WorldWideScience

Sample records for nucleotide sequence database

  1. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  2. Tidying up international nucleotide sequence databases: ecological, geographical and sequence quality annotation of its sequences of mycorrhizal fungi.

    Science.gov (United States)

    Tedersoo, Leho; Abarenkov, Kessy; Nilsson, R Henrik; Schüssler, Arthur; Grelet, Gwen-Aëlle; Kohout, Petr; Oja, Jane; Bonito, Gregory M; Veldre, Vilmar; Jairus, Teele; Ryberg, Martin; Larsson, Karl-Henrik; Kõljalg, Urmas

    2011-01-01

    Sequence analysis of the ribosomal RNA operon, particularly the internal transcribed spacer (ITS) region, provides a powerful tool for identification of mycorrhizal fungi. The sequence data deposited in the International Nucleotide Sequence Databases (INSD) are, however, unfiltered for quality and are often poorly annotated with metadata. To detect chimeric and low-quality sequences and assign the ectomycorrhizal fungi to phylogenetic lineages, fungal ITS sequences were downloaded from INSD, aligned within family-level groups, and examined through phylogenetic analyses and BLAST searches. By combining the fungal sequence database UNITE and the annotation and search tool PlutoF, we also added metadata from the literature to these accessions. Altogether 35,632 sequences belonged to mycorrhizal fungi or originated from ericoid and orchid mycorrhizal roots. Of these sequences, 677 were considered chimeric and 2,174 of low read quality. Information detailing country of collection, geographical coordinates, interacting taxon and isolation source were supplemented to cover 78.0%, 33.0%, 41.7% and 96.4% of the sequences, respectively. These annotated sequences are publicly available via UNITE (http://unite.ut.ee/) for downstream biogeographic, ecological and taxonomic analyses. In European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena/), the annotated sequences have a special link-out to UNITE. We intend to expand the data annotation to additional genes and all taxonomic groups and functional guilds of fungi.

  3. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  4. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  5. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  6. Genome Sequence Databases (Overview): Sequencing and Assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lapidus, Alla L.

    2009-01-01

    From the date its role in heredity was discovered, DNA has been generating interest among scientists from different fields of knowledge: physicists have studied the three dimensional structure of the DNA molecule, biologists tried to decode the secrets of life hidden within these long molecules, and technologists invent and improve methods of DNA analysis. The analysis of the nucleotide sequence of DNA occupies a special place among the methods developed. Thanks to the variety of sequencing technologies available, the process of decoding the sequence of genomic DNA (or whole genome sequencing) has become robust and inexpensive. Meanwhile the assembly of whole genome sequences remains a challenging task. In addition to the need to assemble millions of DNA fragments of different length (from 35 bp (Solexa) to 800 bp (Sanger)), great interest in analysis of microbial communities (metagenomes) of different complexities raises new problems and pushes some new requirements for sequence assembly tools to the forefront. The genome assembly process can be divided into two steps: draft assembly and assembly improvement (finishing). Despite the fact that automatically performed assembly (or draft assembly) is capable of covering up to 98% of the genome, in most cases, it still contains incorrectly assembled reads. The error rate of the consensus sequence produced at this stage is about 1/2000 bp. A finished genome represents the genome assembly of much higher accuracy (with no gaps or incorrectly assembled areas) and quality ({approx}1 error/10,000 bp), validated through a number of computer and laboratory experiments.

  7. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  8. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  9. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  10. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... the discovery of the DNA, a new area of modern plant biotechnology begun. In plant ... Marker Assisted Breeding and Sequence Tagged Sites. (STS) are all in use in modern ...... and behaviour in the honey bee. Genome Res.

  11. Polymorphism Sequence - JSNP | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us JSNP Polymorphism Sequence Data detail Data name Polymorphism Sequence DOI 10.18908/lsdba.nb...dc00114-001 Description of data contents Information on polymorphisms (SNPs and insertions/deletions) and th...se Name database name JSNP_SNP: single nucleotide polymorphism JSNP_InsDel_IND: insertion/deletion JSNP_InsD...ved allele observed 3' Flanking Sequence 3' flanking sequence Offset in Flanking Sequence position of the polymorphism...uence Accession No. accession No. of the sequence for polymorphism screening Offset in Record position of the polymorphism

  12. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  13. Applications of High Throughput Nucleotide Sequencing

    DEFF Research Database (Denmark)

    Waage, Johannes Eichler

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  14. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    Nigerian Journal of Basic and Applied Science (March, 2013), 21(1): 27-32 ... Full Length R esearch A rticle ... The present study highlights data retrieval and representation. .... the end of information and the start of the sequence on the next ...

  15. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  16. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  17. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  18. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  19. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  20. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  1. The World Bacterial Biogeography and Biodiversity through Databases: A Case Study of NCBI Nucleotide Database and GBIF Database

    Directory of Open Access Journals (Sweden)

    Okba Selama

    2013-01-01

    Full Text Available Databases are an essential tool and resource within the field of bioinformatics. The primary aim of this study was to generate an overview of global bacterial biodiversity and biogeography using available data from the two largest public online databases, NCBI Nucleotide and GBIF. The secondary aim was to highlight the contribution each geographic area has to each database. The basis for data analysis of this study was the metadata provided by both databases, mainly, the taxonomy and the geographical area origin of isolation of the microorganism (record. These were directly obtained from GBIF through the online interface, while E-utilities and Python were used in combination with a programmatic web service access to obtain data from the NCBI Nucleotide Database. Results indicate that the American continent, and more specifically the USA, is the top contributor, while Africa and Antarctica are less well represented. This highlights the imbalance of exploration within these areas rather than any reduction in biodiversity. This study describes a novel approach to generating global scale patterns of bacterial biodiversity and biogeography and indicates that the Proteobacteria are the most abundant and widely distributed phylum within both databases.

  2. Compressing DNA sequence databases with coil

    Directory of Open Access Journals (Sweden)

    Hendy Michael D

    2008-05-01

    Full Text Available Abstract Background Publicly available DNA sequence databases such as GenBank are large, and are growing at an exponential rate. The sheer volume of data being dealt with presents serious storage and data communications problems. Currently, sequence data is usually kept in large "flat files," which are then compressed using standard Lempel-Ziv (gzip compression – an approach which rarely achieves good compression ratios. While much research has been done on compressing individual DNA sequences, surprisingly little has focused on the compression of entire databases of such sequences. In this study we introduce the sequence database compression software coil. Results We have designed and implemented a portable software package, coil, for compressing and decompressing DNA sequence databases based on the idea of edit-tree coding. coil is geared towards achieving high compression ratios at the expense of execution time and memory usage during compression – the compression time represents a "one-off investment" whose cost is quickly amortised if the resulting compressed file is transmitted many times. Decompression requires little memory and is extremely fast. We demonstrate a 5% improvement in compression ratio over state-of-the-art general-purpose compression tools for a large GenBank database file containing Expressed Sequence Tag (EST data. Finally, coil can efficiently encode incremental additions to a sequence database. Conclusion coil presents a compelling alternative to conventional compression of flat files for the storage and distribution of DNA sequence databases having a narrow distribution of sequence lengths, such as EST data. Increasing compression levels for databases having a wide distribution of sequence lengths is a direction for future work.

  3. ANCAC: amino acid, nucleotide, and codon analysis of COGs--a tool for sequence bias analysis in microbial orthologs.

    Science.gov (United States)

    Meiler, Arno; Klinger, Claudia; Kaufmann, Michael

    2012-09-08

    The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC's NUCOCOG dataset as the largest one available for that purpose thus far. Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  4. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Directory of Open Access Journals (Sweden)

    Meiler Arno

    2012-09-01

    Full Text Available Abstract Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills.

  5. ANCAC: amino acid, nucleotide, and codon analysis of COGs – a tool for sequence bias analysis in microbial orthologs

    Science.gov (United States)

    2012-01-01

    Background The COG database is the most popular collection of orthologous proteins from many different completely sequenced microbial genomes. Per definition, a cluster of orthologous groups (COG) within this database exclusively contains proteins that most likely achieve the same cellular function. Recently, the COG database was extended by assigning to every protein both the corresponding amino acid and its encoding nucleotide sequence resulting in the NUCOCOG database. This extended version of the COG database is a valuable resource connecting sequence features with the functionality of the respective proteins. Results Here we present ANCAC, a web tool and MySQL database for the analysis of amino acid, nucleotide, and codon frequencies in COGs on the basis of freely definable phylogenetic patterns. We demonstrate the usefulness of ANCAC by analyzing amino acid frequencies, codon usage, and GC-content in a species- or function-specific context. With respect to amino acids we, at least in part, confirm the cognate bias hypothesis by using ANCAC’s NUCOCOG dataset as the largest one available for that purpose thus far. Conclusions Using the NUCOCOG datasets, ANCAC connects taxonomic, amino acid, and nucleotide sequence information with the functional classification via COGs and provides a GUI for flexible mining for sequence-bias. Thereby, to our knowledge, it is the only tool for the analysis of sequence composition in the light of physiological roles and phylogenetic context without requirement of substantial programming-skills. PMID:22958836

  6. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  7. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  8. The Sequenced Angiosperm Genomes and Genome Databases.

    Science.gov (United States)

    Chen, Fei; Dong, Wei; Zhang, Jiawei; Guo, Xinyue; Chen, Junhao; Wang, Zhengjia; Lin, Zhenguo; Tang, Haibao; Zhang, Liangsheng

    2018-01-01

    Angiosperms, the flowering plants, provide the essential resources for human life, such as food, energy, oxygen, and materials. They also promoted the evolution of human, animals, and the planet earth. Despite the numerous advances in genome reports or sequencing technologies, no review covers all the released angiosperm genomes and the genome databases for data sharing. Based on the rapid advances and innovations in the database reconstruction in the last few years, here we provide a comprehensive review for three major types of angiosperm genome databases, including databases for a single species, for a specific angiosperm clade, and for multiple angiosperm species. The scope, tools, and data of each type of databases and their features are concisely discussed. The genome databases for a single species or a clade of species are especially popular for specific group of researchers, while a timely-updated comprehensive database is more powerful for address of major scientific mysteries at the genome scale. Considering the low coverage of flowering plants in any available database, we propose construction of a comprehensive database to facilitate large-scale comparative studies of angiosperm genomes and to promote the collaborative studies of important questions in plant biology.

  9. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  10. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  11. Mouse SNP Miner: an annotated database of mouse functional single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ramensky Vasily E

    2007-01-01

    Full Text Available Abstract Background The mapping of quantitative trait loci in rat and mouse has been extremely successful in identifying chromosomal regions associated with human disease-related phenotypes. However, identifying the specific phenotype-causing DNA sequence variations within a quantitative trait locus has been much more difficult. The recent availability of genomic sequence from several mouse inbred strains (including C57BL/6J, 129X1/SvJ, 129S1/SvImJ, A/J, and DBA/2J has made it possible to catalog DNA sequence differences within a quantitative trait locus derived from crosses between these strains. However, even for well-defined quantitative trait loci ( Description To help identify functional DNA sequence variations within quantitative trait loci we have used the Ensembl annotated genome sequence to compile a database of mouse single nucleotide polymorphisms (SNPs that are predicted to cause missense, nonsense, frameshift, or splice site mutations (available at http://bioinfo.embl.it/SnpApplet/. For missense mutations we have used the PolyPhen and PANTHER algorithms to predict whether amino acid changes are likely to disrupt protein function. Conclusion We have developed a database of mouse SNPs predicted to cause missense, nonsense, frameshift, and splice-site mutations. Our analysis revealed that 20% and 14% of missense SNPs are likely to be deleterious according to PolyPhen and PANTHER, respectively, and 6% are considered deleterious by both algorithms. The database also provides gene expression and functional annotations from the Symatlas, Gene Ontology, and OMIM databases to further assess candidate phenotype-causing mutations. To demonstrate its utility, we show that Mouse SNP Miner successfully finds a previously identified candidate SNP in the taste receptor, Tas1r3, that underlies sucrose preference in the C57BL/6J strain. We also use Mouse SNP Miner to derive a list of candidate phenotype-causing mutations within a previously

  12. Winnowing sequences from a database search.

    Science.gov (United States)

    Berman, P; Zhang, Z; Wolf, Y I; Koonin, E V; Miller, W

    2000-01-01

    In database searches for sequence similarity, matches to a distinct sequence region (e.g., protein domain) are frequently obscured by numerous matches to another region of the same sequence. In order to cope with this problem, algorithms are developed to discard redundant matches. One model for this problem begins with a list of intervals, each with an associated score; each interval gives the range of positions in the query sequence that align to a database sequence, and the score is that of the alignment. If interval I is contained in interval J, and I's score is less than J's, then I is said to be dominated by J. The problem is then to identify each interval that is dominated by at least K other intervals, where K is a given level of "tolerable redundancy." An algorithm is developed to solve the problem in O(N log N) time and O(N*) space, where N is the number of intervals and N* is a precisely defined value that never exceeds N and is frequently much smaller. This criterion for discarding database hits has been implemented in the Blast program, as illustrated herein with examples. Several variations and extensions of this approach are also described.

  13. Rice genetic marker database: An identification of single nucleotide ...

    African Journals Online (AJOL)

    based genetic marker system to provide information about SNP and QTL markers in rice. The SNP marker database provides 7,227 SNP markers including location information on chromosomes by using genetic map. It allows users to access a ...

  14. Nucleotide sequence alignment of hdcA from Gram-positive bacteria.

    Science.gov (United States)

    Diaz, Maria; Ladero, Victor; Redruello, Begoña; Sanchez-Llana, Esther; Del Rio, Beatriz; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-03-01

    The decarboxylation of histidine -carried out mainly by some gram-positive bacteria- yields the toxic dietary biogenic amine histamine (Ladero et al. 2010 〈10.2174/157340110791233256〉 [1], Linares et al. 2016 〈http://dx.doi.org/10.1016/j.foodchem.2015.11.013〉〉 [2]). The reaction is catalyzed by a pyruvoyl-dependent histidine decarboxylase (Linares et al. 2011 〈10.1080/10408398.2011.582813〉 [3]), which is encoded by the gene hdcA. In order to locate conserved regions in the hdcA gene of Gram-positive bacteria, this article provides a nucleotide sequence alignment of all the hdcA sequences from Gram-positive bacteria present in databases. For further utility and discussion, see 〈http://dx.doi.org/ 10.1016/j.foodcont.2015.11.035〉〉 [4].

  15. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  16. AgdbNet – antigen sequence database software for bacterial typing

    Directory of Open Access Journals (Sweden)

    Maiden Martin CJ

    2006-06-01

    Full Text Available Abstract Background Bacterial typing schemes based on the sequences of genes encoding surface antigens require databases that provide a uniform, curated, and widely accepted nomenclature of the variants identified. Due to the differences in typing schemes, imposed by the diversity of genes targeted, creating these databases has typically required the writing of one-off code to link the database to a web interface. Here we describe agdbNet, widely applicable web database software that facilitates simultaneous BLAST querying of multiple loci using either nucleotide or peptide sequences. Results Databases are described by XML files that are parsed by a Perl CGI script. Each database can have any number of loci, which may be defined by nucleotide and/or peptide sequences. The software is currently in use on at least five public databases for the typing of Neisseria meningitidis, Campylobacter jejuni and Streptococcus equi and can be set up to query internal isolate tables or suitably-configured external isolate databases, such as those used for multilocus sequence typing. The style of the resulting website can be fully configured by modifying stylesheets and through the use of customised header and footer files that surround the output of the script. Conclusion The software provides a rapid means of setting up customised Internet antigen sequence databases. The flexible configuration options enable typing schemes with differing requirements to be accommodated.

  17. A New Single Nucleotide Polymorphism Database for Rainbow Trout Generated Through Whole Genome Resequencing

    Directory of Open Access Journals (Sweden)

    Guangtu Gao

    2018-04-01

    Full Text Available Single-nucleotide polymorphisms (SNPs are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout (Oncorhynchus mykiss, SNP discovery has been previously done through sequencing of restriction-site associated DNA (RAD libraries, reduced representation libraries (RRL and RNA sequencing. Recently we have performed high coverage whole genome resequencing with 61 unrelated samples, representing a wide range of rainbow trout and steelhead populations, with 49 new samples added to 12 aquaculture samples from AquaGen (Norway that we previously used for SNP discovery. Of the 49 new samples, 11 were double-haploid lines from Washington State University (WSU and 38 represented wild and hatchery populations from a wide range of geographic distribution and with divergent migratory phenotypes. We then mapped the sequences to the new rainbow trout reference genome assembly (GCA_002163495.1 which is based on the Swanson YY doubled haploid line. Variant calling was conducted with FreeBayes and SAMtools mpileup, followed by filtering of SNPs based on quality score, sequence complexity, read depth on the locus, and number of genotyped samples. Results from the two variant calling programs were compared and genotypes of the double haploid samples were used for detecting and filtering putative paralogous sequence variants (PSVs and multi-sequence variants (MSVs. Overall, 30,302,087 SNPs were identified on the rainbow trout genome 29 chromosomes and 1,139,018 on unplaced scaffolds, with 4,042,723 SNPs having high minor allele frequency (MAF > 0.25. The average SNP density on the chromosomes was one SNP per 64 bp, or 15.6 SNPs per 1 kb. Results from the phylogenetic analysis that we conducted indicate that the SNP markers contain enough population-specific polymorphisms for recovering population relationships despite the small sample size used. Intra-Population polymorphism assessment revealed high level of polymorphism and

  18. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  19. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  20. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  1. FASH: A web application for nucleotides sequence search

    Directory of Open Access Journals (Sweden)

    Chew Paul

    2008-05-01

    Full Text Available Abstract FASH (Fourier Alignment Sequence Heuristics is a web application, based on the Fast Fourier Transform, for finding remote homologs within a long nucleic acid sequence. Given a query sequence and a long text-sequence (e.g, the human genome, FASH detects subsequences within the text that are remotely-similar to the query. FASH offers an alternative approach to Blast/Fasta for querying long RNA/DNA sequences. FASH differs from these other approaches in that it does not depend on the existence of contiguous seed-sequences in its initial detection phase. The FASH web server is user friendly and very easy to operate. Availability FASH can be accessed at https://fash.bgu.ac.il:8443/fash/default.jsp (secured website

  2. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  3. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  4. Nature and distribution of feline sarcoma virus nucleotide sequences.

    Science.gov (United States)

    Frankel, A E; Gilbert, J H; Porzig, K J; Scolnick, E M; Aaronson, S A

    1979-01-01

    The genomes of three independent isolates of feline sarcoma virus (FeSV) were compared by molecular hybridization techniques. Using complementary DNAs prepared from two strains, SM- and ST-FeSV, common complementary DNA'S were selected by sequential hybridization to FeSV and feline leukemia virus RNAs. These DNAs were shown to be highly related among the three independent sarcoma virus isolates. FeSV-specific complementary DNAs were prepared by selection for hybridization by the homologous FeSV RNA and against hybridization by fline leukemia virus RNA. Sarcoma virus-specific sequences of SM-FeSV were shown to differ from those of either ST- or GA-FeSV strains, whereas ST-FeSV-specific DNA shared extensive sequence homology with GA-FeSV. By molecular hybridization, each set of FeSV-specific sequences was demonstrated to be present in normal cat cellular DNA in approximately one copy per haploid genome and was conserved throughout Felidae. In contrast, FeSV-common sequences were present in multiple DNA copies and were found only in Mediterranean cats. The present results are consistent with the concept that each FeSV strain has arisen by a mechanism involving recombination between feline leukemia virus and cat cellular DNA sequences, the latter represented within the cat genome in a manner analogous to that of a cellular gene. PMID:225544

  5. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  6. Applications of High-Throughput Nucleotide Sequencing (PhD)

    DEFF Research Database (Denmark)

    Waage, Johannes

    equally large demands in data handling, analysis and interpretation, perhaps defining the modern challenge of the computational biologist of the post-genomic era. The first part of this thesis consists of a general introduction to the history, common terms and challenges of next generation sequencing......-sequencing, a study of the effects on alternative RNA splicing of KO of the nonsense mediated RNA decay system in Mus, using digital gene expression and a custom-built exon-exon junction mapping pipeline is presented (article I). Evolved from this work, a Bioconductor package, spliceR, for classifying alternative...

  7. Nucleotide sequence of a human tRNA gene heterocluster

    International Nuclear Information System (INIS)

    Chang, Y.N.; Pirtle, I.L.; Pirtle, R.M.

    1986-01-01

    Leucine tRNA from bovine liver was used as a hybridization probe to screen a human gene library harbored in Charon-4A of bacteriophage lambda. The human DNA inserts from plaque-pure clones were characterized by restriction endonuclease mapping and Southern hybridization techniques, using both [3'- 32 P]-labeled bovine liver leucine tRNA and total tRNA as hybridization probes. An 8-kb Hind III fragment of one of these γ-clones was subcloned into the Hind III site of pBR322. Subsequent fine restriction mapping and DNA sequence analysis of this plasmid DNA indicated the presence of four tRNA genes within the 8-kb DNA fragment. A leucine tRNA gene with an anticodon of AAG and a proline tRNA gene with an anticodon of AGG are in a 1.6-kb subfragment. A threonine tRNA gene with an anticodon of UGU and an as yet unidentified tRNA gene are located in a 1.1-kb subfragment. These two different subfragments are separated by 2.8 kb. The coding regions of the three sequenced genes contain characteristic internal split promoter sequences and do not have intervening sequences. The 3'-flanking region of these three genes have typical RNA polymerase III termination sites of at least four consecutive T residues

  8. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. Final Technical Report on the Genome Sequence DataBase (GSDB): DE-FG03 95 ER 62062 September 1997-September 1999

    Energy Technology Data Exchange (ETDEWEB)

    Harger, Carol A.

    1999-10-28

    Since September 1997 NCGR has produced two web-based tools for researchers to use to access and analyze data in the Genome Sequence DataBase (GSDB). These tools are: Sequence Viewer, a nucleotide sequence and annotation visualization tool, and MAR-Finder, a tool that predicts, base upon statistical inferences, the location of matrix attachment regions (MARS) within a nucleotide sequence. [The annual report for June 1996 to August 1997 is included as an attachment to this final report.

  10. Final Technical Report on the Genome Sequence DataBase (GSDB): DE-FG03 95 ER 62062 September 1997-September 1999; FINAL

    International Nuclear Information System (INIS)

    Harger, Carol A.

    1999-01-01

    Since September 1997 NCGR has produced two web-based tools for researchers to use to access and analyze data in the Genome Sequence DataBase (GSDB). These tools are: Sequence Viewer, a nucleotide sequence and annotation visualization tool, and MAR-Finder, a tool that predicts, base upon statistical inferences, the location of matrix attachment regions (MARS) within a nucleotide sequence.[The annual report for June 1996 to August 1997 is included as an attachment to this final report.

  11. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  12. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  13. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  14. The VirusBanker database uses a Java program to allow flexible searching through Bunyaviridae sequences

    Directory of Open Access Journals (Sweden)

    Gibbs Mark J

    2008-02-01

    Full Text Available Abstract Background Viruses of the Bunyaviridae have segmented negative-stranded RNA genomes and several of them cause significant disease. Many partial sequences have been obtained from the segments so that GenBank searches give complex results. Sequence databases usually use HTML pages to mediate remote sorting, but this approach can be limiting and may discourage a user from exploring a database. Results The VirusBanker database contains Bunyaviridae sequences and alignments and is presented as two spreadsheets generated by a Java program that interacts with a MySQL database on a server. Sequences are displayed in rows and may be sorted using information that is displayed in columns and includes data relating to the segment, gene, protein, species, strain, sequence length, terminal sequence and date and country of isolation. Bunyaviridae sequences and alignments may be downloaded from the second spreadsheet with titles defined by the user from the columns, or viewed when passed directly to the sequence editor, Jalview. Conclusion VirusBanker allows large datasets of aligned nucleotide and protein sequences from the Bunyaviridae to be compiled and winnowed rapidly using criteria that are formulated heuristically.

  15. The VirusBanker database uses a Java program to allow flexible searching through Bunyaviridae sequences.

    Science.gov (United States)

    Fourment, Mathieu; Gibbs, Mark J

    2008-02-05

    Viruses of the Bunyaviridae have segmented negative-stranded RNA genomes and several of them cause significant disease. Many partial sequences have been obtained from the segments so that GenBank searches give complex results. Sequence databases usually use HTML pages to mediate remote sorting, but this approach can be limiting and may discourage a user from exploring a database. The VirusBanker database contains Bunyaviridae sequences and alignments and is presented as two spreadsheets generated by a Java program that interacts with a MySQL database on a server. Sequences are displayed in rows and may be sorted using information that is displayed in columns and includes data relating to the segment, gene, protein, species, strain, sequence length, terminal sequence and date and country of isolation. Bunyaviridae sequences and alignments may be downloaded from the second spreadsheet with titles defined by the user from the columns, or viewed when passed directly to the sequence editor, Jalview. VirusBanker allows large datasets of aligned nucleotide and protein sequences from the Bunyaviridae to be compiled and winnowed rapidly using criteria that are formulated heuristically.

  16. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  17. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  18. MIPS: a database for protein sequences and complete genomes.

    Science.gov (United States)

    Mewes, H W; Hani, J; Pfeiffer, F; Frishman, D

    1998-01-01

    The MIPS group [Munich Information Center for Protein Sequences of the German National Center for Environment and Health (GSF)] at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, is involved in a number of data collection activities, including a comprehensive database of the yeast genome, a database reflecting the progress in sequencing the Arabidopsis thaliana genome, the systematic analysis of other small genomes and the collection of protein sequence data within the framework of the PIR-International Protein Sequence Database (described elsewhere in this volume). Through its WWW server (http://www.mips.biochem.mpg.de ) MIPS provides access to a variety of generic databases, including a database of protein families as well as automatically generated data by the systematic application of sequence analysis algorithms. The yeast genome sequence and its related information was also compiled on CD-ROM to provide dynamic interactive access to the 16 chromosomes of the first eukaryotic genome unraveled. PMID:9399795

  19. Study of event sequence database for a nuclear power domain

    International Nuclear Information System (INIS)

    Kusumi, Yoshiaki

    1998-01-01

    A retrieval engine developed to extract event sequences from an accident information database using a time series retrieval formula expressed with ordered retrieval terms is explored. This engine outputs not only a sequence which completely matches with a time series retrieval formula, but also sequence which approximately matches the formula (fuzzy retrieval). An event sequence database in which records consist of three ordered parameters, namely the causal event, the process and result. Then the database is used to assess the feasibility of this engine and favorable results were obtained. (author)

  20. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  1. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  2. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  3. MIPS: a database for genomes and protein sequences.

    Science.gov (United States)

    Mewes, H W; Frishman, D; Güldener, U; Mannhaupt, G; Mayer, K; Mokrejs, M; Morgenstern, B; Münsterkötter, M; Rudd, S; Weil, B

    2002-01-01

    The Munich Information Center for Protein Sequences (MIPS-GSF, Neuherberg, Germany) continues to provide genome-related information in a systematic way. MIPS supports both national and European sequencing and functional analysis projects, develops and maintains automatically generated and manually annotated genome-specific databases, develops systematic classification schemes for the functional annotation of protein sequences, and provides tools for the comprehensive analysis of protein sequences. This report updates the information on the yeast genome (CYGD), the Neurospora crassa genome (MNCDB), the databases for the comprehensive set of genomes (PEDANT genomes), the database of annotated human EST clusters (HIB), the database of complete cDNAs from the DHGP (German Human Genome Project), as well as the project specific databases for the GABI (Genome Analysis in Plants) and HNB (Helmholtz-Netzwerk Bioinformatik) networks. The Arabidospsis thaliana database (MATDB), the database of mitochondrial proteins (MITOP) and our contribution to the PIR International Protein Sequence Database have been described elsewhere [Schoof et al. (2002) Nucleic Acids Res., 30, 91-93; Scharfe et al. (2000) Nucleic Acids Res., 28, 155-158; Barker et al. (2001) Nucleic Acids Res., 29, 29-32]. All databases described, the protein analysis tools provided and the detailed descriptions of our projects can be accessed through the MIPS World Wide Web server (http://mips.gsf.de).

  4. PseudoMLSA: a database for multigenic sequence analysis of Pseudomonas species

    Directory of Open Access Journals (Sweden)

    Lalucat Jorge

    2010-04-01

    Full Text Available Abstract Background The genus Pseudomonas comprises more than 100 species of environmental, clinical, agricultural, and biotechnological interest. Although, the recommended method for discriminating bacterial species is DNA-DNA hybridisation, alternative techniques based on multigenic sequence analysis are becoming a common practice in bacterial species discrimination studies. Since there is not a general criterion for determining which genes are more useful for species resolution; the number of strains and genes analysed is increasing continuously. As a result, sequences of different genes are dispersed throughout several databases. This sequence information needs to be collected in a common database, in order to be useful for future identification-based projects. Description The PseudoMLSA Database is a comprehensive database of multiple gene sequences from strains of Pseudomonas species. The core of the database is composed of selected gene sequences from all Pseudomonas type strains validly assigned to the genus through 2008. The database is aimed to be useful for MultiLocus Sequence Analysis (MLSA procedures, for the identification and characterisation of any Pseudomonas bacterial isolate. The sequences are available for download via a direct connection to the National Center for Biotechnology Information (NCBI. Additionally, the database includes an online BLAST interface for flexible nucleotide queries and similarity searches with the user's datasets, and provides a user-friendly output for easily parsing, navigating, and analysing BLAST results. Conclusions The PseudoMLSA database amasses strains and sequence information of validly described Pseudomonas species, and allows free querying of the database via a user-friendly, web-based interface available at http://www.uib.es/microbiologiaBD/Welcome.html. The web-based platform enables easy retrieval at strain or gene sequence information level; including references to published peer

  5. Where the bugs are: analyzing distributions of bacterial phyla by descriptor keyword search in the nucleotide database.

    Science.gov (United States)

    Squartini, Andrea

    2011-07-26

    The associations between bacteria and environment underlie their preferential interactions with given physical or chemical conditions. Microbial ecology aims at extracting conserved patterns of occurrence of bacterial taxa in relation to defined habitats and contexts. In the present report the NCBI nucleotide sequence database is used as dataset to extract information relative to the distribution of each of the 24 phyla of the bacteria superkingdom and of the Archaea. Over two and a half million records are filtered in their cross-association with each of 48 sets of keywords, defined to cover natural or artificial habitats, interactions with plant, animal or human hosts, and physical-chemical conditions. The results are processed showing: (a) how the different descriptors enrich or deplete the proportions at which the phyla occur in the total database; (b) in which order of abundance do the different keywords score for each phylum (preferred habitats or conditions), and to which extent are phyla clustered to few descriptors (specific) or spread across many (cosmopolitan); (c) which keywords individuate the communities ranking highest for diversity and evenness. A number of cues emerge from the results, contributing to sharpen the picture on the functional systematic diversity of prokaryotes. Suggestions are given for a future automated service dedicated to refining and updating such kind of analyses via public bioinformatic engines.

  6. Using SQL Databases for Sequence Similarity Searching and Analysis.

    Science.gov (United States)

    Pearson, William R; Mackey, Aaron J

    2017-09-13

    Relational databases can integrate diverse types of information and manage large sets of similarity search results, greatly simplifying genome-scale analyses. By focusing on taxonomic subsets of sequences, relational databases can reduce the size and redundancy of sequence libraries and improve the statistical significance of homologs. In addition, by loading similarity search results into a relational database, it becomes possible to explore and summarize the relationships between all of the proteins in an organism and those in other biological kingdoms. This unit describes how to use relational databases to improve the efficiency of sequence similarity searching and demonstrates various large-scale genomic analyses of homology-related data. It also describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. The unit also introduces search_demo, a database that stores sequence similarity search results. The search_demo database is then used to explore the evolutionary relationships between E. coli proteins and proteins in other organisms in a large-scale comparative genomic analysis. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  7. PSSRdb: a relational database of polymorphic simple sequence repeats extracted from prokaryotic genomes.

    Science.gov (United States)

    Kumar, Pankaj; Chaitanya, Pasumarthy S; Nagarajaram, Hampapathalu A

    2011-01-01

    PSSRdb (Polymorphic Simple Sequence Repeats database) (http://www.cdfd.org.in/PSSRdb/) is a relational database of polymorphic simple sequence repeats (PSSRs) extracted from 85 different species of prokaryotes. Simple sequence repeats (SSRs) are the tandem repeats of nucleotide motifs of the sizes 1-6 bp and are highly polymorphic. SSR mutations in and around coding regions affect transcription and translation of genes. Such changes underpin phase variations and antigenic variations seen in some bacteria. Although SSR-mediated phase variation and antigenic variations have been well-studied in some bacteria there seems a lot of other species of prokaryotes yet to be investigated for SSR mediated adaptive and other evolutionary advantages. As a part of our on-going studies on SSR polymorphism in prokaryotes we compared the genome sequences of various strains and isolates available for 85 different species of prokaryotes and extracted a number of SSRs showing length variations and created a relational database called PSSRdb. This database gives useful information such as location of PSSRs in genomes, length variation across genomes, the regions harboring PSSRs, etc. The information provided in this database is very useful for further research and analysis of SSRs in prokaryotes.

  8. EuMicroSatdb: A database for microsatellites in the sequenced genomes of eukaryotes

    Directory of Open Access Journals (Sweden)

    Grover Atul

    2007-07-01

    Full Text Available Abstract Background Microsatellites have immense utility as molecular markers in different fields like genome characterization and mapping, phylogeny and evolutionary biology. Existing microsatellite databases are of limited utility for experimental and computational biologists with regard to their content and information output. EuMicroSatdb (Eukaryotic MicroSatellite database http://ipu.ac.in/usbt/EuMicroSatdb.htm is a web based relational database for easy and efficient positional mining of microsatellites from sequenced eukaryotic genomes. Description A user friendly web interface has been developed for microsatellite data retrieval using Active Server Pages (ASP. The backend database codes for data extraction and assembly have been written using Perl based scripts and C++. Precise need based microsatellites data retrieval is possible using different input parameters like microsatellite type (simple perfect or compound perfect, repeat unit length (mono- to hexa-nucleotide, repeat number, microsatellite length and chromosomal location in the genome. Furthermore, information about clustering of different microsatellites in the genome can also be retrieved. Finally, to facilitate primer designing for PCR amplification of any desired microsatellite locus, 200 bp upstream and downstream sequences are provided. Conclusion The database allows easy systematic retrieval of comprehensive information about simple and compound microsatellites, microsatellite clusters and their locus coordinates in 31 sequenced eukaryotic genomes. The information content of the database is useful in different areas of research like gene tagging, genome mapping, population genetics, germplasm characterization and in understanding microsatellite dynamics in eukaryotic genomes.

  9. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  10. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  11. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  12. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  13. cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

    Energy Technology Data Exchange (ETDEWEB)

    Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

    1983-01-01

    Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

  14. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    Science.gov (United States)

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  15. Complete nucleotide sequence of a novel Hibiscus-infecting Cilevirus from Florida and its relationship with closely associated Cileviruses

    Science.gov (United States)

    The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...

  16. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  17. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  18. muBLASTP: database-indexed protein sequence search on multicore CPUs.

    Science.gov (United States)

    Zhang, Jing; Misra, Sanchit; Wang, Hao; Feng, Wu-Chun

    2016-11-04

    The Basic Local Alignment Search Tool (BLAST) is a fundamental program in the life sciences that searches databases for sequences that are most similar to a query sequence. Currently, the BLAST algorithm utilizes a query-indexed approach. Although many approaches suggest that sequence search with a database index can achieve much higher throughput (e.g., BLAT, SSAHA, and CAFE), they cannot deliver the same level of sensitivity as the query-indexed BLAST, i.e., NCBI BLAST, or they can only support nucleotide sequence search, e.g., MegaBLAST. Due to different challenges and characteristics between query indexing and database indexing, the existing techniques for query-indexed search cannot be used into database indexed search. muBLASTP, a novel database-indexed BLAST for protein sequence search, delivers identical hits returned to NCBI BLAST. On Intel Haswell multicore CPUs, for a single query, the single-threaded muBLASTP achieves up to a 4.41-fold speedup for alignment stages, and up to a 1.75-fold end-to-end speedup over single-threaded NCBI BLAST. For a batch of queries, the multithreaded muBLASTP achieves up to a 5.7-fold speedups for alignment stages, and up to a 4.56-fold end-to-end speedup over multithreaded NCBI BLAST. With a newly designed index structure for protein database and associated optimizations in BLASTP algorithm, we re-factored BLASTP algorithm for modern multicore processors that achieves much higher throughput with acceptable memory footprint for the database index.

  19. Specialized microbial databases for inductive exploration of microbial genome sequences

    Directory of Open Access Journals (Sweden)

    Cabau Cédric

    2005-02-01

    Full Text Available Abstract Background The enormous amount of genome sequence data asks for user-oriented databases to manage sequences and annotations. Queries must include search tools permitting function identification through exploration of related objects. Methods The GenoList package for collecting and mining microbial genome databases has been rewritten using MySQL as the database management system. Functions that were not available in MySQL, such as nested subquery, have been implemented. Results Inductive reasoning in the study of genomes starts from "islands of knowledge", centered around genes with some known background. With this concept of "neighborhood" in mind, a modified version of the GenoList structure has been used for organizing sequence data from prokaryotic genomes of particular interest in China. GenoChore http://bioinfo.hku.hk/genochore.html, a set of 17 specialized end-user-oriented microbial databases (including one instance of Microsporidia, Encephalitozoon cuniculi, a member of Eukarya has been made publicly available. These databases allow the user to browse genome sequence and annotation data using standard queries. In addition they provide a weekly update of searches against the world-wide protein sequences data libraries, allowing one to monitor annotation updates on genes of interest. Finally, they allow users to search for patterns in DNA or protein sequences, taking into account a clustering of genes into formal operons, as well as providing extra facilities to query sequences using predefined sequence patterns. Conclusion This growing set of specialized microbial databases organize data created by the first Chinese bacterial genome programs (ThermaList, Thermoanaerobacter tencongensis, LeptoList, with two different genomes of Leptospira interrogans and SepiList, Staphylococcus epidermidis associated to related organisms for comparison.

  20. Nucleotide sequences of immunoglobulin eta genes of chimpanzee and orangutan: DNA molecular clock and hominoid evolution

    Energy Technology Data Exchange (ETDEWEB)

    Sakoyama, Y.; Hong, K.J.; Byun, S.M.; Hisajima, H.; Ueda, S.; Yaoita, Y.; Hayashida, H.; Miyata, T.; Honjo, T.

    1987-02-01

    To determine the phylogenetic relationships among hominoids and the dates of their divergence, the complete nucleotide sequences of the constant region of the immunoglobulin eta-chain (C/sub eta1/) genes from chimpanzee and orangutan have been determined. These sequences were compared with the human eta-chain constant-region sequence. A molecular clock (silent molecular clock), measured by the degree of sequence divergence at the synonymous (silent) positions of protein-encoding regions, was introduced for the present study. From the comparison of nucleotide sequences of ..cap alpha../sub 1/-antitrypsin and ..beta..- and delta-globulin genes between humans and Old World monkeys, the silent molecular clock was calibrated: the mean evolutionary rate of silent substitution was determined to be 1.56 x 10/sup -9/ substitutions per site per year. Using the silent molecular clock, the mean divergence dates of chimpanzee and orangutan from the human lineage were estimated as 6.4 +/- 2.6 million years and 17.3 +/- 4.5 million years, respectively. It was also shown that the evolutionary rate of primate genes is considerably slower than those of other mammalian genes.

  1. A Reference Viral Database (RVDB) To Enhance Bioinformatics Analysis of High-Throughput Sequencing for Novel Virus Detection.

    Science.gov (United States)

    Goodacre, Norman; Aljanahi, Aisha; Nandakumar, Subhiksha; Mikailov, Mike; Khan, Arifa S

    2018-01-01

    Detection of distantly related viruses by high-throughput sequencing (HTS) is bioinformatically challenging because of the lack of a public database containing all viral sequences, without abundant nonviral sequences, which can extend runtime and obscure viral hits. Our reference viral database (RVDB) includes all viral, virus-related, and virus-like nucleotide sequences (excluding bacterial viruses), regardless of length, and with overall reduced cellular sequences. Semantic selection criteria (SEM-I) were used to select viral sequences from GenBank, resulting in a first-generation viral database (VDB). This database was manually and computationally reviewed, resulting in refined, semantic selection criteria (SEM-R), which were applied to a new download of updated GenBank sequences to create a second-generation VDB. Viral entries in the latter were clustered at 98% by CD-HIT-EST to reduce redundancy while retaining high viral sequence diversity. The viral identity of the clustered representative sequences (creps) was confirmed by BLAST searches in NCBI databases and HMMER searches in PFAM and DFAM databases. The resulting RVDB contained a broad representation of viral families, sequence diversity, and a reduced cellular content; it includes full-length and partial sequences and endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons. Testing of RVDBv10.2, with an in-house HTS transcriptomic data set indicated a significantly faster run for virus detection than interrogating the entirety of the NCBI nonredundant nucleotide database, which contains all viral sequences but also nonviral sequences. RVDB is publically available for facilitating HTS analysis, particularly for novel virus detection. It is meant to be updated on a regular basis to include new viral sequences added to GenBank. IMPORTANCE To facilitate bioinformatics analysis of high-throughput sequencing (HTS) data for the detection of both known and novel viruses, we have

  2. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  3. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Directory of Open Access Journals (Sweden)

    Qingyu Chen

    Full Text Available First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases.We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  4. Supervised Learning for Detection of Duplicates in Genomic Sequence Databases.

    Science.gov (United States)

    Chen, Qingyu; Zobel, Justin; Zhang, Xiuzhen; Verspoor, Karin

    2016-01-01

    First identified as an issue in 1996, duplication in biological databases introduces redundancy and even leads to inconsistency when contradictory information appears. The amount of data makes purely manual de-duplication impractical, and existing automatic systems cannot detect duplicates as precisely as can experts. Supervised learning has the potential to address such problems by building automatic systems that learn from expert curation to detect duplicates precisely and efficiently. While machine learning is a mature approach in other duplicate detection contexts, it has seen only preliminary application in genomic sequence databases. We developed and evaluated a supervised duplicate detection method based on an expert curated dataset of duplicates, containing over one million pairs across five organisms derived from genomic sequence databases. We selected 22 features to represent distinct attributes of the database records, and developed a binary model and a multi-class model. Both models achieve promising performance; under cross-validation, the binary model had over 90% accuracy in each of the five organisms, while the multi-class model maintains high accuracy and is more robust in generalisation. We performed an ablation study to quantify the impact of different sequence record features, finding that features derived from meta-data, sequence identity, and alignment quality impact performance most strongly. The study demonstrates machine learning can be an effective additional tool for de-duplication of genomic sequence databases. All Data are available as described in the supplementary material.

  5. Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

    International Nuclear Information System (INIS)

    Maat, J.

    1978-01-01

    A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

  6. Sequence modelling and an extensible data model for genomic database

    Energy Technology Data Exchange (ETDEWEB)

    Li, Peter Wei-Der [California Univ., San Francisco, CA (United States); Univ. of California, Berkeley, CA (United States)

    1992-01-01

    The Human Genome Project (HGP) plans to sequence the human genome by the beginning of the next century. It will generate DNA sequences of more than 10 billion bases and complex marker sequences (maps) of more than 100 million markers. All of these information will be stored in database management systems (DBMSs). However, existing data models do not have the abstraction mechanism for modelling sequences and existing DBMS`s do not have operations for complex sequences. This work addresses the problem of sequence modelling in the context of the HGP and the more general problem of an extensible object data model that can incorporate the sequence model as well as existing and future data constructs and operators. First, we proposed a general sequence model that is application and implementation independent. This model is used to capture the sequence information found in the HGP at the conceptual level. In addition, abstract and biological sequence operators are defined for manipulating the modelled sequences. Second, we combined many features of semantic and object oriented data models into an extensible framework, which we called the ``Extensible Object Model``, to address the need of a modelling framework for incorporating the sequence data model with other types of data constructs and operators. This framework is based on the conceptual separation between constructors and constraints. We then used this modelling framework to integrate the constructs for the conceptual sequence model. The Extensible Object Model is also defined with a graphical representation, which is useful as a tool for database designers. Finally, we defined a query language to support this model and implement the query processor to demonstrate the feasibility of the extensible framework and the usefulness of the conceptual sequence model.

  7. Sequence modelling and an extensible data model for genomic database

    Energy Technology Data Exchange (ETDEWEB)

    Li, Peter Wei-Der (California Univ., San Francisco, CA (United States) Lawrence Berkeley Lab., CA (United States))

    1992-01-01

    The Human Genome Project (HGP) plans to sequence the human genome by the beginning of the next century. It will generate DNA sequences of more than 10 billion bases and complex marker sequences (maps) of more than 100 million markers. All of these information will be stored in database management systems (DBMSs). However, existing data models do not have the abstraction mechanism for modelling sequences and existing DBMS's do not have operations for complex sequences. This work addresses the problem of sequence modelling in the context of the HGP and the more general problem of an extensible object data model that can incorporate the sequence model as well as existing and future data constructs and operators. First, we proposed a general sequence model that is application and implementation independent. This model is used to capture the sequence information found in the HGP at the conceptual level. In addition, abstract and biological sequence operators are defined for manipulating the modelled sequences. Second, we combined many features of semantic and object oriented data models into an extensible framework, which we called the Extensible Object Model'', to address the need of a modelling framework for incorporating the sequence data model with other types of data constructs and operators. This framework is based on the conceptual separation between constructors and constraints. We then used this modelling framework to integrate the constructs for the conceptual sequence model. The Extensible Object Model is also defined with a graphical representation, which is useful as a tool for database designers. Finally, we defined a query language to support this model and implement the query processor to demonstrate the feasibility of the extensible framework and the usefulness of the conceptual sequence model.

  8. A novel method to discover fluoroquinolone antibiotic resistance (qnr genes in fragmented nucleotide sequences

    Directory of Open Access Journals (Sweden)

    Boulund Fredrik

    2012-12-01

    Full Text Available Abstract Background Broad-spectrum fluoroquinolone antibiotics are central in modern health care and are used to treat and prevent a wide range of bacterial infections. The recently discovered qnr genes provide a mechanism of resistance with the potential to rapidly spread between bacteria using horizontal gene transfer. As for many antibiotic resistance genes present in pathogens today, qnr genes are hypothesized to originate from environmental bacteria. The vast amount of data generated by shotgun metagenomics can therefore be used to explore the diversity of qnr genes in more detail. Results In this paper we describe a new method to identify qnr genes in nucleotide sequence data. We show, using cross-validation, that the method has a high statistical power of correctly classifying sequences from novel classes of qnr genes, even for fragments as short as 100 nucleotides. Based on sequences from public repositories, the method was able to identify all previously reported plasmid-mediated qnr genes. In addition, several fragments from novel putative qnr genes were identified in metagenomes. The method was also able to annotate 39 chromosomal variants of which 11 have previously not been reported in literature. Conclusions The method described in this paper significantly improves the sensitivity and specificity of identification and annotation of qnr genes in nucleotide sequence data. The predicted novel putative qnr genes in the metagenomic data support the hypothesis of a large and uncharacterized diversity within this family of resistance genes in environmental bacterial communities. An implementation of the method is freely available at http://bioinformatics.math.chalmers.se/qnr/.

  9. Construction of an integrated database to support genomic sequence analysis

    Energy Technology Data Exchange (ETDEWEB)

    Gilbert, W.; Overbeek, R.

    1994-11-01

    The central goal of this project is to develop an integrated database to support comparative analysis of genomes including DNA sequence data, protein sequence data, gene expression data and metabolism data. In developing the logic-based system GenoBase, a broader integration of available data was achieved due to assistance from collaborators. Current goals are to easily include new forms of data as they become available and to easily navigate through the ensemble of objects described within the database. This report comments on progress made in these areas.

  10. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    2015-11-01

    Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  11. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India

    Directory of Open Access Journals (Sweden)

    Sukdeb Nandi

    2010-03-01

    Full Text Available Canine parvovirus 2 (CPV‑2 is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV‑2a, CPV‑2b and CPV‑2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV‑2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India

  12. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India.

    Science.gov (United States)

    Nandi, Sukdeb; Anbazhagan, Rajendra; Kumar, Manoj

    2010-01-01

    Canine parvovirus 2 (CPV-2) is one of the most important viruses that causes haemorrhagic gastroenteritis and myocarditis of dogs worldwide. The picture has been complicated further due to the emergence of new mutants of CPV, namely: CPV-2a, CPV-2b and CPV-2c. In this study, the molecular characterisation of strains present in the CPV vaccines available on the Indian market was performed using polymerase chain reaction and DNA sequencing. The VP1/VP2 genes of two vaccine strains and a field strain (Bhopal) were sequenced and the nucleotide and the deduced amino acid sequences were compared. The results indicated that the isolate belonged to CPV type 2b and the strains in the vaccines belonged to type CPV-2. From the study, it is inferred that the CPV strain used in commercially available vaccine preparation differed from the strains present in CPV infection in dogs in India.

  13. Overlapping genomic sequences: a treasure trove of single-nucleotide polymorphisms.

    Science.gov (United States)

    Taillon-Miller, P; Gu, Z; Li, Q; Hillier, L; Kwok, P Y

    1998-07-01

    An efficient strategy to develop a dense set of single-nucleotide polymorphism (SNP) markers is to take advantage of the human genome sequencing effort currently under way. Our approach is based on the fact that bacterial artificial chromosomes (BACs) and P1-based artificial chromosomes (PACs) used in long-range sequencing projects come from diploid libraries. If the overlapping clones sequenced are from different lineages, one is comparing the sequences from 2 homologous chromosomes in the overlapping region. We have analyzed in detail every SNP identified while sequencing three sets of overlapping clones found on chromosome 5p15.2, 7q21-7q22, and 13q12-13q13. In the 200.6 kb of DNA sequence analyzed in these overlaps, 153 SNPs were identified. Computer analysis for repetitive elements and suitability for STS development yielded 44 STSs containing 68 SNPs for further study. All 68 SNPs were confirmed to be present in at least one of the three (Caucasian, African-American, Hispanic) populations studied. Furthermore, 42 of the SNPs tested (62%) were informative in at least one population, 32 (47%) were informative in two or more populations, and 23 (34%) were informative in all three populations. These results clearly indicate that developing SNP markers from overlapping genomic sequence is highly efficient and cost effective, requiring only the two simple steps of developing STSs around the known SNPs and characterizing them in the appropriate populations.

  14. BIOPEP database and other programs for processing bioactive peptide sequences.

    Science.gov (United States)

    Minkiewicz, Piotr; Dziuba, Jerzy; Iwaniak, Anna; Dziuba, Marta; Darewicz, Małgorzata

    2008-01-01

    This review presents the potential for application of computational tools in peptide science based on a sample BIOPEP database and program as well as other programs and databases available via the World Wide Web. The BIOPEP application contains a database of biologically active peptide sequences and a program enabling construction of profiles of the potential biological activity of protein fragments, calculation of quantitative descriptors as measures of the value of proteins as potential precursors of bioactive peptides, and prediction of bonds susceptible to hydrolysis by endopeptidases in a protein chain. Other bioactive and allergenic peptide sequence databases are also presented. Programs enabling the construction of binary and multiple alignments between peptide sequences, the construction of sequence motifs attributed to a given type of bioactivity, searching for potential precursors of bioactive peptides, and the prediction of sites susceptible to proteolytic cleavage in protein chains are available via the Internet as are other approaches concerning secondary structure prediction and calculation of physicochemical features based on amino acid sequence. Programs for prediction of allergenic and toxic properties have also been developed. This review explores the possibilities of cooperation between various programs.

  15. 37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.

    Science.gov (United States)

    2010-07-01

    ... may not include material other than part of the sequence listing. A fixed-width font should be used... integer expressing the number of bases or amino acid residues M. Type Whether presented sequence molecule is DNA, RNA, or PRT (protein). If a nucleotide sequence contains both DNA and RNA fragments, the type...

  16. Genomic DNA Enrichment Using Sequence Capture Microarrays: a Novel Approach to Discover Sequence Nucleotide Polymorphisms (SNP) in Brassica napus L

    Science.gov (United States)

    Clarke, Wayne E.; Parkin, Isobel A.; Gajardo, Humberto A.; Gerhardt, Daniel J.; Higgins, Erin; Sidebottom, Christine; Sharpe, Andrew G.; Snowdon, Rod J.; Federico, Maria L.; Iniguez-Luy, Federico L.

    2013-01-01

    Targeted genomic selection methodologies, or sequence capture, allow for DNA enrichment and large-scale resequencing and characterization of natural genetic variation in species with complex genomes, such as rapeseed canola (Brassica napus L., AACC, 2n=38). The main goal of this project was to combine sequence capture with next generation sequencing (NGS) to discover single nucleotide polymorphisms (SNPs) in specific areas of the B. napus genome historically associated (via quantitative trait loci –QTL– analysis) to traits of agronomical and nutritional importance. A 2.1 million feature sequence capture platform was designed to interrogate DNA sequence variation across 47 specific genomic regions, representing 51.2 Mb of the Brassica A and C genomes, in ten diverse rapeseed genotypes. All ten genotypes were sequenced using the 454 Life Sciences chemistry and to assess the effect of increased sequence depth, two genotypes were also sequenced using Illumina HiSeq chemistry. As a result, 589,367 potentially useful SNPs were identified. Analysis of sequence coverage indicated a four-fold increased representation of target regions, with 57% of the filtered SNPs falling within these regions. Sixty percent of discovered SNPs corresponded to transitions while 40% were transversions. Interestingly, fifty eight percent of the SNPs were found in genic regions while 42% were found in intergenic regions. Further, a high percentage of genic SNPs was found in exons (65% and 64% for the A and C genomes, respectively). Two different genotyping assays were used to validate the discovered SNPs. Validation rates ranged from 61.5% to 84% of tested SNPs, underpinning the effectiveness of this SNP discovery approach. Most importantly, the discovered SNPs were associated with agronomically important regions of the B. napus genome generating a novel data resource for research and breeding this crop species. PMID:24312619

  17. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-04-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons.

  18. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    OpenAIRE

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amin...

  19. Chromosomal location and nucleotide sequence of the Escherichia coli dapA gene.

    Science.gov (United States)

    Richaud, F; Richaud, C; Ratet, P; Patte, J C

    1986-01-01

    In Escherichia coli, the first enzyme of the diaminopimelate and lysine pathway is dihydrodipicolinate synthetase, which is feedback-inhibited by lysine and encoded by the dapA gene. The location of the dapA gene on the bacterial chromosome has been determined accurately with respect to the neighboring purC and dapE genes. The complete nucleotide sequence and the transcriptional start of the dapA gene were determined. The results show that dapA consists of a single cistron encoding a 292-amino acid polypeptide of 31,372 daltons. Images PMID:3514578

  20. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  1. Molecular cloning and nucleotide sequence of CYP6BF1 from the diamondback moth, Plutella xylostella

    Science.gov (United States)

    Li, Hongshan; Dai, Huaguo; Wei, Hui

    2005-01-01

    A novel cDNA clong encoding a cytochrome P450 was screened from the insecticide-susceptible strain of Plutella xylostella (L.) (Lepidoptera:Yponomeutidae). The nucleotide sequence of the clone, designated CYP6BF1, was determined. This is the first full-length sequence of the CYP6 family from Plutella xylostella (L.). The cDNA is 1661bp in length and contains an open reading frame from base pairs 26 to 1570, encoding a protein of 514 amino acid residues. It is similar to the other insect P450s in gene family 6, including CYP6AE1 from Depressaria pastinacella, (46%). The GenBank accession number is AY971374. PMID:17119627

  2. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  3. Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

    2006-01-01

    Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

  4. Complete nucleotide sequence of the RNA-2 of grapevine deformation and Grapevine Anatolian ringspot viruses.

    Science.gov (United States)

    Ghanem-Sabanadzovic, Nina Abou; Sabanadzovic, Sead; Digiaro, Michele; Martelli, Giovanni P

    2005-05-01

    The nucleotide sequence of RNA-2 of Grapevine Anatolian ringspot virus (GARSV) and Grapevine deformation virus (GDefV), two recently described nepoviruses, has been determined. These RNAs are 3753 nt (GDefV) and 4607 nt (GARSV) in size and contain a single open reading frame encoding a polyprotein of 122 kDa (GDefV) and 150 kDa (GARSV). Full-length nucleotide sequence comparison disclosed 71-73% homology between GDefV RNA-2 and that of Grapevine fanleaf virus (GFLV) and Arabis mosaic virus (ArMV), and 62-64% homology between GARSV RNA-2 and that of Grapevine chrome mosaic virus (GCMV) and Tomato black ring virus (TBRV). As previously observed in other nepoviruses, the 5' non-coding regions of both RNAs are capable of forming stem-loop structures. Phylogenetic analysis of the three proteins encoded by RNA-2 (i.e. protein 2A, movement protein and coat protein) confirmed that GDefV and GARSV are distinct viruses which can be assigned as definitive species in subgroup A and subgroup B of the genus Nepovirus, respectively.

