleotide polymorphisms (SNPs) were characterized. Unassembled reads were kept as singletons and together with the contigs contributed to the unigenes characterized in each individual. The high quality of unigenes is evidenced by the proportion (49%) that have significant hits in similarity searches with the A. thaliana proteome. The SiESTa database is accessible at http://www.siesta.ethz.ch. Conclusion The sequence collections established in the present study provide an important genomic resource for four Silene and one Dianthus species and will help to further develop Silene as a

  1. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  2. Specialized microbial databases for inductive exploration of microbial genome sequences

    Directory of Open Access Journals (Sweden)

    Cabau Cédric

    2005-02-01

    Full Text Available Abstract Background The enormous amount of genome sequence data asks for user-oriented databases to manage sequences and annotations. Queries must include search tools permitting function identification through exploration of related objects. Methods The GenoList package for collecting and mining microbial genome databases has been rewritten using MySQL as the database management system. Functions that were not available in MySQL, such as nested subquery, have been implemented. Results Inductive reasoning in the study of genomes starts from "islands of knowledge", centered around genes with some known background. With this concept of "neighborhood" in mind, a modified version of the GenoList structure has been used for organizing sequence data from prokaryotic genomes of particular interest in China. GenoChore http://bioinfo.hku.hk/genochore.html, a set of 17 specialized end-user-oriented microbial databases (including one instance of Microsporidia, Encephalitozoon cuniculi, a member of Eukarya has been made publicly available. These databases allow the user to browse genome sequence and annotation data using standard queries. In addition they provide a weekly update of searches against the world-wide protein sequences data libraries, allowing one to monitor annotation updates on genes of interest. Finally, they allow users to search for patterns in DNA or protein sequences, taking into account a clustering of genes into formal operons, as well as providing extra facilities to query sequences using predefined sequence patterns. Conclusion This growing set of specialized microbial databases organize data created by the first Chinese bacterial genome programs (ThermaList, Thermoanaerobacter tencongensis, LeptoList, with two different genomes of Leptospira interrogans and SepiList, Staphylococcus epidermidis associated to related organisms for comparison.

  3. Using the TIGR gene index databases for biological discovery.

    Science.gov (United States)

    Lee, Yuandan; Quackenbush, John

    2003-11-01

    The TIGR Gene Index web pages provide access to analyses of ESTs and gene sequences for nearly 60 species, as well as a number of resources derived from these. Each species-specific database is presented using a common format with a homepage. A variety of methods exist that allow users to search each species-specific database. Methods implemented currently include nucleotide or protein sequence queries using WU-BLAST, text-based searches using various sequence identifiers, searches by gene, tissue and library name, and searches using functional classes through Gene Ontology assignments. This protocol provides guidance for using the Gene Index Databases to extract information.

  4. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  5. mESAdb: microRNA expression and sequence analysis database.

    Science.gov (United States)

    Kaya, Koray D; Karakülah, Gökhan; Yakicier, Cengiz M; Acar, Aybar C; Konu, Ozlen

    2011-01-01

    microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data.

  6. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  7. Protein sequence annotation in the genome era: the annotation concept of SWISS-PROT+TREMBL.

    Science.gov (United States)

    Apweiler, R; Gateau, A; Contrino, S; Martin, M J; Junker, V; O'Donovan, C; Lang, F; Mitaritonna, N; Kappus, S; Bairoch, A

    1997-01-01

    SWISS-PROT is a curated protein sequence database which strives to provide a high level of annotation, a minimal level of redundancy and high level of integration with other databases. Ongoing genome sequencing projects have dramatically increased the number of protein sequences to be incorporated into SWISS-PROT. Since we do not want to dilute the quality standards of SWISS-PROT by incorporating sequences without proper sequence analysis and annotation, we cannot speed up the incorporation of new incoming data indefinitely. However, as we also want to make the sequences available as fast as possible, we introduced TREMBL (TRanslation of EMBL nucleotide sequence database), a supplement to SWISS-PROT. TREMBL consists of computer-annotated entries in SWISS-PROT format derived from the translation of all coding sequences (CDS) in the EMBL nucleotide sequence database, except for CDS already included in SWISS-PROT. While TREMBL is already of immense value, its computer-generated annotation does not match the quality of SWISS-PROTs. The main difference is in the protein functional information attached to sequences. With this in mind, we are dedicating substantial effort to develop and apply computer methods to enhance the functional information attached to TREMBL entries.

  8. Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

    Science.gov (United States)

    The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

  9. MIPS: a database for protein sequences, homology data and yeast genome information.

    Science.gov (United States)

    Mewes, H W; Albermann, K; Heumann, K; Liebl, S; Pfeiffer, F

    1997-01-01

    The MIPS group (Martinsried Institute for Protein Sequences) at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, collects, processes and distributes protein sequence data within the framework of the tripartite association of the PIR-International Protein Sequence Database (,). MIPS contributes nearly 50% of the data input to the PIR-International Protein Sequence Database. The database is distributed on CD-ROM together with PATCHX, an exhaustive supplement of unique, unverified protein sequences from external sources compiled by MIPS. Through its WWW server (http://www.mips.biochem.mpg.de/ ) MIPS permits internet access to sequence databases, homology data and to yeast genome information. (i) Sequence similarity results from the FASTA program () are stored in the FASTA database for all proteins from PIR-International and PATCHX. The database is dynamically maintained and permits instant access to FASTA results. (ii) Starting with FASTA database queries, proteins have been classified into families and superfamilies (PROT-FAM). (iii) The HPT (hashed position tree) data structure () developed at MIPS is a new approach for rapid sequence and pattern searching. (iv) MIPS provides access to the sequence and annotation of the complete yeast genome (), the functional classification of yeast genes (FunCat) and its graphical display, the 'Genome Browser' (). A CD-ROM based on the JAVA programming language providing dynamic interactive access to the yeast genome and the related protein sequences has been compiled and is available on request. PMID:9016498

  10. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  11. A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing

    Directory of Open Access Journals (Sweden)

    Guangtu Gao

    2018-04-01

    Full Text Available Single-nucleotide polymorphisms (SNPs are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout (Oncorhynchus mykiss, SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD libraries, reduced representation libraries (RRL and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1 which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup, followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs and multi-sequence variants (MSVs. Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25. The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and

  12. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Science.gov (United States)

    2010-07-01

    ... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...

  13. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  14. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  15. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Science.gov (United States)

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  16. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

    Science.gov (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

    1998-07-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  17. BIOPEP database and other programs for processing bioactive peptide sequences.

    Science.gov (United States)

    Minkiewicz, Piotr; Dziuba, Jerzy; Iwaniak, Anna; Dziuba, Marta; Darewicz, Małgorzata

    2008-01-01

    This review presents the potential for application of computational tools in peptide science based on a sample BIOPEP database and program as well as other programs and databases available via the World Wide Web. The BIOPEP application contains a database of biologically active peptide sequences and a program enabling construction of profiles of the potential biological activity of protein fragments, calculation of quantitative descriptors as measures of the value of proteins as potential precursors of bioactive peptides, and prediction of bonds susceptible to hydrolysis by endopeptidases in a protein chain. Other bioactive and allergenic peptide sequence databases are also presented. Programs enabling the construction of binary and multiple alignments between peptide sequences, the construction of sequence motifs attributed to a given type of bioactivity, searching for potential precursors of bioactive peptides, and the prediction of sites susceptible to proteolytic cleavage in protein chains are available via the Internet as are other approaches concerning secondary structure prediction and calculation of physicochemical features based on amino acid sequence. Programs for prediction of allergenic and toxic properties have also been developed. This review explores the possibilities of cooperation between various programs.

  18. The UCSC genome browser database: update 2007

    DEFF Research Database (Denmark)

    Kuhn, R M; Karolchik, D; Zweig, A S

    2006-01-01

    The University of California, Santa Cruz Genome Browser Database contains, as of September 2006, sequence and annotation data for the genomes of 13 vertebrate and 19 invertebrate species. The Genome Browser displays a wide variety of annotations at all scales from the single nucleotide level up t...

  19. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  20. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Science.gov (United States)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  1. Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

    Directory of Open Access Journals (Sweden)

    White Frank F

    2011-07-01

    Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

  2. SINEBase: a database and tool for SINE analysis.

    Science.gov (United States)

    Vassetzky, Nikita S; Kramerov, Dmitri A

    2013-01-01

    SINEBase (http://sines.eimb.ru) integrates the revisited body of knowledge about short interspersed elements (SINEs). A set of formal definitions concerning SINEs was introduced. All available sequence data were screened through these definitions and the genetic elements misidentified as SINEs were discarded. As a result, 175 SINE families have been recognized in animals, flowering plants and green algae. These families were classified by the modular structure of their nucleotide sequences and the frequencies of different patterns were evaluated. These data formed the basis for the database of SINEs. The SINEBase website can be used in two ways: first, to explore the database of SINE families, and second, to analyse candidate SINE sequences using specifically developed tools. This article presents an overview of the database and the process of SINE identification and analysis.

  3. Where the bugs are: analyzing distributions of bacterial phyla by descriptor keyword search in the nucleotide database.

    Science.gov (United States)

    Squartini, Andrea

    2011-07-26

    The associations between bacteria and environment underlie their preferential interactions with given physical or chemical conditions. Microbial ecology aims at extracting conserved patterns of occurrence of bacterial taxa in relation to defined habitats and contexts. In the present report the NCBI nucleotide sequence database is used as dataset to extract information relative to the distribution of each of the 24 phyla of the bacteria superkingdom and of the Archaea. Over two and a half million records are filtered in their cross-association with each of 48 sets of keywords, defined to cover natural or artificial habitats, interactions with plant, animal or human hosts, and physical-chemical conditions. The results are processed showing: (a) how the different descriptors enrich or deplete the proportions at which the phyla occur in the total database; (b) in which order of abundance do the different keywords score for each phylum (preferred habitats or conditions), and to which extent are phyla clustered to few descriptors (specific) or spread across many (cosmopolitan); (c) which keywords individuate the communities ranking highest for diversity and evenness. A number of cues emerge from the results, contributing to sharpen the picture on the functional systematic diversity of prokaryotes. Suggestions are given for a future automated service dedicated to refining and updating such kind of analyses via public bioinformatic engines.

  4. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

    Science.gov (United States)

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

    2012-07-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  5. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Directory of Open Access Journals (Sweden)

    Qingyu Chen

    Full Text Available First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases.We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  6. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Science.gov (United States)

    Chen, Qingyu; Zobel, Justin; Zhang, Xiuzhen; Verspoor, Karin

    2016-01-01

    First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases. We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  7. KAIKObase: An integrated silkworm genome database and data mining tool

    Directory of Open Access Journals (Sweden)

    Nagaraju Javaregowda

    2009-10-01

    Full Text Available Abstract Background The silkworm, Bombyx mori, is one of the most economically important insects in many developing countries owing to its large-scale cultivation for silk production. With the development of genomic and biotechnological tools, B. mori has also become an important bioreactor for production of various recombinant proteins of biomedical interest. In 2004, two genome sequencing projects for B. mori were reported independently by Chinese and Japanese teams; however, the datasets were insufficient for building long genomic scaffolds which are essential for unambiguous annotation of the genome. Now, both the datasets have been merged and assembled through a joint collaboration between the two groups. Description Integration of the two data sets of silkworm whole-genome-shotgun sequencing by the Japanese and Chinese groups together with newly obtained fosmid- and BAC-end sequences produced the best continuity (~3.7 Mb in N50 scaffold size among the sequenced insect genomes and provided a high degree of nucleotide coverage (88% of all 28 chromosomes. In addition, a physical map of BAC contigs constructed by fingerprinting BAC clones and a SNP linkage map constructed using BAC-end sequences were available. In parallel, proteomic data from two-dimensional polyacrylamide gel electrophoresis in various tissues and developmental stages were compiled into a silkworm proteome database. Finally, a Bombyx trap database was constructed for documenting insertion positions and expression data of transposon insertion lines. Conclusion For efficient usage of genome information for functional studies, genomic sequences, physical and genetic map information and EST data were compiled into KAIKObase, an integrated silkworm genome database which consists of 4 map viewers, a gene viewer, and sequence, keyword and position search systems to display results and data at the level of nucleotide sequence, gene, scaffold and chromosome. Integration of the

  8. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  9. The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

    Science.gov (United States)

    Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

    2011-04-01

    A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

  10. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  11. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  12. Using relational databases for improved sequence similarity searching and large-scale genomic analyses.

    Science.gov (United States)

    Mackey, Aaron J; Pearson, William R

    2004-10-01

    Relational databases are designed to integrate diverse types of information and manage large sets of search results, greatly simplifying genome-scale analyses. Relational databases are essential for management and analysis of large-scale sequence analyses, and can also be used to improve the statistical significance of similarity searches by focusing on subsets of sequence libraries most likely to contain homologs. This unit describes using relational databases to improve the efficiency of sequence similarity searching and to demonstrate various large-scale genomic analyses of homology-related data. This unit describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. These include basic use of the database to generate a novel sequence library subset, how to extend and use seqdb_demo for the storage of sequence similarity search results and making use of various kinds of stored search results to address aspects of comparative genomic analysis.

  13. Organizing, exploring, and analyzing antibody sequence data: the case for relational-database managers.

    Science.gov (United States)

    Owens, John

    2009-01-01

    Technological advances in the acquisition of DNA and protein sequence information and the resulting onrush of data can quickly overwhelm the scientist unprepared for the volume of information that must be evaluated and carefully dissected to discover its significance. Few laboratories have the luxury of dedicated personnel to organize, analyze, or consistently record a mix of arriving sequence data. A methodology based on a modern relational-database manager is presented that is both a natural storage vessel for antibody sequence information and a conduit for organizing and exploring sequence data and accompanying annotation text. The expertise necessary to implement such a plan is equal to that required by electronic word processors or spreadsheet applications. Antibody sequence projects maintained as independent databases are selectively unified by the relational-database manager into larger database families that contribute to local analyses, reports, interactive HTML pages, or exported to facilities dedicated to sophisticated sequence analysis techniques. Database files are transposable among current versions of Microsoft, Macintosh, and UNIX operating systems.

  14. The Sequenced Angiosperm Genomes and Genome Databases.

    Science.gov (United States)

    Chen, Fei; Dong, Wei; Zhang, Jiawei; Guo, Xinyue; Chen, Junhao; Wang, Zhengjia; Lin, Zhenguo; Tang, Haibao; Zhang, Liangsheng

    2018-01-01

    Angiosperms, the flowering plants, provide the essential resources for human life, such as food, energy, oxygen, and materials. They also promoted the evolution of human, animals, and the planet earth. Despite the numerous advances in genome reports or sequencing technologies, no review covers all the released angiosperm genomes and the genome databases for data sharing. Based on the rapid advances and innovations in the database reconstruction in the last few years, here we provide a comprehensive review for three major types of angiosperm genome databases, including databases for a single species, for a specific angiosperm clade, and for multiple angiosperm species. The scope, tools, and data of each type of databases and their features are concisely discussed. The genome databases for a single species or a clade of species are especially popular for specific group of researchers, while a timely-updated comprehensive database is more powerful for address of major scientific mysteries at the genome scale. Considering the low coverage of flowering plants in any available database, we propose construction of a comprehensive database to facilitate large-scale comparative studies of angiosperm genomes and to promote the collaborative studies of important questions in plant biology.

  15. The nucleotide sequence of a Polish isolate of Tomato torrado virus.

    Science.gov (United States)

    Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

    2008-12-01

    A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

  16. Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. lactis DSM 7290, and partial characterization of the enzyme.

    Science.gov (United States)

    Vongerichten, K F; Klein, J R; Matern, H; Plapp, R

    1994-10-01

    Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.

  17. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  18. HIV Sequence Compendium 2015

    Energy Technology Data Exchange (ETDEWEB)

    Foley, Brian Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas Kenneth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Cristian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Pennsylvania, Philadelphia, PA (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette Tina Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-05

    This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database is still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  19. Mining biological databases for candidate disease genes

    Science.gov (United States)

    Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.

    2001-07-01

    The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).

  20. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  1. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  2. Evaluation of the authenticity of a highly novel environmental sequence from boreal forest soil using ribosomal RNA secondary structure modeling

    Science.gov (United States)

    D.J. Glass; N. Takebayashi; L. Olson; D.L. Taylor

    2013-01-01

    The number of sequences from both formally described taxa and uncultured environmental DNA deposited in the International Nucleotide Sequence Databases has increased substantially over the last two decades. Although the majority of these sequences represent authentic gene copies, there is evidence of DNA artifacts in these databases as well. These include lab artifacts...

  3. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    NARCIS (Netherlands)

    Steenbergh, P.H.; Sussenbach, J.S.

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  4. Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

    OpenAIRE

    Liljeström, P L; Liljeström, P

    1987-01-01

    Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

  5. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    Science.gov (United States)

    2010-07-01

    ... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

  6. The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

    Science.gov (United States)

    Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

    1992-12-01

    The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

  7. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    Science.gov (United States)

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  8. The SWISS-PROT protein sequence data bank: current status.

    OpenAIRE

    Bairoch, A; Boeckmann, B

    1994-01-01

    SWISS-PROT is an annotated protein sequence database established in 1986 and maintained collaboratively, since 1988, by the Department of Medical Biochemistry of the University of Geneva and the EMBL Data Library. The SWISS-PROT protein sequence data bank consist of sequence entries. Sequence entries are composed of different lines types, each with their own format. For standardization purposes the format of SWISS-PROT follows as closely as possible that of the EMBL Nucleotide Sequence Databa...

  9. Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

    International Nuclear Information System (INIS)

    Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

    1987-01-01

    Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

  10. A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

    Science.gov (United States)

    Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

    2013-07-01

    The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

  11. Rfam: annotating families of non-coding RNA sequences.

    Science.gov (United States)

    Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

    2015-01-01

    The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

  12. Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

    Science.gov (United States)

    Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

    2017-06-26

    Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

  13. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  14. SEQUENCING OF FLAX LIS-1 INSERTION SITE IN THE ALBIDUM GENOTYPE

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2012-12-01

    Full Text Available The paper presents a methodology of identifying the insertion site of LIS-1-1 (Linum Insertion Sequence 1 element in flax Albidum variety when growing under the in vitro combined with environmental stress conditions. Abiotic stress was induced by a reduced nutrient content in a growth medium. The LIS-1 insertion site amplification was reaLIS-1ed using the forward LIS-L: 5'-GGG CAG TTT AAC TGT AAC GAA - 3 'and revers LIS-R: 5'-GCT TGG ATT TAG ACT TGG CAA C - 3' primers by PCR. PCR product was sequenced by direct sequencing method to proove the nucleotide sequence for matching with database LIS-1 sequence. A comparison has been matched with the sequence of the amplified segment in the database for all nucleotides except the 11-position in the 5'-3 ' direction, where instead of the three adenine pair is a couple in the Albidum variety. Changes caused by mobile elements or insertion sequences result in common flax in variability that can be used for the purposes of development of effective marker identification or environment based markers development.

  15. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  16. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  17. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  18. Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

    Science.gov (United States)

    Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2012-07-01

    We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

  19. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  20. In Silico Detection and Typing of Plasmids using PlasmidFinder and Plasmid Multilocus Sequence Typing

    DEFF Research Database (Denmark)

    Carattoli, Alessandra; Zankari, Ea; García-Fernández, Aurora

    2014-01-01

    In the work presented here, we designed and developed two easy-to-use Web tools for in silico detection and characterization of whole-genome sequence (WGS) and whole-plasmid sequence data from members of the family Enterobacteriaceae. These tools will facilitate bacterial typing based on draft...... genomes of multidrug-resistant Enterobacteriaceae species by the rapid detection of known plasmid types. Replicon sequences from 559 fully sequenced plasmids associated with the family Enterobacteriaceae in the NCBI nucleotide database were collected to build a consensus database for integration...... sequences identified in the 559 fully sequenced plasmids. For plasmid multilocus sequence typing (pMLST) analysis, a database that is updated weekly was generated from www.pubmlst.org and integrated into a Web tool called pMLST. Both databases were evaluated using draft genomes from a collection...

  1. Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

    Science.gov (United States)

    Nishizawa, M; Nishizawa, K

    2000-10-01

    The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

  2. Estimating the annotation error rate of curated GO database sequence annotations

    Directory of Open Access Journals (Sweden)

    Brown Alfred L

    2007-05-01

    Full Text Available Abstract Background Annotations that describe the function of sequences are enormously important to researchers during laboratory investigations and when making computational inferences. However, there has been little investigation into the data quality of sequence function annotations. Here we have developed a new method of estimating the error rate of curated sequence annotations, and applied this to the Gene Ontology (GO sequence database (GOSeqLite. This method involved artificially adding errors to sequence annotations at known rates, and used regression to model the impact on the precision of annotations based on BLAST matched sequences. Results We estimated the error rate of curated GO sequence annotations in the GOSeqLite database (March 2006 at between 28% and 30%. Annotations made without use of sequence similarity based methods (non-ISS had an estimated error rate of between 13% and 18%. Annotations made with the use of sequence similarity methodology (ISS had an estimated error rate of 49%. Conclusion While the overall error rate is reasonably low, it would be prudent to treat all ISS annotations with caution. Electronic annotators that use ISS annotations as the basis of predictions are likely to have higher false prediction rates, and for this reason designers of these systems should consider avoiding ISS annotations where possible. Electronic annotators that use ISS annotations to make predictions should be viewed sceptically. We recommend that curators thoroughly review ISS annotations before accepting them as valid. Overall, users of curated sequence annotations from the GO database should feel assured that they are using a comparatively high quality source of information.

  3. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  4. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  5. Construction of an integrated database to support genomic sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Gilbert, W.; Overbeek, R.

    1994-11-01

    The central goal of this project is to develop an integrated database to support comparative analysis of genomes including DNA sequence data, protein sequence data, gene expression data and metabolism data. In developing the logic-based system GenoBase, a broader integration of available data was achieved due to assistance from collaborators. Current goals are to easily include new forms of data as they become available and to easily navigate through the ensemble of objects described within the database. This report comments on progress made in these areas.

  6. BIOSPIDA: A Relational Database Translator for NCBI.

    Science.gov (United States)

    Hagen, Matthew S; Lee, Eva K

    2010-11-13

    As the volume and availability of biological databases continue widespread growth, it has become increasingly difficult for research scientists to identify all relevant information for biological entities of interest. Details of nucleotide sequences, gene expression, molecular interactions, and three-dimensional structures are maintained across many different databases. To retrieve all necessary information requires an integrated system that can query multiple databases with minimized overhead. This paper introduces a universal parser and relational schema translator that can be utilized for all NCBI databases in Abstract Syntax Notation (ASN.1). The data models for OMIM, Entrez-Gene, Pubmed, MMDB and GenBank have been successfully converted into relational databases and all are easily linkable helping to answer complex biological questions. These tools facilitate research scientists to locally integrate databases from NCBI without significant workload or development time.

  7. Viral Genome DataBase: storing and analyzing genes and proteins from complete viral genomes.

    Science.gov (United States)

    Hiscock, D; Upton, C

    2000-05-01

    The Viral Genome DataBase (VGDB) contains detailed information of the genes and predicted protein sequences from 15 completely sequenced genomes of large (&100 kb) viruses (2847 genes). The data that is stored includes DNA sequence, protein sequence, GenBank and user-entered notes, molecular weight (MW), isoelectric point (pI), amino acid content, A + T%, nucleotide frequency, dinucleotide frequency and codon use. The VGDB is a mySQL database with a user-friendly JAVA GUI. Results of queries can be easily sorted by any of the individual parameters. The software and additional figures and information are available at http://athena.bioc.uvic.ca/genomes/index.html .

  8. Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

    Science.gov (United States)

    Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

    2004-01-01

    Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  9. Database for the ampC alleles in Acinetobacter baumannii.

    Directory of Open Access Journals (Sweden)

    Nabil Karah

    Full Text Available Acinetobacter baumannii is a troublesome opportunistic pathogen with a high capacity for clonal dissemination. We announce the establishment of a database for the ampC locus in A. baumannii, in which novel ampC alleles are differentiated based on the occurrence of ≥ 1 nucleotide change, regardless of whether it is silent or missense. The database is openly accessible at the pubmlst platform for A. baumannii (http://pubmlst.org/abaumannii/. Forty-eight distinctive alleles of the ampC locus have so far been identified and deposited in the database. Isolates from clonal complex 1 (CC1, according to the Pasteur multilocus sequence typing scheme, had a variety of the ampC locus alleles, including alleles 1, 3, 4, 5, 6, 7, 8, 13, 14, 17, and 18. On the other hand, isolates from CC2 had the ampC alleles 2, 3, 19, 20, 21, 22, 23, 24, 26, 27, 28, and 46. Allele 3 was characteristic for sequence types ST3 or ST32. The ampC alleles 10, 16, and 25 were characteristic for CC10, ST16, and CC25, respectively. Our study points out that novel gene databases, in which alleles are numbered based on differences in their nucleotide identities, should replace traditional records that use amino acid substitutions to define new alleles.

  10. The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

    Energy Technology Data Exchange (ETDEWEB)

    Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika; Tanaka, Yoshihiro; Teranishi, Kristen S.; Sunagawa, Shinichi; Wong, Mike; Stillman, Jonathon H.

    2010-01-27

    Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set of tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in

  11. SinEx DB: a database for single exon coding sequences in mammalian genomes.

    Science.gov (United States)

    Jorquera, Roddy; Ortiz, Rodrigo; Ossandon, F; Cárdenas, Juan Pablo; Sepúlveda, Rene; González, Carolina; Holmes, David S

    2016-01-01

    Eukaryotic genes are typically interrupted by intragenic, noncoding sequences termed introns. However, some genes lack introns in their coding sequence (CDS) and are generally known as 'single exon genes' (SEGs). In this work, a SEG is defined as a nuclear, protein-coding gene that lacks introns in its CDS. Whereas, many public databases of Eukaryotic multi-exon genes are available, there are only two specialized databases for SEGs. The present work addresses the need for a more extensive and diverse database by creating SinEx DB, a publicly available, searchable database of predicted SEGs from 10 completely sequenced mammalian genomes including human. SinEx DB houses the DNA and protein sequence information of these SEGs and includes their functional predictions (KOG) and the relative distribution of these functions within species. The information is stored in a relational database built with My SQL Server 5.1.33 and the complete dataset of SEG sequences and their functional predictions are available for downloading. SinEx DB can be interrogated by: (i) a browsable phylogenetic schema, (ii) carrying out BLAST searches to the in-house SinEx DB of SEGs and (iii) via an advanced search mode in which the database can be searched by key words and any combination of searches by species and predicted functions. SinEx DB provides a rich source of information for advancing our understanding of the evolution and function of SEGs.Database URL: www.sinex.cl. © The Author(s) 2016. Published by Oxford University Press.

  12. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    2015-11-01

    Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  13. PATACSDB—the database of polyA translational attenuators in coding sequences

    Directory of Open Access Journals (Sweden)

    Malgorzata Habich

    2016-02-01

    Full Text Available Recent additions to the repertoire of gene expression regulatory mechanisms are polyadenylate (polyA tracks encoding for poly-lysine runs in protein sequences. Such tracks stall the translation apparatus and induce frameshifting independently of the effects of charged nascent poly-lysine sequence on the ribosome exit channel. As such, they substantially influence the stability of mRNA and the amount of protein produced from a given transcript. Single base changes in these regions are enough to exert a measurable response on both protein and mRNA abundance; this makes each of these sequences a potentially interesting case study for the effects of synonymous mutation, gene dosage balance and natural frameshifting. Here we present PATACSDB, a resource that contain a comprehensive list of polyA tracks from over 250 eukaryotic genomes. Our data is based on the Ensembl genomic database of coding sequences and filtered with algorithm of 12A-1 which selects sequences of polyA tracks with a minimal length of 12 A’s allowing for one mismatched base. The PATACSDB database is accessible at: http://sysbio.ibb.waw.pl/patacsdb. The source code is available at http://github.com/habich/PATACSDB, and it includes the scripts with which the database can be recreated.

  14. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  15. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  16. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  17. Sequence modelling and an extensible data model for genomic database

    Energy Technology Data Exchange (ETDEWEB)

    Li, Peter Wei-Der [California Univ., San Francisco, CA (United States); Univ. of California, Berkeley, CA (United States)

    1992-01-01

    The Human Genome Project (HGP) plans to sequence the human genome by the beginning of the next century. It will generate DNA sequences of more than 10 billion bases and complex marker sequences (maps) of more than 100 million markers. All of these information will be stored in database management systems (DBMSs). However, existing data models do not have the abstraction mechanism for modelling sequences and existing DBMS`s do not have operations for complex sequences. This work addresses the problem of sequence modelling in the context of the HGP and the more general problem of an extensible object data model that can incorporate the sequence model as well as existing and future data constructs and operators. First, we proposed a general sequence model that is application and implementation independent. This model is used to capture the sequence information found in the HGP at the conceptual level. In addition, abstract and biological sequence operators are defined for manipulating the modelled sequences. Second, we combined many features of semantic and object oriented data models into an extensible framework, which we called the ``Extensible Object Model``, to address the need of a modelling framework for incorporating the sequence data model with other types of data constructs and operators. This framework is based on the conceptual separation between constructors and constraints. We then used this modelling framework to integrate the constructs for the conceptual sequence model. The Extensible Object Model is also defined with a graphical representation, which is useful as a tool for database designers. Finally, we defined a query language to support this model and implement the query processor to demonstrate the feasibility of the extensible framework and the usefulness of the conceptual sequence model.

  18. Sequence modelling and an extensible data model for genomic database

    Energy Technology Data Exchange (ETDEWEB)

    Li, Peter Wei-Der (California Univ., San Francisco, CA (United States) Lawrence Berkeley Lab., CA (United States))

    1992-01-01

    The Human Genome Project (HGP) plans to sequence the human genome by the beginning of the next century. It will generate DNA sequences of more than 10 billion bases and complex marker sequences (maps) of more than 100 million markers. All of these information will be stored in database management systems (DBMSs). However, existing data models do not have the abstraction mechanism for modelling sequences and existing DBMS's do not have operations for complex sequences. This work addresses the problem of sequence modelling in the context of the HGP and the more general problem of an extensible object data model that can incorporate the sequence model as well as existing and future data constructs and operators. First, we proposed a general sequence model that is application and implementation independent. This model is used to capture the sequence information found in the HGP at the conceptual level. In addition, abstract and biological sequence operators are defined for manipulating the modelled sequences. Second, we combined many features of semantic and object oriented data models into an extensible framework, which we called the Extensible Object Model'', to address the need of a modelling framework for incorporating the sequence data model with other types of data constructs and operators. This framework is based on the conceptual separation between constructors and constraints. We then used this modelling framework to integrate the constructs for the conceptual sequence model. The Extensible Object Model is also defined with a graphical representation, which is useful as a tool for database designers. Finally, we defined a query language to support this model and implement the query processor to demonstrate the feasibility of the extensible framework and the usefulness of the conceptual sequence model.

  19. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

  20. Cry-Bt identifier: a biological database for PCR detection of Cry genes present in transgenic plants.

    Science.gov (United States)

    Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil

    2009-10-23

    We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.

  1. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  2. The development and application of a Mycoplasma gallisepticum sequence database.

    Science.gov (United States)

    Armour, Natalie K; Laibinis, Victoria A; Collett, Stephen R; Ferguson-Noel, Naola

    2013-01-01

    Molecular analysis was conducted on 36 Mycoplasma gallisepticum DNA extracts from tracheal swab samples of commercial poultry in seven South African provinces between 2009 and 2012. Twelve unique M. gallisepticum genotypes were identified by polymerase chain reaction and sequence analysis of the 16S-23S rRNA intergenic spacer region (IGSR), M. gallisepticum cytadhesin 2 (mgc2), MGA_0319 and gapA genetic regions. The DNA sequences of these genotypes were distinct from those of M. gallisepticum isolates in a database composed of sequences from other countries, vaccine and reference strains. The most prevalent genotype (SA-WT#7) was detected in samples from commercial broilers, broiler breeders and layers in five provinces. South African M. gallisepticum sequences were more similar to those of the live vaccines commercially available in South Africa, but were distinct from that of F strain vaccine, which is not registered for use in South Africa. The IGSR, mgc2 or MGA_0319 sequences of three South African genotypes were identical to those of the ts-11 vaccine strain, necessitating a combination of mgc2 and IGSR targeted sequencing to differentiate South African wild-type genotypes from ts-11 vaccine. To identify and differentiate all 12 wild-types, mgc2, IGSR and MGA_0319 sequencing was required. Sequencing of gapA was least effective at strain differentiation. This research serves as a model for the development of an M. gallisepticum sequence database, and illustrates its application to characterize M. gallisepticum genotypes, select diagnostic tests and better understand the epidemiology of M. gallisepticum.

  3. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

    Science.gov (United States)

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

    2002-12-01

    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  4. Domain fusion analysis by applying relational algebra to protein sequence and domain databases.

