WorldWideScience

Sample records for nucleotide polymorphism-based diagnostic

  1. Microsatellite genotyping and genome-wide single nucleotide polymorphism-based indices of Plasmodium falciparum diversity within clinical infections.

    Science.gov (United States)

    Murray, Lee; Mobegi, Victor A; Duffy, Craig W; Assefa, Samuel A; Kwiatkowski, Dominic P; Laman, Eugene; Loua, Kovana M; Conway, David J

    2016-05-12

    In regions where malaria is endemic, individuals are often infected with multiple distinct parasite genotypes, a situation that may impact on evolution of parasite virulence and drug resistance. Most approaches to studying genotypic diversity have involved analysis of a modest number of polymorphic loci, although whole genome sequencing enables a broader characterisation of samples. PCR-based microsatellite typing of a panel of ten loci was performed on Plasmodium falciparum in 95 clinical isolates from a highly endemic area in the Republic of Guinea, to characterize within-isolate genetic diversity. Separately, single nucleotide polymorphism (SNP) data from genome-wide short-read sequences of the same samples were used to derive within-isolate fixation indices (F ws), an inverse measure of diversity within each isolate compared to overall local genetic diversity. The latter indices were compared with the microsatellite results, and also with indices derived by randomly sampling modest numbers of SNPs. As expected, the number of microsatellite loci with more than one allele in each isolate was highly significantly inversely correlated with the genome-wide F ws fixation index (r = -0.88, P 10 % had high correlation (r > 0.90) with the index derived using all SNPs. Different types of data give highly correlated indices of within-infection diversity, although PCR-based analysis detects low-level minority genotypes not apparent in bulk sequence analysis. When whole-genome data are not obtainable, quantitative assay of ten or more SNPs can yield a reasonably accurate estimate of the within-infection fixation index (F ws).

  2. Identification of New Single Nucleotide Polymorphism-Based Markers for Inter- and Intraspecies Discrimination of Obligate Bacterial Parasites (Pasteuria spp.) of Invertebrates ▿ †

    Science.gov (United States)

    Mauchline, Tim H.; Knox, Rachel; Mohan, Sharad; Powers, Stephen J.; Kerry, Brian R.; Davies, Keith G.; Hirsch, Penny R.

    2011-01-01

    Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of “cryptic” SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms. PMID:21803895

  3. Identification of new single nucleotide polymorphism-based markers for inter- and intraspecies discrimination of obligate bacterial parasites (Pasteuria spp.) of invertebrates.

    Science.gov (United States)

    Mauchline, Tim H; Knox, Rachel; Mohan, Sharad; Powers, Stephen J; Kerry, Brian R; Davies, Keith G; Hirsch, Penny R

    2011-09-01

    Protein-encoding and 16S rRNA genes of Pasteuria penetrans populations from a wide range of geographic locations were examined. Most interpopulation single nucleotide polymorphisms (SNPs) were detected in the 16S rRNA gene. However, in order to fully resolve all populations, these were supplemented with SNPs from protein-encoding genes in a multilocus SNP typing approach. Examination of individual 16S rRNA gene sequences revealed the occurrence of "cryptic" SNPs which were not present in the consensus sequences of any P. penetrans population. Additionally, hierarchical cluster analysis separated P. penetrans 16S rRNA gene clones into four groups, and one of which contained sequences from the most highly passaged population, demonstrating that it is possible to manipulate the population structure of this fastidious bacterium. The other groups were made from representatives of the other populations in various proportions. Comparison of sequences among three Pasteuria species, namely, P. penetrans, P. hartismeri, and P. ramosa, showed that the protein-encoding genes provided greater discrimination than the 16S rRNA gene. From these findings, we have developed a toolbox for the discrimination of Pasteuria at both the inter- and intraspecies levels. We also provide a model to monitor genetic variation in other obligate hyperparasites and difficult-to-culture microorganisms.

  4. Multiple Locus Variable-Number Tandem-Repeat and Single-Nucleotide Polymorphism-Based Brucella Typing Reveals Multiple Lineages in Brucella melitensis Currently Endemic in China

    Directory of Open Access Journals (Sweden)

    Mingjun Sun

    2017-12-01

    Full Text Available Brucellosis is a worldwide zoonotic disease caused by Brucella spp. In China, brucellosis is recognized as a reemerging disease mainly caused by Brucella melitensis specie. To better understand the currently endemic B. melitensis strains in China, three Brucella genotyping methods were applied to 110 B. melitensis strains obtained in past several years. By MLVA genotyping, five MLVA-8 genotypes were identified, among which genotypes 42 (1-5-3-13-2-2-3-2 was recognized as the predominant genotype, while genotype 63 (1-5-3-13-2-3-3-2 and a novel genotype of 1-5-3-13-2-4-3-2 were second frequently observed. MLVA-16 discerned a total of 57 MLVA-16 genotypes among these Brucella strains, with 41 genotypes being firstly detected and the other 16 genotypes being previously reported. By BruMLSA21 typing, six sequence types (STs were identified, among them ST8 is the most frequently seen in China while the other five STs were firstly detected and designated as ST137, ST138, ST139, ST140, and ST141 by international multilocus sequence typing database. Whole-genome sequence (WGS-single-nucleotide polymorphism (SNP-based typing and phylogenetic analysis resolved Chinese B. melitensis strains into five clusters, reflecting the existence of multiple lineages among these Chinese B. melitensis strains. In phylogeny, Chinese lineages are more closely related to strains collected from East Mediterranean and Middle East countries, such as Turkey, Kuwait, and Iraq. In the next few years, MLVA typing will certainly remain an important epidemiological tool for Brucella infection analysis, as it displays a high discriminatory ability and achieves result largely in agreement with WGS-SNP-based typing. However, WGS-SNP-based typing is found to be the most powerful and reliable method in discerning Brucella strains and will be popular used in the future.

  5. Single nucleotide polymorphism-based molecular typing of M. leprae from multicase families of leprosy patients and their surroundings to understand the transmission of leprosy.

    Science.gov (United States)

    Turankar, R P; Lavania, M; Chaitanya, V S; Sengupta, U; Darlong, J; Darlong, F; Siva Sai, K S R; Jadhav, R S

    2014-03-01

    The exact mode of transmission of leprosy is not clearly understood; however, many studies have demonstrated active transmission of leprosy around a source case. Families of five active leprosy cases and their household contacts were chosen from a high endemic area in Purulia. Fifty-two soil samples were also collected from different areas of their houses. DNA was extracted from slit-skin smears (SSS) and soil samples and the Mycobacterium leprae-specific RLEP (129 bp) region was amplified using PCR. Molecular typing of M. leprae was performed for all RLEP PCR-positive samples by single nucleotide polymorphism (SNP) typing and confirmation by DNA sequencing. SSS of these five patients and six out of the total 28 contacts were PCR positive for RLEP whereas 17 soil samples out of 52 showed the presence of M. leprae DNA. SNP typing of M. leprae from all RLEP PCR-positive subjects (patients and smear-positive contacts) and 10 soil samples showed the SNP type 1 genotype. M. leprae DNA from the five leprosy patients and the six contacts was further subtyped and the D subtype was noted in all patients and contacts, except for one contact where the C subtype was identified. Typing followed by subtyping of M. leprae clearly revealed that either the contacts were infected by the patients or both patients and contacts had the same source of infection. It also revealed that the type of M. leprae in the soil in the inhabited areas where patients resided was also of the same type as that found in patients. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

  6. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Pujolar, José Martin; Jacobsen, M.W.; Als, Thomas Damm

    2014-01-01

    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify...... species-specific diagnostic single-nucleotide polymorphisms (SNPs) and design a low-density array that combined with screening of a diagnostic mitochondrial DNA marker. Eels from Iceland (N=159) and from the neighboring Faroe Islands (N=29) were genotyped, along with 94 larvae (49 European and 45 American...... eel male crosses, backcrosses were also detected, including a first-generation backcross (F1 hybrid × pure European eel) and three individuals identified as second-generation backcrosses originating from American eel × F1 hybrid backcrosses interbreeding with pure European eels. In comparison...

  7. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    Science.gov (United States)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

    2017-02-01

    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  8. Identification of Diagnostic Mitochondrial DNA Single Nucleotide Polymorphisms Specific to Sumatran Orangutan (Pongo abelii Populations

    Directory of Open Access Journals (Sweden)

    Puji Rianti

    2015-10-01

    Full Text Available The hypervariable region I of mitochondrial DNA has frequently been used to distinguish among populations, in particular in species with strong female philopatry. In such cases, populations are expected to diverge rapidly for hypervariable region I markers because of the smaller effective population size and thus increased genetic drift. This rapid divergence leads to the accumulation of mutations exclusively found in one population, which may serve as diagnostic single nucleotide polymorphisms (SNPs. To date, diagnostic SNPs distinctive to Sumatran orangutan populations have not yet been described. However, given the continuously declining numbers of Sumatran orangutans, this information can be vital for effective conservation measures, especially regarding reintroductions of orangutans in rehabilitation centers. Phylogenetic analyses of 54 samples of Sumatran orangutans from nine sampling sites with good provenance, we found five major clades and a total of 20 haplotypes. We propose a total of 52 diagnostic SNPs that are specific to Sumatran orangutan populations. Data can be used to develop restriction fragment length polymorphism assays to carry out genetic assignments using basic laboratory equipment to assign Sumatran orangutan to their population of origin.

  9. Single-Nucleotide-Polymorphism-Based Association Mapping of Dog Stereotypes

    Science.gov (United States)

    Jones, Paul; Chase, Kevin; Martin, Alan; Davern, Pluis; Ostrander, Elaine A.; Lark, Karl G.

    2008-01-01

    Phenotypic stereotypes are traits, often polygenic, that have been stringently selected to conform to specific criteria. In dogs, Canis familiaris, stereotypes result from breed standards set for conformation, performance (behaviors), etc. As a consequence, phenotypic values measured on a few individuals are representative of the breed stereotype. We used DNA samples isolated from 148 dog breeds to associate SNP markers with breed stereotypes. Using size as a trait to test the method, we identified six significant quantitative trait loci (QTL) on five chromosomes that include candidate genes appropriate to regulation of size (e.g., IGF1, IGF2BP2 SMAD2, etc.). Analysis of other morphological stereotypes, also under extreme selection, identified many additional significant loci. Less well-documented data for behavioral stereotypes tentatively identified loci for herding, pointing, boldness, and trainability. Four significant loci were identified for longevity, a breed characteristic not under direct selection, but inversely correlated with breed size. The strengths and limitations of the approach are discussed as well as its potential to identify loci regulating the within-breed incidence of specific polygenic diseases. PMID:18505865

  10. Sirtuin1 single nucleotide polymorphism (A2191G is a diagnostic marker for vibration-induced white finger disease

    Directory of Open Access Journals (Sweden)

    Voelter-Mahlknecht Susanne

    2012-10-01

    Full Text Available Abstract Background Vibration-induced white finger disease (VWF, also known as hand-arm vibration syndrome, is a secondary form of Raynaud’s disease, affecting the blood vessels and nerves. So far, little is known about the pathogenesisof the disease. VWF is associated with an episodic reduction in peripheral blood flow. Sirtuin 1, a class III histone deacetylase, has been described to regulate the endothelium dependent vasodilation by targeting endothelial nitric oxide synthase. We assessed Sirt1single nucleotide polymorphisms in patients with VWF to further elucidate the role of sirtuin 1 in the pathogenesis of VWF. Methods Peripheral blood samples were obtained from 74 patients with VWF (male 93.2%, female 6.8%, median age 53 years and from 317 healthy volunteers (gender equally distributed, below 30 years of age. Genomic DNA was extracted from peripheral blood mononuclear cells and screened for potential Sirt1single nucleotide polymorphisms. Four putative genetic polymorphisms out of 113 within the Sirt1 genomic region (NCBI Gene Reference: NM_012238.3 were assessed. Allelic discrimination was performed by TaqMan-polymerasechainreaction-based allele-specific genotyping single nucleotide polymorphism assays. Results Sirt1single nucleotide polymorphism A2191G (Assay C_25611590_10, rs35224060 was identified within Sirt1 exon 9 (amino acid position 731, Ile → Val, with differing allelic frequencies in the VWF population (A/A: 70.5%, A/G: 29.5%, G/G: 0% and the control population (A/A: 99.7%, A/G: 0.3%, G/G: 0.5%, with significance levels of P U test (two-tailed P t-test and Chi-square test with Yates correction (all two-tailed: P Conclusion We identified theSirt1A2191Gsingle nucleotide polymorphism as a diagnostic marker for VWF.

  11. Single nucleotide polymorphism array karyotyping: a diagnostic and prognostic tool in myelodysplastic syndromes with unsuccessful conventional cytogenetic testing.

    Science.gov (United States)

    Arenillas, Leonor; Mallo, Mar; Ramos, Fernando; Guinta, Kathryn; Barragán, Eva; Lumbreras, Eva; Larráyoz, María-José; De Paz, Raquel; Tormo, Mar; Abáigar, María; Pedro, Carme; Cervera, José; Such, Esperanza; José Calasanz, María; Díez-Campelo, María; Sanz, Guillermo F; Hernández, Jesús María; Luño, Elisa; Saumell, Sílvia; Maciejewski, Jaroslaw; Florensa, Lourdes; Solé, Francesc

    2013-12-01

    Cytogenetic aberrations identified by metaphase cytogenetics (MC) have diagnostic, prognostic, and therapeutic implications in myelodysplastic syndromes (MDS). However, in some MDS patients MC study is unsuccesful. Single nucleotide polymorphism array (SNP-A) based karyotyping could be helpful in these cases. We performed SNP-A in 62 samples from bone marrow or peripheral blood of primary MDS with an unsuccessful MC study. SNP-A analysis enabled the detection of aberrations in 31 (50%) patients. We used the copy number alteration information to apply the International Prognostic Scoring System (IPSS) and we observed differences in survival between the low/intermediate-1 and intermediate-2/high risk patients. We also saw differences in survival between very low/low/intermediate and the high/very high patients when we applied the revised IPSS (IPSS-R). In conclusion, SNP-A can be used successfully in PB samples and the identification of CNA by SNP-A improve the diagnostic and prognostic evaluation of this group of MDS patients. Copyright © 2013 Wiley Periodicals, Inc.

  12. Diagnostic single nucleotide polymorphisms for identifying westslope cutthroat trout (Oncorhynchus clarki lewisi), Yellowstone cutthroat trout (Oncorhynchus clarkii bouvieri) and rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Kalinowski, S T; Novak, B J; Drinan, D P; Jennings, R deM; Vu, N V

    2011-03-01

    We describe 12 diagnostic single nucleotide polymorphism (SNP) assays for use in species identification among rainbow and cutthroat trout: five of these loci have alleles unique to rainbow trout (Oncorhynchus mykiss), three unique to westslope cutthroat trout (O. clarkii lewisi) and four unique to Yellowstone cutthroat trout (O. clarkii bouvieri). These diagnostic assays were identified using a total of 489 individuals from 26 populations and five fish hatchery strains. © 2010 Blackwell Publishing Ltd.

  13. Single-Nucleotide Variations in Cardiac Arrhythmias: Prospects for Genomics and Proteomics Based Biomarker Discovery and Diagnostics

    Directory of Open Access Journals (Sweden)

    Ayman Abunimer

    2014-03-01

    Full Text Available Cardiovascular diseases are a large contributor to causes of early death in developed countries. Some of these conditions, such as sudden cardiac death and atrial fibrillation, stem from arrhythmias—a spectrum of conditions with abnormal electrical activity in the heart. Genome-wide association studies can identify single nucleotide variations (SNVs that may predispose individuals to developing acquired forms of arrhythmias. Through manual curation of published genome-wide association studies, we have collected a comprehensive list of 75 SNVs associated with cardiac arrhythmias. Ten of the SNVs result in amino acid changes and can be used in proteomic-based detection methods. In an effort to identify additional non-synonymous mutations that affect the proteome, we analyzed the post-translational modification S-nitrosylation, which is known to affect cardiac arrhythmias. We identified loss of seven known S-nitrosylation sites due to non-synonymous single nucleotide variations (nsSNVs. For predicted nitrosylation sites we found 1429 proteins where the sites are modified due to nsSNV. Analysis of the predicted S-nitrosylation dataset for over- or under-representation (compared to the complete human proteome of pathways and functional elements shows significant statistical over-representation of the blood coagulation pathway. Gene Ontology (GO analysis displays statistically over-represented terms related to muscle contraction, receptor activity, motor activity, cystoskeleton components, and microtubule activity. Through the genomic and proteomic context of SNVs and S-nitrosylation sites presented in this study, researchers can look for variation that can predispose individuals to cardiac arrhythmias. Such attempts to elucidate mechanisms of arrhythmia thereby add yet another useful parameter in predicting susceptibility for cardiac diseases.

  14. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    Science.gov (United States)

    Watson, Christopher M; Crinnion, Laura A; Harrison, Sally M; Lascelles, Carolina; Antanaviciute, Agne; Carr, Ian M; Bonthron, David T; Sheridan, Eamonn

    2016-01-01

    Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7)(p15q21)x2) which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  15. Hepatitis B virus DNA polymerase gene polymorphism based ...

    African Journals Online (AJOL)

    Hepatitis B virus DNA polymerase gene polymorphism based prediction of genotypes in chronic HBV patients from Western India. Yashwant G. Chavan, Sharad R. Pawar, Minal Wani, Amol D. Raut, Rabindra N. Misra ...

  16. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolis...

  17. Diagnostics

    DEFF Research Database (Denmark)

    Donné, A.J.H.; Costley, A.E.; Barnsley, R.

    2007-01-01

    of the measurements—time and spatial resolutions, etc—will in some cases be more stringent. Many of the measurements will be used in the real time control of the plasma driving a requirement for very high reliability in the systems (diagnostics) that provide the measurements. The implementation of diagnostic systems...... on ITER is a substantial challenge. Because of the harsh environment (high levels of neutron and gamma fluxes, neutron heating, particle bombardment) diagnostic system selection and design has to cope with a range of phenomena not previously encountered in diagnostic design. Extensive design and R......&D is needed to prepare the systems. In some cases the environmental difficulties are so severe that new diagnostic techniques are required. The starting point in the development of diagnostics for ITER is to define the measurement requirements and develop their justification. It is necessary to include all...

  18. A lateral flow biosensor for detection of single nucleotide polymorphism by circular strand displacement reaction.

    Science.gov (United States)

    Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen

    2012-09-04

    A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.

  19. NUCLEOTIDES IN INFANT FEEDING

    Directory of Open Access Journals (Sweden)

    L.G. Mamonova

    2007-01-01

    Full Text Available The article reviews the application of nucleotides-metabolites, playing a key role in many biological processes, for the infant feeding. The researcher provides the date on the nucleotides in the women's milk according to the lactation stages. She also analyzes the foreign experience in feeding newborns with nucleotides-containing milk formulas. The article gives a comparison of nucleotides in the adapted formulas represented in the domestic market of the given products.Key words: children, feeding, nucleotides.

  20. Rapid and Reliable Single Nucleotide Polymorphism-Based Differentiation of Brucella Live Vaccine Strains from Field Strains

    Science.gov (United States)

    Brucellosis is a major zoonotic disease responsible for substantial social and economic problems, particularly in the developing world. One element that can implemented as part of control programs tackling animal disease is the use of one of the OIE recommended vaccines to protect against either Bru...

  1. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against jap...onica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  2. Cyclic nucleotides and radioresistnace

    International Nuclear Information System (INIS)

    Kulinskij, V.I.; Mikheeva, G.A.; Zel'manovich, B.M.

    1982-01-01

    The addition of glucose to meat-peptone broth does not change the radiosensitizing effect (RSE) of cAMP at the logarithmic phase (LP) and the radioprotective effect (RPE) at the stationary phase (SP), but sensitization, characteristic of cGMP, disappears in SP and turns into RPE in LP. Introduction of glucose into the broth for 20 min eliminates all the effects of both cyclic nucleotides in the cya + strain while cya - mutant exhibits RSE. RSE of both cyclic nucleotides is only manifested on minimal media. These data brought confirmation of the dependence of the influence of cyclic media. These data brought confirmation of the dependence of the influence of cyclic nucleotides on radioresistance upon the metabolic status of the cell [ru

  3. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

  4. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth; Meier, Stuart Kurt; Gehring, Christoph A

    2016-01-01

    Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms

  5. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara Elizabeth

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  6. Antinociceptive effect of purine nucleotides.

    Science.gov (United States)

    Mello, C F; Begnini, J; De-La-Vega, D D; Lopes, F P; Schwartz, C C; Jimenez-Bernal, R E; Bellot, R G; Frussa-Filho, R

    1996-10-01

    The antinociceptive effect of purine nucleotides administered systematically (sc) was determined using the formalin and writhing tests in adult male albino mice. The mechanisms underlying nucleotide-induced antinociception were investigated by preinjecting the animals (sc) with specific antagonists for opioid (naloxone, 1 mg/kg), purinergic P1 (caffeine, 5, 10, of 30 mg/kg); theophylline, 10 mg/kg) or purinergic P2 receptors (suramin, 100 mg/kg; Coomassie blue, 30-300 mg/kg; quinidine, 10 mg/kg). Adenosine, adenosine monophosphate (AMP), diphosphate (ADP) and triphosphate (ATP) caused a reduction in the number of writhes and in the time of licking the formalin-injected paw. Naloxone had no effect on adenosine- or adenine nucleotide-induced antinociception. Caffeine (30 mg/kg) and theophylline (10 mg/kg) reversed the antinociceptive action of adenosine and adenine nucleotide derivatives in both tests. P2 antagonists did not reverse adenine nucleotide-induced antinociception. These results suggest that antinociceptive effect of adenine nucleotides is mediated by adenosine.

  7. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  8. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  9. MOLECULAR DIAGNOSTICS OF YERSINIA RUCKERI

    Directory of Open Access Journals (Sweden)

    Yu. Rud

    2014-06-01

    Full Text Available Purpose. The analysis of nucleotide sequences of the 16S rDNA gene of virulent strains of Yersinia ruckeri and to develop the method of molecular diagnostic of enteric redmouth disease. Methodology. By the method of CLUSTALW algorithm in MEGA software version 6.0 the nucleotide sequences of the 16S rDNA gene of virulent strains of Yersinia ruckeri were analysed. For development of molecular diagnostic of Y. ruckeri the method of polymerase chain reaction (PCR was used. Primer selection was carried out in software VectorNTI11 and on-line-service BLAST. The PCR products were investigated by the methods of sequencing and nucleotide analysis. Findings. Based on PCR assay the method of molecular diagnostic of enteric redmouth disease agent, bacterium Y. ruckeri was developed. It was shown that specific oligonucleotide primers generated PCR products in size of 600 base pairs. PCR products were investigated by the sequencing that showed right targeting of primers in reaction. Originality. Among high-conservative gene of 16S rDNA of Y. ruckeri the fragment of DNA was determined to which the specific primers for rapid diagnostic of virulent strains were selected. Practical Value. Rapid diagnostic of yersiniosis will allow to identify an agent of this infectious disease, bacterium Y. ruckeri, and to provide the prophylactic or medical measures in the fish farming of Ukraine.

  10. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  11. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions.

    Science.gov (United States)

    Coari, Kristin M; Martin, Rebecca C; Jain, Kopal; McGown, Linda B

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  12. Nucleotide sequence preservation of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Monnat, R.J. Jr.; Loeb, L.A.

    1985-01-01

    Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

  13. Nucleotide diversity and phylogenetic relationships among ...

    Indian Academy of Sciences (India)

    2017-03-03

    Mar 3, 2017 ... 2Department of Botany, D. S. B. Campus, Kumaun University, Nainital 263 001, India ... Rana T. S. 2017 Nucleotide diversity and phylogenetic relationships ... Anderson and Park 1989). ..... Edgewood Press, Edgewood, USA.

  14. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  15. A Nucleotide Phosphatase Activity in the Nucleotide Binding Domain of an Orphan Resistance Protein from Rice*

    Science.gov (United States)

    Fenyk, Stepan; de San Eustaquio Campillo, Alba; Pohl, Ehmke; Hussey, Patrick J.; Cann, Martin J.