  5. Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

    Science.gov (United States)

    Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

    Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

  6. Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

    International Nuclear Information System (INIS)

    Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

    1987-01-01

    Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

  7. The development and application of a Mycoplasma gallisepticum sequence database.

    Science.gov (United States)

    Armour, Natalie K; Laibinis, Victoria A; Collett, Stephen R; Ferguson-Noel, Naola

    2013-01-01

    Molecular analysis was conducted on 36 Mycoplasma gallisepticum DNA extracts from tracheal swab samples of commercial poultry in seven South African provinces between 2009 and 2012. Twelve unique M. gallisepticum genotypes were identified by polymerase chain reaction and sequence analysis of the 16S-23S rRNA intergenic spacer region (IGSR), M. gallisepticum cytadhesin 2 (mgc2), MGA_0319 and gapA genetic regions. The DNA sequences of these genotypes were distinct from those of M. gallisepticum isolates in a database composed of sequences from other countries, vaccine and reference strains. The most prevalent genotype (SA-WT#7) was detected in samples from commercial broilers, broiler breeders and layers in five provinces. South African M. gallisepticum sequences were more similar to those of the live vaccines commercially available in South Africa, but were distinct from that of F strain vaccine, which is not registered for use in South Africa. The IGSR, mgc2 or MGA_0319 sequences of three South African genotypes were identical to those of the ts-11 vaccine strain, necessitating a combination of mgc2 and IGSR targeted sequencing to differentiate South African wild-type genotypes from ts-11 vaccine. To identify and differentiate all 12 wild-types, mgc2, IGSR and MGA_0319 sequencing was required. Sequencing of gapA was least effective at strain differentiation. This research serves as a model for the development of an M. gallisepticum sequence database, and illustrates its application to characterize M. gallisepticum genotypes, select diagnostic tests and better understand the epidemiology of M. gallisepticum.

  8. Single-nucleotide polymorphism discovery by high-throughput sequencing in sorghum

    Directory of Open Access Journals (Sweden)

    White Frank F

    2011-07-01

    Full Text Available Abstract Background Eight diverse sorghum (Sorghum bicolor L. Moench accessions were subjected to short-read genome sequencing to characterize the distribution of single-nucleotide polymorphisms (SNPs. Two strategies were used for DNA library preparation. Missing SNP genotype data were imputed by local haplotype comparison. The effect of library type and genomic diversity on SNP discovery and imputation are evaluated. Results Alignment of eight genome equivalents (6 Gb to the public reference genome revealed 283,000 SNPs at ≥82% confirmation probability. Sequencing from libraries constructed to limit sequencing to start at defined restriction sites led to genotyping 10-fold more SNPs in all 8 accessions, and correctly imputing 11% more missing data, than from semirandom libraries. The SNP yield advantage of the reduced-representation method was less than expected, since up to one fifth of reads started at noncanonical restriction sites and up to one third of restriction sites predicted in silico to yield unique alignments were not sampled at near-saturation. For imputation accuracy, the availability of a genomically similar accession in the germplasm panel was more important than panel size or sequencing coverage. Conclusions A sequence quantity of 3 million 50-base reads per accession using a BsrFI library would conservatively provide satisfactory genotyping of 96,000 sorghum SNPs. For most reliable SNP-genotype imputation in shallowly sequenced genomes, germplasm panels should consist of pairs or groups of genomically similar entries. These results may help in designing strategies for economical genotyping-by-sequencing of large numbers of plant accessions.

  9. The nucleotide sequence of parsnip yellow fleck virus: a plant picorna-like virus.

    Science.gov (United States)

    Turnbull-Ross, A D; Reavy, B; Mayo, M A; Murant, A F

    1992-12-01

    The complete sequence of 9871 nucleotides (nts) of parsnip yellow fleck virus (PYFV; isolate P-121) was determined from cDNA clones and by direct sequencing of viral RNA. The RNA contains a large open reading frame between nts 279 and 9362 which encodes a polyprotein of 3027 amino acids with a calculated M(r) of 336212 (336K). A PYFV polyclonal antiserum reacted with the proteins expressed from phage carrying cDNA clones from the 5' half of the PYFV genome. Comparison of the polyprotein sequence of PYFV with other viral polyprotein sequences reveals similarities to the putative NTP-binding and RNA polymerase domains of cowpea mosaic comovirus, tomato black ring nepovirus and several animal picornaviruses. The 3' untranslated region of PYFV RNA is 509 nts long and does not have a poly(A) tail. The 3'-terminal 121 nts may form a stem-loop structure which resembles that formed in the genomic RNA of mosquito-borne flaviviruses.

  10. The nucleotide sequence of a Polish isolate of Tomato torrado virus.

    Science.gov (United States)

    Budziszewska, Marta; Obrepalska-Steplowska, Aleksandra; Wieczorek, Przemysław; Pospieszny, Henryk

    2008-12-01

    A new virus was isolated from greenhouse tomato plants showing symptoms of leaf and apex necrosis in Wielkopolska province in Poland in 2003. The observed symptoms and the virus morphology resembled viruses previously reported in Spain called Tomato torrado virus (ToTV) and that in Mexico called Tomato marchitez virus (ToMarV). The complete genome of a Polish isolate Wal'03 was determined using RT-PCR amplification using oligonucleotide primers developed against the ToTV sequences deposited in Genbank, followed by cloning, sequencing, and comparison with the sequence of the type isolate. Phylogenetic analyses, performed on the basis of fragments of polyproteins sequences, established the relationship of Polish isolate Wal'03 with Spanish ToTV and Mexican ToMarV, as well as with other viruses from Sequivirus, Sadwavirus, and Cheravirus genera, reported to be the most similar to the new tomato viruses. Wal'03 genome strands has the same organization and very high homology with the ToTV type isolate, showing only some nucleotide and deduced amino acid changes, in contrast to ToMarV, which was significantly different. The phylogenetic tree clustered aforementioned viruses to the same group, indicating that they have a common origin.

  11. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    Science.gov (United States)

    2010-07-01

    ... mature protein, with the number 1. When presented, the amino acids preceding the mature protein, e.g... acids. (1) The amino acids in a protein or peptide sequence shall be listed using the three-letter... data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...

  12. Single nucleotide polymorphism analysis of Korean native chickens using next generation sequencing data.

    Science.gov (United States)

    Seo, Dong-Won; Oh, Jae-Don; Jin, Shil; Song, Ki-Duk; Park, Hee-Bok; Heo, Kang-Nyeong; Shin, Younhee; Jung, Myunghee; Park, Junhyung; Jo, Cheorun; Lee, Hak-Kyo; Lee, Jun-Heon

    2015-02-01

    There are five native chicken lines in Korea, which are mainly classified by plumage colors (black, white, red, yellow, gray). These five lines are very important genetic resources in the Korean poultry industry. Based on a next generation sequencing technology, whole genome sequence and reference assemblies were performed using Gallus_gallus_4.0 (NCBI) with whole genome sequences from these lines to identify common and novel single nucleotide polymorphisms (SNPs). We obtained 36,660,731,136 ± 1,257,159,120 bp of raw sequence and average 26.6-fold of 25-29 billion reference assembly sequences representing 97.288 % coverage. Also, 4,006,068 ± 97,534 SNPs were observed from 29 autosomes and the Z chromosome and, of these, 752,309 SNPs are the common SNPs across lines. Among the identified SNPs, the number of novel- and known-location assigned SNPs was 1,047,951 ± 14,956 and 2,948,648 ± 81,414, respectively. The number of unassigned known SNPs was 1,181 ± 150 and unassigned novel SNPs was 8,238 ± 1,019. Synonymous SNPs, non-synonymous SNPs, and SNPs having character changes were 26,266 ± 1,456, 11,467 ± 604, 8,180 ± 458, respectively. Overall, 443,048 ± 26,389 SNPs in each bird were identified by comparing with dbSNP in NCBI. The presently obtained genome sequence and SNP information in Korean native chickens have wide applications for further genome studies such as genetic diversity studies to detect causative mutations for economic and disease related traits.

  13. Pervasive within-Mitochondrion Single-Nucleotide Variant Heteroplasmy as Revealed by Single-Mitochondrion Sequencing

    Directory of Open Access Journals (Sweden)

    Jacqueline Morris

    2017-12-01

    Full Text Available Summary: A number of mitochondrial diseases arise from single-nucleotide variant (SNV accumulation in multiple mitochondria. Here, we present a method for identification of variants present at the single-mitochondrion level in individual mouse and human neuronal cells, allowing for extremely high-resolution study of mitochondrial mutation dynamics. We identified extensive heteroplasmy between individual mitochondrion, along with three high-confidence variants in mouse and one in human that were present in multiple mitochondria across cells. The pattern of variation revealed by single-mitochondrion data shows surprisingly pervasive levels of heteroplasmy in inbred mice. Distribution of SNV loci suggests inheritance of variants across generations, resulting in Poisson jackpot lines with large SNV load. Comparison of human and mouse variants suggests that the two species might employ distinct modes of somatic segregation. Single-mitochondrion resolution revealed mitochondria mutational dynamics that we hypothesize to affect risk probabilities for mutations reaching disease thresholds. : Morris et al. use independent sequencing of multiple individual mitochondria from mouse and human brain cells to show high pervasiveness of mutations. The mutations are heteroplasmic within single mitochondria and within and between cells. These findings suggest mechanisms by which mutations accumulate over time, resulting in mitochondrial dysfunction and disease. Keywords: single mitochondrion, single cell, human neuron, mouse neuron, single-nucleotide variation

  14. High-resolution melting genotyping of Enterococcus faecium based on multilocus sequence typing derived single nucleotide polymorphisms.

    Directory of Open Access Journals (Sweden)

    Steven Y C Tong

    Full Text Available We have developed a single nucleotide polymorphism (SNP nucleated high-resolution melting (HRM technique to genotype Enterococcus faecium. Eight SNPs were derived from the E. faecium multilocus sequence typing (MLST database and amplified fragments containing these SNPs were interrogated by HRM. We tested the HRM genotyping scheme on 85 E. faecium bloodstream isolates and compared the results with MLST, pulsed-field gel electrophoresis (PFGE and an allele specific real-time PCR (AS kinetic PCR SNP typing method. In silico analysis based on predicted HRM curves according to the G+C content of each fragment for all 567 sequence types (STs in the MLST database together with empiric data from the 85 isolates demonstrated that HRM analysis resolves E. faecium into 231 "melting types" (MelTs and provides a Simpson's Index of Diversity (D of 0.991 with respect to MLST. This is a significant improvement on the AS kinetic PCR SNP typing scheme that resolves 61 SNP types with D of 0.95. The MelTs were concordant with the known ST of the isolates. For the 85 isolates, there were 13 PFGE patterns, 17 STs, 14 MelTs and eight SNP types. There was excellent concordance between PFGE, MLST and MelTs with Adjusted Rand Indices of PFGE to MelT 0.936 and ST to MelT 0.973. In conclusion, this HRM based method appears rapid and reproducible. The results are concordant with MLST and the MLST based population structure.

  15. Evaluation of atpB nucleotide sequences for phylogenetic studies of ferns and other pteridophytes.

    Science.gov (United States)

    Wolf, P

    1997-10-01

    Inferring basal relationships among vascular plants poses a major challenge to plant systematists. The divergence events that describe these relationships occurred long ago and considerable homoplasy has since accrued for both molecular and morphological characters. A potential solution is to examine phylogenetic analyses from multiple data sets. Here I present a new source of phylogenetic data for ferns and other pteridophytes. I sequenced the chloroplast gene atpB from 23 pteridophyte taxa and used maximum parsimony to infer relationships. A 588-bp region of the gene appeared to contain a statistically significant amount of phylogenetic signal and the resulting trees were largely congruent with similar analyses of nucleotide sequences from rbcL. However, a combined analysis of atpB plus rbcL produced a better resolved tree than did either data set alone. In the shortest trees, leptosporangiate ferns formed a monophyletic group. Also, I detected a well-supported clade of Psilotaceae (Psilotum and Tmesipteris) plus Ophioglossaceae (Ophioglossum and Botrychium). The demonstrated utility of atpB suggests that sequences from this gene should play a role in phylogenetic analyses that incorporate data from chloroplast genes, nuclear genes, morphology, and fossil data.

  16. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  17. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

    Science.gov (United States)

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

    2002-12-01

    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  18. Complete nucleotide sequence of watermelon chlorotic stunt virus originating from Oman.

    Science.gov (United States)

    Khan, Akhtar J; Akhtar, Sohail; Briddon, Rob W; Ammara, Um; Al-Matrooshi, Abdulrahman M; Mansoor, Shahid

    2012-07-01

    Watermelon chlorotic stunt virus (WmCSV) is a bipartite begomovirus (genus Begomovirus, family Geminiviridae) that causes economic losses to cucurbits, particularly watermelon, across the Middle East and North Africa. Recently squash (Cucurbita moschata) grown in an experimental field in Oman was found to display symptoms such as leaf curling, yellowing and stunting, typical of a begomovirus infection. Sequence analysis of the virus isolated from squash showed 97.6-99.9% nucleotide sequence identity to previously described WmCSV isolates for the DNA A component and 93-98% identity for the DNA B component. Agrobacterium-mediated inoculation to Nicotiana benthamiana resulted in the development of symptoms fifteen days post inoculation. This is the first bipartite begomovirus identified in Oman. Overall the Oman isolate showed the highest levels of sequence identity to a WmCSV isolate originating from Iran, which was confirmed by phylogenetic analysis. This suggests that WmCSV present in Oman has been introduced from Iran. The significance of this finding is discussed.

  19. GarlicESTdb: an online database and mining tool for garlic EST sequences

    Directory of Open Access Journals (Sweden)

    Choi Sang-Haeng

    2009-05-01

    Full Text Available Abstract Background Allium sativum., commonly known as garlic, is a species in the onion genus (Allium, which is a large and diverse one containing over 1,250 species. Its close relatives include chives, onion, leek and shallot. Garlic has been used throughout recorded history for culinary, medicinal use and health benefits. Currently, the interest in garlic is highly increasing due to nutritional and pharmaceutical value including high blood pressure and cholesterol, atherosclerosis and cancer. For all that, there are no comprehensive databases available for Expressed Sequence Tags(EST of garlic for gene discovery and future efforts of genome annotation. That is why we developed a new garlic database and applications to enable comprehensive analysis of garlic gene expression. Description GarlicESTdb is an integrated database and mining tool for large-scale garlic (Allium sativum EST sequencing. A total of 21,595 ESTs collected from an in-house cDNA library were used to construct the database. The analysis pipeline is an automated system written in JAVA and consists of the following components: automatic preprocessing of EST reads, assembly of raw sequences, annotation of the assembled sequences, storage of the analyzed information into MySQL databases, and graphic display of all processed data. A web application was implemented with the latest J2EE (Java 2 Platform Enterprise Edition software technology (JSP/EJB/JavaServlet for browsing and querying the database, for creation of dynamic web pages on the client side, and for mapping annotated enzymes to KEGG pathways, the AJAX framework was also used partially. The online resources, such as putative annotation, single nucleotide polymorphisms (SNP and tandem repeat data sets, can be searched by text, explored on the website, searched using BLAST, and downloaded. To archive more significant BLAST results, a curation system was introduced with which biologists can easily edit best-hit annotation

  20. GarlicESTdb: an online database and mining tool for garlic EST sequences.

    Science.gov (United States)

    Kim, Dae-Won; Jung, Tae-Sung; Nam, Seong-Hyeuk; Kwon, Hyuk-Ryul; Kim, Aeri; Chae, Sung-Hwa; Choi, Sang-Haeng; Kim, Dong-Wook; Kim, Ryong Nam; Park, Hong-Seog

    2009-05-18

    Allium sativum., commonly known as garlic, is a species in the onion genus (Allium), which is a large and diverse one containing over 1,250 species. Its close relatives include chives, onion, leek and shallot. Garlic has been used throughout recorded history for culinary, medicinal use and health benefits. Currently, the interest in garlic is highly increasing due to nutritional and pharmaceutical value including high blood pressure and cholesterol, atherosclerosis and cancer. For all that, there are no comprehensive databases available for Expressed Sequence Tags(EST) of garlic for gene discovery and future efforts of genome annotation. That is why we developed a new garlic database and applications to enable comprehensive analysis of garlic gene expression. GarlicESTdb is an integrated database and mining tool for large-scale garlic (Allium sativum) EST sequencing. A total of 21,595 ESTs collected from an in-house cDNA library were used to construct the database. The analysis pipeline is an automated system written in JAVA and consists of the following components: automatic preprocessing of EST reads, assembly of raw sequences, annotation of the assembled sequences, storage of the analyzed information into MySQL databases, and graphic display of all processed data. A web application was implemented with the latest J2EE (Java 2 Platform Enterprise Edition) software technology (JSP/EJB/JavaServlet) for browsing and querying the database, for creation of dynamic web pages on the client side, and for mapping annotated enzymes to KEGG pathways, the AJAX framework was also used partially. The online resources, such as putative annotation, single nucleotide polymorphisms (SNP) and tandem repeat data sets, can be searched by text, explored on the website, searched using BLAST, and downloaded. To archive more significant BLAST results, a curation system was introduced with which biologists can easily edit best-hit annotation information for others to view. The Garlic

  1. Evolutionary relationships in the ilarviruses: nucleotide sequence of prunus necrotic ringspot virus RNA 3.

    Science.gov (United States)

    Sánchez-Navarro, J A; Pallás, V

    1997-01-01

    The complete nucleotide sequence of an isolate of prunus necrotic ringspot virus (PNRSV) RNA 3 has been determined. Elucidation of the amino acid sequence of the proteins encoded by the two large open reading frames (ORFs) allowed us to carry out comparative and phylogenetic studies on the movement (MP) and coat (CP) proteins in the ilarvirus group. Amino acid sequence comparison of the MP revealed a highly conserved basic sequence motif with an amphipathic alpha-helical structure preceding the conserved motif of the '30K superfamily' proposed by Mushegian and Koonin [26] for MP's. Within this '30K' motif a strictly conserved transmembrane domain is present in all ilarviruses sequenced so far. At the amino-terminal end, prune dwarf virus (PDV) has an extension not present in other ilarviruses but which is observed in all bromo- and cucumoviruses, suggesting a common ancestor or a recombinational event in the Bromoviridae family. Examination of the N-terminus of the CP's of all ilarviruses revealed a highly basic region, part of which resembles the Arg-rich motif that has been characterized in the RNA-binding protein family. This motif has also been found in the other members of the Bromoviridae family, suggesting its involvement in a structural function. Furthermore this region is required for infectivity in ilarviruses. The similarities found in this Arg-rich motif are discussed in terms of this process known as genome activation. Finally, phylogenetic analysis of both the MP and CP proteins revealed a higher relationship of A1MV to PNRSV, apple mosaic virus (ApMV) and PDV than any other member of the ilarvirus group. In that sense, A1MV should be considered as a true ilarvirus instead of forming a distinct group of viruses.

  2. Comparison of Nucleotide Sequence of P2C Region in Diabetogenic and Non-Diabetogenic Coxsackie Virus B5 Isolates

    Directory of Open Access Journals (Sweden)

    Cheng-Chong Chou

    2004-11-01

    Full Text Available Enteroviruses are environmental triggers in the pathogenesis of type 1 diabetes mellitus (DM. A sequence of six identical amino acids (PEVKEK is shared by the 2C protein of Coxsackie virus B and the glutamic acid decarboxylase (GAD molecules. Between 1995 and 2002, we investigated 22 Coxsackie virus B5 (CVB5 isolates from southern Taiwan. Four of these isolates were obtained from four new-onset type 1 DM patients with diabetic ketoacidosis. We compared a 300 nucleotide sequence in the 2C protein gene (p2C in 24 CVB5 isolates (4 diabetogenic, 18 non-diabetogenic and 2 prototype. We found 0.3-10% nucleotide differences. In the four isolates from type 1 DM patients, there was only 2.4-3.4% nucleotide difference, and there was only 1.7-7.1% nucleotide difference between type 1 DM isolates and non-diabetogenic isolates. Comparison of the nucleotide sequence between prototype virus and 22 CVB5 isolates revealed 18.4-24.1% difference. Twenty-one CVB5 isolates from type 1 DM and non-type 1 DM patients contained the PEVKEK sequence, as shown by the p2C nucleotide sequence. Our data showed that the viral p2C sequence with homology with GAD is highly conserved in CVB5 isolates. There was no difference between diabetogenic and non-diabetogenic CVB5 isolates. All four type 1 DM patients had at least one of the genetic susceptibility alleles HLA-DR, DQA1, DQB1. Other genetic and autoimmune factors such as HLA genetic susceptibility and GAD may also play important roles in the pathogenesis in type 1 DM.

  3. Comprehensive Genetic Database of Expressed Sequence Tags for Coccolithophorids

    Science.gov (United States)

    Ranji, Mohammad; Hadaegh, Ahmad R.

    Coccolithophorids are unicellular, marine, golden-brown, single-celled algae (Haptophyta) commonly found in near-surface waters in patchy distributions. They belong to the Phytoplankton family that is known to be responsible for much of the earth reproduction. Phytoplankton, just like plants live based on the energy obtained by Photosynthesis which produces oxygen. Substantial amount of oxygen in the earth's atmosphere is produced by Phytoplankton through Photosynthesis. The single-celled Emiliana Huxleyi is the most commonly known specie of Coccolithophorids and is known for extracting bicarbonate (HCO3) from its environment and producing calcium carbonate to form Coccoliths. Coccolithophorids are one of the world's primary producers, contributing about 15% of the average oceanic phytoplankton biomass to the oceans. They produce elaborate, minute calcite platelets (Coccoliths), covering the cell to form a Coccosphere and supplying up to 60% of the bulk pelagic calcite deposited on the sea floors. In order to understand the genetics of Coccolithophorid and the complexities of their biochemical reactions, we decided to build a database to store a complete profile of these organisms' genomes. Although a variety of such databases currently exist, (http://www.geneservice.co.uk/home/) none have yet been developed to comprehensively address the sequencing efforts underway by the Coccolithophorid research community. This database is called CocooExpress and is available to public (http://bioinfo.csusm.edu) for both data queries and sequence contribution.

  4. The complete nucleotide sequence of Alternanthera mosaic virus infecting Portulaca grandiflora represents a new strain distinct from phlox isolates.

    Science.gov (United States)

    Ivanov, Peter A; Mukhamedzhanova, Anna A; Smirnov, Alexander A; Rodionova, Nina P; Karpova, Olga V; Atabekov, Joseph G

    2011-04-01

    A southeastern European isolate of Alternanthera mosaic virus (AltMV-MU) of the genus Potexvirus (family Flexiviridae) was purified from the ornamental plant Portulaca grandiflora. The complete nucleotide sequence (6606 nucleotides) of AltMV-MU genomic RNA was defined. The AltMV-MU genome is different from those of all isolates described earlier and is most closely related to genomes of partly sequenced portulaca isolates AltMV-Po (America) and AltMV-It (Italy). Phylogenetic analysis supports the view that AltMV-MU belongs to a new "portulaca" genotype distinguishable from the "phlox" genotype.

  5. Viral to metazoan marine plankton nucleotide sequences from the Tara Oceans expedition.

    Science.gov (United States)

    Alberti, Adriana; Poulain, Julie; Engelen, Stefan; Labadie, Karine; Romac, Sarah; Ferrera, Isabel; Albini, Guillaume; Aury, Jean-Marc; Belser, Caroline; Bertrand, Alexis; Cruaud, Corinne; Da Silva, Corinne; Dossat, Carole; Gavory, Frédérick; Gas, Shahinaz; Guy, Julie; Haquelle, Maud; Jacoby, E'krame; Jaillon, Olivier; Lemainque, Arnaud; Pelletier, Eric; Samson, Gaëlle; Wessner, Mark; Acinas, Silvia G; Royo-Llonch, Marta; Cornejo-Castillo, Francisco M; Logares, Ramiro; Fernández-Gómez, Beatriz; Bowler, Chris; Cochrane, Guy; Amid, Clara; Hoopen, Petra Ten; De Vargas, Colomban; Grimsley, Nigel; Desgranges, Elodie; Kandels-Lewis, Stefanie; Ogata, Hiroyuki; Poulton, Nicole; Sieracki, Michael E; Stepanauskas, Ramunas; Sullivan, Matthew B; Brum, Jennifer R; Duhaime, Melissa B; Poulos, Bonnie T; Hurwitz, Bonnie L; Pesant, Stéphane; Karsenti, Eric; Wincker, Patrick

    2017-08-01

    A unique collection of oceanic samples was gathered by the Tara Oceans expeditions (2009-2013), targeting plankton organisms ranging from viruses to metazoans, and providing rich environmental context measurements. Thanks to recent advances in the field of genomics, extensive sequencing has been performed for a deep genomic analysis of this huge collection of samples. A strategy based on different approaches, such as metabarcoding, metagenomics, single-cell genomics and metatranscriptomics, has been chosen for analysis of size-fractionated plankton communities. Here, we provide detailed procedures applied for genomic data generation, from nucleic acids extraction to sequence production, and we describe registries of genomics datasets available at the European Nucleotide Archive (ENA, www.ebi.ac.uk/ena). The association of these metadata to the experimental procedures applied for their generation will help the scientific community to access these data and facilitate their analysis. This paper complements other efforts to provide a full description of experiments and open science resources generated from the Tara Oceans project, further extending their value for the study of the world's planktonic ecosystems.

  6. Population structure of pigs determined by single nucleotide polymorphisms observed in assembled expressed sequence tags.

    Science.gov (United States)

    Matsumoto, Toshimi; Okumura, Naohiko; Uenishi, Hirohide; Hayashi, Takeshi; Hamasima, Noriyuki; Awata, Takashi

    2012-01-01

    We have collected more than 190000 porcine expressed sequence tags (ESTs) from full-length complementary DNA (cDNA) libraries and identified more than 2800 single nucleotide polymorphisms (SNPs). In this study, we tentatively chose 222 SNPs observed in assembled ESTs to study pigs of different breeds; 104 were selected by comparing the cDNA sequences of a Meishan pig and samples of three-way cross pigs (Landrace, Large White, and Duroc: LWD), and 118 were selected from LWD samples. To evaluate the genetic variation between the chosen SNPs from pig breeds, we determined the genotypes for 192 pig samples (11 pig groups) from our DNA reference panel with matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Of the 222 reference SNPs, 186 were successfully genotyped. A neighbor-joining tree showed that the pig groups were classified into two large clusters, namely, Euro-American and East Asian pig populations. F-statistics and the analysis of molecular variance of Euro-American pig groups revealed that approximately 25% of the genetic variations occurred because of intergroup differences. As the F(IS) values were less than the F(ST) values(,) the clustering, based on the Bayesian inference, implied that there was strong genetic differentiation among pig groups and less divergence within the groups in our samples. © 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

  7. Characterization of Sri Lanka rabies virus isolates using nucleotide sequence analysis of nucleoprotein gene.

    Science.gov (United States)

    Arai, Y T; Takahashi, H; Kameoka, Y; Shiino, T; Wimalaratne, O; Lodmell, D L

    2001-01-01

    Thirty-four suspected rabid brain samples from 2 humans, 24 dogs, 4 cats, 2 mongooses, I jackal and I water buffalo were collected in 1995-1996 in Sri Lanka. Total RNA was extracted directly from brain suspensions and examined using a one-step reverse transcription-polymerase chain reaction (RT-PCR) for the rabies virus nucleoprotein (N) gene. Twenty-eight samples were found positive for the virus N gene by RT-PCR and also for the virus antigens by fluorescent antibody (FA) test. Rabies virus isolates obtained from different animal species in different regions of Sri Lanka were genetically homogenous. Sequences of 203 nucleotides (nt)-long RT-PCR products obtained from 16 of 27 samples were found identical. Sequences of 1350 nt of N genes of 14 RT-PCR products were determined. The Sri Lanka isolates under study formed a specific cluster that included also an earlier isolate from India but did not include the known isolates from China, Thailand, Malaysia, Israel, Iran, Oman, Saudi Arabia, Russia, Nepal, Philippines, Japan and from several other countries. These results suggest that one type of rabies virus is circulating among human, dog, cat, mongoose, jackal and water buffalo living near Colombo City and in other five remote regions in Sri Lanka.

  8. Complete Nucleotide Sequence Analysis of the Norovirus GII.4 Sydney Variant in South Korea

    Directory of Open Access Journals (Sweden)

    Ji-Sun Park

    2015-01-01

    Full Text Available Norovirus is the primary cause of acute gastroenteritis in individuals of all ages. In Australia, a new strain of norovirus (GII.4 was identified in March 2012, and this strain has spread rapidly around the world. In August 2012, this new GII.4 strain was identified in patients in South Korea. Therefore, to examine the characteristics of the epidemic norovirus GII.4 2012 variant in South Korea, we conducted KM272334 full-length genomic analysis. The genome of the gg-12-08-04 strain consisted of 7,558 bp and contained three open reading frame (ORF composites throughout the whole genome: ORF1 (5,100 bp, ORF2 (1,623 bp, and ORF3 (807 bp. Phylogenetic analyses showed that gg-12-08-04 belonged to the GII.4 Sydney 2012 variant, sharing 98.92% nucleotide similarity with this variant strain. According to SimPlot analysis, the gg-12-08-04 strain was a recombinant strain with breakpoint at the ORF1/2 junction between Osaka 2007 and Apeldoorn 2008 strains. This study is the first report of the complete sequence of the GII.4 Sydney 2012 strain in South Korea. Therefore, this may represent the standard sequence of the norovirus GII.4 2012 variant in South Korea and could therefore be useful for the development of norovirus vaccines.

  9. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Science.gov (United States)

    Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  10. JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

    Science.gov (United States)

    Dong, Min; Graham, Mitchell; Yadav, Nehul

    2017-01-01

    Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

  11. JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

    Directory of Open Access Journals (Sweden)

    Jieming Shi

    Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

  12. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  13. Prevalence of single nucleotide polymorphism among 27 diverse alfalfa genotypes as assessed by transcriptome sequencing

    Directory of Open Access Journals (Sweden)

    Li Xuehui

    2012-10-01

    Full Text Available Abstract Background Alfalfa, a perennial, outcrossing species, is a widely planted forage legume producing highly nutritious biomass. Currently, improvement of cultivated alfalfa mainly relies on recurrent phenotypic selection. Marker assisted breeding strategies can enhance alfalfa improvement efforts, particularly if many genome-wide markers are available. Transcriptome sequencing enables efficient high-throughput discovery of single nucleotide polymorphism (SNP markers for a complex polyploid species. Result The transcriptomes of 27 alfalfa genotypes, including elite breeding genotypes, parents of mapping populations, and unimproved wild genotypes, were sequenced using an Illumina Genome Analyzer IIx. De novo assembly of quality-filtered 72-bp reads generated 25,183 contigs with a total length of 26.8 Mbp and an average length of 1,065 bp, with an average read depth of 55.9-fold for each genotype. Overall, 21,954 (87.2% of the 25,183 contigs represented 14,878 unique protein accessions. Gene ontology (GO analysis suggested that a broad diversity of genes was represented in the resulting sequences. The realignment of individual reads to the contigs enabled the detection of 872,384 SNPs and 31,760 InDels. High resolution melting (HRM analysis was used to validate 91% of 192 putative SNPs identified by sequencing. Both allelic variants at about 95% of SNP sites identified among five wild, unimproved genotypes are still present in cultivated alfalfa, and all four US breeding programs also contain a high proportion of these SNPs. Thus, little evidence exists among this dataset for loss of significant DNA sequence diversity from either domestication or breeding of alfalfa. Structure analysis indicated that individuals from the subspecies falcata, the diploid subspecies caerulea, and the tetraploid subspecies sativa (cultivated tetraploid alfalfa were clearly separated. Conclusion We used transcriptome sequencing to discover large numbers of SNPs

  14. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library

    Directory of Open Access Journals (Sweden)

    Salem Mohamed

    2009-11-01

    Full Text Available Abstract Background To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs have been used for single nucleotide polymorphism (SNP discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA broodstock population. Results The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends. Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183 of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In

  15. Single nucleotide polymorphism discovery in rainbow trout by deep sequencing of a reduced representation library.

    Science.gov (United States)

    Sánchez, Cecilia Castaño; Smith, Timothy P L; Wiedmann, Ralph T; Vallejo, Roger L; Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E

    2009-11-25

    To enhance capabilities for genomic analyses in rainbow trout, such as genomic selection, a large suite of polymorphic markers that are amenable to high-throughput genotyping protocols must be identified. Expressed Sequence Tags (ESTs) have been used for single nucleotide polymorphism (SNP) discovery in salmonids. In those strategies, the salmonid semi-tetraploid genomes often led to assemblies of paralogous sequences and therefore resulted in a high rate of false positive SNP identification. Sequencing genomic DNA using primers identified from ESTs proved to be an effective but time consuming methodology of SNP identification in rainbow trout, therefore not suitable for high throughput SNP discovery. In this study, we employed a high-throughput strategy that used pyrosequencing technology to generate data from a reduced representation library constructed with genomic DNA pooled from 96 unrelated rainbow trout that represent the National Center for Cool and Cold Water Aquaculture (NCCCWA) broodstock population. The reduced representation library consisted of 440 bp fragments resulting from complete digestion with the restriction enzyme HaeIII; sequencing produced 2,000,000 reads providing an average 6 fold coverage of the estimated 150,000 unique genomic restriction fragments (300,000 fragment ends). Three independent data analyses identified 22,022 to 47,128 putative SNPs on 13,140 to 24,627 independent contigs. A set of 384 putative SNPs, randomly selected from the sets produced by the three analyses were genotyped on individual fish to determine the validation rate of putative SNPs among analyses, distinguish apparent SNPs that actually represent paralogous loci in the tetraploid genome, examine Mendelian segregation, and place the validated SNPs on the rainbow trout linkage map. Approximately 48% (183) of the putative SNPs were validated; 167 markers were successfully incorporated into the rainbow trout linkage map. In addition, 2% of the sequences from the

  16. Finding the right coverage : The impact of coverage and sequence quality on single nucleotide polymorphism genotyping error rates

    NARCIS (Netherlands)

    Fountain, Emily D.; Pauli, Jonathan N.; Reid, Brendan N.; Palsboll, Per J.; Peery, M. Zachariah

    Restriction-enzyme-based sequencing methods enable the genotyping of thousands of single nucleotide polymorphism (SNP) loci in nonmodel organisms. However, in contrast to traditional genetic markers, genotyping error rates in SNPs derived from restriction-enzyme-based methods remain largely unknown.

  17. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  18. Whole-genome sequencing identifies genomic heterogeneity at a nucleotide and chromosomal level in bladder cancer

    Science.gov (United States)

    Morrison, Carl D.; Liu, Pengyuan; Woloszynska-Read, Anna; Zhang, Jianmin; Luo, Wei; Qin, Maochun; Bshara, Wiam; Conroy, Jeffrey M.; Sabatini, Linda; Vedell, Peter; Xiong, Donghai; Liu, Song; Wang, Jianmin; Shen, He; Li, Yinwei; Omilian, Angela R.; Hill, Annette; Head, Karen; Guru, Khurshid; Kunnev, Dimiter; Leach, Robert; Eng, Kevin H.; Darlak, Christopher; Hoeflich, Christopher; Veeranki, Srividya; Glenn, Sean; You, Ming; Pruitt, Steven C.; Johnson, Candace S.; Trump, Donald L.

    2014-01-01

    Using complete genome analysis, we sequenced five bladder tumors accrued from patients with muscle-invasive transitional cell carcinoma of the urinary bladder (TCC-UB) and identified a spectrum of genomic aberrations. In three tumors, complex genotype changes were noted. All three had tumor protein p53 mutations and a relatively large number of single-nucleotide variants (SNVs; average of 11.2 per megabase), structural variants (SVs; average of 46), or both. This group was best characterized by chromothripsis and the presence of subclonal populations of neoplastic cells or intratumoral mutational heterogeneity. Here, we provide evidence that the process of chromothripsis in TCC-UB is mediated by nonhomologous end-joining using kilobase, rather than megabase, fragments of DNA, which we refer to as “stitchers,” to repair this process. We postulate that a potential unifying theme among tumors with the more complex genotype group is a defective replication–licensing complex. A second group (two bladder tumors) had no chromothripsis, and a simpler genotype, WT tumor protein p53, had relatively few SNVs (average of 5.9 per megabase) and only a single SV. There was no evidence of a subclonal population of neoplastic cells. In this group, we used a preclinical model of bladder carcinoma cell lines to study a unique SV (translocation and amplification) of the gene glutamate receptor ionotropic N-methyl D-aspertate as a potential new therapeutic target in bladder cancer. PMID:24469795

  19. Complete nucleotide sequence and genome organization of a Chinese isolate of Tobacco vein distorting virus.

    Science.gov (United States)

    Mo, Xiao-han; Chen, Zheng-bin; Chen, Jian-ping

    2010-12-01

    Tobacco bushy top disease is caused by tobacco bushy top virus (TBTV, a member of the genus Umbravirus) which is dependent on tobacco vein-distorting virus (TVDV) to act as a helper virus encapsidating TBTV and enabling its transmission by aphids. Isometric virions from diseased tobacco plants were purified and disease symptoms were reproduced after experimental aphid transmission. The complete genome of TVDV was determined from cloned RT-PCR products derived from viral RNA. It was 5,920 nucleotides (nts) long and had the six major open reading frames (ORFs) typical of a member of the genus Polerovirus. Sequence comparisons showed that it differed significantly from any of the other species in the genus and this was confirmed by phylogenetic analyses of the RdRp and coat protein. SDS-PAGE analysis of purified virions gave two protein bands of about 26 and 59 kDa both of which reacted strongly in Western blots with antiserum produced to prokaryotically expressed TVDV CP showing that the two forms of the TVDV CP were the only protein components of the capsid.

  20. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Science.gov (United States)

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

    2016-03-22

    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  1. Database Description - ASTRA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available abase Description General information of database Database name ASTRA Alternative n...tics Journal Search: Contact address Database classification Nucleotide Sequence Databases - Gene structure,...3702 Taxonomy Name: Oryza sativa Taxonomy ID: 4530 Database description The database represents classified p...(10):1211-6. External Links: Original website information Database maintenance site National Institute of Ad... for user registration Not available About This Database Database Description Dow

  2. Nucleotide sequence of the melA gene, coding for alpha-galactosidase in Escherichia coli K-12.

    OpenAIRE

    Liljeström, P L; Liljeström, P

    1987-01-01

    Melibiose uptake and hydrolysis in E.coli is performed by the MelB and MelA proteins, respectively. We report the cloning and sequencing of the melA gene. The nucleotide sequence data showed that melA codes for a 450 amino acid long protein with a molecular weight of 50.6 kd. The sequence data also supported the assumption that the mel locus forms an operon with melA in proximal position. A comparison of MelA with alpha-galactosidase proteins from yeast and human origin showed that these prot...

  3. Nucleotide sequence of a chickpea chlorotic stunt virus relative that infects pea and faba bean in China.

    Science.gov (United States)

    Zhou, Cui-Ji; Xiang, Hai-Ying; Zhuo, Tao; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

    2012-07-01

    We determined the genome sequence of a new polerovirus that infects field pea and faba bean in China. Its entire nucleotide sequence (6021 nt) was most closely related (83.3% identity) to that of an Ethiopian isolate of chickpea chlorotic stunt virus (CpCSV-Eth). With the exception of the coat protein (encoded by ORF3), amino acid sequence identities of all gene products of this virus to those of CpCSV-Eth and other poleroviruses were Polerovirus, and the name pea mild chlorosis virus is proposed.

  4. MSDB: A Comprehensive Database of Simple Sequence Repeats.

    Science.gov (United States)

    Avvaru, Akshay Kumar; Saxena, Saketh; Sowpati, Divya Tej; Mishra, Rakesh Kumar

    2017-06-01

    Microsatellites, also known as Simple Sequence Repeats (SSRs), are short tandem repeats of 1-6 nt motifs present in all genomes, particularly eukaryotes. Besides their usefulness as genome markers, SSRs have been shown to perform important regulatory functions, and variations in their length at coding regions are linked to several disorders in humans. Microsatellites show a taxon-specific enrichment in eukaryotic genomes, and some may be functional. MSDB (Microsatellite Database) is a collection of >650 million SSRs from 6,893 species including Bacteria, Archaea, Fungi, Plants, and Animals. This database is by far the most exhaustive resource to access and analyze SSR data of multiple species. In addition to exploring data in a customizable tabular format, users can view and compare the data of multiple species simultaneously using our interactive plotting system. MSDB is developed using the Django framework and MySQL. It is freely available at http://tdb.ccmb.res.in/msdb. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  5. Complete nucleotide sequence and analysis of two conjugative broad host range plasmids from a marine microbial biofilm.

    Directory of Open Access Journals (Sweden)

    Peter Norberg

    Full Text Available The complete nucleotide sequence of plasmids pMCBF1 and pMCBF6 was determined and analyzed. pMCBF1 and pMCBF6 form a novel clade within the IncP-1 plasmid family designated IncP-1 ς. The plasmids were exogenously isolated earlier from a marine biofilm. pMCBF1 (62 689 base pairs; bp and pMCBF6 (66 729 bp have identical backbones, but differ in their mercury resistance transposons. pMCBF1 carries Tn5053 and pMCBF6 carries Tn5058. Both are flanked by 5 bp direct repeats, typical of replicative transposition. Both insertions are in the vicinity of a resolvase gene in the backbone, supporting the idea that both transposons are "res-site hunters" that preferably insert close to and use external resolvase functions. The similarity of the backbones indicates recent insertion of the two transposons and the ongoing dynamics of plasmid evolution in marine biofilms. Both plasmids also carry the insertion sequence ISPst1, albeit without flanking repeats. ISPs1is located in an unusual site within the control region of the plasmid. In contrast to most known IncP-1 plasmids the pMCBF1/pMCBF6 backbone has no insert between the replication initiation gene (trfA and the vegetative replication origin (oriV. One pMCBF1/pMCBF6 block of about 2.5 kilo bases (kb has no similarity with known sequences in the databases. Furthermore, insertion of three genes with similarity to the multidrug efflux pump operon mexEF and a gene from the NodT family of the tripartite multi-drug resistance-nodulation-division (RND system in Pseudomonas aeruginosa was found. They do not seem to confer antibiotic resistance to the hosts of pMCBF1/pMCBF6, but the presence of RND on promiscuous plasmids may have serious implications for the spread of antibiotic multi-resistance.

  6. Single nucleotide polymorphism discovery from expressed sequence tags in the waterflea Daphnia magna

    Directory of Open Access Journals (Sweden)

    Souche Erika L

    2011-06-01

    Full Text Available Abstract Background Daphnia (Crustacea: Cladocera plays a central role in standing aquatic ecosystems, has a well known ecology and is widely used in population studies and environmental risk assessments. Daphnia magna is, especially in Europe, intensively used to study stress responses of natural populations to pollutants, climate change, and antagonistic interactions with predators and parasites, which have all been demonstrated to induce micro-evolutionary and adaptive responses. Although its ecology and evolutionary biology is intensively studied, little is known on the functional genomics underpinning of phenotypic responses to environmental stressors. The aim of the present study was to find genes expressed in presence of environmental stressors, and target such genes for single nucleotide polymorphic (SNP marker development. Results We developed three expressed sequence tag (EST libraries using clonal lineages of D. magna exposed to ecological stressors, namely fish predation, parasite infection and pesticide exposure. We used these newly developed ESTs and other Daphnia ESTs retrieved from NCBI GeneBank to mine for SNP markers targeting synonymous as well as non synonymous genetic variation. We validate the developed SNPs in six natural populations of D. magna distributed at regional scale. Conclusions A large proportion (47% of the produced ESTs are Daphnia lineage specific genes, which are potentially involved in responses to environmental stress rather than to general cellular functions and metabolic activities, or reflect the arthropod's aquatic lifestyle. The characterization of genes expressed under stress and the validation of their SNPs for population genetic study is important for identifying ecologically responsive genes in D. magna.

  7. Database Description - RMG | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ase Description General information of database Database name RMG Alternative name ...raki 305-8602, Japan National Institute of Agrobiological Sciences E-mail : Database... classification Nucleotide Sequence Databases Organism Taxonomy Name: Oryza sativa Japonica Group Taxonomy ID: 39947 Database...rnal: Mol Genet Genomics (2002) 268: 434–445 External Links: Original website information Database...available URL of Web services - Need for user registration Not available About This Database Database Descri

  8. Comparison of the nucleotide sequence of wild-type hepatitis - A virus and its attenuated candidate vaccine derivative

    International Nuclear Information System (INIS)

    Cohen, J.I.; Rosenblum, B.; Ticehurst, J.R.; Daemer, R.; Feinstone, S.; Purcell, R.H.

    1987-01-01

    Development of attenuated mutants for use as vaccines is in progress for other viruses, including influenza, rotavirus, varicella-zoster, cytomegalovirus, and hepatitis-A virus (HAV). Attenuated viruses may be derived from naturally occurring mutants that infect human or nonhuman hosts. Alternatively, attenuated mutants may be generated by passage of wild-type virus in cell culture. Production of attenuated viruses in cell culture is a laborious and empiric process. Despite previous empiric successes, understanding the molecular basis for attenuation of vaccine viruses could facilitate future development and use of live-virus vaccines. Comparison of the complete nucleotide sequences of wild-type (virulent) and vaccine (attenuated) viruses has been reported for polioviruses and yellow fever virus. Here, the authors compare the nucleotide sequence of wild-type HAV HM-175 with that of a candidate vaccine derivative

  9. A weighted sampling algorithm for the design of RNA sequences with targeted secondary structure and nucleotide distribution.

    Science.gov (United States)

    Reinharz, Vladimir; Ponty, Yann; Waldispühl, Jérôme

    2013-07-01

    The design of RNA sequences folding into predefined secondary structures is a milestone for many synthetic biology and gene therapy studies. Most of the current software uses similar local search strategies (i.e. a random seed is progressively adapted to acquire the desired folding properties) and more importantly do not allow the user to control explicitly the nucleotide distribution such as the GC-content in their sequences. However, the latter is an important criterion for large-scale applications as it could presumably be used to design sequences with better transcription rates and/or structural plasticity. In this article, we introduce IncaRNAtion, a novel algorithm to design RNA sequences folding into target secondary structures with a predefined nucleotide distribution. IncaRNAtion uses a global sampling approach and weighted sampling techniques. We show that our approach is fast (i.e. running time comparable or better than local search methods), seedless (we remove the bias of the seed in local search heuristics) and successfully generates high-quality sequences (i.e. thermodynamically stable) for any GC-content. To complete this study, we develop a hybrid method combining our global sampling approach with local search strategies. Remarkably, our glocal methodology overcomes both local and global approaches for sampling sequences with a specific GC-content and target structure. IncaRNAtion is available at csb.cs.mcgill.ca/incarnation/. Supplementary data are available at Bioinformatics online.

  10. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus) Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms

    Science.gov (United States)

    Bertolini, Francesca; Scimone, Concetta; Geraci, Claudia; Schiavo, Giuseppina; Utzeri, Valerio Joe; Chiofalo, Vincenzo; Fontanesi, Luca

    2015-01-01

    Few studies investigated the donkey (Equus asinus) at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer) and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated) and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL) obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca). The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs) in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing) and Ion Torrent (RRL) runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources. PMID:26151450

  11. Next Generation Semiconductor Based Sequencing of the Donkey (Equus asinus Genome Provided Comparative Sequence Data against the Horse Genome and a Few Millions of Single Nucleotide Polymorphisms.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available Few studies investigated the donkey (Equus asinus at the whole genome level so far. Here, we sequenced the genome of two male donkeys using a next generation semiconductor based sequencing platform (the Ion Proton sequencer and compared obtained sequence information with the available donkey draft genome (and its Illumina reads from which it was originated and with the EquCab2.0 assembly of the horse genome. Moreover, the Ion Torrent Personal Genome Analyzer was used to sequence reduced representation libraries (RRL obtained from a DNA pool including donkeys of different breeds (Grigio Siciliano, Ragusano and Martina Franca. The number of next generation sequencing reads aligned with the EquCab2.0 horse genome was larger than those aligned with the draft donkey genome. This was due to the larger N50 for contigs and scaffolds of the horse genome. Nucleotide divergence between E. caballus and E. asinus was estimated to be ~ 0.52-0.57%. Regions with low nucleotide divergence were identified in several autosomal chromosomes and in the whole chromosome X. These regions might be evolutionally important in equids. Comparing Y-chromosome regions we identified variants that could be useful to track donkey paternal lineages. Moreover, about 4.8 million of single nucleotide polymorphisms (SNPs in the donkey genome were identified and annotated combining sequencing data from Ion Proton (whole genome sequencing and Ion Torrent (RRL runs with Illumina reads. A higher density of SNPs was present in regions homologous to horse chromosome 12, in which several studies reported a high frequency of copy number variants. The SNPs we identified constitute a first resource useful to describe variability at the population genomic level in E. asinus and to establish monitoring systems for the conservation of donkey genetic resources.

  12. The nucleotide sequence of RNA1 of Lettuce big-vein virus, genus Varicosavirus, reveals its relation to nonsegmented negative-strand RNA viruses.

    Science.gov (United States)

    Sasaya, Takahide; Ishikawa, Koichi; Koganezawa, Hiroki

    2002-06-05

    The complete nucleotide sequence of RNA1 from Lettuce big-vein virus (LBVV), the type member of the genus Varicosavirus, was determined. LBVV RNA1 consists of 6797 nucleotides and contains one large ORF that encodes a large (L) protein of 2040 amino acids with a predicted M(r) of 232,092. Northern blot hybridization analysis indicated that the LBVV RNA1 is a negative-sense RNA. Database searches showed that the amino acid sequence of L protein is homologous to those of L polymerases of nonsegmented negative-strand RNA viruses. A cluster dendrogram derived from alignments of the LBVV L protein and the L polymerases indicated that the L protein is most closely related to the L polymerases of plant rhabdoviruses. Transcription termination/polyadenylation signal-like poly(U) tracts that resemble those in rhabdovirus and paramyxovirus RNAs were present upstream and downstream of the coding region. Although LBVV is related to rhabdoviruses, a key distinguishing feature is that the genome of LBVV is segmented. The results reemphasize the need to reconsider the taxonomic position of varicosaviruses.

  13. Molecular Identification of Necrophagous Muscidae and Sarcophagidae Fly Species Collected in Korea by Mitochondrial Cytochrome c Oxidase Subunit I Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Yu-Hoon Kim

    2014-01-01

    Full Text Available Identification of insect species is an important task in forensic entomology. For more convenient species identification, the nucleotide sequences of cytochrome c oxidase subunit I (COI gene have been widely utilized. We analyzed full-length COI nucleotide sequences of 10 Muscidae and 6 Sarcophagidae fly species collected in Korea. After DNA extraction from collected flies, PCR amplification and automatic sequencing of the whole COI sequence were performed. Obtained sequences were analyzed for a phylogenetic tree and a distance matrix. Our data showed very low intraspecific sequence distances and species-level monophylies. However, sequence comparison with previously reported sequences revealed a few inconsistencies or paraphylies requiring further investigation. To the best of our knowledge, this study is the first report of COI nucleotide sequences from Hydrotaea occulta, Muscina angustifrons, Muscina pascuorum, Ophyra leucostoma, Sarcophaga haemorrhoidalis, Sarcophaga harpax, and Phaonia aureola.

  14. Reticulamoeba Is a Long-Branched Granofilosean (Cercozoa) That Is Missing from Sequence Databases

    Science.gov (United States)

    Bass, David; Yabuki, Akinori; Santini, Sébastien; Romac, Sarah; Berney, Cédric

    2012-01-01

    We sequenced the 18S ribosomal RNA gene of seven isolates of the enigmatic marine amoeboflagellate Reticulamoeba Grell, which resolved into four genetically distinct Reticulamoeba lineages, two of which correspond to R. gemmipara Grell and R. minor Grell, another with a relatively large cell body forming lacunae, and another that has similarities to both R. minor and R. gemmipara but with a greater propensity to form cell clusters. These lineages together form a long-branched clade that branches within the cercozoan class Granofilosea (phylum Cercozoa), showing phylogenetic affinities with the genus Mesofila. The basic morphology of Reticulamoeba is a roundish or ovoid cell with a more or less irregular outline. Long and branched reticulopodia radiate from the cell. The reticulopodia bear granules that are bidirectionally motile. There is also a biflagellate dispersal stage. Reticulamoeba is frequently observed in coastal marine environmental samples. PCR primers specific to the Reticulamoeba clade confirm that it is a frequent member of benthic marine microbial communities, and is also found in brackish water sediments and freshwater biofilm. However, so far it has not been found in large molecular datasets such as the nucleotide database in NCBI GenBank, metagenomic datasets in Camera, and the marine microbial eukaryote sampling and sequencing consortium BioMarKs, although closely related lineages can be found in some of these datasets using a highly targeted approach. Therefore, although such datasets are very powerful tools in microbial ecology, they may, for several methodological reasons, fail to detect ecologically and evolutionary key lineages. PMID:23226495

  15. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  16. Nucleotide sequence of the coat protein gene of Lettuce big-vein virus.

    Science.gov (United States)

    Sasaya, T; Ishikawa, K; Koganezawa, H

    2001-06-01

    A sequence of 1425 nt was established that included the complete coat protein (CP) gene of Lettuce big-vein virus (LBVV). The LBVV CP gene encodes a 397 amino acid protein with a predicted M(r) of 44486. Antisera raised against synthetic peptides corresponding to N-terminal or C-terminal parts of the LBVV CP reacted in Western blot analysis with a protein with an M(r) of about 48000. RNA extracted from purified particles of LBVV by using proteinase K, SDS and phenol migrated in gels as two single-stranded RNA species of approximately 7.3 kb (ss-1) and 6.6 kb (ss-2). After denaturation by heat and annealing at room temperature, the RNA migrated as four species, ss-1, ss-2 and two additional double-stranded RNAs (ds-1 and ds-2). The Northern blot hybridization analysis using riboprobes from a full-length clone of the LBVV CP gene indicated that ss-2 has a negative-sense nature and contains the LBVV CP gene. Moreover, ds-2 is a double-stranded form of ss-2. Database searches showed that the LBVV CP most resembled the nucleocapsid proteins of rhabdoviruses. These results indicate that it would be appropriate to classify LBVV as a negative-sense single-stranded RNA virus rather than as a double-stranded RNA virus.

  17. Amino acid and nucleotide recurrence in aligned sequences: synonymous substitution patterns in association with global and local base compositions.

    Science.gov (United States)

    Nishizawa, M; Nishizawa, K

    2000-10-01

    The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.

  18. Single nucleotide polymorphism barcoding of cytochrome c oxidase I sequences for discriminating 17 species of Columbidae by decision tree algorithm.