    Science.gov (United States)

    Truong, Kevin; Ikura, Mitsuhiko

    2003-05-06

    Domain fusion analysis is a useful method to predict functionally linked proteins that may be involved in direct protein-protein interactions or in the same metabolic or signaling pathway. As separate domain databases like BLOCKS, PROSITE, Pfam, SMART, PRINTS-S, ProDom, TIGRFAMs, and amalgamated domain databases like InterPro continue to grow in size and quality, a computational method to perform domain fusion analysis that leverages on these efforts will become increasingly powerful. This paper proposes a computational method employing relational algebra to find domain fusions in protein sequence databases. The feasibility of this method was illustrated on the SWISS-PROT+TrEMBL sequence database using domain predictions from the Pfam HMM (hidden Markov model) database. We identified 235 and 189 putative functionally linked protein partners in H. sapiens and S. cerevisiae, respectively. From scientific literature, we were able to confirm many of these functional linkages, while the remainder offer testable experimental hypothesis. Results can be viewed at http://calcium.uhnres.utoronto.ca/pi. As the analysis can be computed quickly on any relational database that supports standard SQL (structured query language), it can be dynamically updated along with the sequence and domain databases, thereby improving the quality of predictions over time.

  5. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India

    Directory of Open Access Journals (Sweden)

    Sukdeb Nandi

    2010-03-01

    Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India

  6. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

    Science.gov (United States)

    Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

  7. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  8. PrionHome: a database of prions and other sequences relevant to prion phenomena.

    Directory of Open Access Journals (Sweden)

    Djamel Harbi

    Full Text Available Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions, prionoids (i.e., proteins that propagate like prions between individual cells, and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant, and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments. We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic

  9. PrionHome: a database of prions and other sequences relevant to prion phenomena.

    Science.gov (United States)

    Harbi, Djamel; Parthiban, Marimuthu; Gendoo, Deena M A; Ehsani, Sepehr; Kumar, Manish; Schmitt-Ulms, Gerold; Sowdhamini, Ramanathan; Harrison, Paul M

    2012-01-01

    Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions), prionoids (i.e., proteins that propagate like prions between individual cells), and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant), and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments). We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic sequences, showing

  10. CUDASW++: optimizing Smith-Waterman sequence database searches for CUDA-enabled graphics processing units

    Directory of Open Access Journals (Sweden)

    Maskell Douglas L

    2009-05-01

    Full Text Available Abstract Background The Smith-Waterman algorithm is one of the most widely used tools for searching biological sequence databases due to its high sensitivity. Unfortunately, the Smith-Waterman algorithm is computationally demanding, which is further compounded by the exponential growth of sequence databases. The recent emergence of many-core architectures, and their associated programming interfaces, provides an opportunity to accelerate sequence database searches using commonly available and inexpensive hardware. Findings Our CUDASW++ implementation (benchmarked on a single-GPU NVIDIA GeForce GTX 280 graphics card and a dual-GPU GeForce GTX 295 graphics card provides a significant performance improvement compared to other publicly available implementations, such as SWPS3, CBESW, SW-CUDA, and NCBI-BLAST. CUDASW++ supports query sequences of length up to 59K and for query sequences ranging in length from 144 to 5,478 in Swiss-Prot release 56.6, the single-GPU version achieves an average performance of 9.509 GCUPS with a lowest performance of 9.039 GCUPS and a highest performance of 9.660 GCUPS, and the dual-GPU version achieves an average performance of 14.484 GCUPS with a lowest performance of 10.660 GCUPS and a highest performance of 16.087 GCUPS. Conclusion CUDASW++ is publicly available open-source software. It provides a significant performance improvement for Smith-Waterman-based protein sequence database searches by fully exploiting the compute capability of commonly used CUDA-enabled low-cost GPUs.

  11. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Directory of Open Access Journals (Sweden)

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  12. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    Energy Technology Data Exchange (ETDEWEB)

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  13. Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

    Science.gov (United States)

    Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

    2017-08-01

    A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

  14. Alignment of high-throughput sequencing data inside in-memory databases.

    Science.gov (United States)

    Firnkorn, Daniel; Knaup-Gregori, Petra; Lorenzo Bermejo, Justo; Ganzinger, Matthias

    2014-01-01

    In times of high-throughput DNA sequencing techniques, performance-capable analysis of DNA sequences is of high importance. Computer supported DNA analysis is still an intensive time-consuming task. In this paper we explore the potential of a new In-Memory database technology by using SAP's High Performance Analytic Appliance (HANA). We focus on read alignment as one of the first steps in DNA sequence analysis. In particular, we examined the widely used Burrows-Wheeler Aligner (BWA) and implemented stored procedures in both, HANA and the free database system MySQL, to compare execution time and memory management. To ensure that the results are comparable, MySQL has been running in memory as well, utilizing its integrated memory engine for database table creation. We implemented stored procedures, containing exact and inexact searching of DNA reads within the reference genome GRCh37. Due to technical restrictions in SAP HANA concerning recursion, the inexact matching problem could not be implemented on this platform. Hence, performance analysis between HANA and MySQL was made by comparing the execution time of the exact search procedures. Here, HANA was approximately 27 times faster than MySQL which means, that there is a high potential within the new In-Memory concepts, leading to further developments of DNA analysis procedures in the future.

  15. Reticulamoeba Is a Long-Branched Granofilosean (Cercozoa) That Is Missing from Sequence Databases

    Science.gov (United States)

    Bass, David; Yabuki, Akinori; Santini, Sébastien; Romac, Sarah; Berney, Cédric

    2012-01-01

    We sequenced the 18S ribosomal RNA gene of seven isolates of the enigmatic marine amoeboflagellate Reticulamoeba Grell, which resolved into four genetically distinct Reticulamoeba lineages, two of which correspond to R. gemmipara Grell and R. minor Grell, another with a relatively large cell body forming lacunae, and another that has similarities to both R. minor and R. gemmipara but with a greater propensity to form cell clusters. These lineages together form a long-branched clade that branches within the cercozoan class Granofilosea (phylum Cercozoa), showing phylogenetic affinities with the genus Mesofila. The basic morphology of Reticulamoeba is a roundish or ovoid cell with a more or less irregular outline. Long and branched reticulopodia radiate from the cell. The reticulopodia bear granules that are bidirectionally motile. There is also a biflagellate dispersal stage. Reticulamoeba is frequently observed in coastal marine environmental samples. PCR primers specific to the Reticulamoeba clade confirm that it is a frequent member of benthic marine microbial communities, and is also found in brackish water sediments and freshwater biofilm. However, so far it has not been found in large molecular datasets such as the nucleotide database in NCBI GenBank, metagenomic datasets in Camera, and the marine microbial eukaryote sampling and sequencing consortium BioMarKs, although closely related lineages can be found in some of these datasets using a highly targeted approach. Therefore, although such datasets are very powerful tools in microbial ecology, they may, for several methodological reasons, fail to detect ecologically and evolutionary key lineages. PMID:23226495

  16. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    Science.gov (United States)

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  17. Private and Efficient Query Processing on Outsourced Genomic Databases.

    Science.gov (United States)

    Ghasemi, Reza; Al Aziz, Md Momin; Mohammed, Noman; Dehkordi, Massoud Hadian; Jiang, Xiaoqian

    2017-09-01

    Applications of genomic studies are spreading rapidly in many domains of science and technology such as healthcare, biomedical research, direct-to-consumer services, and legal and forensic. However, there are a number of obstacles that make it hard to access and process a big genomic database for these applications. First, sequencing genomic sequence is a time consuming and expensive process. Second, it requires large-scale computation and storage systems to process genomic sequences. Third, genomic databases are often owned by different organizations, and thus, not available for public usage. Cloud computing paradigm can be leveraged to facilitate the creation and sharing of big genomic databases for these applications. Genomic data owners can outsource their databases in a centralized cloud server to ease the access of their databases. However, data owners are reluctant to adopt this model, as it requires outsourcing the data to an untrusted cloud service provider that may cause data breaches. In this paper, we propose a privacy-preserving model for outsourcing genomic data to a cloud. The proposed model enables query processing while providing privacy protection of genomic databases. Privacy of the individuals is guaranteed by permuting and adding fake genomic records in the database. These techniques allow cloud to evaluate count and top-k queries securely and efficiently. Experimental results demonstrate that a count and a top-k query over 40 Single Nucleotide Polymorphisms (SNPs) in a database of 20 000 records takes around 100 and 150 s, respectively.

  18. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  19. ProOpDB: Prokaryotic Operon DataBase.

    Science.gov (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

    2012-01-01

    The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  20. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  1. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

    2013-01-01

    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

  2. PseudoBase: a database with RNA pseudoknots.

    Science.gov (United States)

    van Batenburg, F H; Gultyaev, A P; Pleij, C W; Ng, J; Oliehoek, J

    2000-01-01

    PseudoBase is a database containing structural, functional and sequence data related to RNA pseudo-knots. It can be reached at http://wwwbio. Leiden Univ.nl/ approximately Batenburg/PKB.html. This page will direct the user to a retrieval page from where a particular pseudoknot can be chosen, or to a submission page which enables the user to add pseudoknot information to the database or to an informative page that elaborates on the various aspects of the database. For each pseudoknot, 12 items are stored, e.g. the nucleotides of the region that contains the pseudoknot, the stem positions of the pseudoknot, the EMBL accession number of the sequence that contains this pseudoknot and the support that can be given regarding the reliability of the pseudoknot. Access is via a small number of steps, using 16 different categories. The development process was done by applying the evolutionary methodology for software development rather than by applying the methodology of the classical waterfall model or the more modern spiral model.

  3. HIV Sequence Compendium 2010

    Energy Technology Data Exchange (ETDEWEB)

    Kuiken, Carla [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Foley, Brian [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Christian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Alabama, Tuscaloosa, AL (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2010-12-31

    This compendium is an annual printed summary of the data contained in the HIV sequence database. In these compendia we try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2010. Hence, though it is called the 2010 Compendium, its contents correspond to the 2009 curated alignments on our website. The number of sequences in the HIV database is still increasing exponentially. In total, at the time of printing, there were 339,306 sequences in the HIV Sequence Database, an increase of 45% since last year. The number of near complete genomes (>7000 nucleotides) increased to 2576 by end of 2009, reflecting a smaller increase than in previous years. However, as in previous years, the compendium alignments contain only a small fraction of these. Included in the alignments are a small number of sequences representing each of the subtypes and the more prevalent circulating recombinant forms (CRFs) such as 01 and 02, as well as a few outgroup sequences (group O and N and SIV-CPZ). Of the rarer CRFs we included one representative each. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. Reprints are available from our website in the form of both HTML and PDF files. As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  4. MAGIC Database and Interfaces: An Integrated Package for Gene Discovery and Expression

    Directory of Open Access Journals (Sweden)

    Lee H. Pratt

    2006-03-01

    Full Text Available The rapidly increasing rate at which biological data is being produced requires a corresponding growth in relational databases and associated tools that can help laboratories contend with that data. With this need in mind, we describe here a Modular Approach to a Genomic, Integrated and Comprehensive (MAGIC Database. This Oracle 9i database derives from an initial focus in our laboratory on gene discovery via production and analysis of expressed sequence tags (ESTs, and subsequently on gene expression as assessed by both EST clustering and microarrays. The MAGIC Gene Discovery portion of the database focuses on information derived from DNA sequences and on its biological relevance. In addition to MAGIC SEQ-LIMS, which is designed to support activities in the laboratory, it contains several additional subschemas. The latter include MAGIC Admin for database administration, MAGIC Sequence for sequence processing as well as sequence and clone attributes, MAGIC Cluster for the results of EST clustering, MAGIC Polymorphism in support of microsatellite and single-nucleotide-polymorphism discovery, and MAGIC Annotation for electronic annotation by BLAST and BLAT. The MAGIC Microarray portion is a MIAME-compliant database with two components at present. These are MAGIC Array-LIMS, which makes possible remote entry of all information into the database, and MAGIC Array Analysis, which provides data mining and visualization. Because all aspects of interaction with the MAGIC Database are via a web browser, it is ideally suited not only for individual research laboratories but also for core facilities that serve clients at any distance.

  5. Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

    Science.gov (United States)

    Li, Hongshan; Dai, Huaguo; Wei, Hui

    2005-01-01

    A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

  6. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  7. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  8. Tandem Mass Spectrum Sequencing: An Alternative to Database Search Engines in Shotgun Proteomics.

    Science.gov (United States)

    Muth, Thilo; Rapp, Erdmann; Berven, Frode S; Barsnes, Harald; Vaudel, Marc

    2016-01-01

    Protein identification via database searches has become the gold standard in mass spectrometry based shotgun proteomics. However, as the quality of tandem mass spectra improves, direct mass spectrum sequencing gains interest as a database-independent alternative. In this chapter, the general principle of this so-called de novo sequencing is introduced along with pitfalls and challenges of the technique. The main tools available are presented with a focus on user friendly open source software which can be directly applied in everyday proteomic workflows.

  9. Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

    International Nuclear Information System (INIS)

    Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

    1998-01-01

    To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

  10. Whole exome sequencing identifies novel mutation in eight Chinese children with isolated tetralogy of Fallot.

    Science.gov (United States)

    Liu, Lin; Wang, Hong-Dan; Cui, Cun-Ying; Qin, Yun-Yun; Fan, Tai-Bing; Peng, Bang-Tian; Zhang, Lian-Zhong; Wang, Cheng-Zeng

    2017-12-05

    Tetralogy of Fallot is the most common cyanotic congenital heart disease. However, its pathogenesis remains to be clarified. The purpose of this study was to identify the genetic variants in Tetralogy of Fallot by whole exome sequencing. Whole exome sequencing was performed among eight small families with Tetralogy of Fallot. Differential single nucleotide polymorphisms and small InDels were found by alignment within families and between families and then were verified by Sanger sequencing. Tetralogy of Fallot-related genes were determined by analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases. A total of sixteen differential single nucleotide polymorphisms loci and eight differential small InDels were discovered. The sixteen differential single nucleotide polymorphisms loci were located on Chr 1, 2, 4, 5, 11, 12, 15, 22 and X. Among the sixteen single nucleotide polymorphisms loci, six has not been reported. The eight differential small InDels were located on Chr 2, 4, 9, 12, 17, 19 and X, whereas of the eight differential small InDels, two has not been reported. Analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases revealed that PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 were associated with Tetralogy of Fallot. Our findings identify PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 mutations as underlying genetic causes of isolated tetralogy of Fallot.

  11. Comprehensive Genetic Database of Expressed Sequence Tags for Coccolithophorids

    Science.gov (United States)

    Ranji, Mohammad; Hadaegh, Ahmad R.

    Coccolithophorids are unicellular, marine, golden-brown, single-celled algae (Haptophyta) commonly found in near-surface waters in patchy distributions. They belong to the Phytoplankton family that is known to be responsible for much of the earth reproduction. Phytoplankton, just like plants live based on the energy obtained by Photosynthesis which produces oxygen. Substantial amount of oxygen in the earth's atmosphere is produced by Phytoplankton through Photosynthesis. The single-celled Emiliana Huxleyi is the most commonly known specie of Coccolithophorids and is known for extracting bicarbonate (HCO3) from its environment and producing calcium carbonate to form Coccoliths. Coccolithophorids are one of the world's primary producers, contributing about 15% of the average oceanic phytoplankton biomass to the oceans. They produce elaborate, minute calcite platelets (Coccoliths), covering the cell to form a Coccosphere and supplying up to 60% of the bulk pelagic calcite deposited on the sea floors. In order to understand the genetics of Coccolithophorid and the complexities of their biochemical reactions, we decided to build a database to store a complete profile of these organisms' genomes. Although a variety of such databases currently exist, (http://www.geneservice.co.uk/home/) none have yet been developed to comprehensively address the sequencing efforts underway by the Coccolithophorid research community. This database is called CocooExpress and is available to public (http://bioinfo.csusm.edu) for both data queries and sequence contribution.

  12. CHASM and SNVBox: toolkit for detecting biologically important single nucleotide mutations in cancer.

    Science.gov (United States)

    Wong, Wing Chung; Kim, Dewey; Carter, Hannah; Diekhans, Mark; Ryan, Michael C; Karchin, Rachel

    2011-08-01

    Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. MySQL database, source code and binaries freely available for academic/government use at http://wiki.chasmsoftware.org, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python 5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM.

  13. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  14. High Performance Protein Sequence Database Scanning on the Cell Broadband Engine

    Directory of Open Access Journals (Sweden)

    Adrianto Wirawan

    2009-01-01

    Full Text Available The enormous growth of biological sequence databases has caused bioinformatics to be rapidly moving towards a data-intensive, computational science. As a result, the computational power needed by bioinformatics applications is growing rapidly as well. The recent emergence of low cost parallel multicore accelerator technologies has made it possible to reduce execution times of many bioinformatics applications. In this paper, we demonstrate how the Cell Broadband Engine can be used as a computational platform to accelerate two approaches for protein sequence database scanning: exhaustive and heuristic. We present efficient parallelization techniques for two representative algorithms: the dynamic programming based Smith–Waterman algorithm and the popular BLASTP heuristic. Their implementation on a Playstation®3 leads to significant runtime savings compared to corresponding sequential implementations.

  15. Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

    Science.gov (United States)

    Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

    2003-01-01

    A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

  16. The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

    2009-01-01

    The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

  17. Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V

    Energy Technology Data Exchange (ETDEWEB)

    Myers, G.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States); Wain-Hobson, S. [ed.] [Laboratory of Molecular Retrovirology, Pasteur Inst.; Smith, R.F. [ed.] [Baylor Coll. of Medicine, Houston, TX (United States). Dept. of Pharmacology; Pavlakis, G.N. [ed.] [National Cancer Inst., Frederick, MD (United States). Cancer Research Facility

    1993-12-31

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

  18. Bioinformatic Analysis of Deleterious Non-Synonymous Single Nucleotide Polymorphisms (nsSNPs in the Coding Regions of Human Prion Protein Gene (PRNP

    Directory of Open Access Journals (Sweden)

    Kourosh Bamdad

    2016-12-01

    Full Text Available Background & Objective: Single nucleotide polymorphisms are the cause of genetic variation to living organisms. Single nucleotide polymorphisms alter residues in the protein sequence. In this investigation, the relationship between prion protein gene polymorphisms and its relevance to pathogenicity was studied. Material & Method: Amino acid sequence of the main isoform from the human prion protein gene (PRNP was extracted from UniProt database and evaluated by FoldAmyloid and AmylPred servers. All non-synonymous single nucleotide polymorphisms (nsSNPs from SNP database (dbSNP were further analyzed by bioinformatics servers including SIFT, PolyPhen-2, I-Mutant-3.0, PANTHER, SNPs & GO, PHD-SNP, Meta-SNP, and MutPred to determine the most damaging nsSNPs. Results: The results of the first structure analyses by FoldAmyloid and AmylPerd servers implied that regions including 5-15, 174-178, 180-184, 211-217, and 240-252 were the most sensitive parts of the protein sequence to amyloidosis. Screening all nsSNPs of the main protein isoform using bioinformatic servers revealed that substitution of Aspartic acid with Valine at position 178 (ID code: rs11538766 was the most deleterious nsSNP in the protein structure. Conclusion:  Substitution of the Aspartic acid with Valine at position 178 (D178V was the most pathogenic mutation in the human prion protein gene. Analyses from the MutPred server also showed that beta-sheets’ increment in the secondary structure was the main reason behind the molecular mechanism of the prion protein aggregation.

  19. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  20. Faster Smith-Waterman database searches with inter-sequence SIMD parallelisation.

    Science.gov (United States)

    Rognes, Torbjørn

    2011-06-01

    The Smith-Waterman algorithm for local sequence alignment is more sensitive than heuristic methods for database searching, but also more time-consuming. The fastest approach to parallelisation with SIMD technology has previously been described by Farrar in 2007. The aim of this study was to explore whether further speed could be gained by other approaches to parallelisation. A faster approach and implementation is described and benchmarked. In the new tool SWIPE, residues from sixteen different database sequences are compared in parallel to one query residue. Using a 375 residue query sequence a speed of 106 billion cell updates per second (GCUPS) was achieved on a dual Intel Xeon X5650 six-core processor system, which is over six times more rapid than software based on Farrar's 'striped' approach. SWIPE was about 2.5 times faster when the programs used only a single thread. For shorter queries, the increase in speed was larger. SWIPE was about twice as fast as BLAST when using the BLOSUM50 score matrix, while BLAST was about twice as fast as SWIPE for the BLOSUM62 matrix. The software is designed for 64 bit Linux on processors with SSSE3. Source code is available from http://dna.uio.no/swipe/ under the GNU Affero General Public License. Efficient parallelisation using SIMD on standard hardware makes it possible to run Smith-Waterman database searches more than six times faster than before. The approach described here could significantly widen the potential application of Smith-Waterman searches. Other applications that require optimal local alignment scores could also benefit from improved performance.

  1. The need for high-quality whole-genome sequence databases in microbial forensics.

    Science.gov (United States)

    Sjödin, Andreas; Broman, Tina; Melefors, Öjar; Andersson, Gunnar; Rasmusson, Birgitta; Knutsson, Rickard; Forsman, Mats

    2013-09-01

    Microbial forensics is an important part of a strengthened capability to respond to biocrime and bioterrorism incidents to aid in the complex task of distinguishing between natural outbreaks and deliberate acts. The goal of a microbial forensic investigation is to identify and criminally prosecute those responsible for a biological attack, and it involves a detailed analysis of the weapon--that is, the pathogen. The recent development of next-generation sequencing (NGS) technologies has greatly increased the resolution that can be achieved in microbial forensic analyses. It is now possible to identify, quickly and in an unbiased manner, previously undetectable genome differences between closely related isolates. This development is particularly relevant for the most deadly bacterial diseases that are caused by bacterial lineages with extremely low levels of genetic diversity. Whole-genome analysis of pathogens is envisaged to be increasingly essential for this purpose. In a microbial forensic context, whole-genome sequence analysis is the ultimate method for strain comparisons as it is informative during identification, characterization, and attribution--all 3 major stages of the investigation--and at all levels of microbial strain identity resolution (ie, it resolves the full spectrum from family to isolate). Given these capabilities, one bottleneck in microbial forensics investigations is the availability of high-quality reference databases of bacterial whole-genome sequences. To be of high quality, databases need to be curated and accurate in terms of sequences, metadata, and genetic diversity coverage. The development of whole-genome sequence databases will be instrumental in successfully tracing pathogens in the future.

  2. Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

    Science.gov (United States)

    Wolf, P

    1997-10-01

    Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

  3. Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

    Science.gov (United States)

    Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

    2010-09-01

    The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  4. Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.

    Directory of Open Access Journals (Sweden)

    Peter Norberg

    Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

  5. The proviral genome of radiation leukemia virus: Molecular cloning, nucleotide sequence of its long terminal repeat and integration in lymphoma cell DNA

    International Nuclear Information System (INIS)

    Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.

    1985-01-01

    The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy

  6. A Public Database of Memory and Naive B-Cell Receptor Sequences.

    Directory of Open Access Journals (Sweden)

    William S DeWitt

    Full Text Available The vast diversity of B-cell receptors (BCR and secreted antibodies enables the recognition of, and response to, a wide range of epitopes, but this diversity has also limited our understanding of humoral immunity. We present a public database of more than 37 million unique BCR sequences from three healthy adult donors that is many fold deeper than any existing resource, together with a set of online tools designed to facilitate the visualization and analysis of the annotated data. We estimate the clonal diversity of the naive and memory B-cell repertoires of healthy individuals, and provide a set of examples that illustrate the utility of the database, including several views of the basic properties of immunoglobulin heavy chain sequences, such as rearrangement length, subunit usage, and somatic hypermutation positions and dynamics.

  7. A Public Database of Memory and Naive B-Cell Receptor Sequences.

    Science.gov (United States)

    DeWitt, William S; Lindau, Paul; Snyder, Thomas M; Sherwood, Anna M; Vignali, Marissa; Carlson, Christopher S; Greenberg, Philip D; Duerkopp, Natalie; Emerson, Ryan O; Robins, Harlan S

    2016-01-01

    The vast diversity of B-cell receptors (BCR) and secreted antibodies enables the recognition of, and response to, a wide range of epitopes, but this diversity has also limited our understanding of humoral immunity. We present a public database of more than 37 million unique BCR sequences from three healthy adult donors that is many fold deeper than any existing resource, together with a set of online tools designed to facilitate the visualization and analysis of the annotated data. We estimate the clonal diversity of the naive and memory B-cell repertoires of healthy individuals, and provide a set of examples that illustrate the utility of the database, including several views of the basic properties of immunoglobulin heavy chain sequences, such as rearrangement length, subunit usage, and somatic hypermutation positions and dynamics.

  8. Gene Unprediction with Spurio: A tool to identify spurious protein sequences.

    Science.gov (United States)

    Höps, Wolfram; Jeffryes, Matt; Bateman, Alex

    2018-01-01

    We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation.  Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases.  We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes.  Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.

  9. Combining next-generation sequencing and online databases for microsatellite development in non-model organisms.

    Science.gov (United States)

    Rico, Ciro; Normandeau, Eric; Dion-Côté, Anne-Marie; Rico, María Inés; Côté, Guillaume; Bernatchez, Louis

    2013-12-03

    Next-generation sequencing (NGS) is revolutionising marker development and the rapidly increasing amount of transcriptomes published across a wide variety of taxa is providing valuable sequence databases for the identification of genetic markers without the need to generate new sequences. Microsatellites are still the most important source of polymorphic markers in ecology and evolution. Motivated by our long-term interest in the adaptive radiation of a non-model species complex of whitefishes (Coregonus spp.), in this study, we focus on microsatellite characterisation and multiplex optimisation using transcriptome sequences generated by Illumina® and Roche-454, as well as online databases of Expressed Sequence Tags (EST) for the study of whitefish evolution and demographic history. We identified and optimised 40 polymorphic loci in multiplex PCR reactions and validated the robustness of our analyses by testing several population genetics and phylogeographic predictions using 494 fish from five lakes and 2 distinct ecotypes.

  10. Faster Smith-Waterman database searches with inter-sequence SIMD parallelisation

    Directory of Open Access Journals (Sweden)

    Rognes Torbjørn

    2011-06-01

    Full Text Available Abstract Background The Smith-Waterman algorithm for local sequence alignment is more sensitive than heuristic methods for database searching, but also more time-consuming. The fastest approach to parallelisation with SIMD technology has previously been described by Farrar in 2007. The aim of this study was to explore whether further speed could be gained by other approaches to parallelisation. Results A faster approach and implementation is described and benchmarked. In the new tool SWIPE, residues from sixteen different database sequences are compared in parallel to one query residue. Using a 375 residue query sequence a speed of 106 billion cell updates per second (GCUPS was achieved on a dual Intel Xeon X5650 six-core processor system, which is over six times more rapid than software based on Farrar's 'striped' approach. SWIPE was about 2.5 times faster when the programs used only a single thread. For shorter queries, the increase in speed was larger. SWIPE was about twice as fast as BLAST when using the BLOSUM50 score matrix, while BLAST was about twice as fast as SWIPE for the BLOSUM62 matrix. The software is designed for 64 bit Linux on processors with SSSE3. Source code is available from http://dna.uio.no/swipe/ under the GNU Affero General Public License. Conclusions Efficient parallelisation using SIMD on standard hardware makes it possible to run Smith-Waterman database searches more than six times faster than before. The approach described here could significantly widen the potential application of Smith-Waterman searches. Other applications that require optimal local alignment scores could also benefit from improved performance.

  11. HIVBrainSeqDB: a database of annotated HIV envelope sequences from brain and other anatomical sites

    Directory of Open Access Journals (Sweden)

    O'Connor Niall

    2010-12-01

    Full Text Available Abstract Background The population of HIV replicating within a host consists of independently evolving and interacting sub-populations that can be genetically distinct within anatomical compartments. HIV replicating within the brain causes neurocognitive disorders in up to 20-30% of infected individuals and is a viral sanctuary site for the development of drug resistance. The primary determinant of HIV neurotropism is macrophage tropism, which is primarily determined by the viral envelope (env gene. However, studies of genetic aspects of HIV replicating in the brain are hindered because existing repositories of HIV sequences are not focused on neurotropic virus nor annotated with neurocognitive and neuropathological status. To address this need, we constructed the HIV Brain Sequence Database. Results The HIV Brain Sequence Database is a public database of HIV envelope sequences, directly sequenced from brain and other tissues from the same patients. Sequences are annotated with clinical data including viral load, CD4 count, antiretroviral status, neurocognitive impairment, and neuropathological diagnosis, all curated from the original publication. Tissue source is coded using an anatomical ontology, the Foundational Model of Anatomy, to capture the maximum level of detail available, while maintaining ontological relationships between tissues and their subparts. 44 tissue types are represented within the database, grouped into 4 categories: (i brain, brainstem, and spinal cord; (ii meninges, choroid plexus, and CSF; (iii blood and lymphoid; and (iv other (bone marrow, colon, lung, liver, etc. Patient coding is correlated across studies, allowing sequences from the same patient to be grouped to increase statistical power. Using Cytoscape, we visualized relationships between studies, patients and sequences, illustrating interconnections between studies and the varying depth of sequencing, patient number, and tissue representation across studies

  12. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  13. Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Dunez, J

    1988-02-01

    Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

  14. Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

    Directory of Open Access Journals (Sweden)

    Jacqueline Morris

    2017-12-01

    Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

  15. Quality standards for DNA sequence variation databases to improve clinical management under development in Australia

    Directory of Open Access Journals (Sweden)

    B. Bennetts

    2014-09-01

    Full Text Available Despite the routine nature of comparing sequence variations identified during clinical testing to database records, few databases meet quality requirements for clinical diagnostics. To address this issue, The Royal College of Pathologists of Australasia (RCPA in collaboration with the Human Genetics Society of Australasia (HGSA, and the Human Variome Project (HVP is developing standards for DNA sequence variation databases intended for use in the Australian clinical environment. The outputs of this project will be promoted to other health systems and accreditation bodies by the Human Variome Project to support the development of similar frameworks in other jurisdictions.

  16. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  17. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  18. SeqHound: biological sequence and structure database as a platform for bioinformatics research

    Directory of Open Access Journals (Sweden)

    Dumontier Michel

    2002-10-01

    Full Text Available Abstract Background SeqHound has been developed as an integrated biological sequence, taxonomy, annotation and 3-D structure database system. It provides a high-performance server platform for bioinformatics research in a locally-hosted environment. Results SeqHound is based on the National Center for Biotechnology Information data model and programming tools. It offers daily updated contents of all Entrez sequence databases in addition to 3-D structural data and information about sequence redundancies, sequence neighbours, taxonomy, complete genomes, functional annotation including Gene Ontology terms and literature links to PubMed. SeqHound is accessible via a web server through a Perl, C or C++ remote API or an optimized local API. It provides functionality necessary to retrieve specialized subsets of sequences, structures and structural domains. Sequences may be retrieved in FASTA, GenBank, ASN.1 and XML formats. Structures are available in ASN.1, XML and PDB formats. Emphasis has been placed on complete genomes, taxonomy, domain and functional annotation as well as 3-D structural functionality in the API, while fielded text indexing functionality remains under development. SeqHound also offers a streamlined WWW interface for simple web-user queries. Conclusions The system has proven useful in several published bioinformatics projects such as the BIND database and offers a cost-effective infrastructure for research. SeqHound will continue to develop and be provided as a service of the Blueprint Initiative at the Samuel Lunenfeld Research Institute. The source code and examples are available under the terms of the GNU public license at the Sourceforge site http://sourceforge.net/projects/slritools/ in the SLRI Toolkit.

  19. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  20. DSAP: deep-sequencing small RNA analysis pipeline.

    Science.gov (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  1. FishPathogens.eu/vhsv: a user-friendly viral haemorrhagic septicaemia virus isolate and sequence database

    DEFF Research Database (Denmark)

    Jonstrup, Søren Peter; Gray, Tanya; Kahns, Søren

    2009-01-01

    A database has been created, http://www.Fish Pathogens.eu, with the aim of providing a single repository for collating important information on significant pathogens of aquaculture, relevant to their control and management. This database will be developed, maintained and managed as part of the Eu......A database has been created, http://www.Fish Pathogens.eu, with the aim of providing a single repository for collating important information on significant pathogens of aquaculture, relevant to their control and management. This database will be developed, maintained and managed as part...... of the European Community Reference Laboratory for Fish Diseases function. This concept has been initially developed for viral haemorrhagic septicaemia virus and will be extended in future to include information on other significant aquaculture pathogens. Information included for each isolate comprises sequence...... to obtain data from any selected part of the genome of interest. The output of the sequence search can be readily retrieved as a FASTA file ready to be imported into a sequence alignment tool of choice, facilitating further molecular epidemiological study....

  2. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  3. The diploid genome sequence of an Asian individual

    DEFF Research Database (Denmark)

    Wang, Jun; Wang, Wei; Li, Ruiqiang

    2008-01-01

    Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we...... used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP...... identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J...

  4. License - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project License to Use This Database Last updated : 2010/02/15 You may use this databas...ional License described below. The Standard License specifies the license terms regarding the use of this database... and the requirements you must follow in using this database. The Additiona...n the Standard License. Standard License The Standard License for this database is the license specified in ...the Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database

  5. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  6. Next-generation sequencing can reveal in vitro-generated PCR crossover products: some artifactual sequences correspond to HLA alleles in the IMGT/HLA database.