    2012-01-01

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack. PMID:22157756

  16. A nucleotide phosphatase activity in the nucleotide binding domain of an orphan resistance protein from rice.

    Science.gov (United States)

    Fenyk, Stepan; Campillo, Alba de San Eustaquio; Pohl, Ehmke; Hussey, Patrick J; Cann, Martin J

    2012-02-03

    Plant resistance proteins (R-proteins) are key components of the plant immune system activated in response to a plethora of different pathogens. R-proteins are P-loop NTPase superfamily members, and current models describe their main function as ATPases in defense signaling pathways. Here we show that a subset of R-proteins have evolved a new function to combat pathogen infection. This subset of R-proteins possesses a nucleotide phosphatase activity in the nucleotide-binding domain. Related R-proteins that fall in the same phylogenetic clade all show the same nucleotide phosphatase activity indicating a conserved function within at least a subset of R-proteins. R-protein nucleotide phosphatases catalyze the production of nucleoside from nucleotide with the nucleotide monophosphate as the preferred substrate. Mutation of conserved catalytic residues substantially reduced activity consistent with the biochemistry of P-loop NTPases. Kinetic analysis, analytical gel filtration, and chemical cross-linking demonstrated that the nucleotide-binding domain was active as a multimer. Nuclear magnetic resonance and nucleotide analogues identified the terminal phosphate bond as the target of a reaction that utilized a metal-mediated nucleophilic attack by water on the phosphoester. In conclusion, we have identified a group of R-proteins with a unique function. This biochemical activity appears to have co-evolved with plants in signaling pathways designed to resist pathogen attack.

  17. A genotype-by-sequencing-single nucleotide polymorphism based linkage map and quantitative trait loci (QTL) associated with resistance to Fusarium oxysporum f. sp. niveum race 2 identified in Citrullus lanatus var. citroides

    Science.gov (United States)

    Fusarium wilt, a fungal disease caused by Fusarium oxysporum f. sp. niveum (Fon), devastates watermelon crop production worldwide. Several races, which are differentiated by host range, of the pathogen exist. Resistance to Fon race 2, a particularly virulent strain prevalent in the United States, do...

  18. Molecular Diagnostics

    OpenAIRE

    Choe, Hyonmin; Deirmengian, Carl A.; Hickok, Noreen J.; Morrison, Tiffany N.; Tuan, Rocky S.

    2015-01-01

    Orthopaedic infections are complex conditions that require immediate diagnosis and accurate identification of the causative organisms to facilitate appropriate management. Conventional methodologies for diagnosis of these infections sometimes lack accuracy or sufficient rapidity. Current molecular diagnostics are an emerging area of bench-to-bedside research in orthopaedic infections. Examples of promising molecular diagnostics include measurement of a specific biomarker in the synovial fluid...

  19. The International Nucleotide Sequence Database Collaboration.

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Nakamura, Yasukazu

    2011-01-01

    Under the International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org), globally comprehensive public domain nucleotide sequence is captured, preserved and presented. The partners of this long-standing collaboration work closely together to provide data formats and conventions that enable consistent data submission to their databases and support regular data exchange around the globe. Clearly defined policy and governance in relation to free access to data and relationships with journal publishers have positioned INSDC databases as a key provider of the scientific record and a core foundation for the global bioinformatics data infrastructure. While growth in sequence data volumes comes no longer as a surprise to INSDC partners, the uptake of next-generation sequencing technology by mainstream science that we have witnessed in recent years brings a step-change to growth, necessarily making a clear mark on INSDC strategy. In this article, we introduce the INSDC, outline data growth patterns and comment on the challenges of increased growth.

  20. Bacterial nucleotide-based second messengers.

    Science.gov (United States)

    Pesavento, Christina; Hengge, Regine

    2009-04-01

    In all domains of life nucleotide-based second messengers transduce signals originating from changes in the environment or in intracellular conditions into appropriate cellular responses. In prokaryotes cyclic di-GMP has emerged as an important and ubiquitous second messenger regulating bacterial life-style transitions relevant for biofilm formation, virulence, and many other bacterial functions. This review describes similarities and differences in the architecture of the cAMP, (p)ppGpp, and c-di-GMP signaling systems and their underlying signaling principles. Moreover, recent advances in c-di-GMP-mediated signaling will be presented and the integration of c-di-GMP signaling with other nucleotide-based signaling systems will be discussed.

  1. Nucleotide Manipulatives to Illustrate the Central Dogma

    OpenAIRE

    Sonja B. Yung; Todd P. Primm

    2015-01-01

    The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  2. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  3. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

  4. Pyrrolidine nucleotide analogs with a tunable conformation

    Czech Academy of Sciences Publication Activity Database

    Poštová Slavětínská, Lenka; Rejman, Dominik; Pohl, Radek

    2014-01-01

    Roč. 10, Aug 22 (2014), s. 1967-1980 ISSN 1860-5397 R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : conformation * NMR * nucleic acids * nucleotide analog * phosphonic acid * pseudorotation * pyrrolidine Subject RIV: CC - Organic Chemistry Impact factor: 2.762, year: 2014 http://www.beilstein-journals.org/bjoc/single/articleFullText.htm?publicId=1860-5397-10-205

  5. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  6. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    International Nuclear Information System (INIS)

    Shin, Joong-Won; Bernstein, Elliot R.

    2014-01-01

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5 ′ -monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results

  7. Methylation-sensitive amplified polymorphism-based genome-wide analysis of cytosine methylation profiles in Nicotiana tabacum cultivars.

    Science.gov (United States)

    Jiao, J; Wu, J; Lv, Z; Sun, C; Gao, L; Yan, X; Cui, L; Tang, Z; Yan, B; Jia, Y

    2015-11-26

    This study aimed to investigate cytosine methylation profiles in different tobacco (Nicotiana tabacum) cultivars grown in China. Methylation-sensitive amplified polymorphism was used to analyze genome-wide global methylation profiles in four tobacco cultivars (Yunyan 85, NC89, K326, and Yunyan 87). Amplicons with methylated C motifs were cloned by reamplified polymerase chain reaction, sequenced, and analyzed. The results show that geographical location had a greater effect on methylation patterns in the tobacco genome than did sampling time. Analysis of the CG dinucleotide distribution in methylation-sensitive polymorphic restriction fragments suggested that a CpG dinucleotide cluster-enriched area is a possible site of cytosine methylation in the tobacco genome. The sequence alignments of the Nia1 gene (that encodes nitrate reductase) in Yunyan 87 in different regions indicate that a C-T transition might be responsible for the tobacco phenotype. T-C nucleotide replacement might also be responsible for the tobacco phenotype and may be influenced by geographical location.

  8. Companion diagnostics

    DEFF Research Database (Denmark)

    Jørgensen, Jan Trøst; Hersom, Maria

    2016-01-01

    of disease mechanisms, things are slowly changing. Within the last few years, we have seen an increasing number of predictive biomarker assays being developed to guide the use of targeted cancer drugs. This type of assay is called companion diagnostics and is developed in parallel to the drug using the drug-diagnostic...... co-development model. The development of companion diagnostics is a relatively new discipline and in this review, different aspects will be discussed including clinical and regulatory issues. Furthermore, examples of drugs, such as the ALK and PD-1/PD-L1 inhibitors, that have been approved recently....... Despite having discussed personalized medicine for more than a decade, we still see that most drug prescriptions for severe chronic diseases are largely based on 'trial and error' and not on solid biomarker data. However, with the advance of molecular diagnostics and a subsequent increased understanding...

  9. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam Sean; Berkowitz, Gerald A.

    2013-01-01

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin

  10. Effects of hypokinesia on cyclic nucleotides and hormonal regulation ...

    African Journals Online (AJOL)

    PTH), calcitonin (CT), cyclic nucleotides (cAMP, cGMP) and calcium in the blood of rats, while in urine - phosphate, calcium and cyclic nucleotides. Design: Laboratory based experiment. Setting: Laboratory in the Department of Biochemistry, ...

  11. Development and Evaluation of a Molecular Diagnostic Method for Rapid Detection of Histoplasma capsulatum var. farciminosum, the Causative Agent of Epizootic Lymphangitis, in Equine Clinical Samples.

    Science.gov (United States)

    Scantlebury, C E; Pinchbeck, G L; Loughnane, P; Aklilu, N; Ashine, T; Stringer, A P; Gordon, L; Marshall, M; Christley, R M; McCarthy, A J

    2016-12-01

    Histoplasma capsulatum var. farciminosum, the causative agent of epizootic lymphangitis (EZL), is endemic in parts of Africa. Diagnosis based on clinical signs and microscopy lacks specificity and is a barrier to further understanding this neglected disease. Here, a nested PCR method targeting the internal transcribed spacer (ITS) region of the rRNA operon was validated for application to equine clinical samples. Twenty-nine horses with signs of EZL from different climatic regions of Ethiopia were clinically examined. Blood samples and aspirates of pus from cutaneous nodules were taken, along with blood from a further 20 horses with no cutaneous EZL lesions. Among the 29 horses with suspected cases of EZL, H. capsulatum var. farciminosum was confirmed by extraction of DNA from pus and blood samples from 25 and 17 horses, respectively. Positive PCR results were also obtained with heat-inactivated pus (24 horses) and blood (23 horses) spotted onto Whatman FTA cards. Two positive results were obtained among blood samples from 20 horses that did not exhibit clinical signs of EZL. These are the first reports of the direct detection of H. capsulatum var. farciminosum in equine blood and at high frequency among horses exhibiting cutaneous lesions. The nested PCR outperformed conventional microscopic diagnosis, as characteristic yeast cells could be observed only in 14 pus samples. The presence of H. capsulatum var. farciminosum DNA was confirmed by sequencing the cloned PCR products, and while alignment of the ITS amplicons showed very little sequence variation, there was preliminary single nucleotide polymorphism-based evidence for the existence of two subgroups of H. capsulatum var. farciminosum This molecular diagnostic method now permits investigation of the epidemiology of EZL. Copyright © 2016 Scantlebury et al.

  12. Development and Evaluation of a Molecular Diagnostic Method for Rapid Detection of Histoplasma capsulatum var. farciminosum, the Causative Agent of Epizootic Lymphangitis, in Equine Clinical Samples

    Science.gov (United States)

    Pinchbeck, G. L.; Loughnane, P.; Aklilu, N.; Ashine, T.; Stringer, A. P.; Gordon, L.; Marshall, M.; Christley, R. M.

    2016-01-01

    Histoplasma capsulatum var. farciminosum, the causative agent of epizootic lymphangitis (EZL), is endemic in parts of Africa. Diagnosis based on clinical signs and microscopy lacks specificity and is a barrier to further understanding this neglected disease. Here, a nested PCR method targeting the internal transcribed spacer (ITS) region of the rRNA operon was validated for application to equine clinical samples. Twenty-nine horses with signs of EZL from different climatic regions of Ethiopia were clinically examined. Blood samples and aspirates of pus from cutaneous nodules were taken, along with blood from a further 20 horses with no cutaneous EZL lesions. Among the 29 horses with suspected cases of EZL, H. capsulatum var. farciminosum was confirmed by extraction of DNA from pus and blood samples from 25 and 17 horses, respectively. Positive PCR results were also obtained with heat-inactivated pus (24 horses) and blood (23 horses) spotted onto Whatman FTA cards. Two positive results were obtained among blood samples from 20 horses that did not exhibit clinical signs of EZL. These are the first reports of the direct detection of H. capsulatum var. farciminosum in equine blood and at high frequency among horses exhibiting cutaneous lesions. The nested PCR outperformed conventional microscopic diagnosis, as characteristic yeast cells could be observed only in 14 pus samples. The presence of H. capsulatum var. farciminosum DNA was confirmed by sequencing the cloned PCR products, and while alignment of the ITS amplicons showed very little sequence variation, there was preliminary single nucleotide polymorphism-based evidence for the existence of two subgroups of H. capsulatum var. farciminosum. This molecular diagnostic method now permits investigation of the epidemiology of EZL. PMID:27707938

  13. Plasma Diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Zaveryaev, V [Kurchatov Institute, Moscow (Russian Federation); others, and

    2012-09-15

    The success in achieving peaceful fusion power depends on the ability to control a high temperature plasma, which is an object with unique properties, possibly the most complicated object created by humans. Over years of fusion research a new branch of science has been created, namely plasma diagnostics, which involves knowledge of almost all fields of physics, from electromagnetism to nuclear physics, and up-to-date progress in engineering and technology (materials, electronics, mathematical methods of data treatment). Historically, work on controlled fusion started with pulsed systems and accordingly the methods of plasma parameter measurement were first developed for short lived and dense plasmas. Magnetically confined hot plasmas require the creation of special experimental techniques for diagnostics. The diagnostic set is the most scientifically intensive part of a plasma device. During many years of research operation some scientific tasks have been solved while new ones arose. New tasks often require significant changes in the diagnostic system, which is thus a very flexible part of plasma machines. Diagnostic systems are designed to solve several tasks. As an example here are the diagnostic tasks for the International Thermonuclear Experimental Reactor - ITER: (1) Measurements for machine protection and basic control; (2) Measurements for advanced control; (3) Additional measurements for performance evaluation and physics. Every new plasma machine is a further step along the path to the main goal - controlled fusion - and nobody knows in advance what new phenomena will be met on the way. So in the planning of diagnostic construction we should keep in mind further system upgrading to meet possible new scientific and technical challenges. (author)

  14. Diagnostic development

    International Nuclear Information System (INIS)

    Barnett, C.F.; Brisson, D.A.; Greco, S.E.

    1978-01-01

    During the past year the far-infrared or submillimeter diagnostic research program resulted in three major developments: (1) an optically pumped 0.385-μm D 2 O-laser oscillator-amplifier system was operated at a power level of 1 MW with a line width of less than 50 MHz; (2) a conical Pyrex submillimeter laser beam dump with a retention efficiency greater than 10 4 was developed for the ion temperature Thompson scattering experiment; and (3) a new diagnostic technique was developed that makes use of the Faraday rotation of a modulated submillimeter laser beam to determine plasma current profile. Measurements of the asymmetric distortion of the H/sub α/ (6563 A) spectral line profile show that the effective toroidal drift velocity, dv/sub two vertical bars i/dT/sub i/, may be used as an indicator of plasma quality and as a complement to other ion temperature diagnostics

  15. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Science.gov (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  16. A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Zeng, Lingwen; Xiao, Zhuo

    2017-01-01

    A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

  17. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  18. Diagnostic dilemma

    DEFF Research Database (Denmark)

    Feldt-Rasmussen, Ulla; Dobrovolny, Robert; Nazarenko, Irina

    2011-01-01

    Fabry disease, an X-linked lysosomal storage disorder, results from the deficient activity of a-galactosidase A (a-Gal A). In affected males, the clinical diagnosis is confirmed by the markedly decreased a-Gal A activity. However, in female heterozygotes, the a-Gal A activity can range from low t...... on enzyme replacement therapy. Thus, gene dosage analyses can detect large deletions (>50bp) in suspect heterozygotes for X-linked and autosomal dominant diseases that are "sequencing cryptic," resolving molecular diagnostic dilemmas....... to normal due to random X-chromosomal inactivation, and diagnostic confirmation requires identification of the family's a-Gal A gene mutation. In a young female who had occasional acroparesthesias, corneal opacities, and 15 to 50% of the lower limit of normal leukocyte a-Gal A activity, a-Gal A sequencing...... in two expert laboratories did not identify a confirmatory mutation, presenting a diagnostic dilemma. A renal biopsy proved diagnostic and renewed efforts to detect an a-Gal A mutation. Subsequent gene dosage analyses identified a large a-Gal A deletion confirming her heterozygosity, and she was started...

  19. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  20. Palindromic nucleotide analysis in human T cell receptor rearrangements.

    Directory of Open Access Journals (Sweden)

    Santosh K Srivastava

    Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

  1. Introduction of an single nucleodite polymorphism-based "Major Y-chromosome haplogroup typing kit" suitable for predicting the geographical origin of male lineages

    DEFF Research Database (Denmark)

    Brión, María; Sanchez, Juan J; Balogh, Kinga

    2005-01-01

    . From more than 200 SNPs compiled in the phylogenetic tree published by the Y-Chromosome Consortium, and looking at the population studies previously published, a package of 29 SNPs has been selected for the identification of major population haplogroups. A "Major Y-chromosome haplogroup typing kit" has......The European Consortium "High-throughput analysis of single nucleotide polymorphisms for the forensic identification of persons--SNPforID", has performed a selection of candidate Y-chromosome single nucleotide polymorphisms (SNPs) for making inferences on the geographic origin of an unknown sample...

  2. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H

    1996-01-01

    The substrate requirements for the catalytic activity of the mouse Cdc25 homolog Guanine nucleotide Release Factor, GRF, were determined using the catalytic domain of GRF expressed in insect cells and E. coli expressed H-Ras mutants. We found a requirement for the loop 7 residues in Ras (amino ac...... and the human Ras like proteins RhoA, Rap1A, Rac1 and G25K revealed a strict Ras specificity; of these only S. pombe Ras was GRF sensitive....

  3. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  4. Thyroid diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Scriba, P C; Boerner, W; Emrich, S; Gutekunst, R; Herrmann, J; Horn, K; Klett, M; Krueskemper, H L; Pfannenstiel, P; Pickardt, C R

    1985-03-01

    None of the in-vitro and in-vivo methods listed permits on unambiguous diagnosis when applied alone, owing to the fact that similar or even identical findings are obtained for various individual parameters in different thyroid diseases. Further, especially the in-vitro tests are also subject to extrathyroidal effects which may mask the typical findings. The limited and varying specificity and sensitivity of the tests applied, as well as the falsification of results caused by the patients' idiosyncracies and the methodology, make it necessary to interpret and evaluate the in-vivo and in-vitro findings only if the clinical situation (anamnesis and physical examination) is known. For maximum diagnostic quality of the tests, the initial probability of the assumed type of thyroid disease must be increased (formulation of the clinical problem). The concepts of exclusion diagnosis and identification must be distinguished as well as the diagnosis of functional disturbances on the one hand and of thyroid diseases on the other. Both of this requires a qualified, specific and detailed anamnesis and examination procedure, and the clinical examination remains the obligatory basis of clinical diagnostics. In case of inexplicable discrepancies between the clinical manifestations and the findings obtained with specific methods, or between the findings obtained with a specific method, the patient should be referred to an expert institution, or the expert institution should be consulted.

  5. Thyroid diagnostics

    International Nuclear Information System (INIS)

    Scriba, P.C.; Boerner, W.; Emrich, S.; Gutekunst, R.; Herrmann, J.; Horn, K.; Klett, M.; Krueskemper, H.L.; Pfannenstiel, P.; Pickardt, C.R.; Reiners, C.; Reinwein, D.; Schleusener, H.

    1985-01-01

    None of the in-vitro and in-vivo methods listed permits on unambiguous diagnosis when applied alone, owing to the fact that similar or even identical findings are obtained for various individual parameters in different thyroid diseases. Further, especially the in-vitro tests are also subject to extrathyroidal effects which may mask the typical findings. The limited and varying specificity and sensitivity of the tests applied, as well as the falsification of results caused by the patients' idiosyncracies and the methodology, make it necessary to interpret and evaluate the in-vivo and in-vitro findings only if the clinical situation (anamnesis and physical examination) is known. For maximum diagnostic quality of the tests, the initial probability of the assumed type of thyroid disease must be increased (formulation of the clinical problem). The concepts of exclusion diagnosis and identification must be distinguished as well as the diagnosis of functional disturbances on the one hand and of thyroid diseases on the other. Both of this requires a qualified, specific and detailed anamnesis and examination procedure, and the clinical examination remains the obligatory basis of clinical diagnostics. In case of inexplicable discrepancies between the clinical manifestations and the findings obtained with specific methods, or between the findings obtained with a specific method, the patient should be referred to an expert institution, or the expert institution should be consulted. (orig./MG) [de

  6. Ambient diagnostics

    CERN Document Server

    Cai, Yang

    2014-01-01

    Part I. FundamentalsIntroductionWhat is Ambient Diagnostics?Diagnostic ModelsMultimedia IntelligenceCrowd SourcingSoft SensorsScience of SimplicityPersonal DiagnosesBasic AlgorithmsBasic ToolsSummaryProblemsTransformationEarly Discoveries of Heartbeat PatternsTransforms, Features, and AttributesSequential FeaturesSpatiotemporal FeaturesShape FeaturesImagery FeaturesFrequency Domain FeaturesMulti-Resolution FeaturesSummaryProblemsPattern RecognitionSimilarities and DistancesClustering MethodsClassification MethodsClassifier Accuracy MeasuresSummaryProblemsPart II. Multimedia IntelligenceSound RecognitionMicrophone AppsModern Acoustic Transducers (Microphones)Frequency Response CharacteristicsDigital Audio File FormatsHeart Sound SensingLung Sound SensingSnore MeterSpectrogram (STFT)Ambient Sound AnalysisSound RecognitionRecognizing Asthma SoundPeak ShiftFeature CompressionRegroupingNoise IssuesFuture ApplicationsSummaryProblemsColor SensorsColor SensingHuman Color VisionColor SensorsColor Matching ExperimentsC...

  7. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria.

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association.

  8. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  9. Exploiting nucleotide composition to engineer promoters.

    Directory of Open Access Journals (Sweden)

    Manfred G Grabherr

    Full Text Available The choice of promoter is a critical step in optimizing the efficiency and stability of recombinant protein production in mammalian cell lines. Artificial promoters that provide stable expression across cell lines and can be designed to the desired strength constitute an alternative to the use of viral promoters. Here, we show how the nucleotide characteristics of highly active human promoters can be modelled via the genome-wide frequency distribution of short motifs: by overlapping motifs that occur infrequently in the genome, we constructed contiguous sequence that is rich in GC and CpGs, both features of known promoters, but lacking homology to real promoters. We show that snippets from this sequence, at 100 base pairs or longer, drive gene expression in vitro in a number of mammalian cells, and are thus candidates for use in protein production. We further show that expression is driven by the general transcription factors TFIIB and TFIID, both being ubiquitously present across cell types, which results in less tissue- and species-specific regulation compared to the viral promoter SV40. We lastly found that the strength of a promoter can be tuned up and down by modulating the counts of GC and CpGs in localized regions. These results constitute a "proof-of-concept" for custom-designing promoters that are suitable for biotechnological and medical applications.

  10. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara; Meier, Stuart; Gehring, Christoph A

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  11. In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

    African Journals Online (AJOL)

    Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

  12. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

  13. Diagnostic accuracy of organ electrodermal diagnostics | Szopinski ...

    African Journals Online (AJOL)

    Objective. To estimate the diagnostic accuracy as well as the scope of utilisation of a new bio-electronic method of organ diagnostics. Design. Double-blind comparative study of the diagnostic results obtained by means of organ electrodermal diagnostics (OED) and clinical diagnoses, as a criterion standard. Setting.

  14. SNS Diagnostics

    International Nuclear Information System (INIS)

    Shea, T.J.; Cameron, P.; Doolittle, L.; Power, J.

    2000-01-01

    The Spallation Neutron Source (SNS) Project is a collaborative effort to build the next generation neutron science facility at Oak Ridge, TN. The facility will deliver a 2 MW proton beam to a liquid mercury target. Neutrons from this target will be moderated and sent to several state-of-the-art instruments. Six national laboratories are involved in SNS construction. Berkeley (LBNL) will build the front end that produces a 2.5 MeV, 52 mA H-beam. Los Alamos (LANL) is responsible for the 1 GeV linac with a superconducting section provided by Thomas Jefferson (JLab). Brookhaven (BNL) is building the transfer lines and accumulator ring. Oak Ridge (ORNL) and Argonne (ANL) have responsibility for the target and instruments. All activities are coordinated by the SNS project office at Oak Ridge. The high beam power, a desired availability of 95%, and an aggressive commissioning schedule lead to some interesting challenges in beam diagnostics

  15. Adenine nucleotide depletion from endothelial cells exposed to xanthine oxidase

    International Nuclear Information System (INIS)

    Aalto, T.K.; Raivio, K.O.