    Science.gov (United States)

    Yang, Cheng-Hong; Wu, Kuo-Chuan; Dahms, Hans-Uwe; Chuang, Li-Yeh; Chang, Hsueh-Wei

    2017-07-01

    DNA barcodes are widely used in taxonomy, systematics, species identification, food safety, and forensic science. Most of the conventional DNA barcode sequences contain the whole information of a given barcoding gene. Most of the sequence information does not vary and is uninformative for a given group of taxa within a monophylum. We suggest here a method that reduces the amount of noninformative nucleotides in a given barcoding sequence of a major taxon, like the prokaryotes, or eukaryotic animals, plants, or fungi. The actual differences in genetic sequences, called single nucleotide polymorphism (SNP) genotyping, provide a tool for developing a rapid, reliable, and high-throughput assay for the discrimination between known species. Here, we investigated SNPs as robust markers of genetic variation for identifying different pigeon species based on available cytochrome c oxidase I (COI) data. We propose here a decision tree-based SNP barcoding (DTSB) algorithm where SNP patterns are selected from the DNA barcoding sequence of several evolutionarily related species in order to identify a single species with pigeons as an example. This approach can make use of any established barcoding system. We here firstly used as an example the mitochondrial gene COI information of 17 pigeon species (Columbidae, Aves) using DTSB after sequence trimming and alignment. SNPs were chosen which followed the rule of decision tree and species-specific SNP barcodes. The shortest barcode of about 11 bp was then generated for discriminating 17 pigeon species using the DTSB method. This method provides a sequence alignment and tree decision approach to parsimoniously assign a unique and shortest SNP barcode for any known species of a chosen monophyletic taxon where a barcoding sequence is available.

  19. Fusion protein gene nucleotide sequence similarities, shared antigenic sites and phylogenetic analysis suggest that phocid distemper virus 2 and canine distemper virus belong to the same virus entity.

    NARCIS (Netherlands)

    I.K.G. Visser (Ilona); R.W.J. van der Heijden (Roger); M.W.G. van de Bildt (Marco); M.J.H. Kenter (Marcel); C. Örvell; A.D.M.E. Osterhaus (Albert)

    1993-01-01

    textabstractNucleotide sequencing of the fusion protein (F) gene of phocid distemper virus-2 (PDV-2), recently isolated from Baikal seals (Phoca sibirica), revealed an open reading frame (nucleotides 84 to 2075) with two potential in-frame ATG translation initiation codons. We suggest that the

  20. The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

    NARCIS (Netherlands)

    Steenbergh, P.H.; Sussenbach, J.S.

    The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

  1. Analysis of nucleotide sequence variations in herpes simplex virus types 1 and 2, and varicella-zoster virus

    International Nuclear Information System (INIS)

    Chiba, A.; Suzutani, T.; Koyano, S.; Azuma, M.; Saijo, M.

    1998-01-01

    To analyze the difference in the degree of divergence between genes from identical herpes virus species, we examined the nucleotide sequence of genes from the herpes simplex virus type 1 (HSV-l ) strains VR-3 and 17 encoding thymidine kinase (TK), deoxyribonuclease (DNase), protein kinase (PK; UL13) and virion-associated host shut off (vhs) protein (UL41). The frequency of nucleotide substitutions per 1 kb in TK gene was 2.5 to 4.3 times higher than those in the other three genes. To prove that the polymorphism of HSV-1 TK gene is common characteristic of herpes virus TK genes, we compared the diversity of TK genes among eight HSV-l , six herpes simplex virus type 2 (HSV-2) and seven varicella-zoster virus (VZV) strains. The average frequency of nucleotide substitutions per 1 kb in the TK gene of HSV-l strains was 4-fold higher than that in the TK gene of HSV-2 strains. The VZV TK gene was highly conserved and only two nucleotide changes were evident in VZV strains. However, the rate of non-synonymous substitutions in total nucleotide substitutions was similar among the TK genes of the three viruses. This result indicated that the mutational rates differed, but there were no significant differences in selective pressure. We conclude that HSV-l TK gene is highly diverged and analysis of variations in the gene is a useful approach for understanding the molecular evolution of HSV-l in a short period. (authors)

  2. Using relational databases for improved sequence similarity searching and large-scale genomic analyses.

    Science.gov (United States)

    Mackey, Aaron J; Pearson, William R

    2004-10-01

    Relational databases are designed to integrate diverse types of information and manage large sets of search results, greatly simplifying genome-scale analyses. Relational databases are essential for management and analysis of large-scale sequence analyses, and can also be used to improve the statistical significance of similarity searches by focusing on subsets of sequence libraries most likely to contain homologs. This unit describes using relational databases to improve the efficiency of sequence similarity searching and to demonstrate various large-scale genomic analyses of homology-related data. This unit describes the installation and use of a simple protein sequence database, seqdb_demo, which is used as a basis for the other protocols. These include basic use of the database to generate a novel sequence library subset, how to extend and use seqdb_demo for the storage of sequence similarity search results and making use of various kinds of stored search results to address aspects of comparative genomic analysis.

  3. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

  4. Cloning and nucleotide sequence analysis of pepV, a carnosinase gene from Lactobacillus delbrueckii subsp. lactis DSM 7290, and partial characterization of the enzyme.

    Science.gov (United States)

    Vongerichten, K F; Klein, J R; Matern, H; Plapp, R

    1994-10-01

    Cell extracts of Lactobacillus delbrueckii subsp. lactis DSM 7290 were found to exhibit unique peptolytic ability against unusual beta-alanyl-dipeptides. In order to clone the gene encoding this activity, designated pepV, a gene library of strain DSM 7290 genomic DNA, prepared in the low-copy-number plasmid pLG339, was screened for heterologous expression in Escherichia coli. Recombinant clones harbouring pepV were identified by their ability to allow the utilization of carnosine (beta-alanyl-histidine) as a source of histidine by the E. coli mutant strain UK197 (pepD, hisG). Complementation was observed in a colony harbouring a recombinant plasmid (pKV101), carrying pepV. A 2.4 kb fragment containing pepV was subcloned and its nucleotide sequence revealed an open reading frame (ORF) of 1413 nucleotides, corresponding to a protein with predicted molecular mass of 51998 Da. A single transcription initiation site 71 bp upstream of the ATG translational start codon was identified by primer extension. No significant homology was detected between pepV or its deduced amino acid sequence with any entry in the databases. The only similarity was found in a region conserved in the ArgE/DapE/CPG2/YscS family of proteins. This observation, and protease inhibitor studies, indicated that pepV is of the metalloprotease type. A second ORF present in the sequenced fragment showed extensive homology to a variety of amino acid permeases from E. coli and Saccharomyces cerevisiae.

  5. MIPS: a database for protein sequences, homology data and yeast genome information.

    Science.gov (United States)

    Mewes, H W; Albermann, K; Heumann, K; Liebl, S; Pfeiffer, F

    1997-01-01

    The MIPS group (Martinsried Institute for Protein Sequences) at the Max-Planck-Institute for Biochemistry, Martinsried near Munich, Germany, collects, processes and distributes protein sequence data within the framework of the tripartite association of the PIR-International Protein Sequence Database (,). MIPS contributes nearly 50% of the data input to the PIR-International Protein Sequence Database. The database is distributed on CD-ROM together with PATCHX, an exhaustive supplement of unique, unverified protein sequences from external sources compiled by MIPS. Through its WWW server (http://www.mips.biochem.mpg.de/ ) MIPS permits internet access to sequence databases, homology data and to yeast genome information. (i) Sequence similarity results from the FASTA program () are stored in the FASTA database for all proteins from PIR-International and PATCHX. The database is dynamically maintained and permits instant access to FASTA results. (ii) Starting with FASTA database queries, proteins have been classified into families and superfamilies (PROT-FAM). (iii) The HPT (hashed position tree) data structure () developed at MIPS is a new approach for rapid sequence and pattern searching. (iv) MIPS provides access to the sequence and annotation of the complete yeast genome (), the functional classification of yeast genes (FunCat) and its graphical display, the 'Genome Browser' (). A CD-ROM based on the JAVA programming language providing dynamic interactive access to the yeast genome and the related protein sequences has been compiled and is available on request. PMID:9016498

  6. Nucleotide sequences from the genomes of diverse cowpea accessions for discovery of genetic variation as part of the Feed the Future Innovation Lab for Climate Resilient Cowpea

    Data.gov (United States)

    US Agency for International Development — Nucleotide sequences were generated from 37 cowpea (Vigna unguiculata L. Walp.) accessions relevant to Africa, China and the USA to discover at type of genetic...

  7. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes].

    Science.gov (United States)

    Kuznedelov, K D; Timoshkin, O A

    1995-01-01

    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  8. Nucleotide Sequences and Comparison of Two Large Conjugative Plasmids from Different Campylobacter species

    National Research Council Canada - National Science Library

    Batchelor, Roger A; Pearson, Bruce M; Friis, Lorna M; Guerry, Patricia; Wells, Jerry M

    2004-01-01

    .... Both plasmids are mosaic in structure, having homologues of genes found in a variety of different commensal and pathogenic bacteria, but nevertheless, showed striking similarities in DNA sequence...

  9. Database-driven primary analysis of raw sequencing data

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to methods for identifying the source of a biological sequence containing sample from raw sequencing reads. The method may be used to identify the source of unknown DNA and can be used for diagnostic, biodefense, food safety and quality, and hygiene applications...

  10. Nucleotide sequence of the 3' ends of the double-stranded RNAs of grapevine chrome mosaic nepovirus.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Dunez, J

    1988-02-01

    Attempts were made to label the termini of dsRNAs corresponding to the two genomic RNAs of grapevine chrome mosaic nepovirus (GCMV). It was not possible to label the 5' ends of the dsRNAs with [gamma-32P]ATP, which suggests that a genome-linked protein blocks their 5' ends. Both dsRNA species were labelled at their 3' ends with pCp. The 3'-terminal sequences were determined by 'wandering spot' or by partial enzymic cleavage analysis. One strand (presumably positive) ended in a poly(A) 30 to 50 nucleotides long whereas the other (presumably negative) ended in 3'-ACCUUUUAAAAAG (RNA1) or 3'-ACCUUUUAAUAAAG (RNA2). The sequences resemble closely those complementary to the 5' ends of the RNAs of tomato black ring virus (strain S), which is distantly related to GCMV.

  11. Complete nucleotide sequence and genome organization of Olive latent virus 3, a new putative member of the family Tymoviridae.

    Science.gov (United States)

    Alabdullah, Abdulkader; Minafra, Angelantonio; Elbeaino, Toufic; Saponari, Maria; Savino, Vito; Martelli, Giovanni P

    2010-09-01

    The complete nucleotide sequence and the genome organization were determined of a putative new member of the family Tymoviridae, tentatively named Olive latent virus 3 (OLV-3), recovered in southern Italy from a symptomless olive tree. The sequenced ssRNA genome comprises 7148 nucleotides excluding the poly(A) tail and contains four open reading frames (ORFs). ORF1 encodes a polyprotein of 221.6kDa in size, containing the conserved signatures of the methyltransferase (MTR), papain-like protease (PRO), helicase (HEL) and RNA-dependent RNA polymerase (RdRp) domains of the replication-associated proteins of positive-strand RNA viruses. ORF2 overlaps completely ORF1 and encodes a putative protein of 43.33kDa showing limited sequence similarity with the putative movement protein of Maize rayado fino virus (MRFV). ORF3 codes for a protein with predicted molecular mass of 28.46kDa, identified as the coat protein (CP), whereas ORF4 overlaps ORF3 and encodes a putative protein of 16kDa with sequence similarity to the p16 and p31 proteins of Citrus sudden death-associated virus (CSDaV) and Grapevine fleck virus (GFkV), respectively. Within the family Tymoviridae, OLV-3 genome has the closest identity level (49-52%) with members of the genus Marafivirus, from which, however, it differs because of the diverse genome organization and the presence of a single type of CP subunits. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  12. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian; Cao, Minh Duc; Hall, Michael B; Duarte, Tania; Wang, Sheng; Coin, Lachlan J M

    2018-01-01

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  13. Chiron: translating nanopore raw signal directly into nucleotide sequence using deep learning

    KAUST Repository

    Teng, Haotian

    2018-04-10

    Sequencing by translocating DNA fragments through an array of nanopores is a rapidly maturing technology that offers faster and cheaper sequencing than other approaches. However, accurately deciphering the DNA sequence from the noisy and complex electrical signal is challenging. Here, we report Chiron, the first deep learning model to achieve end-to-end basecalling and directly translate the raw signal to DNA sequence without the error-prone segmentation step. Trained with only a small set of 4,000 reads, we show that our model provides state-of-the-art basecalling accuracy, even on previously unseen species. Chiron achieves basecalling speeds of more than 2,000 bases per second using desktop computer graphics processing units.

  14. Database Description - KAIKOcDNA | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us KAIKOcDNA Database Description General information of database Database name KAIKOcDNA Alter...National Institute of Agrobiological Sciences Akiya Jouraku E-mail : Database cla...ssification Nucleotide Sequence Databases Organism Taxonomy Name: Bombyx mori Taxonomy ID: 7091 Database des...rnal: G3 (Bethesda) / 2013, Sep / vol.9 External Links: Original website information Database maintenance si...available URL of Web services - Need for user registration Not available About This Database Database

  15. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    Science.gov (United States)

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

  16. Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

    International Nuclear Information System (INIS)

    Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

    1988-01-01

    Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

  17. Mason: a JavaScript web site widget for visualizing and comparing annotated features in nucleotide or protein sequences.

    Science.gov (United States)

    Jaschob, Daniel; Davis, Trisha N; Riffle, Michael

    2015-03-07

    Sequence feature annotations (e.g., protein domain boundaries, binding sites, and secondary structure predictions) are an essential part of biological research. Annotations are widely used by scientists during research and experimental design, and are frequently the result of biological studies. A generalized and simple means of disseminating and visualizing these data via the web would be of value to the research community. Mason is a web site widget designed to visualize and compare annotated features of one or more nucleotide or protein sequence. Annotated features may be of virtually any type, ranging from annotating transcription binding sites or exons and introns in DNA to secondary structure or domain boundaries in proteins. Mason is simple to use and easy to integrate into web sites. Mason has a highly dynamic and configurable interface supporting multiple sets of annotations per sequence, overlapping regions, customization of interface and user-driven events (e.g., clicks and text to appear for tooltips). It is written purely in JavaScript and SVG, requiring no 3(rd) party plugins or browser customization. Mason is a solution for dissemination of sequence annotation data on the web. It is highly flexible, customizable, simple to use, and is designed to be easily integrated into web sites. Mason is open source and freely available at https://github.com/yeastrc/mason.

  18. Biological characterization and complete nucleotide sequence of a Tunisian isolate of Moroccan watermelon mosaic virus.

    Science.gov (United States)

    Yakoubi, S; Desbiez, C; Fakhfakh, H; Wipf-Scheibel, C; Marrakchi, M; Lecoq, H

    2008-01-01

    During a survey conducted in October 2005, cucurbit leaf samples showing virus-like symptoms were collected from the major cucurbit-growing areas in Tunisia. DAS-ELISA showed the presence of Moroccan watermelon mosaic virus (MWMV, Potyvirus), detected for the first time in Tunisia, in samples from the region of Cap Bon (Northern Tunisia). MWMV isolate TN05-76 (MWMV-Tn) was characterized biologically and its full-length genome sequence was established. MWMV-Tn was found to have biological properties similar to those reported for the MWMV type strain from Morocco. Phylogenetic analysis including the comparison of complete amino-acid sequences of 42 potyviruses confirmed that MWMV-Tn is related (65% amino-acid sequence identity) to Papaya ringspot virus (PRSV) isolates but is a member of a distinct virus species. Sequence analysis on parts of the CP gene of MWMV isolates from different geographical origins revealed some geographic structure of MWMV variability, with three different clusters: one cluster including isolates from the Mediterranean region, a second including isolates from western and central Africa, and a third one including isolates from the southern part of Africa. A significant correlation was observed between geographic and genetic distances between isolates. Isolates from countries in the Mediterranean region where MWMV has recently emerged (France, Spain, Portugal) have highly conserved sequences, suggesting that they may have a common and recent origin. MWMV from Sudan, a highly divergent variant, may be considered an evolutionary intermediate between MWMV and PRSV.

  19. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. sequence evaluation and plastome evolution.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G

    2008-04-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome-genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I-III in one clade, while plastome IV appears to be closest to the common ancestor.

  20. The complete nucleotide sequences of the five genetically distinct plastid genomes of Oenothera, subsection Oenothera: I. Sequence evaluation and plastome evolution†

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Rauwolf, Uwe; Silber, Martina V.; Mayer, Klaus; Meurer, Jörg; Haberer, Georg; Herrmann, Reinhold G.

    2008-01-01

    The flowering plant genus Oenothera is uniquely suited for studying molecular mechanisms of speciation. It assembles an intriguing combination of genetic features, including permanent translocation heterozygosity, biparental transmission of plastids, and a general interfertility of well-defined species. This allows an exchange of plastids and nuclei between species often resulting in plastome–genome incompatibility. For evaluation of its molecular determinants we present the complete nucleotide sequences of the five basic, genetically distinguishable plastid chromosomes of subsection Oenothera (=Euoenothera) of the genus, which are associated in distinct combinations with six basic genomes. Sizes of the chromosomes range from 163 365 bp (plastome IV) to 165 728 bp (plastome I), display between 96.3% and 98.6% sequence similarity and encode a total of 113 unique genes. Plastome diversification is caused by an abundance of nucleotide substitutions, small insertions, deletions and repetitions. The five plastomes deviate from the general ancestral design of plastid chromosomes of vascular plants by a subsection-specific 56 kb inversion within the large single-copy segment. This inversion disrupted operon structures and predates the divergence of the subsection presumably 1 My ago. Phylogenetic relationships suggest plastomes I–III in one clade, while plastome IV appears to be closest to the common ancestor. PMID:18299283

  1. Selection, Recombination and History in a Parasitic Flatworm (Echinococcus Inferred from Nucleotide Sequences

    Directory of Open Access Journals (Sweden)

    Haag KL

    1998-01-01

    Full Text Available Three species of flatworms from the genus Echinococcus (E. granulosus, E. multilocularis and E. vogeli and four strains of E. granulosus (cattle, horse, pig and sheep strains were analysed by the PCR-SSCP method followed by sequencing, using as targets two non-coding and two coding (one nuclear and one mitochondrial genomic regions. The sequencing data was used to evaluate hypothesis about the parasite breeding system and the causes of genetic diversification. The calculated recombination parameters suggested that cross-fertilisation was rare in the history of the group. However, the relative rates of substitution in the coding sequences showed that positive selection (instead of purifying selection drove the evolution of an elastase and neutrophil chemotaxis inhibitor gene (AgB/1. The phylogenetic analyses revealed several ambiguities, indicating that the taxonomic status of the E. granulosus horse strain should be revised

  2. Taxonomic evaluation of selected Ganoderma species and database sequence validation

    Directory of Open Access Journals (Sweden)

    Suldbold Jargalmaa

    2017-07-01

    Full Text Available Species in the genus Ganoderma include several ecologically important and pathogenic fungal species whose medicinal and economic value is substantial. Due to the highly similar morphological features within the Ganoderma, identification of species has relied heavily on DNA sequencing using BLAST searches, which are only reliable if the GenBank submissions are accurately labeled. In this study, we examined 113 specimens collected from 1969 to 2016 from various regions in Korea using morphological features and multigene analysis (internal transcribed spacer, translation elongation factor 1-α, and the second largest subunit of RNA polymerase II. These specimens were identified as four Ganoderma species: G. sichuanense, G. cf. adspersum, G. cf. applanatum, and G. cf. gibbosum. With the exception of G. sichuanense, these species were difficult to distinguish based solely on morphological features. However, phylogenetic analysis at three different loci yielded concordant phylogenetic information, and supported the four species distinctions with high bootstrap support. A survey of over 600 Ganoderma sequences available on GenBank revealed that 65% of sequences were either misidentified or ambiguously labeled. Here, we suggest corrected annotations for GenBank sequences based on our phylogenetic validation and provide updated global distribution patterns for these Ganoderma species.

  3. Taxonomic evaluation of selected Ganoderma species and database sequence validation

    Science.gov (United States)

    Jargalmaa, Suldbold; Eimes, John A.; Park, Myung Soo; Park, Jae Young; Oh, Seung-Yoon

    2017-01-01

    Species in the genus Ganoderma include several ecologically important and pathogenic fungal species whose medicinal and economic value is substantial. Due to the highly similar morphological features within the Ganoderma, identification of species has relied heavily on DNA sequencing using BLAST searches, which are only reliable if the GenBank submissions are accurately labeled. In this study, we examined 113 specimens collected from 1969 to 2016 from various regions in Korea using morphological features and multigene analysis (internal transcribed spacer, translation elongation factor 1-α, and the second largest subunit of RNA polymerase II). These specimens were identified as four Ganoderma species: G. sichuanense, G. cf. adspersum, G. cf. applanatum, and G. cf. gibbosum. With the exception of G. sichuanense, these species were difficult to distinguish based solely on morphological features. However, phylogenetic analysis at three different loci yielded concordant phylogenetic information, and supported the four species distinctions with high bootstrap support. A survey of over 600 Ganoderma sequences available on GenBank revealed that 65% of sequences were either misidentified or ambiguously labeled. Here, we suggest corrected annotations for GenBank sequences based on our phylogenetic validation and provide updated global distribution patterns for these Ganoderma species. PMID:28761785

  4. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  5. Cloning, nucleotide sequence and transcriptional analysis of the uvrA gene from Neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Black, C.G.; Fyfe, J.A.M.; Davies, J.K.

    1997-01-01

    A recombinant plasmid capable of restoring UV resistance to an Escherichia coli uvrA mutant was isolated from a genomic library of Neisseria gonorrhoeae. Sequence analysis revealed an open reading frame whose deduced amino acid sequence displayed significant similarity to those of the UvrA proteins of other bacterial species. A second open reading frame (ORF259) was identified upstream from, and in the opposite orientation to the gonococcal uvrA gene. Transcriptional fusions between portions of the gonococcal uvrA upstream region and a reporter gene were used to localise promoter activity in both E. coli and N. gonorrhoeae. The transcriptional starting points of uvrA and ORF259 were mapped in E. coli by primer extension analysis, and corresponding σ 70 promoters were identified. The arrangement of the uvrA-ORF259 intergenic region is similar to that of the gonococcal recA-aroD intergenic region. Both contain inverted copies of the 10 bp neisserial DNA uptake sequence situated between divergently transcribed genes. However, there is no evidence that either the uptake sequence or the proximity of the promoters influences expression of these genes. (author)

  6. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  7. Symbolic complexity for nucleotide sequences: a sign of the genome structure

    International Nuclear Information System (INIS)

    Salgado-García, R; Ugalde, E

    2016-01-01

    We introduce a method for estimating the complexity function (which counts the number of observable words of a given length) of a finite symbolic sequence, which we use to estimate the complexity function of coding DNA sequences for several species of the Hominidae family. In all cases, the obtained symbolic complexities show the same characteristic behavior: exponential growth for small word lengths, followed by linear growth for larger word lengths. The symbolic complexities of the species we consider exhibit a systematic trend in correspondence with the phylogenetic tree. Using our method, we estimate the complexity function of sequences obtained by some known evolution models, and in some cases we observe the characteristic exponential-linear growth of the Hominidae coding DNA complexity. Analysis of the symbolic complexity of sequences obtained from a specific evolution model points to the following conclusion: linear growth arises from the random duplication of large segments during the evolution of the genome, while the decrease in the overall complexity from one species to another is due to a difference in the speed of accumulation of point mutations. (paper)

  8. The use of sequence-based SSR mining for the development of a vast collection of microsatellites in Aquilegia Formosa

    Science.gov (United States)

    Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet

    2014-01-01

    Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...

  9. License - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project License to Use This Database Last updated : 2010/02/15 You may use this databas...ional License described below. The Standard License specifies the license terms regarding the use of this database... and the requirements you must follow in using this database. The Additiona...n the Standard License. Standard License The Standard License for this database is the license specified in ...the Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database

  10. Nucleotide sequence and taxonomy of Cycas necrotic stunt virus. Brief report.

    Science.gov (United States)

    Han, S S; Karasev, A V; Ieki, H; Iwanami, T

    2002-11-01

    Cycas necrotic stunt virus (CNSV) is the only well-characterized virus from gymnosperm. cDNA segments corresponding to the bipartite genome RNAs (RNA1, RNA2) were synthesized and sequenced. Each RNA encoded a single polyprotein, flanked by the 5' and 3' non-coding regions (NCR) and followed by a poly (A) tail. The putative polyproteins encoded by RNA1 and RNA2 had sets of motifs, which were characteristic of viruses in the genus Nepovirus. The polyproteins showed higher sequence identities to Artichoke Italian latent virus, Grapevine chrome mosaic virus and Tomato black ring virus, all of which belong to subgroup b of the genus Nepovirus, than to other nepoviruses. Phylogenetic analysis of RNA dependent RNA polymerase and coat protein also showed closer relationships with these viruses than other viruses. The data obtained supported the taxonomical status of CNSV as a definitive member of the genus Nepovirus, subgroup b.

  11. Comparative high-throughput transcriptome sequencing and development of SiESTa, the Silene EST annotation database

    Directory of Open Access Journals (Sweden)

    Marais Gabriel AB

    2011-07-01

    Full Text Available Abstract Background The genus Silene is widely used as a model system for addressing ecological and evolutionary questions in plants, but advances in using the genus as a model system are impeded by the lack of available resources for studying its genome. Massively parallel sequencing cDNA has recently developed into an efficient method for characterizing the transcriptomes of non-model organisms, generating massive amounts of data that enable the study of multiple species in a comparative framework. The sequences generated provide an excellent resource for identifying expressed genes, characterizing functional variation and developing molecular markers, thereby laying the foundations for future studies on gene sequence and gene expression divergence. Here, we report the results of a comparative transcriptome sequencing study of eight individuals representing four Silene and one Dianthus species as outgroup. All sequences and annotations have been deposited in a newly developed and publicly available database called SiESTa, the Silene EST annotation database. Results A total of 1,041,122 EST reads were generated in two runs on a Roche GS-FLX 454 pyrosequencing platform. EST reads were analyzed separately for all eight individuals sequenced and were assembled into contigs using TGICL. These were annotated with results from BLASTX searches and Gene Ontology (GO terms, and thousands of single-nucleotide polymorphisms (SNPs were characterized. Unassembled reads were kept as singletons and together with the contigs contributed to the unigenes characterized in each individual. The high quality of unigenes is evidenced by the proportion (49% that have significant hits in similarity searches with the A. thaliana proteome. The SiESTa database is accessible at http://www.siesta.ethz.ch. Conclusion The sequence collections established in the present study provide an important genomic resource for four Silene and one Dianthus species and will help to

  12. Comparative high-throughput transcriptome sequencing and development of SiESTa, the Silene EST annotation database

    Science.gov (United States)

    2011-01-01

    Background The genus Silene is widely used as a model system for addressing ecological and evolutionary questions in plants, but advances in using the genus as a model system are impeded by the lack of available resources for studying its genome. Massively parallel sequencing cDNA has recently developed into an efficient method for characterizing the transcriptomes of non-model organisms, generating massive amounts of data that enable the study of multiple species in a comparative framework. The sequences generated provide an excellent resource for identifying expressed genes, characterizing functional variation and developing molecular markers, thereby laying the foundations for future studies on gene sequence and gene expression divergence. Here, we report the results of a comparative transcriptome sequencing study of eight individuals representing four Silene and one Dianthus species as outgroup. All sequences and annotations have been deposited in a newly developed and publicly available database called SiESTa, the Silene EST annotation database. Results A total of 1,041,122 EST reads were generated in two runs on a Roche GS-FLX 454 pyrosequencing platform. EST reads were analyzed separately for all eight individuals sequenced and were assembled into contigs using TGICL. These were annotated with results from BLASTX searches and Gene Ontology (GO) terms, and thousands of single-nucleotide polymorphisms (SNPs) were characterized. Unassembled reads were kept as singletons and together with the contigs contributed to the unigenes characterized in each individual. The high quality of unigenes is evidenced by the proportion (49%) that have significant hits in similarity searches with the A. thaliana proteome. The SiESTa database is accessible at http://www.siesta.ethz.ch. Conclusion The sequence collections established in the present study provide an important genomic resource for four Silene and one Dianthus species and will help to further develop Silene as a

  13. Nucleotide and amino acid sequences of a coat protein of an Ukrainian isolate of Potato virus Y: comparison with homologous sequences of other isolates and phylogenetic analysis

    Directory of Open Access Journals (Sweden)

    Budzanivska I. G.

    2014-03-01

    Full Text Available Aim. Identification of the widespread Ukrainian isolate(s of PVY (Potato virus Y in different potato cultivars and subsequent phylogenetic analysis of detected PVY isolates based on NA and AA sequences of coat protein. Methods. ELISA, RT-PCR, DNA sequencing and phylogenetic analysis. Results. PVY has been identified serologically in potato cultivars of Ukrainian selection. In this work we have optimized a method for total RNA extraction from potato samples and offered a sensitive and specific PCR-based test system of own design for diagnostics of the Ukrainian PVY isolates. Part of the CP gene of the Ukrainian PVY isolate has been sequenced and analyzed phylogenetically. It is demonstrated that the Ukrainian isolate of Potato virus Y (CP gene has a higher percentage of homology with the recombinant isolates (strains of this pathogen (approx. 98.8– 99.8 % of homology for both nucleotide and translated amino acid sequences of the CP gene. The Ukrainian isolate of PVY is positioned in the separate cluster together with the isolates found in Syria, Japan and Iran; these isolates possibly have common origin. The Ukrainian PVY isolate is confirmed to be recombinant. Conclusions. This work underlines the need and provides the means for accurate monitoring of Potato virus Y in the agroecosystems of Ukraine. Most importantly, the phylogenetic analysis demonstrated the recombinant nature of this PVY isolate which has been attributed to the strain group O, subclade N:O.

  14. Mapping vaccinia virus DNA replication origins at nucleotide level by deep sequencing.

    Science.gov (United States)

    Senkevich, Tatiana G; Bruno, Daniel; Martens, Craig; Porcella, Stephen F; Wolf, Yuri I; Moss, Bernard

    2015-09-01

    Poxviruses reproduce in the host cytoplasm and encode most or all of the enzymes and factors needed for expression and synthesis of their double-stranded DNA genomes. Nevertheless, the mode of poxvirus DNA replication and the nature and location of the replication origins remain unknown. A current but unsubstantiated model posits only leading strand synthesis starting at a nick near one covalently closed end of the genome and continuing around the other end to generate a concatemer that is subsequently resolved into unit genomes. The existence of specific origins has been questioned because any plasmid can replicate in cells infected by vaccinia virus (VACV), the prototype poxvirus. We applied directional deep sequencing of short single-stranded DNA fragments enriched for RNA-primed nascent strands isolated from the cytoplasm of VACV-infected cells to pinpoint replication origins. The origins were identified as the switching points of the fragment directions, which correspond to the transition from continuous to discontinuous DNA synthesis. Origins containing a prominent initiation point mapped to a sequence within the hairpin loop at one end of the VACV genome and to the same sequence within the concatemeric junction of replication intermediates. These findings support a model for poxvirus genome replication that involves leading and lagging strand synthesis and is consistent with the requirements for primase and ligase activities as well as earlier electron microscopic and biochemical studies implicating a replication origin at the end of the VACV genome.

  15. Complete nucleotide sequences and virion particle association of two satellite RNAs of panicum mosaic virus.

    Science.gov (United States)

    Pyle, Jesse D; Monis, Judit; Scholthof, Karen-Beth

    2017-08-15

    Over six decades ago, panicum mosaic virus (PMV) was identified as the first viral pathogen of cultivated switchgrass (Panicum virgatum). Subsequently, PMV was demonstrated to support the replication of both a satellite RNA virus (SPMV) and satellite RNA (satRNA) agents during natural infections of host grasses. In this study, we report the isolation and full-length sequences of two PMV satRNAs identified in 1988 from St. Augustinegrass (Stenotaphrum secundatum) and centipedegrass (Eremochloa ophiuroides) hosts. Each of these satellites have sequence relatedness at their 5'- and 3'-ends. In addition, satC has a region of ∼100 nt complementary to the 3'-end of the PMV genome. These agents are associated with purified virions of SPMV infections. Additionally, satS and satC RNAs contain conserved in-frame open reading frames in the complementary-sense sequences that could potentially generate 6.6- and 7.9-kDa proteins, respectively. In protoplasts and plants satS is infectious, when co-inoculated with the PMV RNA alone or PMV+SPMV RNAs, and negatively affects their accumulation. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Molecular cloning, nucleotide sequence, and expression of the gene encoding human eosinophil differentiation factor (interleukin 5)

    International Nuclear Information System (INIS)

    Campbell, H.D.; Tucker, W.Q.J.; Hort, Y.; Martinson, M.E.; Mayo, G.; Clutterbuck, E.J.; Sanderson, C.J.; Young, I.G.

    1987-01-01

    The human eosinophil differentiation factor (EDF) gene was cloned from a genomic library in λ phage EMBL3A by using a murine EDF cDNA clone as a probe. The DNA sequence of a 3.2-kilobase BamHI fragment spanning the gene was determined. The gene contains three introns. The predicted amino acid sequence of 134 amino acids is identical with that recently reported for human interleukin 5 but shows no significant homology with other known hemopoietic growth regulators. The amino acid sequence shows strong homology (∼ 70% identity) with that of murine EDF. Recombinant human EDF, expressed from the human EDF gene after transfection into monkey COS cells, stimulated the production of eosinophils and eosinophil colonies from normal human bone marrow but had no effect on the production of neutrophils or mononuclear cells (monocytes and lymphoid cells). The apparent specificity of human EDF for the eosinophil lineage in myeloid hemopoiesis contrasts with the properties of human interleukin 3 and granulocyte/macrophage and granulocyte colony-stimulating factors but is directly analogous to the biological properties of murine EDF. Human EDF therefore represents a distinct hemopoietic growth factor that could play a central role in the regulation of eosinophilia

  17. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    Science.gov (United States)

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  18. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    Science.gov (United States)

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  19. The complete nucleotide sequence, genome organization, and origin of human adenovirus type 11

    International Nuclear Information System (INIS)

    Stone, Daniel; Furthmann, Anne; Sandig, Volker; Lieber, Andre

    2003-01-01

    The complete DNA sequence and transcription map of human adenovirus type 11 are reported here. This is the first published sequence for a subgenera B human adenovirus and demonstrates a genome organization highly similar to those of other human adenoviruses. All of the genes from the early, intermediate, and late regions are present in the expected locations of the genome for a human adenovirus. The genome size is 34,794 bp in length and has a GC content of 48.9%. Sequence alignment with genomes of groups A (Ad12), C (Ad5), D (Ad17), E (Simian adenovirus 25), and F (Ad40) revealed homologies of 64, 54, 68, 75, and 52%, respectively. Detailed genomic analysis demonstrated that Ads 11 and 35 are highly conserved in all areas except the hexon hypervariable regions and fiber. Similarly, comparison of Ad11 with subgroup E SAV25 revealed poor homology between fibers but high homology in proteins encoded by all other areas of the genome. We propose an evolutionary model in which functional viruses can be reconstituted following fiber substitution from one serotype to another. According to this model either the Ad11 genome is a derivative of Ad35, from which the fiber was substituted with Ad7, or the Ad35 genome is the product of a fiber substitution from Ad21 into the Ad11 genome. This model also provides a possible explanation for the origin of group E Ads, which are evolutionarily derived from a group C fiber substitution into a group B genome

  20. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  1. Update on Pneumocystis carinii f. sp. hominis Typing Based on Nucleotide Sequence Variations in Internal Transcribed Spacer Regions of rRNA Genes

    Science.gov (United States)

    Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.

    1998-01-01

    Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304

  2. The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans.

    Science.gov (United States)

    Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K

    1982-11-11

    The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).

  3. Appendix: a solution hybridization assay to detect radioactive globin messenger RNA nucleotide sequences

    Energy Technology Data Exchange (ETDEWEB)

    Ross, J

    1976-09-15

    In view of the sensitivity and specificity of the solution hybridization assay for unlabeled globin mRNA a similar technique has been devised to detect radioactive globin mRNA sequences with unlabeled globin cDNA. Several properties of the hybridization reaction are presented since RNA kinetic experiments reported recently depend on the validity of this assay. Data on hybridization analysis of (/sup 3/H)RNA from mouse fetal liver or erythroleukemia cell cytoplasm are presented. These data indicate that the excess cDNA solution assay for radioactive globin mRNA detection is specific for globin mRNA sequences. It can be performed rapidly and is highly reproducible from experiment. It is at least 500-fold less sensitive than the assay for unlabeled globin mRNA, due to the RNAase backgrounds of 0.05 to 0.15 %. However, this limitation has not affected kinetic experiments with non-dividing fetal liver erythroid cells, which synthesize relatively large quantities of globin mRNA.

  4. Nucleotide sequence of the promoter region of the gene encoding chicken Calbindin D28K

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, S; Drusiani, E; Battini, R; Fregni, M

    1988-01-11

    Calbindin D28K (formerly Vitamin D-Dependent Calcium Binding Protein) is a protein induced by 1,25-dihydroxycholecalciferol in several chicken tissues. A chicken genomic DNA library was screened with a synthetic oligonucleotide representing the sequence of Calbindin D18K cDNA from nt 146 to nt 176. The positive clone CBAl extends the 5'-end of the first exon by 451 bp. The sequence of a BamHI-SacII restriction fragment with coordinates -451 + 50 is shown. The BamHI-SacII fragment was subcloned 5' to the CAT gene of pUCCAT. The result is shown of a CAT assay on mouse fibroblasts 3T6 transiently transfected with pUCCAT, pUCCAT containing the BamHI-SacII fragment in the correct or opposite orientation or the SV40 promoter. /sup 14/C-chloramphenicol and its acetyl derivatives generated by purified CAT are also shown. The expression of CAT appears to be constitutive since the enzyme activity is not influenced by the presence (+) or absence (-) of 1,25-dihydroxycholecalciferol in the culture medium.

  5. Identification and nucleotide sequence of the thymidine kinase gene of Shope fibroma virus

    International Nuclear Information System (INIS)

    Upton, C.; McFadden, G.

    1986-01-01

    The thymidine kinase (TK) gene of Shope fibroma virus (SFV), a tumorigenic leporipoxvirus, was localized within the viral genome with degenerate oligonucleotide probes. These probes were constructed to two regions of high sequence conservation between the vaccinia virus TK gene and those of several known eucaryotic cellular TK genes, including human, mouse, hamster, and chicken TK genes. The oligonucleotide probes initially localized the SFV TK gene 50 kilobases (kb) from the right terminus of the 160-kb SFV genome within the 9.5-kb BamHI-HindIII fragment E. Fine-mapping analysis indicated that the TK Gene was within a 1.2-kb AvaI-HaeIII fragment, and DNA sequencing of this region revealed an open reading frame capable of encoding a polypeptide of 187 amino acids possessing considerable homology to the TK genes of the vaccinia, variola, and monkeypox orthopoxviruses and also to a variety of cellular TK genes. Homology matrix analysis and homology scores suggest that the SFV TK gene has diverged significantly from its counterpart members in the orthopoxvirus genus. Nevertheless, the presence of conserved upstream open reading frames on the 5' side of all of the poxvirus TK genes indicates a similarity of functional organization between the orthopoxviruses and leporipoxviruses. These data suggest a common ancestral origin for at least some of the unique internal regions of the leporipoxviruses and orthopoxviruses as exemplified by SFV and vaccinia virus, respectively

  6. Single nucleotide variants and InDels identified from whole-genome re-sequencing of Guzerat, Gyr, Girolando and Holstein cattle breeds.

    Directory of Open Access Journals (Sweden)

    Nedenia Bonvino Stafuzza

    Full Text Available Whole-genome re-sequencing, alignment and annotation analyses were undertaken for 12 sires representing four important cattle breeds in Brazil: Guzerat (multi-purpose, Gyr, Girolando and Holstein (dairy production. A total of approximately 4.3 billion reads from an Illumina HiSeq 2000 sequencer generated for each animal 10.7 to 16.4-fold genome coverage. A total of 27,441,279 single nucleotide variations (SNVs and 3,828,041 insertions/deletions (InDels were detected in the samples, of which 2,557,670 SNVs and 883,219 InDels were novel. The submission of these genetic variants to the dbSNP database significantly increased the number of known variants, particularly for the indicine genome. The concordance rate between genotypes obtained using the Bovine HD BeadChip array and the same variants identified by sequencing was about 99.05%. The annotation of variants identified numerous non-synonymous SNVs and frameshift InDels which could affect phenotypic variation. Functional enrichment analysis was performed and revealed that variants in the olfactory transduction pathway was over represented in all four cattle breeds, while the ECM-receptor interaction pathway was over represented in Girolando and Guzerat breeds, the ABC transporters pathway was over represented only in Holstein breed, and the metabolic pathways was over represented only in Gyr breed. The genetic variants discovered here provide a rich resource to help identify potential genomic markers and their associated molecular mechanisms that impact economically important traits for Gyr, Girolando, Guzerat and Holstein breeding programs.

  7. Quality standards for DNA sequence variation databases to improve clinical management under development in Australia

    Directory of Open Access Journals (Sweden)

    B. Bennetts

    2014-09-01

    Full Text Available Despite the routine nature of comparing sequence variations identified during clinical testing to database records, few databases meet quality requirements for clinical diagnostics. To address this issue, The Royal College of Pathologists of Australasia (RCPA in collaboration with the Human Genetics Society of Australasia (HGSA, and the Human Variome Project (HVP is developing standards for DNA sequence variation databases intended for use in the Australian clinical environment. The outputs of this project will be promoted to other health systems and accreditation bodies by the Human Variome Project to support the development of similar frameworks in other jurisdictions.

  8. Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

    Science.gov (United States)

    Guo, D; Maiss, E; Adam, G; Casper, R

    1995-05-01

    The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

  9. Extensive structural variations between mitochondrial genomes of CMS and normal peppers (Capsicum annuum L.) revealed by complete nucleotide sequencing.

    Science.gov (United States)

    Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl

    2014-07-04

    Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was

  10. gEVE: a genome-based endogenous viral element database provides comprehensive viral protein-coding sequences in mammalian genomes.

    Science.gov (United States)

    Nakagawa, So; Takahashi, Mahoko Ueda

    2016-01-01

    In mammals, approximately 10% of genome sequences correspond to endogenous viral elements (EVEs), which are derived from ancient viral infections of germ cells. Although most EVEs have been inactivated, some open reading frames (ORFs) of EVEs obtained functions in the hosts. However, EVE ORFs usually remain unannotated in the genomes, and no databases are available for EVE ORFs. To investigate the function and evolution of EVEs in mammalian genomes, we developed EVE ORF databases for 20 genomes of 19 mammalian species. A total of 736,771 non-overlapping EVE ORFs were identified and archived in a database named gEVE (http://geve.med.u-tokai.ac.jp). The gEVE database provides nucleotide and amino acid sequences, genomic loci and functional annotations of EVE ORFs for all 20 genomes. In analyzing RNA-seq data with the gEVE database, we successfully identified the expressed EVE genes, suggesting that the gEVE database facilitates studies of the genomic analyses of various mammalian species.Database URL: http://geve.med.u-tokai.ac.jp. © The Author(s) 2016. Published by Oxford University Press.

  11. The Porcelain Crab Transcriptome and PCAD, the Porcelain Crab Microarray and Sequence Database

    Energy Technology Data Exchange (ETDEWEB)

    Tagmount, Abderrahmane; Wang, Mei; Lindquist, Erika; Tanaka, Yoshihiro; Teranishi, Kristen S.; Sunagawa, Shinichi; Wong, Mike; Stillman, Jonathon H.

    2010-01-27

    Background: With the emergence of a completed genome sequence of the freshwater crustacean Daphnia pulex, construction of genomic-scale sequence databases for additional crustacean sequences are important for comparative genomics and annotation. Porcelain crabs, genus Petrolisthes, have been powerful crustacean models for environmental and evolutionary physiology with respect to thermal adaptation and understanding responses of marine organisms to climate change. Here, we present a large-scale EST sequencing and cDNA microarray database project for the porcelain crab Petrolisthes cinctipes. Methodology/Principal Findings: A set of ~;;30K unique sequences (UniSeqs) representing ~;;19K clusters were generated from ~;;98K high quality ESTs from a set of tissue specific non-normalized and mixed-tissue normalized cDNA libraries from the porcelain crab Petrolisthes cinctipes. Homology for each UniSeq was assessed using BLAST, InterProScan, GO and KEGG database searches. Approximately 66percent of the UniSeqs had homology in at least one of the databases. All EST and UniSeq sequences along with annotation results and coordinated cDNA microarray datasets have been made publicly accessible at the Porcelain Crab Array Database (PCAD), a feature-enriched version of the Stanford and Longhorn Array Databases.Conclusions/Significance: The EST project presented here represents the third largest sequencing effort for any crustacean, and the largest effort for any crab species. Our assembly and clustering results suggest that our porcelain crab EST data set is equally diverse to the much larger EST set generated in the Daphnia pulex genome sequencing project, and thus will be an important resource to the Daphnia research community. Our homology results support the pancrustacea hypothesis and suggest that Malacostraca may be ancestral to Branchiopoda and Hexapoda. Our results also suggest that our cDNA microarrays cover as much of the transcriptome as can reasonably be captured in

  12. The Bryopsis hypnoides plastid genome: multimeric forms and complete nucleotide sequence.

    Directory of Open Access Journals (Sweden)

    Fang Lü

    Full Text Available BACKGROUND: Bryopsis hypnoides Lamouroux is a siphonous green alga, and its extruded protoplasm can aggregate spontaneously in seawater and develop into mature individuals. The chloroplast of B. hypnoides is the biggest organelle in the cell and shows strong autonomy. To better understand this organelle, we sequenced and analyzed the chloroplast genome of this green alga. PRINCIPAL FINDINGS: A total of 111 functional genes, including 69 potential protein-coding genes, 5 ribosomal RNA genes, and 37 tRNA genes were identified. The genome size (153,429 bp, arrangement, and inverted-repeat (IR-lacking structure of the B. hypnoides chloroplast DNA (cpDNA closely resembles that of Chlorella vulgaris. Furthermore, our cytogenomic investigations using pulsed-field gel electrophoresis (PFGE and southern blotting methods showed that the B. hypnoides cpDNA had multimeric forms, including monomer, dimer, trimer, tetramer, and even higher multimers, which is similar to the higher order organization observed previously for higher plant cpDNA. The relative amounts of the four multimeric cpDNA forms were estimated to be about 1, 1/2, 1/4, and 1/8 based on molecular hybridization analysis. Phylogenetic analyses based on a concatenated alignment of chloroplast protein sequences suggested that B. hypnoides is sister to all Chlorophyceae and this placement received moderate support. CONCLUSION: All of the results suggest that the autonomy of the chloroplasts of B. hypnoides has little to do with the size and gene content of the cpDNA, and the IR-lacking structure of the chloroplasts indirectly demonstrated that the multimeric molecules might result from the random cleavage and fusion of replication intermediates instead of recombinational events.

  13. The complete nucleotide sequence of the barley yellow dwarf GPV isolate from China shows that it is a new member of the genus Polerovirus.

    Science.gov (United States)

    Zhang, Wenwei; Cheng, Zhuomin; Xu, Lei; Wu, Maosen; Waterhouse, Peter; Zhou, Guanghe; Li, Shifang

    2009-01-01

    The complete nucleotide sequence of the ssRNA genome of a Chinese GPV isolate of barley yellow dwarf virus (BYDV) was determined. It comprised 5673 nucleotides, and the deduced genome organization resembled that of members of the genus Polerovirus. It was most closely related to cereal yellow dwarf virus-RPV (77% nt identity over the entire genome; coat protein amino acid identity 79%). The GPV isolate also differs in vector specificity from other BYDV strains. Biological properties, phylogenetic analyses and detailed sequence comparisons suggest that GPV should be considered a member of a new species within the genus, and the name Wheat yellow dwarf virus-GPV is proposed.

  14. Organizing, exploring, and analyzing antibody sequence data: the case for relational-database managers.

    Science.gov (United States)

    Owens, John

    2009-01-01

    Technological advances in the acquisition of DNA and protein sequence information and the resulting onrush of data can quickly overwhelm the scientist unprepared for the volume of information that must be evaluated and carefully dissected to discover its significance. Few laboratories have the luxury of dedicated personnel to organize, analyze, or consistently record a mix of arriving sequence data. A methodology based on a modern relational-database manager is presented that is both a natural storage vessel for antibody sequence information and a conduit for organizing and exploring sequence data and accompanying annotation text. The expertise necessary to implement such a plan is equal to that required by electronic word processors or spreadsheet applications. Antibody sequence projects maintained as independent databases are selectively unified by the relational-database manager into larger database families that contribute to local analyses, reports, interactive HTML pages, or exported to facilities dedicated to sophisticated sequence analysis techniques. Database files are transposable among current versions of Microsoft, Macintosh, and UNIX operating systems.

  15. The R package otu2ot for implementing the entropy decomposition of nucleotide variation in sequence data

    Directory of Open Access Journals (Sweden)

    Alban eRamette

    2014-11-01

    Full Text Available Oligotyping is a novel, supervised computational method that classifies closely related sequences into oligotypes (OTs based on subtle nucleotide variations (Eren et al. 2013. Its application to microbial datasets has helped reveal ecological patterns which are often hidden by the way sequence data are currently clustered to define operational taxonomic units (OTUs. Here, we implemented the OT entropy decomposition procedure and its unsupervised version, Minimal Entropy Decomposition (MED; Eren et al. 2014, in the statistical programming language and environment, R. The aims are to facilitate the integration of computational routines, interactive statistical analyses, and visualization into a single framework. In addition, two complementary approaches are implemented: 1 An analytical method (the broken stick model is proposed to help identify oligotypes of low abundance that could be generated by chance alone and 2 a one-pass profiling (OP method, to efficiently identify those OTUs whose subsequent oligotyping would be most promising. These enhancements are especially useful for large datasets, where a manual screening of entropy analysis results and the creation of a full set of OTs may not be feasible. The package and procedures are illustrated by several tutorials and examples.

  16. Polyadenylation of RNA transcribed from mammalian SINEs by RNA polymerase III: Complex requirements for nucleotide sequences.

    Science.gov (United States)

    Borodulina, Olga R; Golubchikova, Julia S; Ustyantsev, Ilia G; Kramerov, Dmitri A

    2016-02-01

    It is generally accepted that only transcripts synthesized by RNA polymerase II (e.g., mRNA) were subject to AAUAAA-dependent polyadenylation. However, we previously showed that RNA transcribed by RNA polymerase III (pol III) from mouse B2 SINE could be polyadenylated in an AAUAAA-dependent manner. Many species of mammalian SINEs end with the pol III transcriptional terminator (TTTTT) and contain hexamers AATAAA in their A-rich tail. Such SINEs were united into Class T(+), whereas SINEs lacking the terminator and AATAAA sequences were classified as T(-). Here we studied the structural features of SINE pol III transcripts that are necessary for their polyadenylation. Eight and six SINE families from classes T(+) and T(-), respectively, were analyzed. The replacement of AATAAA with AACAAA in T(+) SINEs abolished the RNA polyadenylation. Interestingly, insertion of the polyadenylation signal (AATAAA) and pol III transcription terminator in T(-) SINEs did not result in polyadenylation. The detailed analysis of three T(+) SINEs (B2, DIP, and VES) revealed areas important for the polyadenylation of their pol III transcripts: the polyadenylation signal and terminator in A-rich tail, β region positioned immediately downstream of the box B of pol III promoter, and τ region located upstream of the tail. In DIP and VES (but not in B2), the τ region is a polypyrimidine motif which is also characteristic of many other T(+) SINEs. Most likely, SINEs of different mammals acquired these structural features independently as a result of parallel evolution. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. A survey of endogenous retrovirus (ERV) sequences in the vicinity of multiple sclerosis (MS)-associated single nucleotide polymorphisms (SNPs).

    Science.gov (United States)

    Brütting, Christine; Emmer, Alexander; Kornhuber, Malte; Staege, Martin S

    2016-08-01

    Although multiple sclerosis (MS) is one of the most common central nervous system diseases in young adults, little is known about its etiology. Several human endogenous retroviruses (ERVs) are considered to play a role in MS. We are interested in which ERVs can be identified in the vicinity of MS associated genetic marker to find potential initiators of MS. We analysed the chromosomal regions surrounding 58 single nucleotide polymorphisms (SNPs) that are associated with MS identified in one of the last major genome wide association studies. We scanned these regions for putative endogenous retrovirus sequences with large open reading frames (ORFs). We observed that more retrovirus-related putative ORFs exist in the relatively close vicinity of SNP marker indices in multiple sclerosis compared to control SNPs. We found very high homologies to HERV-K, HCML-ARV, XMRV, Galidia ERV, HERV-H/env62 and XMRV-like mouse endogenous retrovirus mERV-XL. The associated genes (CYP27B1, CD6, CD58, MPV17L2, IL12RB1, CXCR5, PTGER4, TAGAP, TYK2, ICAM3, CD86, GALC, GPR65 as well as the HLA DRB1*1501) are mainly involved in the immune system, but also in vitamin D regulation. The most frequently detected ERV sequences are related to the multiple sclerosis-associated retrovirus, the human immunodeficiency virus 1, HERV-K, and the Simian foamy virus. Our data shows that there is a relation between MS associated SNPs and the number of retroviral elements compared to control. Our data identifies new ERV sequences that have not been associated with MS, so far.

  18. [Application of single nucleotide polymorphism-microarray and target gene sequencing in the study of genetic etiology of children with unexplained intellectual disability or developmental delay].

    Science.gov (United States)

    Gao, Z J; Jiang, Q; Cheng, D Z; Yan, X X; Chen, Q; Xu, K M

    2016-10-02

    Objective: To evaluate the application of single nucleotide polymorphism (SNP)-microarray and target gene sequencing technology in the clinical molecular genetic diagnosis of unexplained intellectual disability(ID) or developmental delay (DD). Method: Patients with ID or DD were recruited in the Department of Neurology, Affiliated Children's Hospital of Capital Institute of Pediatrics between September 2015 and February 2016. The intellectual assessment of the patients was performed using 0-6-year-old pediatric examination table of neuropsychological development or Wechsler intelligence scale (>6 years). Patients with a DQ less than 49 or IQ less than 51 were included in this study. The patients were scanned by SNP-array for detection of genomic copy number variations (CNV), and the revealed genomic imbalance was confirmed by quantitative real time-PCR. Candidate gene mutation screening was carried out by target gene sequencing technology.Causal mutations or likely pathogenic variants were verified by polymerase chain reaction and direct sequencing. Result: There were 15 children with ID or DD enrolled, 9 males and 6 females. The age of these patients was 7 months-16 years and 9 months. SNP-array revealed that two of the 15 patients had genomic CNV. Both CNV were de novo micro deletions, one involved 11q24.1q25 and the other micro deletion located on 21q22.2q22.3. Both micro deletions were proved to have a clinical significance due to their association with ID, brain DD, unusual faces etc. by querying Decipher database. Thirteen patients with negative findings in SNP-array were consequently examined with target gene sequencing technology, genotype-phenotype correlation analysis and genetic analysis. Five patients were diagnosed with monogenic disorder, two were diagnosed with suspected genetic disorder and six were still negative. Conclusion: Sequential use of SNP-array and target gene sequencing technology can significantly increase the molecular genetic etiologic

  19. Combining next-generation sequencing and online databases for microsatellite development in non-model organisms.

    Science.gov (United States)

    Rico, Ciro; Normandeau, Eric; Dion-Côté, Anne-Marie; Rico, María Inés; Côté, Guillaume; Bernatchez, Louis

    2013-12-03

    Next-generation sequencing (NGS) is revolutionising marker development and the rapidly increasing amount of transcriptomes published across a wide variety of taxa is providing valuable sequence databases for the identification of genetic markers without the need to generate new sequences. Microsatellites are still the most important source of polymorphic markers in ecology and evolution. Motivated by our long-term interest in the adaptive radiation of a non-model species complex of whitefishes (Coregonus spp.), in this study, we focus on microsatellite characterisation and multiplex optimisation using transcriptome sequences generated by Illumina® and Roche-454, as well as online databases of Expressed Sequence Tags (EST) for the study of whitefish evolution and demographic history. We identified and optimised 40 polymorphic loci in multiplex PCR reactions and validated the robustness of our analyses by testing several population genetics and phylogeographic predictions using 494 fish from five lakes and 2 distinct ecotypes.