    Science.gov (United States)

    Holcomb, C L; Rastrou, M; Williams, T C; Goodridge, D; Lazaro, A M; Tilanus, M; Erlich, H A

    2014-01-01

    The high-resolution human leukocyte antigen (HLA) genotyping assay that we developed using 454 sequencing and Conexio software uses generic polymerase chain reaction (PCR) primers for DRB exon 2. Occasionally, we observed low abundance DRB amplicon sequences that resulted from in vitro PCR 'crossing over' between DRB1 and DRB3/4/5. These hybrid sequences, revealed by the clonal sequencing property of the 454 system, were generally observed at a read depth of 5%-10% of the true alleles. They usually contained at least one mismatch with the IMGT/HLA database, and consequently, were easily recognizable and did not cause a problem for HLA genotyping. Sometimes, however, these artifactual sequences matched a rare allele and the automatic genotype assignment was incorrect. These observations raised two issues: (1) could PCR conditions be modified to reduce such artifacts? and (2) could some of the rare alleles listed in the IMGT/HLA database be artifacts rather than true alleles? Because PCR crossing over occurs during late cycles of PCR, we compared DRB genotypes resulting from 28 and (our standard) 35 cycles of PCR. For all 21 cell line DNAs amplified for 35 cycles, crossover products were detected. In 33% of the cases, these hybrid sequences corresponded to named alleles. With amplification for only 28 cycles, these artifactual sequences were not detectable. To investigate whether some rare alleles in the IMGT/HLA database might be due to PCR artifacts, we analyzed four samples obtained from the investigators who submitted the sequences. In three cases, the sequences were generated from true alleles. In one case, our 454 sequencing revealed an error in the previously submitted sequence. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  7. E2FM: an encrypted and compressed full-text index for collections of genomic sequences.

    Science.gov (United States)

    Montecuollo, Ferdinando; Schmid, Giovannni; Tagliaferri, Roberto

    2017-09-15

    Next Generation Sequencing (NGS) platforms and, more generally, high-throughput technologies are giving rise to an exponential growth in the size of nucleotide sequence databases. Moreover, many emerging applications of nucleotide datasets-as those related to personalized medicine-require the compliance with regulations about the storage and processing of sensitive data. We have designed and carefully engineered E 2 FM -index, a new full-text index in minute space which was optimized for compressing and encrypting nucleotide sequence collections in FASTA format and for performing fast pattern-search queries. E 2 FM -index allows to build self-indexes which occupy till to 1/20 of the storage required by the input FASTA file, thus permitting to save about 95% of storage when indexing collections of highly similar sequences; moreover, it can exactly search the built indexes for patterns in times ranging from few milliseconds to a few hundreds milliseconds, depending on pattern length. Source code is available at https://github.com/montecuollo/E2FM . ferdinando.montecuollo@unicampania.it. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  8. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR.

    Science.gov (United States)

    D'Souza, T M; Boominathan, K; Reddy, C A

    1996-01-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. PMID:8837429

  9. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  10. Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

    NARCIS (Netherlands)

    Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

    2005-01-01

    The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

  11. Short sequence motifs, overrepresented in mammalian conservednon-coding sequences

    Energy Technology Data Exchange (ETDEWEB)

    Minovitsky, Simon; Stegmaier, Philip; Kel, Alexander; Kondrashov,Alexey S.; Dubchak, Inna

    2007-02-21

    Background: A substantial fraction of non-coding DNAsequences of multicellular eukaryotes is under selective constraint. Inparticular, ~;5 percent of the human genome consists of conservednon-coding sequences (CNSs). CNSs differ from other genomic sequences intheir nucleotide composition and must play important functional roles,which mostly remain obscure.Results: We investigated relative abundancesof short sequence motifs in all human CNSs present in the human/mousewhole-genome alignments vs. three background sets of sequences: (i)weakly conserved or unconserved non-coding sequences (non-CNSs); (ii)near-promoter sequences (located between nucleotides -500 and -1500,relative to a start of transcription); and (iii) random sequences withthe same nucleotide composition as that of CNSs. When compared tonon-CNSs and near-promoter sequences, CNSs possess an excess of AT-richmotifs, often containing runs of identical nucleotides. In contrast, whencompared to random sequences, CNSs contain an excess of GC-rich motifswhich, however, lack CpG dinucleotides. Thus, abundance of short sequencemotifs in human CNSs, taken as a whole, is mostly determined by theiroverall compositional properties and not by overrepresentation of anyspecific short motifs. These properties are: (i) high AT-content of CNSs,(ii) a tendency, probably due to context-dependent mutation, of A's andT's to clump, (iii) presence of short GC-rich regions, and (iv) avoidanceof CpG contexts, due to their hypermutability. Only a small number ofshort motifs, overrepresented in all human CNSs are similar to bindingsites of transcription factors from the FOX family.Conclusion: Human CNSsas a whole appear to be too broad a class of sequences to possess strongfootprints of any short sequence-specific functions. Such footprintsshould be studied at the level of functional subclasses of CNSs, such asthose which flank genes with a particular pattern of expression. Overallproperties of CNSs are affected by

  12. Artemis and ACT: viewing, annotating and comparing sequences stored in a relational database.

    Science.gov (United States)

    Carver, Tim; Berriman, Matthew; Tivey, Adrian; Patel, Chinmay; Böhme, Ulrike; Barrell, Barclay G; Parkhill, Julian; Rajandream, Marie-Adèle

    2008-12-01

    Artemis and Artemis Comparison Tool (ACT) have become mainstream tools for viewing and annotating sequence data, particularly for microbial genomes. Since its first release, Artemis has been continuously developed and supported with additional functionality for editing and analysing sequences based on feedback from an active user community of laboratory biologists and professional annotators. Nevertheless, its utility has been somewhat restricted by its limitation to reading and writing from flat files. Therefore, a new version of Artemis has been developed, which reads from and writes to a relational database schema, and allows users to annotate more complex, often large and fragmented, genome sequences. Artemis and ACT have now been extended to read and write directly to the Generic Model Organism Database (GMOD, http://www.gmod.org) Chado relational database schema. In addition, a Gene Builder tool has been developed to provide structured forms and tables to edit coordinates of gene models and edit functional annotation, based on standard ontologies, controlled vocabularies and free text. Artemis and ACT are freely available (under a GPL licence) for download (for MacOSX, UNIX and Windows) at the Wellcome Trust Sanger Institute web sites: http://www.sanger.ac.uk/Software/Artemis/ http://www.sanger.ac.uk/Software/ACT/

  13. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Science.gov (United States)

    Leonard, Guy; Stevens, Jamie R.; Richards, Thomas A.

    2009-01-01

    The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment file, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree files (with a user-defined combination of species name and/or database accession number). Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file) and generation of species and accession number lists for use in supplementary materials or figure legends. PMID:19812722

  14. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  15. Nucleotide Sequence and Analysis of an orotate transporter-containing plasmid isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410

    DEFF Research Database (Denmark)

    Defoor, Els Marie Celine; Martinussen, Jan

    A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...

  16. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  17. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  18. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  19. Mixed Sequence Reader: A Program for Analyzing DNA Sequences with Heterozygous Base Calling

    Science.gov (United States)

    Chang, Chun-Tien; Tsai, Chi-Neu; Tang, Chuan Yi; Chen, Chun-Houh; Lian, Jang-Hau; Hu, Chi-Yu; Tsai, Chia-Lung; Chao, Angel; Lai, Chyong-Huey; Wang, Tzu-Hao; Lee, Yun-Shien

    2012-01-01

    The direct sequencing of PCR products generates heterozygous base-calling fluorescence chromatograms that are useful for identifying single-nucleotide polymorphisms (SNPs), insertion-deletions (indels), short tandem repeats (STRs), and paralogous genes. Indels and STRs can be easily detected using the currently available Indelligent or ShiftDetector programs, which do not search reference sequences. However, the detection of other genomic variants remains a challenge due to the lack of appropriate tools for heterozygous base-calling fluorescence chromatogram data analysis. In this study, we developed a free web-based program, Mixed Sequence Reader (MSR), which can directly analyze heterozygous base-calling fluorescence chromatogram data in .abi file format using comparisons with reference sequences. The heterozygous sequences are identified as two distinct sequences and aligned with reference sequences. Our results showed that MSR may be used to (i) physically locate indel and STR sequences and determine STR copy number by searching NCBI reference sequences; (ii) predict combinations of microsatellite patterns using the Federal Bureau of Investigation Combined DNA Index System (CODIS); (iii) determine human papilloma virus (HPV) genotypes by searching current viral databases in cases of double infections; (iv) estimate the copy number of paralogous genes, such as β-defensin 4 (DEFB4) and its paralog HSPDP3. PMID:22778697

  20. Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

    2016-09-01

    Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

  1. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    Science.gov (United States)

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  2. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  3. Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

    Science.gov (United States)

    Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

    2012-10-01

    To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

  4. MSDB: A Comprehensive Database of Simple Sequence Repeats.

    Science.gov (United States)

    Avvaru, Akshay Kumar; Saxena, Saketh; Sowpati, Divya Tej; Mishra, Rakesh Kumar

    2017-06-01

    Microsatellites, also known as Simple Sequence Repeats (SSRs), are short tandem repeats of 1-6 nt motifs present in all genomes, particularly eukaryotes. Besides their usefulness as genome markers, SSRs have been shown to perform important regulatory functions, and variations in their length at coding regions are linked to several disorders in humans. Microsatellites show a taxon-specific enrichment in eukaryotic genomes, and some may be functional. MSDB (Microsatellite Database) is a collection of >650 million SSRs from 6,893 species including Bacteria, Archaea, Fungi, Plants, and Animals. This database is by far the most exhaustive resource to access and analyze SSR data of multiple species. In addition to exploring data in a customizable tabular format, users can view and compare the data of multiple species simultaneously using our interactive plotting system. MSDB is developed using the Django framework and MySQL. It is freely available at http://tdb.ccmb.res.in/msdb. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

    Science.gov (United States)

    Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2014-11-01

    In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

  6. Quantum-Sequencing: Fast electronic single DNA molecule sequencing

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free, high-throughput and cost-effective, single-molecule sequencing method. Here, we present the first demonstration of unique ``electronic fingerprint'' of all nucleotides (A, G, T, C), with single-molecule DNA sequencing, using Quantum-tunneling Sequencing (Q-Seq) at room temperature. We show that the electronic state of the nucleobases shift depending on the pH, with most distinct states identified at acidic pH. We also demonstrate identification of single nucleotide modifications (methylation here). Using these unique electronic fingerprints (or tunneling data), we report a partial sequence of beta lactamase (bla) gene, which encodes resistance to beta-lactam antibiotics, with over 95% success rate. These results highlight the potential of Q-Seq as a robust technique for next-generation sequencing.

  7. Artemis and ACT: viewing, annotating and comparing sequences stored in a relational database

    Science.gov (United States)

    Carver, Tim; Berriman, Matthew; Tivey, Adrian; Patel, Chinmay; Böhme, Ulrike; Barrell, Barclay G.; Parkhill, Julian; Rajandream, Marie-Adèle

    2008-01-01

    Motivation: Artemis and Artemis Comparison Tool (ACT) have become mainstream tools for viewing and annotating sequence data, particularly for microbial genomes. Since its first release, Artemis has been continuously developed and supported with additional functionality for editing and analysing sequences based on feedback from an active user community of laboratory biologists and professional annotators. Nevertheless, its utility has been somewhat restricted by its limitation to reading and writing from flat files. Therefore, a new version of Artemis has been developed, which reads from and writes to a relational database schema, and allows users to annotate more complex, often large and fragmented, genome sequences. Results: Artemis and ACT have now been extended to read and write directly to the Generic Model Organism Database (GMOD, http://www.gmod.org) Chado relational database schema. In addition, a Gene Builder tool has been developed to provide structured forms and tables to edit coordinates of gene models and edit functional annotation, based on standard ontologies, controlled vocabularies and free text. Availability: Artemis and ACT are freely available (under a GPL licence) for download (for MacOSX, UNIX and Windows) at the Wellcome Trust Sanger Institute web sites: http://www.sanger.ac.uk/Software/Artemis/ http://www.sanger.ac.uk/Software/ACT/ Contact: artemis@sanger.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:18845581

  8. Differentiation of sheep pox and goat poxviruses by sequence analysis and PCR-RFLP of P32 gene.

    Science.gov (United States)

    Hosamani, Madhusudan; Mondal, Bimalendu; Tembhurne, Prabhakar A; Bandyopadhyay, Santanu Kumar; Singh, Raj Kumar; Rasool, Thaha Jamal

    2004-08-01

    Sheep pox and Goat pox are highly contagious viral diseases of small ruminants. These diseases were earlier thought to be caused by a single species of virus, as they are serologically indistinguishable. P32, one of the major immunogenic genes of Capripoxvirus, was isolated and Sequenced from two Indian isolates of goat poxvirus (GPV) and a vaccine strain of sheep poxvirus (SPV). The sequences were compared with other P32 sequences of capripoxviruses available in the database. Sequence analysis revealed that sheep pox and goat poxviruses share 97.5 and 94.7% homology at nucleotide and amino acid level, respectively. A major difference between them is the presence of an additional aspartic acid at 55th position of P32 of sheep poxvirus that is absent in both goat poxvirus and lumpy skin disease virus. Further, six unique neutral nucleotide substitutions were observed at positions 77, 275, 403, 552, 867 and 964 in the sequence of goat poxvirus, which can be taken as GPV signature residues. Similar unique nucleotide signatures could be identified in SPV and LSDV sequences also. Phylogenetic analysis showed that members of the Capripoxvirus could be delineated into three distinct clusters of GPV, SPV and LSDV based on the P32 genomic sequence. Using this information, a PCR-RFLP method has been developed for unequivocal genomic differentiation of SPV and GPV.

  9. Nucleotide sequence analysis of HTLV-I isolated from cerebrospinal fluid of a patient with TSP/HAM: comparison to other HTLV-I isolates.

    Science.gov (United States)

    Mukhopadhyaya, R; Sadaie, M R

    1993-02-01

    Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.

  10. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  11. Protein backbone angle restraints from searching a database for chemical shift and sequence homology

    Energy Technology Data Exchange (ETDEWEB)

    Cornilescu, Gabriel; Delaglio, Frank; Bax, Ad [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)

    1999-03-15

    Chemical shifts of backbone atoms in proteins are exquisitely sensitive to local conformation, and homologous proteins show quite similar patterns of secondary chemical shifts. The inverse of this relation is used to search a database for triplets of adjacent residues with secondary chemical shifts and sequence similarity which provide the best match to the query triplet of interest. The database contains 13C{alpha}, 13C{beta}, 13C', 1H{alpha} and 15N chemical shifts for 20 proteins for which a high resolution X-ray structure is available. The computer program TALOS was developed to search this database for strings of residues with chemical shift and residue type homology. The relative importance of the weighting factors attached to the secondary chemical shifts of the five types of resonances relative to that of sequence similarity was optimized empirically. TALOS yields the 10 triplets which have the closest similarity in secondary chemical shift and amino acid sequence to those of the query sequence. If the central residues in these 10 triplets exhibit similar {phi} and {psi} backbone angles, their averages can reliably be used as angular restraints for the protein whose structure is being studied. Tests carried out for proteins of known structure indicate that the root-mean-square difference (rmsd) between the output of TALOS and the X-ray derived backbone angles is about 15 deg. Approximately 3% of the predictions made by TALOS are found to be in error.

  12. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Directory of Open Access Journals (Sweden)

    Guy Leonard

    2009-01-01

    Full Text Available The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment fi le, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree fi les (with a user-defined combination of species name and/or database accession number. Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file and generation of species and accession number lists for use in supplementary materials or figure legends.

  13. The mining of toxin-like polypeptides from EST database by single residue distribution analysis.

    Science.gov (United States)

    Kozlov, Sergey; Grishin, Eugene

    2011-01-31

    Novel high throughput sequencing technologies require permanent development of bioinformatics data processing methods. Among them, rapid and reliable identification of encoded proteins plays a pivotal role. To search for particular protein families, the amino acid sequence motifs suitable for selective screening of nucleotide sequence databases may be used. In this work, we suggest a novel method for simplified representation of protein amino acid sequences named Single Residue Distribution Analysis, which is applicable both for homology search and database screening. Using the procedure developed, a search for amino acid sequence motifs in sea anemone polypeptides was performed, and 14 different motifs with broad and low specificity were discriminated. The adequacy of motifs for mining toxin-like sequences was confirmed by their ability to identify 100% toxin-like anemone polypeptides in the reference polypeptide database. The employment of novel motifs for the search of polypeptide toxins in Anemonia viridis EST dataset allowed us to identify 89 putative toxin precursors. The translated and modified ESTs were scanned using a special algorithm. In addition to direct comparison with the motifs developed, the putative signal peptides were predicted and homology with known structures was examined. The suggested method may be used to retrieve structures of interest from the EST databases using simple amino acid sequence motifs as templates. The efficiency of the procedure for directed search of polypeptides is higher than that of most currently used methods. Analysis of 39939 ESTs of sea anemone Anemonia viridis resulted in identification of five protein precursors of earlier described toxins, discovery of 43 novel polypeptide toxins, and prediction of 39 putative polypeptide toxin sequences. In addition, two precursors of novel peptides presumably displaying neuronal function were disclosed.

  14. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    Science.gov (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  15. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  16. Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

    Data.gov (United States)

    US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

  17. Characterization of Sri Lanka rabies virus isolates using nucleotide sequence analysis of nucleoprotein gene.

    Science.gov (United States)

    Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L

    2001-01-01

    Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.

  18. Sequence protein identification by randomized sequence database and transcriptome mass spectrometry (SPIDER-TMS): from manual to automatic application of a 'de novo sequencing' approach.

    Science.gov (United States)

    Pascale, Raffaella; Grossi, Gerarda; Cruciani, Gabriele; Mecca, Giansalvatore; Santoro, Donatello; Sarli Calace, Renzo; Falabella, Patrizia; Bianco, Giuliana

    Sequence protein identification by a randomized sequence database and transcriptome mass spectrometry software package has been developed at the University of Basilicata in Potenza (Italy) and designed to facilitate the determination of the amino acid sequence of a peptide as well as an unequivocal identification of proteins in a high-throughput manner with enormous advantages of time, economical resource and expertise. The software package is a valid tool for the automation of a de novo sequencing approach, overcoming the main limits and a versatile platform useful in the proteomic field for an unequivocal identification of proteins, starting from tandem mass spectrometry data. The strength of this software is that it is a user-friendly and non-statistical approach, so protein identification can be considered unambiguous.

  19. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Science.gov (United States)

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

    2016-03-22

    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  20. Composition-based statistics and translated nucleotide searches: Improving the TBLASTN module of BLAST

    Directory of Open Access Journals (Sweden)

    Schäffer Alejandro A

    2006-12-01

    Full Text Available Abstract Background TBLASTN is a mode of operation for BLAST that aligns protein sequences to a nucleotide database translated in all six frames. We present the first description of the modern implementation of TBLASTN, focusing on new techniques that were used to implement composition-based statistics for translated nucleotide searches. Composition-based statistics use the composition of the sequences being aligned to generate more accurate E-values, which allows for a more accurate distinction between true and false matches. Until recently, composition-based statistics were available only for protein-protein searches. They are now available as a command line option for recent versions of TBLASTN and as an option for TBLASTN on the NCBI BLAST web server. Results We evaluate the statistical and retrieval accuracy of the E-values reported by a baseline version of TBLASTN and by two variants that use different types of composition-based statistics. To test the statistical accuracy of TBLASTN, we ran 1000 searches using scrambled proteins from the mouse genome and a database of human chromosomes. To test retrieval accuracy, we modernize and adapt to translated searches a test set previously used to evaluate the retrieval accuracy of protein-protein searches. We show that composition-based statistics greatly improve the statistical accuracy of TBLASTN, at a small cost to the retrieval accuracy. Conclusion TBLASTN is widely used, as it is common to wish to compare proteins to chromosomes or to libraries of mRNAs. Composition-based statistics improve the statistical accuracy, and therefore the reliability, of TBLASTN results. The algorithms used by TBLASTN are not widely known, and some of the most important are reported here. The data used to test TBLASTN are available for download and may be useful in other studies of translated search algorithms.

  1. RICD: A rice indica cDNA database resource for rice functional genomics

    Directory of Open Access Journals (Sweden)

    Zhang Qifa

    2008-11-01

    Full Text Available Abstract Background The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Results Rice Indica cDNA Database (RICD is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. Conclusion The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  2. Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011 - 30 November 2011

    KAUST Repository

    Abreu, Aluana Gonç alves; Albaina, A.; Alpermann, Tilman J.; Apkenas, Vanessa E.; Bankhead-Dronnet, Sté phanie; Bergek, Sara; Berumen, Michael L.; Cho, Changhung; Clobert, Jean; Coulon, Auré lie; De Feraudy, D.; Estonba, Andone; Hankeln, Thomas M A; Hochkirch, Axel; Hsu, Tsaiwen; Huang, Tsurngjuhn; Irigoien, Xabier; Iriondo, Mikel; Kay, Kathleen M.; Kinitz, Tim; Kothera, Linda; Le Hé nanff, Maxime; Lieutier, Franç ois; Lourdais, Olivier; Macrini, Camila M T; Manzano, Carmen; Martin, Carine; Morris, Veronica Ruth Franco; Nanninga, Gerrit B.; Pardo, D.; Plieske, Jö rg; Pointeau, Sophie; Prestegaard, Tore; Quack, Markus; Richard, Murielle; Savage, Harry M.; Schwarcz, Kaiser D.; Shade, Jessica; Simms, Ellen L.; Solferini, Vera Nisaka; Stevens, Virginie M.; Veith, Michael W.; Wen, Meijuan; Wicker, Florian; Yost, Jenn M.; Zarraonaindia, Iratxe

    2012-01-01

    This article documents the addition of 139 microsatellite marker loci and 90 pairs of single-nucleotide polymorphism sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Aglaoctenus lagotis, Costus pulverulentus, Costus scaber, Culex pipiens, Dascyllus marginatus, Lupinus nanus Benth, Phloeomyzus passerini, Podarcis muralis, Rhododendron rubropilosum Hayata var. taiwanalpinum and Zoarces viviparus. These loci were cross-tested on the following species: Culex quinquefasciatus, Rhododendron pseudochrysanthum Hay. ssp. morii (Hay.) Yamazaki and R. pseudochrysanthum Hayata. This article also documents the addition of 48 sequencing primer pairs and 90 allele-specific primers for Engraulis encrasicolus. © 2012 Blackwell Publishing Ltd.

  3. Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011 - 30 November 2011

    KAUST Repository

    Abreu, Aluana Gonçalves

    2012-02-01

    This article documents the addition of 139 microsatellite marker loci and 90 pairs of single-nucleotide polymorphism sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Aglaoctenus lagotis, Costus pulverulentus, Costus scaber, Culex pipiens, Dascyllus marginatus, Lupinus nanus Benth, Phloeomyzus passerini, Podarcis muralis, Rhododendron rubropilosum Hayata var. taiwanalpinum and Zoarces viviparus. These loci were cross-tested on the following species: Culex quinquefasciatus, Rhododendron pseudochrysanthum Hay. ssp. morii (Hay.) Yamazaki and R. pseudochrysanthum Hayata. This article also documents the addition of 48 sequencing primer pairs and 90 allele-specific primers for Engraulis encrasicolus. © 2012 Blackwell Publishing Ltd.

  4. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  5. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  6. Filovirus RefSeq Entries: Evaluation and Selection of Filovirus Type Variants, Type Sequences, and Names

    Directory of Open Access Journals (Sweden)

    Jens H. Kuhn

    2014-09-01

    Full Text Available Sequence determination of complete or coding-complete genomes of viruses is becoming common practice for supporting the work of epidemiologists, ecologists, virologists, and taxonomists. Sequencing duration and costs are rapidly decreasing, sequencing hardware is under modification for use by non-experts, and software is constantly being improved to simplify sequence data management and analysis. Thus, analysis of virus disease outbreaks on the molecular level is now feasible, including characterization of the evolution of individual virus populations in single patients over time. The increasing accumulation of sequencing data creates a management problem for the curators of commonly used sequence databases and an entry retrieval problem for end users. Therefore, utilizing the data to their fullest potential will require setting nomenclature and annotation standards for virus isolates and associated genomic sequences. The National Center for Biotechnology Information’s (NCBI’s RefSeq is a non-redundant, curated database for reference (or type nucleotide sequence records that supplies source data to numerous other databases. Building on recently proposed templates for filovirus variant naming [ (////-], we report consensus decisions from a majority of past and currently active filovirus experts on the eight filovirus type variants and isolates to be represented in RefSeq, their final designations, and their associated sequences.

  7. Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

    DEFF Research Database (Denmark)

    Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili

    2013-01-01

    In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...

  8. Improved taxonomic assignment of human intestinal 16S rRNA sequences by a dedicated reference database

    NARCIS (Netherlands)

    Ritari, Jarmo; Salojärvi, Jarkko; Lahti, Leo; Vos, de Willem M.

    2015-01-01

    Background: Current sequencing technology enables taxonomic profiling of microbial ecosystems at high resolution and depth by using the 16S rRNA gene as a phylogenetic marker. Taxonomic assignation of newly acquired data is based on sequence comparisons with comprehensive reference databases to

  9. The mining of toxin-like polypeptides from EST database by single residue distribution analysis

    Directory of Open Access Journals (Sweden)

    Grishin Eugene

    2011-01-01

    Full Text Available Abstract Background Novel high throughput sequencing technologies require permanent development of bioinformatics data processing methods. Among them, rapid and reliable identification of encoded proteins plays a pivotal role. To search for particular protein families, the amino acid sequence motifs suitable for selective screening of nucleotide sequence databases may be used. In this work, we suggest a novel method for simplified representation of protein amino acid sequences named Single Residue Distribution Analysis, which is applicable both for homology search and database screening. Results Using the procedure developed, a search for amino acid sequence motifs in sea anemone polypeptides was performed, and 14 different motifs with broad and low specificity were discriminated. The adequacy of motifs for mining toxin-like sequences was confirmed by their ability to identify 100% toxin-like anemone polypeptides in the reference polypeptide database. The employment of novel motifs for the search of polypeptide toxins in Anemonia viridis EST dataset allowed us to identify 89 putative toxin precursors. The translated and modified ESTs were scanned using a special algorithm. In addition to direct comparison with the motifs developed, the putative signal peptides were predicted and homology with known structures was examined. Conclusions The suggested method may be used to retrieve structures of interest from the EST databases using simple amino acid sequence motifs as templates. The efficiency of the procedure for directed search of polypeptides is higher than that of most currently used methods. Analysis of 39939 ESTs of sea anemone Anemonia viridis resulted in identification of five protein precursors of earlier described toxins, discovery of 43 novel polypeptide toxins, and prediction of 39 putative polypeptide toxin sequences. In addition, two precursors of novel peptides presumably displaying neuronal function were disclosed.

  10. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  11. Gene Discovery in the Apicomplexa as Revealed by EST Sequencing and Assembly of a Comparative Gene Database

    Science.gov (United States)

    Li, Li; Brunk, Brian P.; Kissinger, Jessica C.; Pape, Deana; Tang, Keliang; Cole, Robert H.; Martin, John; Wylie, Todd; Dante, Mike; Fogarty, Steven J.; Howe, Daniel K.; Liberator, Paul; Diaz, Carmen; Anderson, Jennifer; White, Michael; Jerome, Maria E.; Johnson, Emily A.; Radke, Jay A.; Stoeckert, Christian J.; Waterston, Robert H.; Clifton, Sandra W.; Roos, David S.; Sibley, L. David

    2003-01-01

    Large-scale EST sequencing projects for several important parasites within the phylum Apicomplexa were undertaken for the purpose of gene discovery. Included were several parasites of medical importance (Plasmodium falciparum, Toxoplasma gondii) and others of veterinary importance (Eimeria tenella, Sarcocystis neurona, and Neospora caninum). A total of 55,192 ESTs, deposited into dbEST/GenBank, were included in the analyses. The resulting sequences have been clustered into nonredundant gene assemblies and deposited into a relational database that supports a variety of sequence and text searches. This database has been used to compare the gene assemblies using BLAST similarity comparisons to the public protein databases to identify putative genes. Of these new entries, ∼15%–20% represent putative homologs with a conservative cutoff of p neurona: , , , , , , , , , , , , , –, –, –, –, –. Eimeria tenella: –, –, –, –, –, –, –, –, – , –, –, –, –, –, –, –, –, –, –, –. Neospora caninum: –, –, , – , –, –.] PMID:12618375

  12. MitoSatPlant: mitochondrial microsatellites database of viridiplantae.

    Science.gov (United States)

    Kumar, Manjeet; Kapil, Aditi; Shanker, Asheesh

    2014-11-01

    Microsatellites also known as simple sequence repeats (SSRs) consist of 1-6 nucleotide long repeating units. The importance of mitochondrial SSRs (mtSSRs) in fields like population genetics, plant phylogenetics and genome mapping motivated us to develop MitoSatPlant, a repository of plant mtSSRs. It contains information for perfect, imperfect and compound SSRs mined from 92 mitochondrial genomes of green plants, available at NCBI (as of 1 Feb 2014). A total of 72,798 SSRs were found, of which PCR primers were designed for 72,495 SSRs. Among all sequences, tetranucleotide repeats (26,802) were found to be most abundant whereas hexanucleotide repeats (2751) were detected with least frequency. MitoSatPlant was developed using SQL server 2008 and can be accessed through a front end designed in ASP.Net. It is an easy to use, user-friendly database and will prove to be a useful resource for plant scientists. To the best of our knowledge MitoSatPlant is the only database available for plant mtSSRs and can be freely accessed at http://compubio.in/mitosatplant/. Copyright © 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  13. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Liu, Siyang; Huang, Shujia; Rao, Junhua

    2015-01-01

    present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

  14. JRC GMO-Amplicons: a collection of nucleic acid sequences related to genetically modified organisms.

    Science.gov (United States)

    Petrillo, Mauro; Angers-Loustau, Alexandre; Henriksson, Peter; Bonfini, Laura; Patak, Alex; Kreysa, Joachim

    2015-01-01

    The DNA target sequence is the key element in designing detection methods for genetically modified organisms (GMOs). Unfortunately this information is frequently lacking, especially for unauthorized GMOs. In addition, patent sequences are generally poorly annotated, buried in complex and extensive documentation and hard to link to the corresponding GM event. Here, we present the JRC GMO-Amplicons, a database of amplicons collected by screening public nucleotide sequence databanks by in silico determination of PCR amplification with reference methods for GMO analysis. The European Union Reference Laboratory for Genetically Modified Food and Feed (EU-RL GMFF) provides these methods in the GMOMETHODS database to support enforcement of EU legislation and GM food/feed control. The JRC GMO-Amplicons database is composed of more than 240 000 amplicons, which can be easily accessed and screened through a web interface. To our knowledge, this is the first attempt at pooling and collecting publicly available sequences related to GMOs in food and feed. The JRC GMO-Amplicons supports control laboratories in the design and assessment of GMO methods, providing inter-alia in silico prediction of primers specificity and GM targets coverage. The new tool can assist the laboratories in the analysis of complex issues, such as the detection and identification of unauthorized GMOs. Notably, the JRC GMO-Amplicons database allows the retrieval and characterization of GMO-related sequences included in patents documentation. Finally, it can help annotating poorly described GM sequences and identifying new relevant GMO-related sequences in public databases. The JRC GMO-Amplicons is freely accessible through a web-based portal that is hosted on the EU-RL GMFF website. Database URL: http://gmo-crl.jrc.ec.europa.eu/jrcgmoamplicons/. © The Author(s) 2015. Published by Oxford University Press.

  15. ORFer--retrieval of protein sequences and open reading frames from GenBank and storage into relational databases or text files.

    Science.gov (United States)

    Büssow, Konrad; Hoffmann, Steve; Sievert, Volker

    2002-12-19

    Functional genomics involves the parallel experimentation with large sets of proteins. This requires management of large sets of open reading frames as a prerequisite of the cloning and recombinant expression of these proteins. A Java program was developed for retrieval of protein and nucleic acid sequences and annotations from NCBI GenBank, using the XML sequence format. Annotations retrieved by ORFer include sequence name, organism and also the completeness of the sequence. The program has a graphical user interface, although it can be used in a non-interactive mode. For protein sequences, the program also extracts the open reading frame sequence, if available, and checks its correct translation. ORFer accepts user input in the form of single or lists of GenBank GI identifiers or accession numbers. It can be used to extract complete sets of open reading frames and protein sequences from any kind of GenBank sequence entry, including complete genomes or chromosomes. Sequences are either stored with their features in a relational database or can be exported as text files in Fasta or tabulator delimited format. The ORFer program is freely available at http://www.proteinstrukturfabrik.de/orfer. The ORFer program allows for fast retrieval of DNA sequences, protein sequences and their open reading frames and sequence annotations from GenBank. Furthermore, storage of sequences and features in a relational database is supported. Such a database can supplement a laboratory information system (LIMS) with appropriate sequence information.