    1990-01-01

    Hypoxia causes breakdown of cellular nucleotides, accumulation of hypoxanthine (HX), and conversion of xanthine dehydrogenase into xanthine oxidase (XO). Upon reoxygenation, the HX-XO reaction generates free radicals, one potential mechanism of tissue damage. Because endothelial cells contain XO and are exposed to circulating HX, they are a likely target for damage. We studied the effect of XO and/or HX at physiologically relevant concentrations on nucleotide metabolism of cultured endothelial cells from human umbilical veins. Cells were labeled with [14C]adenine and incubated for up to 6 h with HX, XO, or both, in the absence or presence of serum. Adenine nucleotides from cell extracts and nucleotide breakdown products (HX, xanthine, and urate) from the medium were separated and counted. HX alone had no effect. XO (80 mU/ml) alone caused a 70% (no serum) or 40% (with serum) fall in adenine nucleotides and an equivalent increase of xanthine and urate. The combination of HX and XO caused a 90% (no serum) or 70% (with serum) decrease in nucleotides, decrease in energy charge, and detachment of cells from the culture plate. Nucleotide depletion was not accounted for by proteolytic activity in the XO preparation. Albumin was only half as effective as serum in preventing nucleotide loss. Thus exogenous XO, in the presence of endogenous HX, triggers adenine nucleotide catabolism, but endogenous XO activity is too low to influence nucleotide levels even at high exogenous HX concentrations. Serum limits the catabolic effect of XO and thus protects cells from free radical damage

  16. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl

    2007-01-03

    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  17. Diagnostic thoracoscopy

    Directory of Open Access Journals (Sweden)

    Plavec Goran

    2002-01-01

    Full Text Available Diagnostic thoracoscopy in patients with pleural effusion of unclear origin mostly provides the correct diagnosis. Results from published reports of previous researches are not uniform. In 47 male and 20 female patients with pleural effusion of unknown etiology, after receiving negative results obtained from cytological finding of pleural effusion and percutaneous needle biopsy, thoracoscopy with biopsy of one or both pleurae was performed. Procedure was done in local anesthesia using Stortz rigid thoracoscope. In 37 patients with malignant disease (primary or metastatic diagnosis was confirmed histopathologically in 31 patient (81.12%. In 27 patients with inflammatory pleural disease diagnosis was confirmed histopathologically in 22 patients (81.4%. Among 11 patients with specific pleural effusions, tuberculosis was confirmed in 10 (90.91%. Normal finding in cases of spontaneous pneumothorax and pulmonary embolism was taken as a positive result. Total number of positive findings was 55 (82.10%. In one patient, the third spontaneous pneumothorax was the indication for thoracoscopy, and after numerous bullae were seen during the procedure, talcum powder pleurodesis was done. In four patients low intensity subcutaneous emphysema occurred one day after thoracoscopy. It can be concluded that thoracoscopy in local anesthesia out of the operating room is good and practical method for solving the unclear pleural effusions, with neglectable rate of complications.

  18. Mitigation diagnostics

    International Nuclear Information System (INIS)

    Hall, S.T.

    1990-01-01

    This paper reports that experience in the remediation of schools and other large buildings has shown the importance of the effects of both the location of geologic sources and HVAC-induced distribution of indoor radon. In general, elevated radon in areas of schools with evenly distributed HVAC pressures are correlated with maximum soil radon emanations. However, strong or unequal HVAC effects can redistribute indoor radon to areas away from the direct source. Effective remediation required a complete understanding of both contributions. In some schools, highest indoor radon levels were located near large return ducts and were attributed to proximity to negative HVAC pressure. Successful sub-slab depressurization systems were installed, however, in rooms with lower indoor but greatest sub-slab radon levels, closest to the source. This shows the inadequacy of using indoor radon levels alone as a basis for remediation. Wings of two other schools with radon problems have equivalent window fan coil units in rooms of equal size and no central HVAC system. Highest indoor radon levels correlated well with highest sub-slab radon levels due to the equivalent effects of the window units. Diagnostic tests in other schools have revealed: blockwall radon transport to upper floors; high blockwall radon adjacent to sub-slab sources; and elevated indoor radon over crawlspace being drawn upward by HVAC-induced negative pressure, determined from indoor to outdoor micromanometer measurements

  19. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  20. The possible role of human milk nucleotides as sleep inducers.

    Science.gov (United States)

    Sánchez, Cristina L; Cubero, Javier; Sánchez, Javier; Chanclón, Belén; Rivero, Montserrat; Rodríguez, Ana B; Barriga, Carmen

    2009-02-01

    Breast-milk contains a potent mixture of diverse components, such as the non-protein nitrogen fraction which includes nucleotides, whose variation in levels is evident throughout lactation. In addition, these substances play an important role in sleep homeostasis. In the present study, human milk samples were analyzed using a capillary electrophoresis system. The rhythmicity of each nucleotide was studied by cosinor analysis. It was found that the nucleotides 5'AMP, 5'GMP, 5'CMP, and 5'IMP have significant (P inducing the 'hypnotic' action of breast-milk at night in the infant.

  1. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    OpenAIRE

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-01-01

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

  2. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  3. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze; Gehring, Christoph A

    2013-01-01

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs

  4. A single nucleotide polymorphism (SNP) assay for population ...

    African Journals Online (AJOL)

    A single nucleotide polymorphism (SNP) assay for population stratification test ... phenotypes and unlinked candidate loci in case-control and cohort studies of ... Key words: Chinese, Japanese, population stratification, ancestry informative ...

  5. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

  6. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    assures cardioprotection. Treatment with extracellular nucleotides, or with tri/di-phosphate, administered under normoxic conditions or during hypoxic conditions, led to a decrease in reactive oxygen species production. CONCLUSIONS: Extracellular tri/di-phosphates are apparently the molecule responsible...

  7. Enzymatic Incorporation of Modified Purine Nucleotides in DNA.

    Science.gov (United States)

    Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet

    2017-12-14

    A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Detection of DNA nucleotides on pretreated boron doped diamond electrodes

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

    2011-07-01

    The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

  9. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  10. Free amino acids and 5'-nucleotides in Finnish forest mushrooms.

    Science.gov (United States)

    Manninen, Hanna; Rotola-Pukkila, Minna; Aisala, Heikki; Hopia, Anu; Laaksonen, Timo

    2018-05-01

    Edible mushrooms are valued because of their umami taste and good nutritional values. Free amino acids, 5'-nucleotides and nucleosides were analyzed from four Nordic forest mushroom species (Lactarius camphoratus, Boletus edulis, Cantharellus cibarius, Craterellus tubaeformis) using high precision liquid chromatography analysis. To our knowledge, these taste components were studied for the first time from Craterellus tubaeformis and Lactarius camphoratus. The focus was on the umami amino acids and 5'-nucleotides. The free amino acid and 5'-nucleotide/nucleoside contents of studied species differed from each other. In all studied samples, umami amino acids were among five major free amino acids. The highest concentration of umami amino acids was on L. camphoratus whereas B. edulis had the highest content of sweet amino acids and C. cibarius had the highest content of bitter amino acids. The content of umami enhancing 5'-nucleotides were low in all studied species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Statistical properties and fractals of nucleotide clusters in DNA sequences

    International Nuclear Information System (INIS)

    Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

    2004-01-01

    Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

  12. Lectures in plasma diagnostics

    International Nuclear Information System (INIS)

    Hutchinson, I.H.

    1990-06-01

    This paper discusses the following topics on plasma diagnostics: Electric probes in flowing and magnetized plasmas; Electron cyclotron emission absorption; Magnetic diagnostics; Spectroscopy; and Thomson Scattering

  13. Evolutionary and Structural Perspectives of Plant Cyclic Nucleotide Gated Cation Channels

    Directory of Open Access Journals (Sweden)

    Alice Kira Zelman

    2012-05-01

    Full Text Available Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs. CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide binding domain (CNBD and a calmodulin binding domain (CaMBD as well as a 6 transmembrane/1 pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments.

  14. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.

    2012-05-29

    Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs). CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a calmodulin binding domain as well as a six transmembrane/one pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments. 2012 Zelman, Dawe, Gehring and Berkowitz.

  15. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    2015-11-01

    Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  16. Diagnostic reasoning strategies and diagnostic success.

    Science.gov (United States)

    Coderre, S; Mandin, H; Harasym, P H; Fick, G H

    2003-08-01

    Cognitive psychology research supports the notion that experts use mental frameworks or "schemes", both to organize knowledge in memory and to solve clinical problems. The central purpose of this study was to determine the relationship between problem-solving strategies and the likelihood of diagnostic success. Think-aloud protocols were collected to determine the diagnostic reasoning used by experts and non-experts when attempting to diagnose clinical presentations in gastroenterology. Using logistic regression analysis, the study found that there is a relationship between diagnostic reasoning strategy and the likelihood of diagnostic success. Compared to hypothetico-deductive reasoning, the odds of diagnostic success were significantly greater when subjects used the diagnostic strategies of pattern recognition and scheme-inductive reasoning. Two other factors emerged as independent determinants of diagnostic success: expertise and clinical presentation. Not surprisingly, experts outperformed novices, while the content area of the clinical cases in each of the four clinical presentations demonstrated varying degrees of difficulty and thus diagnostic success. These findings have significant implications for medical educators. It supports the introduction of "schemes" as a means of enhancing memory organization and improving diagnostic success.

  17. Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

    Science.gov (United States)

    Le Gall, O; Candresse, T; Brault, V; Dunez, J

    1989-10-11

    The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

  18. DNA Nucleotide Sequence Restricted by the RI Endonuclease

    Science.gov (United States)

    Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

    1972-01-01

    The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

  19. Development of a single nucleotide polymorphism (SNP) marker for ...

    African Journals Online (AJOL)

    The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

  20. Four new single nucleotide polymorphisms (SNPs) of toll-like ...

    African Journals Online (AJOL)

    In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

  1. Detection of new single nucleotide polymorphisms by means of real ...

    Indian Academy of Sciences (India)

    Unknown

    amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

  2. Involvement of cyclic nucleotides in locust flight muscle metabolism

    NARCIS (Netherlands)

    Worm, R.A.A.

    1980-01-01

    1. Flight had no significant effect on the levels of c-AMP of c-GMP in the flight muscles of Locusta migratoria. 2. Injections of 0.01 or 0.1 corpus cardiacum equivalents into the abdominal cavity did not elicit any effect on cyclic nucleotide levels either. 3. Injection of A23187 resulted in

  3. Analysis of single nucleotide polymorphisms in case-control studies.

    Science.gov (United States)

    Li, Yonghong; Shiffman, Dov; Oberbauer, Rainer

    2011-01-01

    Single nucleotide polymorphisms (SNPs) are the most common type of genetic variants in the human genome. SNPs are known to modify susceptibility to complex diseases. We describe and discuss methods used to identify SNPs associated with disease in case-control studies. An outline on study population selection, sample collection and genotyping platforms is presented, complemented by SNP selection, data preprocessing and analysis.

  4. Subpicosecond Dynamics in Nucleotides Measured by Spontaneous Raman Spectroscopy

    NARCIS (Netherlands)

    Terpstra, P.A.; Terpstra, P.A.; Otto, Cornelis; Greve, Jan

    1997-01-01

    The band widths in Raman spectra are sensitive to dynamics active on a time scale from 0.1 to 10 ps. The band widths of nucleotide vibrations and their dependence on temperature, concentration, and structure are reported. From the experimental band widths and second moments, it is derived that the

  5. Nucleotide excision repair II: From yeast to mammals

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

  6. Nucleotide excision repair I: from E.coli to yeast.

    NARCIS (Netherlands)

    J.H.J. Hoeijmakers (Jan)

    1993-01-01

    textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

  7. Characterization of single nucleotide polymorphism markers for eelgrass (Zostera marina)

    NARCIS (Netherlands)

    Ferber, Steven; Reusch, Thorsten B. H.; Stam, Wytze T.; Olsen, Jeanine L.

    We characterized 37 single nucleotide polymorphism (SNP) makers for eelgrass Zostera marina. SNP markers were developed using existing EST (expressed sequence tag)-libraries to locate polymorphic loci and develop primers from the functional expressed genes that are deposited in The ZOSTERA database

  8. DNA Nucleotides Detection via capacitance properties of Graphene

    Science.gov (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  9. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Effects of dietary nucleotides on growth and disease resistance of crustaceans were evaluated using axenic Artemia culture tests. Higher Artemia growth in xenic culture (15.6 ± 2.9 mm) than in axenic culture (9.2 ± 1.9 mm) reaffirmed the need to eliminate microbial populations known to influence growth and disease ...

  10. Adiponectin Single Nucleotide Polymorphism (+276G/T) and Its ...

    African Journals Online (AJOL)

    The present study was investigating the association between the single nucleotide polymorphism +276 G/T of the adiponectin gene with serum adiponectin level in patients with coronary artery disease (CAD). In this study 100 healthy controls and 100 Egyptian patients with coronary artery disease of both genders ...

  11. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  12. Single nucleotide polymorphisms in the 5'-flanking region of the ...

    African Journals Online (AJOL)

    Prolactin (PRL), a polypeptide hormone synthesized and secreted by the animal's anterior pituitary gland, plays an important role in the regulation of mammalian lactation and avian reproduction. Considering the significant association between single nucleotide polymorphisms (SNPs) in the 5'-flanking region of PRL and ...

  13. Effects of Dietary Nucleotides on Growth Rate and Disease ...

    African Journals Online (AJOL)

    Nucleotides are low molecular weight biological compounds, which are ... nutrition and disease aspects of crustaceans (Overton and Bland 1981 .... additives on growth and disease resistance. Effects of ... metabolically active cells during stressful conditions ... in humans supplemented with Uracyl, which resulted in optimal ...

  14. Whole Genome Sequencing Increases Molecular Diagnostic Yield Compared with Current Diagnostic Testing for Inherited Retinal Disease.

    Science.gov (United States)

    Ellingford, Jamie M; Barton, Stephanie; Bhaskar, Sanjeev; Williams, Simon G; Sergouniotis, Panagiotis I; O'Sullivan, James; Lamb, Janine A; Perveen, Rahat; Hall, Georgina; Newman, William G; Bishop, Paul N; Roberts, Stephen A; Leach, Rick; Tearle, Rick; Bayliss, Stuart; Ramsden, Simon C; Nemeth, Andrea H; Black, Graeme C M

    2016-05-01

    To compare the efficacy of whole genome sequencing (WGS) with targeted next-generation sequencing (NGS) in the diagnosis of inherited retinal disease (IRD). Case series. A total of 562 patients diagnosed with IRD. We performed a direct comparative analysis of current molecular diagnostics with WGS. We retrospectively reviewed the findings from a diagnostic NGS DNA test for 562 patients with IRD. A subset of 46 of 562 patients (encompassing potential clinical outcomes of diagnostic analysis) also underwent WGS, and we compared mutation detection rates and molecular diagnostic yields. In addition, we compared the sensitivity and specificity of the 2 techniques to identify known single nucleotide variants (SNVs) using 6 control samples with publically available genotype data. Diagnostic yield of genomic testing. Across known disease-causing genes, targeted NGS and WGS achieved similar levels of sensitivity and specificity for SNV detection. However, WGS also identified 14 clinically relevant genetic variants through WGS that had not been identified by NGS diagnostic testing for the 46 individuals with IRD. These variants included large deletions and variants in noncoding regions of the genome. Identification of these variants confirmed a molecular diagnosis of IRD for 11 of the 33 individuals referred for WGS who had not obtained a molecular diagnosis through targeted NGS testing. Weighted estimates, accounting for population structure, suggest that WGS methods could result in an overall 29% (95% confidence interval, 15-45) uplift in diagnostic yield. We show that WGS methods can detect disease-causing genetic variants missed by current NGS diagnostic methodologies for IRD and thereby demonstrate the clinical utility and additional value of WGS. Copyright © 2016 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

  15. Procedures in diagnostic radiology

    International Nuclear Information System (INIS)

    Doyle, T.; Hare, W.S.C.; Thomson, K.; Tess, B.

    1989-01-01

    This book outlines the various procedures necessary for the successful practice of diagnostic radiology. Topics covered are: general principles, imaging of the urinary and gastrointestinal tracts, vascular radiology, arthrography, and miscellaneous diagnostic radiologic procedures

  16. Diagnostic Algorithm Benchmarking

    Science.gov (United States)

    Poll, Scott

    2011-01-01

    A poster for the NASA Aviation Safety Program Annual Technical Meeting. It describes empirical benchmarking on diagnostic algorithms using data from the ADAPT Electrical Power System testbed and a diagnostic software framework.

  17. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

    2015-09-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

  18. Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

    Science.gov (United States)

    Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

    2015-01-01

    An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

  19. Veterinary Molecular Diagnostics

    NARCIS (Netherlands)

    Roest, H.I.J.; Engelsma, M.Y.; Weesendorp, E.; Bossers, A.; Elbers, A.R.W.

    2017-01-01

    In veterinary molecular diagnostics, samples originating from animals are tested. Developments in the farm animals sector and in our societal attitude towards pet animals have resulted in an increased demand for fast and reliable diagnostic techniques. Molecular diagnostics perfectly matches this

  20. Preparation of protected nucleotides usable in oligonucleotide synthesis

    International Nuclear Information System (INIS)

    Debiard, Jean-Pascal

    1983-01-01

    After having presented the components of DNA, the author of this research thesis outlines that, when dealing the chemical synthesis, the respect of the sequence of these components is the main problem as each nucleotide possesses several functions which may react with each other. In order to solve this problem, functional protection is used to protect functions which may react in an undesirable way and to let free those which participate to the desired reaction. But a selective protector group must be used and this group must remain stable during the operations it is not involved in. Therefore, its elimination will be easy and without any risk of deterioration of the synthesised molecule. This research thesis first addresses the various available techniques to perform these steps, and then reports the study of possible applications of synthetic nucleotides in the field of genetic engineering [fr

  1. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    International Nuclear Information System (INIS)

    Lo, A.; Yang, H.L.

    1990-01-01

    This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

  2. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  3. Statistical properties of nucleotides in human chromosomes 21 and 22

    International Nuclear Information System (INIS)

    Zhang Linxi; Sun Tingting

    2005-01-01

    In this paper the statistical properties of nucleotides in human chromosomes 21 and 22 are investigated. The n-tuple Zipf analysis with n = 3, 4, 5, 6, and 7 is used in our investigation. It is found that the most common n-tuples are those which consist only of adenine (A) and thymine (T), and the rarest n-tuples are those in which GC or CG pattern appears twice. With the n-tuples become more and more frequent, the double GC or CG pattern becomes a single GC or CG pattern. The percentage of four nucleotides in the rarest ten and the most common ten n-tuples are also considered in human chromosomes 21 and 22, and different behaviors are found in the percentage of four nucleotides. Frequency of appearance of n-tuple f(r) as a function of rank r is also examined. We find the n-tuple Zipf plot shows a power-law behavior for r n-1 and a rapid decrease for r > 4 n-1 . In order to explore the interior statistical properties of human chromosomes 21 and 22 in detail, we divide the chromosome sequence into some moving windows and we discuss the percentage of ξη (ξ, η = A, C, G, T) pair in those moving windows. In some particular regions, there are some obvious changes in the percentage of ξη pair, and there maybe exist functional differences. The normalized number of repeats N 0 (l) can be described by a power law: N 0 (l) ∼ l -μ . The distance distributions P 0 (S) between two nucleotides in human chromosomes 21 and 22 are also discussed. A two-order polynomial fit exists in those distance distributions: log P 0 (S) = a + bS + cS 2 , and it is quite different from the random sequence

  4. Mitochondria as determinant of nucleotide pools and chromosomal stability

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Munch-Petersen, Birgitte; Stevnsner, Tinna

    2007-01-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochon...... mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides....

  5. Prediction of Nucleotide Binding Peptides Using Star Graph Topological Indices.

    Science.gov (United States)

    Liu, Yong; Munteanu, Cristian R; Fernández Blanco, Enrique; Tan, Zhiliang; Santos Del Riego, Antonino; Pazos, Alejandro

    2015-11-01

    The nucleotide binding proteins are involved in many important cellular processes, such as transmission of genetic information or energy transfer and storage. Therefore, the screening of new peptides for this biological function is an important research topic. The current study proposes a mixed methodology to obtain the first classification model that is able to predict new nucleotide binding peptides, using only the amino acid sequence. Thus, the methodology uses a Star graph molecular descriptor of the peptide sequences and the Machine Learning technique for the best classifier. The best model represents a Random Forest classifier based on two features of the embedded and non-embedded graphs. The performance of the model is excellent, considering similar models in the field, with an Area Under the Receiver Operating Characteristic Curve (AUROC) value of 0.938 and true positive rate (TPR) of 0.886 (test subset). The prediction of new nucleotide binding peptides with this model could be useful for drug target studies in drug development. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Nucleotide sequence of tomato ringspot virus RNA-2.

    Science.gov (United States)

    Rott, M E; Tremaine, J H; Rochon, D M

    1991-07-01

    The sequence of tomato ringspot virus (TomRSV) RNA-2 has been determined. It is 7273 nucleotides in length excluding the 3' poly(A) tail and contains a single long open reading frame (ORF) of 5646 nucleotides in the positive sense beginning at position 78 and terminating at position 5723. A second in-frame AUG at position 441 is in a more favourable context for initiation of translation and may act as a site for initiation of translation. The TomRSV RNA-2 3' noncoding region is 1550 nucleotides in length. The coat protein is located in the C-terminal region of the large polypeptide and shows significant but limited amino acid sequence similarity to the putative coat proteins of the nepoviruses tomato black ring (TBRV), Hungarian grapevine chrome mosaic (GCMV) and grapevine fanleaf (GFLV). Comparisons of the coding and non-coding regions of TomRSV RNA-2 and the RNA components of TBRV, GCMV, GFLV and the comovirus cowpea mosaic virus revealed significant similarity for over 300 amino acids between the coding region immediately to the N-terminal side of the putative coat proteins of TomRSV and GFLV; very little similarity could be detected among the non-coding regions of TomRSV and any of these viruses.

  7. Scambio, a novel guanine nucleotide exchange factor for Rho

    Directory of Open Access Journals (Sweden)

    Groffen John

    2004-04-01

    Full Text Available Abstract Background Small GTPases of the Rho family are critical regulators of various cellular functions including actin cytoskeleton organization, activation of kinase cascades and mitogenesis. For this reason, a major objective has been to understand the mechanisms of Rho GTPase regulation. Here, we examine the function of a novel protein, Scambio, which shares homology with the DH-PH domains of several known guanine nucleotide exchange factors for Rho family members. Results Scambio is located on human chromosome 14q11.1, encodes a protein of around 181 kDa, and is highly expressed in both heart and skeletal muscle. In contrast to most DH-PH-domain containing proteins, it binds the activated, GTP-bound forms of Rac and Cdc42. However, it fails to associate with V14RhoA. Immunofluorescence studies indicate that Scambio and activated Rac3 colocalize in membrane ruffles at the cell periphery. In accordance with these findings, Scambio does not activate either Rac or Cdc42 but rather, stimulates guanine nucleotide exchange on RhoA and its close relative, RhoC. Conclusion Scambio associates with Rac in its activated conformation and functions as a guanine nucleotide exchange factor for Rho.

  8. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  9. Diagnostic Development on NSTX

    International Nuclear Information System (INIS)

    A.L. Roquemore; D. Johnson; R. Kaita; et al

    1999-01-01

    Diagnostics are described which are currently installed or under active development for the newly commissioned NSTX device. The low aspect ratio (R/a less than or equal to 1.3) and low toroidal field (0.1-0.3T) used in this device dictate adaptations in many standard diagnostic techniques. Technical summaries of each diagnostic are given, and adaptations, where significant, are highlighted

  10. TFTR diagnostic vacuum controller

    International Nuclear Information System (INIS)

    Olsen, D.; Persons, R.

    1981-01-01

    The TFTR diagnostic vacuum controller (DVC) provides in conjunction with the Central Instrumentation Control and Data Acquisition System (CICADA), control and monitoring for the pumps, valves and gauges associated with each individual diagnostic vacuum system. There will be approximately 50 systems on TFTR. Two standard versions of the controller (A and B) wil be provided in order to meet the requirements of two diagnostic manifold arrangements. All pump and valve sequencing, as well as protection features, will be implemented by the controller

  11. Complexes of Escherichia coli adenylate kinase and nucleotides: 1H NMR studies of the nucleotide sites in solution

    International Nuclear Information System (INIS)

    Vetter, I.R.; Reinstein, J.; Roesch, P.

    1990-01-01

    One- and two-dimensional nuclear magnetic resonance (NMR) studies, in particular substrate-protein nuclear Overhauser effect (NOESY) measurements, as well as nucleotide and P 1 ,P 5 -bis-(5'-adenosyl) pentaphosphate (AP 5 A) titrations and studies of the temperature-dependent unfolding of the tertiary structure of Escherichia coli adenylate kinase (AK EC ) were performed. These experiments and comparison with the same type of experiments performed with the porcine enzyme led them to the following conclusions: (1) at pH 8 and concentrations of approximately 2.5-3 mM, AK EC is partially unfolded at 318 K; (2) ATP·Mg 2+ binds to the ATP site with a dissociation constant of approximately 40 μM under the assumption that ATP binds to one nucleotide site only; (3) AP 5 A·Mg 2+ binds to both nucleotide sites and thus simulates the active complex; (4) the ATP·Mg 2+ adenine in the AK EC ·AP 5 A·Mg 2+ complex is located close to His 134 and Phe 19 ; (5) the AK EC G-loop with bound ATP·Mg 2+ is structurally highly homologous to the loop region in the oncogene product p21 with bound GTP·Mg 2+

  12. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  13. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.).