  20. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  1. Domain fusion analysis by applying relational algebra to protein sequence and domain databases.

    Science.gov (United States)

    Truong, Kevin; Ikura, Mitsuhiko

    2003-05-06

    Domain fusion analysis is a useful method to predict functionally linked proteins that may be involved in direct protein-protein interactions or in the same metabolic or signaling pathway. As separate domain databases like BLOCKS, PROSITE, Pfam, SMART, PRINTS-S, ProDom, TIGRFAMs, and amalgamated domain databases like InterPro continue to grow in size and quality, a computational method to perform domain fusion analysis that leverages on these efforts will become increasingly powerful. This paper proposes a computational method employing relational algebra to find domain fusions in protein sequence databases. The feasibility of this method was illustrated on the SWISS-PROT+TrEMBL sequence database using domain predictions from the Pfam HMM (hidden Markov model) database. We identified 235 and 189 putative functionally linked protein partners in H. sapiens and S. cerevisiae, respectively. From scientific literature, we were able to confirm many of these functional linkages, while the remainder offer testable experimental hypothesis. Results can be viewed at http://calcium.uhnres.utoronto.ca/pi. As the analysis can be computed quickly on any relational database that supports standard SQL (structured query language), it can be dynamically updated along with the sequence and domain databases, thereby improving the quality of predictions over time.

  2. Identities among actin-encoding cDNAs of the Nile tilapia (Oreochromis niloticus and other eukaryote species revealed by nucleotide and amino acid sequence analyses

    Directory of Open Access Journals (Sweden)

    Andréia B. Poletto

    2008-01-01

    Full Text Available Actin-encoding cDNAs of Nile tilapia (Oreochromis niloticus were isolated by RT-PCR using total RNA samples of different tissues and further characterized by nucleotide sequencing and in silico amino acid (aa sequence analysis. Comparisons among the actin gene sequences of O. niloticus and those of other species evidenced that the isolated genes present a high similarity to other fish and other vertebrate actin genes. The highest nucleotide resemblance was observed between O. niloticus and O. mossambicus a-actin and b-actin genes. Analysis of the predicted aa sequences revealed two distinct types of cytoplasmic actins, one cardiac muscle actin type and one skeletal muscle actin type that were expressed in different tissues of Nile tilapia. The evolutionary relationships between the Nile tilapia actin genes and diverse other organisms is discussed.

  3. Nucleotide sequence analyses of genomic RNAs of peanut stunt virus Mi, the type strain representative of a novel PSV subgroup from China

    NARCIS (Netherlands)

    Yan, L.; Xu, Z.; Goldbach, R.W.; Chen, Y.K.; Prins, M.W.

    2005-01-01

    The complete nucleotide sequence of Peanut stunt virus strain Mi (PSV-Mi) from China was determined and compared to other viruses of the genus Cucumovirus. The tripartite genome of PSV-Mi encoded five open reading frames (ORFs) typical of cucumoviruses. Distance analyses of four ORFs indicated that

  4. Nucleotide Sequence and Analysis of an orotate transporter-containing plasmid isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410

    DEFF Research Database (Denmark)

    Defoor, Els Marie Celine; Martinussen, Jan

    A new lactococcal plasmid, pDBORO, was isolated from the Lactococcus lactis ssp. lactis biovar diacetylactis strain DB0410 responsible for the sensitivity of DB0410 towards the pyrimidine-analog 5´-fluoroorotate. The plasmid pDBORO amounts to 16404 bp and its complete nucleotide sequence has been...

  5. A resource of genome-wide single-nucleotide polymorphisms generated by RAD tag sequencing in the critically endangered European eel

    DEFF Research Database (Denmark)

    Pujolar, J.M.; Jacobsen, M.W.; Frydenberg, J.

    2013-01-01

    Reduced representation genome sequencing such as restriction-site-associated DNA (RAD) sequencing is finding increased use to identify and genotype large numbers of single-nucleotide polymorphisms (SNPs) in model and nonmodel species. We generated a unique resource of novel SNP markers for the Eu...... 425 loci and 376 918 associated SNPs provides a valuable tool for future population genetics and genomics studies and allows for targeting specific genes and particularly interesting regions of the eel genome...

  6. SinEx DB: a database for single exon coding sequences in mammalian genomes.

    Science.gov (United States)

    Jorquera, Roddy; Ortiz, Rodrigo; Ossandon, F; Cárdenas, Juan Pablo; Sepúlveda, Rene; González, Carolina; Holmes, David S

    2016-01-01

    Eukaryotic genes are typically interrupted by intragenic, noncoding sequences termed introns. However, some genes lack introns in their coding sequence (CDS) and are generally known as 'single exon genes' (SEGs). In this work, a SEG is defined as a nuclear, protein-coding gene that lacks introns in its CDS. Whereas, many public databases of Eukaryotic multi-exon genes are available, there are only two specialized databases for SEGs. The present work addresses the need for a more extensive and diverse database by creating SinEx DB, a publicly available, searchable database of predicted SEGs from 10 completely sequenced mammalian genomes including human. SinEx DB houses the DNA and protein sequence information of these SEGs and includes their functional predictions (KOG) and the relative distribution of these functions within species. The information is stored in a relational database built with My SQL Server 5.1.33 and the complete dataset of SEG sequences and their functional predictions are available for downloading. SinEx DB can be interrogated by: (i) a browsable phylogenetic schema, (ii) carrying out BLAST searches to the in-house SinEx DB of SEGs and (iii) via an advanced search mode in which the database can be searched by key words and any combination of searches by species and predicted functions. SinEx DB provides a rich source of information for advancing our understanding of the evolution and function of SEGs.Database URL: www.sinex.cl. © The Author(s) 2016. Published by Oxford University Press.

  7. Genetic differentiation between fake abalone and genuine Haliotis species using the forensically informative nucleotide sequencing (FINS) method.

    Science.gov (United States)

    Ha, Wai Y; Reid, David G; Kam, Wan L; Lau, Yuk Y; Sham, Wing C; Tam, Silvia Y K; Sin, Della W M; Mok, Chuen S

    2011-05-25

    Abalones ( Haliotis species) are a popular delicacy and commonly preserved in dried form either whole or in slices or small pieces for consumption in Asian countries. Driven by the huge profit from trading abalones, dishonest traders may substitute other molluscan species for processed abalone, of which the morphological characteristics are frequently lost in the processed form. For protection of consumer rights and law enforcement against fraud, there is a need for an effective methodology to differentiate between fake and genuine abalone. This paper describes a method (validated according to the international forensic guidelines provided by SWGDAM) for the identification of fake abalone species using forensically informative nucleotide sequence (FINS) analysis. A study of the local market revealed that many claimed "abalone slice" samples on sale are not genuine. The fake abalone samples were found to be either volutids of the genus Cymbium (93%) or the muricid Concholepas concholepas (7%). This is the first report of Cymbium species being used for the preparation and sale as "abalone" in dried sliced form in Hong Kong.

  8. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Directory of Open Access Journals (Sweden)

    Kei-ichi Morita

    Full Text Available Gorlin syndrome (GS is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs. In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals, whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  9. Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

    Science.gov (United States)

    Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

    2015-01-01

    Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

  10. The nucleotide sequence and a first generation gene transfer vector of species B human adenovirus serotype 3.

    Science.gov (United States)

    Sirena, Dominique; Ruzsics, Zsolt; Schaffner, Walter; Greber, Urs F; Hemmi, Silvio

    2005-12-20

    Human adenovirus (Ad) serotype 3 causes respiratory infections. It is considered highly virulent, accounting for about 13% of all Ad isolates. We report here the complete Ad3 DNA sequence of 35,343 base pairs (GenBank accession DQ086466). Ad3 shares 96.43% nucleotide identity with Ad7, another virulent subspecies B1 serotype, and 82.56 and 62.75% identity with the less virulent species B2 Ad11 and species C Ad5, respectively. The genomic organization of Ad3 is similar to the other human Ads comprising five early transcription units, E1A, E1B, E2, E3, and E4, two delayed early units IX and IVa2, and the major late unit, in total 39 putative and 7 hypothetical open reading frames. A recombinant E1-deleted Ad3 was generated on a bacterial artificial chromosome. This prototypic virus efficiently transduced CD46-positive rodent and human cells. Our results will help in clarifying the biology and pathology of adenoviruses and enhance therapeutic applications of viral vectors in clinical settings.

  11. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  12. Single nucleotide polymorphism discovery via genotyping by sequencing to assess population genetic structure and recurrent polyploidization in Andropogon gerardii.

    Science.gov (United States)

    McAllister, Christine A; Miller, Allison J

    2016-07-01

    Autopolyploidy, genome duplication within a single lineage, can result in multiple cytotypes within a species. Geographic distributions of cytotypes may reflect the evolutionary history of autopolyploid formation and subsequent population dynamics including stochastic (drift) and deterministic (differential selection among cytotypes) processes. Here, we used a population genomic approach to investigate whether autopolyploidy occurred once or multiple times in Andropogon gerardii, a widespread, North American grass with two predominant cytotypes. Genotyping by sequencing was used to identify single nucleotide polymorphisms (SNPs) in individuals collected from across the geographic range of A. gerardii. Two independent approaches to SNP calling were used: the reference-free UNEAK pipeline and a reference-guided approach based on the sequenced Sorghum bicolor genome. SNPs generated using these pipelines were analyzed independently with genetic distance and clustering. Analyses of the two SNP data sets showed very similar patterns of population-level clustering of A. gerardii individuals: a cluster of A. gerardii individuals from the southern Plains, a northern Plains cluster, and a western cluster. Groupings of individuals corresponded to geographic localities regardless of cytotype: 6x and 9x individuals from the same geographic area clustered together. SNPs generated using reference-guided and reference-free pipelines in A. gerardii yielded unique subsets of genomic data. Both data sets suggest that the 9x cytotype in A. gerardii likely evolved multiple times from 6x progenitors across the range of the species. Genomic approaches like GBS and diverse bioinformatics pipelines used here facilitate evolutionary analyses of complex systems with multiple ploidy levels. © 2016 Botanical Society of America.

  13. Intelligent Access to Sequence and Structure Databases (IASSD) - an interface for accessing information from major web databases.

    Science.gov (United States)

    Ganguli, Sayak; Gupta, Manoj Kumar; Basu, Protip; Banik, Rahul; Singh, Pankaj Kumar; Vishal, Vineet; Bera, Abhisek Ranjan; Chakraborty, Hirak Jyoti; Das, Sasti Gopal

    2014-01-01

    With the advent of age of big data and advances in high throughput technology accessing data has become one of the most important step in the entire knowledge discovery process. Most users are not able to decipher the query result that is obtained when non specific keywords or a combination of keywords are used. Intelligent access to sequence and structure databases (IASSD) is a desktop application for windows operating system. It is written in Java and utilizes the web service description language (wsdl) files and Jar files of E-utilities of various databases such as National Centre for Biotechnology Information (NCBI) and Protein Data Bank (PDB). Apart from that IASSD allows the user to view protein structure using a JMOL application which supports conditional editing. The Jar file is freely available through e-mail from the corresponding author.

  14. Tandem Mass Spectrum Sequencing: An Alternative to Database Search Engines in Shotgun Proteomics.

    Science.gov (United States)

    Muth, Thilo; Rapp, Erdmann; Berven, Frode S; Barsnes, Harald; Vaudel, Marc

    2016-01-01

    Protein identification via database searches has become the gold standard in mass spectrometry based shotgun proteomics. However, as the quality of tandem mass spectra improves, direct mass spectrum sequencing gains interest as a database-independent alternative. In this chapter, the general principle of this so-called de novo sequencing is introduced along with pitfalls and challenges of the technique. The main tools available are presented with a focus on user friendly open source software which can be directly applied in everyday proteomic workflows.

  15. Estimating the annotation error rate of curated GO database sequence annotations

    Directory of Open Access Journals (Sweden)

    Brown Alfred L

    2007-05-01

    Full Text Available Abstract Background Annotations that describe the function of sequences are enormously important to researchers during laboratory investigations and when making computational inferences. However, there has been little investigation into the data quality of sequence function annotations. Here we have developed a new method of estimating the error rate of curated sequence annotations, and applied this to the Gene Ontology (GO sequence database (GOSeqLite. This method involved artificially adding errors to sequence annotations at known rates, and used regression to model the impact on the precision of annotations based on BLAST matched sequences. Results We estimated the error rate of curated GO sequence annotations in the GOSeqLite database (March 2006 at between 28% and 30%. Annotations made without use of sequence similarity based methods (non-ISS had an estimated error rate of between 13% and 18%. Annotations made with the use of sequence similarity methodology (ISS had an estimated error rate of 49%. Conclusion While the overall error rate is reasonably low, it would be prudent to treat all ISS annotations with caution. Electronic annotators that use ISS annotations as the basis of predictions are likely to have higher false prediction rates, and for this reason designers of these systems should consider avoiding ISS annotations where possible. Electronic annotators that use ISS annotations to make predictions should be viewed sceptically. We recommend that curators thoroughly review ISS annotations before accepting them as valid. Overall, users of curated sequence annotations from the GO database should feel assured that they are using a comparatively high quality source of information.

  16. mESAdb: microRNA expression and sequence analysis database.

    Science.gov (United States)

    Kaya, Koray D; Karakülah, Gökhan; Yakicier, Cengiz M; Acar, Aybar C; Konu, Ozlen

    2011-01-01

    microRNA expression and sequence analysis database (http://konulab.fen.bilkent.edu.tr/mirna/) (mESAdb) is a regularly updated database for the multivariate analysis of sequences and expression of microRNAs from multiple taxa. mESAdb is modular and has a user interface implemented in PHP and JavaScript and coupled with statistical analysis and visualization packages written for the R language. The database primarily comprises mature microRNA sequences and their target data, along with selected human, mouse and zebrafish expression data sets. mESAdb analysis modules allow (i) mining of microRNA expression data sets for subsets of microRNAs selected manually or by motif; (ii) pair-wise multivariate analysis of expression data sets within and between taxa; and (iii) association of microRNA subsets with annotation databases, HUGE Navigator, KEGG and GO. The use of existing and customized R packages facilitates future addition of data sets and analysis tools. Furthermore, the ability to upload and analyze user-specified data sets makes mESAdb an interactive and expandable analysis tool for microRNA sequence and expression data.

  17. An Internet-Accessible DNA Sequence Database for Identifying Fusaria from Human and Animal Infections

    Science.gov (United States)

    Because less than one-third of clinically relevant fusaria can be accurately identified to species level using phenotypic data (i.e., morphological species recognition), we constructed a three-locus DNA sequence database to facilitate molecular identification of the 69 Fusarium species associated wi...

  18. Complete nucleotide sequence of Bacillus subtilis (natto) bacteriophage PM1, a phage associated with disruption of food production.

    Science.gov (United States)

    Umene, Kenichi; Shiraishi, Atsushi

    2013-06-01

    "Natto", considered a traditional food, is made by fermenting boiled soybeans with Bacillus subtilis (natto), which is a natto-producing strain related to B. subtilis. The production of natto is disrupted by phage infections of B. subtilis (natto); hence, it is necessary to control phage infections. PM1, a phage of B. subtilis (natto), was isolated during interrupted natto production in a factory. In a previous study, PM1 was classified morphologically into the family Siphoviridae, and its genome, comprising approximately 50 kbp of linear double-stranded DNA, was assumed to be circularly permuted. In the present study, the complete nucleotide sequence of the PM1 genomic DNA of 50,861 bp (41.3 %G+C) was determined, and 86 open reading frames (ORFs) were deduced. Forty-one ORFs of PM1 shared similarities with proteins deduced from the genome of phages reported so far. Twenty-three ORFs of PM1 were associated with functions related to the phage multiplication process of gene control, DNA replication/modification, DNA packaging, morphogenesis, and cell lysis. Bacillus subtilis (natto) produces a capsular polypeptide of glutamate with a γ-linkage (called poly-γ-glutamate), which appears to serve as a physical barrier to phage adsorption. One ORF of PM1 had similarity with a poly-γ-glutamate hydrolase, which is assumed to degrade the capsular barrier to allow phage progenies to infect encapsulated host cells. The genome analysis of PM1 revealed the characteristics of the phage that are consistent as Bacillus subtilis (natto)-infecting phage.

  19. PATACSDB—the database of polyA translational attenuators in coding sequences

    Directory of Open Access Journals (Sweden)

    Malgorzata Habich

    2016-02-01

    Full Text Available Recent additions to the repertoire of gene expression regulatory mechanisms are polyadenylate (polyA tracks encoding for poly-lysine runs in protein sequences. Such tracks stall the translation apparatus and induce frameshifting independently of the effects of charged nascent poly-lysine sequence on the ribosome exit channel. As such, they substantially influence the stability of mRNA and the amount of protein produced from a given transcript. Single base changes in these regions are enough to exert a measurable response on both protein and mRNA abundance; this makes each of these sequences a potentially interesting case study for the effects of synonymous mutation, gene dosage balance and natural frameshifting. Here we present PATACSDB, a resource that contain a comprehensive list of polyA tracks from over 250 eukaryotic genomes. Our data is based on the Ensembl genomic database of coding sequences and filtered with algorithm of 12A-1 which selects sequences of polyA tracks with a minimal length of 12 A’s allowing for one mismatched base. The PATACSDB database is accessible at: http://sysbio.ibb.waw.pl/patacsdb. The source code is available at http://github.com/habich/PATACSDB, and it includes the scripts with which the database can be recreated.

  20. Characterisation of purified parvalbumin from five fish species and nucleotide sequencing of this major allergen from Pacific pilchard, Sardinops sagax.

    Science.gov (United States)

    Beale, Janine E; Jeebhay, Mohamed F; Lopata, Andreas L

    2009-09-01

    IgE-mediated allergic reaction to seafood is a common cause of food allergy including anaphylactic reactions. Parvalbumin, the major fish allergen, has been shown to display IgE cross-reactivity among fish species consumed predominantly in Europe and the Far East. However, cross-reactivity studies of parvalbumin from fish species widely consumed in the Southern hemisphere are limited as is data relating to immunological and molecular characterisation. In this study, antigenic cross-reactivity and the presence of oligomers and isomers of parvalbumin from five highly consumed fish species in Southern Africa were assessed by immunoblotting using purified parvalbumin and crude fish extracts. Pilchard (Sardinops sagax) parvalbumin was found to display the strongest IgE reactivity among 10 fish-allergic consumers. The cDNA sequence of the beta-form of pilchard parvalbumin was determined and designated Sar sa 1.0101 (accession number FM177701 EMBL/GenBank/DDBJ databases). Oligomeric forms of parvalbumin were observed in all fish species using a monoclonal anti-parvalbumin antibody and subject's sera. Isoforms varied between approximately 10-13 kDa. A highly cross-reactive allergenic isoform of parvalbumin was identified and sequenced, providing a successful primary step towards the generation of a recombinant form that could be used for diagnostic and potential therapeutic use in allergic individuals.

  1. CUDASW++: optimizing Smith-Waterman sequence database searches for CUDA-enabled graphics processing units

    Directory of Open Access Journals (Sweden)

    Maskell Douglas L

    2009-05-01

    Full Text Available Abstract Background The Smith-Waterman algorithm is one of the most widely used tools for searching biological sequence databases due to its high sensitivity. Unfortunately, the Smith-Waterman algorithm is computationally demanding, which is further compounded by the exponential growth of sequence databases. The recent emergence of many-core architectures, and their associated programming interfaces, provides an opportunity to accelerate sequence database searches using commonly available and inexpensive hardware. Findings Our CUDASW++ implementation (benchmarked on a single-GPU NVIDIA GeForce GTX 280 graphics card and a dual-GPU GeForce GTX 295 graphics card provides a significant performance improvement compared to other publicly available implementations, such as SWPS3, CBESW, SW-CUDA, and NCBI-BLAST. CUDASW++ supports query sequences of length up to 59K and for query sequences ranging in length from 144 to 5,478 in Swiss-Prot release 56.6, the single-GPU version achieves an average performance of 9.509 GCUPS with a lowest performance of 9.039 GCUPS and a highest performance of 9.660 GCUPS, and the dual-GPU version achieves an average performance of 14.484 GCUPS with a lowest performance of 10.660 GCUPS and a highest performance of 16.087 GCUPS. Conclusion CUDASW++ is publicly available open-source software. It provides a significant performance improvement for Smith-Waterman-based protein sequence database searches by fully exploiting the compute capability of commonly used CUDA-enabled low-cost GPUs.

  2. PrionHome: a database of prions and other sequences relevant to prion phenomena.

    Directory of Open Access Journals (Sweden)

    Djamel Harbi

    Full Text Available Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions, prionoids (i.e., proteins that propagate like prions between individual cells, and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant, and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments. We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic

  3. PrionHome: a database of prions and other sequences relevant to prion phenomena.

    Science.gov (United States)

    Harbi, Djamel; Parthiban, Marimuthu; Gendoo, Deena M A; Ehsani, Sepehr; Kumar, Manish; Schmitt-Ulms, Gerold; Sowdhamini, Ramanathan; Harrison, Paul M

    2012-01-01

    Prions are units of propagation of an altered state of a protein or proteins; prions can propagate from organism to organism, through cooption of other protein copies. Prions contain no necessary nucleic acids, and are important both as both pathogenic agents, and as a potential force in epigenetic phenomena. The original prions were derived from a misfolded form of the mammalian Prion Protein PrP. Infection by these prions causes neurodegenerative diseases. Other prions cause non-Mendelian inheritance in budding yeast, and sometimes act as diseases of yeast. We report the bioinformatic construction of the PrionHome, a database of >2000 prion-related sequences. The data was collated from various public and private resources and filtered for redundancy. The data was then processed according to a transparent classification system of prionogenic sequences (i.e., sequences that can make prions), prionoids (i.e., proteins that propagate like prions between individual cells), and other prion-related phenomena. There are eight PrionHome classifications for sequences. The first four classifications are derived from experimental observations: prionogenic sequences, prionoids, other prion-related phenomena, and prion interactors. The second four classifications are derived from sequence analysis: orthologs, paralogs, pseudogenes, and candidate-prionogenic sequences. Database entries list: supporting information for PrionHome classifications, prion-determinant areas (where relevant), and disordered and compositionally-biased regions. Also included are literature references for the PrionHome classifications, transcripts and genomic coordinates, and structural data (including comparative models made for the PrionHome from manually curated alignments). We provide database usage examples for both vertebrate and fungal prion contexts. Using the database data, we have performed a detailed analysis of the compositional biases in known budding-yeast prionogenic sequences, showing

  4. The proviral genome of radiation leukemia virus: Molecular cloning, nucleotide sequence of its long terminal repeat and integration in lymphoma cell DNA

    International Nuclear Information System (INIS)

    Janowski, M.; Merregaert, J.; Boniver, J.; Maisin, J.R.

    1985-01-01

    The proviral genome of a thymotropic and leukemogenic C57BL/Ka mouse retrovirus, RadLV/VL/sub 3/(T+L+), was cloned as a biologically active PstI insert in the bacterial plasmid pBR322. Its restriction map was compared to those, already known, of two nonthymotropic and nonleukemogenic viruses of the same mouse strain, the ecotropic BL/Ka(B) and the xenotropic constituent of the radiation leukemia virus complex (RadLV). Differences were observed in the pol gene and in the env gene. Moreover, the nucleotide sequence of the RadLV/VL/sub 3/(T+L+) long terminal repeat revealed the existence of two copies of a 42 bp long sequence, separated by 11 nucleotides and of which BL/Ka(B) possesses only one copy

  5. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  6. Protein backbone angle restraints from searching a database for chemical shift and sequence homology

    Energy Technology Data Exchange (ETDEWEB)

    Cornilescu, Gabriel; Delaglio, Frank; Bax, Ad [National Institutes of Health, Laboratory of Chemical Physics, National Institute of Diabetes and Digestive and Kidney Diseases (United States)

    1999-03-15

    Chemical shifts of backbone atoms in proteins are exquisitely sensitive to local conformation, and homologous proteins show quite similar patterns of secondary chemical shifts. The inverse of this relation is used to search a database for triplets of adjacent residues with secondary chemical shifts and sequence similarity which provide the best match to the query triplet of interest. The database contains 13C{alpha}, 13C{beta}, 13C', 1H{alpha} and 15N chemical shifts for 20 proteins for which a high resolution X-ray structure is available. The computer program TALOS was developed to search this database for strings of residues with chemical shift and residue type homology. The relative importance of the weighting factors attached to the secondary chemical shifts of the five types of resonances relative to that of sequence similarity was optimized empirically. TALOS yields the 10 triplets which have the closest similarity in secondary chemical shift and amino acid sequence to those of the query sequence. If the central residues in these 10 triplets exhibit similar {phi} and {psi} backbone angles, their averages can reliably be used as angular restraints for the protein whose structure is being studied. Tests carried out for proteins of known structure indicate that the root-mean-square difference (rmsd) between the output of TALOS and the X-ray derived backbone angles is about 15 deg. Approximately 3% of the predictions made by TALOS are found to be in error.

  7. Genotyping of human parvovirus B19 in clinical samples from Brazil and Paraguay using heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing

    Directory of Open Access Journals (Sweden)

    Marcos César Lima de Mendonça

    2011-06-01

    Full Text Available Heteroduplex mobility assay, single-stranded conformation polymorphism and nucleotide sequencing were utilised to genotype human parvovirus B19 samples from Brazil and Paraguay. Ninety-seven serum samples were collected from individuals presenting with abortion or erythema infectiosum, arthropathies, severe anaemia and transient aplastic crisis; two additional skin samples were collected by biopsy. After the procedure, all clinical samples were classified as genotype 1.

  8. Complete nucleotide sequence of the self-transmissible TOL plasmid pD2RT provides new insight into arrangement of toluene catabolic plasmids

    DEFF Research Database (Denmark)

    Jutkina, Jekaterina; Hansen, Lars Hestbjerg; Li, Lili

    2013-01-01

    In the present study we report the complete nucleotide sequence of the toluene catabolic plasmid pD2RT of Pseudomonas migulae strain D2RT isolated from Baltic Sea water. The pD2RT is 129,894 base pairs in size with an average G+ C content of 53.75%. A total of 135 open reading frames (ORFs) were ...

  9. Sequence protein identification by randomized sequence database and transcriptome mass spectrometry (SPIDER-TMS): from manual to automatic application of a 'de novo sequencing' approach.

    Science.gov (United States)

    Pascale, Raffaella; Grossi, Gerarda; Cruciani, Gabriele; Mecca, Giansalvatore; Santoro, Donatello; Sarli Calace, Renzo; Falabella, Patrizia; Bianco, Giuliana

    Sequence protein identification by a randomized sequence database and transcriptome mass spectrometry software package has been developed at the University of Basilicata in Potenza (Italy) and designed to facilitate the determination of the amino acid sequence of a peptide as well as an unequivocal identification of proteins in a high-throughput manner with enormous advantages of time, economical resource and expertise. The software package is a valid tool for the automation of a de novo sequencing approach, overcoming the main limits and a versatile platform useful in the proteomic field for an unequivocal identification of proteins, starting from tandem mass spectrometry data. The strength of this software is that it is a user-friendly and non-statistical approach, so protein identification can be considered unambiguous.

  10. SeqHound: biological sequence and structure database as a platform for bioinformatics research

    Directory of Open Access Journals (Sweden)

    Dumontier Michel

    2002-10-01

    Full Text Available Abstract Background SeqHound has been developed as an integrated biological sequence, taxonomy, annotation and 3-D structure database system. It provides a high-performance server platform for bioinformatics research in a locally-hosted environment. Results SeqHound is based on the National Center for Biotechnology Information data model and programming tools. It offers daily updated contents of all Entrez sequence databases in addition to 3-D structural data and information about sequence redundancies, sequence neighbours, taxonomy, complete genomes, functional annotation including Gene Ontology terms and literature links to PubMed. SeqHound is accessible via a web server through a Perl, C or C++ remote API or an optimized local API. It provides functionality necessary to retrieve specialized subsets of sequences, structures and structural domains. Sequences may be retrieved in FASTA, GenBank, ASN.1 and XML formats. Structures are available in ASN.1, XML and PDB formats. Emphasis has been placed on complete genomes, taxonomy, domain and functional annotation as well as 3-D structural functionality in the API, while fielded text indexing functionality remains under development. SeqHound also offers a streamlined WWW interface for simple web-user queries. Conclusions The system has proven useful in several published bioinformatics projects such as the BIND database and offers a cost-effective infrastructure for research. SeqHound will continue to develop and be provided as a service of the Blueprint Initiative at the Samuel Lunenfeld Research Institute. The source code and examples are available under the terms of the GNU public license at the Sourceforge site http://sourceforge.net/projects/slritools/ in the SLRI Toolkit.

  11. Identification of Alternative Splice Variants Using Unique Tryptic Peptide Sequences for Database Searches.

    Science.gov (United States)

    Tran, Trung T; Bollineni, Ravi C; Strozynski, Margarita; Koehler, Christian J; Thiede, Bernd

    2017-07-07

    Alternative splicing is a mechanism in eukaryotes by which different forms of mRNAs are generated from the same gene. Identification of alternative splice variants requires the identification of peptides specific for alternative splice forms. For this purpose, we generated a human database that contains only unique tryptic peptides specific for alternative splice forms from Swiss-Prot entries. Using this database allows an easy access to splice variant-specific peptide sequences that match to MS data. Furthermore, we combined this database without alternative splice variant-1-specific peptides with human Swiss-Prot. This combined database can be used as a general database for searching of LC-MS data. LC-MS data derived from in-solution digests of two different cell lines (LNCaP, HeLa) and phosphoproteomics studies were analyzed using these two databases. Several nonalternative splice variant-1-specific peptides were found in both cell lines, and some of them seemed to be cell-line-specific. Control and apoptotic phosphoproteomes from Jurkat T cells revealed several nonalternative splice variant-1-specific peptides, and some of them showed clear quantitative differences between the two states.

  12. A Public Database of Memory and Naive B-Cell Receptor Sequences.

    Directory of Open Access Journals (Sweden)

    William S DeWitt

    Full Text Available The vast diversity of B-cell receptors (BCR and secreted antibodies enables the recognition of, and response to, a wide range of epitopes, but this diversity has also limited our understanding of humoral immunity. We present a public database of more than 37 million unique BCR sequences from three healthy adult donors that is many fold deeper than any existing resource, together with a set of online tools designed to facilitate the visualization and analysis of the annotated data. We estimate the clonal diversity of the naive and memory B-cell repertoires of healthy individuals, and provide a set of examples that illustrate the utility of the database, including several views of the basic properties of immunoglobulin heavy chain sequences, such as rearrangement length, subunit usage, and somatic hypermutation positions and dynamics.

  13. High Performance Protein Sequence Database Scanning on the Cell Broadband Engine

    Directory of Open Access Journals (Sweden)

    Adrianto Wirawan

    2009-01-01

    Full Text Available The enormous growth of biological sequence databases has caused bioinformatics to be rapidly moving towards a data-intensive, computational science. As a result, the computational power needed by bioinformatics applications is growing rapidly as well. The recent emergence of low cost parallel multicore accelerator technologies has made it possible to reduce execution times of many bioinformatics applications. In this paper, we demonstrate how the Cell Broadband Engine can be used as a computational platform to accelerate two approaches for protein sequence database scanning: exhaustive and heuristic. We present efficient parallelization techniques for two representative algorithms: the dynamic programming based Smith–Waterman algorithm and the popular BLASTP heuristic. Their implementation on a Playstation®3 leads to significant runtime savings compared to corresponding sequential implementations.

  14. A Public Database of Memory and Naive B-Cell Receptor Sequences.

    Science.gov (United States)

    DeWitt, William S; Lindau, Paul; Snyder, Thomas M; Sherwood, Anna M; Vignali, Marissa; Carlson, Christopher S; Greenberg, Philip D; Duerkopp, Natalie; Emerson, Ryan O; Robins, Harlan S

    2016-01-01

    The vast diversity of B-cell receptors (BCR) and secreted antibodies enables the recognition of, and response to, a wide range of epitopes, but this diversity has also limited our understanding of humoral immunity. We present a public database of more than 37 million unique BCR sequences from three healthy adult donors that is many fold deeper than any existing resource, together with a set of online tools designed to facilitate the visualization and analysis of the annotated data. We estimate the clonal diversity of the naive and memory B-cell repertoires of healthy individuals, and provide a set of examples that illustrate the utility of the database, including several views of the basic properties of immunoglobulin heavy chain sequences, such as rearrangement length, subunit usage, and somatic hypermutation positions and dynamics.

  15. Discovery, genotyping and characterization of structural variation and novel sequence at single nucleotide resolution from de novo genome assemblies on a population scale

    DEFF Research Database (Denmark)

    Liu, Siyang; Huang, Shujia; Rao, Junhua

    2015-01-01

    present a novel approach implemented in a single software package, AsmVar, to discover, genotype and characterize different forms of structural variation and novel sequence from population-scale de novo genome assemblies up to nucleotide resolution. Application of AsmVar to several human de novo genome......) as well as large deletions. However, these approaches consistently display a substantial bias against the recovery of complex structural variants and novel sequence in individual genomes and do not provide interpretation information such as the annotation of ancestral state and formation mechanism. We...... assemblies captures a wide spectrum of structural variants and novel sequences present in the human population in high sensitivity and specificity. Our method provides a direct solution for investigating structural variants and novel sequences from de novo genome assemblies, facilitating the construction...

  16. Artemis and ACT: viewing, annotating and comparing sequences stored in a relational database.

    Science.gov (United States)

    Carver, Tim; Berriman, Matthew; Tivey, Adrian; Patel, Chinmay; Böhme, Ulrike; Barrell, Barclay G; Parkhill, Julian; Rajandream, Marie-Adèle

    2008-12-01

    Artemis and Artemis Comparison Tool (ACT) have become mainstream tools for viewing and annotating sequence data, particularly for microbial genomes. Since its first release, Artemis has been continuously developed and supported with additional functionality for editing and analysing sequences based on feedback from an active user community of laboratory biologists and professional annotators. Nevertheless, its utility has been somewhat restricted by its limitation to reading and writing from flat files. Therefore, a new version of Artemis has been developed, which reads from and writes to a relational database schema, and allows users to annotate more complex, often large and fragmented, genome sequences. Artemis and ACT have now been extended to read and write directly to the Generic Model Organism Database (GMOD, http://www.gmod.org) Chado relational database schema. In addition, a Gene Builder tool has been developed to provide structured forms and tables to edit coordinates of gene models and edit functional annotation, based on standard ontologies, controlled vocabularies and free text. Artemis and ACT are freely available (under a GPL licence) for download (for MacOSX, UNIX and Windows) at the Wellcome Trust Sanger Institute web sites: http://www.sanger.ac.uk/Software/Artemis/ http://www.sanger.ac.uk/Software/ACT/

  17. Alignment of high-throughput sequencing data inside in-memory databases.

    Science.gov (United States)

    Firnkorn, Daniel; Knaup-Gregori, Petra; Lorenzo Bermejo, Justo; Ganzinger, Matthias

    2014-01-01

    In times of high-throughput DNA sequencing techniques, performance-capable analysis of DNA sequences is of high importance. Computer supported DNA analysis is still an intensive time-consuming task. In this paper we explore the potential of a new In-Memory database technology by using SAP's High Performance Analytic Appliance (HANA). We focus on read alignment as one of the first steps in DNA sequence analysis. In particular, we examined the widely used Burrows-Wheeler Aligner (BWA) and implemented stored procedures in both, HANA and the free database system MySQL, to compare execution time and memory management. To ensure that the results are comparable, MySQL has been running in memory as well, utilizing its integrated memory engine for database table creation. We implemented stored procedures, containing exact and inexact searching of DNA reads within the reference genome GRCh37. Due to technical restrictions in SAP HANA concerning recursion, the inexact matching problem could not be implemented on this platform. Hence, performance analysis between HANA and MySQL was made by comparing the execution time of the exact search procedures. Here, HANA was approximately 27 times faster than MySQL which means, that there is a high potential within the new In-Memory concepts, leading to further developments of DNA analysis procedures in the future.

  18. Artemis and ACT: viewing, annotating and comparing sequences stored in a relational database

    Science.gov (United States)

    Carver, Tim; Berriman, Matthew; Tivey, Adrian; Patel, Chinmay; Böhme, Ulrike; Barrell, Barclay G.; Parkhill, Julian; Rajandream, Marie-Adèle

    2008-01-01

    Motivation: Artemis and Artemis Comparison Tool (ACT) have become mainstream tools for viewing and annotating sequence data, particularly for microbial genomes. Since its first release, Artemis has been continuously developed and supported with additional functionality for editing and analysing sequences based on feedback from an active user community of laboratory biologists and professional annotators. Nevertheless, its utility has been somewhat restricted by its limitation to reading and writing from flat files. Therefore, a new version of Artemis has been developed, which reads from and writes to a relational database schema, and allows users to annotate more complex, often large and fragmented, genome sequences. Results: Artemis and ACT have now been extended to read and write directly to the Generic Model Organism Database (GMOD, http://www.gmod.org) Chado relational database schema. In addition, a Gene Builder tool has been developed to provide structured forms and tables to edit coordinates of gene models and edit functional annotation, based on standard ontologies, controlled vocabularies and free text. Availability: Artemis and ACT are freely available (under a GPL licence) for download (for MacOSX, UNIX and Windows) at the Wellcome Trust Sanger Institute web sites: http://www.sanger.ac.uk/Software/Artemis/ http://www.sanger.ac.uk/Software/ACT/ Contact: artemis@sanger.ac.uk Supplementary information: Supplementary data are available at Bioinformatics online. PMID:18845581

  19. The need for high-quality whole-genome sequence databases in microbial forensics.

    Science.gov (United States)

    Sjödin, Andreas; Broman, Tina; Melefors, Öjar; Andersson, Gunnar; Rasmusson, Birgitta; Knutsson, Rickard; Forsman, Mats

    2013-09-01

    Microbial forensics is an important part of a strengthened capability to respond to biocrime and bioterrorism incidents to aid in the complex task of distinguishing between natural outbreaks and deliberate acts. The goal of a microbial forensic investigation is to identify and criminally prosecute those responsible for a biological attack, and it involves a detailed analysis of the weapon--that is, the pathogen. The recent development of next-generation sequencing (NGS) technologies has greatly increased the resolution that can be achieved in microbial forensic analyses. It is now possible to identify, quickly and in an unbiased manner, previously undetectable genome differences between closely related isolates. This development is particularly relevant for the most deadly bacterial diseases that are caused by bacterial lineages with extremely low levels of genetic diversity. Whole-genome analysis of pathogens is envisaged to be increasingly essential for this purpose. In a microbial forensic context, whole-genome sequence analysis is the ultimate method for strain comparisons as it is informative during identification, characterization, and attribution--all 3 major stages of the investigation--and at all levels of microbial strain identity resolution (ie, it resolves the full spectrum from family to isolate). Given these capabilities, one bottleneck in microbial forensics investigations is the availability of high-quality reference databases of bacterial whole-genome sequences. To be of high quality, databases need to be curated and accurate in terms of sequences, metadata, and genetic diversity coverage. The development of whole-genome sequence databases will be instrumental in successfully tracing pathogens in the future.

  20. Nucleotide sequence analysis of the recA gene and discrimination of the three isolates of urease-positive thermophilic Campylobacter (UPTC) isolated from seagulls (Larus spp.) in Northern Ireland.

    Science.gov (United States)

    Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O

    2004-01-01

    Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

  1. Complete nucleotide sequence of CTX-M-15-plasmids from clinical Escherichia coli isolates: insertional events of transposons and insertion sequences.

    Directory of Open Access Journals (Sweden)

    Annemieke Smet

    Full Text Available BACKGROUND: CTX-M-producing Escherichia coli strains are regarded as major global pathogens. METHODOLOGY/PRINCIPAL FINDINGS: The nucleotide sequence of three plasmids (pEC_B24: 73801-bp; pEC_L8: 118525-bp and pEC_L46: 144871-bp from Escherichia coli isolates obtained from patients with urinary tract infections and one plasmid (pEC_Bactec: 92970-bp from an Escherichia coli strain isolated from the joint of a horse with arthritis were determined. Plasmid pEC_Bactec belongs to the IncI1 group and carries two resistance genes: bla(TEM-1 and bla(CTX-M-15. It shares more than 90% homology with a previously published bla(CTX-M-plasmid from E. coli of human origin. Plasmid pEC_B24 belongs to the IncFII group whereas plasmids pEC_L8 and pEC_L46 represent a fusion of two replicons of type FII and FIA. On the pEC_B24 backbone, two resistance genes, bla(TEM-1 and bla(CTX-M-15, were found. Six resistance genes, bla(TEM-1, bla(CTX-M-15, bla(OXA-1, aac6'-lb-cr, tetA and catB4, were detected on the pEC_L8 backbone. The same antimicrobial drug resistance genes, with the exception of tetA, were also identified on the pEC_L46 backbone. Genome analysis of all 4 plasmids studied provides evidence of a seemingly frequent transposition event of the bla(CTX-M-15-ISEcp1 element. This element seems to have a preferred insertion site at the tnpA gene of a bla(TEM-carrying Tn3-like transposon, the latter itself being inserted by a transposition event. The IS26-composite transposon, which contains the bla(OXA-1, aac6'-lb-cr and catB4 genes, was inserted into plasmids pEC_L8 and pEC_L46 by homologous recombination rather than a transposition event. Results obtained for pEC_L46 indicated that IS26 also plays an important role in structural rearrangements of the plasmid backbone and seems to facilitate the mobilisation of fragments from other plasmids. CONCLUSIONS: Collectively, these data suggests that IS26 together with ISEcp1 could play a critical role in the evolution of

  2. Databases

    Digital Repository Service at National Institute of Oceanography (India)

    Kunte, P.D.

    Information on bibliographic as well as numeric/textual databases relevant to coastal geomorphology has been included in a tabular form. Databases cover a broad spectrum of related subjects like coastal environment and population aspects, coastline...

  3. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  4. AFLP fragment isolation technique as a method to produce random sequences for single nucleotide polymorphism discovery in the green turtle, Chelonia mydas.

    Science.gov (United States)

    Roden, Suzanne E; Dutton, Peter H; Morin, Phillip A

    2009-01-01

    The green sea turtle, Chelonia mydas, was used as a case study for single nucleotide polymorphism (SNP) discovery in a species that has little genetic sequence information available. As green turtles have a complex population structure, additional nuclear markers other than microsatellites could add to our understanding of their complex life history. Amplified fragment length polymorphism technique was used to generate sets of random fragments of genomic DNA, which were then electrophoretically separated with precast gels, stained with SYBR green, excised, and directly sequenced. It was possible to perform this method without the use of polyacrylamide gels, radioactive or fluorescent labeled primers, or hybridization methods, reducing the time, expense, and safety hazards of SNP discovery. Within 13 loci, 2547 base pairs were screened, resulting in the discovery of 35 SNPs. Using this method, it was possible to yield a sufficient number of loci to screen for SNP markers without the availability of prior sequence information.

  5. TranslatomeDB: a comprehensive database and cloud-based analysis platform for translatome sequencing data.

    Science.gov (United States)

    Liu, Wanting; Xiang, Lunping; Zheng, Tingkai; Jin, Jingjie; Zhang, Gong

    2018-01-04

    Translation is a key regulatory step, linking transcriptome and proteome. Two major methods of translatome investigations are RNC-seq (sequencing of translating mRNA) and Ribo-seq (ribosome profiling). To facilitate the investigation of translation, we built a comprehensive database TranslatomeDB (http://www.translatomedb.net/) which provides collection and integrated analysis of published and user-generated translatome sequencing data. The current version includes 2453 Ribo-seq, 10 RNC-seq and their 1394 corresponding mRNA-seq datasets in 13 species. The database emphasizes the analysis functions in addition to the dataset collections. Differential gene expression (DGE) analysis can be performed between any two datasets of same species and type, both on transcriptome and translatome levels. The translation indices translation ratios, elongation velocity index and translational efficiency can be calculated to quantitatively evaluate translational initiation efficiency and elongation velocity, respectively. All datasets were analyzed using a unified, robust, accurate and experimentally-verifiable pipeline based on the FANSe3 mapping algorithm and edgeR for DGE analyzes. TranslatomeDB also allows users to upload their own datasets and utilize the identical unified pipeline to analyze their data. We believe that our TranslatomeDB is a comprehensive platform and knowledgebase on translatome and proteome research, releasing the biologists from complex searching, analyzing and comparing huge sequencing data without needing local computational power. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Analysis of the genome sequence of the pathogenic Muscovy duck parvovirus strain YY reveals a 14-nucleotide-pair deletion in the inverted terminal repeats.

    Science.gov (United States)

    Wang, Jianye; Huang, Yu; Zhou, Mingxu; Zhu, Guoqiang

    2016-09-01

    Genomic information about Muscovy duck parvovirus is still limited. In this study, the genome of the pathogenic MDPV strain YY was sequenced. The full-length genome of YY is 5075 nucleotides (nt) long, 57 nt shorter than that of strain FM. Sequence alignment indicates that the 5' and 3' inverted terminal repeats (ITR) of strain YY contain a 14-nucleotide-pair deletion in the stem of the palindromic hairpin structure in comparison to strain FM and FZ91-30. The deleted region contains one "E-box" site and one repeated motif with the sequence "TTCCGGT" or "ACCGGAA". Phylogenetic trees constructed based the protein coding genes concordantly showed that YY, together with nine other MDPV isolates from various places, clustered in a separate branch, distinct from the branch formed by goose parvovirus (GPV) strains. These results demonstrate that, despite the distinctive deletion, the YY strain still belongs to the classical MDPV group. Moreover, the deletion of ITR may contribute to the genome evolution of MDPV under immunization pressure.

  7. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    Science.gov (United States)

    Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

    2016-01-01

    Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  8. Databases

    Directory of Open Access Journals (Sweden)

    Nick Ryan

    2004-01-01

    Full Text Available Databases are deeply embedded in archaeology, underpinning and supporting many aspects of the subject. However, as well as providing a means for storing, retrieving and modifying data, databases themselves must be a result of a detailed analysis and design process. This article looks at this process, and shows how the characteristics of data models affect the process of database design and implementation. The impact of the Internet on the development of databases is examined, and the article concludes with a discussion of a range of issues associated with the recording and management of archaeological data.

  9. Faster Smith-Waterman database searches with inter-sequence SIMD parallelisation

    Directory of Open Access Journals (Sweden)

    Rognes Torbjørn

    2011-06-01

    Full Text Available Abstract Background The Smith-Waterman algorithm for local sequence alignment is more sensitive than heuristic methods for database searching, but also more time-consuming. The fastest approach to parallelisation with SIMD technology has previously been described by Farrar in 2007. The aim of this study was to explore whether further speed could be gained by other approaches to parallelisation. Results A faster approach and implementation is described and benchmarked. In the new tool SWIPE, residues from sixteen different database sequences are compared in parallel to one query residue. Using a 375 residue query sequence a speed of 106 billion cell updates per second (GCUPS was achieved on a dual Intel Xeon X5650 six-core processor system, which is over six times more rapid than software based on Farrar's 'striped' approach. SWIPE was about 2.5 times faster when the programs used only a single thread. For shorter queries, the increase in speed was larger. SWIPE was about twice as fast as BLAST when using the BLOSUM50 score matrix, while BLAST was about twice as fast as SWIPE for the BLOSUM62 matrix. The software is designed for 64 bit Linux on processors with SSSE3. Source code is available from http://dna.uio.no/swipe/ under the GNU Affero General Public License. Conclusions Efficient parallelisation using SIMD on standard hardware makes it possible to run Smith-Waterman database searches more than six times faster than before. The approach described here could significantly widen the potential application of Smith-Waterman searches. Other applications that require optimal local alignment scores could also benefit from improved performance.

  10. Secure and robust cloud computing for high-throughput forensic microsatellite sequence analysis and databasing.

    Science.gov (United States)

    Bailey, Sarah F; Scheible, Melissa K; Williams, Christopher; Silva, Deborah S B S; Hoggan, Marina; Eichman, Christopher; Faith, Seth A

    2017-11-01

    Next-generation Sequencing (NGS) is a rapidly evolving technology with demonstrated benefits for forensic genetic applications, and the strategies to analyze and manage the massive NGS datasets are currently in development. Here, the computing, data storage, connectivity, and security resources of the Cloud were evaluated as a model for forensic laboratory systems that produce NGS data. A complete front-to-end Cloud system was developed to upload, process, and interpret raw NGS data using a web browser dashboard. The system was extensible, demonstrating analysis capabilities of autosomal and Y-STRs from a variety of NGS instrumentation (Illumina MiniSeq and MiSeq, and Oxford Nanopore MinION). NGS data for STRs were concordant with standard reference materials previously characterized with capillary electrophoresis and Sanger sequencing. The computing power of the Cloud was implemented with on-demand auto-scaling to allow multiple file analysis in tandem. The system was designed to store resulting data in a relational database, amenable to downstream sample interpretations and databasing applications following the most recent guidelines in nomenclature for sequenced alleles. Lastly, a multi-layered Cloud security architecture was tested and showed that industry standards for securing data and computing resources were readily applied to the NGS system without disadvantageous effects for bioinformatic analysis, connectivity or data storage/retrieval. The results of this study demonstrate the feasibility of using Cloud-based systems for secured NGS data analysis, storage, databasing, and multi-user distributed connectivity. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Faster Smith-Waterman database searches with inter-sequence SIMD parallelisation.

    Science.gov (United States)

    Rognes, Torbjørn

    2011-06-01

    The Smith-Waterman algorithm for local sequence alignment is more sensitive than heuristic methods for database searching, but also more time-consuming. The fastest approach to parallelisation with SIMD technology has previously been described by Farrar in 2007. The aim of this study was to explore whether further speed could be gained by other approaches to parallelisation. A faster approach and implementation is described and benchmarked. In the new tool SWIPE, residues from sixteen different database sequences are compared in parallel to one query residue. Using a 375 residue query sequence a speed of 106 billion cell updates per second (GCUPS) was achieved on a dual Intel Xeon X5650 six-core processor system, which is over six times more rapid than software based on Farrar's 'striped' approach. SWIPE was about 2.5 times faster when the programs used only a single thread. For shorter queries, the increase in speed was larger. SWIPE was about twice as fast as BLAST when using the BLOSUM50 score matrix, while BLAST was about twice as fast as SWIPE for the BLOSUM62 matrix. The software is designed for 64 bit Linux on processors with SSSE3. Source code is available from http://dna.uio.no/swipe/ under the GNU Affero General Public License. Efficient parallelisation using SIMD on standard hardware makes it possible to run Smith-Waterman database searches more than six times faster than before. The approach described here could significantly widen the potential application of Smith-Waterman searches. Other applications that require optimal local alignment scores could also benefit from improved performance.

  12. Complete nucleotide sequence of pGA45, a 140,698-bp incFIIY plasmid encoding blaIMI-3-mediated carbapenem resistance, from river sediment

    Directory of Open Access Journals (Sweden)

    Bingjun eDang

    2016-02-01

    Full Text Available Plasmid pGA45 was isolated from the sediment of Haihe River using E. coli CV601 (gfp-tagged as recipients and indigenous bacteria from sediment as donors. This plasmid confers reduced susceptibility to imipenem which belongs to carbapenem group. Plasmid pGA45 was fully sequenced on an Illumina HiSeq 2000 sequencing system. The complete sequence of plasmid pGA45 was 140,698 bp in length with an average G+C content of 52.03%. Sequence analysis shows that pGA45 belongs to incFIIY group and harbors a backbone region shares high homology and gene synteny to several other incF plasmids including pNDM1_EC14653, pYDC644, pNDM-Ec1GN574, pRJF866, pKOX_NDM1 and pP10164-NDM. In addition to the backbone region, plasmid pGA45 harbors two notable features including one blaIMI-3-containing region and one type VI secretion system region. The blaIMI-3-containing region is responsible for bacteria carbapenem resistance and the type VI secretion system region is probably involved in bacteria virulence, respectively. Plasmid pGA45 represents the first complete nucleotide sequence of the blaIMI-harboring plasmid from environment sample and the sequencing of this plasmid provided insight into the architecture used for the dissemination of blaIMI carbapenemase genes.

  13. Comparative anatomy of the human APRT gene and enzyme: nucleotide sequence divergence and conservation of a nonrandom CpG dinucleotide arrangement

    International Nuclear Information System (INIS)

    Broderick, T.P.; Schaff, D.A.; Bertino, A.M.; Dush, M.K.; Tischfield, J.A.; Stambrook, P.J.

    1987-01-01

    The functional human adenine phosphoribosyltransferase (APRT) gene is <2.6 kilobases in length and contains five exons. The amino acid sequences of APRTs have been highly conserved throughout evolution. The human enzyme is 82%, 90%, and 40% identical to the mouse, hamster, and Escherichia coli enzymes, respectively. The promoter region of the human APRT gene, like that of several other housekeeping genes, lacks TATA and CCAAT boxes but contains five GC boxes that are potential binding sites for the Sp1 transcription factor. The distal three, however, are dispensable for gene expression. Comparison between human and mouse APRT gene nucleotide sequences reveals a high degree of homology within protein coding regions but an absence of significant homology in 5' flanking, 3' untranslated, and intron sequences, except for similarly positioned GC boxes in the promoter region and a 26-base-pair region in intron 3. This 26-base-pair sequence is 92% identical with a similarly positioned sequence in the mouse gene and is also found in intron 3 of the hamster gene, suggesting that its retention may be a consequence of stringent selection. The positions of all introns have been precisely retained in the human and both rodent genes. Retention of an elevated CpG dinucleotide content, despite loss of sequence homology, suggests that there may be selection for CpG dinucleotides in these regions and that their maintenance may be important for APRT gene function

  14. Nucleotide sequences of two cellulase genes from alkalophilic Bacillus sp. strain N-4 and their strong homology.

    OpenAIRE

    Fukumori, F; Sashihara, N; Kudo, T; Horikoshi, K

    1986-01-01

    Two genes for cellulases of alkalophilic Bacillus sp. strain N-4 (ATCC 21833) have been sequenced. From the DNA sequences the cellulases encoded in the plasmids pNK1 and pNK2 consist of 488 and 409 amino acids, respectively. The DNA and protein sequences of the pNK1-encoded cellulase are related to those of the pNK2-encoded cellulase. The pNK2-encoded cellulase lacks the direct repeat sequence of a stretch of 60 amino acids near the C-terminal end of the pNK1-encoded cellulase. The duplicatio...

  15. Genome cluster database. A sequence family analysis platform for Arabidopsis and rice.

    Science.gov (United States)

    Horan, Kevin; Lauricha, Josh; Bailey-Serres, Julia; Raikhel, Natasha; Girke, Thomas

    2005-05-01

    The genome-wide protein sequences from Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) spp. japonica were clustered into families using sequence similarity and domain-based clustering. The two fundamentally different methods resulted in separate cluster sets with complementary properties to compensate the limitations for accurate family analysis. Functional names for the identified families were assigned with an efficient computational approach that uses the description of the most common molecular function gene ontology node within each cluster. Subsequently, multiple alignments and phylogenetic trees were calculated for the assembled families. All clustering results and their underlying sequences were organized in the Web-accessible Genome Cluster Database (http://bioinfo.ucr.edu/projects/GCD) with rich interactive and user-friendly sequence family mining tools to facilitate the analysis of any given family of interest for the plant science community. An automated clustering pipeline ensures current information for future updates in the annotations of the two genomes and clustering improvements. The analysis allowed the first systematic identification of family and singlet proteins present in both organisms as well as those restricted to one of them. In addition, the established Web resources for mining these data provide a road map for future studies of the composition and structure of protein families between the two species.