  16. CpGislandEVO: A Database and Genome Browser for Comparative Evolutionary Genomics of CpG Islands

    Directory of Open Access Journals (Sweden)

    Guillermo Barturen

    2013-01-01

    Full Text Available Hypomethylated, CpG-rich DNA segments (CpG islands, CGIs are epigenome markers involved in key biological processes. Aberrant methylation is implicated in the appearance of several disorders as cancer, immunodeficiency, or centromere instability. Furthermore, methylation differences at promoter regions between human and chimpanzee strongly associate with genes involved in neurological/psychological disorders and cancers. Therefore, the evolutionary comparative analyses of CGIs can provide insights on the functional role of these epigenome markers in both health and disease. Given the lack of specific tools, we developed CpGislandEVO. Briefly, we first compile a database of statistically significant CGIs for the best assembled mammalian genome sequences available to date. Second, by means of a coupled browser front-end, we focus on the CGIs overlapping orthologous genes extracted from OrthoDB, thus ensuring the comparison between CGIs located on truly homologous genome segments. This allows comparing the main compositional features between homologous CGIs. Finally, to facilitate nucleotide comparisons, we lifted genome coordinates between assemblies from different species, which enables the analysis of sequence divergence by direct count of nucleotide substitutions and indels occurring between homologous CGIs. The resulting CpGislandEVO database, linking together CGIs and single-cytosine DNA methylation data from several mammalian species, is freely available at our website.

  17. CAZymes Analysis Toolkit (CAT): web service for searching and analyzing carbohydrate-active enzymes in a newly sequenced organism using CAZy database.

    Science.gov (United States)

    Park, Byung H; Karpinets, Tatiana V; Syed, Mustafa H; Leuze, Michael R; Uberbacher, Edward C

    2010-12-01

    The Carbohydrate-Active Enzyme (CAZy) database provides a rich set of manually annotated enzymes that degrade, modify, or create glycosidic bonds. Despite rich and invaluable information stored in the database, software tools utilizing this information for annotation of newly sequenced genomes by CAZy families are limited. We have employed two annotation approaches to fill the gap between manually curated high-quality protein sequences collected in the CAZy database and the growing number of other protein sequences produced by genome or metagenome sequencing projects. The first approach is based on a similarity search against the entire nonredundant sequences of the CAZy database. The second approach performs annotation using links or correspondences between the CAZy families and protein family domains. The links were discovered using the association rule learning algorithm applied to sequences from the CAZy database. The approaches complement each other and in combination achieved high specificity and sensitivity when cross-evaluated with the manually curated genomes of Clostridium thermocellum ATCC 27405 and Saccharophagus degradans 2-40. The capability of the proposed framework to predict the function of unknown protein domains and of hypothetical proteins in the genome of Neurospora crassa is demonstrated. The framework is implemented as a Web service, the CAZymes Analysis Toolkit, and is available at http://cricket.ornl.gov/cgi-bin/cat.cgi.

  18. FASH: A web application for nucleotides sequence search

    Directory of Open Access Journals (Sweden)

    Chew Paul

    2008-05-01

    Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

  19. The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

    Science.gov (United States)

    Khoe, Clairine V; Chung, Long H; Murray, Vincent

    2018-06-01

    The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  20. Intelligent Access to Sequence and Structure Databases (IASSD) - an interface for accessing information from major web databases.

    Science.gov (United States)

    Ganguli, Sayak; Gupta, Manoj Kumar; Basu, Protip; Banik, Rahul; Singh, Pankaj Kumar; Vishal, Vineet; Bera, Abhisek Ranjan; Chakraborty, Hirak Jyoti; Das, Sasti Gopal

    2014-01-01

    With the advent of age of big data and advances in high throughput technology accessing data has become one of the most important step in the entire knowledge discovery process. Most users are not able to decipher the query result that is obtained when non specific keywords or a combination of keywords are used. Intelligent access to sequence and structure databases (IASSD) is a desktop application for windows operating system. It is written in Java and utilizes the web service description language (wsdl) files and Jar files of E-utilities of various databases such as National Centre for Biotechnology Information (NCBI) and Protein Data Bank (PDB). Apart from that IASSD allows the user to view protein structure using a JMOL application which supports conditional editing. The Jar file is freely available through e-mail from the corresponding author.

  1. [Application of single nucleotide polymorphism-microarray and target gene sequencing in the study of genetic etiology of children with unexplained intellectual disability or developmental delay].

    Science.gov (United States)

    Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M

    2016-10-02

    Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic

  2. Unlimited Thirst for Genome Sequencing, Data Interpretation, and Database Usage in Genomic Era: The Road towards Fast-Track Crop Plant Improvement

    Directory of Open Access Journals (Sweden)

    Arun Prabhu Dhanapal

    2015-01-01

    Full Text Available The number of sequenced crop genomes and associated genomic resources is growing rapidly with the advent of inexpensive next generation sequencing methods. Databases have become an integral part of all aspects of science research, including basic and applied plant and animal sciences. The importance of databases keeps increasing as the volume of datasets from direct and indirect genomics, as well as other omics approaches, keeps expanding in recent years. The databases and associated web portals provide at a minimum a uniform set of tools and automated analysis across a wide range of crop plant genomes. This paper reviews some basic terms and considerations in dealing with crop plant databases utilization in advancing genomic era. The utilization of databases for variation analysis with other comparative genomics tools, and data interpretation platforms are well described. The major focus of this review is to provide knowledge on platforms and databases for genome-based investigations of agriculturally important crop plants. The utilization of these databases in applied crop improvement program is still being achieved widely; otherwise, the end for sequencing is not far away.

  3. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    Directory of Open Access Journals (Sweden)

    Ji-Sun Park

    2015-01-01

    Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  4. Secure and robust cloud computing for high-throughput forensic microsatellite sequence analysis and databasing.

    Science.gov (United States)

    Bailey, Sarah F; Scheible, Melissa K; Williams, Christopher; Silva, Deborah S B S; Hoggan, Marina; Eichman, Christopher; Faith, Seth A

    2017-11-01

    Next-generation Sequencing (NGS) is a rapidly evolving technology with demonstrated benefits for forensic genetic applications, and the strategies to analyze and manage the massive NGS datasets are currently in development. Here, the computing, data storage, connectivity, and security resources of the Cloud were evaluated as a model for forensic laboratory systems that produce NGS data. A complete front-to-end Cloud system was developed to upload, process, and interpret raw NGS data using a web browser dashboard. The system was extensible, demonstrating analysis capabilities of autosomal and Y-STRs from a variety of NGS instrumentation (Illumina MiniSeq and MiSeq, and Oxford Nanopore MinION). NGS data for STRs were concordant with standard reference materials previously characterized with capillary electrophoresis and Sanger sequencing. The computing power of the Cloud was implemented with on-demand auto-scaling to allow multiple file analysis in tandem. The system was designed to store resulting data in a relational database, amenable to downstream sample interpretations and databasing applications following the most recent guidelines in nomenclature for sequenced alleles. Lastly, a multi-layered Cloud security architecture was tested and showed that industry standards for securing data and computing resources were readily applied to the NGS system without disadvantageous effects for bioinformatic analysis, connectivity or data storage/retrieval. The results of this study demonstrate the feasibility of using Cloud-based systems for secured NGS data analysis, storage, databasing, and multi-user distributed connectivity. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. A curated gluten protein sequence database to support development of proteomics methods for determination of gluten in gluten-free foods.

    Science.gov (United States)

    Bromilow, Sophie; Gethings, Lee A; Buckley, Mike; Bromley, Mike; Shewry, Peter R; Langridge, James I; Clare Mills, E N

    2017-06-23

    The unique physiochemical properties of wheat gluten enable a diverse range of food products to be manufactured. However, gluten triggers coeliac disease, a condition which is treated using a gluten-free diet. Analytical methods are required to confirm if foods are gluten-free, but current immunoassay-based methods can unreliable and proteomic methods offer an alternative but require comprehensive and well annotated sequence databases which are lacking for gluten. A manually a curated database (GluPro V1.0) of gluten proteins, comprising 630 discrete unique full length protein sequences has been compiled. It is representative of the different types of gliadin and glutenin components found in gluten. An in silico comparison of their coeliac toxicity was undertaken by analysing the distribution of coeliac toxic motifs. This demonstrated that whilst the α-gliadin proteins contained more toxic motifs, these were distributed across all gluten protein sub-types. Comparison of annotations observed using a discovery proteomics dataset acquired using ion mobility MS/MS showed that more reliable identifications were obtained using the GluPro V1.0 database compared to the complete reviewed Viridiplantae database. This highlights the value of a curated sequence database specifically designed to support the proteomic workflows and the development of methods to detect and quantify gluten. We have constructed the first manually curated open-source wheat gluten protein sequence database (GluPro V1.0) in a FASTA format to support the application of proteomic methods for gluten protein detection and quantification. We have also analysed the manually verified sequences to give the first comprehensive overview of the distribution of sequences able to elicit a reaction in coeliac disease, the prevalent form of gluten intolerance. Provision of this database will improve the reliability of gluten protein identification by proteomic analysis, and aid the development of targeted mass

  6. Identification of Alternative Splice Variants Using Unique Tryptic Peptide Sequences for Database Searches.

    Science.gov (United States)

    Tran, Trung T; Bollineni, Ravi C; Strozynski, Margarita; Koehler, Christian J; Thiede, Bernd

    2017-07-07

    Alternative splicing is a mechanism in eukaryotes by which different forms of mRNAs are generated from the same gene. Identification of alternative splice variants requires the identification of peptides specific for alternative splice forms. For this purpose, we generated a human database that contains only unique tryptic peptides specific for alternative splice forms from Swiss-Prot entries. Using this database allows an easy access to splice variant-specific peptide sequences that match to MS data. Furthermore, we combined this database without alternative splice variant-1-specific peptides with human Swiss-Prot. This combined database can be used as a general database for searching of LC-MS data. LC-MS data derived from in-solution digests of two different cell lines (LNCaP, HeLa) and phosphoproteomics studies were analyzed using these two databases. Several nonalternative splice variant-1-specific peptides were found in both cell lines, and some of them seemed to be cell-line-specific. Control and apoptotic phosphoproteomes from Jurkat T cells revealed several nonalternative splice variant-1-specific peptides, and some of them showed clear quantitative differences between the two states.

  7. The Matrix Method of Representation, Analysis and Classification of Long Genetic Sequences

    Directory of Open Access Journals (Sweden)

    Ivan V. Stepanyan

    2017-01-01

    Full Text Available The article is devoted to a matrix method of comparative analysis of long nucleotide sequences by means of presenting each sequence in the form of three digital binary sequences. This method uses a set of symmetries of biochemical attributes of nucleotides. It also uses the possibility of presentation of every whole set of N-mers as one of the members of a Kronecker family of genetic matrices. With this method, a long nucleotide sequence can be visually represented as an individual fractal-like mosaic or another regular mosaic of binary type. In contrast to natural nucleotide sequences, artificial random sequences give non-regular patterns. Examples of binary mosaics of long nucleotide sequences are shown, including cases of human chromosomes and penicillins. The obtained results are then discussed.

  8. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  9. PineElm_SSRdb: a microsatellite marker database identified from genomic, chloroplast, mitochondrial and EST sequences of pineapple (Ananas comosus (L.) Merrill).

    Science.gov (United States)

    Chaudhary, Sakshi; Mishra, Bharat Kumar; Vivek, Thiruvettai; Magadum, Santoshkumar; Yasin, Jeshima Khan

    2016-01-01

    Simple Sequence Repeats or microsatellites are resourceful molecular genetic markers. There are only few reports of SSR identification and development in pineapple. Complete genome sequence of pineapple available in the public domain can be used to develop numerous novel SSRs. Therefore, an attempt was made to identify SSRs from genomic, chloroplast, mitochondrial and EST sequences of pineapple which will help in deciphering genetic makeup of its germplasm resources. A total of 359511 SSRs were identified in pineapple (356385 from genome sequence, 45 from chloroplast sequence, 249 in mitochondrial sequence and 2832 from EST sequences). The list of EST-SSR markers and their details are available in the database. PineElm_SSRdb is an open source database available for non-commercial academic purpose at http://app.bioelm.com/ with a mapping tool which can develop circular maps of selected marker set. This database will be of immense use to breeders, researchers and graduates working on Ananas spp. and to others working on cross-species transferability of markers, investigating diversity, mapping and DNA fingerprinting.

  10. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  11. Real-Time Pathogen Detection in the Era of Whole-Genome Sequencing and Big Data: Comparison of k-mer and Site-Based Methods for Inferring the Genetic Distances among Tens of Thousands of Salmonella Samples.

    Science.gov (United States)

    Pettengill, James B; Pightling, Arthur W; Baugher, Joseph D; Rand, Hugh; Strain, Errol

    2016-01-01

    The adoption of whole-genome sequencing within the public health realm for molecular characterization of bacterial pathogens has been followed by an increased emphasis on real-time detection of emerging outbreaks (e.g., food-borne Salmonellosis). In turn, large databases of whole-genome sequence data are being populated. These databases currently contain tens of thousands of samples and are expected to grow to hundreds of thousands within a few years. For these databases to be of optimal use one must be able to quickly interrogate them to accurately determine the genetic distances among a set of samples. Being able to do so is challenging due to both biological (evolutionary diverse samples) and computational (petabytes of sequence data) issues. We evaluated seven measures of genetic distance, which were estimated from either k-mer profiles (Jaccard, Euclidean, Manhattan, Mash Jaccard, and Mash distances) or nucleotide sites (NUCmer and an extended multi-locus sequence typing (MLST) scheme). When analyzing empirical data (whole-genome sequence data from 18,997 Salmonella isolates) there are features (e.g., genomic, assembly, and contamination) that cause distances inferred from k-mer profiles, which treat absent data as informative, to fail to accurately capture the distance between samples when compared to distances inferred from differences in nucleotide sites. Thus, site-based distances, like NUCmer and extended MLST, are superior in performance, but accessing the computing resources necessary to perform them may be challenging when analyzing large databases.

  12. Real-Time Pathogen Detection in the Era of Whole-Genome Sequencing and Big Data: Comparison of k-mer and Site-Based Methods for Inferring the Genetic Distances among Tens of Thousands of Salmonella Samples.

    Directory of Open Access Journals (Sweden)

    James B Pettengill

    Full Text Available The adoption of whole-genome sequencing within the public health realm for molecular characterization of bacterial pathogens has been followed by an increased emphasis on real-time detection of emerging outbreaks (e.g., food-borne Salmonellosis. In turn, large databases of whole-genome sequence data are being populated. These databases currently contain tens of thousands of samples and are expected to grow to hundreds of thousands within a few years. For these databases to be of optimal use one must be able to quickly interrogate them to accurately determine the genetic distances among a set of samples. Being able to do so is challenging due to both biological (evolutionary diverse samples and computational (petabytes of sequence data issues. We evaluated seven measures of genetic distance, which were estimated from either k-mer profiles (Jaccard, Euclidean, Manhattan, Mash Jaccard, and Mash distances or nucleotide sites (NUCmer and an extended multi-locus sequence typing (MLST scheme. When analyzing empirical data (whole-genome sequence data from 18,997 Salmonella isolates there are features (e.g., genomic, assembly, and contamination that cause distances inferred from k-mer profiles, which treat absent data as informative, to fail to accurately capture the distance between samples when compared to distances inferred from differences in nucleotide sites. Thus, site-based distances, like NUCmer and extended MLST, are superior in performance, but accessing the computing resources necessary to perform them may be challenging when analyzing large databases.

  13. Nucleotide diversity maps reveal variation in diversity among wheat genomes and chromosomes

    Directory of Open Access Journals (Sweden)

    McGuire Patrick E

    2010-12-01

    Full Text Available Abstract Background A genome-wide assessment of nucleotide diversity in a polyploid species must minimize the inclusion of homoeologous sequences into diversity estimates and reliably allocate individual haplotypes into their respective genomes. The same requirements complicate the development and deployment of single nucleotide polymorphism (SNP markers in polyploid species. We report here a strategy that satisfies these requirements and deploy it in the sequencing of genes in cultivated hexaploid wheat (Triticum aestivum, genomes AABBDD and wild tetraploid wheat (Triticum turgidum ssp. dicoccoides, genomes AABB from the putative site of wheat domestication in Turkey. Data are used to assess the distribution of diversity among and within wheat genomes and to develop a panel of SNP markers for polyploid wheat. Results Nucleotide diversity was estimated in 2114 wheat genes and was similar between the A and B genomes and reduced in the D genome. Within a genome, diversity was diminished on some chromosomes. Low diversity was always accompanied by an excess of rare alleles. A total of 5,471 SNPs was discovered in 1791 wheat genes. Totals of 1,271, 1,218, and 2,203 SNPs were discovered in 488, 463, and 641 genes of wheat putative diploid ancestors, T. urartu, Aegilops speltoides, and Ae. tauschii, respectively. A public database containing genome-specific primers, SNPs, and other information was constructed. A total of 987 genes with nucleotide diversity estimated in one or more of the wheat genomes was placed on an Ae. tauschii genetic map, and the map was superimposed on wheat deletion-bin maps. The agreement between the maps was assessed. Conclusions In a young polyploid, exemplified by T. aestivum, ancestral species are the primary source of genetic diversity. Low effective recombination due to self-pollination and a genetic mechanism precluding homoeologous chromosome pairing during polyploid meiosis can lead to the loss of diversity from large

  14. RANDNA: a random DNA sequence generator.

    Science.gov (United States)

    Piva, Francesco; Principato, Giovanni

    2006-01-01

    Monte Carlo simulations are useful to verify the significance of data. Genomic regularities, such as the nucleotide correlations or the not uniform distribution of the motifs throughout genomic or mature mRNA sequences, exist and their significance can be checked by means of the Monte Carlo test. The test needs good quality random sequences in order to work, moreover they should have the same nucleotide distribution as the sequences in which the regularities have been found. Random DNA sequences are also useful to estimate the background score of an alignment, that is a threshold below which the resulting score is merely due to chance. We have developed RANDNA, a free software which allows to produce random DNA or RNA sequences setting both their length and the percentage of nucleotide composition. Sequences having the same nucleotide distribution of exonic, intronic or intergenic sequences can be generated. Its graphic interface makes it possible to easily set the parameters that characterize the sequences being produced and saved in a text format file. The pseudo-random number generator function of Borland Delphi 6 is used, since it guarantees a good randomness, a long cycle length and a high speed. We have checked the quality of sequences generated by the software, by means of well-known tests, both by themselves and versus genuine random sequences. We show the good quality of the generated sequences. The software, complete with examples and documentation, is freely available to users from: http://www.introni.it/en/software.

  15. An Internet-Accessible DNA Sequence Database for Identifying Fusaria from Human and Animal Infections

    Science.gov (United States)

    Because less than one-third of clinically relevant fusaria can be accurately identified to species level using phenotypic data (i.e., morphological species recognition), we constructed a three-locus DNA sequence database to facilitate molecular identification of the 69 Fusarium species associated wi...

  16. Mason: a JavaScript web site widget for visualizing and comparing annotated features in nucleotide or protein sequences.

    Science.gov (United States)

    Jaschob, Daniel; Davis, Trisha N; Riffle, Michael

    2015-03-07

    Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.

  17. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    Science.gov (United States)

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui

    2012-10-01

    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  19. The MAR databases: development and implementation of databases specific for marine metagenomics.

    Science.gov (United States)

    Klemetsen, Terje; Raknes, Inge A; Fu, Juan; Agafonov, Alexander; Balasundaram, Sudhagar V; Tartari, Giacomo; Robertsen, Espen; Willassen, Nils P

    2018-01-04

    We introduce the marine databases; MarRef, MarDB and MarCat (https://mmp.sfb.uit.no/databases/), which are publicly available resources that promote marine research and innovation. These data resources, which have been implemented in the Marine Metagenomics Portal (MMP) (https://mmp.sfb.uit.no/), are collections of richly annotated and manually curated contextual (metadata) and sequence databases representing three tiers of accuracy. While MarRef is a database for completely sequenced marine prokaryotic genomes, which represent a marine prokaryote reference genome database, MarDB includes all incomplete sequenced prokaryotic genomes regardless level of completeness. The last database, MarCat, represents a gene (protein) catalog of uncultivable (and cultivable) marine genes and proteins derived from marine metagenomics samples. The first versions of MarRef and MarDB contain 612 and 3726 records, respectively. Each record is built up of 106 metadata fields including attributes for sampling, sequencing, assembly and annotation in addition to the organism and taxonomic information. Currently, MarCat contains 1227 records with 55 metadata fields. Ontologies and controlled vocabularies are used in the contextual databases to enhance consistency. The user-friendly web interface lets the visitors browse, filter and search in the contextual databases and perform BLAST searches against the corresponding sequence databases. All contextual and sequence databases are freely accessible and downloadable from https://s1.sfb.uit.no/public/mar/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

    Science.gov (United States)

    Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

    2018-03-01

    Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

  1. Aminoacyl-tRNA synthetases database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewski, J

    2000-01-01

    The aminoacyl-tRNA synthetases (AARS) are a diverse group of enzymes that ensure the fidelity of transfer of genetic information from DNA into protein. They catalyse the attachment of amino acids to transfer RNAs and thereby establish the rules of the genetic code by virtue of matching the nucleotide triplet of the anticodon with its cognate amino acid. Currently, 818 AARS primary structures have been reported from archaebacteria, eubacteria, mitochondria, chloro-plasts and eukaryotic cells. The database is a compilation of the amino acid sequences of all AARSs, known to date, which are available as separate entries or alignments of related proteins via the WWW at http://rose.man.poznan.pl/aars/index.html

  2. Permanent genetic resources added to molecular ecology resources database 1 june 2011–31 july 2011

    DEFF Research Database (Denmark)

    Barker, F. Keith; Bell, James J.; Bogdanowicz, Steven M.

    2011-01-01

    This article documents the addition of 112 microsatellite marker loci and 24 pairs of single nucleotide polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Agelaius phoeniceus, Austrolittorina cincta, Circus cyaneus......, Circus macrourus, Circus pygargus, Cryptocoryne · purpurea Ridl. nothovar. purpurea, Mya arenaria, Patagioenas squamosa, Prochilodus mariae, Scylla serrata and Scytalopus speluncae. These loci were cross-tested on the following species: Cryptocoryne · purpurea nothovar. purpurea, Cryptocoryne affinis...

  3. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    Science.gov (United States)

    Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

    2016-01-01

    Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  4. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Directory of Open Access Journals (Sweden)

    Huaiyong Luo

    Full Text Available The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  5. Genome-Wide Analysis of Simple Sequence Repeats and Efficient Development of Polymorphic SSR Markers Based on Whole Genome Re-Sequencing of Multiple Isolates of the Wheat Stripe Rust Fungus.

    Science.gov (United States)

    Luo, Huaiyong; Wang, Xiaojie; Zhan, Gangming; Wei, Guorong; Zhou, Xinli; Zhao, Jing; Huang, Lili; Kang, Zhensheng

    2015-01-01

    The biotrophic parasitic fungus Puccinia striiformis f. sp. tritici (Pst) causes stripe rust, a devastating disease of wheat, endangering global food security. Because the Pst population is highly dynamic, it is difficult to develop wheat cultivars with durable and highly effective resistance. Simple sequence repeats (SSRs) are widely used as molecular markers in genetic studies to determine population structure in many organisms. However, only a small number of SSR markers have been developed for Pst. In this study, a total of 4,792 SSR loci were identified using the whole genome sequences of six isolates from different regions of the world, with a marker density of one SSR per 22.95 kb. The majority of the SSRs were di- and tri-nucleotide repeats. A database containing 1,113 SSR markers were established. Through in silico comparison, the previously reported SSR markers were found mainly in exons, whereas the SSR markers in the database were mostly in intergenic regions. Furthermore, 105 polymorphic SSR markers were confirmed in silico by their identical positions and nucleotide variations with INDELs identified among the six isolates. When 104 in silico polymorphic SSR markers were used to genotype 21 Pst isolates, 84 produced the target bands, and 82 of them were polymorphic and revealed the genetic relationships among the isolates. The results show that whole genome re-sequencing of multiple isolates provides an ideal resource for developing SSR markers, and the newly developed SSR markers are useful for genetic and population studies of the wheat stripe rust fungus.

  6. Identification of Known and Novel Recurrent Viral Sequences in Data from Multiple Patients and Multiple Cancers

    DEFF Research Database (Denmark)

    Friis-Nielsen, Jens; Kjartansdóttir, Kristín Rós; Mollerup, Sarah

    2016-01-01

    non-template controls, and 24 test samples. Recurrent sequences were statistically associated to biological, methodological or technical features with the aim to identify novel pathogens or plausible contaminants that may associate to a particular kit or method. We provide examples of identified......Virus discovery from high throughput sequencing data often follows a bottom-up approach where taxonomic annotation takes place prior to association to disease. Albeit effective in some cases, the approach fails to detect novel pathogens and remote variants not present in reference databases. We...... have developed a species independent pipeline that utilises sequence clustering for the identification of nucleotide sequences that co-occur across multiple sequencing data instances. We applied the workflow to 686 sequencing libraries from 252 cancer samples of different cancer and tissue types, 32...

  7. MPID-T2: a database for sequence-structure-function analyses of pMHC and TR/pMHC structures.

    Science.gov (United States)

    Khan, Javed Mohammed; Cheruku, Harish Reddy; Tong, Joo Chuan; Ranganathan, Shoba

    2011-04-15

    Sequence-structure-function information is critical in understanding the mechanism of pMHC and TR/pMHC binding and recognition. A database for sequence-structure-function information on pMHC and TR/pMHC interactions, MHC-Peptide Interaction Database-TR version 2 (MPID-T2), is now available augmented with the latest PDB and IMGT/3Dstructure-DB data, advanced features and new parameters for the analysis of pMHC and TR/pMHC structures. http://biolinfo.org/mpid-t2. shoba.ranganathan@mq.edu.au Supplementary data are available at Bioinformatics online.

  8. Management of High-Throughput DNA Sequencing Projects: Alpheus.

    Science.gov (United States)

    Miller, Neil A; Kingsmore, Stephen F; Farmer, Andrew; Langley, Raymond J; Mudge, Joann; Crow, John A; Gonzalez, Alvaro J; Schilkey, Faye D; Kim, Ryan J; van Velkinburgh, Jennifer; May, Gregory D; Black, C Forrest; Myers, M Kathy; Utsey, John P; Frost, Nicholas S; Sugarbaker, David J; Bueno, Raphael; Gullans, Stephen R; Baxter, Susan M; Day, Steve W; Retzel, Ernest F

    2008-12-26

    High-throughput DNA sequencing has enabled systems biology to begin to address areas in health, agricultural and basic biological research. Concomitant with the opportunities is an absolute necessity to manage significant volumes of high-dimensional and inter-related data and analysis. Alpheus is an analysis pipeline, database and visualization software for use with massively parallel DNA sequencing technologies that feature multi-gigabase throughput characterized by relatively short reads, such as Illumina-Solexa (sequencing-by-synthesis), Roche-454 (pyrosequencing) and Applied Biosystem's SOLiD (sequencing-by-ligation). Alpheus enables alignment to reference sequence(s), detection of variants and enumeration of sequence abundance, including expression levels in transcriptome sequence. Alpheus is able to detect several types of variants, including non-synonymous and synonymous single nucleotide polymorphisms (SNPs), insertions/deletions (indels), premature stop codons, and splice isoforms. Variant detection is aided by the ability to filter variant calls based on consistency, expected allele frequency, sequence quality, coverage, and variant type in order to minimize false positives while maximizing the identification of true positives. Alpheus also enables comparisons of genes with variants between cases and controls or bulk segregant pools. Sequence-based differential expression comparisons can be developed, with data export to SAS JMP Genomics for statistical analysis.

  9. OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

    Science.gov (United States)

    Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

    2016-02-01

    Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

  10. Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon

    Directory of Open Access Journals (Sweden)

    Shenglong Tan

    2012-01-01

    Full Text Available Nucleotide-binding site (NBS disease resistance genes play an important role in defending plants from a variety of pathogens and insect pests. Many R-genes have been identified in various plant species. However, little is known about the NBS-encoding genes in Brachypodium distachyon. In this study, using computational analysis of the B. distachyon genome, we identified 126 regular NBS-encoding genes and characterized them on the bases of structural diversity, conserved protein motifs, chromosomal locations, gene duplications, promoter region, and phylogenetic relationships. EST hits and full-length cDNA sequences (from Brachypodium database of 126 R-like candidates supported their existence. Based on the occurrence of conserved protein motifs such as coiled-coil (CC, NBS, leucine-rich repeat (LRR, these regular NBS-LRR genes were classified into four subgroups: CC-NBS-LRR, NBS-LRR, CC-NBS, and X-NBS. Further expression analysis of the regular NBS-encoding genes in Brachypodium database revealed that these genes are expressed in a wide range of libraries, including those constructed from various developmental stages, tissue types, and drought challenged or nonchallenged tissue.

  11. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    Science.gov (United States)

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  12. Adaptive Processing for Sequence Alignment

    KAUST Repository

    Zidan, Mohammed A.; Bonny, Talal; Salama, Khaled N.

    2012-01-01

    Disclosed are various embodiments for adaptive processing for sequence alignment. In one embodiment, among others, a method includes obtaining a query sequence and a plurality of database sequences. A first portion of the plurality of database sequences is distributed to a central processing unit (CPU) and a second portion of the plurality of database sequences is distributed to a graphical processing unit (GPU) based upon a predetermined splitting ratio associated with the plurality of database sequences, where the database sequences of the first portion are shorter than the database sequences of the second portion. A first alignment score for the query sequence is determined with the CPU based upon the first portion of the plurality of database sequences and a second alignment score for the query sequence is determined with the GPU based upon the second portion of the plurality of database sequences.

  13. Adaptive Processing for Sequence Alignment

    KAUST Repository

    Zidan, Mohammed A.

    2012-01-26

    Disclosed are various embodiments for adaptive processing for sequence alignment. In one embodiment, among others, a method includes obtaining a query sequence and a plurality of database sequences. A first portion of the plurality of database sequences is distributed to a central processing unit (CPU) and a second portion of the plurality of database sequences is distributed to a graphical processing unit (GPU) based upon a predetermined splitting ratio associated with the plurality of database sequences, where the database sequences of the first portion are shorter than the database sequences of the second portion. A first alignment score for the query sequence is determined with the CPU based upon the first portion of the plurality of database sequences and a second alignment score for the query sequence is determined with the GPU based upon the second portion of the plurality of database sequences.

  14. Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1.

    Science.gov (United States)

    Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi

    2016-12-01

    The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

  15. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    Science.gov (United States)

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  16. Amino acid sequences of predicted proteins and their annotation for 95 organism species. - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Gclust Server Amino acid sequences of predicted proteins and their annotation for 95 organis...m species. Data detail Data name Amino acid sequences of predicted proteins and their annotation for 95 orga...nism species. DOI 10.18908/lsdba.nbdc00464-001 Description of data contents Amino acid sequences of predicted proteins...Database Description Download License Update History of This Database Site Policy | Contact Us Amino acid sequences of predicted prot...eins and their annotation for 95 organism species. - Gclust Server | LSDB Archive ...

  17. Nucleotide sequences of the Erwinia chrysanthemi ogl and pelE genes negatively regulated by the kdgR gene product.

    Science.gov (United States)

    Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J

    1989-12-21

    The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  18. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  19. DNA barcode and identification of the varieties and provenances of Taiwan's domestic and imported made teas using ribosomal internal transcribed spacer 2 sequences.

    Science.gov (United States)

    Lee, Shih-Chieh; Wang, Chia-Hsiang; Yen, Cheng-En; Chang, Chieh

    2017-04-01

    The major aim of made tea identification is to identify the variety and provenance of the tea plant. The present experiment used 113 tea plants [Camellia sinensis (L.) O. Kuntze] housed at the Tea Research and Extension Substation, from which 113 internal transcribed spacer 2 (ITS2) fragments, 104 trnL intron, and 98 trnL-trnF intergenic sequence region DNA sequences were successfully sequenced. The similarity of the ITS2 nucleotide sequences between tea plants housed at the Tea Research and Extension Substation was 0.379-0.994. In this polymerase chain reaction-amplified noncoding region, no varieties possessed identical sequences. Compared with the trnL intron and trnL-trnF intergenic sequence fragments of chloroplast cpDNA, the proportion of ITS2 nucleotide sequence variation was large and is more suitable for establishing a DNA barcode database to identify tea plant varieties. After establishing the database, 30 imported teas and 35 domestic made teas were used in this model system to explore the feasibility of using ITS2 sequences to identify the varieties and provenances of made teas. A phylogenetic tree was constructed using ITS2 sequences with the unweighted pair group method with arithmetic mean, which indicated that the same variety of tea plant is likely to be successfully categorized into one cluster, but contamination from other tea plants was also detected. This result provides molecular evidence that the similarity between important tea varieties in Taiwan remains high. We suggest a direct, wide collection of made tea and original samples of tea plants to establish an ITS2 sequence molecular barcode identification database to identify the varieties and provenances of tea plants. The DNA barcode comparison method can satisfy the need for a rapid, low-cost, frontline differentiation of the large amount of made teas from Taiwan and abroad, and can provide molecular evidence of their varieties and provenances. Copyright © 2016. Published by Elsevier B.V.