    Science.gov (United States)

    Galeano, Carlos H; Fernández, Andrea C; Gómez, Marcela; Blair, Matthew W

    2009-12-23

    Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 x G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 x 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation

  14. AVP-stimulated nucleotide secretion in perfused mouse medullary thick ascending limb and cortical collecting duct

    DEFF Research Database (Denmark)

    Odgaard, Elvin V. P.; Prætorius, Helle; Leipziger, Jens Georg

    2009-01-01

    is stimulated remain elusive. Here, we investigate the phenomenon of nucleotide secretion in intact, perfused mouse medullary thick ascending limb (mTAL) and cortical collecting duct (CCD). The nucleotide secretion was monitored by a biosensor adapted to register nucleotides in the tubular outflow...

  15. Implementation of Targeted Next Generation Sequencing in Clinical Diagnostics

    DEFF Research Database (Denmark)

    Larsen, Martin Jakob; Burton, Mark; Thomassen, Mads

    Accurate mutation detection is essential in clinical genetic diagnostics of monogenic hereditary diseases. Targeted next generation sequencing (NGS) provides a promising and cost-effective alternative to Sanger sequencing and MLPA analysis currently used in most diagnostic laboratories. One...... of mutation positive controls previously characterized by Sanger/MLPA analysis. Agilent SureSelect Target-Enrichment kits were used for capturing a set of genes associated with hereditary breast and ovarian cancer syndrome and a compilation of genes involved in multiple rare single gene disorders......, respectively. For diagnostics, the sequencing coverage is essential, wherefore a minimum coverage of 30x per nucleotide in the coding regions was used as our primary quality criterion. For the majority of the included genes, we obtained adequate gene coverage, in which we were able to detect 100% of the known...

  16. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

    2016-01-01

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

  17. The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

    Science.gov (United States)

    Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

    2016-01-15

    Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Psychologists' diagnostic processes during a diagnostic interview

    NARCIS (Netherlands)

    Groenier, Marleen; Beerthuis, Vos R.J.; Pieters, Julius Marie; Witteman, C.L.M.; Witteman, Cilia L.M.; Swinkels, Jan A.

    2011-01-01

    In mental health care, psychologists assess clients’ complaints, analyze underlying problems, and identify causes for these problems, to make treatment decisions. We present a study on psychologists’ diagnostic processes, in which a mixed-method approach was employed. We aimed to identify a common

  19. Diagnostic nerve ultrasonography

    International Nuclear Information System (INIS)

    Baeumer, T.; Grimm, A.; Schelle, T.

    2017-01-01

    For the diagnostics of nerve lesions an imaging method is necessary to visualize peripheral nerves and their surrounding structures for an etiological classification. Clinical neurological and electrophysiological investigations provide functional information about nerve lesions. The information provided by a standard magnetic resonance imaging (MRI) examination is inadequate for peripheral nerve diagnostics; however, MRI neurography is suitable but on the other hand a resource and time-consuming method. Using ultrasonography for peripheral nerve diagnostics. With ultrasonography reliable diagnostics of entrapment neuropathies and traumatic nerve lesions are possible. The use of ultrasonography for neuropathies shows that a differentiation between different forms is possible. Nerve ultrasonography is an established diagnostic tool. In addition to the clinical examination and clinical electrophysiology, structural information can be obtained, which results in a clear improvement in the diagnostics. Ultrasonography has become an integral part of the diagnostic work-up of peripheral nerve lesions in neurophysiological departments. Nerve ultrasonography is recommended for the diagnostic work-up of peripheral nerve lesions in addition to clinical and electrophysiological investigations. It should be used in the clinical work-up of entrapment neuropathies, traumatic nerve lesions and spacy-occupying lesions of nerves. (orig.) [de

  20. Ongoing experiments: diagnostics requirements

    International Nuclear Information System (INIS)

    Dickerman, C.E.

    1976-01-01

    The paper reviews the fuel motion diagnostics needs for ongoing LMFBR safety experiments over approximately the next five years, with the discussion centered on TREAT. Brief comments on the direction in which clad motion diagnostics requirements are expected to develop are also presented

  1. Clinical diagnostic ultrasound

    International Nuclear Information System (INIS)

    Barnett, E.; Morley, P.

    1986-01-01

    This textbook on diagnostic ultrasound covers the main systems, with emphasis being placed on the clinical application of diagnostic ultrasound in everyday practice. It provides not only a textbook for postgraduates (particularly FRCR candidates), but also a reference work for practitioners of clinical ultrasound and clinicians generally

  2. Gearbox vibration diagnostic analyzer

    Science.gov (United States)

    1992-01-01

    This report describes the Gearbox Vibration Diagnostic Analyzer installed in the NASA Lewis Research Center's 500 HP Helicopter Transmission Test Stand to monitor gearbox testing. The vibration of the gearbox is analyzed using diagnostic algorithms to calculate a parameter indicating damaged components.

  3. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms

    OpenAIRE

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jka/Jkb, Fya/Fyb, S/s, K/k, Kpa/Kpb, Jsa/Jsb, Coa/Cob and Lua/Lub alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplif...

  4. Nucleotide sequence of the triosephosphate isomerase gene from Macaca mulatta

    Energy Technology Data Exchange (ETDEWEB)

    Old, S.E.; Mohrenweiser, H.W. (Univ. of Michigan, Ann Arbor (USA))

    1988-09-26

    The triosephosphate isomerase gene from a rhesus monkey, Macaca mulatta, charon 34 library was sequenced. The human and chimpanzee enzymes differ from the rhesus enzyme at ASN 20 and GLU 198. The nucleotide sequence identity between rhesus and human is 97% in the coding region and >94% in the flanking regions. Comparison of the rhesus and chimp genes, including the intron and flanking sequences, does not suggest a mechanism for generating the two TPI peptides of proliferating cells from hominoids and a single peptide from the rhesus gene.

  5. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  6. Nucleotide Selectivity at a Preinsertion Checkpoint of T7 RNA Polymerase Transcription Elongation.

    Science.gov (United States)

    E, Chao; Duan, Baogen; Yu, Jin

    2017-04-20

    Nucleotide selection is crucial for transcription fidelity control, in particular, for viral T7 RNA polymerase (RNAP) lack of proofreading activity. It has been recognized that multiple kinetic checkpoints exist prior to full nucleotide incorporation. In this work, we implemented intensive atomistic molecular dynamics (MD) simulations to quantify how strong the nucleotide selection is at the initial checkpoint of an elongation cycle of T7 RNAP. The incoming nucleotides bind into a preinsertion site where a critical tyrosine residue locates nearby to assist the nucleotide selection. We calculated the relative binding free energy between a noncognate nucleotide and a cognate one at a preinsertion configuration via alchemical simulations, showing that a small selection free energy or the binding free energy difference (∼3 k B T) exists between the two nucleotides. Indeed, another preinsertion configuration favored by the noncognate nucleotides was identified, which appears to be off path for further nucleotide insertion and additionally assists the nucleotide selection. By chemical master equation (CME) approach, we show that the small selection free energy at the preinsertion site along with the off-path noncognate nucleotide filtering can help substantially to reduce the error rate and to maintain the elongation rate high in the T7 RNAP transcription.

  7. Site-specific fab fragment biotinylation at the conserved nucleotide binding site for enhanced Ebola detection.

    Science.gov (United States)

    Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

    2015-07-01

    The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides. © 2015 Wiley Periodicals, Inc.

  8. Role of novel and rare nucleotide substitutions of the β-globin gene

    Directory of Open Access Journals (Sweden)

    Margherita Vinciguerra

    2012-11-01

    Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序,旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段:1)血液及血红蛋白数据;2)珠蛋白基因分子分析以及家族遗传研究(如有可能)。 自2003年以来,我们已对这类病例进行DNA序列分析:传统的分子方法无法给出完整的诊断响应,尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。

  9. Kinetic mechanism and nucleotide specificity of NADH peroxidase

    International Nuclear Information System (INIS)

    Stoll, V.S.; Blanchard, J.S.

    1988-01-01

    NADH peroxidase is a flavoprotein isolated from Streptococcus faecalis which catalyzes the pyridine nucleotide-dependent reduction of hydrogen peroxide to water. Initial velocity, product, and dead-end inhibition studies have been performed at pH 7.5 and support a ping-pong kinetic mechanism. In the absence of hydrogen peroxide, both transhydrogenation between NADH and thioNAD, and isotope exchange between [ 14 C]NADH and NAD, have been demonstrated, although in both these experiments, the maximal velocity of nucleotide exchange was less than 1.5% the maximal velocity of the peroxidatic reaction. We propose that NADH binds tightly to both oxidized and two-electron reduced enzyme. NADH oxidation proceeds stereospecifically with the transfer of the 4S hydrogen to enzyme, and then, via exchange, to water. No primary tritium kinetic isotope effect was observed, and no statistically significant primary deuterium kinetic isotope effects on V/K were determined, although primary deuterium kinetic isotope effects on V were observed in the presence and absence of sodium acetate. NADH peroxidase thus shares with other flavoprotein reductases striking kinetic, spectroscopic, and stereochemical similarities. On this basis, we propose a chemical mechanism for the peroxide cleaving reaction catalyzed by NADH peroxidase which involves the obligate formation of a flavinperoxide, and peroxo bond cleavage by nucleophilic attack by enzymatic dithiols

  10. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  11. Retinal Cyclic Nucleotide-Gated Channels: From Pathophysiology to Therapy

    Directory of Open Access Journals (Sweden)

    Stylianos Michalakis

    2018-03-01

    Full Text Available The first step in vision is the absorption of photons by the photopigments in cone and rod photoreceptors. After initial amplification within the phototransduction cascade the signal is translated into an electrical signal by the action of cyclic nucleotide-gated (CNG channels. CNG channels are ligand-gated ion channels that are activated by the binding of cyclic guanosine monophosphate (cGMP or cyclic adenosine monophosphate (cAMP. Retinal CNG channels transduce changes in intracellular concentrations of cGMP into changes of the membrane potential and the Ca2+ concentration. Structurally, the CNG channels belong to the superfamily of pore-loop cation channels and share a common gross structure with hyperpolarization-activated cyclic nucleotide-gated (HCN channels and voltage-gated potassium channels (KCN. In this review, we provide an overview on the molecular properties of CNG channels and describe their physiological role in the phototransduction pathways. We also discuss insights into the pathophysiological role of CNG channel proteins that have emerged from the analysis of CNG channel-deficient animal models and human CNG channelopathies. Finally, we summarize recent gene therapy activities and provide an outlook for future clinical application.

  12. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  13. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A; Turek, Ilona S.

    2017-01-01

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  14. Modification of synthesis nucleotides [γ-32P] ATP

    International Nuclear Information System (INIS)

    Wira Y Rahman; Endang Sarmini; Herlina; Triyanto; Hambali; Abdul Mutalib; Santi Nurbaiti

    2013-01-01

    In molecular biology, radionuclides in the form of radiolabeled compounds have been widely used as deoxyribonucleic acid (DNA) / ribonucleic acid (RNA) tracer in order to explore a wide range of physiological and pathological processes. One of such compounds is [γ- 32 P]-adenosine triphosphate {[γ- 32 P]-ATP} [γ- 32 P]-ATP which has been widely used in the biotechnology research. In order to support the biotechnology research in Indonesia in this project, [γ- 32 P]- ATP had been synthesized by enzymatic reactions with modifying the method of synthesis using the precursor DL-glyceraldehyde 3-phosphate, nucleotides Adenosine Diphosphate (ADP) and H 3 32 PO 4 and enzymes glyceraldehyde 3-phosphate dehydrogenase, 3-phosphoroglyceric phosphokinase and lactate dehydrogenase. The purification of the synthesized [γ- 32 P]-ATP, by using DEAE Sephadex column chromatography. The synthesis and purification process that had been performed were able in producing of [γ- 32 P]-ATP with radioactivity of 1,175 mCi and radiochemical purity of 99,49%.. Having successfully prepared the [γ- 32 P]-ATP and application, in the near future the Radioisotopes and Radiopharmaceuticals Centre is expected to be able in providing the above-mentioned radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  15. Nucleobases, nucleosides, and nucleotides: versatile biomolecules for generating functional nanomaterials.

    Science.gov (United States)

    Pu, Fang; Ren, Jinsong; Qu, Xiaogang

    2018-02-21

    The incorporation of biomolecules into nanomaterials generates functional nanosystems with novel and advanced properties, presenting great potential for applications in various fields. Nucleobases, nucleosides and nucleotides, as building blocks of nucleic acids and biological coenzymes, constitute necessary components of the foundation of life. In recent years, as versatile biomolecules for the construction or regulation of functional nanomaterials, they have stimulated interest in researchers, due to their unique properties such as structural diversity, multiplex binding sites, self-assembly ability, stability, biocompatibility, and chirality. In this review, strategies for the synthesis of nanomaterials and the regulation of their morphologies and functions using nucleobases, nucleosides, and nucleotides as building blocks, templates or modulators are summarized alongside selected applications. The diverse applications range from sensing, bioimaging, and drug delivery to mimicking light-harvesting antenna, the construction of logic gates, and beyond. Furthermore, some perspectives and challenges in this emerging field are proposed. This review is directed toward the broader scientific community interested in biomolecule-based functional nanomaterials.

  16. Assay of cyclic nucleotide phosphodiesterase using radiolabeled and fluorescent substrates

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Manganiello, V.C.

    1988-01-01

    There are four major classes of phosphodiesterase with different specificities for cAMP and cGMP and different allosteric regulators. Type I phosphodiesterase is activated by calmodulin plus Ca/sup 2+/ and has a higher affinity for cGMP than cAMP. Type II phosphodiesterase likewise has a higher affinity for cGMP than cAMP, but the activity toward one substrate is markedly stimulated by low (micromolar) concentrations of the other nucleotide. Type III phosphodiesterase has a higher affinity for cAMP than cGMP; its activity is increased in responsive cells by certain hormones, e.g., insulin, isoproterenol. Type IV phosphodiesterase is the cGMP-specific enzyme, which also has an allosteric binding site for cGMP. An example of this class of enzyme is the one from retinal rod outer segments, which is activated by light via rhodopsin and the guanine nucleotide-binding protein transducin. There appears to be little structural relatedness among these enzymes based on immunologic analysis, consistent with the possibility that divergent forms evolved from an ancestral enzyme. Determination of the amount of a specific form of phosphodiesterase in crude material is often difficult. Modification of assay conditions by judicious choice of substrate and/or inhibitor concentrations may selectively favor (or reduce) the activity of a particular form; in many instances, however, some fractionation of enzymes may be necessary. This is discussed more fully in the final section of this chapter

  17. Complete nucleotide sequences of avian metapneumovirus subtype B genome.

    Science.gov (United States)

    Sugiyama, Miki; Ito, Hiroshi; Hata, Yusuke; Ono, Eriko; Ito, Toshihiro

    2010-12-01

    Complete nucleotide sequences were determined for subtype B avian metapneumovirus (aMPV), the attenuated vaccine strain VCO3/50 and its parental pathogenic strain VCO3/60616. The genomes of both strains comprised 13,508 nucleotides (nt), with a 42-nt leader at the 3'-end and a 46-nt trailer at the 5'-end. The genome contains eight genes in the order 3'-N-P-M-F-M2-SH-G-L-5', which is the same order shown in the other metapneumoviruses. The genes are flanked on either side by conserved transcriptional start and stop signals and have intergenic sequences varying in length from 1 to 88 nt. Comparison of nt and predicted amino acid (aa) sequences of VCO3/60616 with those of other metapneumoviruses revealed higher homology with aMPV subtype A virus than with other metapneumoviruses. A total of 18 nt and 10 deduced aa differences were seen between the strains, and one or a combination of several differences could be associated with attenuation of VCO3/50.

  18. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  19. Diagnostics on Z (invited)

    International Nuclear Information System (INIS)

    Nash, T. J.; Derzon, M. S.; Chandler, G. A.; Fehl, D. L.; Leeper, R. J.; Porter, J. L.; Spielman, R. B.; Ruiz, C.; Cooper, G.; McGurn, J.

    2001-01-01

    The 100 ns, 20 MA pinch-driver Z is surrounded by an extensive set of diagnostics. There are nine radial lines of sight set at 12 o above horizontal and each of these may be equipped with up to five diagnostic ports. Instruments routinely fielded viewing the pinch from the side with these ports include x-ray diode arrays, photoconducting detector arrays, bolometers, transmission grating spectrometers, time-resolved x-ray pinhole cameras, x-ray crystal spectrometers, calorimeters, silicon photodiodes, and neutron detectors. A diagnostic package fielded on axis for viewing internal pinch radiation consists of nine lines of sight. This package accommodates virtually the same diagnostics as the radial ports. Other diagnostics not fielded on the axial or radial ports include current B-dot monitors, filtered x-ray scintillators coupled by fiber optics to streak cameras, streaked visible spectroscopy, velocity interferometric system for any reflector, bremsstrahlung cameras, and active shock breakout measurement of hohlraum temperature. The data acquisition system is capable of recording up to 500 channels and the data from each shot is available on the Internet. A major new diagnostic presently under construction is the BEAMLET backlighter. We will briefly describe each of these diagnostics and present some of the highest-quality data from them

  20. Allele specific LAMP- gold nanoparticle for characterization of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Fábio Ferreira Carlos

    2017-12-01

    Full Text Available Due to their relevance as disease biomarkers and for diagnostics, screening of single nucleotide polymorphism (SNPs requires simple and straightforward strategies capable to provide results in medium throughput settings. Suitable approaches relying on isothermal amplification techniques have been evolving to substitute the cumbersome and highly specialized PCR amplification detection schemes. Nonetheless, identification of an individual’s genotype still requires sophisticated equipment and laborious methods.Here, we present a low-cost and reliable approach based on the allele specific loop-mediated isothermal amplification (AS-LAMP coupled to ssDNA functionalized gold nanoparticle (Au-nanoprobe colorimetric sequence discrimination. The Au-nanoprobe integration allows for the colorimetric detection of AS-LAMP amplification product that can be easily interpreted in less than 15 min. We targeted a clinical relevant SNP responsible for lactose intolerance (-13910C/T dbSNP rs#: 4988235 to demonstrate its proof of concept and full potential of this novel approach. Keywords: SNP, Isothermal amplification, Gold nanoparticles, Gold nanoprobes, Lactose intolerance

  1. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms.

    Science.gov (United States)

    Honsa, Erin; Fricke, Thomas; Stephens, Alex J; Ko, Danny; Kong, Fanrong; Gilbert, Gwendolyn L; Huygens, Flavia; Giffard, Philip M

    2008-08-19

    Streptococcus agalactiae (Group B Streptococcus (GBS)) is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP) based method for assigning GBS isolates to multilocus sequence typing (MLST)-defined clonal complexes. It was found that a SNP set derived from the MLST database on the basis of maximization of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  2. Cable Diagnostic Focused Initiative

    Energy Technology Data Exchange (ETDEWEB)

    Hartlein, R.A.; Hampton, R.N.

    2010-12-30

    This report summarizes an extensive effort made to understand how to effectively use the various diagnostic technologies to establish the condition of medium voltage underground cable circuits. These circuits make up an extensive portion of the electric delivery infrastructure in the United States. Much of this infrastructure is old and experiencing unacceptable failure rates. By deploying efficient diagnostic testing programs, electric utilities can replace or repair circuits that are about to fail, providing an optimal approach to improving electric system reliability. This is an intrinsically complex topic. Underground cable systems are not homogeneous. Cable circuits often contain multiple branches with different cable designs and a range of insulation materials. In addition, each insulation material ages differently as a function of time, temperature and operating environment. To complicate matters further, there are a wide variety of diagnostic technologies available for assessing the condition of cable circuits with a diversity of claims about the effectiveness of each approach. As a result, the benefits of deploying cable diagnostic testing programs have been difficult to establish, leading many utilities to avoid the their use altogether. This project was designed to help address these issues. The information provided is the result of a collaborative effort between Georgia Tech NEETRAC staff, Georgia Tech academic faculty, electric utility industry participants, as well as cable system diagnostic testing service providers and test equipment providers. Report topics include: •How cable systems age and fail, •The various technologies available for detecting potential failure sites, •The advantages and disadvantages of different diagnostic technologies, •Different approaches for utilities to employ cable system diagnostics. The primary deliverables of this project are this report, a Cable Diagnostic Handbook (a subset of this report) and an online

  3. Plasma diagnostic reflectometry

    International Nuclear Information System (INIS)

    Cohen, B.I.; Afeyan, B.B.; Garrison, J.C.; Kaiser, T.B.; Luhmann, N.C. Jr.; Domier, C.W.; Chou, A.E.; Baang, S.

    1996-01-01

    Theoretical and experimental studies of plasma diagnostic reflectometry have been undertaken as a collaborative research project between the Lawrence Livermore National Laboratory (LLNL) and the University of California Department of Applied Science Plasma Diagnostics Group under the auspices of the Laboratory Directed Research and Development Program at LLNL. Theoretical analyses have explored the basic principles of reflectometry to understand its limitations, to address specific gaps in the understanding of reflectometry measurements in laboratory experiments, and to explore extensions of reflectometry such as ultra-short-pulse reflectometry. The theory has supported basic laboratory reflectometry experiments where reflectometry measurements can be corroborated by independent diagnostic measurements

  4. Equipment for radiation diagnostics

    International Nuclear Information System (INIS)

    Tschunt, E.; Platz, W.

    1976-01-01

    The invention relates to an improvement of the line type of the plotter in an X-ray diagnostics apparatus enabling the production of distinguishable recordings by means of a single plot type. The construction is described explicitly. (UWI) [de

  5. National Convective Weather Diagnostic

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Current convective hazards identified by the National Convective Weather Detection algorithm. The National Convective Weather Diagnostic (NCWD) is an automatically...

  6. Diagnostic radiology: I

    International Nuclear Information System (INIS)

    Anon.

    1993-01-01

    This chapter describes the historic development of diagnostic equipment for radiology. The problems associated with fluoroscope design are detailed and the current uses of updated technology, particularly digitization, are considered. Numerous historical photographs are included. 13 refs

  7. Prenatal Genetic Diagnostic Tests

    Science.gov (United States)

    ... are available for many inherited disorders. The main disadvantage is that diagnostic testing carries a very small ... chromosomes, arranged in order of size. Microarray: A technology that examines all of a person’s genes to ...

  8. Molecular diagnostics of periodontitis

    OpenAIRE

    Izabela Korona-Głowniak; Radosław Siwiec; Marcin Berger; Anna Malm; Jolanta Szymańska

    2017-01-01

    The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host’s health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridi...

  9. Optics/Optical Diagnostics Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — The Optics/Optical Diagnostics Laboratory supports graduate instruction in optics, optical and laser diagnostics and electro-optics. The optics laboratory provides...

  10. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

    2015-01-01

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  11. Radicals of DNA and DNA nucleotides generated by ionising radiation

    International Nuclear Information System (INIS)

    Przybytniak, G.

    2004-01-01

    A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

  12. Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

    Science.gov (United States)

    Berti, Lorenzo; Burley, Glenn A.

    2008-02-01

    Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

  13. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    ) followed by five 15 s all-out sprints. Control trials were conducted in a 20°C environment while heat stress trials were performed at an ambient temperature of 40°C. Muscle biopsies and venous blood samples were obtained at rest, after 40 min of exercise and following the maximal sprints. Following......Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycling...... exercise with heat stress, the core and muscle temperatures peaked at 39.5±0.2 and 40.2±0.2°C to be ~ 1°C higher (Pheat stress trial (P

  14. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  15. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... to explain contemporary patterns of polymorphisms in rice, including a (i) selectively neutral population bottleneck model, (ii) bottleneck plus migration model, (iii) multiple selective sweeps model, and (iv) bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been...