  16. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  17. Protein backbone chemical shifts predicted from searching a database for torsion angle and sequence homology

    International Nuclear Information System (INIS)

    Shen Yang; Bax, Ad

    2007-01-01

    Chemical shifts of nuclei in or attached to a protein backbone are exquisitely sensitive to their local environment. A computer program, SPARTA, is described that uses this correlation with local structure to predict protein backbone chemical shifts, given an input three-dimensional structure, by searching a newly generated database for triplets of adjacent residues that provide the best match in φ/ψ/χ 1 torsion angles and sequence similarity to the query triplet of interest. The database contains 15 N, 1 H N , 1 H α , 13 C α , 13 C β and 13 C' chemical shifts for 200 proteins for which a high resolution X-ray (≤2.4 A) structure is available. The relative importance of the weighting factors for the φ/ψ/χ 1 angles and sequence similarity was optimized empirically. The weighted, average secondary shifts of the central residues in the 20 best-matching triplets, after inclusion of nearest neighbor, ring current, and hydrogen bonding effects, are used to predict chemical shifts for the protein of known structure. Validation shows good agreement between the SPARTA-predicted and experimental shifts, with standard deviations of 2.52, 0.51, 0.27, 0.98, 1.07 and 1.08 ppm for 15 N, 1 H N , 1 H α , 13 C α , 13 C β and 13 C', respectively, including outliers

  18. The nucleotide sequence of the RNA-2 of an isolate of the English serotype of tomato black ring virus: RNA recombination in the history of nepoviruses.

    Science.gov (United States)

    Le Gall, O L; Lanneau, M; Candresse, T; Dunez, J

    1995-05-01

    The RNA-2 of a carrot isolate from the English serotype of tomato black ring nepovirus (TBRV-ED) has been sequenced. It is 4618 nucleotides long and contains one open reading frame encoding a polypeptide of 1344 amino acids. The 5' non-coding region contains three repetitions of a stem-loop structure also conserved in TBRV-Scottish and grapevine chrome mosaic nepovirus (GCMV). The coat protein domain was mapped to the carboxy-terminal one-third of the polyprotein. Sequence comparisons indicate that TBRV-ED RNA-2 probably arose by an RNA recombination event that resulted in the exchange of the putative movement protein gene between TBRV and GCMV.

  19. Whole genome sequencing options for bacterial strain typing and epidemiologic analysis based on single nucleotide polymorphism versus gene-by-gene-based approaches.

    Science.gov (United States)

    Schürch, A C; Arredondo-Alonso, S; Willems, R J L; Goering, R V

    2018-04-01

    Whole genome sequence (WGS)-based strain typing finds increasing use in the epidemiologic analysis of bacterial pathogens in both public health as well as more localized infection control settings. This minireview describes methodologic approaches that have been explored for WGS-based epidemiologic analysis and considers the challenges and pitfalls of data interpretation. Personal collection of relevant publications. When applying WGS to study the molecular epidemiology of bacterial pathogens, genomic variability between strains is translated into measures of distance by determining single nucleotide polymorphisms in core genome alignments or by indexing allelic variation in hundreds to thousands of core genes, assigning types to unique allelic profiles. Interpreting isolate relatedness from these distances is highly organism specific, and attempts to establish species-specific cutoffs are unlikely to be generally applicable. In cases where single nucleotide polymorphism or core gene typing do not provide the resolution necessary for accurate assessment of the epidemiology of bacterial pathogens, inclusion of accessory gene or plasmid sequences may provide the additional required discrimination. As with all epidemiologic analysis, realizing the full potential of the revolutionary advances in WGS-based approaches requires understanding and dealing with issues related to the fundamental steps of data generation and interpretation. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Molecular characterization and phylogenetic analysis of Explanatum explanatum in India based on nucleotide sequences of ribosomal ITS2 and the mitochondrial gene nad1.

    Science.gov (United States)

    Hayashi, Kei; Mohanta, Uday K; Ohari, Yuma; Neeraja, Tambireddy; Singh, T Shantikumar; Sugiyama, Hiromu; Itagaki, Tadashi

    2016-12-01

    The aim of this study was to analyze the phylogenetic relationship between Explanatum explanatum populations in India and other countries of the Indian subcontinent. Seventy liver amphistomes collected from four localities in India were identified as E. explanatum based on the nucleotide sequences of ribosomal ITS2. The flukes were then analyzed phylogenetically based on the nucleotide sequence of the mitochondrial gene nad1 in comparison with flukes from Bangladesh and Nepal. In the resulting phylogenetic tree, the nad1 haplotypes from India were divided into four clades, and the flukes showing the haplotypes of clades A and C were predominant in India. The haplotypes of the clades A and C have also been detected in Bangladesh and Nepal, and therefore, it seems they occur commonly throughout the Indian subcontinent. The results of AMOVA suggested that gene flow was likely to occur between E. explanatum populations in these countries. These countries are geographically close and have been historically and culturally connected to each other, and therefore, the movements of host ruminants among these countries might have been involved in the migration of the flukes and their gene flow.

  1. Detection of de novo single nucleotide variants in offspring of atomic-bomb survivors close to the hypocenter by whole-genome sequencing.

    Science.gov (United States)

    Horai, Makiko; Mishima, Hiroyuki; Hayashida, Chisa; Kinoshita, Akira; Nakane, Yoshibumi; Matsuo, Tatsuki; Tsuruda, Kazuto; Yanagihara, Katsunori; Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Hata, Tomoko; Miyazaki, Yasushi; Yoshiura, Koh-Ichiro

    2018-03-01

    Ionizing radiation released by the atomic bombs at Hiroshima and Nagasaki, Japan, in 1945 caused many long-term illnesses, including increased risks of malignancies such as leukemia and solid tumours. Radiation has demonstrated genetic effects in animal models, leading to concerns over the potential hereditary effects of atomic bomb-related radiation. However, no direct analyses of whole DNA have yet been reported. We therefore investigated de novo variants in offspring of atomic-bomb survivors by whole-genome sequencing (WGS). We collected peripheral blood from three trios, each comprising a father (atomic-bomb survivor with acute radiation symptoms), a non-exposed mother, and their child, none of whom had any past history of haematological disorders. One trio of non-exposed individuals was included as a control. DNA was extracted and the numbers of de novo single nucleotide variants in the children were counted by WGS with sequencing confirmation. Gross structural variants were also analysed. Written informed consent was obtained from all participants prior to the study. There were 62, 81, and 42 de novo single nucleotide variants in the children of atomic-bomb survivors, compared with 48 in the control trio. There were no gross structural variants in any trio. These findings are in accord with previously published results that also showed no significant genetic effects of atomic-bomb radiation on second-generation survivors.

  2. Complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from Klebsiella pneumoniae isolated in 1969.

    Science.gov (United States)

    Doublet, Benoît; Boyd, David; Douard, Gregory; Praud, Karine; Cloeckaert, Axel; Mulvey, Michael R

    2012-10-01

    To determine the complete nucleotide sequence of the multidrug resistance IncA/C plasmid pR55 from a clinical Klebsiella pneumoniae strain that was isolated from a urinary tract infection in 1969 in a French hospital and compare it with those of contemporary emerging IncA/C plasmids. The plasmid was purified and sequenced using a 454 sequencing approach. After draft assembly, additional PCRs and walking reads were performed for gap closure. Sequence comparisons and multiple alignments with other IncA/C plasmids were done using the BLAST algorithm and CLUSTAL W, respectively. Plasmid pR55 (170 810 bp) revealed a shared plasmid backbone (>99% nucleotide identity) with current members of the IncA/C(2) multidrug resistance plasmid family that are widely disseminating antibiotic resistance genes. Nevertheless, two specific multidrug resistance gene arrays probably acquired from other genetic elements were identified inserted at conserved hotspot insertion sites in the IncA/C backbone. A novel transposon named Tn6187 showed an atypical mixed transposon configuration composed of two mercury resistance operons and two transposition modules that are related to Tn21 and Tn1696, respectively, and an In0-type integron. IncA/C(2) multidrug resistance plasmids have a broad host range and have been implicated in the dissemination of antibiotic resistance among Enterobacteriaceae from humans and animals. This typical IncA/C(2) genetic scaffold appears to carry various multidrug resistance gene arrays and is now also a successful vehicle for spreading AmpC-like cephalosporinase and metallo-β-lactamase genes, such as bla(CMY) and bla(NDM), respectively.

  3. Nucleotide sequence analysis of HTLV-I isolated from cerebrospinal fluid of a patient with TSP/HAM: comparison to other HTLV-I isolates.

    Science.gov (United States)

    Mukhopadhyaya, R; Sadaie, M R

    1993-02-01

    Human T-cell leukemia virus type I (HTLV-I) has been associated with adult T-cell leukemia/lymphoma and the chronic neurologic disorder tropical spastic paraparesis/HTLV-I-associated myelopathy (TSP/HAM). To study the genetic structure of the virus associated with TSP/HAM, we have obtained and sequenced a partial genomic clone from an HTLV-I-positive cell line established from cerebrospinal fluid (CSF) of a Jamaican patient with TSP/HAM. This clone consisted of a 4.3-kb viral sequence containing the 5' long terminal repeat (LTR), gag, and N-terminal portion of the pol gene, with an overall 1.3% sequence variation resulting from mostly nucleotide substitutions, as compared to the prototype HTLV-I ATK-1. The gag and pol regions showed only 1.4% and 1.2% nucleotide variations, respectively. However, the U3 region of the LTR showed the highest sequence variation (3.6%), where several changes appear to be common among certain TSP/HAM isolates. Several of these changes reside within the 21-bp boundaries and the Tax-responsive element. It would be important to determine if the observed changes are sufficient to cause neurologic disorders similar to the murine leukemia virus system or simply reflect the divergent pool of HTLV-I from different geographic locations. At this time, we cannot rule out the possibility that the observed changes have either direct or indirect significance for the HTLV-I pathogenesis in TSP/HAM.

  4. DMPD: Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of health and disease. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available and nucleotide oligomerisation domain inthe regulation of health and disease. Pu...bmedID 17535871 Title Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of health...17535871 Critical role of toll-like receptors and nucleotide oligomerisation domain inthe regulation of heal...th and disease. Mitchell JA, Paul-Clark MJ, Clarke GW, McMaster SK, Cartwright N. J

  5. Nucleotide sequences of cDNAs for human papillomavirus type 18 transcripts in HeLa cells

    International Nuclear Information System (INIS)

    Inagaki, Yutaka; Tsunokawa, Youko; Takebe, Naoko; Terada, Masaaki; Sugimura, Takashi; Nawa, Hiroyuki; Nakanishi, Shigetada

    1988-01-01

    HeLa cells expressed 3.4- and 1.6-kilobase (kb) transcripts of the integrated human papillomavirus (HPV) type 18 genome. Two types of cDNA clones representing each size of HPV type 18 transcript were isolated. Sequence analysis of these two types of cDNA clones revealed that the 3.4-kb transcript contained E6, E7, the 5' portion of E1, and human sequence and that the 1.6-kb transcript contained spliced and frameshifted E6 (E6 * ), E7, and human sequence. There was a common human sequence containing a poly(A) addition signal in the 3' end portions of both transcripts, indicating that they were transcribed from the HPV genome at the same integration site with different splicing. Furthermore, the 1.6-kb transcript contained both of the two viral TATA boxes upstream of E6, strongly indicating that a cellular promoter was used for its transcription

  6. Nucleotide sequence analysis of the Legionella micdadei mip gene, encoding a 30-kilodalton analog of the Legionella pneumophila Mip protein

    DEFF Research Database (Denmark)

    Bangsborg, Jette Marie; Cianciotto, N P; Hindersson, P

    1991-01-01

    After the demonstration of analogs of the Legionella pneumophila macrophage infectivity potentiator (Mip) protein in other Legionella species, the Legionella micdadei mip gene was cloned and expressed in Escherichia coli. DNA sequence analysis of the L. micdadei mip gene contained in the plasmid p...... homology with the mip-like genes of several Legionella species. Furthermore, amino acid sequence comparisons revealed significant homology to two eukaryotic proteins with isomerase activity (FK506-binding proteins)....

  7. Complete nucleotide sequence and genome analysis of bacteriophage BFK20 — A lytic phage of the industrial producer Brevibacterium flavum

    Czech Academy of Sciences Publication Activity Database

    Bukovska, G.; Klucar, L.; Vlček, Čestmír; Adamovic, J.; Turna, J.; Timko, J.

    2006-01-01

    Roč. 348, č. 1 (2006), s. 57-71 ISSN 0042-6822 Grant - others:Slovenská akademie věd(SK) VEGA2/5068/25; Science and Technology Assistance Agency(SK) APVT-51-025004 Institutional research plan: CEZ:AV0Z50520514 Keywords : Bacteriophage * Complete genome sequence * Sequence analysis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.525, year: 2006

  8. Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

    International Nuclear Information System (INIS)

    Fisher, R.F.; Swanson, J.A.; Mulligan, J.T.; Long, S.R.

    1987-01-01

    The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

  9. Improved taxonomic assignment of human intestinal 16S rRNA sequences by a dedicated reference database

    NARCIS (Netherlands)

    Ritari, Jarmo; Salojärvi, Jarkko; Lahti, Leo; Vos, de Willem M.

    2015-01-01

    Background: Current sequencing technology enables taxonomic profiling of microbial ecosystems at high resolution and depth by using the 16S rRNA gene as a phylogenetic marker. Taxonomic assignation of newly acquired data is based on sequence comparisons with comprehensive reference databases to

  10. Strand bias in complementary single-nucleotide polymorphisms of transcribed human sequences: evidence for functional effects of synonymous polymorphisms

    Directory of Open Access Journals (Sweden)

    Majewski Jacek

    2006-08-01

    Full Text Available Abstract Background Complementary single-nucleotide polymorphisms (SNPs may not be distributed equally between two DNA strands if the strands are functionally distinct, such as in transcribed genes. In introns, an excess of A↔G over the complementary C↔T substitutions had previously been found and attributed to transcription-coupled repair (TCR, demonstrating the valuable functional clues that can be obtained by studying such asymmetry. Here we studied asymmetry of human synonymous SNPs (sSNPs in the fourfold degenerate (FFD sites as compared to intronic SNPs (iSNPs. Results The identities of the ancestral bases and the direction of mutations were inferred from human-chimpanzee genomic alignment. After correction for background nucleotide composition, excess of A→G over the complementary T→C polymorphisms, which was observed previously and can be explained by TCR, was confirmed in FFD SNPs and iSNPs. However, when SNPs were separately examined according to whether they mapped to a CpG dinucleotide or not, an excess of C→T over G→A polymorphisms was found in non-CpG site FFD SNPs but was absent from iSNPs and CpG site FFD SNPs. Conclusion The genome-wide discrepancy of human FFD SNPs provides novel evidence for widespread selective pressure due to functional effects of sSNPs. The similar asymmetry pattern of FFD SNPs and iSNPs that map to a CpG can be explained by transcription-coupled mechanisms, including TCR and transcription-coupled mutation. Because of the hypermutability of CpG sites, more CpG site FFD SNPs are relatively younger and have confronted less selection effect than non-CpG FFD SNPs, which can explain the asymmetric discrepancy of CpG site FFD SNPs vs. non-CpG site FFD SNPs.

  11. Nucleotide sequences of the Erwinia chrysanthemi ogl and pelE genes negatively regulated by the kdgR gene product.

    Science.gov (United States)

    Reverchon, S; Huang, Y; Bourson, C; Robert-Baudouy, J

    1989-12-21

    The nucleotide sequences of the coding and regulatory regions of the genes encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with a predicted Mr of 44,124. A possible transcriptional start signal showing homology with the Escherichia coli promoter consensus sequence was detected. In addition, a sequence 3' to the coding region was found to be able to form a secondary structure which may function as an Rho-independent transcriptional termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a 404-aa polypeptide was detected. PLe is secreted into the external medium by E. chrysanthemi, and a potential signal peptide sequence was identified in the pelE gene. In the 5' upstream pelE coding region, a putative promoter resembling E. coli promoter consensus sequences was detected. Furthermore, the region immediately 3' to the pelE translational stop codon may function as an Rho-independent translational termination signal. In strain 3937, the synthesis of OGL and PLe, as well as the other enzymes involved in the pectin-degradative pathway (particularly the kdgT product), are known to be regulated by the KdgR repressor, which mediates galacturonate and polygalacturonate induction. Synthesis of these enzymes is also regulated by the CRP-cAMP complex which mediates catabolite repression. Analysis of the regulatory regions of ogl and pelE allowed us to identify possible CRP-binding sites for these two genes.(ABSTRACT TRUNCATED AT 250 WORDS)

  12. Nucleotide sequence of the gene coding for human factor VII, a vitamin K-dependent protein participating in blood coagulation

    International Nuclear Information System (INIS)

    O'Hara, P.J.; Grant, F.J.; Haldeman, B.A.; Gray, C.L.; Insley, M.Y.; Hagen, F.S.; Murray, M.J.

    1987-01-01

    Activated factor VII (factor VIIa) is a vitamin K-dependent plasma serine protease that participates in a cascade of reactions leading to the coagulation of blood. Two overlapping genomic clones containing sequences encoding human factor VII were isolated and characterized. The complete sequence of the gene was determined and found to span about 12.8 kilobases. The mRNA for factor VII as demonstrated by cDNA cloning is polyadenylylated at multiple sites but contains only one AAUAAA poly(A) signal sequence. The mRNA can undergo alternative splicing, forming one transcript containing eight segments as exons and another with an additional exon that encodes a larger prepro leader sequence. The latter transcript has no known counterpart in the other vitamin K-dependent proteins. The positions of the introns with respect to the amino acid sequence encoded by the eight essential exons of factor VII are the same as those present in factor IX, factor X, protein C, and the first three exons of prothrombin. These exons code for domains generally conserved among members of this gene family. The comparable introns in these genes, however, are dissimilar with respect to size and sequence, with the exception of intron C in factor VII and protein C. The gene for factor VII also contains five regions made up of tandem repeats of oligonucleotide monomer elements. More than a quarter of the intron sequences and more than a third of the 3' untranslated portion of the mRNA transcript consist of these minisatellite tandem repeats

  13. A two-locus DNA sequence database for typing plant and human pathogens within the Fusarium oxysporum species complex

    DEFF Research Database (Denmark)

    O'Donnell, Kerry; Gueidan, C; Sink, S

    2009-01-01

    We constructed a two-locus database, comprising partial translation elongation factor (EF-1alpha) gene sequences and nearly full-length sequences of the nuclear ribosomal intergenic spacer region (IGS rDNA) for 850 isolates spanning the phylogenetic breadth of the Fusarium oxysporum species compl...... of the IGS rDNA sequences may be non-orthologous. We also evaluated enniatin, fumonisin and moniliformin mycotoxin production in vitro within a phylogenetic framework....

  14. Molecular study and nucleotide sequencing of Chlamydia abortus isolated from aborted sheep fetuses ewes of Alborz province

    Directory of Open Access Journals (Sweden)

    amirreza ebadi

    2015-02-01

    Full Text Available Chlamydia is an obligate intracellular and gram negative coccobacilli and one of the most important causes of abortion in ruminants especially in ewes. This investigation was performed with the purpose of molecular study and sequencing of Chlamydia abortus isolated from aborted sheep fetuses of Alborz Province. In this study, DNA extraction was performed on 100 samples from aborted fetuses of 32 sheep flocks from different areas of Alborz province. Then using specific primers of gene IGS-Sr- RNA, polymerase chain reaction was conducted and 10 samples were selected randomly from the positive cases were sent to Macrogene company in Korea for sequencing. In this study, 37 samples from a total of 100 aborted fetuses were positive for Chlamydia abortus. After sequencing, more than 99 percent of the positive samples were similar with sequences in gene bank. The sequencing results indicated that the samples were very similar to isolates LN554882/1, AF051935/1 and CR848038/1 of the gene bank and were in the same cluster. Also, this investigation indicated that Chlamydia abortus is one of the main reasons of ewe abortion in Alborz province.

  15. Striking structural dynamism and nucleotide sequence variation of the transposon Galileo in the genome of Drosophila mojavensis.

    Science.gov (United States)

    Marzo, Mar; Bello, Xabier; Puig, Marta; Maside, Xulio; Ruiz, Alfredo

    2013-02-04

    Galileo is a transposable element responsible for the generation of three chromosomal inversions in natural populations of Drosophila buzzatii. Although the most characteristic feature of Galileo is the long internally-repetitive terminal inverted repeats (TIRs), which resemble the Drosophila Foldback element, its transposase-coding sequence has led to its classification as a member of the P-element superfamily (Class II, subclass 1, TIR order). Furthermore, Galileo has a wide distribution in the genus Drosophila, since it has been found in 6 of the 12 Drosophila sequenced genomes. Among these species, D. mojavensis, the one closest to D. buzzatii, presented the highest diversity in sequence and structure of Galileo elements. In the present work, we carried out a thorough search and annotation of all the Galileo copies present in the D. mojavensis sequenced genome. In our set of 170 Galileo copies we have detected 5 Galileo subfamilies (C, D, E, F, and X) with different structures ranging from nearly complete, to only 2 TIR or solo TIR copies. Finally, we have explored the structural and length variation of the Galileo copies that point out the relatively frequent rearrangements within and between Galileo elements. Different mechanisms responsible for these rearrangements are discussed. Although Galileo is a transposable element with an ancient history in the D. mojavensis genome, our data indicate a recent transpositional activity. Furthermore, the dynamism in sequence and structure, mainly affecting the TIRs, suggests an active exchange of sequences among the copies. This exchange could lead to new subfamilies of the transposon, which could be crucial for the long-term survival of the element in the genome.

  16. Next-generation sequencing can reveal in vitro-generated PCR crossover products: some artifactual sequences correspond to HLA alleles in the IMGT/HLA database.

    Science.gov (United States)

    Holcomb, C L; Rastrou, M; Williams, T C; Goodridge, D; Lazaro, A M; Tilanus, M; Erlich, H A

    2014-01-01

    The high-resolution human leukocyte antigen (HLA) genotyping assay that we developed using 454 sequencing and Conexio software uses generic polymerase chain reaction (PCR) primers for DRB exon 2. Occasionally, we observed low abundance DRB amplicon sequences that resulted from in vitro PCR 'crossing over' between DRB1 and DRB3/4/5. These hybrid sequences, revealed by the clonal sequencing property of the 454 system, were generally observed at a read depth of 5%-10% of the true alleles. They usually contained at least one mismatch with the IMGT/HLA database, and consequently, were easily recognizable and did not cause a problem for HLA genotyping. Sometimes, however, these artifactual sequences matched a rare allele and the automatic genotype assignment was incorrect. These observations raised two issues: (1) could PCR conditions be modified to reduce such artifacts? and (2) could some of the rare alleles listed in the IMGT/HLA database be artifacts rather than true alleles? Because PCR crossing over occurs during late cycles of PCR, we compared DRB genotypes resulting from 28 and (our standard) 35 cycles of PCR. For all 21 cell line DNAs amplified for 35 cycles, crossover products were detected. In 33% of the cases, these hybrid sequences corresponded to named alleles. With amplification for only 28 cycles, these artifactual sequences were not detectable. To investigate whether some rare alleles in the IMGT/HLA database might be due to PCR artifacts, we analyzed four samples obtained from the investigators who submitted the sequences. In three cases, the sequences were generated from true alleles. In one case, our 454 sequencing revealed an error in the previously submitted sequence. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  17. Identification and Evaluation of Single-Nucleotide Polymorphisms in Allotetraploid Peanut (Arachis hypogaea L.) Based on Amplicon Sequencing Combined with High Resolution Melting (HRM) Analysis.

    Science.gov (United States)

    Hong, Yanbin; Pandey, Manish K; Liu, Ying; Chen, Xiaoping; Liu, Hong; Varshney, Rajeev K; Liang, Xuanqiang; Huang, Shangzhi

    2015-01-01

    The cultivated peanut (Arachis hypogaea L.) is an allotetraploid (AABB) species derived from the A-genome (Arachis duranensis) and B-genome (Arachis ipaensis) progenitors. Presence of two versions of a DNA sequence based on the two progenitor genomes poses a serious technical and analytical problem during single nucleotide polymorphism (SNP) marker identification and analysis. In this context, we have analyzed 200 amplicons derived from expressed sequence tags (ESTs) and genome survey sequences (GSS) to identify SNPs in a panel of genotypes consisting of 12 cultivated peanut varieties and two diploid progenitors representing the ancestral genomes. A total of 18 EST-SNPs and 44 genomic-SNPs were identified in 12 peanut varieties by aligning the sequence of A. hypogaea with diploid progenitors. The average frequency of sequence polymorphism was higher for genomic-SNPs than the EST-SNPs with one genomic-SNP every 1011 bp as compared to one EST-SNP every 2557 bp. In order to estimate the potential and further applicability of these identified SNPs, 96 peanut varieties were genotyped using high resolution melting (HRM) method. Polymorphism information content (PIC) values for EST-SNPs ranged between 0.021 and 0.413 with a mean of 0.172 in the set of peanut varieties, while genomic-SNPs ranged between 0.080 and 0.478 with a mean of 0.249. Total 33 SNPs were used for polymorphism detection among the parents and 10 selected lines from mapping population Y13Zh (Zhenzhuhei × Yueyou13). Of the total 33 SNPs, nine SNPs showed polymorphism in the mapping population Y13Zh, and seven SNPs were successfully mapped into five linkage groups. Our results showed that SNPs can be identified in allotetraploid peanut with high accuracy through amplicon sequencing and HRM assay. The identified SNPs were very informative and can be used for different genetic and breeding applications in peanut.

  18. A survey of single nucleotide polymorphisms identified from whole-genome sequencing and their functional effect in the porcine genome.

    Science.gov (United States)

    Keel, B N; Nonneman, D J; Rohrer, G A

    2017-08-01

    Genetic variants detected from sequence have been used to successfully identify causal variants and map complex traits in several organisms. High and moderate impact variants, those expected to alter or disrupt the protein coded by a gene and those that regulate protein production, likely have a more significant effect on phenotypic variation than do other types of genetic variants. Hence, a comprehensive list of these functional variants would be of considerable interest in swine genomic studies, particularly those targeting fertility and production traits. Whole-genome sequence was obtained from 72 of the founders of an intensely phenotyped experimental swine herd at the U.S. Meat Animal Research Center (USMARC). These animals included all 24 of the founding boars (12 Duroc and 12 Landrace) and 48 Yorkshire-Landrace composite sows. Sequence reads were mapped to the Sscrofa10.2 genome build, resulting in a mean of 6.1 fold (×) coverage per genome. A total of 22 342 915 high confidence SNPs were identified from the sequenced genomes. These included 21 million previously reported SNPs and 79% of the 62 163 SNPs on the PorcineSNP60 BeadChip assay. Variation was detected in the coding sequence or untranslated regions (UTRs) of 87.8% of the genes in the porcine genome: loss-of-function variants were predicted in 504 genes, 10 202 genes contained nonsynonymous variants, 10 773 had variation in UTRs and 13 010 genes contained synonymous variants. Approximately 139 000 SNPs were classified as loss-of-function, nonsynonymous or regulatory, which suggests that over 99% of the variation detected in our pigs could potentially be ignored, allowing us to focus on a much smaller number of functional SNPs during future analyses. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

  19. Palingol: a declarative programming language to describe nucleic acids' secondary structures and to scan sequence database.

    Science.gov (United States)

    Billoud, B; Kontic, M; Viari, A

    1996-01-01

    At the DNA/RNA level, biological signals are defined by a combination of spatial structures and sequence motifs. Until now, few attempts had been made in writing general purpose search programs that take into account both sequence and structure criteria. Indeed, the most successful structure scanning programs are usually dedicated to particular structures and are written using general purpose programming languages through a complex and time consuming process where the biological problem of defining the structure and the computer engineering problem of looking for it are intimately intertwined. In this paper, we describe a general representation of structures, suitable for database scanning, together with a programming language, Palingol, designed to manipulate it. Palingol has specific data types, corresponding to structural elements-basically helices-that can be arranged in any way to form a complex structure. As a consequence of the declarative approach used in Palingol, the user should only focus on 'what to search for' while the language engine takes care of 'how to look for it'. Therefore, it becomes simpler to write a scanning program and the structural constraints that define the required structure are more clearly identified. PMID:8628670

  20. Sequence-based separation of single-stranded DNA using nucleotides in capillary electrophoresis: focus on phosphate.

    Science.gov (United States)

    Zhang, Xueru; McGown, Linda B

    2013-06-01

    DNA analysis has widespread applicability in biology, medicine, biotechnology, and forensics. DNA separation by length is readily achieved using sieving gels in electrophoresis. Separation by sequence is less simple, generally requiring adequate differences in native or induced conformation or differences in thermal or chemical stability of the strands that are hybridized prior to measurement. We previously demonstrated separation of four single-stranded DNA 76-mers that differ by only a few A-G substitutions based solely on sequence using guanosine-5'-monophosphate (GMP) in the running buffer. We attributed separation to the unique self-assembly of GMP to form higher order structures. Here, we examine an expanded set of 76-mers designed to probe the mechanism of the separation and effects of experimental conditions. We were surprised to find that other ribonucleotides achieved the similar separation to GMP, and that some separation was achieved using sodium phosphate instead of GMP. Potassium phosphate achieved almost as good separations as the ribonucleotides. This suggests that the separation medium provides a physicochemical environment for the DNA that effects strand migration in a sequence-selective manner. Further investigation is needed to determine whether the mechanism involves specific interactions between the phosphates and the DNA strands or is a result of other properties of the separation medium. Phosphate generally has been avoided in DNA separations by capillary gel electrophoresis because its high ionic strength exacerbates Joule heating. Our results suggest that phosphate compounds should be examined for separation of DNA based on sequence. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  2. Determining Clostridium difficile intra-taxa diversity by mining multilocus sequence typing databases.

    Science.gov (United States)

    Muñoz, Marina; Ríos-Chaparro, Dora Inés; Patarroyo, Manuel Alfonso; Ramírez, Juan David

    2017-03-14

    Multilocus sequence typing (MLST) is a highly discriminatory typing strategy; it is reproducible and scalable. There is a MLST scheme for Clostridium difficile (CD), a gram positive bacillus causing different pathologies of the gastrointestinal tract. This work was aimed at describing the frequency of sequence types (STs) and Clades (C) reported and evalute the intra-taxa diversity in the CD MLST database (CD-MLST-db) using an MLSA approach. Analysis of 1778 available isolates showed that clade 1 (C1) was the most frequent worldwide (57.7%), followed by C2 (29.1%). Regarding sequence types (STs), it was found that ST-1, belonging to C2, was the most frequent. The isolates analysed came from 17 countries, mostly from the United Kingdom (UK) (1541 STs, 87.0%). The diversity of the seven housekeeping genes in the MLST scheme was evaluated, and alleles from the profiles (STs), for identifying CD population structure. It was found that adk and atpA are conserved genes allowing a limited amount of clusters to be discriminated; however, different genes such as drx, glyA and particularly sodA showed high diversity indexes and grouped CD populations in many clusters, suggesting that these genes' contribution to CD typing should be revised. It was identified that CD STs reported to date have a mostly clonal population structure with foreseen events of recombination; however, one group of STs was not assigned to a clade being highly different containing at least nine well-supported clusters, suggesting a greater amount of clades for CD. This study shows the usefulness of CD-MLST-db as a tool for studying CD distribution and population structure, identifying the need for reviewing the usefulness of sodA as housekeeping gene within the MLST scheme and suggesting the existence of a greater amount of CD clades. The study also shows the plausible exchange of genetic material between STs, contributing towards intra-taxa genetic diversity.

  3. Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

    International Nuclear Information System (INIS)

    Xiong Gang; Wang, X.R.

    2005-01-01

    The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

  4. The complete nucleotide sequences of the 5 genetically distinct plastid genomes of Oenothera, subsection Oenothera: II. A microevolutionary view using bioinformatics and formal genetic data.

    Science.gov (United States)

    Greiner, Stephan; Wang, Xi; Herrmann, Reinhold G; Rauwolf, Uwe; Mayer, Klaus; Haberer, Georg; Meurer, Jörg

    2008-09-01

    A unique combination of genetic features and a rich stock of information make the flowering plant genus Oenothera an appealing model to explore the molecular basis of speciation processes including nucleus-organelle coevolution. From representative species, we have recently reported complete nucleotide sequences of the 5 basic and genetically distinguishable plastid chromosomes of subsection Oenothera (I-V). In nature, Oenothera plastid genomes are associated with 6 distinct, either homozygous or heterozygous, diploid nuclear genotypes of the 3 basic genomes A, B, or C. Artificially produced plastome-genome combinations that do not occur naturally often display interspecific plastome-genome incompatibility (PGI). In this study, we compare formal genetic data available from all 30 plastome-genome combinations with sequence differences between the plastomes to uncover potential determinants for interspecific PGI. Consistent with an active role in speciation, a remarkable number of genes have high Ka/Ks ratios. Different from the Solanacean cybrid model Atropa/tobacco, RNA editing seems not to be relevant for PGIs in Oenothera. However, predominantly sequence polymorphisms in intergenic segments are proposed as possible sources for PGI. A single locus, the bidirectional promoter region between psbB and clpP, is suggested to contribute to compartmental PGI in the interspecific AB hybrid containing plastome I (AB-I), consistent with its perturbed photosystem II activity.

  5. Nucleotide and deduced amino acid sequence of the envelope gene of the Vasilchenko strain of TBE virus; comparison with other flaviviruses.

    Science.gov (United States)

    Gritsun, T S; Frolova, T V; Pogodina, V V; Lashkevich, V A; Venugopal, K; Gould, E A

    1993-02-01

    A strain of tick-borne encephalitis virus known as Vasilchenko (Vs) exhibits relatively low virulence characteristics in monkeys, Syrian hamsters and humans. The gene encoding the envelope glycoprotein of this virus was cloned and sequenced. Alignment of the sequence with those of other known tick-borne flaviviruses and identification of the recognised amino acid genetic marker EHLPTA confirmed its identity as a member of the TBE complex. However, Vs virus was distinguishable from eastern and western tick-borne serotypes by the presence of the sequence AQQ at amino acid positions 232-234 and also by the presence of other specific amino acid substitutions which may be genetic markers for these viruses and could determine their pathogenetic characteristics. When compared with other tick-borne flaviviruses, Vs virus had 12 unique amino acid substitutions including an additional potential glycosylation site at position (315-317). The Vs virus strain shared closest nucleotide and amino acid homology (84.5% and 95.5% respectively) with western and far eastern strains of tick-borne encephalitis virus. Comparison with the far eastern serotype of tick-borne encephalitis virus, by cross-immunoelectrophoresis of Vs virions and PAGE analysis of the extracted virion proteins, revealed differences in surface charge and virus stability that may account for the different virulence characteristics of Vs virus. These results support and enlarge upon previous data obtained from molecular and serological analysis.

  6. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses.

    Science.gov (United States)

    Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen

    2013-01-01

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).

  7. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    Directory of Open Access Journals (Sweden)

    Elizabeth N. Krueger

    2013-07-01

    Full Text Available The yellow dwarf viruses (YDVs of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs and Wheat yellow dwarf virus (WYDV of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392. The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV.

  8. The influence of selection on the evolutionary distance estimated from the base changes observed between homologous nucleotide sequences.

    Science.gov (United States)

    Otsuka, J; Kawai, Y; Sugaya, N

    2001-11-21

    In most studies of molecular evolution, the nucleotide base at a site is assumed to change with the apparent rate under functional constraint, and the comparison of base changes between homologous genes is thought to yield the evolutionary distance corresponding to the site-average change rate multiplied by the divergence time. However, this view is not sufficiently successful in estimating the divergence time of species, but mostly results in the construction of tree topology without a time-scale. In the present paper, this problem is investigated theoretically by considering that observed base changes are the results of comparing the survivals through selection of mutated bases. In the case of weak selection, the time course of base changes due to mutation and selection can be obtained analytically, leading to a theoretical equation showing how the selection has influence on the evolutionary distance estimated from the enumeration of base changes. This result provides a new method for estimating the divergence time more accurately from the observed base changes by evaluating both the strength of selection and the mutation rate. The validity of this method is verified by analysing the base changes observed at the third codon positions of amino acid residues with four-fold codon degeneracy in the protein genes of mammalian mitochondria; i.e. the ratios of estimated divergence times are fairly well consistent with a series of fossil records of mammals. Throughout this analysis, it is also suggested that the mutation rates in mitochondrial genomes are almost the same in different lineages of mammals and that the lineage-specific base-change rates indicated previously are due to the selection probably arising from the preference of transfer RNAs to codons.

  9. Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

  10. Complete nucleotide sequence of the Coturnix chinensis (blue-breasted quail) mitochondrial genome and a phylogenetic analysis with related species.

    Science.gov (United States)

    Nishibori, M; Tsudzuki, M; Hayashi, T; Yamamoto, Y; Yasue, H

    2002-01-01

    Coturnix chinensis (blue-breasted quail) has been classically grouped in Galliformes Phasianidae Coturnix, based on morphologic features and biochemical evidence. Since the blue-breasted quail has the smallest body size among the species of Galliformes, in addition to a short generation time and an excellent reproductive performance, it is a possible model fowl for breeding and physiological studies of the Coturnix japonica (Japanese quail) and Gallus gallus domesticus (chicken), which are classified in the same family as blue-breasted quail. However, since its phylogenetic position in the family Phasianidae has not been determined conclusively, the sequence of the entire blue-breasted quail mitochondria (mt) genome was obtained to provide genetic information for phylogenetic analysis in the present study. The blue-breasted quail mtDNA was found to be a circular DNA of 16,687 base pairs (bp) with the same genomic structure as the mtDNAs of Japanese quail and chicken, though it is smaller than Japanese quail and chicken mtDNAs by 10 bp and 88 bp, respectively. The sequence identity of all mitochondrial genes, including those for 12S and 16S ribosomal RNAs, between blue-breasted quail and Japanese quail ranged from 84.5% to 93.5%; between blue-breasted quail and chicken, sequence identity ranged from 78.0% to 89.6%. In order to obtain information on the phylogenetic position of blue-breasted quail in Galliformes Phasianidae, the 2,184 bp sequence comprising NADH dehydrogenase subunit 2 and cytochrome b genes available for eight species in Galliformes [Japanese quail, chicken, Gallus varius (green junglefowl), Bambusicola thoracica (Chinese bamboo partridge), Pavo cristatus (Indian peafowl), Perdix perdix (gray partridge), Phasianus colchicus (ring-neck pheasant), and Tympanchus phasianellus (sharp-tailed grouse)] together with that of Aythya americana (redhead) were examined using a maximum likelihood (ML) method. The ML analyses on the first/second codon positions

  11. TargetM6A: Identifying N6-Methyladenosine Sites From RNA Sequences via Position-Specific Nucleotide Propensities and a Support Vector Machine.

    Science.gov (United States)

    Li, Guang-Qing; Liu, Zi; Shen, Hong-Bin; Yu, Dong-Jun

    2016-10-01

    As one of the most ubiquitous post-transcriptional modifications of RNA, N 6 -methyladenosine ( [Formula: see text]) plays an essential role in many vital biological processes. The identification of [Formula: see text] sites in RNAs is significantly important for both basic biomedical research and practical drug development. In this study, we designed a computational-based method, called TargetM6A, to rapidly and accurately target [Formula: see text] sites solely from the primary RNA sequences. Two new features, i.e., position-specific nucleotide/dinucleotide propensities (PSNP/PSDP), are introduced and combined with the traditional nucleotide composition (NC) feature to formulate RNA sequences. The extracted features are further optimized to obtain a much more compact and discriminative feature subset by applying an incremental feature selection (IFS) procedure. Based on the optimized feature subset, we trained TargetM6A on the training dataset with a support vector machine (SVM) as the prediction engine. We compared the proposed TargetM6A method with existing methods for predicting [Formula: see text] sites by performing stringent jackknife tests and independent validation tests on benchmark datasets. The experimental results show that the proposed TargetM6A method outperformed the existing methods for predicting [Formula: see text] sites and remarkably improved the prediction performances, with MCC = 0.526 and AUC = 0.818. We also provided a user-friendly web server for TargetM6A, which is publicly accessible for academic use at http://csbio.njust.edu.cn/bioinf/TargetM6A.

  12. Meta-analysis of sequence-based association studies across three cattle breeds reveals 25 QTL for fat and protein percentages in milk at nucleotide resolution.

    Science.gov (United States)

    Pausch, Hubert; Emmerling, Reiner; Gredler-Grandl, Birgit; Fries, Ruedi; Daetwyler, Hans D; Goddard, Michael E

    2017-11-09

    Genotyping and whole-genome sequencing data have been generated for hundreds of thousands of cattle. International consortia used these data to compile imputation reference panels that facilitate the imputation of sequence variant genotypes for animals that have been genotyped using dense microarrays. Association studies with imputed sequence variant genotypes allow for the characterization of quantitative trait loci (QTL) at nucleotide resolution particularly when individuals from several breeds are included in the mapping populations. We imputed genotypes for 28 million sequence variants in 17,229 cattle of the Braunvieh, Fleckvieh and Holstein breeds in order to compile large mapping populations that provide high power to identify QTL for milk production traits. Association tests between imputed sequence variant genotypes and fat and protein percentages in milk uncovered between six and thirteen QTL (P < 1e-8) per breed. Eight of the detected QTL were significant in more than one breed. We combined the results across breeds using meta-analysis and identified a total of 25 QTL including six that were not significant in the within-breed association studies. Two missense mutations in the ABCG2 (p.Y581S, rs43702337, P = 4.3e-34) and GHR (p.F279Y, rs385640152, P = 1.6e-74) genes were the top variants at QTL on chromosomes 6 and 20. Another known causal missense mutation in the DGAT1 gene (p.A232K, rs109326954, P = 8.4e-1436) was the second top variant at a QTL on chromosome 14 but its allelic substitution effects were inconsistent across breeds. It turned out that the conflicting allelic substitution effects resulted from flaws in the imputed genotypes due to the use of a multi-breed reference population for genotype imputation. Many QTL for milk production traits segregate across breeds and across-breed meta-analysis has greater power to detect such QTL than within-breed association testing. Association testing between imputed sequence variant genotypes and

  13. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  14. Single-nucleotide variant in multiple copies of a deleted in azoospermia (DAZ) sequence - a human Y chromosome quantitative polymorphism.

    Science.gov (United States)

    Szmulewicz, Martin N; Ruiz, Luis M; Reategui, Erika P; Hussini, Saeed; Herrera, Rene J

    2002-01-01

    The evolution of the deleted in azoospermia (DAZ) gene family supports prevalent theories on the origin and development of sex chromosomes and sexual dimorphism. The ancestral DAZL gene in human chromosome 3 is known to be involved in germline development of both males and females. The available phylogenetic data suggest that some time after the divergence of the New World and Old World monkey lineages, the DAZL gene, which is found in all mammals, was copied to the Y chromosome of an ancestor to the Old World monkeys, but not New World monkeys. In modern man, the Y-linked DAZ gene complex is located on the distal part of the q arm. It is thought that after being copied to the Y chromosome, and after the divergence of the human and great ape lineages, the DAZ gene in the former underwent internal rearrangements. This included tandem duplications as well as a T > C transition altering an MboI restriction enzyme site in a duplicated sequence. In this study, we report on the ratios of MboI-/MboI+ variant sequences in individuals from seven worldwide human populations (Basque, Benin, Egypt, Formosa, Kungurtug, Oman and Rwanda) in the DAZ complex. The ratio of PCR MboI- and MboI+ amplicons can be used to characterize individuals and populations. Our results show a nonrandom distribution of MboI-/MboI+ sequence ratios in all populations examined, as well as significant differences in ratios between populations when compared pairwise. The multiple ratios imply that there have been more than one recent reorganization events at this locus. Considering the dynamic nature of this locus and its involvement in male fertility, we investigated the extent and distribution of this polymorphism. Copyright 2002 S. Karger AG, Basel

  15. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  16. PCR Assays for Identification of Coccidioides posadasii Based on the Nucleotide Sequence of the Antigen 2/Proline-Rich Antigen

    Science.gov (United States)

    Bialek, Ralf; Kern, Jan; Herrmann, Tanja; Tijerina, Rolando; Ceceñas, Luis; Reischl, Udo; González, Gloria M.

    2004-01-01

    A conventional nested PCR and a real-time LightCycler PCR assay for detection of Coccidioides posadasii DNA were designed and tested in 120 clinical strains. These had been isolated from 114 patients within 10 years in Monterrey, Nuevo Leon, Mexico, known to be endemic for coccidioidomycosis. The gene encoding the specific antigen 2/proline-rich antigen (Ag2/PRA) was used as a target. All strains were correctly identified, whereas DNA from related members of the family Onygenaceae remained negative. Melting curve analysis by LightCycler and sequencing of the 526-bp product of the first PCR demonstrated either 100% identity to the GenBank sequence of the Silveira strain, now known to be C. posadasii (accession number AF013256), or a single silent mutation at position 1228. Length determination of two microsatellite-containing loci (GAC and 621) identified all 120 isolates as C. posadasii. Specific DNA was amplified by conventional nested PCR from three microscopically spherule-positive paraffin-embedded tissue samples, whereas 20 human tissue samples positive for other dimorphic fungi remained negative. Additionally, the safety of each step of a modified commercially available DNA extraction procedure was evaluated by using 10 strains. At least three steps of the protocol were demonstrated to sufficiently kill arthroconidia. This safe procedure is applicable to cultures and to clinical specimens. PMID:14766853

  17. Human uroporphyrinogen III synthase: Molecular cloning, nucleotide sequence, and expression of a full-length cDNA

    International Nuclear Information System (INIS)

    Tsai, Shihfeng; Bishop, D.F.; Desnick, R.J.

    1988-01-01

    Uroporphyrinogen III synthase, the fourth enzyme in the heme biosynthetic pathway, is responsible for conversion of the linear tetrapyrrole, hydroxymethylbilane, to the cyclic tetrapyrrole, uroporphyrinogen III. The deficient activity of URO-synthase is the enzymatic defect in the autosomal recessive disorder congenital erythropoietic porphyria. To facilitate the isolation of a full-length cDNA for human URO-synthase, the human erythrocyte enzyme was purified to homogeneity and 81 nonoverlapping amino acids were determined by microsequencing the N terminus and four tryptic peptides. Two synthetic oligonucleotide mixtures were used to screen 1.2 x 10 6 recombinants from a human adult liver cDNA library. Eight clones were positive with both oligonucleotide mixtures. Of these, dideoxy sequencing of the 1.3 kilobase insert from clone pUROS-2 revealed 5' and 3' untranslated sequences of 196 and 284 base pairs, respectively, and an open reading frame of 798 base pairs encoding a protein of 265 amino acids with a predicted molecular mass of 28,607 Da. The isolation and expression of this full-length cDNA for human URO-synthase should facilitate studies of the structure, organization, and chromosomal localization of this heme biosynthetic gene as well as the characterization of the molecular lesions causing congenital erythropoietic porphyria

  18. HIVBrainSeqDB: a database of annotated HIV envelope sequences from brain and other anatomical sites

    Directory of Open Access Journals (Sweden)

    O'Connor Niall

    2010-12-01

    Full Text Available Abstract Background The population of HIV replicating within a host consists of independently evolving and interacting sub-populations that can be genetically distinct within anatomical compartments. HIV replicating within the brain causes neurocognitive disorders in up to 20-30% of infected individuals and is a viral sanctuary site for the development of drug resistance. The primary determinant of HIV neurotropism is macrophage tropism, which is primarily determined by the viral envelope (env gene. However, studies of genetic aspects of HIV replicating in the brain are hindered because existing repositories of HIV sequences are not focused on neurotropic virus nor annotated with neurocognitive and neuropathological status. To address this need, we constructed the HIV Brain Sequence Database. Results The HIV Brain Sequence Database is a public database of HIV envelope sequences, directly sequenced from brain and other tissues from the same patients. Sequences are annotated with clinical data including viral load, CD4 count, antiretroviral status, neurocognitive impairment, and neuropathological diagnosis, all curated from the original publication. Tissue source is coded using an anatomical ontology, the Foundational Model of Anatomy, to capture the maximum level of detail available, while maintaining ontological relationships between tissues and their subparts. 44 tissue types are represented within the database, grouped into 4 categories: (i brain, brainstem, and spinal cord; (ii meninges, choroid plexus, and CSF; (iii blood and lymphoid; and (iv other (bone marrow, colon, lung, liver, etc. Patient coding is correlated across studies, allowing sequences from the same patient to be grouped to increase statistical power. Using Cytoscape, we visualized relationships between studies, patients and sequences, illustrating interconnections between studies and the varying depth of sequencing, patient number, and tissue representation across studies

  19. Purification, enzymatic characterization, and nucleotide sequence of a high-isoelectric-point alpha-glucosidase from barley malt

    DEFF Research Database (Denmark)

    Frandsen, T P; Lok, F; Mirgorodskaya, E

    2000-01-01

    in the transition state complex. Mass spectrometry of tryptic fragments assigned the 92-kD protein to a barley cDNA (GenBank accession no. U22450) that appears to encode an alpha-glucosidase. A corresponding sequence (HvAgl97; GenBank accession no. AF118226) was isolated from a genomic phage library using a c......High-isoelectric-point (pI) alpha-glucosidase was purified 7, 300-fold from an extract of barley (Hordeum vulgare) malt by ammonium sulfate fractionation, ion-exchange, and butyl-Sepharose chromatography. The enzyme had high activity toward maltose (k(cat) = 25 s(-1)), with an optimum at pH 4...

  20. Complete nucleotide sequence of the Oenothera elata plastid chromosome, representing plastome I of the five distinguishable euoenothera plastomes.

    Science.gov (United States)

    Hupfer, H; Swiatek, M; Hornung, S; Herrmann, R G; Maier, R M; Chiu, W L; Sears, B

    2000-05-01

    We describe the 159,443-bp [corrected] sequence of the plastid chromosome of Oenothera elata (evening primrose). The Oe. elata plastid chromosome represents type I of the five genetically distinguishable basic plastomes found in the subsection Euoenothera. The genus Oenothera provides an ideal system in which to address fundamental questions regarding the functional integration of the compartmentalised genetic system characteristic of the eukaryotic cell. Its highly developed taxonomy and genetics, together with a favourable combination of features in its genetic structure (interspecific fertility, stable heterozygous progeny, biparental transmission of organelles, and the phenomenon of complex heterozygosity), allow facile exchanges of nuclei, plastids and mitochondria, as well as individual chromosome pairs, between species. The resulting hybrids or cybrids are usually viable and fertile, but can display various forms of developmental disturbance.

  1. COMPLETE NUCLEOTIDE SEQUENCE OF SPHEROIDIN GENES OF CALLIPTAMUS ITALICUS ENTOMOPOXVIRUS(CIEPV) AND GOMPHOCERUS SIBIRICUS ENTOMOPOXVIRUS(GSEPV)

    Institute of Scientific and Technical Information of China (English)

    Yong-danLi; Li-yingWang; Xi-wuGao; Chao-yangZhao; Zhao-fengTian

    2004-01-01

    The spheroidin genes of Calliptamus italicus entomopoxvirus (CiEPV) and Gomphocerus sibiricus entomopoxvirus (GsEPV) were obtained by PCR,and the fragments were cloned, sequenced and analyzed. The CiEPV and GsEPV spheroidin genes respectively harbored ORFs of 2 922 bps and 2 967 bps that were capable of coding polypeptides of 109.2 and 111.1 kDa. Computer analysis indicated that CiEPV and GsEPV spheroidins shared less than 20% amino acid identities with lepidopteran AmEPV and coleopteran AcEPV spheroidins, but more than 80% amino acid identities with orthopteran OaEPV, MsEPV and AaEPV spheroidins. The CiEPV and GsEPV spheroidins respectively contained 19 and 21 cysteine residues that were particularly abundant at the C-termini, as is the case with those of the other orthopteran EPV spheroidins. The numbers and locations of the cysteine residues of the spheroidins were most similar to those of the spheroidins of EPVs that are virulent on the same insect orders. The promoter regions of the two spheroidin genes were highly conserved (99%) among the orthopteran EPVs and also contained the typical very A+T rich and TAAATG signal mediating transcription of poxvirus late genes. We also sequenced an incomplete ORF downstream of the pheroidin gene of CiEPV and GsEPV. The ORF was in the opposite direction to the spheroidin gene and was homologous to MSV072 putative protein of MsEPV.

  2. Species delimitation of common reef corals in the genus Pocillopora using nucleotide sequence phylogenies, population genetics and symbiosis ecology.

    Science.gov (United States)

    Pinzón, Jorge H; LaJeunesse, Todd C

    2011-01-01

    Stony corals in the genus Pocillopora are among the most common and widely distributed of Indo-Pacific corals and, as such, are often the subject of physiological and ecological research. In the far Tropical Eastern Pacific (TEP), they are major constituents of shallow coral communities, exhibiting considerable variability in colony shape and branch morphology and marked differences in response to thermal stress. Numerous intermediates occur between morphospecies that may relate to extensive hybridization. The diversity of the Pocillopora genus in the TEP was analysed genetically using nuclear ribosomal (ITS2) and mitochondrial (ORF) sequences, and population genetic markers (seven microsatellite loci). The resident dinoflagellate endosymbiont (Symbiodinium sp.) in each sample was also characterized using sequences of the internal transcribed spacer 2 (ITS2) rDNA and the noncoding region of the chloroplast psbA minicircle. From these analyses, three symbiotically distinct, reproductively isolated, nonhybridizing, evolutionarily divergent animal lineages were identified. Designated types 1, 2 and 3, these groupings were incongruent with traditional morphospecies classification. Type 1 was abundant and widespread throughout the TEP; type 2 was restricted to the Clipperton Atoll; and type 3 was found only in Panama and the Galapagos Islands. Each type harboured a different Symbiodinium'species lineage' in Clade C, and only type 1 associated with the 'stress-tolerant'Symbiodinium glynni (D1). The accurate delineation of species and implementation of a proper taxonomy may profoundly improve our assessment of Pocillopora's reproductive biology, biogeographic distributions, and resilience to climate warming, information that must be considered when planning for the conservation of reef corals. © 2010 Blackwell Publishing Ltd.

  3. The mitochondrial genome sequence of the ciliate Paramecium caudatum reveals a shift in nucleotide composition and codon usage within the genus Paramecium

    Directory of Open Access Journals (Sweden)

    Berendonk Thomas U

    2011-05-01

    Full Text Available Abstract Background Despite the fact that the organization of the ciliate mitochondrial genome is exceptional, only few ciliate mitochondrial genomes have been sequenced until today. All ciliate mitochondrial genomes are linear. They are 40 kb to 47 kb long and contain some 50 tightly packed genes without introns. Earlier studies documented that the mitochondrial guanine + cytosine contents are very different between Paramecium tetraurelia and all studied Tetrahymena species. This raises the question of whether the high mitochondrial G+C content observed in P. tetraurelia is a characteristic property of Paramecium mtDNA, or whether it is an exception of the ciliate mitochondrial genomes known so far. To test this question, we determined the mitochondrial genome sequence of Paramecium caudatum and compared the gene content and sequence properties to the closely related P. tetraurelia. Results The guanine + cytosine content of the P. caudatum mitochondrial genome was significantly lower than that of P. tetraurelia (22.4% vs. 41.2%. This difference in the mitochondrial nucleotide composition was accompanied by significantly different codon usage patterns in both species, i.e. within P. caudatum clearly A/T ending codons dominated, whereas for P. tetraurelia the synonymous codons were more balanced with a higher number of G/C ending codons. Further analyses indicated that the nucleotide composition of most members of the genus Paramecium resembles that of P. caudatum and that the shift observed in P. tetraurelia is restricted to the P. aurelia species complex. Conclusions Surprisingly, the codon usage bias in the P. caudatum mitochondrial genome, exemplified by the effective number of codons, is more similar to the distantly related T. pyriformis and other single-celled eukaryotes such as Chlamydomonas, than to the closely related P. tetraurelia. These differences in base composition and codon usage bias were, however, not reflected in the amino

  4. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

    Science.gov (United States)

    Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo

    2002-12-01

    The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

  5. Genome-Wide Single-Nucleotide Polymorphisms Discovery and High-Density Genetic Map Construction in Cauliflower Using Specific-Locus Amplified Fragment Sequencing

    Science.gov (United States)

    Zhao, Zhenqing; Gu, Honghui; Sheng, Xiaoguang; Yu, Huifang; Wang, Jiansheng; Huang, Long; Wang, Dan

    2016-01-01

    Molecular markers and genetic maps play an important role in plant genomics and breeding studies. Cauliflower is an important and distinctive vegetable; however, very few molecular resources have been reported for this species. In this study, a novel, specific-locus amplified fragment (SLAF) sequencing strategy was employed for large-scale single nucleotide polymorphism (SNP) discovery and high-density genetic map construction in a double-haploid, segregating population of cauliflower. A total of 12.47 Gb raw data containing 77.92 M pair-end reads were obtained after processing and 6815 polymorphic SLAFs between the two parents were detected. The average sequencing depths reached 52.66-fold for the female parent and 49.35-fold for the male parent. Subsequently, these polymorphic SLAFs were used to genotype the population and further filtered based on several criteria to construct a genetic linkage map of cauliflower. Finally, 1776 high-quality SLAF markers, including 2741 SNPs, constituted the linkage map with average data integrity of 95.68%. The final map spanned a total genetic length of 890.01 cM with an average marker interval of 0.50 cM, and covered 364.9 Mb of the reference genome. The markers and genetic map developed in this study could provide an important foundation not only for comparative genomics studies within Brassica oleracea species but also for quantitative trait loci identification and molecular breeding of cauliflower. PMID:27047515

  6. Genetic relatedness among indigenous rice varieties in the Eastern Himalayan region based on nucleotide sequences of the Waxy gene.