  20. A software pipeline for processing and identification of fungal ITS sequences

    Directory of Open Access Journals (Sweden)

    Kristiansson Erik

    2009-01-01

    Full Text Available Abstract Background Fungi from environmental samples are typically identified to species level through DNA sequencing of the nuclear ribosomal internal transcribed spacer (ITS region for use in BLAST-based similarity searches in the International Nucleotide Sequence Databases. These searches are time-consuming and regularly require a significant amount of manual intervention and complementary analyses. We here present software – in the form of an identification pipeline for large sets of fungal ITS sequences – developed to automate the BLAST process and several additional analysis steps. The performance of the pipeline was evaluated on a dataset of 350 ITS sequences from fungi growing as epiphytes on building material. Results The pipeline was written in Perl and uses a local installation of NCBI-BLAST for the similarity searches of the query sequences. The variable subregion ITS2 of the ITS region is extracted from the sequences and used for additional searches of higher sensitivity. Multiple alignments of each query sequence and its closest matches are computed, and query sequences sharing at least 50% of their best matches are clustered to facilitate the evaluation of hypothetically conspecific groups. The pipeline proved to speed up the processing, as well as enhance the resolution, of the evaluation dataset considerably, and the fungi were found to belong chiefly to the Ascomycota, with Penicillium and Aspergillus as the two most common genera. The ITS2 was found to indicate a different taxonomic affiliation than did the complete ITS region for 10% of the query sequences, though this figure is likely to vary with the taxonomic scope of the query sequences. Conclusion The present software readily assigns large sets of fungal query sequences to their respective best matches in the international sequence databases and places them in a larger biological context. The output is highly structured to be easy to process, although it still needs

  1. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  2. Transcriptome sequencing of mung bean (Vigna radiate L.) genes and the identification of EST-SSR markers.

    Science.gov (United States)

    Chen, Honglin; Wang, Lixia; Wang, Suhua; Liu, Chunji; Blair, Matthew Wohlgemuth; Cheng, Xuzhen

    2015-01-01

    Mung bean (Vigna radiate (L.) Wilczek) is an important traditional food legume crop, with high economic and nutritional value. It is widely grown in China and other Asian countries. Despite its importance, genomic information is currently unavailable for this crop plant species or some of its close relatives in the Vigna genus. In this study, more than 103 million high quality cDNA sequence reads were obtained from mung bean using Illumina paired-end sequencing technology. The processed reads were assembled into 48,693 unigenes with an average length of 874 bp. Of these unigenes, 25,820 (53.0%) and 23,235 (47.7%) showed significant similarity to proteins in the NCBI non-redundant protein and nucleotide sequence databases, respectively. Furthermore, 19,242 (39.5%) could be classified into gene ontology categories, 18,316 (37.6%) into Swiss-Prot categories and 10,918 (22.4%) into KOG database categories (E-value SSR), and 2,303 sequences contained more than one SSR together in the same expressed sequence tag (EST). A total of 13,134 EST-SSRs were identified as potential molecular markers, with mono-nucleotide A/T repeats being the most abundant motif class and G/C repeats being rare. In this SSR analysis, we found five main repeat motifs: AG/CT (30.8%), GAA/TTC (12.6%), AAAT/ATTT (6.8%), AAAAT/ATTTT (6.2%) and AAAAAT/ATTTTT (1.9%). A total of 200 SSR loci were randomly selected for validation by PCR amplification as EST-SSR markers. Of these, 66 marker primer pairs produced reproducible amplicons that were polymorphic among 31 mung bean accessions selected from diverse geographical locations. The large number of SSR-containing sequences found in this study will be valuable for the construction of a high-resolution genetic linkage maps, association or comparative mapping and genetic analyses of various Vigna species.

  3. The R package otu2ot for implementing the entropy decomposition of nucleotide variation in sequence data

    Directory of Open Access Journals (Sweden)

    Alban eRamette

    2014-11-01

    Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.

  4. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  5. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  6. Developing single nucleotide polymorphism markers for the identification of pineapple (Ananas comosus) germplasm.

    Science.gov (United States)

    Zhou, Lin; Matsumoto, Tracie; Tan, Hua-Wei; Meinhardt, Lyndel W; Mischke, Sue; Wang, Boyi; Zhang, Dapeng

    2015-01-01

    Pineapple (Ananas comosus [L.] Merr.) is the third most important tropical fruit in the world after banana and mango. As a crop with vegetative propagation, genetic redundancy is a major challenge for efficient genebank management and in breeding. Using expressed sequence tag and nucleotide sequences from public databases, we developed 213 single nucleotide polymorphism (SNP) markers and validated 96 SNPs by genotyping the United States Department of Agriculture - Agricultural Research Service pineapple germplasm collection, maintained in Hilo, Hawaii. The validation resulted in designation of a set of 57 polymorphic SNP markers that revealed a high rate of duplicates in this pineapple collection. Twenty-four groups of duplicates were detected, encompassing 130 of the total 170 A cosmos accessions. The results show that somatic mutation has been the main source of intra-cultivar variations in pineapple. Multivariate clustering and a model-based population stratification suggest that the modern pineapple cultivars are comprised of progenies that are derived from different wild Ananas botanical varieties. Parentage analysis further revealed that both A. comosus var. bracteatus and A. comosus var. ananassoides are likely progenitors of pineapple cultivars. However, the traditional classification of cultivated pineapple into horticultural groups (e.g. 'Cayenne', 'Spanish', 'Queen') was not well supported by the present study. These SNP markers provide robust and universally comparable DNA fingerprints; thus, they can serve as an efficient genotyping tool to assist pineapple germplasm management, propagation of planting material, and pineapple cultivar protection. The high rate of genetic redundancy detected in this pineapple collection suggests the potential impact of applying this technology on other clonally propagated perennial crops.

  7. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    Science.gov (United States)

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  8. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    Science.gov (United States)

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  9. Complete genome sequence of Fer-de-Lance Virus reveals a novel gene in reptilian Paramyxoviruses

    Science.gov (United States)

    Kurath, G.; Batts, W.N.; Ahne, W.; Winton, J.R.

    2004-01-01

    The complete RNA genome sequence of the archetype reptilian paramyxovirus, Fer-de-Lance virus (FDLV), has been determined. The genome is 15,378 nucleotides in length and consists of seven nonoverlapping genes in the order 3??? N-U-P-M-F-HN-L 5???, coding for the nucleocapsid, unknown, phospho-, matrix, fusion, hemagglutinin-neuraminidase, and large polymerase proteins, respectively. The gene junctions contain highly conserved transcription start and stop signal sequences and tri-nucleotide intergenic regions similar to those of other Paramyxoviridae. The FDLV P gene expression strategy is like that of rubulaviruses, which express the accessory V protein from the primary transcript and edit a portion of the mRNA to encode P and I proteins. There is also an overlapping open reading frame potentially encoding a small basic protein in the P gene. The gene designated U (unknown), encodes a deduced protein of 19.4 kDa that has no counterpart in other paramyxoviruses and has no similarity with sequences in the National Center for Biotechnology Information database. Active transcription of the U gene in infected cells was demonstrated by Northern blot analysis, and bicistronic N-U mRNA was also evident. The genomes of two other snake paramyxovirus genotypes were also found to have U genes, with 11 to 16% nucleotide divergence from the FDLV U gene. Pairwise comparisons of amino acid identities and phylogenetic analyses of all deduced FDLV protein sequences with homologous sequences from other Paramyxoviridae indicate that FDLV represents a new genus within the subfamily Paramyxovirinae. We suggest the name Ferlavirus for the new genus, with FDLV as the type species.

  10. DRDB: An Online Date Palm Genomic Resource Database

    Directory of Open Access Journals (Sweden)

    Zilong He

    2017-11-01

    Full Text Available Background: Date palm (Phoenix dactylifera L. is a cultivated woody plant with agricultural and economic importance in many countries around the world. With the advantages of next generation sequencing technologies, genome sequences for many date palm cultivars have been released recently. Short sequence repeat (SSR and single nucleotide polymorphism (SNP can be identified from these genomic data, and have been proven to be very useful biomarkers in plant genome analysis and breeding.Results: Here, we first improved the date palm genome assembly using 130X of HiSeq data generated in our lab. Then 246,445 SSRs (214,901 SSRs and 31,544 compound SSRs were annotated in this genome assembly; among the SSRs, mononucleotide SSRs (58.92% were the most abundant, followed by di- (29.92%, tri- (8.14%, tetra- (2.47%, penta- (0.36%, and hexa-nucleotide SSRs (0.19%. The high-quality PCR primer pairs were designed for most (174,497; 70.81% out of total SSRs. We also annotated 6,375,806 SNPs with raw read depth≥3 in 90% cultivars. To further reduce false positive SNPs, we only kept 5,572,650 (87.40% out of total SNPs with at least 20% cultivars support for downstream analyses. The high-quality PCR primer pairs were also obtained for 4,177,778 (65.53% SNPs. We reconstructed the phylogenetic relationships among the 62 cultivars using these variants and found that they can be divided into three clusters, namely North Africa, Egypt – Sudan, and Middle East – South Asian, with Egypt – Sudan being the admixture of North Africa and Middle East – South Asian cultivars; we further confirmed these clusters using principal component analysis. Moreover, 34,346 SSRs and 4,177,778 SNPs with PCR primers were assigned to shared cultivars for cultivar classification and diversity analysis. All these SSRs, SNPs and their classification are available in our database, and can be used for cultivar identification, comparison, and molecular breeding.Conclusion:DRDB is a

  11. A two-locus DNA sequence database for typing plant and human pathogens within the Fusarium oxysporum species complex

    DEFF Research Database (Denmark)

    O'Donnell, Kerry; Gueidan, C; Sink, S

    2009-01-01

    We constructed a two-locus database, comprising partial translation elongation factor (EF-1alpha) gene sequences and nearly full-length sequences of the nuclear ribosomal intergenic spacer region (IGS rDNA) for 850 isolates spanning the phylogenetic breadth of the Fusarium oxysporum species compl...... of the IGS rDNA sequences may be non-orthologous. We also evaluated enniatin, fumonisin and moniliformin mycotoxin production in vitro within a phylogenetic framework....

  12. Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

    Science.gov (United States)

    Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

    2009-06-01

    The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

  13. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  15. Sequence determinants of human microsatellite variability

    Directory of Open Access Journals (Sweden)

    Jakobsson Mattias

    2009-12-01

    Full Text Available Abstract Background Microsatellite loci are frequently used in genomic studies of DNA sequence repeats and in population studies of genetic variability. To investigate the effect of sequence properties of microsatellites on their level of variability we have analyzed genotypes at 627 microsatellite loci in 1,048 worldwide individuals from the HGDP-CEPH cell line panel together with the DNA sequences of these microsatellites in the human RefSeq database. Results Calibrating PCR fragment lengths in individual genotypes by using the RefSeq sequence enabled us to infer repeat number in the HGDP-CEPH dataset and to calculate the mean number of repeats (as opposed to the mean PCR fragment length, under the assumption that differences in PCR fragment length reflect differences in the numbers of repeats in the embedded repeat sequences. We find the mean and maximum numbers of repeats across individuals to be positively correlated with heterozygosity. The size and composition of the repeat unit of a microsatellite are also important factors in predicting heterozygosity, with tetra-nucleotide repeat units high in G/C content leading to higher heterozygosity. Finally, we find that microsatellites containing more separate sets of repeated motifs generally have higher heterozygosity. Conclusions These results suggest that sequence properties of microsatellites have a significant impact in determining the features of human microsatellite variability.

  16. GDR (Genome Database for Rosaceae): integrated web-database for Rosaceae genomics and genetics data.

    Science.gov (United States)

    Jung, Sook; Staton, Margaret; Lee, Taein; Blenda, Anna; Svancara, Randall; Abbott, Albert; Main, Dorrie

    2008-01-01

    The Genome Database for Rosaceae (GDR) is a central repository of curated and integrated genetics and genomics data of Rosaceae, an economically important family which includes apple, cherry, peach, pear, raspberry, rose and strawberry. GDR contains annotated databases of all publicly available Rosaceae ESTs, the genetically anchored peach physical map, Rosaceae genetic maps and comprehensively annotated markers and traits. The ESTs are assembled to produce unigene sets of each genus and the entire Rosaceae. Other annotations include putative function, microsatellites, open reading frames, single nucleotide polymorphisms, gene ontology terms and anchored map position where applicable. Most of the published Rosaceae genetic maps can be viewed and compared through CMap, the comparative map viewer. The peach physical map can be viewed using WebFPC/WebChrom, and also through our integrated GDR map viewer, which serves as a portal to the combined genetic, transcriptome and physical mapping information. ESTs, BACs, markers and traits can be queried by various categories and the search result sites are linked to the mapping visualization tools. GDR also provides online analysis tools such as a batch BLAST/FASTA server for the GDR datasets, a sequence assembly server and microsatellite and primer detection tools. GDR is available at http://www.rosaceae.org.

  17. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA.

    Science.gov (United States)

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R

    2009-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types of structural elements and constraints. However, traditional methods are too computationally expensive to perform well on large scale alignment and less effective with the sequences from diversified phylogenetic classifications. We propose a new approach that utilizes coevolutional rates among pairs of nucleotide positions using phylogenetic and evolutionary relationships of the organisms of aligned sequences. With a novel data schema to manage relevant information within a relational database, our method, implemented with a Microsoft SQL Server 2005, showed 90% sensitivity in identifying base pair interactions among 16S ribosomal RNA sequences from Bacteria, at a scale 40 times bigger and 50% better sensitivity than a previous study. The results also indicated covariation signals for a few sets of cross-strand base stacking pairs in secondary structure helices, and other subtle constraints in the RNA structure.

  18. Genome cluster database. A sequence family analysis platform for Arabidopsis and rice.

    Science.gov (United States)

    Horan, Kevin; Lauricha, Josh; Bailey-Serres, Julia; Raikhel, Natasha; Girke, Thomas

    2005-05-01

    The genome-wide protein sequences from Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) spp. japonica were clustered into families using sequence similarity and domain-based clustering. The two fundamentally different methods resulted in separate cluster sets with complementary properties to compensate the limitations for accurate family analysis. Functional names for the identified families were assigned with an efficient computational approach that uses the description of the most common molecular function gene ontology node within each cluster. Subsequently, multiple alignments and phylogenetic trees were calculated for the assembled families. All clustering results and their underlying sequences were organized in the Web-accessible Genome Cluster Database (http://bioinfo.ucr.edu/projects/GCD) with rich interactive and user-friendly sequence family mining tools to facilitate the analysis of any given family of interest for the plant science community. An automated clustering pipeline ensures current information for future updates in the annotations of the two genomes and clustering improvements. The analysis allowed the first systematic identification of family and singlet proteins present in both organisms as well as those restricted to one of them. In addition, the established Web resources for mining these data provide a road map for future studies of the composition and structure of protein families between the two species.

  19. Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

    International Nuclear Information System (INIS)

    Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.

    1987-01-01

    The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

  20. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  1. DNA Polymerases Drive DNA Sequencing-by-Synthesis Technologies: Both Past and Present

    Directory of Open Access Journals (Sweden)

    Cheng-Yao eChen

    2014-06-01

    Full Text Available Next-generation sequencing (NGS technologies have revolutionized modern biological and biomedical research. The engines responsible for this innovation are DNA polymerases; they catalyze the biochemical reaction for deriving template sequence information. In fact, DNA polymerase has been a cornerstone of DNA sequencing from the very beginning. E. coli DNA polymerase I proteolytic (Klenow fragment was originally utilized in Sanger's dideoxy chain terminating DNA sequencing chemistry. From these humble beginnings followed an explosion of organism-specific, genome sequence information accessible via public database. Family A/B DNA polymerases from mesophilic/thermophilic bacteria/archaea were modified and tested in today's standard capillary electrophoresis (CE and NGS sequencing platforms. These enzymes were selected for their efficient incorporation of bulky dye-terminator and reversible dye-terminator nucleotides respectively. Third generation, real-time single molecule sequencing platform requires slightly different enzyme properties. Enterobacterial phage ⱷ29 DNA polymerase copies long stretches of DNA and possesses a unique capability to efficiently incorporate terminal phosphate-labeled nucleoside polyphosphates. Furthermore, ⱷ29 enzyme has also been utilized in emerging DNA sequencing technologies including nanopore-, and protein-transistor-based sequencing. DNA polymerase is, and will continue to be, a crucial component of sequencing technologies.

  2. Enriching Genomic Resources and Marker Development from Transcript Sequences of Jatropha curcas for Microgravity Studies

    Science.gov (United States)

    Tian, Wenlan; Paudel, Dev

    2017-01-01

    Jatropha (Jatropha curcas L.) is an economically important species with a great potential for biodiesel production. To enrich the jatropha genomic databases and resources for microgravity studies, we sequenced and annotated the transcriptome of jatropha and developed SSR and SNP markers from the transcriptome sequences. In total 1,714,433 raw reads with an average length of 441.2 nucleotides were generated. De novo assembling and clustering resulted in 115,611 uniquely assembled sequences (UASs) including 21,418 full-length cDNAs and 23,264 new jatropha transcript sequences. The whole set of UASs were fully annotated, out of which 59,903 (51.81%) were assigned with gene ontology (GO) term, 12,584 (10.88%) had orthologs in Eukaryotic Orthologous Groups (KOG), and 8,822 (7.63%) were mapped to 317 pathways in six different categories in Kyoto Encyclopedia of Genes and Genome (KEGG) database, and it contained 3,588 putative transcription factors. From the UASs, 9,798 SSRs were discovered with AG/CT as the most frequent (45.8%) SSR motif type. Further 38,693 SNPs were detected and 7,584 remained after filtering. This UAS set has enriched the current jatropha genomic databases and provided a large number of genetic markers, which can facilitate jatropha genetic improvement and many other genetic and biological studies. PMID:28154822

  3. Barcoding lichen-forming fungi using 454 pyrosequencing is challenged by artifactual and biological sequence variation.

    Science.gov (United States)

    Mark, Kristiina; Cornejo, Carolina; Keller, Christine; Flück, Daniela; Scheidegger, Christoph

    2016-09-01

    Although lichens (lichen-forming fungi) play an important role in the ecological integrity of many vulnerable landscapes, only a minority of lichen-forming fungi have been barcoded out of the currently accepted ∼18 000 species. Regular Sanger sequencing can be problematic when analyzing lichens since saprophytic, endophytic, and parasitic fungi live intimately admixed, resulting in low-quality sequencing reads. Here, high-throughput, long-read 454 pyrosequencing in a GS FLX+ System was tested to barcode the fungal partner of 100 epiphytic lichen species from Switzerland using fungal-specific primers when amplifying the full internal transcribed spacer region (ITS). The present study shows the potential of DNA barcoding using pyrosequencing, in that the expected lichen fungus was successfully sequenced for all samples except one. Alignment solutions such as BLAST were found to be largely adequate for the generated long reads. In addition, the NCBI nucleotide database-currently the most complete database for lichen-forming fungi-can be used as a reference database when identifying common species, since the majority of analyzed lichens were identified correctly to the species or at least to the genus level. However, several issues were encountered, including a high sequencing error rate, multiple ITS versions in a genome (incomplete concerted evolution), and in some samples the presence of mixed lichen-forming fungi (possible lichen chimeras).

  4. ToxGen: an improved reference database for the identification of type B-trichothecene genotypes in Fusarium

    Directory of Open Access Journals (Sweden)

    Tomasz Kulik

    2017-02-01

    Full Text Available Type B trichothecenes, which pose a serious hazard to consumer health, occur worldwide in grains. These mycotoxins are produced mainly by three different trichothecene genotypes/chemotypes: 3ADON (3-acetyldeoxynivalenol, 15ADON (15-acetyldeoxynivalenol and NIV (nivalenol, named after these three major mycotoxin compounds. Correct identification of these genotypes is elementary for all studies relating to population surveys, fungal ecology and mycotoxicology. Trichothecene producers exhibit enormous strain-dependent chemical diversity, which may result in variation in levels of the genotype’s determining toxin and in the production of low to high amounts of atypical compounds. New high-throughput DNA-sequencing technologies promise to boost the diagnostics of mycotoxin genotypes. However, this requires a reference database containing a satisfactory taxonomic sampling of sequences showing high correlation to actually produced chemotypes. We believe that one of the most pressing current challenges of such a database is the linking of molecular identification with chemical diversity of the strains, as well as other metadata. In this study, we use the Tri12 gene involved in mycotoxin biosynthesis for identification of Tri genotypes through sequence comparison. Tri12 sequences from a range of geographically diverse fungal strains comprising 22 Fusarium species were stored in the ToxGen database, which covers descriptive and up-to-date annotations such as indication on Tri genotype and chemotype of the strains, chemical diversity, information on trichothecene-inducing host, substrate or media, geographical locality, and most recent taxonomic affiliations. The present initiative bridges the gap between the demands of comprehensive studies on trichothecene producers and the existing nucleotide sequence databases, which lack toxicological and other auxiliary data. We invite researchers working in the fields of fungal taxonomy, epidemiology and

  5. ToxGen: an improved reference database for the identification of type B-trichothecene genotypes in Fusarium.

    Science.gov (United States)

    Kulik, Tomasz; Abarenkov, Kessy; Buśko, Maciej; Bilska, Katarzyna; van Diepeningen, Anne D; Ostrowska-Kołodziejczak, Anna; Krawczyk, Katarzyna; Brankovics, Balázs; Stenglein, Sebastian; Sawicki, Jakub; Perkowski, Juliusz

    2017-01-01

    Type B trichothecenes, which pose a serious hazard to consumer health, occur worldwide in grains. These mycotoxins are produced mainly by three different trichothecene genotypes/chemotypes: 3ADON (3-acetyldeoxynivalenol), 15ADON (15-acetyldeoxynivalenol) and NIV (nivalenol), named after these three major mycotoxin compounds. Correct identification of these genotypes is elementary for all studies relating to population surveys, fungal ecology and mycotoxicology. Trichothecene producers exhibit enormous strain-dependent chemical diversity, which may result in variation in levels of the genotype's determining toxin and in the production of low to high amounts of atypical compounds. New high-throughput DNA-sequencing technologies promise to boost the diagnostics of mycotoxin genotypes. However, this requires a reference database containing a satisfactory taxonomic sampling of sequences showing high correlation to actually produced chemotypes. We believe that one of the most pressing current challenges of such a database is the linking of molecular identification with chemical diversity of the strains, as well as other metadata. In this study, we use the Tri12 gene involved in mycotoxin biosynthesis for identification of Tri genotypes through sequence comparison. Tri12 sequences from a range of geographically diverse fungal strains comprising 22 Fusarium species were stored in the ToxGen database, which covers descriptive and up-to-date annotations such as indication on Tri genotype and chemotype of the strains, chemical diversity, information on trichothecene-inducing host, substrate or media, geographical locality, and most recent taxonomic affiliations. The present initiative bridges the gap between the demands of comprehensive studies on trichothecene producers and the existing nucleotide sequence databases, which lack toxicological and other auxiliary data. We invite researchers working in the fields of fungal taxonomy, epidemiology and mycotoxicology to join the

  6. Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

    Science.gov (United States)

    Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

    2010-12-01

    Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

  7. Database Description - TMFunction | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available sidue (or mutant) in a protein. The experimental data are collected from the literature both by searching th...the sequence database, UniProt, structural database, PDB, and literature database

  8. MannDB – A microbial database of automated protein sequence analyses and evidence integration for protein characterization

    Directory of Open Access Journals (Sweden)

    Kuczmarski Thomas A

    2006-10-01

    Full Text Available Abstract Background MannDB was created to meet a need for rapid, comprehensive automated protein sequence analyses to support selection of proteins suitable as targets for driving the development of reagents for pathogen or protein toxin detection. Because a large number of open-source tools were needed, it was necessary to produce a software system to scale the computations for whole-proteome analysis. Thus, we built a fully automated system for executing software tools and for storage, integration, and display of automated protein sequence analysis and annotation data. Description MannDB is a relational database that organizes data resulting from fully automated, high-throughput protein-sequence analyses using open-source tools. Types of analyses provided include predictions of cleavage, chemical properties, classification, features, functional assignment, post-translational modifications, motifs, antigenicity, and secondary structure. Proteomes (lists of hypothetical and known proteins are downloaded and parsed from Genbank and then inserted into MannDB, and annotations from SwissProt are downloaded when identifiers are found in the Genbank entry or when identical sequences are identified. Currently 36 open-source tools are run against MannDB protein sequences either on local systems or by means of batch submission to external servers. In addition, BLAST against protein entries in MvirDB, our database of microbial virulence factors, is performed. A web client browser enables viewing of computational results and downloaded annotations, and a query tool enables structured and free-text search capabilities. When available, links to external databases, including MvirDB, are provided. MannDB contains whole-proteome analyses for at least one representative organism from each category of biological threat organism listed by APHIS, CDC, HHS, NIAID, USDA, USFDA, and WHO. Conclusion MannDB comprises a large number of genomes and comprehensive protein

  9. [Complete genome sequencing and analyses of rabies viruses isolated from wild animals (Chinese Ferret-Badger) in Zhejiang province].

    Science.gov (United States)

    Lei, Yong-Liang; Wang, Xiao-Guang; Liu, Fu-Ming; Chen, Xiu-Ying; Ye, Bi-Feng; Mei, Jian-Hua; Lan, Jin-Quan; Tang, Qing

    2009-08-01

    Based on sequencing the full-length genomes of two Chinese Ferret-Badger, we analyzed the properties of rabies viruses genetic variation in molecular level to get information on prevalence and variation of rabies viruses in Zhejiang, and to enrich the genome database of rabies viruses street strains isolated from Chinese wildlife. Overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses of the N genes from Chinese Ferret-Badger, sika deer, vole, dog. Vaccine strains were then determined. The two full-length genomes were completely sequenced to find out that they had the same genetic structure with 11 923 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions (IGRs), 423 nts-Pseudogene-like sequence (Psi), 70 nts-Trailer. The two full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by blast and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the two full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so that the nucleotide mutations happened in these two genomes were most probably as synonymous mutations. Compared to the referenced rabies viruses, the lengths of the five protein coding regions did not show any changes or recombination, but only with a few-point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the two ferret badgers genomes were similar to the referenced vaccine or street strains. The two strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessing the distinct geographyphic characteristics of China. All the evidence suggested a cue that these two ferret badgers

  10. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences

    OpenAIRE

    Lescot, Magali; Déhais, Patrice; Thijs, Gert; Marchal, Kathleen; Moreau, Yves; Van de Peer, Yves; Rouzé, Pierre; Rombauts, Stephane

    2002-01-01

    PlantCARE is a database of plant cis-acting regulatory elements, enhancers and repressors. Regulatory elements are represented by positional matrices, consensus sequences and individual sites on particular promoter sequences. Links to the EMBL, TRANSFAC and MEDLINE databases are provided when available. Data about the transcription sites are extracted mainly from the literature, supplemented with an increasing number of in silico predicted data. Apart from a general description for specific t...

  11. TranslatomeDB: a comprehensive database and cloud-based analysis platform for translatome sequencing data.

    Science.gov (United States)

    Liu, Wanting; Xiang, Lunping; Zheng, Tingkai; Jin, Jingjie; Zhang, Gong

    2018-01-04

    Translation is a key regulatory step, linking transcriptome and proteome. Two major methods of translatome investigations are RNC-seq (sequencing of translating mRNA) and Ribo-seq (ribosome profiling). To facilitate the investigation of translation, we built a comprehensive database TranslatomeDB (http://www.translatomedb.net/) which provides collection and integrated analysis of published and user-generated translatome sequencing data. The current version includes 2453 Ribo-seq, 10 RNC-seq and their 1394 corresponding mRNA-seq datasets in 13 species. The database emphasizes the analysis functions in addition to the dataset collections. Differential gene expression (DGE) analysis can be performed between any two datasets of same species and type, both on transcriptome and translatome levels. The translation indices translation ratios, elongation velocity index and translational efficiency can be calculated to quantitatively evaluate translational initiation efficiency and elongation velocity, respectively. All datasets were analyzed using a unified, robust, accurate and experimentally-verifiable pipeline based on the FANSe3 mapping algorithm and edgeR for DGE analyzes. TranslatomeDB also allows users to upload their own datasets and utilize the identical unified pipeline to analyze their data. We believe that our TranslatomeDB is a comprehensive platform and knowledgebase on translatome and proteome research, releasing the biologists from complex searching, analyzing and comparing huge sequencing data without needing local computational power. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  13. Cluster based on sequence comparison of homologous proteins of 95 organism species - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Gclust Server Cluster based on sequence comparison of homologous proteins of 95 organism spe...cies Data detail Data name Cluster based on sequence comparison of homologous proteins of 95 organism specie...istory of This Database Site Policy | Contact Us Cluster based on sequence compariso

  14. Rice genetic marker database: An identification of single nucleotide ...

    African Journals Online (AJOL)

    based genetic marker system to provide information about SNP and QTL markers in rice. The SNP marker database provides 7,227 SNP markers including location information on chromosomes by using genetic map. It allows users to access a ...

  15. Bellerophon: a program to detect chimeric sequences in multiple sequence alignments.

    Science.gov (United States)

    Huber, Thomas; Faulkner, Geoffrey; Hugenholtz, Philip

    2004-09-22

    Bellerophon is a program for detecting chimeric sequences in multiple sequence datasets by an adaption of partial treeing analysis. Bellerophon was specifically developed to detect 16S rRNA gene chimeras in PCR-clone libraries of environmental samples but can be applied to other nucleotide sequence alignments. Bellerophon is available as an interactive web server at http://foo.maths.uq.edu.au/~huber/bellerophon.pl

  16. Centrifuge: rapid and sensitive classification of metagenomic sequences.

    Science.gov (United States)

    Kim, Daehwan; Song, Li; Breitwieser, Florian P; Salzberg, Steven L

    2016-12-01

    Centrifuge is a novel microbial classification engine that enables rapid, accurate, and sensitive labeling of reads and quantification of species on desktop computers. The system uses an indexing scheme based on the Burrows-Wheeler transform (BWT) and the Ferragina-Manzini (FM) index, optimized specifically for the metagenomic classification problem. Centrifuge requires a relatively small index (4.2 GB for 4078 bacterial and 200 archaeal genomes) and classifies sequences at very high speed, allowing it to process the millions of reads from a typical high-throughput DNA sequencing run within a few minutes. Together, these advances enable timely and accurate analysis of large metagenomics data sets on conventional desktop computers. Because of its space-optimized indexing schemes, Centrifuge also makes it possible to index the entire NCBI nonredundant nucleotide sequence database (a total of 109 billion bases) with an index size of 69 GB, in contrast to k-mer-based indexing schemes, which require far more extensive space. © 2016 Kim et al.; Published by Cold Spring Harbor Laboratory Press.

  17. One-Step PCR Sequencing. Final Technical Progress Report for February 15, 1997 - November 30, 2001

    Energy Technology Data Exchange (ETDEWEB)

    Shaw, B. R.

    2004-04-16

    We investigated new chemistries and alternate approaches for direct gene sequencing and detection based on the properties of boron-substituted nucleotides as chain delimiters in lieu of conventional chain terminators. Chain terminators, such as the widely used Sanger dideoxynucleotide truncators, stop DNA synthesis during replication and hence are incompatible with further PCR amplification. Chain delimiters, on the other hand, are chemically-modified, ''stealth'' nucleotides that act like normal nucleotides in DNA synthesis and PCR amplification, but can be unmasked following chain extension and exponential amplification. Specifically, chain delimiters give rise to an alternative sequencing strategy based on selective degradation of DNA chains generated by PCR amplification with modified nucleotides. The method as originally devised employed template-directed enzymatic, random incorporation of small amounts of boron-modified nucleotides (e.g., 2'-deoxynucleoside 5'-alpha-[P-borano]- triphosphates) during PCR amplification. Rather than incorporation of dideoxy chain terminators, which are less efficiently incorporated in PCR-based amplification than natural deoxynucleotides, our method is based on selective incorporation and exonuclease degradation of DNA chains generated by efficient PCR amplification of chemically-modified ''stealth'' nucleotides. The stealth nucleotides have a boranophosphate group instead of a normal phosphate, yet behave like normal nucleotides during PCR-amplification. The unique feature of our method is that the position of the stealth nucleotide, and hence DNA sequencing fragments, are revealed at the desired, appropriate moment following PCR amplification. During the current grant period, a variety of new boron-modified nucleotides were synthesized, and new chemistries and enzymatic methods and combinations thereof were explored to improve the method and study the effects of borane modified

  18. NCBI-compliant genome submissions: tips and tricks to save time and money

    NARCIS (Netherlands)

    Pirovano, Walter; Boetzer, Marten; Derks, M.F.L.; Smit, S.