  16. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  17. High pressure {sup 31}P NMR spectroscopy on guanine nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Spoerner, Michael; Karl, Matthias; Lopes, Pedro; Hoering, Marcus; Loeffel, Karoline; Nuehs, Andrea; Adelsberger, Joseph; Kremer, Werner; Kalbitzer, Hans Robert, E-mail: hans-robert.kalbitzer@ur.de [University of Regensburg, Centre of Magnetic Resonance in Chemistry and Biomedicine, Institute of Biophysics and Physical Biochemistry (Germany)

    2017-01-15

    The {sup 31}P NMR pressure response of guanine nucleotides bound to proteins has been studied in the past for characterizing the pressure perturbation of conformational equilibria. The pressure response of the {sup 31}P NMR chemical shifts of the phosphate groups of GMP, GDP, and GTP as well as the commonly used GTP analogs GppNHp, GppCH{sub 2}p and GTPγS was measured in the absence and presence of Mg{sup 2+}-ions within a pressure range up to 200 MPa. The pressure dependence of chemical shifts is clearly non-linear. For all nucleotides a negative first order pressure coefficient B{sub 1} was determined indicating an upfield shift of the resonances with pressure. With exception of the α-phosphate group of Mg{sup 2+}·GMP and Mg{sup 2+}·GppNHp the second order pressure coefficients are positive. To describe the data of Mg{sup 2+}·GppCH{sub 2}p and GTPγS a Taylor expansion of 3rd order is required. For distinguishing pH effects from pressure effects a complete pH titration set is presented for GMP, as well as GDP and GTP in absence and presence of Mg{sup 2+} ions using indirect referencing to DSS under identical experimental conditions. By a comparison between high pressure {sup 31}P NMR data on free Mg{sup 2+}-GDP and Mg{sup 2+}-GDP in complex with the proto-oncogene Ras we demonstrate that pressure induced changes in chemical shift are clearly different between both forms.

  18. Electrical detection and quantification of single and mixed DNA nucleotides in suspension

    Science.gov (United States)

    Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

    2016-09-01

    High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

  19. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

    Science.gov (United States)

    2012-01-01

    science tool box after a thorough validation study. This method incorporates molecular biology techniques that are already well established in research and diagnostic laboratories, allowing for an easy introduction of this method into existing laboratories. Keywords: single nucleotide polymorphisms, genotyping, plant pathology, viruses, microbial forensics, Single base primer extension, SNaPshot Multiplex Kit PMID:22594601

  20. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus.

    Science.gov (United States)

    Rogers, Stephanie M; Payton, Mark; Allen, Robert W; Melcher, Ulrich; Carver, Jesse; Fletcher, Jacqueline

    2012-05-17

    validation study. This method incorporates molecular biology techniques that are already well established in research and diagnostic laboratories, allowing for an easy introduction of this method into existing laboratories. single nucleotide polymorphisms, genotyping, plant pathology, viruses, microbial forensics, Single base primer extension, SNaPshot Multiplex Kit.

  1. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  2. The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

    International Nuclear Information System (INIS)

    Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

    1977-01-01

    In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

  3. Nucleos: a web server for the identification of nucleotide-binding sites in protein structures.

    Science.gov (United States)

    Parca, Luca; Ferré, Fabrizio; Ausiello, Gabriele; Helmer-Citterich, Manuela

    2013-07-01

    Nucleos is a web server for the identification of nucleotide-binding sites in protein structures. Nucleos compares the structure of a query protein against a set of known template 3D binding sites representing nucleotide modules, namely the nucleobase, carbohydrate and phosphate. Structural features, clustering and conservation are used to filter and score the predictions. The predicted nucleotide modules are then joined to build whole nucleotide-binding sites, which are ranked by their score. The server takes as input either the PDB code of the query protein structure or a user-submitted structure in PDB format. The output of Nucleos is composed of ranked lists of predicted nucleotide-binding sites divided by nucleotide type (e.g. ATP-like). For each ranked prediction, Nucleos provides detailed information about the score, the template structure and the structural match for each nucleotide module composing the nucleotide-binding site. The predictions on the query structure and the template-binding sites can be viewed directly on the web through a graphical applet. In 98% of the cases, the modules composing correct predictions belong to proteins with no homology relationship between each other, meaning that the identification of brand-new nucleotide-binding sites is possible using information from non-homologous proteins. Nucleos is available at http://nucleos.bio.uniroma2.it/nucleos/.

  4. Improved diagnostic PCR assay for Actinobacillus pleuropneumoniae based on the nucleotide sequence of an outer membrane lipoprotein

    DEFF Research Database (Denmark)

    Gram, Trine; Ahrens, Peter

    1998-01-01

    species related to A. pleuropneumoniae or isolated from pigs were assayed. They were all found negative in the PCR, as were tonsil cultures from 50 pigs of an A. pleuropneumoniae-negative herd. The sensitivity assessed by agarose gel analysis of the PCR product was 10(2) CFU/PCR test tube. The specificity...

  5. LHD neutron diagnostics

    International Nuclear Information System (INIS)

    Isobe, M.; Ogawa, K.; Kobuchi, T.

    2015-01-01

    The Large Helical Device (LHD) project will step into a next stage, i.e. experiment by using deuterium gases after two years of preparation. A comprehensive set of neutron and γ-ray diagnostics is going to be installed on the LHD towards extension of energetic-particle (EP) physics research in heliotron plasmas. Conceptual design of fusion products diagnostics for the LHD was made in late 1990s. After conclusion of agreements for the LHD deuterium experiment with local government bodies, development of FPs diagnostics has begun lately. Because there are a lot of tasks to do, all Japan fusion neutron and γ-ray diagnostics team has been organized in the collaboration framework of National Institute for Fusion Science. FPs diagnostics system on the LHD will consist of 1) wide dynamic range neutron flux monitor (NFM), 2) neutron activation system (NAS), 3) vertical neutron camera (VNC). In addition to these, we are developing a directional scintillating fiber detector, an artificial diamond detector and a γ-ray scintillation detector for confinement study of MeV ions. A neutron energy spectrometer prototype is also being developed and tested in KSTAR. In this paper, roles of NFM, NAS and VNC and current status of implementation onto the LHD are briefly described. (author)

  6. Pitfalls in diagnostic radiology

    Energy Technology Data Exchange (ETDEWEB)

    Peh, Wilfred C.G. (ed.) [Khoo Teck Puat Hospital (Singapore). Dept. of Diagnostic Radiology

    2015-04-01

    Only textbook to focus primarily on the topic of pitfalls in diagnostic radiology. Highlights the pitfalls in a comprehensive and systematic manner. Written by experts in different imaging modalities and subspecialties from reputable centers across the world. The practice of diagnostic radiology has become increasingly complex, with the use of numerous imaging modalities and division into many subspecialty areas. It is becoming ever more difficult for subspecialist radiologists, general radiologists, and residents to keep up with the advances that are occurring year on year, and this is particularly true for less familiar topics. Failure to appreciate imaging pitfalls often leads to diagnostic error and misinterpretation, and potential medicolegal problems. Diagnostic errors may be due to various factors such as inadequate imaging technique, imaging artifacts, failure to recognize normal structures or variants, lack of correlation with clinical and other imaging findings, and poor training or inexperience. Many, if not most, of these factors are potentially recognizable, preventable, or correctable. This textbook, written by experts from reputable centers across the world, systematically and comprehensively highlights the pitfalls that may occur in diagnostic radiology. Both pitfalls specific to different modalities and techniques and those specific to particular organ systems are described with the help of numerous high-quality illustrations. Recognition of these pitfalls is crucial in helping the practicing radiologist to achieve a more accurate diagnosis.

  7. Pitfalls in diagnostic radiology

    International Nuclear Information System (INIS)

    Peh, Wilfred C.G.

    2015-01-01

    Only textbook to focus primarily on the topic of pitfalls in diagnostic radiology. Highlights the pitfalls in a comprehensive and systematic manner. Written by experts in different imaging modalities and subspecialties from reputable centers across the world. The practice of diagnostic radiology has become increasingly complex, with the use of numerous imaging modalities and division into many subspecialty areas. It is becoming ever more difficult for subspecialist radiologists, general radiologists, and residents to keep up with the advances that are occurring year on year, and this is particularly true for less familiar topics. Failure to appreciate imaging pitfalls often leads to diagnostic error and misinterpretation, and potential medicolegal problems. Diagnostic errors may be due to various factors such as inadequate imaging technique, imaging artifacts, failure to recognize normal structures or variants, lack of correlation with clinical and other imaging findings, and poor training or inexperience. Many, if not most, of these factors are potentially recognizable, preventable, or correctable. This textbook, written by experts from reputable centers across the world, systematically and comprehensively highlights the pitfalls that may occur in diagnostic radiology. Both pitfalls specific to different modalities and techniques and those specific to particular organ systems are described with the help of numerous high-quality illustrations. Recognition of these pitfalls is crucial in helping the practicing radiologist to achieve a more accurate diagnosis.

  8. Polychromatic holographic plasma diagnostics

    International Nuclear Information System (INIS)

    Zhiglinskij, A.G.; Morozov, A.O.

    1992-01-01

    Review of holographic interferometry properties is performed and advantages of this method by plasma diagnostics are indicated. Main results obtained by the method of holographic interferometry in studies of various-type plasmas are considered. Special attention is paid to multiwave plasma diagnostics, the necessity of which is related as a rule to multicomponent composition of plasma. The eight laser and gas-discharge sources and holographic schemes, which make it possible to realize plasma polychromatic and holographic interferometry, are considered. The advantages of the method are demonstrated by examples of polychromatic holographic diagnostics of arc discharge and discharge in a hollow cathode. Review of theoretical works determining the applicability area of resonance polychromatic interferometry is carried out

  9. Reversed field pinch diagnostics

    International Nuclear Information System (INIS)

    Weber, P.G.

    1986-01-01

    The Reversed Field Pinch (RFP) is a toroidal, axisymmetric magnetic confinement configuration characterized by a magnetic field configuration in which the toroidal magnetic field is of similar strength to the poloidal field, and is reversed at the edge compared to the center. The RFP routinely operates at high beta, and is a strong candidate for a compact fusion device. Relevant attributes of the configuration will be presented, together with an overview of present and planned experiments and their diagnostics. RFP diagnostics are in many ways similar to those of other magnetic confinement devices (such as tokamaks); these lectures will point out pertinent differences, and will present some diagnostics which provide special insights into unique attributes of the RFP

  10. Metabolomics for laboratory diagnostics.

    Science.gov (United States)

    Bujak, Renata; Struck-Lewicka, Wiktoria; Markuszewski, Michał J; Kaliszan, Roman

    2015-09-10

    Metabolomics is an emerging approach in a systems biology field. Due to continuous development in advanced analytical techniques and in bioinformatics, metabolomics has been extensively applied as a novel, holistic diagnostic tool in clinical and biomedical studies. Metabolome's measurement, as a chemical reflection of a current phenotype of a particular biological system, is nowadays frequently implemented to understand pathophysiological processes involved in disease progression as well as to search for new diagnostic or prognostic biomarkers of various organism's disorders. In this review, we discussed the research strategies and analytical platforms commonly applied in the metabolomics studies. The applications of the metabolomics in laboratory diagnostics in the last 5 years were also reviewed according to the type of biological sample used in the metabolome's analysis. We also discussed some limitations and further improvements which should be considered taking in mind potential applications of metabolomic research and practice. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Corpuscular plasma diagnostics

    International Nuclear Information System (INIS)

    Afrosimov, V.; Petrov, M.

    1984-01-01

    An elementary explanation is presented of the physical principles and important methods of corpuscular plasma diagnostics. The invaluable role of corpuscular methods for measuring the hot plasma ion component in thermonuclear facilities, especially hydrogen ions in tokamaks, is emphasized. All corpuscular methods employ analysis of fast neutral atoms and therefore the mechanism of their creation inside a hot plasma is explained first. The ammount of information obtainable from spectra of fast neutrals is discussed. Multichannel analyzers developed at the FTI A.F. Ioffe in Leningrad are described in detail. Classical passive corpuscular diagnostics are examined as are active methods using artifitial beams of hydrogen atoms. The method used for obtaining local values of ion temperature and density is explained. Corpuscular spectroscopic diagnostics and its application for measuring impurities is mentioned. (J.U.)

  12. [Cytology in uropathological diagnostics].

    Science.gov (United States)

    Gaisa, N T; Lindemann-Docter, K

    2015-11-01

    Cytology in uropathological diagnostics is mainly performed for oncological purposes. The assessment of malignancy by urothelial cell morphology is therefore decisive; however, cytology is only sensitive enough to detect high-grade tumor cells and the different low-grade tumors cannot be reliably diagnosed. Thus, the four-tier classification system of cytological findings (i.e. negative, atypical cells but significance uncertain, suspicious and positive) refers to high-grade tumor cells only. Furthermore, for valid cytological diagnostics not only the cytological specimen but also clinical information on cystoscopy findings and, if applicable, a biopsy should be evaluated together. In difficult differential diagnostic settings, e.g. differentiation between reactive versus neoplastic atypia or difficult to access lesions in the upper urinary tract, additional fluorescence in situ hybridization of cytological preparations might be helpful. At the moment there are no indications for further immunocytology or additional biomarker tests.

  13. ORION laser target diagnostics

    International Nuclear Information System (INIS)

    Bentley, C. D.; Edwards, R. D.; Andrew, J. E.; James, S. F.; Gardner, M. D.; Comley, A. J.; Vaughan, K.; Horsfield, C. J.; Rubery, M. S.; Rothman, S. D.; Daykin, S.; Masoero, S. J.; Palmer, J. B.; Meadowcroft, A. L.; Williams, B. M.; Gumbrell, E. T.; Fyrth, J. D.; Brown, C. R. D.; Hill, M. P.; Oades, K.

    2012-01-01

    The ORION laser facility is one of the UK's premier laser facilities which became operational at AWE in 2010. Its primary mission is one of stockpile stewardship, ORION will extend the UK's experimental plasma physics capability to the high temperature, high density regime relevant to Atomic Weapons Establishment's (AWE) program. The ORION laser combines ten laser beams operating in the ns regime with two sub ps short pulse chirped pulse amplification beams. This gives the UK a unique combined long pulse/short pulse laser capability which is not only available to AWE personnel but also gives access to our international partners and visiting UK academia. The ORION laser facility is equipped with a comprehensive suite of some 45 diagnostics covering optical, particle, and x-ray diagnostics all able to image the laser target interaction point. This paper focuses on a small selection of these diagnostics.

  14. ORION laser target diagnostics.

    Science.gov (United States)

    Bentley, C D; Edwards, R D; Andrew, J E; James, S F; Gardner, M D; Comley, A J; Vaughan, K; Horsfield, C J; Rubery, M S; Rothman, S D; Daykin, S; Masoero, S J; Palmer, J B; Meadowcroft, A L; Williams, B M; Gumbrell, E T; Fyrth, J D; Brown, C R D; Hill, M P; Oades, K; Wright, M J; Hood, B A; Kemshall, P

    2012-10-01

    The ORION laser facility is one of the UK's premier laser facilities which became operational at AWE in 2010. Its primary mission is one of stockpile stewardship, ORION will extend the UK's experimental plasma physics capability to the high temperature, high density regime relevant to Atomic Weapons Establishment's (AWE) program. The ORION laser combines ten laser beams operating in the ns regime with two sub ps short pulse chirped pulse amplification beams. This gives the UK a unique combined long pulse/short pulse laser capability which is not only available to AWE personnel but also gives access to our international partners and visiting UK academia. The ORION laser facility is equipped with a comprehensive suite of some 45 diagnostics covering optical, particle, and x-ray diagnostics all able to image the laser target interaction point. This paper focuses on a small selection of these diagnostics.

  15. Nova diagnostics summary

    International Nuclear Information System (INIS)

    Slivinsky, V.W.; Drake, R.P.

    1985-01-01

    The authors intend that Nova be the best diagnosed ICF research facility in operation today. The authors experience in providing advanced diagnostics for previous laser systems will be extended at Nova, and will be challenged by the development of new instrumentation to diagnose the more advanced targets made possible by this powerful laser. Previous experience has shown that to understand target performance, the authors must have as complete a set of diagnostics as possible. The Nova diagnostics are divided into two sets: the basic set required for the initial Nova experiments and the more advanced set for later, generally more complex, experiments. The basic set will be operational for the first Nova shots; it was a Nova line item funded with Nova construction money. This basic set is presented in a table

  16. Angiography - interventional diagnostic applications

    International Nuclear Information System (INIS)

    Schild, H.

    1994-01-01

    The angiography system is very different from the other systems used in diagnostic radiology. The invasivity of angiography requires special, high standards in theoretical and practical training and experience both of beginners and experienced personnel. This textbook fully meets the demand for in-depth and exhaustive information, as it presents: - The fundamentals and techniques of angiography, the vascular anatomy, and many hints and tips of great help in practice. - A comprehensive survey of diagnostic problems and examination approaches, including neuro-angiography, with 221 reproductions of original angiographs, and additional schematic representations. - A special chapter devoted to indication and relevant techniques for the major vascular interventional examinations. - A great number of tables explain at a glance standard examination techniques, indications and diagnostic criteria. (orig./CB) [de

  17. Beam Instrumentation and Diagnostics

    CERN Document Server

    Strehl, Peter

    2006-01-01

    This treatise covers all aspects of the design and the daily operations of a beam diagnostic system for a large particle accelerator. A very interdisciplinary field, it involves contributions from physicists, electrical and mechanical engineers and computer experts alike so as to satisfy the ever-increasing demands for beam parameter variability for a vast range of operation modi and particles. The author draws upon 40 years of research and work, most of them spent as the head of the beam diagnostics group at GSI. He has illustrated the more theoretical aspects with many real-life examples that will provide beam instrumentation designers with ideas and tools for their work.

  18. Diagnostic Imaging Workshop

    International Nuclear Information System (INIS)

    Sociedad Argentina de Fisica Medica

    2012-01-01

    The American Association of Physicist in Medicine (AAPM), the International Organization for Medical Physics (IOMP) and the Argentina Society of Medical Physics (SAFIM) was organized the Diagnostic Imaging Workshop 2012, in the city of Buenos Aires, Argentina. This workshop was an oriented training and scientific exchange between professionals and technicians who work in medical physics, especially in the areas of diagnostic imaging, nuclear medicine and radiotherapy, with special emphasis on the use of multimodal imaging for radiation treatment, planning as well of quality assurance associates.

  19. Electron beam diagnostics study

    International Nuclear Information System (INIS)

    Garganne, P.

    1989-08-01

    This paper summarizes the results of a study on beam diagnostics, using carbon wire scanners and optical transition radiation (DTR) monitors. The main consideration consists in the material selection, taking their thermal properties and their effect on the beam into account [fr

  20. Molecular Beacons in Diagnostics

    OpenAIRE

    Tyagi, Sanjay; Kramer, Fred Russell

    2012-01-01

    Recent technical advances have begun to realize the potential of molecular beacons to test for diverse infections in clinical diagnostic laboratories. These include the ability to test for, and quantify, multiple pathogens in the same clinical sample, and to detect antibiotic resistant strains within hours. The design principles of molecular beacons have also spawned a variety of allied technologies.

  1. Diagnostic radiation and pregnancy

    International Nuclear Information System (INIS)

    Collins, L.; Fitzgerald, P.

    1983-01-01

    Accidental irradiation of the embryo or fetus in the first trimester is a problem which will occasionally occur. The value of a proper estimation of the radiation dose is emphasised. Very rarely does a single diagnostic procedure result in a uterine dose as high as 50 mGy. An accidental irradiation should rarely be cause for termination of a pregnancy

  2. Diagnostic imaging of craniopharyngioma

    International Nuclear Information System (INIS)

    Gradzki, J.; Nowak, S.; Paprzycki, W.

    1993-01-01

    40 patients have been examined with operational and histological confirmation of craniopharyngioma. CT image and X-ray plane of skull were performed in case all of these patients. TMR was conformed to examine 4 patients. X-ray planes was compared to CT. CT permits tumor cyst detection. The efficacy of mentioned above diagnostic techniques was compared with surgical findings. (author)

  3. Diagnostics for induction accelerators

    International Nuclear Information System (INIS)

    Fessenden, T.J.

    1996-04-01

    The induction accelerator was conceived by N. C. Christofilos and first realized as the Astron accelerator that operated at LLNL from the early 1960's to the end of 1975. This accelerator generated electron beams at energies near 6 MeV with typical currents of 600 Amperes in 400 ns pulses. The Advanced Test Accelerator (ATA) built at Livermore's Site 300 produced 10,000 Ampere beams with pulse widths of 70 ns at energies approaching 50 MeV. Several other electron and ion induction accelerators have been fabricated at LLNL and LBNL. This paper reviews the principal diagnostics developed through efforts by scientists at both laboratories for measuring the current, position, energy, and emittance of beams generated by these high current, short pulse accelerators. Many of these diagnostics are closely related to those developed for other accelerators. However, the very fast and intense current pulses often require special diagnostic techniques and considerations. The physics and design of the more unique diagnostics developed for electron induction accelerators are presented and discussed in detail

  4. Diagnostic studies in amyloidosis

    NARCIS (Netherlands)

    Hazenberg, Bouke Pier Cornelis

    2007-01-01

    In this thesis two diagnostic techniques are studied in amyloidosis. Systemic amyloidosis is characterized by deposition of amyloid fibrils (tiny fibres) throughout the body resulting in damage of vital organs. Amyloid can be detected in a tissue specimen stained with Congo red: red-stained amyloid

  5. 1968 Prototype Diagnostic Test.

    Science.gov (United States)

    Veterans Administration Hospital, Bedford, MA.

    This true-false diagnostic test was used for pretesting of employees at a Veterans Administration Hospital. The test is comprised of 20 items. An alternate test--Classification Questionnaire--was used for testing after remedial training. (For related document, see TM 002 334.) (DB)

  6. Diagnostics for induction accelerators

    International Nuclear Information System (INIS)

    Fessenden, T.J.

    1997-01-01

    The induction accelerator was conceived by N. C. Christofilos and first realized as the Astron accelerator that operated at Lawrence Livermore National Laboratory (LLNL) from the early 1960s to the end of 1975. This accelerator generated electron beams at energies near 6 MeV with typical currents of 600 Amperes in 400-ns pulses. The Advanced Test Accelerator (ATA) built at Livermore close-quote s Site 300 produced 10,000-Ampere beams with pulse widths of 70 ns at energies approaching 50 MeV. Several other electron and ion induction accelerators have been fabricated at LLNL and Lawrence Berkeley National Laboratory (LBNL). This paper reviews the principal diagnostics developed through efforts by scientists at both laboratories for measuring the current, position, energy, and emittance of beams generated by these high-current, short-pulse accelerators. Many of these diagnostics are closely related to those developed for other accelerators. However, the very fast and intense current pulses often require special diagnostic techniques and considerations. The physics and design of the more unique diagnostics developed for electron induction accelerators are presented and discussed in detail. copyright 1997 American Institute of Physics

  7. It's diagnostics, stupid.

    Science.gov (United States)

    Bernards, René

    2010-04-02

    To stem the spiraling cost of cancer treatment, a concerted effort is urgently needed to develop molecular diagnostics to better identify the patients that respond to expensive targeted therapies. Opportunities and obstacles in the development of such drug response biomarkers are discussed here. Copyright 2010 Elsevier Inc. All rights reserved.

  8. Diagnostics for pellet experiments

    International Nuclear Information System (INIS)

    Johnson, R.R.

    1978-01-01

    The target diagnostics which are being used and planned in current laser driven ICF Experiments are described. Most of these diagnostics can be easily applied to future ion-beam fusion experiments. The status of laser fusion diagnostics has been much improved in the last 5 years and further improvements can be expected and should be available when the first ICF experiments using ion beams are performed. As an example, x-ray temporal and spatial resolutions are now approximately 5 psec and 3 μm, which is approximately a factor of 4 better than the resolution reported in the first implosion experiments. As one plans ahead for ion-beam fusion experiments it should be emphasized that high yield experiments are easier to diagnose provided adequate shielding is employed. However, in the event that the first high yield experiments fail it will be necessary to have diagnostics available to determine where the problems lie. In laser fusion it is interesting to note that higher laser powers are required now for breakeven experiments than first anticipated, mainly because some aspects of the laser-interaction physics were not recognized until the experiments were carefully diagnosed. Thus as has been pointed out, it may be necessary to increase the energy of the ion-beam driver to enable us to do breakeven experiments with high confidence

  9. Flowfield modeling and diagnostics

    International Nuclear Information System (INIS)

    Gupta, A.K.; Lilley, D.G.

    1985-01-01

    This textbook is devoted solely to flowfield modeling and diagnostics; their practical use, recent and current research, and projected developments and trends. It provides an account of the use of a broad range of techniques in industrial and research practice, both with and without combustion. Application ideas are complemented by details about experimental and modeling techniques

  10. Serbia : Systematic Country Diagnostic

    OpenAIRE

    World Bank Group

    2015-01-01

    This Systematic Country Diagnostic (SCD) aims to identify the major constraints on and opportunities for sustaining poverty reduction and shared prosperity in Serbia. The SCD serves as the analytic foundation on which the World Bank Group and the Government of Serbia will define a new Country Partnership Framework for FY2016 to FY2020. It is based on the best possible analysis, drawing on ...