    Science.gov (United States)

    Choudhury, Baharul I; Khan, Mohammed L; Dayanandan, Selvadurai

    2014-12-29

    Indigenous rice varieties in the Eastern Himalayan region of Northeast India are traditionally classified into sali, boro and jum ecotypes based on geographical locality and the season of cultivation. In this study, we used DNA sequence data from the Waxy (Wx) gene to infer the genetic relatedness among indigenous rice varieties in Northeast India and to assess the genetic distinctiveness of ecotypes. The results of all three analyses (Bayesian, Maximum Parsimony and Neighbor Joining) were congruent and revealed two genetically distinct clusters of rice varieties in the region. The large group comprised several varieties of sali and boro ecotypes, and all agronomically improved varieties. The small group consisted of only traditionally cultivated indigenous rice varieties, which included one boro, few sali and all jum varieties. The fixation index analysis revealed a very low level of differentiation between sali and boro (F(ST) = 0.005), moderate differentiation between sali and jum (F(ST) = 0.108) and high differentiation between jum and boro (F(ST) = 0.230) ecotypes. The genetic relatedness analyses revealed that sali, boro and jum ecotypes are genetically heterogeneous, and the current classification based on cultivation type is not congruent with the genetic background of rice varieties. Indigenous rice varieties chosen from genetically distinct clusters could be used in breeding programs to improve genetic gain through heterosis, while maintaining high genetic diversity.

  7. Characterization of the transcriptome, nucleotide sequence polymorphism, and natural selection in the desert adapted mouse Peromyscus eremicus

    Directory of Open Access Journals (Sweden)

    Matthew D. MacManes

    2014-10-01

    Full Text Available As a direct result of intense heat and aridity, deserts are thought to be among the most harsh of environments, particularly for their mammalian inhabitants. Given that osmoregulation can be challenging for these animals, with failure resulting in death, strong selection should be observed on genes related to the maintenance of water and solute balance. One such animal, Peromyscus eremicus, is native to the desert regions of the southwest United States and may live its entire life without oral fluid intake. As a first step toward understanding the genetics that underlie this phenotype, we present a characterization of the P. eremicus transcriptome. We assay four tissues (kidney, liver, brain, testes from a single individual and supplement this with population level renal transcriptome sequencing from 15 additional animals. We identified a set of transcripts undergoing both purifying and balancing selection based on estimates of Tajima’s D. In addition, we used the branch-site test to identify a transcript—Slc2a9, likely related to desert osmoregulation—undergoing enhanced selection in P. eremicus relative to a set of related non-desert rodents.

  8. Detection and copy number estimation of the transgenic nucleotide sequences in an unknown GM event of Oryza sativa

    Directory of Open Access Journals (Sweden)

    Ali M. Sajjad

    2016-12-01

    Full Text Available The present study was designed to establish a qualitative detection method based on conventional and real time PCR assay to screen the commonly grown rice varieties for the presence of the cry1Ac gene. The detection of genetically modified rice in the screening process would necessitate accurate assay development and precise qualitative PCR tests complying with established procedures for the detection and characterization of transgenes in food grains. Such assay would not only enable the monitoring of transgene flow in local agricultural environment but also the characterization of different plant species produced with this transgene and its regulatory components. Thus, a reliable and quick screening assay was established for the qualitative detection of the transgene along with the promoter and selectable marker gene in genetically modified rice. By conventional PCR, a fragment of 215 bp was amplified with gene specific primers of cry1Ac. Primers for other transgenes such as gna and bar were also employed; however, no amplification was detected. The presence of the p35s, sps, and nptII genes was confirmed by qualitative real-time PCR. The specificity of the respective PCR products was checked through melt peak curve analysis. Sharp and precise melting temperatures indicated the presence of a single kind of PCR product in correspondence to each of the primers used. Moreover, the copy number of cry1Ac was estimated by ∆∆CT method. It is proposed that the primer sets and experimental conditions used in this study will be sufficient to meet the requirements for molecular detection and characterization of the cry1Ac transgene and affiliated sequences in sorting out conventional rice varieties from the ones which are genetically modified. It will also help to monitor the ecological flow of these transgenes and other biosafety factors.

  9. Genome-wide association study using high-density single nucleotide polymorphism arrays and whole-genome sequences for clinical mastitis traits in dairy cattle.

    Science.gov (United States)

    Sahana, G; Guldbrandtsen, B; Thomsen, B; Holm, L-E; Panitz, F; Brøndum, R F; Bendixen, C; Lund, M S

    2014-11-01

    Mastitis is a mammary disease that frequently affects dairy cattle. Despite considerable research on the development of effective prevention and treatment strategies, mastitis continues to be a significant issue in bovine veterinary medicine. To identify major genes that affect mastitis in dairy cattle, 6 chromosomal regions on Bos taurus autosome (BTA) 6, 13, 16, 19, and 20 were selected from a genome scan for 9 mastitis phenotypes using imputed high-density single nucleotide polymorphism arrays. Association analyses using sequence-level variants for the 6 targeted regions were carried out to map causal variants using whole-genome sequence data from 3 breeds. The quantitative trait loci (QTL) discovery population comprised 4,992 progeny-tested Holstein bulls, and QTL were confirmed in 4,442 Nordic Red and 1,126 Jersey cattle. The targeted regions were imputed to the sequence level. The highest association signal for clinical mastitis was observed on BTA 6 at 88.97 Mb in Holstein cattle and was confirmed in Nordic Red cattle. The peak association region on BTA 6 contained 2 genes: vitamin D-binding protein precursor (GC) and neuropeptide FF receptor 2 (NPFFR2), which, based on known biological functions, are good candidates for affecting mastitis. However, strong linkage disequilibrium in this region prevented conclusive determination of the causal gene. A different QTL on BTA 6 located at 88.32 Mb in Holstein cattle affected mastitis. In addition, QTL on BTA 13 and 19 were confirmed to segregate in Nordic Red cattle and QTL on BTA 16 and 20 were confirmed in Jersey cattle. Although several candidate genes were identified in these targeted regions, it was not possible to identify a gene or polymorphism as the causal factor for any of these regions. Copyright © 2014 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  10. Improvements in the HbVar database of human hemoglobin variants and thalassemia mutations for population and sequence variation studies.

    NARCIS (Netherlands)

    G.P. Patrinos (George); B. Giardine (Belinda); C. Riemer (Cathy); W. Miller (Webb); D.H. Chui (David); N.P. Anagnou (Nicholas); H. Wajcman (Henri); R.C. Hardison (Ross)

    2004-01-01

    textabstractHbVar (http://globin.cse.psu.edu/globin/hbvar/) is a relational database developed by a multi-center academic effort to provide up-to-date and high quality information on the genomic sequence changes leading to hemoglobin variants and all types of thalassemia and

  11. An Efficient Approach to Mining Maximal Contiguous Frequent Patterns from Large DNA Sequence Databases

    Directory of Open Access Journals (Sweden)

    Md. Rezaul Karim

    2012-03-01

    Full Text Available Mining interesting patterns from DNA sequences is one of the most challenging tasks in bioinformatics and computational biology. Maximal contiguous frequent patterns are preferable for expressing the function and structure of DNA sequences and hence can capture the common data characteristics among related sequences. Biologists are interested in finding frequent orderly arrangements of motifs that are responsible for similar expression of a group of genes. In order to reduce mining time and complexity, however, most existing sequence mining algorithms either focus on finding short DNA sequences or require explicit specification of sequence lengths in advance. The challenge is to find longer sequences without specifying sequence lengths in advance. In this paper, we propose an efficient approach to mining maximal contiguous frequent patterns from large DNA sequence datasets. The experimental results show that our proposed approach is memory-efficient and mines maximal contiguous frequent patterns within a reasonable time.

  12. The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

    Science.gov (United States)

    Nallaseth, Ferez Soli

    The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1

  13. UET: a database of evolutionarily-predicted functional determinants of protein sequences that cluster as functional sites in protein structures.

    Science.gov (United States)

    Lua, Rhonald C; Wilson, Stephen J; Konecki, Daniel M; Wilkins, Angela D; Venner, Eric; Morgan, Daniel H; Lichtarge, Olivier

    2016-01-04

    The structure and function of proteins underlie most aspects of biology and their mutational perturbations often cause disease. To identify the molecular determinants of function as well as targets for drugs, it is central to characterize the important residues and how they cluster to form functional sites. The Evolutionary Trace (ET) achieves this by ranking the functional and structural importance of the protein sequence positions. ET uses evolutionary distances to estimate functional distances and correlates genotype variations with those in the fitness phenotype. Thus, ET ranks are worse for sequence positions that vary among evolutionarily closer homologs but better for positions that vary mostly among distant homologs. This approach identifies functional determinants, predicts function, guides the mutational redesign of functional and allosteric specificity, and interprets the action of coding sequence variations in proteins, people and populations. Now, the UET database offers pre-computed ET analyses for the protein structure databank, and on-the-fly analysis of any protein sequence. A web interface retrieves ET rankings of sequence positions and maps results to a structure to identify functionally important regions. This UET database integrates several ways of viewing the results on the protein sequence or structure and can be found at http://mammoth.bcm.tmc.edu/uet/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Molecular Comparison and Evolutionary Analyses of VP1 Nucleotide Sequences of New African Human Enterovirus 71 Isolates Reveal a Wide Genetic Diversity

    Science.gov (United States)

    Nougairède, Antoine; Joffret, Marie-Line; Deshpande, Jagadish M.; Dubot-Pérès, Audrey; Héraud, Jean-Michel

    2014-01-01

    Most circulating strains of Human enterovirus 71 (EV-A71) have been classified primarily into three genogroups (A to C) on the basis of genetic divergence between the 1D gene, which encodes the VP1 capsid protein. The aim of the present study was to provide further insights into the diversity of the EV-A71 genogroups following the recent description of highly divergent isolates, in particular those from African countries, including Madagascar. We classified recent EV-A71 isolates by a large comparison of 3,346 VP1 nucleotidic sequences collected from GenBank. Analysis of genetic distances and phylogenetic investigations indicated that some recently-reported isolates did not fall into the genogroups A-C and clustered into three additional genogroups, including one Indian genogroup (genogroup D) and 2 African ones (E and F). Our Bayesian phylogenetic analysis provided consistent data showing that the genogroup D isolates share a recent common ancestor with the members of genogroup E, while the isolates of genogroup F evolved from a recent common ancestor shared with the members of the genogroup B. Our results reveal the wide diversity that exists among EV-A71 isolates and suggest that the number of circulating genogroups is probably underestimated, particularly in developing countries where EV-A71 epidemiology has been poorly studied. PMID:24598878

  15. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper.

    Science.gov (United States)

    Manivannan, Abinaya; Kim, Jin-Hee; Yang, Eun-Young; Ahn, Yul-Kyun; Lee, Eun-Su; Choi, Sena; Kim, Do-Sun

    2018-01-01

    Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS) approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP) indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  16. Next-Generation Sequencing Approaches in Genome-Wide Discovery of Single Nucleotide Polymorphism Markers Associated with Pungency and Disease Resistance in Pepper

    Directory of Open Access Journals (Sweden)

    Abinaya Manivannan

    2018-01-01

    Full Text Available Pepper is an economically important horticultural plant that has been widely used for its pungency and spicy taste in worldwide cuisines. Therefore, the domestication of pepper has been carried out since antiquity. Owing to meet the growing demand for pepper with high quality, organoleptic property, nutraceutical contents, and disease tolerance, genomics assisted breeding techniques can be incorporated to develop novel pepper varieties with desired traits. The application of next-generation sequencing (NGS approaches has reformed the plant breeding technology especially in the area of molecular marker assisted breeding. The availability of genomic information aids in the deeper understanding of several molecular mechanisms behind the vital physiological processes. In addition, the NGS methods facilitate the genome-wide discovery of DNA based markers linked to key genes involved in important biological phenomenon. Among the molecular markers, single nucleotide polymorphism (SNP indulges various benefits in comparison with other existing DNA based markers. The present review concentrates on the impact of NGS approaches in the discovery of useful SNP markers associated with pungency and disease resistance in pepper. The information provided in the current endeavor can be utilized for the betterment of pepper breeding in future.

  17. FishPathogens.eu/vhsv: a user-friendly viral haemorrhagic septicaemia virus isolate and sequence database

    DEFF Research Database (Denmark)

    Jonstrup, Søren Peter; Gray, Tanya; Kahns, Søren

    2009-01-01

    A database has been created, http://www.Fish Pathogens.eu, with the aim of providing a single repository for collating important information on significant pathogens of aquaculture, relevant to their control and management. This database will be developed, maintained and managed as part of the Eu......A database has been created, http://www.Fish Pathogens.eu, with the aim of providing a single repository for collating important information on significant pathogens of aquaculture, relevant to their control and management. This database will be developed, maintained and managed as part...... of the European Community Reference Laboratory for Fish Diseases function. This concept has been initially developed for viral haemorrhagic septicaemia virus and will be extended in future to include information on other significant aquaculture pathogens. Information included for each isolate comprises sequence...... to obtain data from any selected part of the genome of interest. The output of the sequence search can be readily retrieved as a FASTA file ready to be imported into a sequence alignment tool of choice, facilitating further molecular epidemiological study....

  18. Nucleotide and Predicted Amino Acid Sequence-Based Analysis of the Avian Metapneumovirus Type C Cell Attachment Glycoprotein Gene: Phylogenetic Analysis and Molecular Epidemiology of U.S. Pneumoviruses

    Science.gov (United States)

    Alvarez, Rene; Lwamba, Humphrey M.; Kapczynski, Darrell R.; Njenga, M. Kariuki; Seal, Bruce S.

    2003-01-01

    A serologically distinct avian metapneumovirus (aMPV) was isolated in the United States after an outbreak of turkey rhinotracheitis (TRT) in February 1997. The newly recognized U.S. virus was subsequently demonstrated to be genetically distinct from European subtypes and was designated aMPV serotype C (aMPV/C). We have determined the nucleotide sequence of the gene encoding the cell attachment glycoprotein (G) of aMPV/C (Colorado strain and three Minnesota isolates) and predicted amino acid sequence by sequencing cloned cDNAs synthesized from intracellular RNA of aMPV/C-infected cells. The nucleotide sequence comprised 1,321 nucleotides with only one predicted open reading frame encoding a protein of 435 amino acids, with a predicted Mr of 48,840. The structural characteristics of the predicted G protein of aMPV/C were similar to those of the human respiratory syncytial virus (hRSV) attachment G protein, including two mucin-like regions (heparin-binding domains) flanking both sides of a CX3C chemokine motif present in a conserved hydrophobic pocket. Comparison of the deduced G-protein amino acid sequence of aMPV/C with those of aMPV serotypes A, B, and D, as well as hRSV revealed overall predicted amino acid sequence identities ranging from 4 to 16.5%, suggesting a distant relationship. However, G-protein sequence identities ranged from 72 to 97% when aMPV/C was compared to other members within the aMPV/C subtype or 21% for the recently identified human MPV (hMPV) G protein. Ratios of nonsynonymous to synonymous nucleotide changes were greater than one in the G gene when comparing the more recent Minnesota isolates to the original Colorado isolate. Epidemiologically, this indicates positive selection among U.S. isolates since the first outbreak of TRT in the United States. PMID:12682171

  19. CBS Genome Atlas Database: a dynamic storage for bioinformatic results and sequence data

    DEFF Research Database (Denmark)

    Hallin, Peter Fischer; Ussery, David

    2004-01-01

    , these results counts to more than 220 pieces of information. The backbone of this solution consists of a program package written in Perl, which enables administrators to synchronize and update the database content. The MySQL database has been connected to the CBS web-server via PHP4, to present a dynamic web...... and frequent addition of new models are factors that require a dynamic database layout. Using basic tools like the GNU Make system, csh, Perl and MySQL, we have created a flexible database environment for storing and maintaining such results for a collection of complete microbial genomes. Currently...... content for users outside the center. This solution is tightly fitted to existing server infrastructure and the solutions proposed here can perhaps serve as a template for other research groups to solve database issues....

  20. Clinical and molecular characterization of a cohort of patients with novel nucleotide alterations of the Dystrophin gene detected by direct sequencing

    Directory of Open Access Journals (Sweden)

    Corti Stefania

    2011-03-01

    Full Text Available Abstract Background Duchenne and Becker Muscular dystrophies (DMD/BMD are allelic disorders caused by mutations in the dystrophin gene, which encodes a sarcolemmal protein responsible for muscle integrity. Deletions and duplications account for approximately 75% of mutations in DMD and 85% in BMD. The implementation of techniques allowing complete gene sequencing has focused attention on small point mutations and other mechanisms underlying complex rearrangements. Methods We selected 47 patients (41 families; 35 DMD, 6 BMD without deletions and duplications in DMD gene (excluded by multiplex ligation-dependent probe amplification and multiplex polymerase chain reaction analysis. This cohort was investigated by systematic direct sequence analysis to study sequence variation. We focused our attention on rare mutational events which were further studied through transcript analysis. Results We identified 40 different nucleotide alterations in DMD gene and their clinical correlates; altogether, 16 mutations were novel. DMD probands carried 9 microinsertions/microdeletions, 19 nonsense mutations, and 7 splice-site mutations. BMD patients carried 2 nonsense mutations, 2 splice-site mutations, 1 missense substitution, and 1 single base insertion. The most frequent stop codon was TGA (n = 10 patients, followed by TAG (n = 7 and TAA (n = 4. We also analyzed the molecular mechanisms of five rare mutational events. They are two frame-shifting mutations in the DMD gene 3'end in BMD and three novel splicing defects: IVS42: c.6118-3C>A, which causes a leaky splice-site; c.9560A>G, which determines a cryptic splice-site activation and c.9564-426 T>G, which creates pseudoexon retention within IVS65. Conclusion The analysis of our patients' sample, carrying point mutations or complex rearrangements in DMD gene, contributes to the knowledge on phenotypic correlations in dystrophinopatic patients and can provide a better understanding of pre-mRNA maturation defects

  1. Comparing Enterovirus 71 with Coxsackievirus A16 by analyzing nucleotide sequences and antigenicity of recombinant proteins of VP1s and VP4s

    Directory of Open Access Journals (Sweden)

    Sun Yu

    2011-11-01

    Full Text Available Abstract Background Enterovirus 71 (EV71 and Coxsackievirus A16 (CA16 are two major etiological agents of Hand, Foot and Mouth Disease (HFMD. EV71 is associated with severe cases but not CA16. The mechanisms contributed to the different pathogenesis of these two viruses are unknown. VP1 and VP4 are two major structural proteins of these viruses, and should be paid close attention to. Results The sequences of vp1s from 14 EV71 and 14 CA16, and vp4s from 10 EV71 and 1 CA16 isolated in this study during 2007 to 2009 HFMD seasons were analyzed together with the corresponding sequences available in GenBank using DNAStar and MEGA 4.0. Phylogenetic analysis of complete vp1s or vp4s showed that EV71 isolated in Beijing belonged to C4 and CA16 belonged to lineage B2 (lineage C. VP1s and VP4s from 4 strains of viruses expressed in E. coli BL21 cells were used to detect IgM and IgG in human sera by Western Blot. The detection of IgM against VP1s of EV71 and CA16 showed consistent results with current infection, while none of the sera were positive against VP4s of EV71 and CA16. There was significant difference in the positive rates between EV71 VP1 and CA16 VP1 (χ2 = 5.02, P 2 = 15.30, P 2 = 26.47, P 2 = 16.78, P Conclusions EV71 and CA16 were highly diverse in the nucleotide sequences of vp1s and vp4s. The sera positive rates of VP1 and VP4 of EV71 were lower than those of CA16 respectively, which suggested a less exposure rate to EV71 than CA16 in Beijing population. Human serum antibodies detected by Western blot using VP1s and VP4s as antigen indicated that the immunological reaction to VP1 and VP4 of both EV71 and CA16 was different.

  2. The UCSC genome browser database: update 2007

    DEFF Research Database (Denmark)

    Kuhn, R M; Karolchik, D; Zweig, A S

    2006-01-01

    The University of California, Santa Cruz Genome Browser Database contains, as of September 2006, sequence and annotation data for the genomes of 13 vertebrate and 19 invertebrate species. The Genome Browser displays a wide variety of annotations at all scales from the single nucleotide level up t...

  3. Discovery and mapping of a new expressed sequence tag-single nucleotide polymorphism and simple sequence repeat panel for large-scale genetic studies and breeding of Theobroma cacao L.

    Science.gov (United States)

    Allegre, Mathilde; Argout, Xavier; Boccara, Michel; Fouet, Olivier; Roguet, Yolande; Bérard, Aurélie; Thévenin, Jean Marc; Chauveau, Aurélie; Rivallan, Ronan; Clement, Didier; Courtois, Brigitte; Gramacho, Karina; Boland-Augé, Anne; Tahi, Mathias; Umaharan, Pathmanathan; Brunel, Dominique; Lanaud, Claire

    2012-01-01

    Theobroma cacao is an economically important tree of several tropical countries. Its genetic improvement is essential to provide protection against major diseases and improve chocolate quality. We discovered and mapped new expressed sequence tag-single nucleotide polymorphism (EST-SNP) and simple sequence repeat (SSR) markers and constructed a high-density genetic map. By screening 149 650 ESTs, 5246 SNPs were detected in silico, of which 1536 corresponded to genes with a putative function, while 851 had a clear polymorphic pattern across a collection of genetic resources. In addition, 409 new SSR markers were detected on the Criollo genome. Lastly, 681 new EST-SNPs and 163 new SSRs were added to the pre-existing 418 co-dominant markers to construct a large consensus genetic map. This high-density map and the set of new genetic markers identified in this study are a milestone in cocoa genomics and for marker-assisted breeding. The data are available at http://tropgenedb.cirad.fr. PMID:22210604

  4. Characterization of new Schistosoma mansoni microsatellite loci in sequences obtained from public DNA databases and microsatellite enriched genomic libraries

    Directory of Open Access Journals (Sweden)

    Rodrigues NB

    2002-01-01

    Full Text Available In the last decade microsatellites have become one of the most useful genetic markers used in a large number of organisms due to their abundance and high level of polymorphism. Microsatellites have been used for individual identification, paternity tests, forensic studies and population genetics. Data on microsatellite abundance comes preferentially from microsatellite enriched libraries and DNA sequence databases. We have conducted a search in GenBank of more than 16,000 Schistosoma mansoni ESTs and 42,000 BAC sequences. In addition, we obtained 300 sequences from CA and AT microsatellite enriched genomic libraries. The sequences were searched for simple repeats using the RepeatMasker software. Of 16,022 ESTs, we detected 481 (3% sequences that contained 622 microsatellites (434 perfect, 164 imperfect and 24 compounds. Of the 481 ESTs, 194 were grouped in 63 clusters containing 2 to 15 ESTs per cluster. Polymorphisms were observed in 16 clusters. The 287 remaining ESTs were orphan sequences. Of the 42,017 BAC end sequences, 1,598 (3.8% contained microsatellites (2,335 perfect, 287 imperfect and 79 compounds. The 1,598 BAC end sequences 80 were grouped into 17 clusters containing 3 to 17 BAC end sequences per cluster. Microsatellites were present in 67 out of 300 sequences from microsatellite enriched libraries (55 perfect, 38 imperfect and 15 compounds. From all of the observed loci 55 were selected for having the longest perfect repeats and flanking regions that allowed the design of primers for PCR amplification. Additionally we describe two new polymorphic microsatellite loci.

  5. Minimotif Miner 3.0: database expansion and significantly improved reduction of false-positive predictions from consensus sequences.

    Science.gov (United States)

    Mi, Tian; Merlin, Jerlin Camilus; Deverasetty, Sandeep; Gryk, Michael R; Bill, Travis J; Brooks, Andrew W; Lee, Logan Y; Rathnayake, Viraj; Ross, Christian A; Sargeant, David P; Strong, Christy L; Watts, Paula; Rajasekaran, Sanguthevar; Schiller, Martin R

    2012-01-01

    Minimotif Miner (MnM available at http://minimotifminer.org or http://mnm.engr.uconn.edu) is an online database for identifying new minimotifs in protein queries. Minimotifs are short contiguous peptide sequences that have a known function in at least one protein. Here we report the third release of the MnM database which has now grown 60-fold to approximately 300,000 minimotifs. Since short minimotifs are by their nature not very complex we also summarize a new set of false-positive filters and linear regression scoring that vastly enhance minimotif prediction accuracy on a test data set. This online database can be used to predict new functions in proteins and causes of disease.

  6. Gene Discovery in the Apicomplexa as Revealed by EST Sequencing and Assembly of a Comparative Gene Database

    Science.gov (United States)

    Li, Li; Brunk, Brian P.; Kissinger, Jessica C.; Pape, Deana; Tang, Keliang; Cole, Robert H.; Martin, John; Wylie, Todd; Dante, Mike; Fogarty, Steven J.; Howe, Daniel K.; Liberator, Paul; Diaz, Carmen; Anderson, Jennifer; White, Michael; Jerome, Maria E.; Johnson, Emily A.; Radke, Jay A.; Stoeckert, Christian J.; Waterston, Robert H.; Clifton, Sandra W.; Roos, David S.; Sibley, L. David

    2003-01-01

    Large-scale EST sequencing projects for several important parasites within the phylum Apicomplexa were undertaken for the purpose of gene discovery. Included were several parasites of medical importance (Plasmodium falciparum, Toxoplasma gondii) and others of veterinary importance (Eimeria tenella, Sarcocystis neurona, and Neospora caninum). A total of 55,192 ESTs, deposited into dbEST/GenBank, were included in the analyses. The resulting sequences have been clustered into nonredundant gene assemblies and deposited into a relational database that supports a variety of sequence and text searches. This database has been used to compare the gene assemblies using BLAST similarity comparisons to the public protein databases to identify putative genes. Of these new entries, ∼15%–20% represent putative homologs with a conservative cutoff of p neurona: , , , , , , , , , , , , , –, –, –, –, –. Eimeria tenella: –, –, –, –, –, –, –, –, – , –, –, –, –, –, –, –, –, –, –, –. Neospora caninum: –, –, , – , –, –.] PMID:12618375

  7. Evaluation of the authenticity of a highly novel environmental sequence from boreal forest soil using ribosomal RNA secondary structure modeling

    Science.gov (United States)

    D.J. Glass; N. Takebayashi; L. Olson; D.L. Taylor

    2013-01-01

    The number of sequences from both formally described taxa and uncultured environmental DNA deposited in the International Nucleotide Sequence Databases has increased substantially over the last two decades. Although the majority of these sequences represent authentic gene copies, there is evidence of DNA artifacts in these databases as well. These include lab artifacts...

  8. Complete nucleotide sequence and genome structure of a Japanese isolate of hibiscus latent Fort Pierce virus, a unique tobamovirus that contains an internal poly(A) region in its 3' end.

    Science.gov (United States)

    Yoshida, Tetsuya; Kitazawa, Yugo; Komatsu, Ken; Neriya, Yutaro; Ishikawa, Kazuya; Fujita, Naoko; Hashimoto, Masayoshi; Maejima, Kensaku; Yamaji, Yasuyuki; Namba, Shigetou

    2014-11-01

    In this study, we detected a Japanese isolate of hibiscus latent Fort Pierce virus (HLFPV-J), a member of the genus Tobamovirus, in a hibiscus plant in Japan and determined the complete sequence and organization of its genome. HLFPV-J has four open reading frames (ORFs), each of which shares more than 98 % nucleotide sequence identity with those of other HLFPV isolates. Moreover, HLFPV-J contains a unique internal poly(A) region of variable length, ranging from 44 to 78 nucleotides, in its 3'-untranslated region (UTR), as is the case with hibiscus latent Singapore virus (HLSV), another hibiscus-infecting tobamovirus. The length of the HLFPV-J genome was 6431 nucleotides, including the shortest internal poly(A) region. The sequence identities of ORFs 1, 2, 3 and 4 of HLFPV-J to other tobamoviruses were 46.6-68.7, 49.9-70.8, 31.0-70.8 and 39.4-70.1 %, respectively, at the nucleotide level and 39.8-75.0, 43.6-77.8, 19.2-70.4 and 31.2-74.2 %, respectively, at the amino acid level. The 5'- and 3'-UTRs of HLFPV-J showed 24.3-58.6 and 13.0-79.8 % identity, respectively, to other tobamoviruses. In particular, when compared to other tobamoviruses, each ORF and UTR of HLFPV-J showed the highest sequence identity to those of HLSV. Phylogenetic analysis showed that HLFPV-J, other HLFPV isolates and HLSV constitute a malvaceous-plant-infecting tobamovirus cluster. These results indicate that the genomic structure of HLFPV-J has unique features similar to those of HLSV. To our knowledge, this is the first report of the complete genome sequence of HLFPV.

  9. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  10. Cluster based on sequence comparison of homologous proteins of 95 organism species - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Gclust Server Cluster based on sequence comparison of homologous proteins of 95 organism spe...cies Data detail Data name Cluster based on sequence comparison of homologous proteins of 95 organism specie...istory of This Database Site Policy | Contact Us Cluster based on sequence compariso

  11. MannDB – A microbial database of automated protein sequence analyses and evidence integration for protein characterization

    Directory of Open Access Journals (Sweden)

    Kuczmarski Thomas A

    2006-10-01

    Full Text Available Abstract Background MannDB was created to meet a need for rapid, comprehensive automated protein sequence analyses to support selection of proteins suitable as targets for driving the development of reagents for pathogen or protein toxin detection. Because a large number of open-source tools were needed, it was necessary to produce a software system to scale the computations for whole-proteome analysis. Thus, we built a fully automated system for executing software tools and for storage, integration, and display of automated protein sequence analysis and annotation data. Description MannDB is a relational database that organizes data resulting from fully automated, high-throughput protein-sequence analyses using open-source tools. Types of analyses provided include predictions of cleavage, chemical properties, classification, features, functional assignment, post-translational modifications, motifs, antigenicity, and secondary structure. Proteomes (lists of hypothetical and known proteins are downloaded and parsed from Genbank and then inserted into MannDB, and annotations from SwissProt are downloaded when identifiers are found in the Genbank entry or when identical sequences are identified. Currently 36 open-source tools are run against MannDB protein sequences either on local systems or by means of batch submission to external servers. In addition, BLAST against protein entries in MvirDB, our database of microbial virulence factors, is performed. A web client browser enables viewing of computational results and downloaded annotations, and a query tool enables structured and free-text search capabilities. When available, links to external databases, including MvirDB, are provided. MannDB contains whole-proteome analyses for at least one representative organism from each category of biological threat organism listed by APHIS, CDC, HHS, NIAID, USDA, USFDA, and WHO. Conclusion MannDB comprises a large number of genomes and comprehensive protein

  12. ORFer--retrieval of protein sequences and open reading frames from GenBank and storage into relational databases or text files.

    Science.gov (United States)

    Büssow, Konrad; Hoffmann, Steve; Sievert, Volker

    2002-12-19

    Functional genomics involves the parallel experimentation with large sets of proteins. This requires management of large sets of open reading frames as a prerequisite of the cloning and recombinant expression of these proteins. A Java program was developed for retrieval of protein and nucleic acid sequences and annotations from NCBI GenBank, using the XML sequence format. Annotations retrieved by ORFer include sequence name, organism and also the completeness of the sequence. The program has a graphical user interface, although it can be used in a non-interactive mode. For protein sequences, the program also extracts the open reading frame sequence, if available, and checks its correct translation. ORFer accepts user input in the form of single or lists of GenBank GI identifiers or accession numbers. It can be used to extract complete sets of open reading frames and protein sequences from any kind of GenBank sequence entry, including complete genomes or chromosomes. Sequences are either stored with their features in a relational database or can be exported as text files in Fasta or tabulator delimited format. The ORFer program is freely available at http://www.proteinstrukturfabrik.de/orfer. The ORFer program allows for fast retrieval of DNA sequences, protein sequences and their open reading frames and sequence annotations from GenBank. Furthermore, storage of sequences and features in a relational database is supported. Such a database can supplement a laboratory information system (LIMS) with appropriate sequence information.

  13. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Directory of Open Access Journals (Sweden)

    Mullen Michael P

    2011-01-01

    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  14. TMC-SNPdb: an Indian germline variant database derived from whole exome sequences.

    Science.gov (United States)

    Upadhyay, Pawan; Gardi, Nilesh; Desai, Sanket; Sahoo, Bikram; Singh, Ankita; Togar, Trupti; Iyer, Prajish; Prasad, Ratnam; Chandrani, Pratik; Gupta, Sudeep; Dutt, Amit

    2016-01-01

    Cancer is predominantly a somatic disease. A mutant allele present in a cancer cell genome is considered somatic when it's absent in the paired normal genome along with public SNP databases. The current build of dbSNP, the most comprehensive public SNP database, however inadequately represents several non-European Caucasian populations, posing a limitation in cancer genomic analyses of data from these populations. We present the T: ata M: emorial C: entre-SNP D: ata B: ase (TMC-SNPdb), as the first open source, flexible, upgradable, and freely available SNP database (accessible through dbSNP build 149 and ANNOVAR)-representing 114 309 unique germline variants-generated from whole exome data of 62 normal samples derived from cancer patients of Indian origin. The TMC-SNPdb is presented with a companion subtraction tool that can be executed with command line option or using an easy-to-use graphical user interface with the ability to deplete additional Indian population specific SNPs over and above dbSNP and 1000 Genomes databases. Using an institutional generated whole exome data set of 132 samples of Indian origin, we demonstrate that TMC-SNPdb could deplete 42, 33 and 28% false positive somatic events post dbSNP depletion in Indian origin tongue, gallbladder, and cervical cancer samples, respectively. Beyond cancer somatic analyses, we anticipate utility of the TMC-SNPdb in several Mendelian germline diseases. In addition to dbSNP build 149 and ANNOVAR, the TMC-SNPdb along with the subtraction tool is available for download in the public domain at the following:Database URL: http://www.actrec.gov.in/pi-webpages/AmitDutt/TMCSNP/TMCSNPdp.html. © The Author(s) 2016. Published by Oxford University Press.

  15. Polymorphisms and resistance mutations of hepatitis C virus on sequences in the European hepatitis C virus database

    Science.gov (United States)

    Kliemann, Dimas Alexandre; Tovo, Cristiane Valle; da Veiga, Ana Beatriz Gorini; de Mattos, Angelo Alves; Wood, Charles

    2016-01-01

    AIM To evaluate the occurrence of resistant mutations in treatment-naïve hepatitis C virus (HCV) sequences deposited in the European hepatitis C virus database (euHCVdb). METHODS The sequences were downloaded from the euHCVdb (https://euhcvdb.ibcp.fr/euHCVdb/). The search was performed for full-length NS3 protease, NS5A and NS5B polymerase sequences of HCV, separated by genotypes 1a, 1b, 2a, 2b and 3a, and resulted in 798 NS3, 708 NS5A and 535 NS5B sequences from HCV genotypes 1a, 1b, 2a, 2b and 3a, after the exclusion of sequences containing errors and/or gaps or incomplete sequences, and sequences from patients previously treated with direct antiviral agents (DAA). The sequence alignment was performed with MEGA 6.06 MAC and the resulting protein sequences were then analyzed using the BioEdit 7.2.5. for mutations associated with resistance. Only positions that have been described as being associated with failure in treatment in in vivo studies, and/or as conferring a more than 2-fold change in replication in comparison to the wildtype reference strain in in vitro phenotypic assays were included in the analysis. RESULTS The Q80K variant in the NS3 gene was the most prevalent mutation, being found in 44.66% of subtype 1a and 0.25% of subtype 1b. Other frequent mutations observed in more than 2% of the NS3 sequences were: I170V (3.21%) in genotype 1a, and Y56F (15.93%), V132I (23.28%) and I170V (65.20%) in genotype 1b. For the NS5A, 2.21% of the genotype 1a sequences have the P58S mutation, 5.95% of genotype 1b sequences have the R30Q mutation, 15.79% of subtypes 2a sequences have the Q30R mutation, 23.08% of subtype 2b sequences have a L31M mutation, and in subtype 3a sequences, 23.08% have the M31L resistant variants. For the NS5B, the V321L RAV was identified in 0.60% of genotype 1a and in 0.32% of genotype 1b sequences, and the N142T variant was observed in 0.32% of subtype 1b sequences. The C316Y, S556G, D559N RAV were identified in 0.33%, 7.82% and 0.32% of

  16. Polymorphisms and resistance mutations of hepatitis C virus on sequences in the European hepatitis C virus database.

    Science.gov (United States)

    Kliemann, Dimas Alexandre; Tovo, Cristiane Valle; da Veiga, Ana Beatriz Gorini; de Mattos, Angelo Alves; Wood, Charles

    2016-10-28

    To evaluate the occurrence of resistant mutations in treatment-naïve hepatitis C virus (HCV) sequences deposited in the European hepatitis C virus database (euHCVdb). The sequences were downloaded from the euHCVdb (https://euhcvdb.ibcp.fr/euHCVdb/). The search was performed for full-length NS3 protease, NS5A and NS5B polymerase sequences of HCV, separated by genotypes 1a, 1b, 2a, 2b and 3a, and resulted in 798 NS3, 708 NS5A and 535 NS5B sequences from HCV genotypes 1a, 1b, 2a, 2b and 3a, after the exclusion of sequences containing errors and/or gaps or incomplete sequences, and sequences from patients previously treated with direct antiviral agents (DAA). The sequence alignment was performed with MEGA 6.06 MAC and the resulting protein sequences were then analyzed using the BioEdit 7.2.5. for mutations associated with resistance. Only positions that have been described as being associated with failure in treatment in in vivo studies, and/or as conferring a more than 2-fold change in replication in comparison to the wildtype reference strain in in vitro phenotypic assays were included in the analysis. The Q80K variant in the NS3 gene was the most prevalent mutation, being found in 44.66% of subtype 1a and 0.25% of subtype 1b. Other frequent mutations observed in more than 2% of the NS3 sequences were: I170V (3.21%) in genotype 1a, and Y56F (15.93%), V132I (23.28%) and I170V (65.20%) in genotype 1b. For the NS5A, 2.21% of the genotype 1a sequences have the P58S mutation, 5.95% of genotype 1b sequences have the R30Q mutation, 15.79% of subtypes 2a sequences have the Q30R mutation, 23.08% of subtype 2b sequences have a L31M mutation, and in subtype 3a sequences, 23.08% have the M31L resistant variants. For the NS5B, the V321L RAV was identified in 0.60% of genotype 1a and in 0.32% of genotype 1b sequences, and the N142T variant was observed in 0.32% of subtype 1b sequences. The C316Y, S556G, D559N RAV were identified in 0.33%, 7.82% and 0.32% of genotype 1b sequences

  17. The SWISS-PROT protein sequence data bank: current status.

    OpenAIRE

    Bairoch, A; Boeckmann, B

    1994-01-01

    SWISS-PROT is an annotated protein sequence database established in 1986 and maintained collaboratively, since 1988, by the Department of Medical Biochemistry of the University of Geneva and the EMBL Data Library. The SWISS-PROT protein sequence data bank consist of sequence entries. Sequence entries are composed of different lines types, each with their own format. For standardization purposes the format of SWISS-PROT follows as closely as possible that of the EMBL Nucleotide Sequence Databa...

  18. ChickVD: a sequence variation database for the chicken genome

    DEFF Research Database (Denmark)

    Wang, Jing; He, Ximiao; Ruan, Jue

    2005-01-01

    Working in parallel with the efforts to sequence the chicken (Gallus gallus) genome, the Beijing Genomics Institute led an international team of scientists from China, USA, UK, Sweden, The Netherlands and Germany to map extensive DNA sequence variation throughout the chicken genome by sampling DN...... on quantitative trait loci using data from collaborating institutions and public resources. Our data can be queried by search engine and homology-based BLAST searches. ChickVD is publicly accessible at http://chicken.genomics.org.cn. Udgivelsesdato: 2005-Jan-1...

  19. Performance of Correspondence Algorithms in Vision-Based Driver Assistance Using an Online Image Sequence Database

    DEFF Research Database (Denmark)

    Klette, Reinhard; Krüger, Norbert; Vaudrey, Tobi

    2011-01-01

    the classification of recorded video data into situations defined by a cooccurrence of some events in recorded traffic scenes. About 100-400 stereo frames (or 4-16 s of recording) are considered a basic sequence, which will be identified with one particular situation. Future testing is expected to be on data...

  20. Amino acid sequences of predicted proteins and their annotation for 95 organism species. - Gclust Server | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Gclust Server Amino acid sequences of predicted proteins and their annotation for 95 organis...m species. Data detail Data name Amino acid sequences of predicted proteins and their annotation for 95 orga...nism species. DOI 10.18908/lsdba.nbdc00464-001 Description of data contents Amino acid sequences of predicted proteins...Database Description Download License Update History of This Database Site Policy | Contact Us Amino acid sequences of predicted prot...eins and their annotation for 95 organism species. - Gclust Server | LSDB Archive ...

  1. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  2. Sequence Classification - TMBETA-GENOME | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ansmembrane helical proteins by applying statistical and machine learning methods to each amino acid sequenc.... Amino Acid Result of predicting β-barrel membrane protein with a statistical method using amino acid compo...sition. ( TMBETADISC-COMP ) Dipeptide Result of predicting β-barrel membrane protein with a statistic...ting β-barrel membrane protein with a statistical method using motifs. ( TMBETADISC-MOTIF ) SVM Result of pr

  3. Using the TIGR gene index databases for biological discovery.

    Science.gov (United States)

    Lee, Yuandan; Quackenbush, John

    2003-11-01

    The TIGR Gene Index web pages provide access to analyses of ESTs and gene sequences for nearly 60 species, as well as a number of resources derived from these. Each species-specific database is presented using a common format with a homepage. A variety of methods exist that allow users to search each species-specific database. Methods implemented currently include nucleotide or protein sequence queries using WU-BLAST, text-based searches using various sequence identifiers, searches by gene, tissue and library name, and searches using functional classes through Gene Ontology assignments. This protocol provides guidance for using the Gene Index Databases to extract information.

  4. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences

    OpenAIRE

    Lescot, Magali; Déhais, Patrice; Thijs, Gert; Marchal, Kathleen; Moreau, Yves; Van de Peer, Yves; Rouzé, Pierre; Rombauts, Stephane

    2002-01-01

    PlantCARE is a database of plant cis-acting regulatory elements, enhancers and repressors. Regulatory elements are represented by positional matrices, consensus sequences and individual sites on particular promoter sequences. Links to the EMBL, TRANSFAC and MEDLINE databases are provided when available. Data about the transcription sites are extracted mainly from the literature, supplemented with an increasing number of in silico predicted data. Apart from a general description for specific t...

  5. Identification of Anhydrobiosis-related Genes from an Expressed Sequence Tag Database in the Cryptobiotic Midge Polypedilum vanderplanki (Diptera; Chironomidae)*

    Science.gov (United States)

    Cornette, Richard; Kanamori, Yasushi; Watanabe, Masahiko; Nakahara, Yuichi; Gusev, Oleg; Mitsumasu, Kanako; Kadono-Okuda, Keiko; Shimomura, Michihiko; Mita, Kazuei; Kikawada, Takahiro; Okuda, Takashi

    2010-01-01

    Some organisms are able to survive the loss of almost all their body water content, entering a latent state known as anhydrobiosis. The sleeping chironomid (Polypedilum vanderplanki) lives in the semi-arid regions of Africa, and its larvae can survive desiccation in an anhydrobiotic form during the dry season. To unveil the molecular mechanisms of this resistance to desiccation, an anhydrobiosis-related Expressed Sequence Tag (EST) database was obtained from the sequences of three cDNA libraries constructed from P. vanderplanki larvae after 0, 12, and 36 h of desiccation. The database contained 15,056 ESTs distributed into 4,807 UniGene clusters. ESTs were classified according to gene ontology categories, and putative expression patterns were deduced for all clusters on the basis of the number of clones in each library; expression patterns were confirmed by real-time PCR for selected genes. Among up-regulated genes, antioxidants, late embryogenesis abundant (LEA) proteins, and heat shock proteins (Hsps) were identified as important groups for anhydrobiosis. Genes related to trehalose metabolism and various transporters were also strongly induced by desiccation. Those results suggest that the oxidative stress response plays a central role in successful anhydrobiosis. Similarly, protein denaturation and aggregation may be prevented by marked up-regulation of Hsps and the anhydrobiosis-specific LEA proteins. A third major feature is the predicted increase in trehalose synthesis and in the expression of various transporter proteins allowing the distribution of trehalose and other solutes to all tissues. PMID:20833722

  6. PROCARB: A Database of Known and Modelled Carbohydrate-Binding Protein Structures with Sequence-Based Prediction Tools

    Directory of Open Access Journals (Sweden)

    Adeel Malik

    2010-01-01

    Full Text Available Understanding of the three-dimensional structures of proteins that interact with carbohydrates covalently (glycoproteins as well as noncovalently (protein-carbohydrate complexes is essential to many biological processes and plays a significant role in normal and disease-associated functions. It is important to have a central repository of knowledge available about these protein-carbohydrate complexes as well as preprocessed data of predicted structures. This can be significantly enhanced by tools de novo which can predict carbohydrate-binding sites for proteins in the absence of structure of experimentally known binding site. PROCARB is an open-access database comprising three independently working components, namely, (i Core PROCARB module, consisting of three-dimensional structures of protein-carbohydrate complexes taken from Protein Data Bank (PDB, (ii Homology Models module, consisting of manually developed three-dimensional models of N-linked and O-linked glycoproteins of unknown three-dimensional structure, and (iii CBS-Pred prediction module, consisting of web servers to predict carbohydrate-binding sites using single sequence or server-generated PSSM. Several precomputed structural and functional properties of complexes are also included in the database for quick analysis. In particular, information about function, secondary structure, solvent accessibility, hydrogen bonds and literature reference, and so forth, is included. In addition, each protein in the database is mapped to Uniprot, Pfam, PDB, and so forth.

  7. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  8. The Danish STR sequence database: duplicate typing of 363 Danes with the ForenSeq™ DNA Signature Prep Kit.

    Science.gov (United States)

    Hussing, C; Bytyci, R; Huber, C; Morling, N; Børsting, C

    2018-05-24

    Some STR loci have internal sequence variations, which are not revealed by the standard STR typing methods used in forensic genetics (PCR and fragment length analysis by capillary electrophoresis (CE)). Typing of STRs with next-generation sequencing (NGS) uncovers the sequence variation in the repeat region and in the flanking regions. In this study, 363 Danish individuals were typed for 56 STRs (26 autosomal STRs, 24 Y-STRs, and 6 X-STRs) using the ForenSeq™ DNA Signature Prep Kit to establish a Danish STR sequence database. Increased allelic diversity was observed in 34 STRs by the PCR-NGS assay. The largest increases were found in DYS389II and D12S391, where the numbers of sequenced alleles were around four times larger than the numbers of alleles determined by repeat length alone. Thirteen SNPs and one InDel were identified in the flanking regions of 12 STRs. Furthermore, 36 single positions and five longer stretches in the STR flanking regions were found to have dubious genotyping quality. The combined match probability of the 26 autosomal STRs was 10,000 times larger using the PCR-NGS assay than by using PCR-CE. The typical paternity indices for trios and duos were 500 and 100 times larger, respectively, than those obtained with PCR-CE. The assay also amplified 94 SNPs selected for human identification. Eleven of these loci were not in Hardy-Weinberg equilibrium in the Danish population, most likely because the minimum threshold for allele calling (30 reads) in the ForenSeq™ Universal Analysis Software was too low and frequent allele dropouts were not detected.

  9. Translational database selection and multiplexed sequence capture for up front filtering of reliable breast cancer biomarker candidates.

    Directory of Open Access Journals (Sweden)

    Patrik L Ståhl

    Full Text Available Biomarker identification is of utmost importance for the development of novel diagnostics and therapeutics. Here we make use of a translational database selection strategy, utilizing data from the Human Protein Atlas (HPA on differentially expressed protein patterns in healthy and breast cancer tissues as a means to filter out potential biomarkers for underlying genetic causatives of the disease. DNA was isolated from ten breast cancer biopsies, and the protein coding and flanking non-coding genomic regions corresponding to the selected proteins were extracted in a multiplexed format from the samples using a single DNA sequence capture array. Deep sequencing revealed an even enrichment of the multiplexed samples and a great variation of genetic alterations in the tumors of the sampled individuals. Benefiting from the upstream filtering method, the final set of biomarker candidates could be completely verified through bidirectional Sanger sequencing, revealing a 40 percent false positive rate despite high read coverage. Of the variants encountered in translated regions, nine novel non-synonymous variations were identified and verified, two of which were present in more than one of the ten tumor samples.

  10. Practical Value of Food Pathogen Traceability through Building a Whole-Genome Sequencing Network and Database.

    Science.gov (United States)

    Allard, Marc W; Strain, Errol; Melka, David; Bunning, Kelly; Musser, Steven M; Brown, Eric W; Timme, Ruth

    2016-08-01

    The FDA has created a United States-based open-source whole-genome sequencing network of state, federal, international, and commercial partners. The GenomeTrakr network represents a first-of-its-kind distributed genomic food shield for characterizing and tracing foodborne outbreak pathogens back to their sources. The GenomeTrakr network is leading investigations of outbreaks of foodborne illnesses and compliance actions with more accurate and rapid recalls of contaminated foods as well as more effective monitoring of preventive controls for food manufacturing environments. An expanded network would serve to provide an international rapid surveillance system for pathogen traceback, which is critical to support an effective public health response to bacterial outbreaks. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  11. HIV Sequence Compendium 2015

    Energy Technology Data Exchange (ETDEWEB)

    Foley, Brian Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas Kenneth [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Cristian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Pennsylvania, Philadelphia, PA (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette Tina Marie [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2015-10-05

    This compendium is an annual printed summary of the data contained in the HIV sequence database. We try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2015. Hence, though it is published in 2015 and called the 2015 Compendium, its contents correspond to the 2014 curated alignments on our website. The number of sequences in the HIV database is still increasing. In total, at the end of 2014, there were 624,121 sequences in the HIV Sequence Database, an increase of 7% since the previous year. This is the first year that the number of new sequences added to the database has decreased compared to the previous year. The number of near complete genomes (>7000 nucleotides) increased to 5834 by end of 2014. However, as in previous years, the compendium alignments contain only a fraction of these. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/ content/sequence/NEWALIGN/align.html As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  12. CAZymes Analysis Toolkit (CAT): web service for searching and analyzing carbohydrate-active enzymes in a newly sequenced organism using CAZy database.

    Science.gov (United States)

    Park, Byung H; Karpinets, Tatiana V; Syed, Mustafa H; Leuze, Michael R; Uberbacher, Edward C

    2010-12-01

    The Carbohydrate-Active Enzyme (CAZy) database provides a rich set of manually annotated enzymes that degrade, modify, or create glycosidic bonds. Despite rich and invaluable information stored in the database, software tools utilizing this information for annotation of newly sequenced genomes by CAZy families are limited. We have employed two annotation approaches to fill the gap between manually curated high-quality protein sequences collected in the CAZy database and the growing number of other protein sequences produced by genome or metagenome sequencing projects. The first approach is based on a similarity search against the entire nonredundant sequences of the CAZy database. The second approach performs annotation using links or correspondences between the CAZy families and protein family domains. The links were discovered using the association rule learning algorithm applied to sequences from the CAZy database. The approaches complement each other and in combination achieved high specificity and sensitivity when cross-evaluated with the manually curated genomes of Clostridium thermocellum ATCC 27405 and Saccharophagus degradans 2-40. The capability of the proposed framework to predict the function of unknown protein domains and of hypothetical proteins in the genome of Neurospora crassa is demonstrated. The framework is implemented as a Web service, the CAZymes Analysis Toolkit, and is available at http://cricket.ornl.gov/cgi-bin/cat.cgi.

  13. Characterization and compilation of polymorphic simple sequence repeat (SSR markers of peanut from public database

    Directory of Open Access Journals (Sweden)

    Zhao Yongli

    2012-07-01

    Full Text Available Abstract Background There are several reports describing thousands of SSR markers in the peanut (Arachis hypogaea L. genome. There is a need to integrate various research reports of peanut DNA polymorphism into a single platform. Further, because of lack of uniformity in the labeling of these markers across the publications, there is some confusion on the identities of many markers. We describe below an effort to develop a central comprehensive database of polymorphic SSR markers in peanut. Findings We compiled 1,343 SSR markers as detecting polymorphism (14.5% within a total of 9,274 markers. Amongst all polymorphic SSRs examined, we found that AG motif (36.5% was the most abundant followed by AAG (12.1%, AAT (10.9%, and AT (10.3%.The mean length of SSR repeats in dinucleotide SSRs was significantly longer than that in trinucleotide SSRs. Dinucleotide SSRs showed higher polymorphism frequency for genomic SSRs when compared to trinucleotide SSRs, while for EST-SSRs, the frequency of polymorphic SSRs was higher in trinucleotide SSRs than in dinucleotide SSRs. The correlation of the length of SSR and the frequency of polymorphism revealed that the frequency of polymorphism was decreased as motif repeat number increased. Conclusions The assembled polymorphic SSRs would enhance the density of the existing genetic maps of peanut, which could also be a useful source of DNA markers suitable for high-throughput QTL mapping and marker-assisted selection in peanut improvement and thus would be of value to breeders.

  14. Nucleotide sequences of the cDNAs encoding the V-regions of H- and L-chains of a human monoclonal antibody with broad reactivity to malignant tumor cells

    Energy Technology Data Exchange (ETDEWEB)

    Kishimoto, Toshimitsu; Okajima, Hideki; Okumoto, Takeki [Yoshitomi Pharmaceutical Industries, Ltd., Saitama (Japan); Taniguchi, Masaru [Chiba Univ. (Japan)

    1989-06-12

    The human monoclonal antibody secreted from 4G12 hybridoma cells has broad reactivity to malignant tumor cells, especially for lung squamous cell carcinomas, and recognizes a new tumor-associated and differentiation antigen. The antigen detected by 4G12 is a glycoprotein with MW 195,000 and MW 65,000 under nonreducing and reducing conditions, respectively. Screening of a 4G12 {lambda}gt10 cDNA library with constant region probes for human immunoglobulin yielded full length clones for H- and L-chains. Nucleotide sequences revealed that subtypes of the variable regions were V{sub HIII} and {lambda}{sub 1}, respectively.

  15. The PAZAR database of gene regulatory information coupled to the ORCA toolkit for the study of regulatory sequences

    Science.gov (United States)

    Portales-Casamar, Elodie; Arenillas, David; Lim, Jonathan; Swanson, Magdalena I.; Jiang, Steven; McCallum, Anthony; Kirov, Stefan; Wasserman, Wyeth W.