    2017-01-01

    Genome sequences nowadays play a central role in molecular biology and bioinformatics. These sequences are shared with the scientific community through sequence databases. The sequence repositories of the International Nucleotide Sequence Database Collaboration (INSDC, comprising GenBank, ENA and

  19. Bioinformatic approach in the identification of arabidopsis gene homologous in amaranthus

    Directory of Open Access Journals (Sweden)

    Jana Žiarovská

    2015-05-01

    Full Text Available Bioinfomatics offers an efficient tool for molecular genetics applications and sequence homology search algorithms became an inevitable part for many different research strategies. Appropriate managing of known data that are stored in public available databases can be used in many ways in the research. Here, we report the identification of RmlC-like cupins superfamily protein DNA sequence than is known in Arabidopsis genome for the Amaranthus - plant specie where this sequence was still not sequenced. A BLAST based approach was used to identify the homologous sequences in the nucleotide database and to find suitable parts of the Arabidopsis sequence were primers can be designed. In total, 64 hits were found in nucleotide database for Arabidopsis RmlC-like cupins sequence. A query cover ranged from 10% up to the 100% among RmlC-like cupins nucleotides and its homologues that are actually stored in public nucleotide databases. The most conserved region was identified for matches that posses nucleotides in the range of 1506 up to the 1925 bp of RmlC-like cupins DNA sequence stored in the database. The in silico approach was subsequently used in PCR analysis where the specifity of designed primers was approved. A unique, 250 bp long fragment was obtained for Amaranthus cruentus and a hybride Amaranthus hypochondriacus x hybridus in our analysis. Bioinformatic based analysis of unknown parts of the plant genomes as showed in this study is a very good additional tool in PCR based analysis of plant variability. This approach is suitable in the case for plants, where concrete genomic data are still missing for the appropriate genes, as was demonstrated for Amaranthus. 

  20. [Sequencing and analysis of complete genome of rabies viruses isolated from Chinese Ferret-Badger and dog in Zhejiang province].

    Science.gov (United States)

    Lei, Yong-Liang; Wang, Xiao-Guang; Tao, Xiao-Yan; Li, Hao; Meng, Sheng-Li; Chen, Xiu-Ying; Liu, Fu-Ming; Ye, Bi-Feng; Tang, Qing

    2010-01-01

    Based on sequencing the full-length genomes of four Chinese Ferret-Badger and dog, we analyze the properties of rabies viruses genetic variation in molecular level, get the information about rabies viruses prevalence and variation in Zhejiang, and enrich the genome database of rabies viruses street strains isolated from China. Rabies viruses in suckling mice were isolated, overlapped fragments were amplified by RT-PCR and full-length genomes were assembled to analyze the nucleotide and deduced protein similarities and phylogenetic analyses from Chinese Ferret-Badger, dog, sika deer, vole, used vaccine strain were determined. The four full-length genomes were sequenced completely and had the same genetic structure with the length of 11, 923 nts or 11, 925 nts including 58 nts-Leader, 1353 nts-NP, 894 nts-PP, 609 nts-MP, 1575 nts-GP, 6386 nts-LP, and 2, 5, 5 nts- intergenic regions(IGRs), 423 nts-Pseudogene-like sequence (psi), 70 nts-Trailer. The four full-length genomes were in accordance with the properties of Rhabdoviridae Lyssa virus by BLAST and multi-sequence alignment. The nucleotide and amino acid sequences among Chinese strains had the highest similarity, especially among animals of the same species. Of the four full-length genomes, the similarity in amino acid level was dramatically higher than that in nucleotide level, so the nucleotide mutations happened in these four genomes were most synonymous mutations. Compared with the reference rabies viruses, the lengths of the five protein coding regions had no change, no recombination, only with a few point mutations. It was evident that the five proteins appeared to be stable. The variation sites and types of the four genomes were similar to the reference vaccine or street strains. And the four strains were genotype 1 according to the multi-sequence and phylogenetic analyses, which possessed the distinct district characteristics of China. Therefore, these four rabies viruses are likely to be street viruses

  1. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.

  2. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...

  3. The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

    Science.gov (United States)

    Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

    1995-05-01

    The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

  4. TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine.

    Science.gov (United States)

    Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun

    2016-10-01

    As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.

  5. Permanent genetic resources added to Molecular Ecology Resources Database 1 December 2011-31 January 2012.

    Science.gov (United States)

    Arias, M C; Arnoux, E; Bell, James J; Bernadou, Abel; Bino, Giorgia; Blatrix, R; Bourguet, Denis; Carrea, Cecilia; Clamens, Anne-Laure; Cunha, Haydée A; d'Alençon, E; Ding, Yi; Djieto-Lordon, C; Dubois, M P; Dumas, P; Eraud, C; Faivre, B; Francisco, F O; Françoso, E; Garcia, M; Gardner, Jonathan P A; Garnier, S; Gimenez, S; Gold, John R; Harris, D J; He, Guangcun; Hellemans, B; Hollenbeck, Christopher M; Jing, Shengli; Kergoat, G J; Liu, Bingfang; McDowell, Jan R; McKey, D; Miller, Terrence L; Newton, Erica; Pagenkopp Lohan, Katrina M; Papetti, Chiara; Paterson, Ian; Peccoud, J; Peng, Xinxin; Piatscheck, F; Ponsard, Sergine; Reece, Kimberly S; Reisser, Céline M O; Renshaw, Mark A; Ruzzante, Daniel E; Sauve, M; Shields, Jeffrey D; Solé-Cava, Antonio; Souche, E L; Van Houdt, J K J; Vasconcellos, Anderson; Volckaert, F A M; Wang, Shuzhen; Xiao, Jie; Yu, Hangjin; Zane, Lorenzo; Zannato, Barbara; Zemlak, Tyler S; Zhang, Chunxiao; Zhao, Yan; Zhou, Xi; Zhu, Lili

    2012-05-01

    This article documents the addition of 473 microsatellite marker loci and 71 pairs of single-nucleotide polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Barteria fistulosa, Bombus morio, Galaxias platei, Hematodinium perezi, Macrocentrus cingulum Brischke (a.k.a. M. abdominalis Fab., M. grandii Goidanich or M. gifuensis Ashmead), Micropogonias furnieri, Nerita melanotragus, Nilaparvata lugens Stål, Sciaenops ocellatus, Scomber scombrus, Spodoptera frugiperda and Turdus lherminieri. These loci were cross-tested on the following species: Barteria dewevrei, Barteria nigritana, Barteria solida, Cynoscion acoupa, Cynoscion jamaicensis, Cynoscion leiarchus, Cynoscion nebulosus, Cynoscion striatus, Cynoscion virescens, Macrodon ancylodon, Menticirrhus americanus, Nilaparvata muiri and Umbrina canosai. This article also documents the addition of 116 sequencing primer pairs for Dicentrarchus labrax. © 2012 Blackwell Publishing Ltd.

  6. Sequence specificity and biological consequences of drugs that bind covalently in the minor groove of DNA

    International Nuclear Information System (INIS)

    Hurley, L.H.; Needham-VanDevanter, D.R.

    1986-01-01

    DNA ligands which bind within the minor groove of DNA exhibit varying degrees of sequence selectivity. Factors which contribute to nucleotide sequence recognition by minor groove ligands have been extensively investigated. Electrostatic interactions, ligand and DNA dehydration energies, hydrophobic interactions and steric factors all play significant roles in sequence selectivity in the minor groove. Interestingly, ligand recognition of nucleotide sequence in the minor groove does not involve significant hydrogen bonding. This is in sharp contrast to cellular enzyme and protein recognition of nucleotide sequence, which is achieved in the major groove via specific hydrogen bond formation between individual bases and the ligand. The ability to read nucleotide sequence via hydrogen bonding allows precise binding of proteins to specific DNA sequences. Minor groove ligands examined to date exhibit a much lower sequence specificity, generally binding to a subset of possible sequences, rather than a single sequence. 19 refs., 7 figs

  7. Applications of High-Throughput Nucleotide Sequencing (PhD)

    DEFF Research Database (Denmark)

    Waage, Johannes

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  8. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  9. UET: a database of evolutionarily-predicted functional determinants of protein sequences that cluster as functional sites in protein structures.

    Science.gov (United States)

    Lua, Rhonald C; Wilson, Stephen J; Konecki, Daniel M; Wilkins, Angela D; Venner, Eric; Morgan, Daniel H; Lichtarge, Olivier

    2016-01-04

    The structure and function of proteins underlie most aspects of biology and their mutational perturbations often cause disease. To identify the molecular determinants of function as well as targets for drugs, it is central to characterize the important residues and how they cluster to form functional sites. The Evolutionary Trace (ET) achieves this by ranking the functional and structural importance of the protein sequence positions. ET uses evolutionary distances to estimate functional distances and correlates genotype variations with those in the fitness phenotype. Thus, ET ranks are worse for sequence positions that vary among evolutionarily closer homologs but better for positions that vary mostly among distant homologs. This approach identifies functional determinants, predicts function, guides the mutational redesign of functional and allosteric specificity, and interprets the action of coding sequence variations in proteins, people and populations. Now, the UET database offers pre-computed ET analyses for the protein structure databank, and on-the-fly analysis of any protein sequence. A web interface retrieves ET rankings of sequence positions and maps results to a structure to identify functionally important regions. This UET database integrates several ways of viewing the results on the protein sequence or structure and can be found at http://mammoth.bcm.tmc.edu/uet/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Minimotif Miner 3.0: database expansion and significantly improved reduction of false-positive predictions from consensus sequences.

    Science.gov (United States)

    Mi, Tian; Merlin, Jerlin Camilus; Deverasetty, Sandeep; Gryk, Michael R; Bill, Travis J; Brooks, Andrew W; Lee, Logan Y; Rathnayake, Viraj; Ross, Christian A; Sargeant, David P; Strong, Christy L; Watts, Paula; Rajasekaran, Sanguthevar; Schiller, Martin R

    2012-01-01

    Minimotif Miner (MnM available at http://minimotifminer.org or http://mnm.engr.uconn.edu) is an online database for identifying new minimotifs in protein queries. Minimotifs are short contiguous peptide sequences that have a known function in at least one protein. Here we report the third release of the MnM database which has now grown 60-fold to approximately 300,000 minimotifs. Since short minimotifs are by their nature not very complex we also summarize a new set of false-positive filters and linear regression scoring that vastly enhance minimotif prediction accuracy on a test data set. This online database can be used to predict new functions in proteins and causes of disease.

  11. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  12. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  13. Nature and distribution of feline sarcoma virus nucleotide sequences.

    Science.gov (United States)

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  14. Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

    Directory of Open Access Journals (Sweden)

    Suravajhala P

    2017-06-01

    Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

  15. Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

    Science.gov (United States)

    : Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

  16. Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

    Science.gov (United States)

    Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

    2014-11-01

    As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of

  17. Transcript-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Allen, Alexandra M; Barker, Gary L A; Berry, Simon T; Coghill, Jane A; Gwilliam, Rhian; Kirby, Susan; Robinson, Phil; Brenchley, Rachel C; D'Amore, Rosalinda; McKenzie, Neil; Waite, Darren; Hall, Anthony; Bevan, Michael; Hall, Neil; Edwards, Keith J

    2011-12-01

    Food security is a global concern and substantial yield increases in cereal crops are required to feed the growing world population. Wheat is one of the three most important crops for human and livestock feed. However, the complexity of the genome coupled with a decline in genetic diversity within modern elite cultivars has hindered the application of marker-assisted selection (MAS) in breeding programmes. A crucial step in the successful application of MAS in breeding programmes is the development of cheap and easy to use molecular markers, such as single-nucleotide polymorphisms. To mine selected elite wheat germplasm for intervarietal single-nucleotide polymorphisms, we have used expressed sequence tags derived from public sequencing programmes and next-generation sequencing of normalized wheat complementary DNA libraries, in combination with a novel sequence alignment and assembly approach. Here, we describe the development and validation of a panel of 1114 single-nucleotide polymorphisms in hexaploid bread wheat using competitive allele-specific polymerase chain reaction genotyping technology. We report the genotyping results of these markers on 23 wheat varieties, selected to represent a broad cross-section of wheat germplasm including a number of elite UK varieties. Finally, we show that, using relatively simple technology, it is possible to rapidly generate a linkage map containing several hundred single-nucleotide polymorphism markers in the doubled haploid mapping population of Avalon × Cadenza. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  18. Database Description - AcEST | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name AcEST Alternative n...hi, Tokyo-to 192-0397 Tel: +81-42-677-1111(ext.3654) E-mail: Database classificat...eneris Taxonomy ID: 13818 Database description This is a database of EST sequences of Adiantum capillus-vene...(3): 223-227. External Links: Original website information Database maintenance site Plant Environmental Res...base Database Description Download License Update History of This Database Site Policy | Contact Us Database Description - AcEST | LSDB Archive ...

  19. Complete nucleotide sequence of pGA45, a 140,698-bp incFIIY plasmid encoding blaIMI-3-mediated carbapenem resistance, from river sediment

    Directory of Open Access Journals (Sweden)

    Bingjun eDang

    2016-02-01

    Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.

  20. Nostoc PCC7524, a cyanobacterium which contains five sequence-specific deoxyribonucleases

    NARCIS (Netherlands)

    Reaston, J.; Duybesteyn, M.G.C.; Waard, Adrian de

    1982-01-01

    Five nucleotide sequence-specific deoxyribonucleases present in cell-free extracts of the filamentous cyanobacterium Nostoc PCC7524 have been purified and characterized. One of these enzymes, designated Nsp(7524)I cleaves at a new kind of nucleotide sequence i.e. 5'-PuCATG λ Py-3'. The other four

  1. Recurrence plot analysis of DNA sequences

    Energy Technology Data Exchange (ETDEWEB)

    Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn

    2004-11-15

    Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.

  2. Base-By-Base: single nucleotide-level analysis of whole viral genome alignments.

    Science.gov (United States)

    Brodie, Ryan; Smith, Alex J; Roper, Rachel L; Tcherepanov, Vasily; Upton, Chris

    2004-07-14

    With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes) is not feasible without new bioinformatics tools. A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1) rapidly identify and correct alignment errors in large, multiple genome alignments; and 2) generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs) to retrieve detailed annotation information about the aligned genomes or use information from text files. Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  3. Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

    Science.gov (United States)

    Guo, D; Maiss, E; Adam, G; Casper, R

    1995-05-01

    The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

  4. BioWarehouse: a bioinformatics database warehouse toolkit.

    Science.gov (United States)

    Lee, Thomas J; Pouliot, Yannick; Wagner, Valerie; Gupta, Priyanka; Stringer-Calvert, David W J; Tenenbaum, Jessica D; Karp, Peter D

    2006-03-23

    This article addresses the problem of interoperation of heterogeneous bioinformatics databases. We introduce BioWarehouse, an open source toolkit for constructing bioinformatics database warehouses using the MySQL and Oracle relational database managers. BioWarehouse integrates its component databases into a common representational framework within a single database management system, thus enabling multi-database queries using the Structured Query Language (SQL) but also facilitating a variety of database integration tasks such as comparative analysis and data mining. BioWarehouse currently supports the integration of a pathway-centric set of databases including ENZYME, KEGG, and BioCyc, and in addition the UniProt, GenBank, NCBI Taxonomy, and CMR databases, and the Gene Ontology. Loader tools, written in the C and JAVA languages, parse and load these databases into a relational database schema. The loaders also apply a degree of semantic normalization to their respective source data, decreasing semantic heterogeneity. The schema supports the following bioinformatics datatypes: chemical compounds, biochemical reactions, metabolic pathways, proteins, genes, nucleic acid sequences, features on protein and nucleic-acid sequences, organisms, organism taxonomies, and controlled vocabularies. As an application example, we applied BioWarehouse to determine the fraction of biochemically characterized enzyme activities for which no sequences exist in the public sequence databases. The answer is that no sequence exists for 36% of enzyme activities for which EC numbers have been assigned. These gaps in sequence data significantly limit the accuracy of genome annotation and metabolic pathway prediction, and are a barrier for metabolic engineering. Complex queries of this type provide examples of the value of the data warehousing approach to bioinformatics research. BioWarehouse embodies significant progress on the database integration problem for bioinformatics.

  5. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    Science.gov (United States)

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

  6. The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

    Science.gov (United States)

    Nallaseth, Ferez Soli

    The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1

  7. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  8. Serological and genetic characterisation of bovine respiratory syncytial virus (BRSV) indicates that Danish isolates belong to the intermediate subgroup: no evidence of a selective effect on the variability of G protein nucleotide sequence by prior cell culture adaption and passages in cell culture

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.

    1998-01-01

    on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar......Danish isolates of bovine respiratory syncytial virus (BRSV) were characterised by nucleotide sequencing of the G glycoprotein and by their reactivity with a panel of monoclonal antibodies (MAbs). Among the six Danish isolates, the overall sequence divergence ranged between 0 and 3...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...

  9. Detection of a divergent variant of grapevine virus F by next-generation sequencing.

    Science.gov (United States)

    Molenaar, Nicholas; Burger, Johan T; Maree, Hans J

    2015-08-01

    The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).

  10. Predicting protein-binding RNA nucleotides with consideration of binding partners.

    Science.gov (United States)

    Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook

    2015-06-01

    In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in

  11. FALDO: a semantic standard for describing the location of nucleotide and protein feature annotation.

    Science.gov (United States)

    Bolleman, Jerven T; Mungall, Christopher J; Strozzi, Francesco; Baran, Joachim; Dumontier, Michel; Bonnal, Raoul J P; Buels, Robert; Hoehndorf, Robert; Fujisawa, Takatomo; Katayama, Toshiaki; Cock, Peter J A

    2016-06-13

    Nucleotide and protein sequence feature annotations are essential to understand biology on the genomic, transcriptomic, and proteomic level. Using Semantic Web technologies to query biological annotations, there was no standard that described this potentially complex location information as subject-predicate-object triples. We have developed an ontology, the Feature Annotation Location Description Ontology (FALDO), to describe the positions of annotated features on linear and circular sequences. FALDO can be used to describe nucleotide features in sequence records, protein annotations, and glycan binding sites, among other features in coordinate systems of the aforementioned "omics" areas. Using the same data format to represent sequence positions that are independent of file formats allows us to integrate sequence data from multiple sources and data types. The genome browser JBrowse is used to demonstrate accessing multiple SPARQL endpoints to display genomic feature annotations, as well as protein annotations from UniProt mapped to genomic locations. Our ontology allows users to uniformly describe - and potentially merge - sequence annotations from multiple sources. Data sources using FALDO can prospectively be retrieved using federalised SPARQL queries against public SPARQL endpoints and/or local private triple stores.

  12. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  13. A Long-Read Transcriptome Assembly of Cotton (Gossypium hirsutum L. and Intraspecific Single Nucleotide Polymorphism Discovery

    Directory of Open Access Journals (Sweden)

    Hamid Ashrafi

    2015-07-01

    Full Text Available Upland cotton ( L. has a narrow germplasm base, which constrains marker development and hampers intraspecific breeding. A pressing need exists for high-throughput single nucleotide polymorphism (SNP markers that can be readily applied to germplasm in breeding and breeding-related research programs. Despite progress made in developing new sequencing technologies during the past decade, the cost of sequencing remains substantial when one is dealing with numerous samples and large genomes. Several strategies have been proposed to lower the cost of sequencing for multiple genotypes of large-genome species like cotton, such as transcriptome sequencing and reduced-representation DNA sequencing. This paper reports the development of a transcriptome assembly of the inbred line Texas Marker-1 (TM-1, a genetic standard for cotton, its usefulness as a reference for RNA sequencing (RNA-seq-based SNP identification, and the availability of transcriptome sequences of four other cotton cultivars. An assembly of TM-1 was made using Roche 454 transcriptome reads combined with an assembly of all available public expressed sequence tag (EST sequences of TM-1. The TM-1 assembly consists of 72,450 contigs with a total of 70 million bp. Functional predictions of the transcripts were estimated by alignment to selected protein databases. Transcriptome sequences of the five lines, including TM-1, were obtained using an Illumina Genome Analyzer-II, and the short reads were mapped to the TM-1 assembly to discover SNPs among the five lines. We identified >14,000 unfiltered allelic SNPs, of which ∼3,700 SNPs were retained for assay development after applying several rigorous filters. This paper reports availability of the reference transcriptome assembly and shows its utility in developing intraspecific SNP markers in upland cotton.

  14. BioWarehouse: a bioinformatics database warehouse toolkit

    Directory of Open Access Journals (Sweden)

    Stringer-Calvert David WJ

    2006-03-01

    Full Text Available Abstract Background This article addresses the problem of interoperation of heterogeneous bioinformatics databases. Results We introduce BioWarehouse, an open source toolkit for constructing bioinformatics database warehouses using the MySQL and Oracle relational database managers. BioWarehouse integrates its component databases into a common representational framework within a single database management system, thus enabling multi-database queries using the Structured Query Language (SQL but also facilitating a variety of database integration tasks such as comparative analysis and data mining. BioWarehouse currently supports the integration of a pathway-centric set of databases including ENZYME, KEGG, and BioCyc, and in addition the UniProt, GenBank, NCBI Taxonomy, and CMR databases, and the Gene Ontology. Loader tools, written in the C and JAVA languages, parse and load these databases into a relational database schema. The loaders also apply a degree of semantic normalization to their respective source data, decreasing semantic heterogeneity. The schema supports the following bioinformatics datatypes: chemical compounds, biochemical reactions, metabolic pathways, proteins, genes, nucleic acid sequences, features on protein and nucleic-acid sequences, organisms, organism taxonomies, and controlled vocabularies. As an application example, we applied BioWarehouse to determine the fraction of biochemically characterized enzyme activities for which no sequences exist in the public sequence databases. The answer is that no sequence exists for 36% of enzyme activities for which EC numbers have been assigned. These gaps in sequence data significantly limit the accuracy of genome annotation and metabolic pathway prediction, and are a barrier for metabolic engineering. Complex queries of this type provide examples of the value of the data warehousing approach to bioinformatics research. Conclusion BioWarehouse embodies significant progress on the

  15. Database Description - eSOL | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available base Description General information of database Database name eSOL Alternative nam...eator Affiliation: The Research and Development of Biological Databases Project, National Institute of Genet...nology 4259 Nagatsuta-cho, Midori-ku, Yokohama, Kanagawa 226-8501 Japan Email: Tel.: +81-45-924-5785 Database... classification Protein sequence databases - Protein properties Organism Taxonomy Name: Escherichia coli Taxonomy ID: 562 Database...i U S A. 2009 Mar 17;106(11):4201-6. External Links: Original website information Database maintenance site

  16. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  17. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  18. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...

  19. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  20. Sequencing and characterization of the guppy (Poecilia reticulata transcriptome

    Directory of Open Access Journals (Sweden)

    Rodd F Helen

    2011-04-01

    Full Text Available Abstract Background Next-generation sequencing is providing researchers with a relatively fast and affordable option for developing genomic resources for organisms that are not among the traditional genetic models. Here we present a de novo assembly of the guppy (Poecilia reticulata transcriptome using 454 sequence reads, and we evaluate potential uses of this transcriptome, including detection of sex-specific transcripts and deployment as a reference for gene expression analysis in guppies and a related species. Guppies have been model organisms in ecology, evolutionary biology, and animal behaviour for over 100 years. An annotated transcriptome and other genomic tools will facilitate understanding the genetic and molecular bases of adaptation and variation in a vertebrate species with a uniquely well known natural history. Results We generated approximately 336 Mbp of mRNA sequence data from male brain, male body, female brain, and female body. The resulting 1,162,670 reads assembled into 54,921 contigs, creating a reference transcriptome for the guppy with an average read depth of 28×. We annotated nearly 40% of this reference transcriptome by searching protein and gene ontology databases. Using this annotated transcriptome database, we identified candidate genes of interest to the guppy research community, putative single nucleotide polymorphisms (SNPs, and male-specific expressed genes. We also showed that our reference transcriptome can be used for RNA-sequencing-based analysis of differential gene expression. We identified transcripts that, in juveniles, are regulated differently in the presence and absence of an important predator, Rivulus hartii, including two genes implicated in stress response. For each sample in the RNA-seq study, >50% of high-quality reads mapped to unique sequences in the reference database with high confidence. In addition, we evaluated the use of the guppy reference transcriptome for gene expression analyses in

  1. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  2. NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

    Directory of Open Access Journals (Sweden)

    Lakshya Veer Singh

    2013-06-01

    Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

  3. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L

    2011-06-01

    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  4. Interference of Homologous Sequences on the SNP Study of CYP2A13 Gene

    Directory of Open Access Journals (Sweden)

    Qinghua ZHOU

    2010-02-01

    Full Text Available Background and objective It has been proven that cytochrome P450 enzyme 2A13 (CYP2A13 played an important role in the association between single nucleotide polymorphisms (SNP and human diseases. Cytochrome P450 enzymes are a group of isoenzymes, whose sequence homology may interfere with the study for SNP. The aim of this study is to explore the interference on the SNP study of CYP2A13 caused by homologous sequences. Methods Taqman probe was applied to detect distribution of rs8192789 sites in 573 subjects, and BLAST method was used to analyze the amplified sequences. Partial sequences of CYP2A13 were emplified by PCR from 60 cases. The emplified sequences were TA cloned and sequenced. Results For rs8192789 loci in 573 cases, only 3 cases were TT, while the rest were CT heterozygotes, which was caused by homologous sequences. There are a large number of overlapping peaks in identical sequences of 60 cases, and the SNP of 101 amino acid site reported in the SNP database is not found. The cloned sequences are 247 bp, 235 bp fragments. Conclusion The homologous sequences may interfere the study for SNP of CYP2A13, and some SNP may not exist.

  5. Genetic differentiation between fake abalone and genuine Haliotis species using the forensically informative nucleotide sequencing (FINS) method.

    Science.gov (United States)

    Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S

    2011-05-25

    Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.

  6. The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3.

    Science.gov (United States)

    Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio

    2005-12-20

    Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.

  7. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  8. Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

    Science.gov (United States)

    Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

    2017-07-01

    DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

  9. Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.

    Science.gov (United States)

    Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng

    2017-07-01

    The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.

  10. Nucleotide and deduced amino acid sequence of the envelope gene of the Vasilchenko strain of TBE virus; comparison with other flaviviruses.

    Science.gov (United States)

    Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A

    1993-02-01

    A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.

  11. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    Directory of Open Access Journals (Sweden)

    Jonas Binladen

    2007-02-01

    Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

  12. BlockLogo: Visualization of peptide and sequence motif conservation

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Kudahl, Ulrich Johan; Simon, Christian

    2013-01-01

    BlockLogo is a web-server application for the visualization of protein and nucleotide fragments, continuous protein sequence motifs, and discontinuous sequence motifs using calculation of block entropy from multiple sequence alignments. The user input consists of a multiple sequence alignment, se...

  13. Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

    International Nuclear Information System (INIS)

    Xiong Gang; Wang, X.R.

    2005-01-01

    The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

  14. The mitochondrial genome sequence of the ciliate Paramecium caudatum reveals a shift in nucleotide composition and codon usage within the genus Paramecium

    Directory of Open Access Journals (Sweden)

    Berendonk Thomas U

    2011-05-01

    Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino

  15. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  16. Characterization of Liaoning cashmere goat transcriptome: sequencing, de novo assembly, functional annotation and comparative analysis.

    Directory of Open Access Journals (Sweden)

    Hongliang Liu

    Full Text Available Liaoning cashmere goat is a famous goat breed for cashmere wool. In order to increase the transcriptome data and accelerate genetic improvement for this breed, we performed de novo transcriptome sequencing to generate the first expressed sequence tag dataset for the Liaoning cashmere goat, using next-generation sequencing technology.Transcriptome sequencing of Liaoning cashmere goat on a Roche 454 platform yielded 804,601 high-quality reads. Clustering and assembly of these reads produced a non-redundant set of 117,854 unigenes, comprising 13,194 isotigs and 104,660 singletons. Based on similarity searches with known proteins, 17,356 unigenes were assigned to 6,700 GO categories, and the terms were summarized into three main GO categories and 59 sub-categories. 3,548 and 46,778 unigenes had significant similarity to existing sequences in the KEGG and COG databases, respectively. Comparative analysis revealed that 42,254 unigenes were aligned to 17,532 different sequences in NCBI non-redundant nucleotide databases. 97,236 (82.51% unigenes were mapped to the 30 goat chromosomes. 35,551 (30.17% unigenes were matched to 11,438 reported goat protein-coding genes. The remaining non-matched unigenes were further compared with cattle and human reference genes, 67 putative new goat genes were discovered. Additionally, 2,781 potential simple sequence repeats were initially identified from all unigenes.The transcriptome of Liaoning cashmere goat was deep sequenced, de novo assembled, and annotated, providing abundant data to better understand the Liaoning cashmere goat transcriptome. The potential simple sequence repeats provide a material basis for future genetic linkage and quantitative trait loci analyses.

  17. Rfam: updates to the RNA families database

    DEFF Research Database (Denmark)

    Gardner, Paul P; Daub, Jennifer; Tate, John G

    2008-01-01

    Rfam is a collection of RNA sequence families, represented by multiple sequence alignments and covariance models (CMs). The primary aim of Rfam is to annotate new members of known RNA families on nucleotide sequences, particularly complete genomes, using sensitive BLAST filters in combination...... to the website, methodologies and data used by Rfam are discussed. Rfam is freely available on the Web at http://rfam.sanger.ac.uk/and http://rfam.janelia.org/....

  18. AcEST(EST sequences of Adiantum capillus-veneris and their annotation) - AcEST | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us AcEST AcEST(EST sequences of Adiantum capillus-veneris and their annotation) Data detail Dat...a name AcEST(EST sequences of Adiantum capillus-veneris and their annotation) DOI 10.18908/lsdba.nbdc00839-0...01 Description of data contents EST sequence of Adiantum capillus-veneris and its annotation (clone ID, libr...le search URL http://togodb.biosciencedbc.jp/togodb/view/archive_acest#en Data acquisition method Capillary ...ainst UniProtKB/Swiss-Prot and UniProtKB/TrEMBL databases) Number of data entries Adiantum capillus-veneris

  19. GOBASE: an organelle genome database

    OpenAIRE

    O?Brien, Emmet A.; Zhang, Yue; Wang, Eric; Marie, Veronique; Badejoko, Wole; Lang, B. Franz; Burger, Gertraud

    2008-01-01

    The organelle genome database GOBASE, now in its 21st release (June 2008), contains all published mitochondrion-encoded sequences (?913 000) and chloroplast-encoded sequences (?250 000) from a wide range of eukaryotic taxa. For all sequences, information on related genes, exons, introns, gene products and taxonomy is available, as well as selected genome maps and RNA secondary structures. Recent major enhancements to database functionality include: (i) addition of an interface for RNA editing...

  20. Base-By-Base: Single nucleotide-level analysis of whole viral genome alignments

    Directory of Open Access Journals (Sweden)

    Tcherepanov Vasily

    2004-07-01

    Full Text Available Abstract Background With ever increasing numbers of closely related virus genomes being sequenced, it has become desirable to be able to compare two genomes at a level more detailed than gene content because two strains of an organism may share the same set of predicted genes but still differ in their pathogenicity profiles. For example, detailed comparison of multiple isolates of the smallpox virus genome (each approximately 200 kb, with 200 genes is not feasible without new bioinformatics tools. Results A software package, Base-By-Base, has been developed that provides visualization tools to enable researchers to 1 rapidly identify and correct alignment errors in large, multiple genome alignments; and 2 generate tabular and graphical output of differences between the genomes at the nucleotide level. Base-By-Base uses detailed annotation information about the aligned genomes and can list each predicted gene with nucleotide differences, display whether variations occur within promoter regions or coding regions and whether these changes result in amino acid substitutions. Base-By-Base can connect to our mySQL database (Virus Orthologous Clusters; VOCs to retrieve detailed annotation information about the aligned genomes or use information from text files. Conclusion Base-By-Base enables users to quickly and easily compare large viral genomes; it highlights small differences that may be responsible for important phenotypic differences such as virulence. It is available via the Internet using Java Web Start and runs on Macintosh, PC and Linux operating systems with the Java 1.4 virtual machine.

  1. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  2. Brassica ASTRA: an integrated database for Brassica genomic research.

    Science.gov (United States)

    Love, Christopher G; Robinson, Andrew J; Lim, Geraldine A C; Hopkins, Clare J; Batley, Jacqueline; Barker, Gary; Spangenberg, German C; Edwards, David

    2005-01-01

    Brassica ASTRA is a public database for genomic information on Brassica species. The database incorporates expressed sequences with Swiss-Prot and GenBank comparative sequence annotation as well as secondary Gene Ontology (GO) annotation derived from the comparison with Arabidopsis TAIR GO annotations. Simple sequence repeat molecular markers are identified within resident sequences and mapped onto the closely related Arabidopsis genome sequence. Bacterial artificial chromosome (BAC) end sequences derived from the Multinational Brassica Genome Project are also mapped onto the Arabidopsis genome sequence enabling users to identify candidate Brassica BACs corresponding to syntenic regions of Arabidopsis. This information is maintained in a MySQL database with a web interface providing the primary means of interrogation. The database is accessible at http://hornbill.cspp.latrobe.edu.au.