  11. Diagnostic and interventional radiology

    Energy Technology Data Exchange (ETDEWEB)

    Vogl, Thomas J. [Klinikum der Johann Wolfgang Goethe-Universitaet, Frankfurt am Main (Germany). Inst. fuer Diagnostische und Interventionelle Radiologie; Reith, Wolfgang [Universitaetsklinikum des Saarlandes, Homburg/Saar (Germany). Klinik fuer Diagnostische und Interventionelle Neuroradiologie; Rummeny, Ernst J. (ed.) [Technische Univ. Muenchen Klinikum rechts der Isar, Muenchen (Germany). Inst. fuer Radiologie

    2016-08-01

    This exceptional book covers all aspects of diagnostic and interventional radiology within one volume, at a level appropriate for the specialist. From the basics through diagnosis to intervention: the reader will find a complete overview of all areas of radiology. The clear, uniform structure, with chapters organized according to organ system, facilitates the rapid retrieval of information. Features include: Presentation of the normal radiological anatomy Classification of the different imaging procedures according to their diagnostic relevance Imaging diagnosis with many reference images Precise description of the interventional options The inclusion of many instructive aids will be of particular value to novices in decision making: Important take home messages and summaries of key radiological findings smooth the path through the jungle of facts Numerous tables on differential diagnosis and typical findings in the most common diseases offer a rapid overview and orientation Diagnostic flow charts outline the sequence of diagnostic evaluation All standard procedures within the field of interventional radiology are presented in a clinically relevant and readily understandable way, with an abundance of illustrations. This is a textbook, atlas, and reference in one: with more than 2500 images for comparison with the reader's own findings. This comprehensive and totally up-to-date book provides a superb overview of everything that the radiology specialist of today needs to know.

  12. Identification of novel single nucleotide polymorphisms associated with acute respiratory distress syndrome by exome-seq.

    Directory of Open Access Journals (Sweden)

    Katherine Shortt

    Full Text Available Acute respiratory distress syndrome (ARDS is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719 in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T occurs within a histone mark (intron 6 of the Arylsulfatase D gene. rs9605146 (G>A causes a deleterious coding change (proline to leucine in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted.

  13. Uncommon nucleotide excision repair phenotypes revealed by targeted high-throughput sequencing.

    Science.gov (United States)

    Calmels, Nadège; Greff, Géraldine; Obringer, Cathy; Kempf, Nadine; Gasnier, Claire; Tarabeux, Julien; Miguet, Marguerite; Baujat, Geneviève; Bessis, Didier; Bretones, Patricia; Cavau, Anne; Digeon, Béatrice; Doco-Fenzy, Martine; Doray, Bérénice; Feillet, François; Gardeazabal, Jesus; Gener, Blanca; Julia, Sophie; Llano-Rivas, Isabel; Mazur, Artur; Michot, Caroline; Renaldo-Robin, Florence; Rossi, Massimiliano; Sabouraud, Pascal; Keren, Boris; Depienne, Christel; Muller, Jean; Mandel, Jean-Louis; Laugel, Vincent

    2016-03-22

    Deficient nucleotide excision repair (NER) activity causes a variety of autosomal recessive diseases including xeroderma pigmentosum (XP) a disorder which pre-disposes to skin cancer, and the severe multisystem condition known as Cockayne syndrome (CS). In view of the clinical overlap between NER-related disorders, as well as the existence of multiple phenotypes and the numerous genes involved, we developed a new diagnostic approach based on the enrichment of 16 NER-related genes by multiplex amplification coupled with next-generation sequencing (NGS). Our test cohort consisted of 11 DNA samples, all with known mutations and/or non pathogenic SNPs in two of the tested genes. We then used the same technique to analyse samples from a prospective cohort of 40 patients. Multiplex amplification and sequencing were performed using AmpliSeq protocol on the Ion Torrent PGM (Life Technologies). We identified causative mutations in 17 out of the 40 patients (43%). Four patients showed biallelic mutations in the ERCC6(CSB) gene, five in the ERCC8(CSA) gene: most of them had classical CS features but some had very mild and incomplete phenotypes. A small cohort of 4 unrelated classic XP patients from the Basque country (Northern Spain) revealed a common splicing mutation in POLH (XP-variant), demonstrating a new founder effect in this population. Interestingly, our results also found ERCC2(XPD), ERCC3(XPB) or ERCC5(XPG) mutations in two cases of UV-sensitive syndrome and in two cases with mixed XP/CS phenotypes. Our study confirms that NGS is an efficient technique for the analysis of NER-related disorders on a molecular level. It is particularly useful for phenotypes with combined features or unusually mild symptoms. Targeted NGS used in conjunction with DNA repair functional tests and precise clinical evaluation permits rapid and cost-effective diagnosis in patients with NER-defects.

  14. Both COMT Val158Met single nucleotide polymorphism and sex-dependent differences influence response inhibition

    Directory of Open Access Journals (Sweden)

    Valentina eMione

    2015-05-01

    Full Text Available Reactive and proactive control of actions are cognitive abilities that allow to deal with a continuously changing environment by adjusting already programmed actions. They also set forthcoming acts by evaluating the outcome of the previous ones. Earlier studies highlighted sex related differences in the strategies and in the pattern of brain activation during cognitive tasks involving reactive and proactive control. To further identify sex-dependent characteristics in the cognitive control of actions, in this study we have assessed whether/how differences in reactive and proactive control were modulated by the COMT Val158Met single nucleotide polymorphism, a genetic factor known to influence the functionality of the dopaminergic system, in particular at the level of prefrontal cortex. Two groups of male and female participants were further sorted according to their genotype (Val/Met, Val/Val and Met/Met and tested in a stop signal task, a consolidated tool to measure reactive and proactive control in experimental and clinical settings. In each group of participants we estimated both a measure of the capacity to react to unexpected events and the ability of monitoring their performance. The between groups comparison of these measures indicated a poorer ability of male individuals carrying the Val/Val genotype in error-monitoring, suggesting that differences between sexes could be influenced by the efficiency of COMT and that other sex-specific factors have to be considered. The comprehension of inter-groups behavioral and physiological correlates of cognitive control will provide more accurate diagnostic tools for predicting the incidence and the development of pathologies like ADHD or deviant behaviors as drug or alcohol abuse.

  15. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Gilbert Gwendolyn L

    2008-08-01

    Full Text Available Abstract Background Streptococcus agalactiae (Group B Streptococcus (GBS is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP based method for assigning GBS isolates to multilocus sequence typing (MLST-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  16. Microarray Beads for Identifying Blood Group Single Nucleotide Polymorphisms.

    Science.gov (United States)

    Drago, Francesca; Karpasitou, Katerina; Poli, Francesca

    2009-01-01

    We have developed a high-throughput system for single nucleotide polymorphism (SNP) genotyping of alleles of diverse blood group systems exploiting Luminex technology. The method uses specific oligonucleotide probes coupled to a specific array of fluorescent microspheres and is designed for typing Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, K/k, Kp(a)/Kp(b), Js(a)/Js(b), Co(a)/Co(b) and Lu(a)/Lu(b) alleles. Briefly, two multiplex PCR reactions (PCR I and PCR II) according to the laboratory specific needs are set up. PCR I amplifies the alleles tested routinely, namely Jk(a)/Jk(b), Fy(a)/Fy(b), S/s, and K/k. PCR II amplifies those alleles that are typed less frequently. Biotinylated PCR products are hybridized in a single multiplex assay with the corresponding probe mixture. After incubation with R-phycoerythrin-conjugated streptavidin, the emitted fluorescence is analyzed with Luminex 100. So far, we have typed more than 2,000 subjects, 493 of whom with multiplex assay, and there have been no discrepancies with the serology results other than null and/or weak phenotypes. The cost of consumables and reagents for typing a single biallelic pair per sample is less than EUR 3.-, not including DNA extraction costs. The capability to perform multiplexed reactions makes the method markedly suitable for mass screening of red blood cell alleles. This genotyping approach represents an important tool in transfusion medicine.

  17. Implication of SUMO E3 ligases in nucleotide excision repair.

    Science.gov (United States)

    Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji

    2015-08-01

    Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.

  18. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  19. Myristoylated α subunits of guanine nucleotide-binding regulatory proteins

    International Nuclear Information System (INIS)

    Buss, J.E.; Mumby, S.M.; Casey, P.J.; Gilman, A.G.; Sefton, B.M.

    1987-01-01

    Antisera directed against specific subunits of guanine nucleotide-binding regulatory proteins (G proteins) were used to immunoprecipitate these polypeptides from metabolically labeled cells. This technique detects, in extracts of a human astrocytoma cell line, the α subunits of G/sub s/ (stimulatory) (α 45 and α 52 ), a 41-kDa subunit of G/sub i/ (inhibitory) (α 41 ), a 40-kDa protein (α 40 ), and the 36-kDa β subunit. No protein that comigrated with the α subunit of G 0 (unknown function) (α 39 ) was detected. In cells grown in the presence of [ 3 H]myristic acid, α 41 and α 40 contained 3 H label, while the β subunit did not. Chemical analysis of lipids attached covalently to purified α 41 and α 39 from bovine brain also revealed myristic acid. Similar analysis of brain G protein β and γ subunits and of G/sub t/ (Transducin) subunits (α, β, and γ) failed to reveal fatty acids. The fatty acid associated with α 41 , α 40 , and α 39 was stable to treatment with base, suggesting that the lipid is linked to the polypeptide via an amide bond. These GTP binding proteins are thus identified as members of a select group of proteins that contains myristic acid covalently attached to the peptide backbone. Myristate may play an important role in stabilizing interactions of G proteins with phospholipid or with membrane-bound proteins

  20. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  1. Expression of Vesicular Nucleotide Transporter in Rat Odontoblasts

    International Nuclear Information System (INIS)

    Ikeda, Erina; Goto, Tetsuya; Gunjigake, Kaori; Kuroishi, Kayoko; Ueda, Masae; Kataoka, Shinji; Toyono, Takashi; Nakatomi, Mitsushiro; Seta, Yuji; Kitamura, Chiaki; Nishihara, Tatsuji; Kawamoto, Tatsuo

    2016-01-01

    Several theories have been proposed regarding pain transmission mechanisms in tooth. However, the exact signaling mechanism from odontoblasts to pulp nerves remains to be clarified. Recently, ATP-associated pain transmission has been reported, but it is unclear whether ATP is involved in tooth pain transmission. In the present study, we focused on the vesicular nucleotide transporter (VNUT), a transporter of ATP into vesicles, and examined whether VNUT was involved in ATP release from odontoblasts. We examined the expression of VNUT in rat pulp by RT-PCR and immunostaining. ATP release from cultured odontoblast-like cells with heat stimulation was evaluated using ATP luciferase methods. VNUT was expressed in pulp tissue, and the distribution of VNUT-immunopositive vesicles was confirmed in odontoblasts. In odontoblasts, some VNUT-immunopositive vesicles were colocalized with membrane fusion proteins. Additionally P2X 3 , an ATP receptor, immunopositive axons were distributed between odontoblasts. The ATP release by thermal stimulation from odontoblast-like cells was inhibited by the addition of siRNA for VNUT. These findings suggest that cytosolic ATP is transported by VNUT and that the ATP in the vesicles is then released from odontoblasts to ATP receptors on axons. ATP vesicle transport in odontoblasts seems to be a key mechanism for signal transduction from odontoblasts to axons in the pulp

  2. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  3. Adenine nucleotide translocator transports haem precursors into mitochondria.

    Directory of Open Access Journals (Sweden)

    Motoki Azuma

    2008-08-01

    Full Text Available Haem is a prosthetic group for haem proteins, which play an essential role in oxygen transport, respiration, signal transduction, and detoxification. In haem biosynthesis, the haem precursor protoporphyrin IX (PP IX must be accumulated into the mitochondrial matrix across the inner membrane, but its mechanism is largely unclear. Here we show that adenine nucleotide translocator (ANT, the inner membrane transporter, contributes to haem biosynthesis by facilitating mitochondrial accumulation of its precursors. We identified that haem and PP IX specifically bind to ANT. Mitochondrial uptake of PP IX was inhibited by ADP, a known substrate of ANT. Conversely, ADP uptake into mitochondria was competitively inhibited by haem and its precursors, suggesting that haem-related porphyrins are accumulated into mitochondria via ANT. Furthermore, disruption of the ANT genes in yeast resulted in a reduction of haem biosynthesis by blocking the translocation of haem precursors into the matrix. Our results represent a new model that ANT plays a crucial role in haem biosynthesis by facilitating accumulation of its precursors into the mitochondrial matrix.

  4. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  5. Single Nucleotide Polymorphism Identification, Characterization, and Linkage Mapping in Quinoa

    Directory of Open Access Journals (Sweden)

    P. J. Maughan

    2012-11-01

    Full Text Available Quinoa ( Willd. is an important seed crop throughout the Andean region of South America. It is important as a regional food security crop for millions of impoverished rural inhabitants of the Andean Altiplano (high plains. Efforts to improve the crop have led to an increased focus on genetic research. We report the identification of 14,178 putative single nucleotide polymorphisms (SNPs using a genomic reduction protocol as well as the development of 511 functional SNP assays. The SNP assays are based on KASPar genotyping chemistry and were detected using the Fluidigm dynamic array platform. A diversity screen of 113 quinoa accessions showed that the minor allele frequency (MAF of the SNPs ranged from 0.02 to 0.50, with an average MAF of 0.28. Structure analysis of the quinoa diversity panel uncovered the two major subgroups corresponding to the Andean and coastal quinoa ecotypes. Linkage mapping of the SNPs in two recombinant inbred line populations produced an integrated linkage map consisting of 29 linkage groups with 20 large linkage groups, spanning 1404 cM with a marker density of 3.1 cM per SNP marker. The SNPs identified here represent important genomic tools needed in emerging plant breeding programs for advanced genetic analysis of agronomic traits in quinoa.

  6. Domestication rewired gene expression and nucleotide diversity patterns in tomato.

    Science.gov (United States)

    Sauvage, Christopher; Rau, Andrea; Aichholz, Charlotte; Chadoeuf, Joël; Sarah, Gautier; Ruiz, Manuel; Santoni, Sylvain; Causse, Mathilde; David, Jacques; Glémin, Sylvain

    2017-08-01

    Plant domestication has led to considerable phenotypic modifications from wild species to modern varieties. However, although changes in key traits have been well documented, less is known about the underlying molecular mechanisms, such as the reduction of molecular diversity or global gene co-expression patterns. In this study, we used a combination of gene expression and population genetics in wild and crop tomato to decipher the footprints of domestication. We found a set of 1729 differentially expressed genes (DEG) between the two genetic groups, belonging to 17 clusters of co-expressed DEG, suggesting that domestication affected not only individual genes but also regulatory networks. Five co-expression clusters were enriched in functional terms involving carbohydrate metabolism or epigenetic regulation of gene expression. We detected differences in nucleotide diversity between the crop and wild groups specific to DEG. Our study provides an extensive profiling of the rewiring of gene co-expression induced by the domestication syndrome in one of the main crop species. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  7. Nucleotide diversity and linkage disequilibrium in five Lolium perenne genes with putative role in shoot branching

    DEFF Research Database (Denmark)

    Brazauskas, Gintaras; Pašakinskienė, Izolda; Asp, Torben

    2010-01-01

    Knowledge on nucleotide diversity and linkage disequilibrium (LD) patterns is prerequisite for association analyses. However, little is known about the nucleotide diversity in the evolutionary important ryegrass shoot morphology genes. Five candidate genes, LpIAA1, LpRUB1, LpBRI1, LpSHOOT1 and Lp...

  8. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  9. A novel Y-xylosidase, nucleotide sequence encoding it and use thereof.

    NARCIS (Netherlands)

    Graaff, de L.H.; Peij, van N.N.M.E.; Broeck, van den H.C.; Visser, J.

    1996-01-01

    A nucleotide sequence is provided which encodes a peptide having beta-xylosidase activity and exhibits at least 30mino acid identity with the amino acid sequence shown in SEQ ID NO. 1 or hybridises under stringent conditions with a nucleotide sequence shown in SEQ ID NO. 1, or a part thereof having

  10. Tune-Based Halo Diagnostics

    International Nuclear Information System (INIS)

    Cameron, Peter

    2003-01-01

    Tune-based halo diagnostics can be divided into two categories -- diagnostics for halo prevention, and diagnostics for halo measurement. Diagnostics for halo prevention are standard fare in accumulators, synchrotrons, and storage rings, and again can be divided into two categories -- diagnostics to measure the tune distribution (primarily to avoid resonances), and diagnostics to identify instabilities (which will not be discussed here). These diagnostic systems include kicked (coherent) tune measurement, phase-locked loop (PLL) tune measurement, Schottky tune measurement, beam transfer function (BTF) measurements, and measurement of transverse quadrupole mode envelope oscillations. We refer briefly to tune diagnostics used at RHIC and intended for the SNS, and then present experimental results. Tune-based diagnostics for halo measurement (as opposed to prevention) are considerably more difficult. We present one brief example of tune-based halo measurement

  11. The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

    Science.gov (United States)

    Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

    1989-04-01

    The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

  12. Beyond Diagnostic Accuracy: The Clinical Utility of Diagnostic Tests

    NARCIS (Netherlands)

    Bossuyt, Patrick M. M.; Reitsma, Johannes B.; Linnet, Kristian; Moons, Karel G. M.

    2012-01-01

    Like any other medical technology or intervention, diagnostic tests should be thoroughly evaluated before their introduction into daily practice. Increasingly, decision makers, physicians, and other users of diagnostic tests request more than simple measures of a test's analytical or technical

  13. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    Science.gov (United States)

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  14. R3D Align web server for global nucleotide to nucleotide alignments of RNA 3D structures.

    Science.gov (United States)

    Rahrig, Ryan R; Petrov, Anton I; Leontis, Neocles B; Zirbel, Craig L

    2013-07-01

    The R3D Align web server provides online access to 'RNA 3D Align' (R3D Align), a method for producing accurate nucleotide-level structural alignments of RNA 3D structures. The web server provides a streamlined and intuitive interface, input data validation and output that is more extensive and easier to read and interpret than related servers. The R3D Align web server offers a unique Gallery of Featured Alignments, providing immediate access to pre-computed alignments of large RNA 3D structures, including all ribosomal RNAs, as well as guidance on effective use of the server and interpretation of the output. By accessing the non-redundant lists of RNA 3D structures provided by the Bowling Green State University RNA group, R3D Align connects users to structure files in the same equivalence class and the best-modeled representative structure from each group. The R3D Align web server is freely accessible at http://rna.bgsu.edu/r3dalign/.

  15. Molecular Diagnostics in Transfusion Medicine: In Capillary, on a Chip, in Silico, or in Flight?

    Science.gov (United States)

    Garritsen, Henk S.P.; Xiu-Cheng Fan, Alex; Lenz, Daniela; Hannig, Horst; Yan Zhong, Xiao; Geffers, Robert; Lindenmaier, Werner; Dittmar, Kurt E.J.; Wörmann, Bernhard

    2009-01-01

    Summary Serology, defined as antibody-based diagnostics, has been regarded as the diagnostic gold standard in transfusion medicine. Nowadays however the impact of molecular diagnostics in transfusion medicine is rapidly growing. Molecular diagnostics can improve tissue typing (HLA typing), increase safety of blood products (NAT testing of infectious diseases), and enable blood group typing in difficult situations (after transfusion of blood products or prenatal non-invasive RhD typing). Most of the molecular testing involves the determination of the presence of single nucleotide polymorphisms (SNPs). Antigens (e.g. blood group antigens) mostly result from single nucleotide differences in critical positions. However, most blood group systems cannot be determined by looking at a single SNP. To identify members of a blood group system a number of critical SNPs have to be taken into account. The platforms which are currently used to perform molecular diagnostics are mostly gel-based, requiring time-consuming multiple manual steps. To implement molecular methods in transfusion medicine in the future the development of higher-throughput SNP genotyping non-gel-based platforms which allow a rapid, cost-effective screening are essential. Because of its potential for automation, high throughput and cost effectiveness the special focus of this paper is a relative new technique: SNP genotyping by MALDI-TOF MS analysis. PMID:21113259

  16. Actinides and rare earths complexation with adenosine phosphate nucleotides

    International Nuclear Information System (INIS)

    Mostapha, Sarah

    2013-01-01

    Organophosphorus compounds are important molecules in both nuclear industry and living systems fields. Indeed, several extractants of organophosphorus compounds (such as TBP, HDEHP) are used in the nuclear fuel cycle reprocessing and in the biological field. For instance, the nucleotides are organophosphates which play a very important role in various metabolic processes. Although the literature on the interactions of actinides with inorganic phosphate is abundant, published studies with organophosphate compounds are generally limited to macroscopic and / or physiological approaches. The objective of this thesis is to study the structure of several organophosphorus compounds with actinides to reach a better understanding and develop new specific buildings blocks. The family of the chosen molecules for this procedure consists of three adenine nucleotides mono, bi and triphosphate (AMP, adenosine monophosphate - ADP, adenosine diphosphate - ATP, adenosine triphosphate) and an amino-alkylphosphate (AEP O-phosphoryl-ethanolamine). Complexes synthesis was conducted in aqueous and weakly acidic medium (2.8-4) for several lanthanides (III) (Lu, Yb, Eu) and actinides (U (VI), Th (IV) and Am (III)). Several analytical and spectroscopic techniques have been used to describe the organization of the synthesized complexes: spectrometric analysis performed by FTIR and NMR were used to identify the functional groups involved in the complexation, analysis by ESI-MS and pH-metric titration were used to determine the solution speciation and EXAFS analyzes were performed on Mars beamline of the SOLEIL synchrotron, have described the local cation environment, for both solution and solid compounds. Some theoretical approaches of DFT were conducted to identify stable structures in purpose of completing the experimental studies. All solid complexes (AMP, ADP, ATP and AEP) have polynuclear structures, while soluble ATP complexes are mononuclear. For all synthesized complexes, it has been

  17. Oriented Immobilization of Fab Fragments by Site-Specific Biotinylation at the Conserved Nucleotide Binding Site for Enhanced Antigen Detection.

    Science.gov (United States)

    Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

    2015-09-08

    Oriented immobilization of antibodies and antibody fragments has become increasingly important as a result of the efforts to reduce the size of diagnostic and sensor devices to miniaturized dimensions for improved accessibility to the end-user. Reduced dimensions of sensor devices necessitate the immobilized antibodies to conserve their antigen binding activity for proper operation. Fab fragments are becoming more commonly used in small-scaled diagnostic devices due to their small size and ease of manufacture. In this study, we used the previously described UV-NBS(Biotin) method to functionalize Fab fragments with IBA-EG11-Biotin linker utilizing UV energy to initiate a photo-cross-linking reaction between the nucleotide binding site (NBS) on the Fab fragment and IBA-Biotin molecule. Our results demonstrate that immobilization of biotinylated Fab fragments via UV-NBS(Biotin) method generated the highest level of immobilized Fab on surfaces when compared to other typical immobilization methods while preserving antigen binding activity. UV-NBS(Biotin) method provided 432-fold, 114-fold, and 29-fold improved antigen detection sensitivity than physical adsorption, NHS-Biotin, and ε-NH3(+), methods, respectively. Additionally, the limit of detection (LOD) for PSA utilizing Fab fragments immobilized via UV-NBS(Biotin) method was significantly lower than that of the other immobilization methods, with an LOD of 0.4 pM PSA. In summary, site-specific biotinylation of Fab fragments without structural damage or loss in antigen binding activity provides a wide range of application potential for UV-NBS immobilization technique across numerous diagnostic devices and nanotechnologies.