    2009-01-01

    The PAZAR database unites independently created and maintained data collections of transcription factor and regulatory sequence annotation. The flexible PAZAR schema permits the representation of diverse information derived from experiments ranging from biochemical protein–DNA binding to cellular reporter gene assays. Data collections can be made available to the public, or restricted to specific system users. The data ‘boutiques’ within the shopping-mall-inspired system facilitate the analysis of genomics data and the creation of predictive models of gene regulation. Since its initial release, PAZAR has grown in terms of data, features and through the addition of an associated package of software tools called the ORCA toolkit (ORCAtk). ORCAtk allows users to rapidly develop analyses based on the information stored in the PAZAR system. PAZAR is available at http://www.pazar.info. ORCAtk can be accessed through convenient buttons located in the PAZAR pages or via our website at http://www.cisreg.ca/ORCAtk. PMID:18971253

  16. Functional role of bacteriophage transfer RNAs: codon usage analysis of genomic sequences stored in the GENBANK/EMBL/DDBJ databases

    Directory of Open Access Journals (Sweden)

    T Kunisawa

    2006-01-01

    Full Text Available Complete genomic sequence data are stored in the public GenBank/EMBL/DDBJ databases so that any investigator can make use of the data. This report describes a comparative analysis of codon usage that is impossible without such a public and open data system. A limited number of bacteriophages harbor their own transfer RNAs. Based on a comparison between T4 phage-encoded tRNA species and the relative cellular amounts of host Escherichia coli tRNAs, it is hypothesized that T4 tRNAs could serve to supplement host isoacceptor tRNA species that are present in minor amounts and thus enhance the translational efficiency of phage proteins. When compared to their respective host bacteria, the codon usage data of bacteriophages D3, φC31, HP1, D29 and 933W all show an increased frequency of synonymous codons or amino acids that correspond to phage tRNA species, suggesting their supplemental role in the efficient production of phage proteins. The data-analysis presents an example in which the availability of an open and fully accessible database system would allow one to obtain comprehensive insights into a fundamental problem in molecular biology.

  17. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  18. Identification and Removal of Contaminant Sequences From Ribosomal Gene Databases: Lessons From the Census of Deep Life.

    Science.gov (United States)

    Sheik, Cody S; Reese, Brandi Kiel; Twing, Katrina I; Sylvan, Jason B; Grim, Sharon L; Schrenk, Matthew O; Sogin, Mitchell L; Colwell, Frederick S

    2018-01-01

    Earth's subsurface environment is one of the largest, yet least studied, biomes on Earth, and many questions remain regarding what microorganisms are indigenous to the subsurface. Through the activity of the Census of Deep Life (CoDL) and the Deep Carbon Observatory, an open access 16S ribosomal RNA gene sequence database from diverse subsurface environments has been compiled. However, due to low quantities of biomass in the deep subsurface, the potential for incorporation of contaminants from reagents used during sample collection, processing, and/or sequencing is high. Thus, to understand the ecology of subsurface microorganisms (i.e., the distribution, richness, or survival), it is necessary to minimize, identify, and remove contaminant sequences that will skew the relative abundances of all taxa in the sample. In this meta-analysis, we identify putative contaminants associated with the CoDL dataset, recommend best practices for removing contaminants from samples, and propose a series of best practices for subsurface microbiology sampling. The most abundant putative contaminant genera observed, independent of evenness across samples, were Propionibacterium , Aquabacterium , Ralstonia , and Acinetobacter . While the top five most frequently observed genera were Pseudomonas , Propionibacterium , Acinetobacter , Ralstonia , and Sphingomonas . The majority of the most frequently observed genera (high evenness) were associated with reagent or potential human contamination. Additionally, in DNA extraction blanks, we observed potential archaeal contaminants, including methanogens, which have not been discussed in previous contamination studies. Such contaminants would directly affect the interpretation of subsurface molecular studies, as methanogenesis is an important subsurface biogeochemical process. Utilizing previously identified contaminant genera, we found that ∼27% of the total dataset were identified as contaminant sequences that likely originate from DNA

  19. Unlimited Thirst for Genome Sequencing, Data Interpretation, and Database Usage in Genomic Era: The Road towards Fast-Track Crop Plant Improvement

    Directory of Open Access Journals (Sweden)

    Arun Prabhu Dhanapal

    2015-01-01

    Full Text Available The number of sequenced crop genomes and associated genomic resources is growing rapidly with the advent of inexpensive next generation sequencing methods. Databases have become an integral part of all aspects of science research, including basic and applied plant and animal sciences. The importance of databases keeps increasing as the volume of datasets from direct and indirect genomics, as well as other omics approaches, keeps expanding in recent years. The databases and associated web portals provide at a minimum a uniform set of tools and automated analysis across a wide range of crop plant genomes. This paper reviews some basic terms and considerations in dealing with crop plant databases utilization in advancing genomic era. The utilization of databases for variation analysis with other comparative genomics tools, and data interpretation platforms are well described. The major focus of this review is to provide knowledge on platforms and databases for genome-based investigations of agriculturally important crop plants. The utilization of these databases in applied crop improvement program is still being achieved widely; otherwise, the end for sequencing is not far away.

  20. MerCat: a versatile k-mer counter and diversity estimator for database-independent property analysis obtained from metagenomic and/or metatranscriptomic sequencing data

    Energy Technology Data Exchange (ETDEWEB)

    White, Richard A.; Panyala, Ajay R.; Glass, Kevin A.; Colby, Sean M.; Glaesemann, Kurt R.; Jansson, Georg C.; Jansson, Janet K.

    2017-02-21

    MerCat is a parallel, highly scalable and modular property software package for robust analysis of features in next-generation sequencing data. MerCat inputs include assembled contigs and raw sequence reads from any platform resulting in feature abundance counts tables. MerCat allows for direct analysis of data properties without reference sequence database dependency commonly used by search tools such as BLAST and/or DIAMOND for compositional analysis of whole community shotgun sequencing (e.g. metagenomes and metatranscriptomes).

  1. Partial nucleotide sequences, and routine typing by polymerase chain reaction-restriction fragment length polymorphism, of the brown trout (Salmo trutta) lactate dehydrogenase, LDH-C1*90 and *100 alleles.

    Science.gov (United States)

    McMeel, O M; Hoey, E M; Ferguson, A

    2001-01-01

    The cDNA nucleotide sequences of the lactate dehydrogenase alleles LDH-C1*90 and *100 of brown trout (Salmo trutta) were found to differ at position 308 where an A is present in the *100 allele but a G is present in the *90 allele. This base substitution results in an amino acid change from aspartic acid at position 82 in the LDH-C1 100 allozyme to a glycine in the 90 allozyme. Since aspartic acid has a net negative charge whilst glycine is uncharged, this is consistent with the electrophoretic observation that the LDH-C1 100 allozyme has a more anodal mobility relative to the LDH-C1 90 allozyme. Based on alignment of the cDNA sequence with the mouse genomic sequence, a local primer set was designed, incorporating the variable position, and was found to give very good amplification with brown trout genomic DNA. Sequencing of this fragment confirmed the difference in both homozygous and heterozygous individuals. Digestion of the polymerase chain reaction products with BslI, a restriction enzyme specific for the site difference, gave one, two and three fragments for the two homozygotes and the heterozygote, respectively, following electrophoretic separation. This provides a DNA-based means of routine screening of the highly informative LDH-C1* polymorphism in brown trout population genetic studies. Primer sets presented could be used to sequence cDNA of other LDH* genes of brown trout and other species.

  2. A 19-nucleotide insertion in the leader sequence of avian leukosis virus subgroup J contributes to its replication in vitro but is not related to its pathogenicity in vivo.

    Directory of Open Access Journals (Sweden)

    Xiaolin Ji

    Full Text Available Subgroup J avian leukosis virus (ALV-J was first isolated from meat-type chickens that had developed myeloid leukosis and since 2008, ALV-J infections in chickens have become widespread in China. A comparison of the sequence of ALV-J epidemic isolates with HPRS-103, the ALV-J prototype virus, revealed several distinct features, one of which is a 19-nucleotide (nt insertion in the leader sequence. To determine the role of the 19-nt insertion in ALV-J pathogenicity, a pair of viruses were constructed and rescued. The first virus was an ALV-J Chinese isolate (designated rSD1009 containing the 19-nt insertion in its leader sequence. The second virus was a clone, in which the leader sequence had a deleted 19-nt sequence (designated rSD1009△19. Compared with rSD1009△19, rSD1009 displayed a moderate growth advantage in vitro. However, no differences were demonstrated in either viral replication or oncogenicity between the two rescued viruses in chickens. These results indicated that the 19-nt insertion contributed to ALV-J replication in vitro but was not related to its pathogenicity in vivo.

  3. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  4. PineElm_SSRdb: a microsatellite marker database identified from genomic, chloroplast, mitochondrial and EST sequences of pineapple (Ananas comosus (L.) Merrill).

    Science.gov (United States)

    Chaudhary, Sakshi; Mishra, Bharat Kumar; Vivek, Thiruvettai; Magadum, Santoshkumar; Yasin, Jeshima Khan

    2016-01-01

    Simple Sequence Repeats or microsatellites are resourceful molecular genetic markers. There are only few reports of SSR identification and development in pineapple. Complete genome sequence of pineapple available in the public domain can be used to develop numerous novel SSRs. Therefore, an attempt was made to identify SSRs from genomic, chloroplast, mitochondrial and EST sequences of pineapple which will help in deciphering genetic makeup of its germplasm resources. A total of 359511 SSRs were identified in pineapple (356385 from genome sequence, 45 from chloroplast sequence, 249 in mitochondrial sequence and 2832 from EST sequences). The list of EST-SSR markers and their details are available in the database. PineElm_SSRdb is an open source database available for non-commercial academic purpose at http://app.bioelm.com/ with a mapping tool which can develop circular maps of selected marker set. This database will be of immense use to breeders, researchers and graduates working on Ananas spp. and to others working on cross-species transferability of markers, investigating diversity, mapping and DNA fingerprinting.

  5. BIOSPIDA: A Relational Database Translator for NCBI.

    Science.gov (United States)

    Hagen, Matthew S; Lee, Eva K

    2010-11-13

    As the volume and availability of biological databases continue widespread growth, it has become increasingly difficult for research scientists to identify all relevant information for biological entities of interest. Details of nucleotide sequences, gene expression, molecular interactions, and three-dimensional structures are maintained across many different databases. To retrieve all necessary information requires an integrated system that can query multiple databases with minimized overhead. This paper introduces a universal parser and relational schema translator that can be utilized for all NCBI databases in Abstract Syntax Notation (ASN.1). The data models for OMIM, Entrez-Gene, Pubmed, MMDB and GenBank have been successfully converted into relational databases and all are easily linkable helping to answer complex biological questions. These tools facilitate research scientists to locally integrate databases from NCBI without significant workload or development time.

  6. Peptide and nucleotide sequences of rat CD4 (W3/25) antigen: evidence for derivation from a structure with four immunoglobulin-related domains

    International Nuclear Information System (INIS)

    Clark, S.J.; Jefferies, W.A.; Barclay, A.N.; Gagnon, J.; Williams, A.F.

    1987-01-01

    The rat W3/25 antigen was the first marker antigen of helper T lymphocytes to be identified. Subsequently, the human OKT4 antigen (now called CD4) was described, and cell distribution and functional data suggested that W3/25 and OKT4 antigens were homologous. This is now confirmed by the matching of peptide sequences from W3/25 antigen with sequence predicted from rat cDNA clones detected by cross-hybridization with a cDNA probe for human CD4. Analysis of the two sequences suggests an evolutionary origin from a structure with four immunoglobulin-related domains, although only domain 1 at the NH 2 terminus meets the standard criteria for an immunoglobulin-related sequence. CD4 domains 2 and 4 contain disulfide bonds but seem like truncated immunoglobulin domains, whereas domain 3 may have a pattern of β-strands like an immunoglobulin variable domain, but without the disulfide bond

  7. Genetic diversity of the captive Asian tapir population in Thailand, based on mitochondrial control region sequence data and the comparison of its nucleotide structure with Brazilian tapir.

    Science.gov (United States)

    Muangkram, Yuttamol; Amano, Akira; Wajjwalku, Worawidh; Pinyopummintr, Tanu; Thongtip, Nikorn; Kaolim, Nongnid; Sukmak, Manakorn; Kamolnorranath, Sumate; Siriaroonrat, Boripat; Tipkantha, Wanlaya; Maikaew, Umaporn; Thomas, Warisara; Polsrila, Kanda; Dongsaard, Kwanreaun; Sanannu, Saowaphang; Wattananorrasate, Anuwat

    2017-07-01

    The Asian tapir (Tapirus indicus) has been classified as Endangered on the IUCN Red List of Threatened Species (2008). Genetic diversity data provide important information for the management of captive breeding and conservation of this species. We analyzed mitochondrial control region (CR) sequences from 37 captive Asian tapirs in Thailand. Multiple alignments of the full-length CR sequences sized 1268 bp comprised three domains as described in other mammal species. Analysis of 16 parsimony-informative variable sites revealed 11 haplotypes. Furthermore, the phylogenetic analysis using median-joining network clearly showed three clades correlated with our earlier cytochrome b gene study in this endangered species. The repetitive motif is located between first and second conserved sequence blocks, similar to the Brazilian tapir. The highest polymorphic site was located in the extended termination associated sequences domain. The results could be applied for future genetic management based in captivity and wild that shows stable populations.

  8. MPID-T2: a database for sequence-structure-function analyses of pMHC and TR/pMHC structures.

    Science.gov (United States)

    Khan, Javed Mohammed; Cheruku, Harish Reddy; Tong, Joo Chuan; Ranganathan, Shoba

    2011-04-15

    Sequence-structure-function information is critical in understanding the mechanism of pMHC and TR/pMHC binding and recognition. A database for sequence-structure-function information on pMHC and TR/pMHC interactions, MHC-Peptide Interaction Database-TR version 2 (MPID-T2), is now available augmented with the latest PDB and IMGT/3Dstructure-DB data, advanced features and new parameters for the analysis of pMHC and TR/pMHC structures. http://biolinfo.org/mpid-t2. shoba.ranganathan@mq.edu.au Supplementary data are available at Bioinformatics online.

  9. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  10. Targeted genomic enrichment and sequencing of CyHV-3 from carp tissues confirms low nucleotide diversity and mixed genotype infections

    Directory of Open Access Journals (Sweden)

    Saliha Hammoumi

    2016-09-01

    Full Text Available Koi herpesvirus disease (KHVD is an emerging disease that causes mass mortality in koi and common carp, Cyprinus carpio L. Its causative agent is Cyprinid herpesvirus 3 (CyHV-3, also known as koi herpesvirus (KHV. Although data on the pathogenesis of this deadly virus is relatively abundant in the literature, still little is known about its genomic diversity and about the molecular mechanisms that lead to such a high virulence. In this context, we developed a new strategy for sequencing full-length CyHV-3 genomes directly from infected fish tissues. Total genomic DNA extracted from carp gill tissue was specifically enriched with CyHV-3 sequences through hybridization to a set of nearly 2 million overlapping probes designed to cover the entire genome length, using KHV-J sequence (GenBank accession number AP008984 as reference. Applied to 7 CyHV-3 specimens from Poland and Indonesia, this targeted genomic enrichment enabled recovery of the full genomes with >99.9% reference coverage. The enrichment rate was directly correlated to the estimated number of viral copies contained in the DNA extracts used for library preparation, which varied between ∼5000 and ∼2×107. The average sequencing depth was >200 for all samples, thus allowing the search for variants with high confidence. Sequence analyses highlighted a significant proportion of intra-specimen sequence heterogeneity, suggesting the presence of mixed infections in all investigated fish. They also showed that inter-specimen genetic diversity at the genome scale was very low (>99.95% of sequence identity. By enabling full genome comparisons directly from infected fish tissues, this new method will be valuable to trace outbreaks rapidly and at a reasonable cost, and in turn to understand the transmission routes of CyHV-3.

  11. The master two-dimensional gel database of human AMA cell proteins: towards linking protein and genome sequence and mapping information (update 1991)

    DEFF Research Database (Denmark)

    Celis, J E; Leffers, H; Rasmussen, H H

    1991-01-01

    autoantigens" and "cDNAs". For convenience we have included an alphabetical list of all known proteins recorded in this database. In the long run, the main goal of this database is to link protein and DNA sequencing and mapping information (Human Genome Program) and to provide an integrated picture......The master two-dimensional gel database of human AMA cells currently lists 3801 cellular and secreted proteins, of which 371 cellular polypeptides (306 IEF; 65 NEPHGE) were added to the master images during the last 10 months. These include: (i) very basic and acidic proteins that do not focus...

  12. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    International Nuclear Information System (INIS)

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

    1988-01-01

    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  13. Complete nucleotide sequence and organization of the mitogenome of the silk moth Caligula boisduvalii (Lepidoptera: Saturniidae) and comparison with other lepidopteran insects.

    Science.gov (United States)

    Hong, Mee Yeon; Lee, Eun Mee; Jo, Yong Hun; Park, Hae Chul; Kim, Seong Ryul; Hwang, Jae Sam; Jin, Byung Rae; Kang, Pil Don; Kim, Ki-Gyoung; Han, Yeon Soo; Kim, Iksoo

    2008-04-30

    The 15,360-bp long complete mitogenome of Caligula boisduvalii possesses a gene arrangement and content identical to other completely sequenced lepidopteran mitogenomes, but different from the common arrangement found in most insect order, as the result of the movement of tRNA(Met) to a position 5'-upstream of tRNA Ile. The 330-bp A+T-rich region is apparently capable of forming a stem-and-loop structure, which harbors the conserved flanking sequences at both ends. Dissimilar to what has been seen in other sequenced lepidopteran insects, the initiation codon for C. boisduvalii COI appears to be TTG, which is a rare, but apparently possible initiation codon. The ATP8, ATP6, ND4L, and ND6 genes, which neighbor another PCG at their 3' end, all harbored potential sequences for the formation of a hairpin structure. This is suggestive of the importance of such structures for the precise cleavage of the mRNA of mature PCGs. Phylogenetic analyses of available sequenced species of Bombycoidea, Pyraloidea, and Tortricidea supported the morphology-based current hypothesis that Bombycoidea and Pyraloidea are monophyletic (Obtectomera). As previously suggested, Bombycidae (Bombyx mori and B. mandarina) and Saturniidae (Antheraea pernyi and C. boisduvalii) formed a reciprocal monophyletic group.

  14. The soybean-Phytophthora resistance locus Rps1-k encompasses coiled coil-nucleotide binding-leucine rich repeat-like genes and repetitive sequences

    Directory of Open Access Journals (Sweden)

    Bhattacharyya Madan K

    2008-03-01

    Full Text Available Abstract Background A series of Rps (resistance to Pytophthora sojae genes have been protecting soybean from the root and stem rot disease caused by the Oomycete pathogen, Phytophthora sojae. Five Rps genes were mapped to the Rps1 locus located near the 28 cM map position on molecular linkage group N of the composite genetic soybean map. Among these five genes, Rps1-k was introgressed from the cultivar, Kingwa. Rps1-k has been providing stable and broad-spectrum Phytophthora resistance in the major soybean-producing regions of the United States. Rps1-k has been mapped and isolated. More than one functional Rps1-k gene was identified from the Rps1-k locus. The clustering feature at the Rps1-k locus might have facilitated the expansion of Rps1-k gene numbers and the generation of new recognition specificities. The Rps1-k region was sequenced to understand the possible evolutionary steps that shaped the generation of Phytophthora resistance genes in soybean. Results Here the analyses of sequences of three overlapping BAC clones containing the 184,111 bp Rps1-k region are reported. A shotgun sequencing strategy was applied in sequencing the BAC contig. Sequence analysis predicted a few full-length genes including two Rps1-k genes, Rps1-k-1 and Rps1-k-2. Previously reported Rps1-k-3 from this genomic region 1 was evolved through intramolecular recombination between Rps1-k-1 and Rps1-k-2 in Escherichia coli. The majority of the predicted genes are truncated and therefore most likely they are nonfunctional. A member of a highly abundant retroelement, SIRE1, was identified from the Rps1-k region. The Rps1-k region is primarily composed of repetitive sequences. Sixteen simple repeat and 63 tandem repeat sequences were identified from the locus. Conclusion These data indicate that the Rps1 locus is located in a gene-poor region. The abundance of repetitive sequences in the Rps1-k region suggested that the location of this locus is in or near a

  15. Using Markov chains of nucleotide sequences as a possible precursor to predict functional roles of human genome: a case study on inactive chromatin regions.

    Science.gov (United States)

    Lee, K-E; Lee, E-J; Park, H-S

    2016-08-30

    Recent advances in computational epigenetics have provided new opportunities to evaluate n-gram probabilistic language models. In this paper, we describe a systematic genome-wide approach for predicting functional roles in inactive chromatin regions by using a sequence-based Markovian chromatin map of the human genome. We demonstrate that Markov chains of sequences can be used as a precursor to predict functional roles in heterochromatin regions and provide an example comparing two publicly available chromatin annotations of large-scale epigenomics projects: ENCODE project consortium and Roadmap Epigenomics consortium.

  16. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    NARCIS (Netherlands)

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.; Elsas, van J.D.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily

  17. Length and nucleotide sequence polymorphism at the trnL and trnF non-coding regions of chloroplast genomes among Saccharum and Erianthus species

    Science.gov (United States)

    The aneupolyploidy genome of sugarcane (Saccharum hybrids spp.) and lack of a classical genetic linkage map make genetics research most difficult for sugarcane. Whole genome sequencing and genetic characterization of sugarcane and related taxa are far behind other crops. In this study, universal PCR...

  18. NUCLEOTIDE SEQUENCING AND TRANSCRIPTIONAL MAPPING OF THE GENES ENCODING BIPHENYL DIOXYGENASE, A MULTICOM- PONENT POLYCHLORINATED-BIPHENYL-DEGRADING ENZYME IN PSEUDOMONAS STRAIN LB400

    Science.gov (United States)

    The DNA region encoding biphenyl dioxygenase, the first enzyme in the biphenyl-polychlorinated biphenyl degradation pathway of Pseudomonas species strain LB400, was sequenced. Six open reading frames were identified, four of which are homologous to the components of toluene dioxy...

  19. CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

    Science.gov (United States)

    Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

  20. Population genetic structure in farm and feral American mink (Neovison vison) inferred from RAD sequencing-generated single nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Thirstrup, Janne Pia; Ruiz-Gonzalez, Aritz; Pujolar, José Martin

    2015-01-01

    Feral American mink populations (Neovison vison), derived from mink farms, are widespread in Europe. In this study we investigated genetic diversity and genetic differentiation between feral and farm mink using a panel of genetic markers (194 SNP) generated from RAD sequencing data. Sampling incl...

  1. Nucleotide sequence and phylogeny of the tet (L) tetracycline resistance determinant encoded by the plasmid pSTE1 from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Schwarz, S.; Cardoso, M.; Wegener, Henrik Caspar

    1992-01-01

    O from Streptococcus mutans were performed. An alignment of Tet amino acid sequence revealed the presence of 30 conserved amino acids among these Tet variants. On the basis of the alignment, a phylogenetic tree was constructed. It demonstrated large evolutionary distances between the Tet M and Tet O...

  2. AcEST(EST sequences of Adiantum capillus-veneris and their annotation) - AcEST | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us AcEST AcEST(EST sequences of Adiantum capillus-veneris and their annotation) Data detail Dat...a name AcEST(EST sequences of Adiantum capillus-veneris and their annotation) DOI 10.18908/lsdba.nbdc00839-0...01 Description of data contents EST sequence of Adiantum capillus-veneris and its annotation (clone ID, libr...le search URL http://togodb.biosciencedbc.jp/togodb/view/archive_acest#en Data acquisition method Capillary ...ainst UniProtKB/Swiss-Prot and UniProtKB/TrEMBL databases) Number of data entries Adiantum capillus-veneris

  3. Exploring the correlation between the sequence composition of the nucleotide binding G5 loop of the FeoB GTPase domain (NFeoB) and intrinsic rate of GDP release.

    Science.gov (United States)

    Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika

    2014-12-12

    GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.

  4. The complete nucleotide sequence and environmental distribution of the cryptic, conjugative, broad-host-range plasmid pIPO2 islated from bacteria of the wheat rhizosphere

    OpenAIRE

    Tauch, A.; Schneiker, S.; Selbitschka, W.; PÜhler, A.; Overbeek, van, L.S.; Smalla, K.; Thomas, C.M.; Bailey, M.J.; Forney, L.J.; Weightman, A.; Ceglowski, P.; Pembroke, T.; Tietze, E.; Schröder, G.; Lanka, E.

    2002-01-01

    The flood of sequence data resulting from the large number of current genome projects has increased the need for a flexible, open source genome annotation system, which so far has not existed. To account for the individual needs of different projects, such a system should be modular and easily extensible. We present a genome annotation system for prokaryote genomes, which is well tested and readily adaptable to different tasks. The modular system was developed using an object-oriented approac...

  5. Complete nucleotide sequence of Sida golden mosaic Florida virus and phylogenetic relationships with other begomoviruses infecting malvaceous weeds in the Caribbean.

    Science.gov (United States)

    Fiallo-Olivé, Elvira; Martínez-Zubiaur, Yamila; Moriones, Enrique; Navas-Castillo, Jesús

    2010-09-01

    The complete genome sequence of two isolates of the bipartite begomovirus (genus Begomovirus, family Geminiviridae) Sida golden mosaic Florida virus (SiGMFV) is presented. We propose that both isolates, found infecting Malvastrum coromandelianum (family Malvaceae) in Cuba, belong to a new strain of SiGMFV. Phylogenetic analysis showed that SiGMFV DNA-A is located in a monophyletic cluster that includes begomoviruses infecting malvaceous weeds from the Caribbean.

  6. Analysis of complete nucleotide sequences of Angolan hepatitis B virus isolates reveals the existence of a separate lineage within genotype E.

    Directory of Open Access Journals (Sweden)

    Barbara V Lago

    Full Text Available Hepatitis B virus genotype E (HBV/E is highly prevalent in Western Africa. In this work, 30 HBV/E isolates from HBsAg positive Angolans (staff and visitors of a private hospital in Luanda were genetically characterized: 16 of them were completely sequenced and the pre-S/S sequences of the remaining 14 were determined. A high proportion (12/30, 40% of subjects tested positive for both HBsAg and anti-HBs markers. Deduced amino acid sequences revealed the existence of specific substitutions and deletions in the B- and T-cell epitopes of the surface antigen (pre-S1- and pre-S2 regions of the virus isolates derived from 8/12 individuals with concurrent HBsAg/anti-HBs. Phylogenetic analysis performed with 231 HBV/E full-length sequences, including 16 from this study, showed that all isolates from Angola, Namibia and the Democratic Republic of Congo (n = 28 clustered in a separate lineage, divergent from the HBV/E isolates from nine other African countries, namely Cameroon, Central African Republic, Côte d'Ivoire, Ghana, Guinea, Madagascar, Niger, Nigeria and Sudan, with a Bayesian posterior probability of 1. Five specific mutations, namely small S protein T57I, polymerase Q177H, G245W and M612L, and X protein V30L, were observed in 79-96% of the isolates of the separate lineage, compared to a frequency of 0-12% among the other HBV/E African isolates.

  7. A curated gluten protein sequence database to support development of proteomics methods for determination of gluten in gluten-free foods.

    Science.gov (United States)

    Bromilow, Sophie; Gethings, Lee A; Buckley, Mike; Bromley, Mike; Shewry, Peter R; Langridge, James I; Clare Mills, E N

    2017-06-23

    The unique physiochemical properties of wheat gluten enable a diverse range of food products to be manufactured. However, gluten triggers coeliac disease, a condition which is treated using a gluten-free diet. Analytical methods are required to confirm if foods are gluten-free, but current immunoassay-based methods can unreliable and proteomic methods offer an alternative but require comprehensive and well annotated sequence databases which are lacking for gluten. A manually a curated database (GluPro V1.0) of gluten proteins, comprising 630 discrete unique full length protein sequences has been compiled. It is representative of the different types of gliadin and glutenin components found in gluten. An in silico comparison of their coeliac toxicity was undertaken by analysing the distribution of coeliac toxic motifs. This demonstrated that whilst the α-gliadin proteins contained more toxic motifs, these were distributed across all gluten protein sub-types. Comparison of annotations observed using a discovery proteomics dataset acquired using ion mobility MS/MS showed that more reliable identifications were obtained using the GluPro V1.0 database compared to the complete reviewed Viridiplantae database. This highlights the value of a curated sequence database specifically designed to support the proteomic workflows and the development of methods to detect and quantify gluten. We have constructed the first manually curated open-source wheat gluten protein sequence database (GluPro V1.0) in a FASTA format to support the application of proteomic methods for gluten protein detection and quantification. We have also analysed the manually verified sequences to give the first comprehensive overview of the distribution of sequences able to elicit a reaction in coeliac disease, the prevalent form of gluten intolerance. Provision of this database will improve the reliability of gluten protein identification by proteomic analysis, and aid the development of targeted mass

  8. Maximum likelihood and Bayesian analyses of a combined nucleotide sequence dataset for genetic characterization of a novel pestivirus, SVA/cont-08.

    Science.gov (United States)

    Liu, Lihong; Xia, Hongyan; Baule, Claudia; Belák, Sándor

    2009-01-01

    Bovine viral diarrhoea virus 1 (BVDV-1) and Bovine viral diarrhoea virus 2 (BVDV-2) are two recognised bovine pestivirus species of the genus Pestivirus. Recently, a pestivirus, termed SVA/cont-08, was detected in a batch of contaminated foetal calf serum originating from South America. Comparative sequence analysis showed that the SVA/cont-08 virus shares 15-28% higher sequence identity to pestivirus D32/00_'HoBi' than to members of BVDV-1 and BVDV-2. In order to reveal the phylogenetic relationship of SVA/cont-08 with other pestiviruses, a molecular dataset of 30 pestiviruses and 1,896 characters, comprising the 5'UTR, N(pro) and E2 gene regions, was analysed by two methods: maximum likelihood and Bayesian approach. An identical, well-supported tree topology was observed, where four pestiviruses (SVA/cont-08, D32/00_'HoBi', CH-KaHo/cont, and Th/04_KhonKaen) formed a monophyletic clade that is closely related to the BVDV-1 and BVDV-2 clades. The strategy applied in this study is useful for classifying novel pestiviruses in the future.

  9. Ariadne: a database search engine for identification and chemical analysis of RNA using tandem mass spectrometry data.

    Science.gov (United States)

    Nakayama, Hiroshi; Akiyama, Misaki; Taoka, Masato; Yamauchi, Yoshio; Nobe, Yuko; Ishikawa, Hideaki; Takahashi, Nobuhiro; Isobe, Toshiaki

    2009-04-01

    We present here a method to correlate tandem mass spectra of sample RNA nucleolytic fragments with an RNA nucleotide sequence in a DNA/RNA sequence database, thereby allowing tandem mass spectrometry (MS/MS)-based identification of RNA in biological samples. Ariadne, a unique web-based database search engine, identifies RNA by two probability-based evaluation steps of MS/MS data. In the first step, the software evaluates the matches between the masses of product ions generated by MS/MS of an RNase digest of sample RNA and those calculated from a candidate nucleotide sequence in a DNA/RNA sequence database, which then predicts the nucleotide sequences of these RNase fragments. In the second step, the candidate sequences are mapped for all RNA entries in the database, and each entry is scored for a function of occurrences of the candidate sequences to identify a particular RNA. Ariadne can also predict post-transcriptional modifications of RNA, such as methylation of nucleotide bases and/or ribose, by estimating mass shifts from the theoretical mass values. The method was validated with MS/MS data of RNase T1 digests of in vitro transcripts. It was applied successfully to identify an unknown RNA component in a tRNA mixture and to analyze post-transcriptional modification in yeast tRNA(Phe-1).

  10. Nucleotide sequence of a cDNA coding for the barley seed protein CMa: an inhibitor of insect α-amylase

    DEFF Research Database (Denmark)

    Rasmussen, Søren Kjærsgård; Johansson, A.

    1992-01-01

    The primary structure of the insect alpha-amylase inhibitor CMa of barley seeds was deduced from a full-length cDNA clone pc43F6. Analysis of RNA from barley endosperm shows high levels 15 and 20 days after flowering. The cDNA predicts an amino acid sequence of 119 residues preceded by a signal...... peptide of 25 amino acids. Ala and Leu account for 55% of the signal peptide. CMa is 60-85% identical with alpha-amylase inhibitors of wheat, but shows less than 50% identity to trypsin inhibitors of barley and wheat. The 10 Cys residues are located in identical positions compared to the cereal inhibitor...

  11. Isolation and characterization of human glycophorin A cDNAs using a synthetic oligonucleotide approach: nucleotide sequence, mRNA structure and regulation by 12-O-tetradecanoylphorbol 13-acetate (TPA)

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1986-01-01

    The authors have previously shown that treatment of human erythroleukemic K562 cells with the tumor-promoting phorbol ester, TPA, results in a diminished expression of glycophorin A at the level of protein biosynthesis and in vitro mRNA translation activity. To further examine the structure, relationships and expression of human glycophorins they have successfully isolated and sequenced several glycophorin A specific cDNA clones derived from K562 cells, by making extensive use of mixed and exact synthetic oligonucleotides as primers and radioactively labeled probes. The nucleotide sequence obtained from the largest glycophorin A cDNA suggests the presence of a hydrophobic leader-like peptide of at least 19 amino acids. Northern gel analysis using both whole cDNA-plasmid and synthetic oligonucleotide probes revealed the existence of multiple mRNAs, three of which they believe to be glycophorin A-specific, whereas a fourth and smaller mRNA appears to be glycophorin B-specific. Furthermore, the abundance of all four glycophorin mRNAs were found to be extensively reduced following treatment of K562 cells with TPA suggesting coordinate regulation, possibly at the level of gene transcription

  12. FishPathogens.eu/vhsv: A user-friendly Viral Haemorrhagic Septicaemia Virus (VHSV) isolate and sequence database

    DEFF Research Database (Denmark)

    Jonstrup, Søren Peter; Gray, Tanya; Kahns, Søren

    A database has been created, www.FishPathogens.eu, with the aim of providing a single repository for collating important information on significant pathogens of aquaculture, relevant to their control and management. This database will be developed, maintained and managed as part of the European...

  13. Nucleotide sequence of pOLA52: a conjugative IncX1 plasmid from Escherichia coli which enables biofilm formation and multidrug efflux

    DEFF Research Database (Denmark)

    Norman, Anders; Hansen, Lars H.; She, Qunxin

    2008-01-01

    . The plasmid was also classified as IncX1 with incompatibility testing. The conjugal transfer and plasmid maintenance regions of pOLA52 therefore seem to represent IncX1 orthologues of the well-characterized IncX2 plasmid R6K. Sequence homology searches in GenBank also suggested a considerably higher...... of type 3 fimbriae (mrkABCDF). The plasmid was found to be 51,602 bp long with 68 putative genes. About half of the plasmid constituted a conserved IncX1-type backbone with predicted regions for conjugation, replication and partitioning, as well as a toxin/antitoxin (TA) plasmid addiction system...... prevalence of IncX1 group plasmids than IncX2. The 21 kb 'genetic load' region of pOLA52 was shown to consist of a mosaic, among other things a fragmented Tn3 transposon encoding ampicillin resistance. Most notably the oqxAB and mrkABCDF cassettes were contained within two composite transposons (Tn6010...

  14. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae) based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments.

    Science.gov (United States)

    Wang, Zhaoshan; Du, Shuhui; Dayanandan, Selvadurai; Wang, Dongsheng; Zeng, Yanfei; Zhang, Jianguo

    2014-01-01

    Populus (Salicaceae) is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1) the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2) three advanced sections (Populus, Aigeiros and Tacamahaca) are of hybrid origin; (3) species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4) many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  15. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments.

    Directory of Open Access Journals (Sweden)

    Zhaoshan Wang

    Full Text Available Populus (Salicaceae is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1 the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2 three advanced sections (Populus, Aigeiros and Tacamahaca are of hybrid origin; (3 species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4 many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  16. Construction of an Ostrea edulis database from genomic and expressed sequence tags (ESTs) obtained from Bonamia ostreae infected haemocytes: Development of an immune-enriched oligo-microarray.

    Science.gov (United States)

    Pardo, Belén G; Álvarez-Dios, José Antonio; Cao, Asunción; Ramilo, Andrea; Gómez-Tato, Antonio; Planas, Josep V; Villalba, Antonio; Martínez, Paulino

    2016-12-01

    The flat oyster, Ostrea edulis, is one of the main farmed oysters, not only in Europe but also in the United States and Canada. Bonamiosis due to the parasite Bonamia ostreae has been associated with high mortality episodes in this species. This parasite is an intracellular protozoan that infects haemocytes, the main cells involved in oyster defence. Due to the economical and ecological importance of flat oyster, genomic data are badly needed for genetic improvement of the species, but they are still very scarce. The objective of this study is to develop a sequence database, OedulisDB, with new genomic and transcriptomic resources, providing new data and convenient tools to improve our knowledge of the oyster's immune mechanisms. Transcriptomic and genomic sequences were obtained using 454 pyrosequencing and compiled into an O. edulis database, OedulisDB, consisting of two sets of 10,318 and 7159 unique sequences that represent the oyster's genome (WG) and de novo haemocyte transcriptome (HT), respectively. The flat oyster transcriptome was obtained from two strains (naïve and tolerant) challenged with B. ostreae, and from their corresponding non-challenged controls. Approximately 78.5% of 5619 HT unique sequences were successfully annotated by Blast search using public databases. A total of 984 sequences were identified as being related to immune response and several key immune genes were identified for the first time in flat oyster. Additionally, transcriptome information was used to design and validate the first oligo-microarray in flat oyster enriched with immune sequences from haemocytes. Our transcriptomic and genomic sequencing and subsequent annotation have largely increased the scarce resources available for this economically important species and have enabled us to develop an OedulisDB database and accompanying tools for gene expression analysis. This study represents the first attempt to characterize in depth the O. edulis haemocyte transcriptome in

  17. 5S ribosomal RNA database Y2K.

    Science.gov (United States)

    Szymanski, M; Barciszewska, M Z; Barciszewski, J; Erdmann, V A

    2000-01-01

    This paper presents the updated version (Y2K) of the database of ribosomal 5S ribonucleic acids (5S rRNA) and their genes (5S rDNA), http://rose.man/poznan.pl/5SData/index.html. This edition of the database contains 1985primary structures of 5S rRNA and 5S rDNA. They include 60 archaebacterial, 470 eubacterial, 63 plastid, nine mitochondrial and 1383 eukaryotic sequences. The nucleotide sequences of the 5S rRNAs or 5S rDNAs are divided according to the taxonomic position of the source organisms.

  18. Characterization of the Complete Nucleotide Sequences of IncA/C2 Plasmids Carrying In809-Like Integrons from Enterobacteriaceae Isolates of Wildlife Origin.

    Science.gov (United States)

    Papagiannitsis, Costas C; Kutilova, Iva; Medvecky, Matej; Hrabak, Jaroslav; Dolejska, Monika

    2017-09-01

    A total of 18 Enterobacteriaceae (17 from gulls and 1 from a clinical sample) collected from Australia, carrying IncA/C plasmids with the IMP-encoding In809-like integrons, were studied. Seven plasmids, being representatives of different origins, plasmid sizes, replicon combinations, and resistance genes, were completely sequenced. Plasmid pEc158, identified in a clinical Escherichia coli ST752 isolate, showed extensive similarity to type 2 IncA/C 2 plasmids. pEc158 carried none of the bla CMY-2 -like region or ARI-B and ARI-A regions, while it contained a hybrid transposon structure. The six remaining plasmids, which were of wildlife origin, were highly similar to each other and probably were fusion derivatives of type 1 and type 2 A/C 2 plasmids. The latter plasmids contained an ARI-B region and hybrid transposon structures. In all plasmids, hybrid transposon structures containing In809-like integrons were inserted 3,434 bp downstream of the rhs2 start codon. In all cases, the one outermost 38-bp inverted repeat (IR) of the transposon was associated with the Tn 1696 tnp module, while the other outermost 38-bp IR of the transposon was associated with either a Tn 6317 -like module or a Tn 21 mer module. However, the internal structure of the transposon and the resistance genes were different in each plasmid. These findings indicated that, for the specific periods of time and settings, different IncA/C 2 plasmid types carrying In809-like elements circulated among isolates of wildlife and clinical origins. Additionally, they provided the basis for speculations regarding the reshuffling of IncA/C 2 plasmids with In809-like integrons and confirmed the rapid evolution of IncA/C 2 plasmid lineages. Copyright © 2017 American Society for Microbiology.

  19. Comparison of nucleotide sequences of recent and previous lineages of peste-des-petits-ruminants viruses of sheep and goats in Nigeria

    Directory of Open Access Journals (Sweden)

    Samuel Mantip

    2016-08-01

    Full Text Available Peste-des-petits-ruminants virus (PPRV is a highly contagious, fatal and economically important viral disease of small ruminants that is still endemic and militates against the production of sheep and goats in endemic areas of the world. The aim of this study was to describe the viral strains within the country. This was carried out by collecting tissue and swab samples from sheep and goats in various agro-ecological zones of Nigeria. The phylogeny of archived PPRV strains or isolates and those circulating and causing recent outbreaks was determined by sequencing of the nucleoprotein (N-gene. Twenty tissue and swab samples from apparently healthy and sick sheep and goats were collected randomly from 18 states, namely 3 states in each of the 6 agro-ecological zones visited. A total of 360 samples were collected. A total of 35 samples of 360 (9.7% tested positive by reverse transcriptase–polymerase chain reaction, of which 25 were from oculo-nasal swabs and 10 were from tissue samples. Neighbour-joining phylogenetic analysis using Phylogenetic Analysis Using Parsimony (PAUP identified four different lineages, that is, lineages I, II, III and IV. Interestingly, the Nigerian strains described in this study grouped in two separate major lineages, that is, lineages II and IV. Strains from Sokoto, Oyo, Plateau and Ondo states grouped according to the historical distribution of PPRV together with the Nigerian 75/1 strain of lineage II, while other strains from Sokoto, Oyo, Plateau, Akwa-Ibom, Adamawa, Kaduna, Lagos, Bauchi, Niger and Kano states grouped together with the East African and Asian strains of lineage IV. This finding confirms that both lineage II and IV strains of PPRV are circulating in Nigeria. Previously, only strains of lineage II were found to be present in the country.

  20. Deep Sequence Analysis of Non-Small Cell Lung Cancer: Integrated Analysis of Gene Expression, Alternative Splicing, and Single Nucleotide Variations in Lung Adenocarcinomas with and without Oncogenic KRAS Mutations

    International Nuclear Information System (INIS)

    Kalari, Krishna R.; Rossell, David; Necela, Brian M.; Asmann, Yan W.; Nair, Asha

    2012-01-01

    KRAS mutations are highly prevalent in non-small cell lung cancer (NSCLC), and tumors harboring these mutations tend to be aggressive and resistant to chemotherapy. We used next-generation sequencing technology to identify pathways that are specifically altered in lung tumors harboring a KRAS mutation. Paired-end RNA-sequencing of 15 primary lung adenocarcinoma tumors (8 harboring mutant KRAS and 7 with wild-type KRAS) were performed. Sequences were mapped to the human genome, and genomic features, including differentially expressed genes, alternate splicing isoforms and single nucleotide variants, were determined for tumors with and without KRAS mutation using a variety of computational methods. Network analysis was carried out on genes showing differential expression (374 genes), alternate splicing (259 genes), and SNV-related changes (65 genes) in NSCLC tumors harboring a KRAS mutation. Genes exhibiting two or more connections from the lung adenocarcinoma network were used to carry out integrated pathway analysis. The most significant signaling pathways identified through this analysis were the NFκB, ERK1/2, and AKT pathways. A 27 gene mutant KRAS-specific sub network was extracted based on gene–gene connections from the integrated network, and interrogated for druggable targets. Our results confirm previous evidence that mutant KRAS tumors exhibit activated NFκB, ERK1/2, and AKT pathways and may be preferentially sensitive to target therapeutics toward these pathways. In addition, our analysis indicates novel, previously unappreciated links between mutant KRAS and the TNFR and PPARγ signaling pathways, suggesting that targeted PPARγ antagonists and TNFR inhibitors may be useful therapeutic strategies for treatment of mutant KRAS lung tumors. Our study is the first to integrate genomic features from RNA-Seq data from NSCLC and to define a first draft genomic landscape model that is unique to tumors with oncogenic KRAS mutations.

  1. PSI/TM-Coffee: a web server for fast and accurate multiple sequence alignments of regular and transmembrane proteins using homology extension on reduced databases.

    Science.gov (United States)

    Floden, Evan W; Tommaso, Paolo D; Chatzou, Maria; Magis, Cedrik; Notredame, Cedric; Chang, Jia-Ming

    2016-07-08

    The PSI/TM-Coffee web server performs multiple sequence alignment (MSA) of proteins by combining homology extension with a consistency based alignment approach. Homology extension is performed with Position Specific Iterative (PSI) BLAST searches against a choice of redundant and non-redundant databases. The main novelty of this server is to allow databases of reduced complexity to rapidly perform homology extension. This server also gives the possibility to use transmembrane proteins (TMPs) reference databases to allow even faster homology extension on this important category of proteins. Aside from an MSA, the server also outputs topological prediction of TMPs using the HMMTOP algorithm. Previous benchmarking of the method has shown this approach outperforms the most accurate alignment methods such as MSAProbs, Kalign, PROMALS, MAFFT, ProbCons and PRALINE™. The web server is available at http://tcoffee.crg.cat/tmcoffee. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  3. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  4. Serological and genetic characterisation of bovine respiratory syncytial virus (BRSV) indicates that Danish isolates belong to the intermediate subgroup: no evidence of a selective effect on the variability of G protein nucleotide sequence by prior cell culture adaption and passages in cell culture

    DEFF Research Database (Denmark)

    Larsen, Lars Erik; Uttenthal, Åse; Arctander, P.

    1998-01-01

    on the nucleotide sequence of the G protein. These findings indicated that the previously established variabilities of the G protein of RS virus isolates were not attributable to mutations induced during the propagation of the virus. The reactivity of the Danish isolates with G protein-specific MAbs were similar......Danish isolates of bovine respiratory syncytial virus (BRSV) were characterised by nucleotide sequencing of the G glycoprotein and by their reactivity with a panel of monoclonal antibodies (MAbs). Among the six Danish isolates, the overall sequence divergence ranged between 0 and 3...... part of the G gene of additional 11 field BRSV viruses, processed directly from lung samples without prior adaption to cell culture growth. revealed sequence variabilities in the range obtained with the propagated virus. In addition, several passages in cell culture and in calves had no major impact...

  5. HIV Sequence Compendium 2010

    Energy Technology Data Exchange (ETDEWEB)

    Kuiken, Carla [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Foley, Brian [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Leitner, Thomas [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Apetrei, Christian [Univ. of Pittsburgh, PA (United States); Hahn, Beatrice [Univ. of Alabama, Tuscaloosa, AL (United States); Mizrachi, Ilene [National Center for Biotechnology Information, Bethesda, MD (United States); Mullins, James [Univ. of Washington, Seattle, WA (United States); Rambaut, Andrew [Univ. of Edinburgh, Scotland (United Kingdom); Wolinsky, Steven [Northwestern Univ., Evanston, IL (United States); Korber, Bette [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2010-12-31

    This compendium is an annual printed summary of the data contained in the HIV sequence database. In these compendia we try to present a judicious selection of the data in such a way that it is of maximum utility to HIV researchers. Each of the alignments attempts to display the genetic variability within the different species, groups and subtypes of the virus. This compendium contains sequences published before January 1, 2010. Hence, though it is called the 2010 Compendium, its contents correspond to the 2009 curated alignments on our website. The number of sequences in the HIV database is still increasing exponentially. In total, at the time of printing, there were 339,306 sequences in the HIV Sequence Database, an increase of 45% since last year. The number of near complete genomes (>7000 nucleotides) increased to 2576 by end of 2009, reflecting a smaller increase than in previous years. However, as in previous years, the compendium alignments contain only a small fraction of these. Included in the alignments are a small number of sequences representing each of the subtypes and the more prevalent circulating recombinant forms (CRFs) such as 01 and 02, as well as a few outgroup sequences (group O and N and SIV-CPZ). Of the rarer CRFs we included one representative each. A more complete version of all alignments is available on our website, http://www.hiv.lanl.gov/content/sequence/NEWALIGN/align.html. Reprints are available from our website in the form of both HTML and PDF files. As always, we are open to complaints and suggestions for improvement. Inquiries and comments regarding the compendium should be addressed to seq-info@lanl.gov.

  6. In Silico Detection and Typing of Plasmids using PlasmidFinder and Plasmid Multilocus Sequence Typing

    DEFF Research Database (Denmark)

    Carattoli, Alessandra; Zankari, Ea; García-Fernández, Aurora

    2014-01-01

    In the work presented here, we designed and developed two easy-to-use Web tools for in silico detection and characterization of whole-genome sequence (WGS) and whole-plasmid sequence data from members of the family Enterobacteriaceae. These tools will facilitate bacterial typing based on draft...... genomes of multidrug-resistant Enterobacteriaceae species by the rapid detection of known plasmid types. Replicon sequences from 559 fully sequenced plasmids associated with the family Enterobacteriaceae in the NCBI nucleotide database were collected to build a consensus database for integration...... sequences identified in the 559 fully sequenced plasmids. For plasmid multilocus sequence typing (pMLST) analysis, a database that is updated weekly was generated from www.pubmlst.org and integrated into a Web tool called pMLST. Both databases were evaluated using draft genomes from a collection...

  7. The SDH mutation database: an online resource for succinate dehydrogenase sequence variants involved in pheochromocytoma, paraganglioma and mitochondrial complex II deficiency

    Directory of Open Access Journals (Sweden)

    Devilee Peter

    2005-11-01

    Full Text Available Abstract Background The SDHA, SDHB, SDHC and SDHD genes encode the subunits of succinate dehydrogenase (succinate: ubiquinone oxidoreductase, a component of both the Krebs cycle and the mitochondrial respiratory chain. SDHA, a flavoprotein and SDHB, an iron-sulfur protein together constitute the catalytic domain, while SDHC and SDHD encode membrane anchors that allow the complex to participate in the respiratory chain as complex II. Germline mutations of SDHD and SDHB are a major cause of the hereditary forms of the tumors paraganglioma and pheochromocytoma. The largest subunit, SDHA, is mutated in patients with Leigh syndrome and late-onset optic atrophy, but has not as yet been identified as a factor in hereditary cancer. Description The SDH mutation database is based on the recently described Leiden Open (source Variation Database (LOVD system. The variants currently described in the database were extracted from the published literature and in some cases annotated to conform to current mutation nomenclature. Researchers can also directly submit new sequence variants online. Since the identification of SDHD, SDHC, and SDHB as classic tumor suppressor genes in 2000 and 2001, studies from research groups around the world have identified a total of 120 variants. Here we introduce all reported paraganglioma and pheochromocytoma related sequence variations in these genes, in addition to all reported mutations of SDHA. The database is now accessible online. Conclusion The SDH mutation database offers a valuable tool and resource for clinicians involved in the treatment of patients with paraganglioma-pheochromocytoma, clinical geneticists needing an overview of current knowledge, and geneticists and other researchers needing a solid foundation for further exploration of both these tumor syndromes and SDHA-related phenotypes.

  8. [Phylogenetic relationships of the species of Oxytropis DC. subg. Oxytropis and Phacoxytropis (Fabaceae) from Asian Russia inferred from the nucleotide sequence analysis of the intergenic spacers of the chloroplast genome].

    Science.gov (United States)

    Kholina, A B; Kozyrenko, M M; Artyukova, E V; Sandanov, D V; Andrianova, E A

    2016-08-01

    The nucleotide sequence analysis of trnH–psbA, trnL–trnF, and trnS–trnG intergenic spacer regions of chloroplast DNA performed in the representatives of the genus Oxytropis from Asian Russia provided clarification of the phylogenetic relationships of some species and sections in the subgenera Oxytropis and Phacoxytropis and in the genus Oxytropis as a whole. Only the section Mesogaea corresponds to the subgenus Phacoxytropis, while the section Janthina of the same subgenus groups together with the sections of the subgenus Oxytropis. The sections Chrysantha and Ortholoma of the subgenus Oxytropis are not only closely related to each other, but together with the section Mesogaea, they are grouped into the subgenus Phacoxytropis. It seems likely that the sections Chrysantha and Ortholoma should be assigned to the subgenus Phacoxytropis, and the section Janthina should be assigned to the subgenus Oxytropis. The molecular differences were identified between O. coerulea and O. mandshurica from the section Janthina that were indicative of considerable divergence of their chloroplast genomes and the species independence of the taxa. The species independence of O. czukotica belonging to the section Arctobia was also confirmed.

  9. Retrieval and Representation of Nucleotide Sequence of ...

    African Journals Online (AJOL)

    ABSTRACT: Educational programmes all over the world are facing increasing ... providing biological insights, and proficiency to access and use the vast repository of computational and web- based resources which are the most available information in the world today. ... opening up new frontiers in the past two decades.

  10. Expressed sequence tags (ESTs) and single nucleotide ...

    African Journals Online (AJOL)

    SERVER

    2008-02-19

    Feb 19, 2008 ... polymorphisms (SNPs): Emerging molecular marker tools for ... knowledge in plant biology, breeding and biotechnology. The emergence of many ...... phenotypes: past successes for Mendelian disease, future approaches for ...

  11. ngs.plot: Quick mining and visualization of next-generation sequencing data by integrating genomic databases.

    Science.gov (United States)

    Shen, Li; Shao, Ningyi; Liu, Xiaochuan; Nestler, Eric

    2014-04-15

    Understanding the relationship between the millions of functional DNA elements and their protein regulators, and how they work in conjunction to manifest diverse phenotypes, is key to advancing our understanding of the mammalian genome. Next-generation sequencing technology is now used widely to probe these protein-DNA interactions and to profile gene expression at a genome-wide scale. As the cost of DNA sequencing continues to fall, the interpretation of the ever increasing amount of data generated represents a considerable challenge. We have developed ngs.plot - a standalone program to visualize enrichment patterns of DNA-interacting proteins at functionally important regions based on next-generation sequencing data. We demonstrate that ngs.plot is not only efficient but also scalable. We use a few examples to demonstrate that ngs.plot is easy to use and yet very powerful to generate figures that are publication ready. We conclude that ngs.plot is a useful tool to help fill the gap between massive datasets and genomic information in this era of big sequencing data.

  12. Structural and sequence variants in patients with Silver-Russell syndrome or similar features-Curation of a disease database

    DEFF Research Database (Denmark)

    Tümer, Zeynep; López-Hernández, Julia Angélica; Netchine, Irène

    2018-01-01

    data of these patients. The clinical features are scored according to the Netchine-Harbison clinical scoring system (NH-CSS), which has recently been accepted as standard by consensus. The structural and sequence variations are reviewed and where necessary redescribed according to recent...

  13. Mining biological databases for candidate disease genes

    Science.gov (United States)

    Braun, Terry A.; Scheetz, Todd; Webster, Gregg L.; Casavant, Thomas L.

    2001-07-01

    The publicly-funded effort to sequence the complete nucleotide sequence of the human genome, the Human Genome Project (HGP), has currently produced more than 93% of the 3 billion nucleotides of the human genome into a preliminary `draft' format. In addition, several valuable sources of information have been developed as direct and indirect results of the HGP. These include the sequencing of model organisms (rat, mouse, fly, and others), gene discovery projects (ESTs and full-length), and new technologies such as expression analysis and resources (micro-arrays or gene chips). These resources are invaluable for the researchers identifying the functional genes of the genome that transcribe and translate into the transcriptome and proteome, both of which potentially contain orders of magnitude more complexity than the genome itself. Preliminary analyses of this data identified approximately 30,000 - 40,000 human `genes.' However, the bulk of the effort still remains -- to identify the functional and structural elements contained within the transcriptome and proteome, and to associate function in the transcriptome and proteome to genes. A fortuitous consequence of the HGP is the existence of hundreds of databases containing biological information that may contain relevant data pertaining to the identification of disease-causing genes. The task of mining these databases for information on candidate genes is a commercial application of enormous potential. We are developing a system to acquire and mine data from specific databases to aid our efforts to identify disease genes. A high speed cluster of Linux of workstations is used to analyze sequence and perform distributed sequence alignments as part of our data mining and processing. This system has been used to mine GeneMap99 sequences within specific genomic intervals to identify potential candidate disease genes associated with Bardet-Biedle Syndrome (BBS).