  3. Optimization of sequence alignment for simple sequence repeat regions

    Directory of Open Access Journals (Sweden)

    Ogbonnaya Francis C

    2011-07-01

    Full Text Available Abstract Background Microsatellites, or simple sequence repeats (SSRs, are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs. SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. Findings To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type. When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. Conclusions The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic

  4. Sequence-specific bias correction for RNA-seq data using recurrent neural networks.

    Science.gov (United States)

    Zhang, Yao-Zhong; Yamaguchi, Rui; Imoto, Seiya; Miyano, Satoru

    2017-01-25

    The recent success of deep learning techniques in machine learning and artificial intelligence has stimulated a great deal of interest among bioinformaticians, who now wish to bring the power of deep learning to bare on a host of bioinformatical problems. Deep learning is ideally suited for biological problems that require automatic or hierarchical feature representation for biological data when prior knowledge is limited. In this work, we address the sequence-specific bias correction problem for RNA-seq data redusing Recurrent Neural Networks (RNNs) to model nucleotide sequences without pre-determining sequence structures. The sequence-specific bias of a read is then calculated based on the sequence probabilities estimated by RNNs, and used in the estimation of gene abundance. We explore the application of two popular RNN recurrent units for this task and demonstrate that RNN-based approaches provide a flexible way to model nucleotide sequences without knowledge of predetermined sequence structures. Our experiments show that training a RNN-based nucleotide sequence model is efficient and RNN-based bias correction methods compare well with the-state-of-the-art sequence-specific bias correction method on the commonly used MAQC-III data set. RNNs provides an alternative and flexible way to calculate sequence-specific bias without explicitly pre-determining sequence structures.

  5. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  6. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  7. MG-Digger: an automated pipeline to search for giant virus-related sequences in metagenomes

    Directory of Open Access Journals (Sweden)

    Jonathan eVerneau

    2016-03-01

    Full Text Available The number of metagenomic studies conducted each year is growing dramatically. Storage and analysis of such big data is difficult and time-consuming. Interestingly, analysis shows that environmental and human metagenomes include a significant amount of non-annotated sequences, representing a ‘dark matter’. We established a bioinformatics pipeline that automatically detects metagenome reads matching query sequences from a given set and applied this tool to the detection of sequences matching large and giant DNA viral members of the proposed order Megavirales or virophages. A total of 1,045 environmental and human metagenomes (≈ 1 Terabase pairs were collected, processed and stored on our bioinformatics server. In addition, nucleotide and protein sequences from 93 Megavirales representatives, including 19 giant viruses of amoeba, and five virophages, were collected. The pipeline was generated by scripts written in Python language and entitled MG-Digger. Metagenomes previously found to contain megavirus-like sequences were tested as controls. MG-Digger was able to annotate hundreds of metagenome sequences as best matching those of giant viruses. These sequences were most often found to be similar to phycodnavirus or mimivirus sequences, but included reads related to recently available pandoraviruses, Pithovirus sibericum, and faustoviruses. Compared to other tools, MG-Digger combined stand-alone use on Linux or Windows operating systems through a user-friendly interface, implementation of ready-to-use customized metagenome databases and query sequence databases, adjustable parameters for BLAST searches, and creation of output files containing selected reads with best match identification. Compared to Metavir 2, a reference tool in viral metagenome analysis, MG-Digger detected 8% more true positive Megavirales-related reads in a control metagenome. The present work shows that massive, automated and recurrent analyses of metagenomes are

  8. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    Science.gov (United States)

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  9. MerCat: a versatile k-mer counter and diversity estimator for database-independent property analysis obtained from metagenomic and/or metatranscriptomic sequencing data

    Energy Technology Data Exchange (ETDEWEB)

    White, Richard A.; Panyala, Ajay R.; Glass, Kevin A.; Colby, Sean M.; Glaesemann, Kurt R.; Jansson, Georg C.; Jansson, Janet K.

    2017-02-21

    MerCat is a parallel, highly scalable and modular property software package for robust analysis of features in next-generation sequencing data. MerCat inputs include assembled contigs and raw sequence reads from any platform resulting in feature abundance counts tables. MerCat allows for direct analysis of data properties without reference sequence database dependency commonly used by search tools such as BLAST and/or DIAMOND for compositional analysis of whole community shotgun sequencing (e.g. metagenomes and metatranscriptomes).

  10. Protein backbone chemical shifts predicted from searching a database for torsion angle and sequence homology

    International Nuclear Information System (INIS)

    Shen Yang; Bax, Ad

    2007-01-01

    Chemical shifts of nuclei in or attached to a protein backbone are exquisitely sensitive to their local environment. A computer program, SPARTA, is described that uses this correlation with local structure to predict protein backbone chemical shifts, given an input three-dimensional structure, by searching a newly generated database for triplets of adjacent residues that provide the best match in φ/ψ/χ 1 torsion angles and sequence similarity to the query triplet of interest. The database contains 15 N, 1 H N , 1 H α , 13 C α , 13 C β and 13 C' chemical shifts for 200 proteins for which a high resolution X-ray (≤2.4 A) structure is available. The relative importance of the weighting factors for the φ/ψ/χ 1 angles and sequence similarity was optimized empirically. The weighted, average secondary shifts of the central residues in the 20 best-matching triplets, after inclusion of nearest neighbor, ring current, and hydrogen bonding effects, are used to predict chemical shifts for the protein of known structure. Validation shows good agreement between the SPARTA-predicted and experimental shifts, with standard deviations of 2.52, 0.51, 0.27, 0.98, 1.07 and 1.08 ppm for 15 N, 1 H N , 1 H α , 13 C α , 13 C β and 13 C', respectively, including outliers

  11. Improving taxonomic accuracy for fungi in public sequence databases: applying ‘one name one species’ in well-defined genera with Trichoderma/Hypocrea as a test case

    Science.gov (United States)

    Strope, Pooja K; Chaverri, Priscila; Gazis, Romina; Ciufo, Stacy; Domrachev, Michael; Schoch, Conrad L

    2017-01-01

    Abstract The ITS (nuclear ribosomal internal transcribed spacer) RefSeq database at the National Center for Biotechnology Information (NCBI) is dedicated to the clear association between name, specimen and sequence data. This database is focused on sequences obtained from type material stored in public collections. While the initial ITS sequence curation effort together with numerous fungal taxonomy experts attempted to cover as many orders as possible, we extended our latest focus to the family and genus ranks. We focused on Trichoderma for several reasons, mainly because the asexual and sexual synonyms were well documented, and a list of proposed names and type material were recently proposed and published. In this case study the recent taxonomic information was applied to do a complete taxonomic audit for the genus Trichoderma in the NCBI Taxonomy database. A name status report is available here: https://www.ncbi.nlm.nih.gov/Taxonomy/TaxIdentifier/tax_identifier.cgi. As a result, the ITS RefSeq Targeted Loci database at NCBI has been augmented with more sequences from type and verified material from Trichoderma species. Additionally, to aid in the cross referencing of data from single loci and genomes we have collected a list of quality records of the RPB2 gene obtained from type material in GenBank that could help validate future submissions. During the process of curation misidentified genomes were discovered, and sequence records from type material were found hidden under previous classifications. Source metadata curation, although more cumbersome, proved to be useful as confirmation of the type material designation. Database URL: http://www.ncbi.nlm.nih.gov/bioproject/PRJNA177353 PMID:29220466

  12. Simulating efficiently the evolution of DNA sequences.

    Science.gov (United States)

    Schöniger, M; von Haeseler, A

    1995-02-01

    Two menu-driven FORTRAN programs are described that simulate the evolution of DNA sequences in accordance with a user-specified model. This general stochastic model allows for an arbitrary stationary nucleotide composition and any transition-transversion bias during the process of base substitution. In addition, the user may define any hypothetical model tree according to which a family of sequences evolves. The programs suggest the computationally most inexpensive approach to generate nucleotide substitutions. Either reproducible or non-repeatable simulations, depending on the method of initializing the pseudo-random number generator, can be performed. The corresponding options are offered by the interface menu.

  13. Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

    International Nuclear Information System (INIS)

    Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.

    2003-01-01

    Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

  14. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Gilbert Gwendolyn L

    2008-08-01

    Full Text Available Abstract Background Streptococcus agalactiae (Group B Streptococcus (GBS is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP based method for assigning GBS isolates to multilocus sequence typing (MLST-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  15. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms.

    Science.gov (United States)

    Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

    2008-08-19

    Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  16. An Integrated Molecular Database on Indian Insects.

    Science.gov (United States)

    Pratheepa, Maria; Venkatesan, Thiruvengadam; Gracy, Gandhi; Jalali, Sushil Kumar; Rangheswaran, Rajagopal; Antony, Jomin Cruz; Rai, Anil

    2018-01-01

    MOlecular Database on Indian Insects (MODII) is an online database linking several databases like Insect Pest Info, Insect Barcode Information System (IBIn), Insect Whole Genome sequence, Other Genomic Resources of National Bureau of Agricultural Insect Resources (NBAIR), Whole Genome sequencing of Honey bee viruses, Insecticide resistance gene database and Genomic tools. This database was developed with a holistic approach for collecting information about phenomic and genomic information of agriculturally important insects. This insect resource database is available online for free at http://cib.res.in. http://cib.res.in/.

  17. Improvements in the HbVar database of human hemoglobin variants and thalassemia mutations for population and sequence variation studies.

    NARCIS (Netherlands)

    G.P. Patrinos (George); B. Giardine (Belinda); C. Riemer (Cathy); W. Miller (Webb); D.H. Chui (David); N.P. Anagnou (Nicholas); H. Wajcman (Henri); R.C. Hardison (Ross)

    2004-01-01

    textabstractHbVar (http://globin.cse.psu.edu/globin/hbvar/) is a relational database developed by a multi-center academic effort to provide up-to-date and high quality information on the genomic sequence changes leading to hemoglobin variants and all types of thalassemia and

  18. DMPD: Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of health and disease. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available and nucleotide oligomerisation domain inthe regulation of health and disease. Pu...bmedID 17535871 Title Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of health...17535871 Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of heal...th and disease. Mitchell JA, Paul-Clark MJ, Clarke GW, McMaster SK, Cartwright N. J

  19. Recovering probabilities for nucleotide trimming processes for T cell receptor TRA and TRG V-J junctions analyzed with IMGT tools

    Directory of Open Access Journals (Sweden)

    Lefranc Marie-Paule

    2008-10-01

    Full Text Available Abstract Background Nucleotides are trimmed from the ends of variable (V, diversity (D and joining (J genes during immunoglobulin (IG and T cell receptor (TR rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT® sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output". However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." Results A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA and TR gamma (TRG V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT®, the international ImMunoGeneTics information system®, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. Conclusion By

  20. Recovering probabilities for nucleotide trimming processes for T cell receptor TRA and TRG V-J junctions analyzed with IMGT tools.

    Science.gov (United States)

    Bleakley, Kevin; Lefranc, Marie-Paule; Biau, Gérard

    2008-10-02

    Nucleotides are trimmed from the ends of variable (V), diversity (D) and joining (J) genes during immunoglobulin (IG) and T cell receptor (TR) rearrangements in B cells and T cells of the immune system. This trimming is followed by addition of nucleotides at random, forming the N regions (N for nucleotides) of the V-J and V-D-J junctions. These processes are crucial for creating diversity in the immune response since the number of trimmed nucleotides and the number of added nucleotides vary in each B or T cell. IMGT sequence analysis tools, IMGT/V-QUEST and IMGT/JunctionAnalysis, are able to provide detailed and accurate analysis of the final observed junction nucleotide sequences (tool "output"). However, as trimmed nucleotides can potentially be replaced by identical N region nucleotides during the process, the observed "output" represents a biased estimate of the "true trimming process." A probabilistic approach based on an analysis of the standardized tool "output" is proposed to infer the probability distribution of the "true trimmming process" and to provide plausible biological hypotheses explaining this process. We collated a benchmark dataset of TR alpha (TRA) and TR gamma (TRG) V-J rearranged sequences and junctions analysed with IMGT/V-QUEST and IMGT/JunctionAnalysis, the nucleotide sequence analysis tools from IMGT, the international ImMunoGeneTics information system, http://imgt.cines.fr. The standardized description of the tool output is based on the IMGT-ONTOLOGY axioms and concepts. We propose a simple first-order model that attempts to transform the observed "output" probability distribution into an estimate closer to the "true trimming process" probability distribution. We use this estimate to test the hypothesis that Poisson processes are involved in trimming. This hypothesis was not rejected at standard confidence levels for three of the four trimming processes: TRAV, TRAJ and TRGV. By using trimming of rearranged TR genes as a benchmark, we

  1. REDIdb: the RNA editing database.

    Science.gov (United States)

    Picardi, Ernesto; Regina, Teresa Maria Rosaria; Brennicke, Axel; Quagliariello, Carla

    2007-01-01

    The RNA Editing Database (REDIdb) is an interactive, web-based database created and designed with the aim to allocate RNA editing events such as substitutions, insertions and deletions occurring in a wide range of organisms. The database contains both fully and partially sequenced DNA molecules for which editing information is available either by experimental inspection (in vitro) or by computational detection (in silico). Each record of REDIdb is organized in a specific flat-file containing a description of the main characteristics of the entry, a feature table with the editing events and related details and a sequence zone with both the genomic sequence and the corresponding edited transcript. REDIdb is a relational database in which the browsing and identification of editing sites has been simplified by means of two facilities to either graphically display genomic or cDNA sequences or to show the corresponding alignment. In both cases, all editing sites are highlighted in colour and their relative positions are detailed by mousing over. New editing positions can be directly submitted to REDIdb after a user-specific registration to obtain authorized secure access. This first version of REDIdb database stores 9964 editing events and can be freely queried at http://biologia.unical.it/py_script/search.html.

  2. Exome sequencing of a pedigree with Tourette syndrome or chronic tic disorder.

    Science.gov (United States)

    Sundaram, Senthil K; Huq, Ahm M; Sun, Zhen; Yu, Wu; Bennett, Lindsey; Wilson, Benjamin J; Behen, Michael E; Chugani, Harry T

    2011-05-01

    Ten members of a 3-generation pedigree with 7 showing Tourette syndrome/chronic tic phenotype (TS-CTD) were evaluated with whole exome sequencing. We identified 3 novel, nonsynonymous single nucleotide variants in the MRPL3, DNAJC13, and OFCC1 genes that segregated with chronic tic phenotype. These variants were not present in 100 control subjects or in dbSNP/1000 Genomes databases. A novel variant in the 5' untranslated region of the OFCC1 gene was found in 2 TS-CTD patients from a different pedigree. Further studies will clarify the importance of variants in MRPL3, DNAJC13, and OFCC1 genes in TS. Copyright © 2011 American Neurological Association.

  3. Sequence variation and phylogenetic analysis of envelope glycoprotein of hepatitis G virus.

    Science.gov (United States)

    Lim, M Y; Fry, K; Yun, A; Chong, S; Linnen, J; Fung, K; Kim, J P

    1997-11-01

    A transfusion-transmissible agent provisionally designated hepatitis G virus (HGV) was recently identified. In this study, we examined the variability of the HGV genome by analysing sequences in the putative envelope region from 72 isolates obtained from diverse geographical sources. The 1561 nucleotide sequence of the E1/E2/NS2a region of HGV was determined from 12 isolates, and compared with three published sequences. The most variability was observed in 400 nucleotides at the N terminus of E2. We next analysed this 400 nucleotide envelope variable region (EV) from an additional 60 HGV isolates. This sequence varied considerably among the 75 isolates, with overall identity ranging from 79.3% to 99.5% at the nucleotide level, and from 83.5% to 100% at the amino acid level. However, hypervariable regions were not identified. Phylogenetic analyses indicated that the 75 HGV isolates belong to a single genotype. A single-tier distribution of evolutionary distances was observed among the 15 E1/E2/NS2a sequences and the 75 EV sequences. In contrast, 11 isolates of HCV were analysed and showed a three-tiered distribution, representing genotypes, subtypes, and isolates. The 75 isolates of HGV fell into four clusters on the phylogenetic tree. Tight geographical clustering was observed among the HGV isolates from Japan and Korea.

  4. Transcriptome characterization of the South African abalone Haliotis midae using sequencing-by-synthesis

    Directory of Open Access Journals (Sweden)

    Roodt-Wilding Rouvay

    2011-03-01

    Full Text Available Abstract Background Worldwide, the genus Haliotis is represented by 56 extant species and several of these are commercially cultured. Among the six abalone species found in South Africa, Haliotis midae is the only aquacultured species. Despite its economic importance, genomic sequence resources for H. midae, and for abalone in general, are still scarce. Next generation sequencing technologies provide a fast and efficient tool to generate large sequence collections that can be used to characterize the transcriptome and identify expressed genes associated with economically important traits like growth and disease resistance. Results More than 25 million short reads generated by the Illumina Genome Analyzer were de novo assembled in 22,761 contigs with an average size of 260 bp. With a stringent E-value threshold of 10-10, 3,841 contigs (16.8% had a BLAST homologous match against the Genbank non-redundant (NR protein database. Most of these sequences were annotated using the gene ontology (GO and eukaryotic orthologous groups of proteins (KOG databases and assigned to various functional categories. According to annotation results, many gene families involved in immune response were identified. Thousands of simple sequence repeats (SSR and single nucleotide polymorphisms (SNP were detected. Setting stringent parameters to ensure a high probability of amplification, 420 primer pairs in 181 contigs containing SSR loci were designed. Conclusion This data represents the most comprehensive genomic resource for the South African abalone H. midae to date. The amount of assembled sequences demonstrated the utility of the Illumina sequencing technology in the transcriptome characterization of a non-model species. It allowed the development of several markers and the identification of promising candidate genes for future studies on population and functional genomics in H. midae and in other abalone species.

  5. Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

    Science.gov (United States)

    Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

    2009-08-01

    The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

  6. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  7. An extended sequence specificity for UV-induced DNA damage.

    Science.gov (United States)

    Chung, Long H; Murray, Vincent

    2018-01-01

    The sequence specificity of UV-induced DNA damage was determined with a higher precision and accuracy than previously reported. UV light induces two major damage adducts: cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). Employing capillary electrophoresis with laser-induced fluorescence and taking advantages of the distinct properties of the CPDs and 6-4PPs, we studied the sequence specificity of UV-induced DNA damage in a purified DNA sequence using two approaches: end-labelling and a polymerase stop/linear amplification assay. A mitochondrial DNA sequence that contained a random nucleotide composition was employed as the target DNA sequence. With previous methodology, the UV sequence specificity was determined at a dinucleotide or trinucleotide level; however, in this paper, we have extended the UV sequence specificity to a hexanucleotide level. With the end-labelling technique (for 6-4PPs), the consensus sequence was found to be 5'-GCTC*AC (where C* is the breakage site); while with the linear amplification procedure, it was 5'-TCTT*AC. With end-labelling, the dinucleotide frequency of occurrence was highest for 5'-TC*, 5'-TT* and 5'-CC*; whereas it was 5'-TT* for linear amplification. The influence of neighbouring nucleotides on the degree of UV-induced DNA damage was also examined. The core sequences consisted of pyrimidine nucleotides 5'-CTC* and 5'-CTT* while an A at position "1" and C at position "2" enhanced UV-induced DNA damage. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  8. [Meta-analysis on relationship between single nucleotide polymorphism of rs2231142 in ABCG2 gene and gout in East Asian population].

    Science.gov (United States)

    Wu, Lei; He, Yao; Zhang, Di

    2015-11-01

    To systematically evaluate the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout in East Asian population. The literature retrieval was conducted by using English databases (Medline, EMbase), Chinese databases (CNKI, Vip, Wanfang, SinaMed) and others to collect the published papers on the association between single nucleotide polymorphism of rs2231142 genetic susceptibility and gout by the end of December 2014. Meta-analysis was performed with software Stata 12.0. Nine studies were included. There were significant associations between increased risk of gout and single nucleotide polymorphism of rs2231142, the combined OR was 2.04 (95%CI: 1.82-2.28) for A allele and C allele, 1.97 (95%CI: 1.57-2.48) for CA and CC, 3.71 (95%CI: 3.07-4.47) for AA and CC. Sex and region specific subgroup analysis showed less heterogeneity. There is significant association between gout and single nucleotide polymorphism of rs2231142 in East Asian population, and A allele is a high risk gene for gout.

  9. SoyDB: a knowledge database of soybean transcription factors

    Directory of Open Access Journals (Sweden)

    Valliyodan Babu

    2010-01-01

    Full Text Available Abstract Background Transcription factors play the crucial rule of regulating gene expression and influence almost all biological processes. Systematically identifying and annotating transcription factors can greatly aid further understanding their functions and mechanisms. In this article, we present SoyDB, a user friendly database containing comprehensive knowledge of soybean transcription factors. Description The soybean genome was recently sequenced by the Department of Energy-Joint Genome Institute (DOE-JGI and is publicly available. Mining of this sequence identified 5,671 soybean genes as putative transcription factors. These genes were comprehensively annotated as an aid to the soybean research community. We developed SoyDB - a knowledge database for all the transcription factors in the soybean genome. The database contains protein sequences, predicted tertiary structures, putative DNA binding sites, domains, homologous templates in the Protein Data Bank (PDB, protein family classifications, multiple sequence alignments, consensus protein sequence motifs, web logo of each family, and web links to the soybean transcription factor database PlantTFDB, known EST sequences, and other general protein databases including Swiss-Prot, Gene Ontology, KEGG, EMBL, TAIR, InterPro, SMART, PROSITE, NCBI, and Pfam. The database can be accessed via an interactive and convenient web server, which supports full-text search, PSI-BLAST sequence search, database browsing by protein family, and automatic classification of a new protein sequence into one of 64 annotated transcription factor families by hidden Markov models. Conclusions A comprehensive soybean transcription factor database was constructed and made publicly accessible at http://casp.rnet.missouri.edu/soydb/.

  10. A SNP-centric database for the investigation of the human genome

    Directory of Open Access Journals (Sweden)

    Kohane Isaac S

    2004-03-01

    Full Text Available Abstract Background Single Nucleotide Polymorphisms (SNPs are an increasingly important tool for genetic and biomedical research. Although current genomic databases contain information on several million SNPs and are growing at a very fast rate, the true value of a SNP in this context is a function of the quality of the annotations that characterize it. Retrieving and analyzing such data for a large number of SNPs often represents a major bottleneck in the design of large-scale association studies. Description SNPper is a web-based application designed to facilitate the retrieval and use of human SNPs for high-throughput research purposes. It provides a rich local database generated by combining SNP data with the Human Genome sequence and with several other data sources, and offers the user a variety of querying, visualization and data export tools. In this paper we describe the structure and organization of the SNPper database, we review the available data export and visualization options, and we describe how the architecture of SNPper and its specialized data structures support high-volume SNP analysis. Conclusions The rich annotation database and the powerful data manipulation and presentation facilities it offers make SNPper a very useful online resource for SNP research. Its success proves the great need for integrated and interoperable resources in the field of computational biology, and shows how such systems may play a critical role in supporting the large-scale computational analysis of our genome.

  11. Legume and Lotus japonicus Databases

    DEFF Research Database (Denmark)

    Hirakawa, Hideki; Mun, Terry; Sato, Shusei

    2014-01-01

    Since the genome sequence of Lotus japonicus, a model plant of family Fabaceae, was determined in 2008 (Sato et al. 2008), the genomes of other members of the Fabaceae family, soybean (Glycine max) (Schmutz et al. 2010) and Medicago truncatula (Young et al. 2011), have been sequenced. In this sec....... In this section, we introduce representative, publicly accessible online resources related to plant materials, integrated databases containing legume genome information, and databases for genome sequence and derived marker information of legume species including L. japonicus...

  12. Dictionary as Database.

    Science.gov (United States)

    Painter, Derrick

    1996-01-01

    Discussion of dictionaries as databases focuses on the digitizing of The Oxford English dictionary (OED) and the use of Standard Generalized Mark-Up Language (SGML). Topics include the creation of a consortium to digitize the OED, document structure, relational databases, text forms, sequence, and discourse. (LRW)

  13. GRIP Database original data - GRIPDB | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us GRI...PDB GRIP Database original data Data detail Data name GRIP Database original data DOI 10....18908/lsdba.nbdc01665-006 Description of data contents GRIP Database original data It consists of data table...s and sequences. Data file File name: gripdb_original_data.zip File URL: ftp://ftp.biosciencedbc.jp/archive/gripdb/LATEST/gri...e Database Description Download License Update History of This Database Site Policy | Contact Us GRIP Database original data - GRIPDB | LSDB Archive ...

  14. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    Science.gov (United States)

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  15. Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.

    Science.gov (United States)

    Sasaya, T; Ishikawa, K; Koganezawa, H

    2001-06-01

    A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.

  16. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal

    1983-01-01

    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  17. A framework for organizing cancer-related variations from existing databases, publications and NGS data using a High-performance Integrated Virtual Environment (HIVE).

    Science.gov (United States)

    Wu, Tsung-Jung; Shamsaddini, Amirhossein; Pan, Yang; Smith, Krista; Crichton, Daniel J; Simonyan, Vahan; Mazumder, Raja

    2014-01-01

    Years of sequence feature curation by UniProtKB/Swiss-Prot, PIR-PSD, NCBI-CDD, RefSeq and other database biocurators has led to a rich repository of information on functional sites of genes and proteins. This information along with variation-related annotation can be used to scan human short sequence reads from next-generation sequencing (NGS) pipelines for presence of non-synonymous single-nucleotide variations (nsSNVs) that affect functional sites. This and similar workflows are becoming more important because thousands of NGS data sets are being made available through projects such as The Cancer Genome Atlas (TCGA), and researchers want to evaluate their biomarkers in genomic data. BioMuta, an integrated sequence feature database, provides a framework for automated and manual curation and integration of cancer-related sequence features so that they can be used in NGS analysis pipelines. Sequence feature information in BioMuta is collected from the Catalogue of Somatic Mutations in Cancer (COSMIC), ClinVar, UniProtKB and through biocuration of information available from publications. Additionally, nsSNVs identified through automated analysis of NGS data from TCGA are also included in the database. Because of the petabytes of data and information present in NGS primary repositories, a platform HIVE (High-performance Integrated Virtual Environment) for storing, analyzing, computing and curating NGS data and associated metadata has been developed. Using HIVE, 31 979 nsSNVs were identified in TCGA-derived NGS data from breast cancer patients. All variations identified through this process are stored in a Curated Short Read archive, and the nsSNVs from the tumor samples are included in BioMuta. Currently, BioMuta has 26 cancer types with 13 896 small-scale and 308 986 large-scale study-derived variations. Integration of variation data allows identifications of novel or common nsSNVs that can be prioritized in validation studies. Database URL: BioMuta: http

  18. Novel expressed sequence tag- simple sequence repeats (EST ...

    African Journals Online (AJOL)

    Using different bioinformatic criteria, the SUCEST database was used to mine for simple sequence repeat (SSR) markers. Among 42,189 clusters, 1,425 expressed sequence tag- simple sequence repeats (EST-SSRs) were identified in silico. Trinucleotide repeats were the most abundant SSRs detected. Of 212 primer pairs ...

  19. Basic Local Alignment Search Tool (BLAST)

    Data.gov (United States)

    U.S. Department of Health & Human Services — BLAST finds regions of similarity between biological sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the...

  20. Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.

    Directory of Open Access Journals (Sweden)

    Enying Zhang

    Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.

  1. LNA-enhanced detection of single nucleotide polymorphisms in the apolipoprotein E

    DEFF Research Database (Denmark)

    Jacobsen, Nana; Bentzen, Joan; Meldgaard, Michael

    2002-01-01

    Genotyping of single nucleotide polymorphisms (SNPs) in large populations presents a great challenge, especially if the SNPs are embedded in GC-rich regions, such as the codon 112 SNP in the human apolipoprotein E (apoE). In the present study, we have used immobilized locked nucleic acid (LNA...... was applied to a panel of patient samples with simultaneous genotyping of the patients by DNA sequencing. The apoE genotyping assays for the codons 112 and 158 SNPs resulted in unambiguous results for all patient samples, concurring with those obtained by DNA sequencing....

  2. In Silico Derivation of HLA-Specific Alloreactivity Potential from Whole Exome Sequencing of Stem Cell Transplant Donors and Recipients: Understanding the Quantitative Immunobiology of Allogeneic Transplantation

    Directory of Open Access Journals (Sweden)

    Max eJameson-Lee

    2014-11-01

    Full Text Available Donor T cell mediated graft versus host effects (GVH may result from the aggregate alloreactivity to minor histocompatibility antigens (mHA presented by the HLA molecules in each donor-recipient pair undergoing stem cell transplantation (SCT. Whole exome sequencing has previously demonstrated a large number of nonsynonymous single nucleotide polymorphisms (SNP present in HLA-matched recipients of SCT donors (GVH direction. The nucleotide sequence flanking each of these SNPs was obtained and the amino acid sequence determined. All the possible nonameric-peptides incorporating the variant amino acid resulting from these SNPs were interrogated in-silico for their likelihood to be presented by the HLA class I molecules using the Immune Epitope Database stabilized matrix method (SMM and NetMHCpan algorithms. The SMM algorithm predicted that a median of 18,396 peptides weakly bound HLA class I molecules in individual SCT recipients, and 2,254 peptides displayed strong binding. A similar library of presented peptides was identified when the data was interrogated using the NetMHCpan algorithm. The bioinformatic algorithm presented here demonstrates that there may be a high level of mHA variation in HLA-matched individuals, constituting an HLA-specific alloreactivity potential.

  3. Simplified validation of borderline hits of database searches

    OpenAIRE

    Thomas, Henrik; Shevchenko, Andrej

    2008-01-01

    Along with unequivocal hits produced by matching multiple MS/MS spectra to database sequences, LC-MS/MS analysis often yields a large number of hits of borderline statistical confidence. To simplify their validation, we propose to use rapid de novo interpretation of all acquired MS/MS spectra and, with the help of a simple software tool, display the candidate sequences together with each database search hit. We demonstrate that comparing hit database sequences and independent de novo interpre...

  4. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  5. A 19-nucleotide insertion in the leader sequence of avian leukosis virus subgroup J contributes to its replication in vitro but is not related to its pathogenicity in vivo.

    Directory of Open Access Journals (Sweden)

    Xiaolin Ji

    Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.

  6. Engineering method to build the composite structure ply database

    Directory of Open Access Journals (Sweden)

    Qinghua Shi

    Full Text Available In this paper, a new method to build a composite ply database with engineering design constraints is proposed. This method has two levels: the core stacking sequence design and the whole stacking sequence design. The core stacking sequences are obtained by the full permutation algorithm considering the ply ratio requirement and the dispersion character which characterizes the dispersion of ply angles. The whole stacking sequences are the combinations of the core stacking sequences. By excluding the ply sequences which do not meet the engineering requirements, the final ply database is obtained. One example with the constraints that the total layer number is 100 and the ply ratio is 30:60:10 is presented to validate the method. This method provides a new way to set up the ply database based on the engineering requirements without adopting intelligent optimization algorithms. Keywords: Composite ply database, VBA program, Structure design, Stacking sequence

  7. Fast and secure retrieval of DNA sequences

    NARCIS (Netherlands)

    2014-01-01

    Sequence models are retrieved from a sequences index. The sequence models model DNA or RNA sequences stored in a database, and each comprises a finite memory tree source model and parameters for the finite memory tree source model. One or more DNA or RNA sequences stored in the database are

  8. Comprehensive analysis of the N-glycan biosynthetic pathway using bioinformatics to generate UniCorn: A theoretical N-glycan structure database.

    Science.gov (United States)

    Akune, Yukie; Lin, Chi-Hung; Abrahams, Jodie L; Zhang, Jingyu; Packer, Nicolle H; Aoki-Kinoshita, Kiyoko F; Campbell, Matthew P

    2016-08-05

    Glycan structures attached to proteins are comprised of diverse monosaccharide sequences and linkages that are produced from precursor nucleotide-sugars by a series of glycosyltransferases. Databases of these structures are an essential resource for the interpretation of analytical data and the development of bioinformatics tools. However, with no template to predict what structures are possible the human glycan structure databases are incomplete and rely heavily on the curation of published, experimentally determined, glycan structure data. In this work, a library of 45 human glycosyltransferases was used to generate a theoretical database of N-glycan structures comprised of 15 or less monosaccharide residues. Enzyme specificities were sourced from major online databases including Kyoto Encyclopedia of Genes and Genomes (KEGG) Glycan, Consortium for Functional Glycomics (CFG), Carbohydrate-Active enZymes (CAZy), GlycoGene DataBase (GGDB) and BRENDA. Based on the known activities, more than 1.1 million theoretical structures and 4.7 million synthetic reactions were generated and stored in our database called UniCorn. Furthermore, we analyzed the differences between the predicted glycan structures in UniCorn and those contained in UniCarbKB (www.unicarbkb.org), a database which stores experimentally described glycan structures reported in the literature, and demonstrate that UniCorn can be used to aid in the assignment of ambiguous structures whilst also serving as a discovery database. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. dBBQs: dataBase of Bacterial Quality scores

    OpenAIRE

    Wanchai, Visanu; Patumcharoenpol, Preecha; Nookaew, Intawat; Ussery, David

    2017-01-01

    Background: It is well-known that genome sequencing technologies are becoming significantly cheaper and faster. As a result of this, the exponential growth in sequencing data in public databases allows us to explore ever growing large collections of genome sequences. However, it is less known that the majority of available sequenced genome sequences in public databases are not complete, drafts of varying qualities. We have calculated quality scores for around 100,000 bacterial genomes from al...