  18. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  19. Association of single nucleotide polymorphisms with radiation-induced esophagitis

    International Nuclear Information System (INIS)

    Zhang Li; Wang Lvhua; Yang Ming; Ji Wei; Zhao Lujun; Yang Weizhi; Zhou Zongmei; Ou Guangfei; Lin Dongxin

    2008-01-01

    Objective: To evaluate the relationship between single nucleotide polymorphism(SNP) of candidate genes and radiation-induced esophagitis (RIE) in patients with lung cancer. Methods: Between Jan. 2004 and Aug. 2006, 170 patients with pathologically diagnosed lung cancer were enrolled in this study. The total target dose was 45-70 Gy (median 60 Gy). One hundred and thirty-two patients were treated with three-dimensional conformal radiotherapy(3DCRT) and 38 with two-dimensional radiotherapy(2DRT). Forty-one patients received radiotherapy alone, 78 received sequential chemoradiotherapy and 51 received concurrent chemoradiotherapy. Thirty-seven SNPs in 20 DNA repair genes were analyzed by using PCR- based restricted fragment length polymorphism (RFLP). These genes were apoptosis and inflammatory cytokine genes including ATM, ERCC1, XRCC3, XRCCI, XPD, XPC, XPG, NBS1, STK15, ZNF350, ADPRT, TP53, FAS, FASL, CYP2D6*4, CASPASE8, COX2,TGF-β, CD14 and ACE. The endpoint was grade ≥2 R I E. Results: Forty of the 170 patients developed grade ≥2 R I E, including 36 in grade 2 and 4 in grade 3. Univariate analysis revealed that radiation technique and concurrent chemoradiotherapy were statistically significant relatives to the incidence of R I E (P=0.032, 0.049), and both of them had the trend associating with the esophagitis (P=0.072, 0.094). An increased incidence of esophagitis was observed associating with the TGF-β 1 -509T and XPD 751Lys/Lys genotypes (χ 2 =5.65, P=0.017; χ 2 =3.84, P=0.048) in multivariate analysis. Conclusions: Genetic polymorphisms in TGF-β 1 gene and XPD gene have a significant association with radiation-induced esophagitis. (authors)

  20. Deregulation of ocular nucleotide homeostasis in patients with diabetic retinopathy.

    Science.gov (United States)

    Loukovaara, Sirpa; Sandholm, Jouko; Aalto, Kristiina; Liukkonen, Janne; Jalkanen, Sirpa; Yegutkin, Gennady G

    2017-02-01

    Clear signaling roles for ATP and adenosine have been established in all tissues, including the eye. The magnitude of signaling responses is governed by networks of enzymes; however, little is known about the regulatory mechanisms of purinergic signaling in the eye. By employing thin-layer chromatographic assays with 3 H-labeled substrates, this study aimed to evaluate the role of nucleotide homeostasis in the pathogenesis of vitreoretinal diseases in humans. We have identified soluble enzymes ecto-5'-nucleotidase/CD73, adenylate kinase-1, and nucleoside diphosphate kinase in the vitreous fluid that control active cycling between pro-inflammatory ATP and anti-inflammatory adenosine. Strikingly, patients with proliferative form of diabetic retinopathy (DR) had higher adenylate kinase activity and ATP concentration, when compared to non-proliferative DR eyes and non-diabetic controls operated for rhegmatogenous retinal detachment, macular hole, and pucker. The non-parametric correlation analysis revealed positive correlations between intravitreal adenylate kinase and concentrations of ATP, ADP, and other angiogenic (angiopoietins-1 and -2), profibrotic (transforming growth factor-β1), and proteolytic (matrix metalloproteinase-9) factors but not erythropoietin and VEGF. Immunohistochemical staining of postmortem human retina additionally revealed selective expression of ecto-5'-nucleotidase/CD73 on the rod-and-cone-containing photoreceptor cells. Collectively, these findings provide novel insights into the regulatory mechanisms that influence purinergic signaling in diseased eye and open up new possibilities in the development of enzyme-targeted therapeutic approaches for prevention and treatment of DR. Ecto-5'-nucleotidase/CD73 and adenylate kinase-1 circulate in human vitreous fluid. Adenylate kinase activity is high in diabetic eyes with proliferative retinopathy. Diabetic eyes display higher intravitreal ATP/ADP ratio than non-diabetic controls. Soluble adenylate

  1. Cancer pancreatis, diagnostic procedures

    International Nuclear Information System (INIS)

    Graadal, Oe.; Schlichting, E.; Aasen, A.O.; Stadaas, J.O.

    1990-01-01

    151 patients treated for carcinoma of the pancreas at Ullevaal Hospital (Oslo University) during the period 1980-89 were studied. The most common initial symptom was abdominal pain. Other frequent debut symptoms were loss of weight and jaundice. ERCP and PTC were found to be the best diagnostic procedures. CT or ultrasonography were normal in 10-20% of the patients. Nearly all tumors of the pancreas were found by the ERCP procedure. Also angiography was used to evaluate operability of the pancreas tumor, but was found to be a very uncertain diagnostic method. This method will not be used in the future evaluation of patients with cancer of the pancreas. 13 refs., 1 fig., 2 tabs

  2. Inertial confinement fusion diagnostics

    International Nuclear Information System (INIS)

    Coleman, L.W.

    1986-10-01

    The concept and goals of ICF will be briefly reviewed and the new 100 kJ class Nova laser facility will be described. Experimental results obtained to date with Nova will be summarized, and the discussions of diagnostics will use examples on the present capabilities of Nova and new developments that are underway. The classes of diagnostic systems to be discussed fall into three basic categories: optical, x-ray, and particle. Examples of highly space resolved, time resolved, and spectrally resolved techniques as well as schemes involving combinations of these capabilities will be presented. A brief summary of the sophisticated acquisition and analysis system in use for Nova data will be provided

  3. Nanodevices in diagnostics

    Science.gov (United States)

    Hu, Ye; Fine, Daniel H.; Tasciotti, Ennio; Bouamrani, Ali; Ferrari, Mauro

    2010-01-01

    The real-time, personalized and highly sensitive early-stage diagnosis of disease remains an important challenge in modern medicine. With the ability to interact with matter at the nanoscale, the development of nanotechnology architectures and materials could potentially extend subcellular and molecular detection beyond the limits of conventional diagnostic modalities. At the very least, nanotechnology should be able to dramatically accelerate biomarker discovery, as well as facilitate disease monitoring, especially of maladies presenting a high degree of molecular and compositional heterogeneity. This article gives an overview of several of the most promising nanodevices and nanomaterials along with their applications in clinical practice. Significant work to adapt nanoscale materials and devices to clinical applications involving large interdisciplinary collaborations is already underway with the potential for nanotechnology to become an important enabling diagnostic technology. PMID:20229595

  4. Nanobiosensors in diagnostics

    Directory of Open Access Journals (Sweden)

    Alejandro Chamorro-Garcia

    2016-11-01

    Full Text Available Medical diagnosis has been greatly improved thanks to the development of new techniques capable of performing very sensitive detection and quantifying certain parameters. These parameters can be correlated with the presence of specific molecules and their quantity. Unfortunately, these techniques are demanding, expensive, and often complicated. On the other side, progress in other fields of science and technology has contributed to the rapid growth of nanotechnology. Although being an emerging discipline, nanotechnology has raised huge interest and expectations. Most of the enthusiasm comes from new possibilities and properties of nanomaterials. Biosensors (simple, robust, sensitive, cost-effective combined with nanomaterials, also called nanobiosensors, are serving as bridge between advanced detection/diagnostics and daily/routine tests. Here we review some of the latest applications of nanobiosensors in diagnostics field.

  5. Diagnostic radiation risks

    Energy Technology Data Exchange (ETDEWEB)

    Sherwood, T [Addenbrooke' s Hospital, Cambridge (UK)

    1980-04-01

    A brief discussion on diagnostic radiation risks is given. First some fundamental facts on the concepts and units of radiation measurement are clarified. Medical diagnostic radiation doses are also compared to the radiation doses received annually by man from natural background radiation. The controversy concerning the '10-day rule' in X-raying women of child-bearing age is discussed; it would appear that the risk of malformation in an unborn child due to X-radiation is very much less than the natural level of risk of malformation. The differences in the radiographic techniques and thus the different X-ray doses needed to make adequate X-ray images of different parts of the body are considered. The radiation burden of nuclear medicine investigations compared to X-ray procedures is also discussed. Finally, the problems of using volunteers in radiation research are aired.

  6. Diagnostics and structure

    International Nuclear Information System (INIS)

    Vial, J.C.

    1986-01-01

    The structure of prominences and the diagnostic techniques used to evaluate their physical parameters are discussed. These include electron temperature, various densities (n sub p, n sub e, n sub l), ionization degree, velocities, and magnetic field vector. UV and radio measurements have already evidenced the existence of different temperature regions, corresponding to different geometrical locations, e.g., the so called Prominence-Corona (P-C) interface. Velocity measurements are important for considering formation and mass balance of prominences but there are conflicting velocity measurements which have led to the basic question: what structure is actually observed at a given wavelength; what averaging is performed within the projected slit area during the exposure time? In optically thick lines, the question of the formation region of the radiation along the line of sight is also not a trivial one. The same is true for low resolution measurements of the magnetic field. Coupling diagnostics with structure is now a general preoccupation

  7. FEL components and diagnostics

    International Nuclear Information System (INIS)

    Carr, R.

    1997-01-01

    FEL hardware includes undulators, alignment systems, electron beam diagnostics, and mechanical and vacuum systems. While most FEL close-quote s employ conventional undulators, there is some interest in novel types, particularly where conventional designs cannot be used, as at very short periods and high fields. For these areas, superconducting technology is indicated. The most serious issue facing long FEL undulators is that of alignment; mechanical techniques may not be accurate enough, and beam-based strategies must be considered. To maintain alignment and control the electron trajectory, beam position monitors with micron precision are required. Beam size monitors are also required to assure control of emittance. The talks given in the working group sessions touch on undulators, alignment, and electron beam diagnostics, and they are summarized here. copyright 1997 American Institute of Physics

  8. Litigations in diagnostic radiology

    International Nuclear Information System (INIS)

    Patil, Ranjit

    2014-01-01

    There are various regulatory bodies at the international and national level, which lay down norms for radiation protection. These are the International Commission for Radiation Protection (ICRP) the National Commission for Radiation Protection (NCRP) in America, and the Atomic Energy Regulatory Board (AERB) in India. These bodies recommend norms on various radiation issues. Radiography and radiology are two key tools for diagnosing and treating diseases. Recently there are concerns about the effect of ionizing radiation on man and the frequent use of diagnostic radiographs. The professionals are expected to conduct their actions according to guidelines which reflect new information and changing technology in diagnostic radiography. Failure to do so may have severe legal consequences. Patient protection is a matter of normal course but knowledge and awareness of the legal issues is important to avoid legal hassles. Implications of the radiation protection guidelines are discussed. (author)

  9. STELLA Experiment - Microbunch Diagnostic

    Energy Technology Data Exchange (ETDEWEB)

    He, P.; Liu, Y.; Cline, D. B.; Babzien, M.; Gallardo, J. C.; Kusche, K. P.; Pogorelsky, I. V.; Skaritka, J.; van Steenbergen, A.; Yakimenko, V.; Kimura, W. D.

    1998-07-01

    A microbunch diagnostic system is built at the Accelerator Test Facility (ATF) of Brookhaven National Laboratory for monitoring microbunches (10-fs bunch length) produced by the Inverse Free Electron Laser accelerator in Staged Electron Laser Acceleration experiment. It is similar to one already demonstrated at the ATF. With greatly improved beam optics conditions higher order harmonic coherent transition radiation will be measurable to determine the microbunch length and shape.

  10. Advanced diagnostic graphics

    International Nuclear Information System (INIS)

    Bray, M.A.; Petersen, R.J.; Clark, M.T.; Gertman, D.I.

    1981-01-01

    This paper reports US NRC-sponsored research at the Idaho National Engineering Laboratory (INEL) involving evaluation of computer-based diagnostic graphics. The specific targets of current evaluations are multivariate data display formats which may be used in Safety Parameter Display Systems (SPDS) being developed for nuclear power plant control rooms. The purpose of the work is to provide a basis for NRC action in regulating licensee SPDSs or later computer/cathode ray tube (CRT) applications in nuclear control rooms

  11. Molecular diagnostics in endodontics

    OpenAIRE

    Rechenberg, Dan-Krister; Zehnder, Matthias

    2014-01-01

    Recent systematic reviews have substantiated the fact that current testing methods to assess the inflammatory state of the pulp and the periapical tissues are of limited value. Consequently, it may be time to search for alternative routes in endodontic diagnostics. Molecular assessment methods could be the future. However, in the field of endodontics, the research in that direction is only about to evolve. Because pulpal and periradicular diseases are related to opportunistic infections, diag...

  12. Molecular Diagnostics of ?-Thalassemia

    OpenAIRE

    Atanasovska, B; Bozhinovski, G; Chakalova, L; Kocheva, S; Karanfilski, O; Plaseska-Karanfiska, D

    2012-01-01

    A high-quality hemoglobinopathy diagnosis is based on the results of a number of tests including assays for molecular identification of causative mutations. We describe the current diagnostic strategy for the identification of ?-thalassemias and hemoglobin (Hb) variants at the International Reference Laboratory for Haemoglobinopathies, Research Centre for Genetic Engineering and Biotechnology (RCGEB) ?Georgi D. Efremov,? Skopje, Republic of Macedonia. Our overall approach and most of the meth...

  13. Equipment for isotope diagnostics

    International Nuclear Information System (INIS)

    Platz, W.

    1976-01-01

    The invention concerns an improvement of equipment for isotope diagnostics allowing to mark special intensity ranges of the recorded measurements by means of different colors. For undisturbed operation it is of advantage to avoid electric circuits between movable and unmovable parts of the color recorder. According to the invention, long gear wheels of glass fiber-reinforced polyamide are used for these connections. (ORU) [de

  14. RFQ1 diagnostic devices

    International Nuclear Information System (INIS)

    Chidley, B.G.; Arbique, G.M.; de Jong, M.S.; McMichael, G.E.; Michel, W.L.; Smith, B.H.

    1991-01-01

    The diagnostic devices in use on RFQ1 will be described. They consist of a double-slit emittance-measuring unit, a 45 degree deflection energy-analysis magnet, parametric current transformers, optical beam sensors, beam-stop current monitors, and an x-ray end-point analyzer. All of these devices are able to operate up to the full output current of RFQ1 (75 mA cw at 0.6 MeV)

  15. Idiopathic chondrolysis - diagnostic difficulties

    International Nuclear Information System (INIS)

    Kozlowski, K.; Scougall, J.; Royal Alexandra Hospital for Children, Sydney

    1984-01-01

    Four cases of idiopathic chondrolysis of the hip in three white girls and one Maori girl are reported. The authors stress the causes why a disease with characteristic clinical and radiographic appearances and normal biochemical findings presents diagnostic difficulties. It is suspected that idiopathic chondrolysis is a metabolic disorder of chondrocytes, triggered by environment circumstances in susceptible individuals. Idiopathic chondrolysis is probably one of the most common causes of coxarthrosis in women. (orig.)

  16. Radiological diagnostics in hyperparathyroidism

    International Nuclear Information System (INIS)

    Moedder, U.; Kuhn, F.P.; Gruetzner, G.

    1991-01-01

    The most important radiologically detectable effects of the primary and secondary hyperparathyroidism of the skeletal system and the periarticular soft tissue structures are presented. In the following sensitivity and specificity of radiological imaging - sonography, scintigraphy, computed tomography, magnetic resonance imaging, arteriography and selective venous sampling - in the preoperative diagnostic of the parathyroid adenomas are discussed. Therefore, radiological imaging can be omitted before primary surgery. It was only in secondary surgery that radiological process proved useful and a guide during surgical intervention. (orig.) [de

  17. Thioaptamer Diagnostic System, Phase I

    Data.gov (United States)

    National Aeronautics and Space Administration — AM Biotechnologies (AM) will develop a diagnostic system in response to SBIR Topic X10.01 Reusable Diagnostic Lab Technology that will simultaneously detect and...

  18. Molecular diagnostics of periodontitis.

    Science.gov (United States)

    Korona-Głowniak, Izabela; Siwiec, Radosław; Berger, Marcin; Malm, Anna; Szymańska, Jolanta

    2017-01-28

    The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host's health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization) come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR), real-time polymerase chain reaction (real-time PCR), 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), as well as terminal restriction fragment length polymorphism (TRFLP) and next generation sequencing (NGS). The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

  19. Molecular diagnostics of periodontitis

    Directory of Open Access Journals (Sweden)

    Izabela Korona-Głowniak

    2017-01-01

    Full Text Available The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host’s health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR, real-time polymerase chain reaction (real-time PCR, 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE, temperature gradient gel electrophoresis (TGGE, as well as terminal restriction fragment length polymorphism (TRFLP and next generation sequencing (NGS. The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

  20. XML Diagnostics Description Standard

    International Nuclear Information System (INIS)

    Neto, A.; Fernandes, H.; Varandas, C.; Lister, J.; Yonekawa, I.

    2006-01-01

    A standard for the self-description of fusion plasma diagnostics will be presented, based on the Extensible Markup Language (XML). The motivation is to maintain and organise the information on all the components of a laboratory experiment, from the hardware to the access security, to save time and money when problems arises. Since there is no existing standard to organise this kind of information, every Association stores and organises each experiment in different ways. This can lead to severe problems when the organisation schema is poorly documented or written in national languages. The exchange of scientists, researchers and engineers between laboratories is a common practice nowadays. Sometimes they have to install new diagnostics or to update existing ones and frequently they lose a great deal of time trying to understand the currently installed system. The most common problems are: no documentation available; the person who understands it has left; documentation written in the national language. Standardisation is the key to solving all the problems mentioned. From the commercial information on the diagnostic (component supplier; component price) to the hardware description (component specifications; drawings) to the operation of the equipment (finite state machines) through change control (who changed what and when) and internationalisation (information at least in the native language and in English), a common XML schema will be proposed. This paper will also discuss an extension of these ideas to the self-description of ITER plant systems, since the problems will be identical. (author)

  1. SNS Diagnostics Timing Integration

    CERN Document Server

    Long, Cary D; Murphy, Darryl J; Pogge, James; Purcell, John D; Sundaram, Madhan

    2005-01-01

    The Spallation Neutron Source (SNS) accelerator systems will deliver a 1.0 GeV, 1.4 MW proton beam to a liquid mercury target for neutron scattering research. The accelerator complex consists of a 1 GeV linear accelerator, an accumulator ring and associated transport lines. The SNS diagnostics platform is PC-based running Windows XP Embedded for its OS and LabVIEW as its programming language. Coordinating timing among the various diagnostics instruments with the generation of the beam pulse is a challenging task that we have chosen to divide into three phases. First, timing was derived from VME based systems. In the second phase, described in this paper, timing pulses are generated by an in house designed PCI timing card installed in ten diagnostics PCs. Using fan-out modules, enough triggers were generated for all instruments. This paper describes how the Timing NAD (Network Attached Device) was rapidly developed using our NAD template, LabVIEW's PCI driver wizard, and LabVIEW Channel Access library. The NAD...

  2. Radiological diagnostics of skeletal tumors

    International Nuclear Information System (INIS)

    Uhl, M.; Herget, G.W.

    2008-01-01

    The book contains contributions concerning the following topics: 1. introduction and fundamentals: WHO classification of bone tumors, imaging diagnostics and their function; localization, typical clinical and radiological criteria, TNM classification and status classification, invasive tumor diagnostics; 2. specific tumor diagnostics: chondrogenic bone tumors, osseous tumors, connective tissue bony tumors, osteoclastoma, osteomyelogenic bone tumors, vascular bone tumors, neurogenic bone tumors, chordoma; adamantinoma of the long tubular bone; tumor-like lesions, bony metastases, bone granulomas, differential diagnostics: tumor-like lesions

  3. Degradation of brown adipocyte purine nucleotides regulates uncoupling protein 1 activity

    Directory of Open Access Journals (Sweden)

    Tobias Fromme

    2018-02-01

    Full Text Available Objective: Non-shivering thermogenesis in mammalian brown adipose tissue depends on thermogenic uncoupling protein 1. Its activity is triggered by free fatty acids while purine nucleotides mediate inhibition. During activation, it is thought that free fatty acids overcome purine-mediated inhibition. We measured the cellular concentration and the release of purine nucleotide metabolites to uncover a possible role of purine nucleotide degradation in uncoupling protein 1 activation. Methods: With mass spectrometry, purine nucleotide metabolites were quantified in cellular homogenates and supernatants of cultured primary brown adipocytes. We also determined oxygen consumption in response to a β-adrenergic agonist. Results: Upon adrenergic activation, brown adipocytes decreased the intracellular concentration of inhibitory nucleotides (ATP, ADP, GTP and GDP and released the respective degradation products. At the same time, an increase in cellular calcium occurred. None of these phenomena occurred in white adipocytes or myotubes. The brown adipocyte expression of enzymes implicated in purine metabolic remodeling is altered upon cold exposure. Pharmacological and genetic interference of purine metabolism altered uncoupling protein 1 mediated uncoupled respiration. Conclusion: Adrenergic stimulation of brown adipocytes lowers the intracellular concentration of purine nucleotides, thereby contributing to uncoupling protein 1 activation. Keywords: Purine nucleotides, Uncoupling protein 1, Brown adipose tissue, Non-shivering thermogenesis, HILIC-MS/MS, Guanosine monophosphate reductase

  4. The architecture of diagnostic research

    DEFF Research Database (Denmark)

    Colli, Agostino; Fraquelli, Mirella; Casazza, Giovanni

    2014-01-01

    The diagnostic research process can be divided into five phases, designed to establish the clinical utility of a new diagnostic test - the index test. The aim of the present review is to illustrate the study designs that are appropriate for each diagnostic phase, using clinical examples regarding...

  5. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    Science.gov (United States)

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  6. Molecular recognition of nucleotides in micelles and the development and expansion of a chemistry outreach program

    Science.gov (United States)

    Schechinger, Linda Sue

    I. To investigate the delivery of nucleotide-based drugs, we are studying molecular recognition of nucleotide derivatives in environments that are similar to cell membranes. The Nowick group previously discovered that membrane-like surfactant micelles tetradecyltrimethylammonium bromide (TTAB) micelle facilitate molecular of adenosine monophosphate (AMP) recognition. The micelles bind nucleotides by means of electrostatic interactions and hydrogen bonding. We observed binding by following 1H NMR chemical shift changes of unique hexylthymine protons upon addition of AMP. Cationic micelles are required for binding. In surfactant-free or sodium dodecylsulfate solutions, no hydrogen bonding is observed. These observations suggest that the cationic surfactant headgroups bind the nucleotide phosphate group, while the intramicellar base binds the nucleotide base. The micellar system was optimized to enhance binding and selectivity for adenosine nucleotides. The selectivity for adenosine and the number of phosphate groups attached to the adenosine were both investigated. Addition of cytidine, guanidine, or uridine monophosphates, results in no significant downfield shifting of the NH resonance. Selectivity for the phosphate is limited, since adenosine mono-, di-, and triphosphates all have similar binding constants. We successfully achieved molecular recognition of adenosine nucleotides in micellar environments. There is significant difference in the binding interactions between the adenosine nucleotides and three other natural nucleotides. II. The UCI Chemistry Outreach Program (UCICOP) addresses the declining interest of the nations youth for science. UCICOP brings fun and exciting chemistry experiments to local high schools, to remind students that science is fun and has many practical uses. Volunteer students and alumni of UCI perform the demonstrations using scripts and material provided by UCICOP. The preparation of scripts and materials is done by two coordinators

  7. 2012 HIV Diagnostics Conference: the molecular diagnostics perspective.

    Science.gov (United States)

    Branson, Bernard M; Pandori, Mark

    2013-04-01

    2012 HIV Diagnostic Conference Atlanta, GA, USA, 12-14 December 2012. This report highlights the presentations and discussions from the 2012 National HIV Diagnostic Conference held in Atlanta (GA, USA), on 12-14 December 2012. Reflecting changes in the evolving field of HIV diagnostics, the conference provided a forum for evaluating developments in molecular diagnostics and their role in HIV diagnosis. In 2010, the HIV Diagnostics Conference concluded with the proposal of a new diagnostic algorithm which included nucleic acid testing to resolve discordant screening and supplemental antibody test results. The 2012 meeting, picking up where the 2010 meeting left off, focused on scientific presentations that assessed this new algorithm and the role played by RNA testing and new developments in molecular diagnostics, including detection of total and integrated HIV-1 DNA, detection and quantification of HIV-2 RNA, and rapid formats for detection of HIV-1 RNA.

  8. Subnanomole detection and quantitation of high specific activity 32P-nucleotides

    International Nuclear Information System (INIS)

    Coniglio, C.; Pappas, G.; Gill, W.J.; Kashdan, M.; Maniscalco, M.

    1991-01-01

    Microbore liquid chromatography utilizes conventional HPLC and ultraviolet detection principles to determine subnanomole mass quantities of biologically significant molecules. This system takes advantage of specifically designed microflow equipment to analyze ultraviolet absorbing species at the picomole range. 32P-labeled nucleotides are examples of compounds routinely used at picomole quantities that are extremely difficult to accurately quantify using standard mass measurement techniques. The procedure described in this paper has the capability of measuring nucleotides down to 10 pmol using commercially available microbore ultraviolet detection equipment. The technique can be used to accurately measure the specific activity of as little as 10 microCi of an aqueous 32P-nucleotide solution

  9. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  10. Pro-inflammatory cytokine single nucleotide polymorphisms in Kawasaki disease.