  14. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  15. SINEBase: a database and tool for SINE analysis.

    Science.gov (United States)

    Vassetzky, Nikita S; Kramerov, Dmitri A

    2013-01-01

    SINEBase (http://sines.eimb.ru) integrates the revisited body of knowledge about short interspersed elements (SINEs). A set of formal definitions concerning SINEs was introduced. All available sequence data were screened through these definitions and the genetic elements misidentified as SINEs were discarded. As a result, 175 SINE families have been recognized in animals, flowering plants and green algae. These families were classified by the modular structure of their nucleotide sequences and the frequencies of different patterns were evaluated. These data formed the basis for the database of SINEs. The SINEBase website can be used in two ways: first, to explore the database of SINE families, and second, to analyse candidate SINE sequences using specifically developed tools. This article presents an overview of the database and the process of SINE identification and analysis.

  16. A search for pre-main-sequence stars in high-latitude molecular clouds. 3: A survey of the Einstein database

    Science.gov (United States)

    Caillault, Jean-Pierre; Magnani, Loris; Fryer, Chris

    1995-01-01

    In order to discern whether the high-latitude molecular clouds are regions of ongoing star formation, we have used X-ray emission as a tracer of youthful stars. The entire Einstein database yields 18 images which overlap 10 of the clouds mapped partially or completely in the CO (1-0) transition, providing a total of approximately 6 deg squared of overlap. Five previously unidentified X-ray sources were detected: one has an optical counterpart which is a pre-main-sequence (PMS) star, and two have normal main-sequence stellar counterparts, while the other two are probably extragalactic sources. The PMS star is located in a high Galactic latitude Lynds dark cloud, so this result is not too suprising. The translucent clouds, though, have yet to reveal any evidence of star formation.

  17. Development of a multiplex polymerase chain reaction-sequence-specific primer method for NKG2D and NKG2F single-nucleotide polymorphism typing using isothermal multiple displacement amplification products.

    Science.gov (United States)

    Kaewmanee, M; Phoksawat, W; Romphruk, A; Romphruk, A V; Jumnainsong, A; Leelayuwat, C

    2013-06-01

    Natural killer group 2 member D (NKG2D) on immune effector cells recognizes multiple stress-inducible ligands. NKG2D single-nucleotide polymorphism (SNP) haplotypes were related to the levels of cytotoxic activity of peripheral blood mononuclear cells. Indeed, these polymorphisms were also located in NKG2F. Isothermal multiple displacement amplification (IMDA) is used for whole genome amplification (WGA) that can amplify very small genomic DNA templates into microgram with whole genome coverage. This is particularly useful in the cases of limited amount of valuable DNA samples requiring multi-locus genotyping. In this study, we evaluated the quality and applicability of IMDA to genetic studies in terms of sensitivity, efficiency of IMDA re-amplification and stability of IMDA products. The smallest amount of DNA to be effectively amplified by IMDA was 200 pg yielding final DNA of approximately 16 µg within 1.5 h. IMDA could be re-amplified only once (second round of amplification), and could be kept for 5 months at 4°C and more than a year at -20°C without loosing genome coverage. The amplified products were used successfully to setup a multiplex polymerase chain reaction-sequence-specific primer for SNP typing of the NKG2D/F genes. The NKG2D/F multiplex polymerase chain reaction (PCR) contained six PCR mixtures for detecting 10 selected SNPs, including 8 NKG2D/F SNP haplotypes and 2 additional NKG2D coding SNPs. This typing procedure will be applicable in both clinical and research laboratories. Thus, our data provide useful information and limitations for utilization of genome-wide amplification using IMDA and its application for multiplex NKG2D/F typing. © 2013 John Wiley & Sons Ltd.

  18. Two-step processing for activation of the cytolysin/hemolysin of Vibrio cholerae O1 biotype El Tor: nucleotide sequence of the structural gene (hlyA) and characterization of the processed products.

    Science.gov (United States)

    Yamamoto, K; Ichinose, Y; Shinagawa, H; Makino, K; Nakata, A; Iwanaga, M; Honda, T; Miwatani, T

    1990-12-01

    Vibrio cholerae O1 biotype El Tor produces and secretes a 65-kDa cytolysin/hemolysin into the culture medium. We cloned the structural gene (hlyA) for the cytolysin from the total DNA of a V. cholerae O1 El Tor strain, N86. Nucleotide sequence analysis of hlyA revealed an open reading frame consisting of 2,223 bp which can code for a protein of 741 amino acids with a molecular weight of 81,961. Consistent with this, a 79-kDa protein was identified as the product of hlyA by maxicell analysis in Escherichia coli. N-terminal amino acids of this 79-kDa HlyA protein and those of a 65-kDa El Tor cytolysin purified from V. cholerae were Asn-26 and Asn-158, respectively. The 82- and 79-kDa precursors of the 65-kDa mature cytolysin were found in V. cholerae by pulse-chase labeling and Western blot (immunoblot) analysis of hlyA products. Hemolytic activity of the 79-kDa HlyA protein from E. coli was less than 5% that for the 65-kDa cytolysin from V. cholerae. Our results suggest that in V. cholerae, the 82-kDa preprotoxin synthesized in the cytoplasm is secreted through the membranes into the culture medium as the 79-kDa inactive protoxin after cleavage of the signal peptide and is then further processed into the 65-kDa active cytolysin by release of the N-terminal 15-kDa fragment.

  19. (reprocessed)HeliscopeCAGE sequencing, Delve mapping and CAGE TSS aggregation - FANTOM5 | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us FANTOM...ntified by CAGE tag analysis (BED format) *.rdna.fa.gz: rDNA sequences (FASTA format) Data file File name: fantom...5_rp_exp_details.zip File URL: ftp://ftp.biosciencedbc.jp/archive/fantom5/20161221/fantom5_rp_exp_detai...tp://ftp.biosciencedbc.jp/archive/fantom5/datafiles/reprocessed/hg38_latest/basic/ File size: 1.4 TB File na...me: (reprocessed)basic (Mus musculus) File URL: ftp://ftp.biosciencedbc.jp/archive/fantom5/datafiles/reproce

  20. Private and Efficient Query Processing on Outsourced Genomic Databases.

    Science.gov (United States)

    Ghasemi, Reza; Al Aziz, Md Momin; Mohammed, Noman; Dehkordi, Massoud Hadian; Jiang, Xiaoqian

    2017-09-01

    Applications of genomic studies are spreading rapidly in many domains of science and technology such as healthcare, biomedical research, direct-to-consumer services, and legal and forensic. However, there are a number of obstacles that make it hard to access and process a big genomic database for these applications. First, sequencing genomic sequence is a time consuming and expensive process. Second, it requires large-scale computation and storage systems to process genomic sequences. Third, genomic databases are often owned by different organizations, and thus, not available for public usage. Cloud computing paradigm can be leveraged to facilitate the creation and sharing of big genomic databases for these applications. Genomic data owners can outsource their databases in a centralized cloud server to ease the access of their databases. However, data owners are reluctant to adopt this model, as it requires outsourcing the data to an untrusted cloud service provider that may cause data breaches. In this paper, we propose a privacy-preserving model for outsourcing genomic data to a cloud. The proposed model enables query processing while providing privacy protection of genomic databases. Privacy of the individuals is guaranteed by permuting and adding fake genomic records in the database. These techniques allow cloud to evaluate count and top-k queries securely and efficiently. Experimental results demonstrate that a count and a top-k query over 40 Single Nucleotide Polymorphisms (SNPs) in a database of 20 000 records takes around 100 and 150 s, respectively.

  1. Protein sequence annotation in the genome era: the annotation concept of SWISS-PROT+TREMBL.

    Science.gov (United States)

    Apweiler, R; Gateau, A; Contrino, S; Martin, M J; Junker, V; O'Donovan, C; Lang, F; Mitaritonna, N; Kappus, S; Bairoch, A

    1997-01-01

    SWISS-PROT is a curated protein sequence database which strives to provide a high level of annotation, a minimal level of redundancy and high level of integration with other databases. Ongoing genome sequencing projects have dramatically increased the number of protein sequences to be incorporated into SWISS-PROT. Since we do not want to dilute the quality standards of SWISS-PROT by incorporating sequences without proper sequence analysis and annotation, we cannot speed up the incorporation of new incoming data indefinitely. However, as we also want to make the sequences available as fast as possible, we introduced TREMBL (TRanslation of EMBL nucleotide sequence database), a supplement to SWISS-PROT. TREMBL consists of computer-annotated entries in SWISS-PROT format derived from the translation of all coding sequences (CDS) in the EMBL nucleotide sequence database, except for CDS already included in SWISS-PROT. While TREMBL is already of immense value, its computer-generated annotation does not match the quality of SWISS-PROTs. The main difference is in the protein functional information attached to sequences. With this in mind, we are dedicating substantial effort to develop and apply computer methods to enhance the functional information attached to TREMBL entries.

  2. Genome-Wide Analysis of Microsatellite Markers Based on Sequenced Database in Chinese Spring Wheat (Triticum aestivum L..

    Directory of Open Access Journals (Sweden)

    Bin Han

    Full Text Available Microsatellites or simple sequence repeats (SSRs are distributed across both prokaryotic and eukaryotic genomes and have been widely used for genetic studies and molecular marker-assisted breeding in crops. Though an ordered draft sequence of hexaploid bread wheat have been announced, the researches about systemic analysis of SSRs for wheat still have not been reported so far. In the present study, we identified 364,347 SSRs from among 10,603,760 sequences of the Chinese spring wheat (CSW genome, which were present at a density of 36.68 SSR/Mb. In total, we detected 488 types of motifs ranging from di- to hexanucleotides, among which dinucleotide repeats dominated, accounting for approximately 42.52% of the genome. The density of tri- to hexanucleotide repeats was 24.97%, 4.62%, 3.25% and 24.65%, respectively. AG/CT, AAG/CTT, AGAT/ATCT, AAAAG/CTTTT and AAAATT/AATTTT were the most frequent repeats among di- to hexanucleotide repeats. Among the 21 chromosomes of CSW, the density of repeats was highest on chromosome 2D and lowest on chromosome 3A. The proportions of di-, tri-, tetra-, penta- and hexanucleotide repeats on each chromosome, and even on the whole genome, were almost identical. In addition, 295,267 SSR markers were successfully developed from the 21 chromosomes of CSW, which cover the entire genome at a density of 29.73 per Mb. All of the SSR markers were validated by reverse electronic-Polymerase Chain Reaction (re-PCR; 70,564 (23.9% were found to be monomorphic and 224,703 (76.1% were found to be polymorphic. A total of 45 monomorphic markers were selected randomly for validation purposes; 24 (53.3% amplified one locus, 8 (17.8% amplified multiple identical loci, and 13 (28.9% did not amplify any fragments from the genomic DNA of CSW. Then a dendrogram was generated based on the 24 monomorphic SSR markers among 20 wheat cultivars and three species of its diploid ancestors showing that monomorphic SSR markers represented a promising

  3. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  4. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  5. CHASM and SNVBox: toolkit for detecting biologically important single nucleotide mutations in cancer.

    Science.gov (United States)

    Wong, Wing Chung; Kim, Dewey; Carter, Hannah; Diekhans, Mark; Ryan, Michael C; Karchin, Rachel

    2011-08-01

    Thousands of cancer exomes are currently being sequenced, yielding millions of non-synonymous single nucleotide variants (SNVs) of possible relevance to disease etiology. Here, we provide a software toolkit to prioritize SNVs based on their predicted contribution to tumorigenesis. It includes a database of precomputed, predictive features covering all positions in the annotated human exome and can be used either stand-alone or as part of a larger variant discovery pipeline. MySQL database, source code and binaries freely available for academic/government use at http://wiki.chasmsoftware.org, Source in Python and C++. Requires 32 or 64-bit Linux system (tested on Fedora Core 8,10,11 and Ubuntu 10), 2.5*≤ Python 5.0, 60 GB available hard disk space (50 MB for software and data files, 40 GB for MySQL database dump when uncompressed), 2 GB of RAM.

  6. RegTransBase - A Database Of Regulatory Sequences and Interactionsin a Wide Range of Prokaryotic Genomes

    Energy Technology Data Exchange (ETDEWEB)

    Kazakov, Alexei E.; Cipriano, Michael J.; Novichkov, Pavel S.; Minovitsky, Simon; Vinogradov, Dmitry V.; Arkin, Adam; Mironov, AndreyA.; Gelfand, Mikhail S.; Dubchak, Inna

    2006-07-01

    RegTransBase, a manually curated database of regulatoryinteractions in prokaryotes, captures the knowledge in publishedscientific literature using a controlled vocabulary. Although a number ofdatabases describing interactions between regulatory proteins and theirbinding sites are currently being maintained, they focus mostly on themodel organisms Escherichia coli and Bacillus subtilis, or are entirelycomputationally derived. RegTransBase describes a large number ofregulatory interactions reported in many organisms and contains varioustypes of experimental data, in particular: the activation or repressionof transcription by an identified direct regulator; determining thetranscriptional regulatory function of a protein (or RNA) directlybinding to DNA (RNA); mapping or prediction of binding site for aregulatory protein; characterization of regulatory mutations. Currently,the RegTransBase content is derived from about 3000 relevant articlesdescribing over 7000 experiments in relation to 128 microbes. It containsdata on the regulation of about 7500 genes and evidence for 6500interactions with 650 regulators. RegTransBase also contains manuallycreated position weight matrices (PWM) that can be used to identifycandidate regulatory sites in over 60 species. RegTransBase is availableat http://regtransbase.lbl.gov.

  7. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  8. Comparison of cluster-based and source-attribution methods for estimating transmission risk using large HIV sequence databases.

    Science.gov (United States)

    Le Vu, Stéphane; Ratmann, Oliver; Delpech, Valerie; Brown, Alison E; Gill, O Noel; Tostevin, Anna; Fraser, Christophe; Volz, Erik M

    2018-06-01

    Phylogenetic clustering of HIV sequences from a random sample of patients can reveal epidemiological transmission patterns, but interpretation is hampered by limited theoretical support and statistical properties of clustering analysis remain poorly understood. Alternatively, source attribution methods allow fitting of HIV transmission models and thereby quantify aspects of disease transmission. A simulation study was conducted to assess error rates of clustering methods for detecting transmission risk factors. We modeled HIV epidemics among men having sex with men and generated phylogenies comparable to those that can be obtained from HIV surveillance data in the UK. Clustering and source attribution approaches were applied to evaluate their ability to identify patient attributes as transmission risk factors. We find that commonly used methods show a misleading association between cluster size or odds of clustering and covariates that are correlated with time since infection, regardless of their influence on transmission. Clustering methods usually have higher error rates and lower sensitivity than source attribution method for identifying transmission risk factors. But neither methods provide robust estimates of transmission risk ratios. Source attribution method can alleviate drawbacks from phylogenetic clustering but formal population genetic modeling may be required to estimate quantitative transmission risk factors. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  9. Consensus coding sequence (CCDS) database: a standardized set of human and mouse protein-coding regions supported by expert curation.

    Science.gov (United States)

    Pujar, Shashikant; O'Leary, Nuala A; Farrell, Catherine M; Loveland, Jane E; Mudge, Jonathan M; Wallin, Craig; Girón, Carlos G; Diekhans, Mark; Barnes, If; Bennett, Ruth; Berry, Andrew E; Cox, Eric; Davidson, Claire; Goldfarb, Tamara; Gonzalez, Jose M; Hunt, Toby; Jackson, John; Joardar, Vinita; Kay, Mike P; Kodali, Vamsi K; Martin, Fergal J; McAndrews, Monica; McGarvey, Kelly M; Murphy, Michael; Rajput, Bhanu; Rangwala, Sanjida H; Riddick, Lillian D; Seal, Ruth L; Suner, Marie-Marthe; Webb, David; Zhu, Sophia; Aken, Bronwen L; Bruford, Elspeth A; Bult, Carol J; Frankish, Adam; Murphy, Terence; Pruitt, Kim D

    2018-01-04

    The Consensus Coding Sequence (CCDS) project provides a dataset of protein-coding regions that are identically annotated on the human and mouse reference genome assembly in genome annotations produced independently by NCBI and the Ensembl group at EMBL-EBI. This dataset is the product of an international collaboration that includes NCBI, Ensembl, HUGO Gene Nomenclature Committee, Mouse Genome Informatics and University of California, Santa Cruz. Identically annotated coding regions, which are generated using an automated pipeline and pass multiple quality assurance checks, are assigned a stable and tracked identifier (CCDS ID). Additionally, coordinated manual review by expert curators from the CCDS collaboration helps in maintaining the integrity and high quality of the dataset. The CCDS data are available through an interactive web page (https://www.ncbi.nlm.nih.gov/CCDS/CcdsBrowse.cgi) and an FTP site (ftp://ftp.ncbi.nlm.nih.gov/pub/CCDS/). In this paper, we outline the ongoing work, growth and stability of the CCDS dataset and provide updates on new collaboration members and new features added to the CCDS user interface. We also present expert curation scenarios, with specific examples highlighting the importance of an accurate reference genome assembly and the crucial role played by input from the research community. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

  10. Database Description - TMFunction | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available sidue (or mutant) in a protein. The experimental data are collected from the literature both by searching th...the sequence database, UniProt, structural database, PDB, and literature database

  11. HMMerThread: detecting remote, functional conserved domains in entire genomes by combining relaxed sequence-database searches with fold recognition.

    Directory of Open Access Journals (Sweden)

    Charles Richard Bradshaw

    Full Text Available Conserved domains in proteins are one of the major sources of functional information for experimental design and genome-level annotation. Though search tools for conserved domain databases such as Hidden Markov Models (HMMs are sensitive in detecting conserved domains in proteins when they share sufficient sequence similarity, they tend to miss more divergent family members, as they lack a reliable statistical framework for the detection of low sequence similarity. We have developed a greatly improved HMMerThread algorithm that can detect remotely conserved domains in highly divergent sequences. HMMerThread combines relaxed conserved domain searches with fold recognition to eliminate false positive, sequence-based identifications. With an accuracy of 90%, our software is able to automatically predict highly divergent members of conserved domain families with an associated 3-dimensional structure. We give additional confidence to our predictions by validation across species. We have run HMMerThread searches on eight proteomes including human and present a rich resource of remotely conserved domains, which adds significantly to the functional annotation of entire proteomes. We find ∼4500 cross-species validated, remotely conserved domain predictions in the human proteome alone. As an example, we find a DNA-binding domain in the C-terminal part of the A-kinase anchor protein 10 (AKAP10, a PKA adaptor that has been implicated in cardiac arrhythmias and premature cardiac death, which upon stress likely translocates from mitochondria to the nucleus/nucleolus. Based on our prediction, we propose that with this HLH-domain, AKAP10 is involved in the transcriptional control of stress response. Further remotely conserved domains we discuss are examples from areas such as sporulation, chromosome segregation and signalling during immune response. The HMMerThread algorithm is able to automatically detect the presence of remotely conserved domains in

  12. Rfam: annotating families of non-coding RNA sequences.

    Science.gov (United States)

    Daub, Jennifer; Eberhardt, Ruth Y; Tate, John G; Burge, Sarah W

    2015-01-01

    The primary task of the Rfam database is to collate experimentally validated noncoding RNA (ncRNA) sequences from the published literature and facilitate the prediction and annotation of new homologues in novel nucleotide sequences. We group homologous ncRNA sequences into "families" and related families are further grouped into "clans." We collate and manually curate data cross-references for these families from other databases and external resources. Our Web site offers researchers a simple interface to Rfam and provides tools with which to annotate their own sequences using our covariance models (CMs), through our tools for searching, browsing, and downloading information on Rfam families. In this chapter, we will work through examples of annotating a query sequence, collating family information, and searching for data.

  13. Single nucleotide polymorphism in transcriptional regulatory regions and expression of environmentally responsive genes

    International Nuclear Information System (INIS)

    Wang, Xuting; Tomso, Daniel J.; Liu Xuemei; Bell, Douglas A.

    2005-01-01

    Single nucleotide polymorphisms (SNPs) in the human genome are DNA sequence variations that can alter an individual's response to environmental exposure. SNPs in gene coding regions can lead to changes in the biological properties of the encoded protein. In contrast, SNPs in non-coding gene regulatory regions may affect gene expression levels in an allele-specific manner, and these functional polymorphisms represent an important but relatively unexplored class of genetic variation. The main challenge in analyzing these SNPs is a lack of robust computational and experimental methods. Here, we first outline mechanisms by which genetic variation can impact gene regulation, and review recent findings in this area; then, we describe a methodology for bioinformatic discovery and functional analysis of regulatory SNPs in cis-regulatory regions using the assembled human genome sequence and databases on sequence polymorphism and gene expression. Our method integrates SNP and gene databases and uses a set of computer programs that allow us to: (1) select SNPs, from among the >9 million human SNPs in the NCBI dbSNP database, that are similar to cis-regulatory element (RE) consensus sequences; (2) map the selected dbSNP entries to the human genome assembly in order to identify polymorphic REs near gene start sites; (3) prioritize the candidate polymorphic RE containing genes by searching the existing genotype and gene expression data sets. The applicability of this system has been demonstrated through studies on p53 responsive elements and is being extended to additional pathways and environmentally responsive genes

  14. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

    2016-01-01

    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  15. Isolation of laccase gene-specific sequences from white rot and brown rot fungi by PCR

    Energy Technology Data Exchange (ETDEWEB)

    D`Souza, T.M.; Boominathan, K.; Reddy, C.A. [Michigan State Univ., East Lansing, MI (United States)

    1996-10-01

    Degenerate primers corresponding to the consensus sequences of the copper-binding regions in the N-terminal domains of known basidiomycete laccases were used to isolate laccase gene-specific sequences from strains representing nine genera of wood rot fungi. All except three gave the expected PCR product of about 200 bp. Computer searches of the databases identified the sequences of each of the PCR product of about 200 bp. Computer searches of the databases identified the sequence of each of the PCR products analyzed as a laccase gene sequence, suggesting the specificity of the primers. PCR products of the white rot fungi Ganoderma lucidum, Phlebia brevispora, and Trametes versicolor showed 65 to 74% nucleotide sequence similarity to each other; the similarity in deduced amino acid sequences was 83 to 91%. The PCR products of Lentinula edodes and Lentinus tigrinus, on the other hand, showed relatively low nucleotide and amino acid similarities (58 to 64 and 62 to 81%, respectively); however, these similarities were still much higher than when compared with the corresponding regions in the laccases of the ascomycete fungi Aspergillus nidulans and Neurospora crassa. A few of the white rot fungi, as well as Gloeophyllum trabeum, a brown rot fungus, gave a 144-bp PCR fragment which had a nucleotide sequence similarity of 60 to 71%. Demonstration of laccase activity in G. trabeum and several other brown rot fungi was of particular interest because these organisms were not previously shown to produce laccases. 36 refs., 6 figs., 2 tabs.

  16. Database for the ampC alleles in Acinetobacter baumannii.

    Directory of Open Access Journals (Sweden)

    Nabil Karah

    Full Text Available Acinetobacter baumannii is a troublesome opportunistic pathogen with a high capacity for clonal dissemination. We announce the establishment of a database for the ampC locus in A. baumannii, in which novel ampC alleles are differentiated based on the occurrence of ≥ 1 nucleotide change, regardless of whether it is silent or missense. The database is openly accessible at the pubmlst platform for A. baumannii (http://pubmlst.org/abaumannii/. Forty-eight distinctive alleles of the ampC locus have so far been identified and deposited in the database. Isolates from clonal complex 1 (CC1, according to the Pasteur multilocus sequence typing scheme, had a variety of the ampC locus alleles, including alleles 1, 3, 4, 5, 6, 7, 8, 13, 14, 17, and 18. On the other hand, isolates from CC2 had the ampC alleles 2, 3, 19, 20, 21, 22, 23, 24, 26, 27, 28, and 46. Allele 3 was characteristic for sequence types ST3 or ST32. The ampC alleles 10, 16, and 25 were characteristic for CC10, ST16, and CC25, respectively. Our study points out that novel gene databases, in which alleles are numbered based on differences in their nucleotide identities, should replace traditional records that use amino acid substitutions to define new alleles.

  17. Analysis of expressed sequence tags from Actinidia: applications of a cross species EST database for gene discovery in the areas of flavor, health, color and ripening

    Directory of Open Access Journals (Sweden)

    Richardson Annette C

    2008-07-01

    Full Text Available Abstract Background Kiwifruit (Actinidia spp. are a relatively new, but economically important crop grown in many different parts of the world. Commercial success is driven by the development of new cultivars with novel consumer traits including flavor, appearance, healthful components and convenience. To increase our understanding of the genetic diversity and gene-based control of these key traits in Actinidia, we have produced a collection of 132,577 expressed sequence tags (ESTs. Results The ESTs were derived mainly from four Actinidia species (A. chinensis, A. deliciosa, A. arguta and A. eriantha and fell into 41,858 non redundant clusters (18,070 tentative consensus sequences and 23,788 EST singletons. Analysis of flavor and fragrance-related gene families (acyltransferases and carboxylesterases and pathways (terpenoid biosynthesis is presented in comparison with a chemical analysis of the compounds present in Actinidia including esters, acids, alcohols and terpenes. ESTs are identified for most genes in color pathways controlling chlorophyll degradation and carotenoid biosynthesis. In the health area, data are presented on the ESTs involved in ascorbic acid and quinic acid biosynthesis showing not only that genes for many of the steps in these pathways are represented in the database, but that genes encoding some critical steps are absent. In the convenience area, genes related to different stages of fruit softening are identified. Conclusion This large EST resource will allow researchers to undertake the tremendous challenge of understanding the molecular basis of genetic diversity in the Actinidia genus as well as provide an EST resource for comparative fruit genomics. The various bioinformatics analyses we have undertaken demonstrates the extent of coverage of ESTs for genes encoding different biochemical pathways in Actinidia.

  18. A new version of the RDP (Ribosomal Database Project)

    Science.gov (United States)

    Maidak, B. L.; Cole, J. R.; Parker, C. T. Jr; Garrity, G. M.; Larsen, N.; Li, B.; Lilburn, T. G.; McCaughey, M. J.; Olsen, G. J.; Overbeek, R.; hide

    1999-01-01

    The Ribosomal Database Project (RDP-II), previously described by Maidak et al. [ Nucleic Acids Res. (1997), 25, 109-111], is now hosted by the Center for Microbial Ecology at Michigan State University. RDP-II is a curated database that offers ribosomal RNA (rRNA) nucleotide sequence data in aligned and unaligned forms, analysis services, and associated computer programs. During the past two years, data alignments have been updated and now include >9700 small subunit rRNA sequences. The recent development of an ObjectStore database will provide more rapid updating of data, better data accuracy and increased user access. RDP-II includes phylogenetically ordered alignments of rRNA sequences, derived phylogenetic trees, rRNA secondary structure diagrams, and various software programs for handling, analyzing and displaying alignments and trees. The data are available via anonymous ftp (ftp.cme.msu. edu) and WWW (http://www.cme.msu.edu/RDP). The WWW server provides ribosomal probe checking, approximate phylogenetic placement of user-submitted sequences, screening for possible chimeric rRNA sequences, automated alignment, and a suggested placement of an unknown sequence on an existing phylogenetic tree. Additional utilities also exist at RDP-II, including distance matrix, T-RFLP, and a Java-based viewer of the phylogenetic trees that can be used to create subtrees.

  19. Permanent genetic resources added to molecular ecology resources database 1 june 2011–31 july 2011

    DEFF Research Database (Denmark)

    Barker, F. Keith; Bell, James J.; Bogdanowicz, Steven M.

    2011-01-01

    This article documents the addition of 112 microsatellite marker loci and 24 pairs of single nucleotide polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Agelaius phoeniceus, Austrolittorina cincta, Circus cyaneus......, Circus macrourus, Circus pygargus, Cryptocoryne · purpurea Ridl. nothovar. purpurea, Mya arenaria, Patagioenas squamosa, Prochilodus mariae, Scylla serrata and Scytalopus speluncae. These loci were cross-tested on the following species: Cryptocoryne · purpurea nothovar. purpurea, Cryptocoryne affinis...

  20. Adaptive Processing for Sequence Alignment

    KAUST Repository

    Zidan, Mohammed A.; Bonny, Talal; Salama, Khaled N.

    2012-01-01

    Disclosed are various embodiments for adaptive processing for sequence alignment. In one embodiment, among others, a method includes obtaining a query sequence and a plurality of database sequences. A first portion of the plurality of database sequences is distributed to a central processing unit (CPU) and a second portion of the plurality of database sequences is distributed to a graphical processing unit (GPU) based upon a predetermined splitting ratio associated with the plurality of database sequences, where the database sequences of the first portion are shorter than the database sequences of the second portion. A first alignment score for the query sequence is determined with the CPU based upon the first portion of the plurality of database sequences and a second alignment score for the query sequence is determined with the GPU based upon the second portion of the plurality of database sequences.

  1. Adaptive Processing for Sequence Alignment

    KAUST Repository

    Zidan, Mohammed A.

    2012-01-26

    Disclosed are various embodiments for adaptive processing for sequence alignment. In one embodiment, among others, a method includes obtaining a query sequence and a plurality of database sequences. A first portion of the plurality of database sequences is distributed to a central processing unit (CPU) and a second portion of the plurality of database sequences is distributed to a graphical processing unit (GPU) based upon a predetermined splitting ratio associated with the plurality of database sequences, where the database sequences of the first portion are shorter than the database sequences of the second portion. A first alignment score for the query sequence is determined with the CPU based upon the first portion of the plurality of database sequences and a second alignment score for the query sequence is determined with the GPU based upon the second portion of the plurality of database sequences.

  2. KAIKObase: An integrated silkworm genome database and data mining tool

    Directory of Open Access Journals (Sweden)

    Nagaraju Javaregowda

    2009-10-01

    Full Text Available Abstract Background The silkworm, Bombyx mori, is one of the most economically important insects in many developing countries owing to its large-scale cultivation for silk production. With the development of genomic and biotechnological tools, B. mori has also become an important bioreactor for production of various recombinant proteins of biomedical interest. In 2004, two genome sequencing projects for B. mori were reported independently by Chinese and Japanese teams; however, the datasets were insufficient for building long genomic scaffolds which are essential for unambiguous annotation of the genome. Now, both the datasets have been merged and assembled through a joint collaboration between the two groups. Description Integration of the two data sets of silkworm whole-genome-shotgun sequencing by the Japanese and Chinese groups together with newly obtained fosmid- and BAC-end sequences produced the best continuity (~3.7 Mb in N50 scaffold size among the sequenced insect genomes and provided a high degree of nucleotide coverage (88% of all 28 chromosomes. In addition, a physical map of BAC contigs constructed by fingerprinting BAC clones and a SNP linkage map constructed using BAC-end sequences were available. In parallel, proteomic data from two-dimensional polyacrylamide gel electrophoresis in various tissues and developmental stages were compiled into a silkworm proteome database. Finally, a Bombyx trap database was constructed for documenting insertion positions and expression data of transposon insertion lines. Conclusion For efficient usage of genome information for functional studies, genomic sequences, physical and genetic map information and EST data were compiled into KAIKObase, an integrated silkworm genome database which consists of 4 map viewers, a gene viewer, and sequence, keyword and position search systems to display results and data at the level of nucleotide sequence, gene, scaffold and chromosome. Integration of the

  3. The diploid genome sequence of an Asian individual

    DEFF Research Database (Denmark)

    Wang, Jun; Wang, Wei; Li, Ruiqiang

    2008-01-01

    Here we present the first diploid genome sequence of an Asian individual. The genome was sequenced to 36-fold average coverage using massively parallel sequencing technology. We aligned the short reads onto the NCBI human reference genome to 99.97% coverage, and guided by the reference genome, we...... used uniquely mapped reads to assemble a high-quality consensus sequence for 92% of the Asian individual's genome. We identified approximately 3 million single-nucleotide polymorphisms (SNPs) inside this region, of which 13.6% were not in the dbSNP database. Genotyping analysis showed that SNP...... identification had high accuracy and consistency, indicating the high sequence quality of this assembly. We also carried out heterozygote phasing and haplotype prediction against HapMap CHB and JPT haplotypes (Chinese and Japanese, respectively), sequence comparison with the two available individual genomes (J...

  4. Improving taxonomic accuracy for fungi in public sequence databases: applying ‘one name one species’ in well-defined genera with Trichoderma/Hypocrea as a test case

    Science.gov (United States)

    Strope, Pooja K; Chaverri, Priscila; Gazis, Romina; Ciufo, Stacy; Domrachev, Michael; Schoch, Conrad L

    2017-01-01

    Abstract The ITS (nuclear ribosomal internal transcribed spacer) RefSeq database at the National Center for Biotechnology Information (NCBI) is dedicated to the clear association between name, specimen and sequence data. This database is focused on sequences obtained from type material stored in public collections. While the initial ITS sequence curation effort together with numerous fungal taxonomy experts attempted to cover as many orders as possible, we extended our latest focus to the family and genus ranks. We focused on Trichoderma for several reasons, mainly because the asexual and sexual synonyms were well documented, and a list of proposed names and type material were recently proposed and published. In this case study the recent taxonomic information was applied to do a complete taxonomic audit for the genus Trichoderma in the NCBI Taxonomy database. A name status report is available here: https://www.ncbi.nlm.nih.gov/Taxonomy/TaxIdentifier/tax_identifier.cgi. As a result, the ITS RefSeq Targeted Loci database at NCBI has been augmented with more sequences from type and verified material from Trichoderma species. Additionally, to aid in the cross referencing of data from single loci and genomes we have collected a list of quality records of the RPB2 gene obtained from type material in GenBank that could help validate future submissions. During the process of curation misidentified genomes were discovered, and sequence records from type material were found hidden under previous classifications. Source metadata curation, although more cumbersome, proved to be useful as confirmation of the type material designation. Database URL: http://www.ncbi.nlm.nih.gov/bioproject/PRJNA177353 PMID:29220466

  5. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Science.gov (United States)

    Leonard, Guy; Stevens, Jamie R.; Richards, Thomas A.

    2009-01-01

    The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment file, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree files (with a user-defined combination of species name and/or database accession number). Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file) and generation of species and accession number lists for use in supplementary materials or figure legends. PMID:19812722

  6. REFGEN and TREENAMER: Automated Sequence Data Handling for Phylogenetic Analysis in the Genomic Era

    Directory of Open Access Journals (Sweden)

    Guy Leonard

    2009-01-01

    Full Text Available The phylogenetic analysis of nucleotide sequences and increasingly that of amino acid sequences is used to address a number of biological questions. Access to extensive datasets, including numerous genome projects, means that standard phylogenetic analyses can include many hundreds of sequences. Unfortunately, most phylogenetic analysis programs do not tolerate the sequence naming conventions of genome databases. Managing large numbers of sequences and standardizing sequence labels for use in phylogenetic analysis programs can be a time consuming and laborious task. Here we report the availability of an online resource for the management of gene sequences recovered from public access genome databases such as GenBank. These web utilities include the facility for renaming every sequence in a FASTA alignment fi le, with each sequence label derived from a user-defined combination of the species name and/or database accession number. This facility enables the user to keep track of the branching order of the sequences/taxa during multiple tree calculations and re-optimisations. Post phylogenetic analysis, these webpages can then be used to rename every label in the subsequent tree fi les (with a user-defined combination of species name and/or database accession number. Together these programs drastically reduce the time required for managing sequence alignments and labelling phylogenetic figures. Additional features of our platform include the automatic removal of identical accession numbers (recorded in the report file and generation of species and accession number lists for use in supplementary materials or figure legends.

  7. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  8. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  9. Canis mtDNA HV1 database: a web-based tool for collecting and surveying Canis mtDNA HV1 haplotype in public database.

    Science.gov (United States)

    Thai, Quan Ke; Chung, Dung Anh; Tran, Hoang-Dung

    2017-06-26

    Canine and wolf mitochondrial DNA haplotypes, which can be used for forensic or phylogenetic analyses, have been defined in various schemes depending on the region analyzed. In recent studies, the 582 bp fragment of the HV1 region is most commonly used. 317 different canine HV1 haplotypes have been reported in the rapidly growing public database GenBank. These reported haplotypes contain several inconsistencies in their haplotype information. To overcome this issue, we have developed a Canis mtDNA HV1 database. This database collects data on the HV1 582 bp region in dog mitochondrial DNA from the GenBank to screen and correct the inconsistencies. It also supports users in detection of new novel mutation profiles and assignment of new haplotypes. The Canis mtDNA HV1 database (CHD) contains 5567 nucleotide entries originating from 15 subspecies in the species Canis lupus. Of these entries, 3646 were haplotypes and grouped into 804 distinct sequences. 319 sequences were recognized as previously assigned haplotypes, while the remaining 485 sequences had new mutation profiles and were marked as new haplotype candidates awaiting further analysis for haplotype assignment. Of the 3646 nucleotide entries, only 414 were annotated with correct haplotype information, while 3232 had insufficient or lacked haplotype information and were corrected or modified before storing in the CHD. The CHD can be accessed at http://chd.vnbiology.com . It provides sequences, haplotype information, and a web-based tool for mtDNA HV1 haplotyping. The CHD is updated monthly and supplies all data for download. The Canis mtDNA HV1 database contains information about canine mitochondrial DNA HV1 sequences with reconciled annotation. It serves as a tool for detection of inconsistencies in GenBank and helps identifying new HV1 haplotypes. Thus, it supports the scientific community in naming new HV1 haplotypes and to reconcile existing annotation of HV1 582 bp sequences.

  10. Viral Genome DataBase: storing and analyzing genes and proteins from complete viral genomes.

    Science.gov (United States)

    Hiscock, D; Upton, C

    2000-05-01

    The Viral Genome DataBase (VGDB) contains detailed information of the genes and predicted protein sequences from 15 completely sequenced genomes of large (&100 kb) viruses (2847 genes). The data that is stored includes DNA sequence, protein sequence, GenBank and user-entered notes, molecular weight (MW), isoelectric point (pI), amino acid content, A + T%, nucleotide frequency, dinucleotide frequency and codon use. The VGDB is a mySQL database with a user-friendly JAVA GUI. Results of queries can be easily sorted by any of the individual parameters. The software and additional figures and information are available at http://athena.bioc.uvic.ca/genomes/index.html .

  11. Systematization of the protein sequence diversity in enzymes related to secondary metabolic pathways in plants, in the context of big data biology inspired by the KNApSAcK motorcycle database.

    Science.gov (United States)

    Ikeda, Shun; Abe, Takashi; Nakamura, Yukiko; Kibinge, Nelson; Hirai Morita, Aki; Nakatani, Atsushi; Ono, Naoaki; Ikemura, Toshimichi; Nakamura, Kensuke; Altaf-Ul-Amin, Md; Kanaya, Shigehiko

    2013-05-01

    Biology is increasingly becoming a data-intensive science with the recent progress of the omics fields, e.g. genomics, transcriptomics, proteomics and metabolomics. The species-metabolite relationship database, KNApSAcK Core, has been widely utilized and cited in metabolomics research, and chronological analysis of that research work has helped to reveal recent trends in metabolomics research. To meet the needs of these trends, the KNApSAcK database has been extended by incorporating a secondary metabolic pathway database called Motorcycle DB. We examined the enzyme sequence diversity related to secondary metabolism by means of batch-learning self-organizing maps (BL-SOMs). Initially, we constructed a map by using a big data matrix consisting of the frequencies of all possible dipeptides in the protein sequence segments of plants and bacteria. The enzyme sequence diversity of the secondary metabolic pathways was examined by identifying clusters of segments associated with certain enzyme groups in the resulting map. The extent of diversity of 15 secondary metabolic enzyme groups is discussed. Data-intensive approaches such as BL-SOM applied to big data matrices are needed for systematizing protein sequences. Handling big data has become an inevitable part of biology.

  12. Gene Unprediction with Spurio: A tool to identify spurious protein sequences.

    Science.gov (United States)

    Höps, Wolfram; Jeffryes, Matt; Bateman, Alex

    2018-01-01

    We now have access to the sequences of tens of millions of proteins. These protein sequences are essential for modern molecular biology and computational biology. The vast majority of protein sequences are derived from gene prediction tools and have no experimental supporting evidence for their translation.  Despite the increasing accuracy of gene prediction tools there likely exists a large number of spurious protein predictions in the sequence databases.  We have developed the Spurio tool to help identify spurious protein predictions in prokaryotes.  Spurio searches the query protein sequence against a prokaryotic nucleotide database using tblastn and identifies homologous sequences. The tblastn matches are used to score the query sequence's likelihood of being a spurious protein prediction using a Gaussian process model. The most informative feature is the appearance of stop codons within the presumed translation of homologous DNA sequences. Benchmarking shows that the Spurio tool is able to distinguish spurious from true proteins. However, transposon proteins are prone to be predicted as spurious because of the frequency of degraded homologs found in the DNA sequence databases. Our initial experiments suggest that less than 1% of the proteins in the UniProtKB sequence database are likely to be spurious and that Spurio is able to identify over 60 times more spurious proteins than the AntiFam resource. The Spurio software and source code is available under an MIT license at the following URL: https://bitbucket.org/bateman-group/spurio.

  13. Nucleotide sequence of soybean chloroplast DNA regions which contain the psb A and trn H genes and cover the ends of the large single copy region and one end of the inverted repeats.

    Science.gov (United States)

    Spielmann, A; Stutz, E

    1983-10-25

    The soybean chloroplast psb A gene (photosystem II thylakoid membrane protein of Mr 32 000, lysine-free) and the trn H gene (tRNAHisGUG), which both map in the large single copy region adjacent to one of the inverted repeat structures (IR1), have been sequenced including flanking regions. The psb A gene shows in its structural part 92% sequence homology with the corresponding genes of spinach and N. debneyi and contains also an open reading frame for 353 aminoacids. The aminoacid sequence of a potential primary translation product (calculated Mr, 38 904, no lysine) diverges from that of spinach and N. debneyi in only two positions in the C-terminal part. The trn H gene has the same polarity as the psb A gene and the coding region is located at the very end of the large single copy region. The deduced sequence of the soybean chloroplast tRNAHisGUG is identical with that of Zea mays chloroplasts. Both ends of the large single copy region were sequenced including a small segment of the adjacent IR1 and IR2.

  14. Generation and analysis of a large-scale expressed sequence Tag database from a full-length enriched cDNA library of developing leaves of Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Min Lin

    Full Text Available BACKGROUND: Cotton (Gossypium hirsutum L. is one of the world's most economically-important crops. However, its entire genome has not been sequenced, and limited resources are available in GenBank for understanding the molecular mechanisms underlying leaf development and senescence. METHODOLOGY/PRINCIPAL FINDINGS: In this study, 9,874 high-quality ESTs were generated from a normalized, full-length cDNA library derived from pooled RNA isolated from throughout leaf development during the plant blooming stage. After clustering and assembly of these ESTs, 5,191 unique sequences, representative 1,652 contigs and 3,539 singletons, were obtained. The average unique sequence length was 682 bp. Annotation of these unique sequences revealed that 84.4% showed significant homology to sequences in the NCBI non-redundant protein database, and 57.3% had significant hits to known proteins in the Swiss-Prot database. Comparative analysis indicated that our library added 2,400 ESTs and 991 unique sequences to those known for cotton. The unigenes were functionally characterized by gene ontology annotation. We identified 1,339 and 200 unigenes as potential leaf senescence-related genes and transcription factors, respectively. Moreover, nine genes related to leaf senescence and eleven MYB transcription factors were randomly selected for quantitative real-time PCR (qRT-PCR, which revealed that these genes were regulated differentially during senescence. The qRT-PCR for three GhYLSs revealed that these genes express express preferentially in senescent leaves. CONCLUSIONS/SIGNIFICANCE: These EST resources will provide valuable sequence information for gene expression profiling analyses and functional genomics studies to elucidate their roles, as well as for studying the mechanisms of leaf development and senescence in cotton and discovering candidate genes related to important agronomic traits of cotton. These data will also facilitate future whole-genome sequence

  15. The Pisa pre-main sequence tracks and isochrones. A database covering a wide range of Z, Y, mass, and age values

    Science.gov (United States)

    Tognelli, E.; Prada Moroni, P. G.; Degl'Innocenti, S.

    2011-09-01

    Context. In recent years new observations of pre-main sequence stars (pre-MS) with Z ≤ Z⊙ have been made available. To take full advantage of the continuously growing amount of data of pre-MS stars in different environments, we need to develop updated pre-MS models for a wide range of metallicity to assign reliable ages and masses to the observed stars. Aims: We present updated evolutionary pre-MS models and isochrones for a fine grid of mass, age, metallicity, and helium values. Methods: We use a standard and well-tested stellar evolutionary code (i.e. FRANEC), that adopts outer boundary conditions from detailed and realistic atmosphere models. In this code, we incorporate additional improvements to the physical inputs related to the equation of state and the low temperature radiative opacities essential to computing low-mass stellar models. Results: We make available via internet a large database of pre-MS tracks and isochrones for a wide range of chemical compositions (Z = 0.0002-0.03), masses (M = 0.2-7.0 M⊙), and ages (1-100 Myr) for a solar-calibrated mixing length parameter α (i.e. 1.68). For each chemical composition, additional models were computed with two different mixing length values, namely α = 1.2 and 1.9. Moreover, for Z ≥ 0.008, we also provided models with two different initial deuterium abundances. The characteristics of the models have been discussed in detail and compared with other work in the literature. The main uncertainties affecting theoretical predictions have been critically discussed. Comparisons with selected data indicate that there is close agreement between theory and observation. Tracks and isochrones are available on the web at the http://astro.df.unipi.it/stellar-models/Tracks and isochrones are also available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/533/A109

  16. Comprehensive two-dimensional gel protein databases offer a global approach to the analysis of human cells: the transformed amnion cells (AMA) master database and its link to genome DNA sequence data

    DEFF Research Database (Denmark)

    Celis, J E; Gesser, B; Rasmussen, H H

    1990-01-01

    , mitochondria, Golgi, ribosomes, intermediate filaments, microfilaments and microtubules), levels in fetal human tissues, partial protein sequences (containing information on 48 human proteins microsequenced so far), cell cycle-regulated proteins, proteins sensitive to interferons alpha, beta, and gamma, heat...

  17. Dictionary as Database.

    Science.gov (United States)

    Painter, Derrick

    1996-01-01

    Discussion of dictionaries as databases focuses on the digitizing of The Oxford English dictionary (OED) and the use of Standard Generalized Mark-Up Language (SGML). Topics include the creation of a consortium to digitize the OED, document structure, relational databases, text forms, sequence, and discourse. (LRW)

  18. Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011 - 30 November 2011

    KAUST Repository

    Abreu, Aluana Gonç alves; Albaina, A.; Alpermann, Tilman J.; Apkenas, Vanessa E.; Bankhead-Dronnet, Sté phanie; Bergek, Sara; Berumen, Michael L.; Cho, Changhung; Clobert, Jean; Coulon, Auré lie; De Feraudy, D.; Estonba, Andone; Hankeln, Thomas M A; Hochkirch, Axel; Hsu, Tsaiwen; Huang, Tsurngjuhn; Irigoien, Xabier; Iriondo, Mikel; Kay, Kathleen M.; Kinitz, Tim; Kothera, Linda; Le Hé nanff, Maxime; Lieutier, Franç ois; Lourdais, Olivier; Macrini, Camila M T; Manzano, Carmen; Martin, Carine; Morris, Veronica Ruth Franco; Nanninga, Gerrit B.; Pardo, D.; Plieske, Jö rg; Pointeau, Sophie; Prestegaard, Tore; Quack, Markus; Richard, Murielle; Savage, Harry M.; Schwarcz, Kaiser D.; Shade, Jessica; Simms, Ellen L.; Solferini, Vera Nisaka; Stevens, Virginie M.; Veith, Michael W.; Wen, Meijuan; Wicker, Florian; Yost, Jenn M.; Zarraonaindia, Iratxe

    2012-01-01

    This article documents the addition of 139 microsatellite marker loci and 90 pairs of single-nucleotide polymorphism sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Aglaoctenus lagotis, Costus pulverulentus, Costus scaber, Culex pipiens, Dascyllus marginatus, Lupinus nanus Benth, Phloeomyzus passerini, Podarcis muralis, Rhododendron rubropilosum Hayata var. taiwanalpinum and Zoarces viviparus. These loci were cross-tested on the following species: Culex quinquefasciatus, Rhododendron pseudochrysanthum Hay. ssp. morii (Hay.) Yamazaki and R. pseudochrysanthum Hayata. This article also documents the addition of 48 sequencing primer pairs and 90 allele-specific primers for Engraulis encrasicolus. © 2012 Blackwell Publishing Ltd.

  19. Permanent Genetic Resources added to Molecular Ecology Resources Database 1 October 2011 - 30 November 2011

    KAUST Repository

    Abreu, Aluana Gonçalves

    2012-02-01

    This article documents the addition of 139 microsatellite marker loci and 90 pairs of single-nucleotide polymorphism sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Aglaoctenus lagotis, Costus pulverulentus, Costus scaber, Culex pipiens, Dascyllus marginatus, Lupinus nanus Benth, Phloeomyzus passerini, Podarcis muralis, Rhododendron rubropilosum Hayata var. taiwanalpinum and Zoarces viviparus. These loci were cross-tested on the following species: Culex quinquefasciatus, Rhododendron pseudochrysanthum Hay. ssp. morii (Hay.) Yamazaki and R. pseudochrysanthum Hayata. This article also documents the addition of 48 sequencing primer pairs and 90 allele-specific primers for Engraulis encrasicolus. © 2012 Blackwell Publishing Ltd.

  20. Human Retroviruses and AIDS. A compilation and analysis of nucleic acid and amino acid sequences: I--II; III--V

    Energy Technology Data Exchange (ETDEWEB)

    Myers, G.; Korber, B. [eds.] [Los Alamos National Lab., NM (United States); Wain-Hobson, S. [ed.] [Laboratory of Molecular Retrovirology, Pasteur Inst.; Smith, R.F. [ed.] [Baylor Coll. of Medicine, Houston, TX (United States). Dept. of Pharmacology; Pavlakis, G.N. [ed.] [National Cancer Inst., Frederick, MD (United States). Cancer Research Facility

    1993-12-31

    This compendium and the accompanying floppy diskettes are the result of an effort to compile and rapidly publish all relevant molecular data concerning the human immunodeficiency viruses (HIV) and related retroviruses. The scope of the compendium and database is best summarized by the five parts that it comprises: (I) HIV and SIV Nucleotide Sequences; (II) Amino Acid Sequences; (III) Analyses; (IV) Related Sequences; and (V) Database Communications. Information within all the parts is updated at least twice in each year, which accounts for the modes of binding and pagination in the compendium.

  1. DSAP: deep-sequencing small RNA analysis pipeline.

    Science.gov (United States)

    Huang, Po-Jung; Liu, Yi-Chung; Lee, Chi-Ching; Lin, Wei-Chen; Gan, Richie Ruei-Chi; Lyu, Ping-Chiang; Tang, Petrus

    2010-07-01

    DSAP is an automated multiple-task web service designed to provide a total solution to analyzing deep-sequencing small RNA datasets generated by next-generation sequencing technology. DSAP uses a tab-delimited file as an input format, which holds the unique sequence reads (tags) and their corresponding number of copies generated by the Solexa sequencing platform. The input data will go through four analysis steps in DSAP: (i) cleanup: removal of adaptors and poly-A/T/C/G/N nucleotides; (ii) clustering: grouping of cleaned sequence tags into unique sequence clusters; (iii) non-coding RNA (ncRNA) matching: sequence homology mapping against a transcribed sequence library from the ncRNA database Rfam (http://rfam.sanger.ac.uk/); and (iv) known miRNA matching: detection of known miRNAs in miRBase (http://www.mirbase.org/) based on sequence homology. The expression levels corresponding to matched ncRNAs and miRNAs are summarized in multi-color clickable bar charts linked to external databases. DSAP is also capable of displaying miRNA expression levels from different jobs using a log(2)-scaled color matrix. Furthermore, a cross-species comparative function is also provided to show the distribution of identified miRNAs in different species as deposited in miRBase. DSAP is available at http://dsap.cgu.edu.tw.

  2. Whole exome sequencing identifies novel mutation in eight Chinese children with isolated tetralogy of Fallot.

    Science.gov (United States)

    Liu, Lin; Wang, Hong-Dan; Cui, Cun-Ying; Qin, Yun-Yun; Fan, Tai-Bing; Peng, Bang-Tian; Zhang, Lian-Zhong; Wang, Cheng-Zeng

    2017-12-05

    Tetralogy of Fallot is the most common cyanotic congenital heart disease. However, its pathogenesis remains to be clarified. The purpose of this study was to identify the genetic variants in Tetralogy of Fallot by whole exome sequencing. Whole exome sequencing was performed among eight small families with Tetralogy of Fallot. Differential single nucleotide polymorphisms and small InDels were found by alignment within families and between families and then were verified by Sanger sequencing. Tetralogy of Fallot-related genes were determined by analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases. A total of sixteen differential single nucleotide polymorphisms loci and eight differential small InDels were discovered. The sixteen differential single nucleotide polymorphisms loci were located on Chr 1, 2, 4, 5, 11, 12, 15, 22 and X. Among the sixteen single nucleotide polymorphisms loci, six has not been reported. The eight differential small InDels were located on Chr 2, 4, 9, 12, 17, 19 and X, whereas of the eight differential small InDels, two has not been reported. Analysis using Gene Ontology /pathway, Online Mendelian Inheritance in Man, PubMed and other databases revealed that PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 were associated with Tetralogy of Fallot. Our findings identify PEX5 , NACA , ATXN2 , CELA1 , PCDHB4 and CTBP1 mutations as underlying genetic causes of isolated tetralogy of Fallot.

  3. Mixed Sequence Reader: A Program for Analyzing DNA Sequences with Heterozygous Base Calling

    Science.gov (United States)

    Chang, Chun-Tien; Tsai, Chi-Neu; Tang, Chuan Yi; Chen, Chun-Houh; Lian, Jang-Hau; Hu, Chi-Yu; Tsai, Chia-Lung; Chao, Angel; Lai, Chyong-Huey; Wang, Tzu-Hao; Lee, Yun-Shien

    2012-01-01

    The direct sequencing of PCR products generates heterozygous base-calling fluorescence chromatograms that are useful for identifying single-nucleotide polymorphisms (SNPs), insertion-deletions (indels), short tandem repeats (STRs), and paralogous genes. Indels and STRs can be easily detected using the currently available Indelligent or ShiftDetector programs, which do not search reference sequences. However, the detection of other genomic variants remains a challenge due to the lack of appropriate tools for heterozygous base-calling fluorescence chromatogram data analysis. In this study, we developed a free web-based program, Mixed Sequence Reader (MSR), which can directly analyze heterozygous base-calling fluorescence chromatogram data in .abi file format using comparisons with reference sequences. The heterozygous sequences are identified as two distinct sequences and aligned with reference sequences. Our results showed that MSR may be used to (i) physically locate indel and STR sequences and determine STR copy number by searching NCBI reference sequences; (ii) predict combinations of microsatellite patterns using the Federal Bureau of Investigation Combined DNA Index System (CODIS); (iii) determine human papilloma virus (HPV) genotypes by searching current viral databases in cases of double infections; (iv) estimate the copy number of paralogous genes, such as β-defensin 4 (DEFB4) and its paralog HSPDP3. PMID:22778697

  4. Cry-Bt identifier: a biological database for PCR detection of Cry genes present in transgenic plants.

    Science.gov (United States)

    Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil

    2009-10-23

    We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.

  5. Covariant Evolutionary Event Analysis for Base Interaction Prediction Using a Relational Database Management System for RNA.

    Science.gov (United States)

    Xu, Weijia; Ozer, Stuart; Gutell, Robin R

    2009-01-01

    With an increasingly large amount of sequences properly aligned, comparative sequence analysis can accurately identify not only common structures formed by standard base pairing but also new types