  10. Building the library of RNA 3D nucleotide conformations using the clustering approach

    Directory of Open Access Journals (Sweden)

    Zok Tomasz

    2015-09-01

    Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.

  11. Comparison of two Next Generation sequencing platforms for full genome sequencing of Classical Swine Fever Virus

    DEFF Research Database (Denmark)

    Fahnøe, Ulrik; Pedersen, Anders Gorm; Höper, Dirk

    2013-01-01

    to the consensus sequence. Additionally, we got an average sequence depth for the genome of 4000 for the Iontorrent PGM and 400 for the FLX platform making the mapping suitable for single nucleotide variant (SNV) detection. The analysis revealed a single non-silent SNV A10665G leading to the amino acid change D......Next Generation Sequencing (NGS) is becoming more adopted into viral research and will be the preferred technology in the years to come. We have recently sequenced several strains of Classical Swine Fever Virus (CSFV) by NGS on both Genome Sequencer FLX (GS FLX) and Iontorrent PGM platforms...

  12. SAAS: Short Amino Acid Sequence - A Promising Protein Secondary Structure Prediction Method of Single Sequence

    Directory of Open Access Journals (Sweden)

    Zhou Yuan Wu

    2013-07-01

    Full Text Available In statistical methods of predicting protein secondary structure, many researchers focus on single amino acid frequencies in α-helices, β-sheets, and so on, or the impact near amino acids on an amino acid forming a secondary structure. But the paper considers a short sequence of amino acids (3, 4, 5 or 6 amino acids as integer, and statistics short sequence's probability forming secondary structure. Also, many researchers select low homologous sequences as statistical database. But this paper select whole PDB database. In this paper we propose a strategy to predict protein secondary structure using simple statistical method. Numerical computation shows that, short amino acids sequence as integer to statistics, which can easy see trend of short sequence forming secondary structure, and it will work well to select large statistical database (whole PDB database without considering homologous, and Q3 accuracy is ca. 74% using this paper proposed simple statistical method, but accuracy of others statistical methods is less than 70%.

  13. The master two-dimensional gel database of human AMA cell proteins: towards linking protein and genome sequence and mapping information (update 1991)

    DEFF Research Database (Denmark)

    Celis, J E; Leffers, H; Rasmussen, H H

    1991-01-01

    autoantigens" and "cDNAs". For convenience we have included an alphabetical list of all known proteins recorded in this database. In the long run, the main goal of this database is to link protein and DNA sequencing and mapping information (Human Genome Program) and to provide an integrated picture......The master two-dimensional gel database of human AMA cells currently lists 3801 cellular and secreted proteins, of which 371 cellular polypeptides (306 IEF; 65 NEPHGE) were added to the master images during the last 10 months. These include: (i) very basic and acidic proteins that do not focus...

  14. RareVar: A Framework for Detecting Low-Frequency Single-Nucleotide Variants.

    Science.gov (United States)

    Hao, Yangyang; Xuei, Xiaoling; Li, Lang; Nakshatri, Harikrishna; Edenberg, Howard J; Liu, Yunlong

    2017-07-01

    Accurate identification of low-frequency somatic point mutations in tumor samples has important clinical utilities. Although high-throughput sequencing technology enables capturing such variants while sequencing primary tumor samples, our ability for accurate detection is compromised when the variant frequency is close to the sequencer error rate. Most current experimental and bioinformatic strategies target mutations with ≥5% allele frequency, which limits our ability to understand the cancer etiology and tumor evolution. We present an experimental and computational modeling framework, RareVar, to reliably identify low-frequency single-nucleotide variants from high-throughput sequencing data under standard experimental protocols. RareVar protocol includes a benchmark design by pooling DNAs from already sequenced individuals at various concentrations to target variants at desired frequencies, 0.5%-3% in our case. By applying a generalized, linear model-based, position-specific error model, followed by machine-learning-based variant calibration, our approach outperforms existing methods. Our method can be applied on most capture and sequencing platforms without modifying the experimental protocol.

  15. Sequence variations in the FAD2 gene in seeded pumpkins.

    Science.gov (United States)

    Ge, Y; Chang, Y; Xu, W L; Cui, C S; Qu, S P

    2015-12-21

    Seeded pumpkins are important economic crops; the seeds contain various unsaturated fatty acids, such as oleic acid and linoleic acid, which are crucial for human and animal nutrition. The fatty acid desaturase-2 (FAD2) gene encodes delta-12 desaturase, which converts oleic acid to linoleic acid. However, little is known about sequence variations in FAD2 in seeded pumpkins. Twenty-seven FAD2 clones from 27 accessions of Cucurbita moschata, Cucurbita maxima, Cucurbita pepo, and Cucurbita ficifolia were obtained (totally 1152 bp; a single gene without introns). More than 90% nucleotide identities were detected among the 27 FAD2 clones. Nucleotide substitution, rather than nucleotide insertion and deletion, led to sequence polymorphism in the 27 FAD2 clones. Furthermore, the 27 FAD2 selected clones all encoded the FAD2 enzyme (delta-12 desaturase) with amino acid sequence identities from 91.7 to 100% for 384 amino acids. The same main-function domain between 47 and 329 amino acids was identified. The four species clustered separately based on differences in the sequences that were identified using the unweighted pair group method with arithmetic mean. Geographic origin and species were found to be closely related to sequence variation in FAD2.

  16. SeqReporter: automating next-generation sequencing result interpretation and reporting workflow in a clinical laboratory.

    Science.gov (United States)

    Roy, Somak; Durso, Mary Beth; Wald, Abigail; Nikiforov, Yuri E; Nikiforova, Marina N

    2014-01-01

    A wide repertoire of bioinformatics applications exist for next-generation sequencing data analysis; however, certain requirements of the clinical molecular laboratory limit their use: i) comprehensive report generation, ii) compatibility with existing laboratory information systems and computer operating system, iii) knowledgebase development, iv) quality management, and v) data security. SeqReporter is a web-based application developed using ASP.NET framework version 4.0. The client-side was designed using HTML5, CSS3, and Javascript. The server-side processing (VB.NET) relied on interaction with a customized SQL server 2008 R2 database. Overall, 104 cases (1062 variant calls) were analyzed by SeqReporter. Each variant call was classified into one of five report levels: i) known clinical significance, ii) uncertain clinical significance, iii) pending pathologists' review, iv) synonymous and deep intronic, and v) platform and panel-specific sequence errors. SeqReporter correctly annotated and classified 99.9% (859 of 860) of sequence variants, including 68.7% synonymous single-nucleotide variants, 28.3% nonsynonymous single-nucleotide variants, 1.7% insertions, and 1.3% deletions. One variant of potential clinical significance was re-classified after pathologist review. Laboratory information system-compatible clinical reports were generated automatically. SeqReporter also facilitated quality management activities. SeqReporter is an example of a customized and well-designed informatics solution to optimize and automate the downstream analysis of clinical next-generation sequencing data. We propose it as a model that may envisage the development of a comprehensive clinical informatics solution. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  17. Cloning and sequencing of the casein kinase 2 alpha subunit from Zea mays

    DEFF Research Database (Denmark)

    Dobrowolska, G; Boldyreff, B; Issinger, O G

    1991-01-01

    The nucleotide sequence of the cDNA coding for the alpha subunit of casein kinase 2 of Zea mays has been determined. The cDNA clone contains an open reading frame of 996 nucleotides encoding a polypeptide comprising 332 amino acids. The primary amino acid sequence exhibits 75% identity to the alpha...... subunit and 71% identity to the alpha' subunit of human casein kinase 2....

  18. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    Science.gov (United States)

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  19. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

    2007-01-01

    BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

  20. TIA: algorithms for development of identity-linked SNP islands for analysis by massively parallel DNA sequencing.

    Science.gov (United States)

    Farris, M Heath; Scott, Andrew R; Texter, Pamela A; Bartlett, Marta; Coleman, Patricia; Masters, David

    2018-04-11

    Single nucleotide polymorphisms (SNPs) located within the human genome have been shown to have utility as markers of identity in the differentiation of DNA from individual contributors. Massively parallel DNA sequencing (MPS) technologies and human genome SNP databases allow for the design of suites of identity-linked target regions, amenable to sequencing in a multiplexed and massively parallel manner. Therefore, tools are needed for leveraging the genotypic information found within SNP databases for the discovery of genomic targets that can be evaluated on MPS platforms. The SNP island target identification algorithm (TIA) was developed as a user-tunable system to leverage SNP information within databases. Using data within the 1000 Genomes Project SNP database, human genome regions were identified that contain globally ubiquitous identity-linked SNPs and that were responsive to targeted resequencing on MPS platforms. Algorithmic filters were used to exclude target regions that did not conform to user-tunable SNP island target characteristics. To validate the accuracy of TIA for discovering these identity-linked SNP islands within the human genome, SNP island target regions were amplified from 70 contributor genomic DNA samples using the polymerase chain reaction. Multiplexed amplicons were sequenced using the Illumina MiSeq platform, and the resulting sequences were analyzed for SNP variations. 166 putative identity-linked SNPs were targeted in the identified genomic regions. Of the 309 SNPs that provided discerning power across individual SNP profiles, 74 previously undefined SNPs were identified during evaluation of targets from individual genomes. Overall, DNA samples of 70 individuals were uniquely identified using a subset of the suite of identity-linked SNP islands. TIA offers a tunable genome search tool for the discovery of targeted genomic regions that are scalable in the population frequency and numbers of SNPs contained within the SNP island regions

  1. In silico Analysis of 3′-End-Processing Signals in Aspergillus oryzae Using Expressed Sequence Tags and Genomic Sequencing Data

    Science.gov (United States)

    Tanaka, Mizuki; Sakai, Yoshifumi; Yamada, Osamu; Shintani, Takahiro; Gomi, Katsuya

    2011-01-01

    To investigate 3′-end-processing signals in Aspergillus oryzae, we created a nucleotide sequence data set of the 3′-untranslated region (3′ UTR) plus 100 nucleotides (nt) sequence downstream of the poly(A) site using A. oryzae expressed sequence tags and genomic sequencing data. This data set comprised 1065 sequences derived from 1042 unique genes. The average 3′ UTR length in A. oryzae was 241 nt, which is greater than that in yeast but similar to that in plants. The 3′ UTR and 100 nt sequence downstream of the poly(A) site is notably U-rich, while the region located 15–30 nt upstream of the poly(A) site is markedly A-rich. The most frequently found hexanucleotide in this A-rich region is AAUGAA, although this sequence accounts for only 6% of all transcripts. These data suggested that A. oryzae has no highly conserved sequence element equivalent to AAUAAA, a mammalian polyadenylation signal. We identified that putative 3′-end-processing signals in A. oryzae, while less well conserved than those in mammals, comprised four sequence elements: the furthest upstream U-rich element, A-rich sequence, cleavage site, and downstream U-rich element flanking the cleavage site. Although these putative 3′-end-processing signals are similar to those in yeast and plants, some notable differences exist between them. PMID:21586533

  2. Quantum-Sequencing: Biophysics of quantum tunneling through nucleic acids

    Science.gov (United States)

    Casamada Ribot, Josep; Chatterjee, Anushree; Nagpal, Prashant

    2014-03-01

    Tunneling microscopy and spectroscopy has extensively been used in physical surface sciences to study quantum tunneling to measure electronic local density of states of nanomaterials and to characterize adsorbed species. Quantum-Sequencing (Q-Seq) is a new method based on tunneling microscopy for electronic sequencing of single molecule of nucleic acids. A major goal of third-generation sequencing technologies is to develop a fast, reliable, enzyme-free single-molecule sequencing method. Here, we present the unique ``electronic fingerprints'' for all nucleotides on DNA and RNA using Q-Seq along their intrinsic biophysical parameters. We have analyzed tunneling spectra for the nucleotides at different pH conditions and analyzed the HOMO, LUMO and energy gap for all of them. In addition we show a number of biophysical parameters to further characterize all nucleobases (electron and hole transition voltage and energy barriers). These results highlight the robustness of Q-Seq as a technique for next-generation sequencing.

  3. Sequencing and Characterization of the Invasive Sycamore Lace Bug Corythucha ciliata (Hemiptera: Tingidae) Transcriptome

    Science.gov (United States)

    Qu, Cheng; Fu, Ningning; Xu, Yihua

    2016-01-01

    The sycamore lace bug, Corythucha ciliata (Hemiptera: Tingidae), is an invasive forestry pest rapidly expanding in many countries. This pest poses a considerable threat to the urban forestry ecosystem, especially to Platanus spp. However, its molecular biology and biochemistry are poorly understood. This study reports the first C. ciliata transcriptome, encompassing three different life stages (Nymphs, adults female (AF) and adults male (AM)). In total, 26.53 GB of clean data and 60,879 unigenes were obtained from three RNA-seq libraries. These unigenes were annotated and classified by Nr (NCBI non-redundant protein sequences), Nt (NCBI non-redundant nucleotide sequences), Pfam (Protein family), KOG/COG (Clusters of Orthologous Groups of proteins), Swiss-Prot (A manually annotated and reviewed protein sequence database), and KO (KEGG Ortholog database). After all pairwise comparisons between these three different samples, a large number of differentially expressed genes were revealed. The dramatic differences in global gene expression profiles were found between distinct life stages (nymphs and AF, nymphs and AM) and sex difference (AF and AM), with some of the significantly differentially expressed genes (DEGs) being related to metamorphosis, digestion, immune and sex difference. The different express of unigenes were validated through quantitative Real-Time PCR (qRT-PCR) for 16 randomly selected unigenes. In addition, 17,462 potential simple sequence repeat molecular markers were identified in these transcriptome resources. These comprehensive C. ciliata transcriptomic information can be utilized to promote the development of environmentally friendly methodologies to disrupt the processes of metamorphosis, digestion, immune and sex differences. PMID:27494615

  4. Cloning and sequence analysis of a partial CDS of leptospiral ligA gene in pET-32a - Escherichia coli DH5α system

    Directory of Open Access Journals (Sweden)

    Manju Soman

    2018-04-01

    Full Text Available Aim: This study aims at cloning, sequencing, and phylogenetic analysis of a partial CDS of ligA gene in pET-32a - Escherichia coli DH5α system, with the objective of identifying the conserved nature of the ligA gene in the genus Leptospira. Materials and Methods: A partial CDS (nucleotide 1873 to nucleotide 3363 of the ligA gene was amplified from genomic DNA of Leptospira interrogans serovar Canicola by polymerase chain reaction (PCR. The PCR-amplified DNA was cloned into pET-32a vector and transformed into competent E. coli DH5α bacterial cells. The partial ligA gene insert was sequenced and the nucleotide sequences obtained were aligned with the published ligA gene sequences of other Leptospira serovars, using nucleotide BLAST, NCBI. Phylogenetic analysis of the gene sequence was done by maximum likelihood method using Mega 6.06 software. Results: The PCR could amplify the 1491 nucleotide sequence spanning from nucleotide 1873 to nucleotide 3363 of the ligA gene and the partial ligA gene could be successfully cloned in E. coli DH5α cells. The nucleotide sequence when analyzed for homology with the reported gene sequences of other Leptospira serovars was found to have 100% homology to the 1910 bp to 3320 bp sequence of ligA gene of L. interrogans strain Kito serogroup Canicola. The predicted protein consisted of 470 aminoacids. Phylogenetic analysis revealed that the ligA gene was conserved in L. interrogans species. Conclusion: The partial ligA gene could be successfully cloned and sequenced from E. coli DH5α cells. The sequence showed 100% homology to the published ligA gene sequences. The phylogenetic analysis revealed the conserved nature of the ligA gene. Further studies on the expression and immunogenicity of the partial LigA protein need to be carried out to determine its competence as a subunit vaccine candidate.

  5. SequenceCEROSENE: a computational method and web server to visualize spatial residue neighborhoods at the sequence level.

    Science.gov (United States)

    Heinke, Florian; Bittrich, Sebastian; Kaiser, Florian; Labudde, Dirk

    2016-01-01

    To understand the molecular function of biopolymers, studying their structural characteristics is of central importance. Graphics programs are often utilized to conceive these properties, but with the increasing number of available structures in databases or structure models produced by automated modeling frameworks this process requires assistance from tools that allow automated structure visualization. In this paper a web server and its underlying method for generating graphical sequence representations of molecular structures is presented. The method, called SequenceCEROSENE (color encoding of residues obtained by spatial neighborhood embedding), retrieves the sequence of each amino acid or nucleotide chain in a given structure and produces a color coding for each residue based on three-dimensional structure information. From this, color-highlighted sequences are obtained, where residue coloring represent three-dimensional residue locations in the structure. This color encoding thus provides a one-dimensional representation, from which spatial interactions, proximity and relations between residues or entire chains can be deduced quickly and solely from color similarity. Furthermore, additional heteroatoms and chemical compounds bound to the structure, like ligands or coenzymes, are processed and reported as well. To provide free access to SequenceCEROSENE, a web server has been implemented that allows generating color codings for structures deposited in the Protein Data Bank or structure models uploaded by the user. Besides retrieving visualizations in popular graphic formats, underlying raw data can be downloaded as well. In addition, the server provides user interactivity with generated visualizations and the three-dimensional structure in question. Color encoded sequences generated by SequenceCEROSENE can aid to quickly perceive the general characteristics of a structure of interest (or entire sets of complexes), thus supporting the researcher in the initial

  6. Construction of an Ostrea edulis database from genomic and expressed sequence tags (ESTs) obtained from Bonamia ostreae infected haemocytes: Development of an immune-enriched oligo-microarray.

    Science.gov (United States)

    Pardo, Belén G; Álvarez-Dios, José Antonio; Cao, Asunción; Ramilo, Andrea; Gómez-Tato, Antonio; Planas, Josep V; Villalba, Antonio; Martínez, Paulino

    2016-12-01

    The flat oyster, Ostrea edulis, is one of the main farmed oysters, not only in Europe but also in the United States and Canada. Bonamiosis due to the parasite Bonamia ostreae has been associated with high mortality episodes in this species. This parasite is an intracellular protozoan that infects haemocytes, the main cells involved in oyster defence. Due to the economical and ecological importance of flat oyster, genomic data are badly needed for genetic improvement of the species, but they are still very scarce. The objective of this study is to develop a sequence database, OedulisDB, with new genomic and transcriptomic resources, providing new data and convenient tools to improve our knowledge of the oyster's immune mechanisms. Transcriptomic and genomic sequences were obtained using 454 pyrosequencing and compiled into an O. edulis database, OedulisDB, consisting of two sets of 10,318 and 7159 unique sequences that represent the oyster's genome (WG) and de novo haemocyte transcriptome (HT), respectively. The flat oyster transcriptome was obtained from two strains (naïve and tolerant) challenged with B. ostreae, and from their corresponding non-challenged controls. Approximately 78.5% of 5619 HT unique sequences were successfully annotated by Blast search using public databases. A total of 984 sequences were identified as being related to immune response and several key immune genes were identified for the first time in flat oyster. Additionally, transcriptome information was used to design and validate the first oligo-microarray in flat oyster enriched with immune sequences from haemocytes. Our transcriptomic and genomic sequencing and subsequent annotation have largely increased the scarce resources available for this economically important species and have enabled us to develop an OedulisDB database and accompanying tools for gene expression analysis. This study represents the first attempt to characterize in depth the O. edulis haemocyte transcriptome in

  7. Construction of a virtual Mycobacterium tuberculosis consensus genome and its application to data from a next generation sequencer.

    Science.gov (United States)

    Okumura, Kayo; Kato, Masako; Kirikae, Teruo; Kayano, Mitsunori; Miyoshi-Akiyama, Tohru

    2015-03-20

    Although Mycobacterium tuberculosis isolates are consisted of several different lineages and the epidemiology analyses are usually assessed relative to a particular reference genome, M. tuberculosis H37Rv, which might introduce some biased results. Those analyses are essentially based genome sequence information of M. tuberculosis and could be performed in sillico in theory, with whole genome sequence (WGS) data available in the databases and obtained by next generation sequencers (NGSs). As an approach to establish higher resolution methods for such analyses, whole genome sequences of the M. tuberculosis complexes (MTBCs) strains available on databases were aligned to construct virtual reference genome sequences called the consensus sequence (CS), and evaluated its feasibility in in sillico epidemiological analyses. The consensus sequence (CS) was successfully constructed and utilized to perform phylogenetic analysis, evaluation of read mapping efficacy, which is crucial for detecting single nucleotide polymorphisms (SNPs), and various MTBC typing methods virtually including spoligotyping, VNTR, Long sequence polymorphism and Beijing typing. SNPs detected based on CS, in comparison with H37Rv, were utilized in concatemer-based phylogenetic analysis to determine their reliability relative to a phylogenetic tree based on whole genome alignment as the gold standard. Statistical comparison of phylogenic trees based on CS with that of H37Rv indicated the former showed always better results that that of later. SNP detection and concatenation with CS was advantageous because the frequency of crucial SNPs distinguishing among strain lineages was higher than those of H37Rv. The number of SNPs detected was lower with the consensus than with the H37Rv sequence, resulting in a significant reduction in computational time. Performance of each virtual typing was satisfactory and accorded with those published when those are available. These results indicated that virtual CS

  8. MSuPDA: A Memory Efficient Algorithm for Sequence Alignment.

    Science.gov (United States)

    Khan, Mohammad Ibrahim; Kamal, Md Sarwar; Chowdhury, Linkon

    2016-03-01

    Space complexity is a million dollar question in DNA sequence alignments. In this regard, memory saving under pushdown automata can help to reduce the occupied spaces in computer memory. Our proposed process is that anchor seed (AS) will be selected from given data set of nucleotide base pairs for local sequence alignment. Quick splitting techniques will separate the AS from all the DNA genome segments. Selected AS will be placed to pushdown automata's (PDA) input unit. Whole DNA genome segments will be placed into PDA's stack. AS from input unit will be matched with the DNA genome segments from stack of PDA. Match, mismatch and indel of nucleotides will be popped from the stack under the control unit of pushdown automata. During the POP operation on stack, it will free the memory cell occupied by the nucleotide base pair.

  9. Defining objective clusters for rabies virus sequences using affinity propagation clustering.

    Directory of Open Access Journals (Sweden)

    Susanne Fischer

    2018-01-01

    Full Text Available Rabies is caused by lyssaviruses, and is one of the oldest known zoonoses. In recent years, more than 21,000 nucleotide sequences of rabies viruses (RABV, from the prototype species rabies lyssavirus, have been deposited in public databases. Subsequent phylogenetic analyses in combination with metadata suggest geographic distributions of RABV. However, these analyses somewhat experience technical difficulties in defining verifiable criteria for cluster allocations in phylogenetic trees inviting for a more rational approach. Therefore, we applied a relatively new mathematical clustering algorythm named 'affinity propagation clustering' (AP to propose a standardized sub-species classification utilizing full-genome RABV sequences. Because AP has the advantage that it is computationally fast and works for any meaningful measure of similarity between data samples, it has previously been applied successfully in bioinformatics, for analysis of microarray and gene expression data, however, cluster analysis of sequences is still in its infancy. Existing (516 and original (46 full genome RABV sequences were used to demonstrate the application of AP for RABV clustering. On a global scale, AP proposed four clusters, i.e. New World cluster, Arctic/Arctic-like, Cosmopolitan, and Asian as previously assigned by phylogenetic studies. By combining AP with established phylogenetic analyses, it is possible to resolve phylogenetic relationships between verifiably determined clusters and sequences. This workflow will be useful in confirming cluster distributions in a uniform transparent manner, not only for RABV, but also for other comparative sequence analyses.

  10. HIV drug resistance testing among patients failing second line antiretroviral therapy. Comparison of in-house and commercial sequencing.

    Science.gov (United States)

    Chimukangara, Benjamin; Varyani, Bhavini; Shamu, Tinei; Mutsvangwa, Junior; Manasa, Justen; White, Elizabeth; Chimbetete, Cleophas; Luethy, Ruedi; Katzenstein, David

    2017-05-01

    HIV genotyping is often unavailable in low and middle-income countries due to infrastructure requirements and cost. We compared genotype resistance testing in patients with virologic failure, by amplification of HIV pol gene, followed by "in-house" sequencing and commercial sequencing. Remnant plasma samples from adults and children failing second-line ART were amplified and sequenced using in-house and commercial di-deoxysequencing, and analyzed in Harare, Zimbabwe and at Stanford, U.S.A, respectively. HIV drug resistance mutations were determined using the Stanford HIV drug resistance database. Twenty-six of 28 samples were amplified and 25 were successfully genotyped. Comparison of average percent nucleotide and amino acid identities between 23 pairs sequenced in both laboratories were 99.51 (±0.56) and 99.11 (±0.95), respectively. All pairs clustered together in phylogenetic analysis. Sequencing analysis identified 6/23 pairs with mutation discordances resulting in differences in phenotype, but these did not impact future regimens. The results demonstrate our ability to produce good quality drug resistance data in-house. Despite discordant mutations in some sequence pairs, the phenotypic predictions were not clinically significant. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Ancestral sequence reconstruction in primate mitochondrial DNA: compositional bias and effect on functional inference.

    Science.gov (United States)

    Krishnan, Neeraja M; Seligmann, Hervé; Stewart, Caro-Beth; De Koning, A P Jason; Pollock, David D

    2004-10-01

    Reconstruction of ancestral DNA and amino acid sequences is an important means of inferring information about past evolutionary events. Such reconstructions suggest changes in molecular function and evolutionary processes over the course of evolution and are used to infer adaptation and convergence. Maximum likelihood (ML) is generally thought to provide relatively accurate reconstructed sequences compared to parsimony, but both methods lead to the inference of multiple directional changes in nucleotide frequencies in primate mitochondrial DNA (mtDNA). To better understand this surprising result, as well as to better understand how parsimony and ML differ, we constructed a series of computationally simple "conditional pathway" methods that differed in the number of substitutions allowed per site along each branch, and we also evaluated the entire Bayesian posterior frequency distribution of reconstructed ancestral states. We analyzed primate mitochondrial cytochrome b (Cyt-b) and cytochrome oxidase subunit I (COI) genes and found that ML reconstructs ancestral frequencies that are often more different from tip sequences than are parsimony reconstructions. In contrast, frequency reconstructions based on the posterior ensemble more closely resemble extant nucleotide frequencies. Simulations indicate that these differences in ancestral sequence inference are probably due to deterministic bias caused by high uncertainty in the optimization-based ancestral reconstruction methods (parsimony, ML, Bayesian maximum a posteriori). In contrast, ancestral nucleotide frequencies based on an average of the Bayesian set of credible ancestral sequences are much less biased. The methods involving simpler conditional pathway calculations have slightly reduced likelihood values compared to full likelihood calculations, but they can provide fairly unbiased nucleotide reconstructions and may be useful in more complex phylogenetic analyses than considered here due to their speed and

  12. Masking as an effective quality control method for next-generation sequencing data analysis.

    Science.gov (United States)

    Yun, Sajung; Yun, Sijung

    2014-12-13

    Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

  13. De novo assembly of pen shell ( Atrina pectinata) transcriptome and screening of its genic microsatellites

    Science.gov (United States)

    Sun, Xiujun; Li, Dongming; Liu, Zhihong; Zhou, Liqing; Wu, Biao; Yang, Aiguo

    2017-10-01

    The pen shell ( Atrina pectinata) is a large wedge-shaped bivalve, which belongs to family Pinnidae. Due to its large and nutritious adductor muscle, it is the popular seafood with high commercial value in Asia-Pacific countries. However, limiting genomic and transcriptomic data have hampered its genetic investigations. In this study, the transcriptome of A. pectinata was deeply sequenced using Illumina pair-end sequencing technology. After assembling, a total of 127263 unigenes were obtained. Functional annotation indicated that the highest percentage of unigenes (18.60%) was annotated on GO database, followed by 18.44% on PFAM database and 17.04% on NR database. There were 270 biological pathways matched with those in KEGG database. Furthermore, a total of 23452 potential simple sequence repeats (SSRs) were identified, of them the most abundant type was mono-nucleotide repeats (12902, 55.01%), which was followed by di-nucleotide (8132, 34.68%), tri-nucleotide (2010, 8.57%), tetra-nucleotide (401, 1.71%), and penta-nucleotide (7, 0.03%) repeats. Sixty SSRs were selected for validating and developing genic SSR markers, of them 23 showed polymorphism in a cultured population with the average observed and expected heterozygosities of 0.412 and 0.579, respectively. In this study, we established the first comprehensive transcript dataset of A. pectinata genes. Our results demonstrated that RNA-Seq is a fast and cost-effective method for genic SSR development in non-model species.

  14. Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human monoclonal antibody with broad reactivity to malignant tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)

    1989-06-12

    The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.

  15. CloVR-Comparative: automated, cloud-enabled comparative microbial genome sequence analysis pipeline.

    Science.gov (United States)

    Agrawal, Sonia; Arze, Cesar; Adkins, Ricky S; Crabtree, Jonathan; Riley, David; Vangala, Mahesh; Galens, Kevin; Fraser, Claire M; Tettelin, Hervé; White, Owen; Angiuoli, Samuel V; Mahurkar, Anup; Fricke, W Florian

    2017-04-27

    The benefit of increasing genomic sequence data to the scientific community depends on easy-to-use, scalable bioinformatics support. CloVR-Comparative combines commonly used bioinformatics tools into an intuitive, automated, and cloud-enabled analysis pipeline for comparative microbial genomics. CloVR-Comparative runs on annotated complete or draft genome sequences that are uploaded by the user or selected via a taxonomic tree-based user interface and downloaded from NCBI. CloVR-Comparative runs reference-free multiple whole-genome alignments to determine unique, shared and core coding sequences (CDSs) and single nucleotide polymorphisms (SNPs). Output includes short summary reports and detailed text-based results files, graphical visualizations (phylogenetic trees, circular figures), and a database file linked to the Sybil comparative genome browser. Data up- and download, pipeline configuration and monitoring, and access to Sybil are managed through CloVR-Comparative web interface. CloVR-Comparative and Sybil are distributed as part of the CloVR virtual appliance, which runs on local computers or the Amazon EC2 cloud. Representative datasets (e.g. 40 draft and complete Escherichia coli genomes) are processed in genomics projects, while eliminating the need for on-site computational resources and expertise.

  16. Complete sequence analysis reveals two distinct poleroviruses infecting cucurbits in China.

    Science.gov (United States)

    Xiang, Hai-ying; Shang, Qiao-xia; Han, Cheng-gui; Li, Da-wei; Yu, Jia-lin

    2008-01-01

    The complete RNA genomes of a Chinese isolate of cucurbit aphid-borne yellows virus (CABYV-CHN) and a new polerovirus tentatively referred to as melon aphid-borne yellows virus (MABYV) were determined. The entire genome of CABYV-CHN shared 89.0% nucleotide sequence identity with the French CABYV isolate. In contrast, nucleotide sequence identities between MABYV and CABYV and other poleroviruses were in the range of 50.7-74.2%, with amino acid sequence identities ranging from 24.8 to 82.9% for individual gene products. We propose that CABYV-CHN is a strain of CABYV and that MABYV is a member of a tentative distinct species within the genus Polerovirus.

  17. The Importance of Biological Databases in Biological Discovery.

    Science.gov (United States)

    Baxevanis, Andreas D; Bateman, Alex

    2015-06-19

    Biological databases play a central role in bioinformatics. They offer scientists the opportunity to access a wide variety of biologically relevant data, including the genomic sequences of an increasingly broad range of organisms. This unit provides a brief overview of major sequence databases and portals, such as GenBank, the UCSC Genome Browser, and Ensembl. Model organism databases, including WormBase, The Arabidopsis Information Resource (TAIR), and those made available through the Mouse Genome Informatics (MGI) resource, are also covered. Non-sequence-centric databases, such as Online Mendelian Inheritance in Man (OMIM), the Protein Data Bank (PDB), MetaCyc, and the Kyoto Encyclopedia of Genes and Genomes (KEGG), are also discussed. Copyright © 2015 John Wiley & Sons, Inc.

  18. The complete nucleotide sequences of the 5 genetically distinct plastid genomes of Oenothera, subsection Oenothera: II. A microevolutionary view using bioinformatics and formal genetic data.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg

    2008-09-01

    A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.

  19. Symbolic complexity for nucleotide sequences: a sign of the genome structure

    International Nuclear Information System (INIS)

    Salgado-García, R; Ugalde, E

    2016-01-01

    We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)

  20. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

    Science.gov (United States)

    McAllister, Christine A; Miller, Allison J

    2016-07-01

    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.