    Science.gov (United States)

    Assari, Raheleh; Aghighi, Yahya; Ziaee, Vahid; Sadr, Maryam; Rahmani, Farzaneh; Rezaei, Arezou; Sadr, Zeinab; Moradinejad, Mohammad Hassan; Raeeskarami, Seyed Reza; Rezaei, Nima

    2016-07-25

    Kawasaki disease (KD) is a systemic vasculitis of children associated with cardiovascular sequelae. Proinflammatory cytokines play a major role in KD pathogenesis. However, their role is both influenced and modified by regulatory T-cells. IL-1 gene cluster, IL-6 and TNF-α polymorphisms have shown significant associations with some vasculitides. Herein we investigated their role in KD. Fifty-five patients with KD who were randomly selected from referrals to the main pediatric hospital were enrolled in this case-control study. Single nucleotide polymorphisms (SNPs) of the following genes were assessed in patients and 140 healthy subjects as control group: IL-1α at -889 (rs1800587), IL-1β at -511 (rs16944), IL-1β at +3962 (rs1143634), IL-1R at Pst-I 1970 (rs2234650), IL-1RN/A at Mspa-I 11100 (rs315952), TNF-α at -308 (rs1800629), TNF-α at -238, IL-6 at -174 (rs1800795) and IL-6 at +565. Twenty-one percent of the control group had A allele at TNF-α -238 while only 8% of KD patients had A allele at this position (P = 0.003, OR [95%CI] = 0.32 [0.14-0.71]). Consistently, TNF-α genotype GG at -238 had significant association with KD (OR [95% CI] = 4.31 [1.79-10.73]). Most controls carried the CG genotype at IL-6 -174 (n = 93 [66.9%]) while GG genotype was the most common genotype (n = 27 [49%]) among patients. Carriers of the GG haplotype at TNF-α (-308, -238) were significantly more prevalent among the KD group. No association was found between IL-1 gene cluster, allelic or haplotypic variants and KD. TNF-α GG genotype at -238 and GG haplotype at positions -308 and -238 were associated with KD in an Iranian population. © 2016 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

  11. MAST magnetic diagnostics

    Science.gov (United States)

    Edlington, T.; Martin, R.; Pinfold, T.

    2001-01-01

    The mega-ampere spherical tokamak (MAST) experiment is a new, large, low aspect ratio device (R=0.7-0.8 m, a=0.5-0.65 m, maximum BT˜0.63 T at R=0.7 m) operating its first experimental physics campaign. Designed to study a wide variety of plasma shapes with up to 2 MA of plasma current with an aspect ratio down to 1.3, the poloidal field (PF) coils used for plasma formation, equilibrium and shaping are inside the main vacuum vessel. For plasma control and to investigate a wide range of plasma phenomena, an extensive set of magnetic diagnostics have been installed inside the vacuum vessel. More than 600 vacuum compatible, bakeable diagnostic coils are configured in a number of discrete arrays close to the plasma edge with about half the coils installed behind the graphite armour tiles covering the center column. The coil arrays measure the toroidal and poloidal variation in the equilibrium field and its high frequency fluctuating components. Internal coils also measure currents in the PF coils, plasma current, stored energy and induced currents in the mechanical support structures of the coils and graphite armour tiles. The latter measurements are particularly important when halo currents are induced following a plasma termination, for example, when the plasma becomes vertically unstable. The article describes the MAST magnetic diagnostic coil set and their calibration. The way in which coil signals are used to control the plasma equilibrium is described and data from the first MAST experimental campaign presented. These coil data are used as input to the code EFIT [L. Lao et al., Nucl. Fusion 25, 1611 (1985)], for measurement of halo currents in the vacuum vessel structure and for measurements of the structure of magnetic field fluctuations near the plasma edge.

  12. Planetary Transmission Diagnostics

    Science.gov (United States)

    Lewicki, David G. (Technical Monitor); Samuel, Paul D.; Conroy, Joseph K.; Pines, Darryll J.

    2004-01-01

    This report presents a methodology for detecting and diagnosing gear faults in the planetary stage of a helicopter transmission. This diagnostic technique is based on the constrained adaptive lifting algorithm. The lifting scheme, developed by Wim Sweldens of Bell Labs, is a time domain, prediction-error realization of the wavelet transform that allows for greater flexibility in the construction of wavelet bases. Classic lifting analyzes a given signal using wavelets derived from a single fundamental basis function. A number of researchers have proposed techniques for adding adaptivity to the lifting scheme, allowing the transform to choose from a set of fundamental bases the basis that best fits the signal. This characteristic is desirable for gear diagnostics as it allows the technique to tailor itself to a specific transmission by selecting a set of wavelets that best represent vibration signals obtained while the gearbox is operating under healthy-state conditions. However, constraints on certain basis characteristics are necessary to enhance the detection of local wave-form changes caused by certain types of gear damage. The proposed methodology analyzes individual tooth-mesh waveforms from a healthy-state gearbox vibration signal that was generated using the vibration separation (synchronous signal-averaging) algorithm. Each waveform is separated into analysis domains using zeros of its slope and curvature. The bases selected in each analysis domain are chosen to minimize the prediction error, and constrained to have the same-sign local slope and curvature as the original signal. The resulting set of bases is used to analyze future-state vibration signals and the lifting prediction error is inspected. The constraints allow the transform to effectively adapt to global amplitude changes, yielding small prediction errors. However, local wave-form changes associated with certain types of gear damage are poorly adapted, causing a significant change in the

  13. Biotechnology in diagnostics

    International Nuclear Information System (INIS)

    Koprowski, H.; Ferrone, S.; Albertini, A.

    1985-01-01

    In recent years much progress has been made in the area of biotechnology. The cellular and molecular cloning methodology to develop monoclonal antibodies and DNA probes have been extensively utilized in basic and clinical research. These investigations have provided the necessary information to apply these reagents to diagnostic problems. The RIA 85 meeting focused on the application of monoclonal antibodies and DNA probes in laboratory medicine. The papers presented at this meeting clearly indicate that biotechnology has already had a significant impact on clinical medicine. (Auth.)

  14. Bouveret's Syndrome: diagnostic considerations

    International Nuclear Information System (INIS)

    Cooper, S.G.; Sherman, S.B.; Steinhardt, J.E.; Wilson, J.M. Jr.; Richman, A.H.

    1987-01-01

    Bouveret's syndrome is a rare disease entity manifested by the formation of a cholecystoduodenal or choledochoduodenal fistula with passage of a gallstone into the duodenal bulb and subsequent obstruction of the gastric outlet. To date, no report of this entity using computed tomographic (CT) imaging is available. This article presents a case of Bouveret's syndrome with the classic findings on upper gastrointestinal (GI) tract series and a description of the CT manifestations. The literature is reviewed with discussion of the diagnostic approach to patients with Bouveret's syndrome

  15. FASTBUS Snoop Diagnostic Module

    International Nuclear Information System (INIS)

    Walz, H.V.; Downing, R.

    1980-11-01

    Development of the FASTBUS Snoop Module, undertaken as part of the prototype program for the new interlaboratory data bus standard, is described. The Snoop Module resides on a FASTBUS crate segment and provides diagnostic monitoring and testing capability. Communication with a remote host computer is handled independent of FASTBUS through a serial link. The module consists of a high-speed ECL front-end to monitor and single-step FASTBUS cycles, a master-slave interface, and a control microprocessor with serial communication ports. Design details and performance specifications of the prototype module are reported. 9 figures, 1 table

  16. Isotope diagnostics apparatus

    International Nuclear Information System (INIS)

    Herrschaft, H.

    1976-01-01

    The invention relates to a measuring probe for an isotope diagnostics apparatus to determine the distribution of radioactive substances in a body by measuring the radiation emanating from this body by means of a multiplicity of measuring probes directed simultaneously towards areas of measuring surfae and carried in guidances of a holding block. The measuring results of the individual probes are recorded separately, thus allowing the possibility of being evaluated separately, too. Measuring probes of this kind are used in multi-channel measuring objects and are useful particularly for determining the regional cerebral blood flow. (orig./ORU) [de

  17. Vibration control, machine diagnostics

    International Nuclear Information System (INIS)

    1990-01-01

    Changing vibrations announce damage in the form of wear or cracks on components of, e.g., engine rotors, pumps, power plant turbo sets, rounding-up tools, or marine diesel engines. Therefore, machine diagnostics use frequency analyses, system tests, trend analyses as well as expert systems to localize or estimate the causes of these damages and malfunctions. Data acquisistion, including not only sensors, but also reliable and redundant data processing systems and analyzing systems, play an important role. The lectures pertaining to the data base are covered in detail. (DG) [de

  18. Diagnostic radiology 1987

    International Nuclear Information System (INIS)

    Margulis, A.R.; Gooding, C.A.

    1987-01-01

    This is the latest version of the continuing education course on diagnostic radiology given yearly by the Department of Radiology at the University of California, San Francisco. The lectures are grouped into sections on gastrointestinal radiology, mammography, uroradiology, magnetic resonance, hepatobiliary radiology, pediatric radiology, ultrasound, interventional radiology, chest radiology, nuclear medicine, cardiovascular radiology, and skeletal radiology. Each section contains four to eight topics. Each of these consists of text that represents highlights in narrative form, selected illustrations, and a short bibliography. The presentation gives a general idea of what points were made in the lecture

  19. Nuclear power plant diagnostics

    International Nuclear Information System (INIS)

    Hollo, E.; Siklossy, P.

    1982-01-01

    The cooling circuit vibration diagnostic system of the Block 1 of the Paks nuclear power station is described. The automatic online vibration monitoring system consisting presently of 42 acceleration sensors and 9 pressure fluctuation sensors, which could be extended, performs both global and local inspection of the primary cooling circuit and its components. The offline data processing system evaluates the data for failure mode analysis. The software under development will be appropriate for partial preliminary identification of failure reasons during their initial phases. The installation experiences and the preliminary results during the hot operational testing of Block 1 are presented. (Sz.J.)

  20. Thermal diagnostics for LTP

    International Nuclear Information System (INIS)

    Lobo, Alberto; Nofrarias, M; Sanjuan, J

    2005-01-01

    This is a short note reporting on the current state of development of the temperature sensors which are part of the LTP Diagnostics Subsystem on board the LISA Pathfinder mission (LPF). A thermal insulator has been designed which ensures sufficient stability of a set of eight NTC sensors (negative temperature coefficient of resistance or thermistors), and the front-end electronics has also been designed and manufactured. Tests have been performed which nearly approach the goal of a global stability of 10 -5 K Hz -1/2

  1. Unraveling the cellular context of cyclic nucleotide signaling proteins by chemical proteomics

    NARCIS (Netherlands)

    Corradini, E.

    2015-01-01

    Understanding the molecular mechanisms which regulate signal transduction is fundamental to the development of therapeutic molecules for the treatment of several diseases. In particular, signaling proteins, such as cyclic nucleotide dependent enzymes are the orchestrators of many tissue functions.

  2. WEB-server for search of a periodicity in amino acid and nucleotide sequences

    Science.gov (United States)

    E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.

    2017-12-01

    A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.

  3. Study on the change of cyclic nucleotide in mice with yang vacuity disease

    International Nuclear Information System (INIS)

    Zhu Xinhua; Shen Ling; Wang Shuguang

    2002-01-01

    To study the relation between Yang Vacuity disease happening, development and cyclic nucleotide response, and prove curative effects of some assisting Yang drug, the plasma cAMP, cGMP and cAMP/cGMP levels were detected by radioimmunoassay in the Yang Vacuity group and curing group. Results: showed: (1) Yang Vacuity group: the symptoms were clear, death rate was high, the plasma cAMP and cAMP/cGMP increased obviously, it suggests that cyclic nucleotide was imbalance. (2) Curing group: the symptoms of Yang Vacuity disease were improved obviously, death rate dropped, cAMP declined, cGMP increased, while cAMP/cGMP reached the normal level, it showed that cyclic nucleotide of the body had altered greatly. (3) It is a reference target for Yang Vacuity. (4) Assisting yang drug (Sini Decoction) had a close relation with correcting imbalance of cyclic nucleotide

  4. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  5. Diagnostic Technologies in Practice

    Science.gov (United States)

    Steinberg, Malcolm; Kwag, Michael; Chown, Sarah A.; Doupe, Glenn; Trussler, Terry; Rekart, Michael; Gilbert, Mark

    2015-01-01

    Diagnosing HIV-positive gay men through enhanced testing technologies that detect acute HIV infection (AHI) or recent HIV infection provides opportunities for individual and population health benefits. We recruited 25 men in British Columbia who received an acute (n = 13) or recent (n = 12) HIV diagnosis to engage in a longitudinal multiple-methods study over one year or longer. Our thematic analysis of baseline qualitative interviews revealed insights within men’s accounts of technologically mediated processes of HIV discovery and diagnosis. Our analysis illuminated the dialectic of new HIV technologies in practice by considering the relationship between advances in diagnostics (e.g., nucleic acid amplification tests) and the users of these medical technologies in clinical settings (e.g., clients and practitioners). Technological innovations and testing protocols have shifted experiences of learning of one’s HIV-positive status; these innovations have created new diagnostic categories that require successful interpretation and translation to be rendered meaningful, to alleviate uncertainty, and to support public health objectives. PMID:25201583

  6. Shiva optical diagnostics

    International Nuclear Information System (INIS)

    Rienecker, F.; Kobierecki, M.; Ozarski, R.; Seppala, L.; Manes, K.; Merritt, B.

    1977-01-01

    In the laser fusion program at Lawrence Livermore Laboratory, no target experiment is complete unless it is complemented by careful measurements of the laser pulse that irradiates the target. For this purpose, an incident beam diagnostics (IBD) package has been designed for the Shiva laser. The package will furnish data on items such as the total energy and the focusable energy out of the laser chain, and the spatial and temporal energy and power distribution at the target plane. Understanding laser-plasma interactions requires knowledge of the amount of 1.06 μm light energy that is scattered in various directions from the target. The light energy that is scattered toward the beam focusing lens is analyzed by a reflected beam diagnostic (RBD) package containing a calorimeter, a multiple image camera and a TV camera. This paper describes the detailed design and operation of the IBD and RBD packages as tools to align spatial filters and targets, as well as to diagnose the laser beams and target reflectivity

  7. Laser fusion diagnostics

    International Nuclear Information System (INIS)

    Coleman, L.W.

    1978-01-01

    The current status of the capability of laser fusion diagnostics is reviewed. Optical and infrared streak cameras provide one time resolution measurement capability of less than 10 ps, while x-ray streak cameras provide 15 ps time resolution in the range of about 1--30 keV presently. Time integrated spatial resolutions of 1 μm are provided with a variety of optical techniques. Ultraviolet holographic interferometry has measured electron densities above 10 21 cm -3 with 1 μm spatial resolution and 15 ps temporal resolution. X-ray microscopes provide 3 μm time integrated resolution and the x-ray streak pinhole camera has 6 μm spatial resolution. Development of the framing camera has thus far provided 50 μm spatial resolution with 125 ps frame duration and the third order reconstruction of zone plate images has provided 3 μm resolutions for alpha particles. Time integrated measurements of x-rays span the range shown. Finally, the new Shiva neutron spectrometer increases the energy resolution capability of that technique to 25 keV for 14-MeV neutrons. These combined capabilities provide a unique set of diagnostics for the detailed measurement of the interaction of laser light with targets and a subsequent performance of those targets

  8. Reflectometry diagnostics on TCV

    Science.gov (United States)

    Molina Cabrera, Pedro; Coda, Stefano; Porte, Laurie; Offeddu, Nicola; Tcv Team

    2017-10-01

    Both profile reflectometer and Doppler back-scattering (DBS) diagnostics are being developed for the TCV Tokamak using a steerable quasi-optical launcher and universal polarizers. First results will be presented. A pulse reflectometer is being developed to complement Thomson Scattering measurements of electron density, greatly increasing temporal resolution and also effectively enabling fluctuation measurements. Pulse reflectometry consists of sending short pulses of varying frequency and measuring the roundtrip group-delay with precise chronometers. A fast arbitrary waveform generator is used as a pulse source feeding frequency multipliers that bring the pulses to V-band. A DBS diagnostic is currently operational in TCV. DBS may be used to infer the perpendicular velocity and wave number spectrum of electron density fluctuations in the 3-15 cm-1 wave-number range. Off-the-shelf transceiver modules, originally used for VNA measurements, are being used in a Doppler radar configuration. See author list of S. Coda et al., 2017 Nucl. Fusion 57 102011.

  9. Radiation hardening of diagnostics

    International Nuclear Information System (INIS)

    Siemon, R.E.

    1991-01-01

    The world fusion program has advanced to the stage where it is appropriate to construct a number of devices for the purpose of burning DT fuel. In these next-generation experiments, the expected flux and fluence of 14 MeV neutrons and associated gamma rays will pose a significant challenge to the operation and diagnostics of the fusion device. Radiation effects include structural damage to materials such as vacuum windows and seals, modifications to electrical properties such as electrical conductivity and dielectric strength and impaired optical properties such as reduced transparency and luminescence of windows and fiber optics during irradiation. In preparation for construction and operation of these new facilities, the fusion diagnostics community needs to work with materials scientists to develop a better understanding of radiation effects, and to undertake a testing program aimed at developing workable solutions for this multi-faceted problem. A unique facility to help in this regard is the Los Alamos Spallation Radiation Effects Facility, a neutron source located at the beam stop of the world's most powerful accelerator, the Los Alamos Meson Physics Facility (LAMPF). The LAMPF proton beam generates 10 16 neutrons per second because of ''spallation'' reactions when the protons collide with the copper nuclei in the beam stop

  10. Climate Model Diagnostic Analyzer

    Science.gov (United States)

    Lee, Seungwon; Pan, Lei; Zhai, Chengxing; Tang, Benyang; Kubar, Terry; Zhang, Zia; Wang, Wei

    2015-01-01

    The comprehensive and innovative evaluation of climate models with newly available global observations is critically needed for the improvement of climate model current-state representation and future-state predictability. A climate model diagnostic evaluation process requires physics-based multi-variable analyses that typically involve large-volume and heterogeneous datasets, making them both computation- and data-intensive. With an exploratory nature of climate data analyses and an explosive growth of datasets and service tools, scientists are struggling to keep track of their datasets, tools, and execution/study history, let alone sharing them with others. In response, we have developed a cloud-enabled, provenance-supported, web-service system called Climate Model Diagnostic Analyzer (CMDA). CMDA enables the physics-based, multivariable model performance evaluations and diagnoses through the comprehensive and synergistic use of multiple observational data, reanalysis data, and model outputs. At the same time, CMDA provides a crowd-sourcing space where scientists can organize their work efficiently and share their work with others. CMDA is empowered by many current state-of-the-art software packages in web service, provenance, and semantic search.

  11. Thioaptamer Diagnostic System (TDS)

    Science.gov (United States)

    Yang, Xianbin

    2015-01-01

    AM Biotechnologies, LLC, in partnership with Sandia National Laboratories, has developed a diagnostic device that quickly detects sampled biomarkers. The TDS quickly quantifies clinically relevant biomarkers using only microliters of a single sample. The system combines ambient-stable, long shelf-life affinity assays with handheld, microfluidic gel electrophoresis affinity assay quantification technology. The TDS is easy to use, operates in microgravity, and permits simultaneous quantification of 32 biomarkers. In Phase I of the project, the partners demonstrated that a thioaptamer assay used in the microfluidic instrument could quantify a specific biomarker in serum in the low nanomolar range. The team also identified novel affinity agents to bone-specific alkaline phosphatase (BAP) and demonstrated their ability to detect BAP with the microfluidic instrument. In Phase II, AM Biotech expanded the number of ambient affinity agents and demonstrated a TDS prototype. In the long term, the clinical version of the TDS will provide a robust, flight-tested diagnostic capability for space exploration missions.

  12. Encyclopedia of diagnostic imaging

    International Nuclear Information System (INIS)

    Baert, A.L.

    2008-01-01

    The simple A to Z format provides easy access to relevant information in the field of imaging. Extensive cross references between keywords and related articles enable efficient searches in a user-friendly manner. Fully searchable and hyperlinked electronic online edition. The aim of this comprehensive encyclopedia is to provide detailed information on diagnostic radiology contributing to the broad field of imaging. The wide range of entries are written by leading experts. They will provide basic and clinical scientists in academia, practice and industry with valuable information about the field of diagnostic imaging. Those in related fields, students, teachers, and interested laypeople will also benefit from the important and relevant information on the most recent developments. Please note that this publication is available as print only or online only or print + online set. Save 75% of the online list price when purchasing the bundle. For more information on the online version please type the publication title into the search box above, then click on the eReference version in the results list. (orig.)

  13. Molecular diagnostics of Avian influenza virus

    Directory of Open Access Journals (Sweden)

    Petrović Tamaš

    2006-01-01

    Full Text Available The success of supervizing an infectious disease depends on the ability for speedy detection and characterization of the cause and the forming of a corresponding system for examining the success of control implemented in order to prevent a recurrence of the disease. Since influenza viruses continue to circle, causing significant morbidity and mortality both among the human population and among animals all over the world, it is essential to secure the timely identification and monitoring of the strains that are in circulation. The speedy detection and characterization of new highly-virulent varieties is one of the priorities of the World Health Organization monitoring network. The implementation of molecular methods has an increasingly significant role in diagnostics and the monitoring of the influenza virus. Among a large number of molecular methods, the one particularly in use is the reverse transcription-polimerase chain reaction (PT-PCR. Technological progress in the area of the conducting of molecular methods has enabled that we can prove, in one day, using the RT-PCR method even very small quantities of the infective agent in a sample. In an obtained PCR product, we can relatively easily establish the nucleotide sequence, a detailed analysis and molecular epidemiology of the circulating strains. The molecular diagnostics procedure (RT-PCR is based on the correct choice or designing of primers depending on the desired knowledge. In order to obtain a specific diagnosis of influenza A, B or C, primers are used which multiply internal genes, such as the nucleoprotein (NP or matrix gene (M, because these are genes that are highly conserved among the virus types. In the event that we are interested in the subtype of influenza A, after obtaining a positive reaction, primers for genes of surface antigens are selected, such as hemagglutinin. Following the correct detection of the H subtype, it is possible to establish the virus virulence through the

  14. The effect of exhaustive exercise on the concentration of purine nucleotides and their metabolites in erythrocytes

    OpenAIRE

    E Skotnicka; I Baranowska-Bosiacka; W Dudzińska; M Suska; R Nowak; K Krupecki; AJ Hłyńczak

    2008-01-01

    In this study we tried to obtain a complete overview of purine nucleotide metabolism in erythrocytes before and during an incremental, intermittent exhaustive exercise bout protocol for sportsmen (high-performance rowers) and untrained, healthy, active volunteers. Erythrocyte levels of the main nucleotides (ATP, ADP, AMP, GTP, GDP, GMP, IMP, NAD and NADP ), nucleosides (Ado, Guo, Ino) and the base Hyp were measured using the HPLC method. The parameters that can be deducted from their concent...

  15. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    International Nuclear Information System (INIS)

    Boulias, C.; Moscarello, M.A.

    1989-01-01

    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides

  16. Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

    Science.gov (United States)

    Hendershot, Jenna M.; O'Brien, Patrick J.

    2014-01-01

    Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

  17. Biochemistry of an olfactory purinergic system: dephosphorylation of excitatory nucleotides and uptake of adenosine

    Energy Technology Data Exchange (ETDEWEB)

    Trapido-Rosenthal, H G; Carr, W E; Gleeson, R A

    1987-10-01

    The olfactory organ of the spiny lobster, Panulirus argus, is composed of chemosensory sensilla containing the dendrites of primary chemosensory neurons. Receptors on these dendrites are activated by the nucleotides AMP, ADP, and ATP but not by the nucleoside adenosine. It is shown here that the lobster chemosensory sensilla contain enzymes that dephosphorylate excitatory nucleotides and an uptake system that internalizes the nonexcitatory dephosphorylated product adenosine. The uptake of (/sup 3/H)-adenosine is saturable with increasing concentration, linear with time for up to 3 h, sodium dependent, insensitive to moderate pH changes and has a Km of 7.1 microM and a Vmax of 5.2 fmol/sensillum/min (573 fmol/micrograms of protein/min). Double-label experiments show that sensilla dephosphorylate nucleotides extracellularly; /sup 3/H from adenine-labeled AMP or ATP is internalized, whereas 32P from phosphate-labeled nucleotides is not. The dephosphorylation of AMP is very rapid; /sup 3/H from AMP is internalized at the same rate as /sup 3/H from adenosine. Sensillar 5'-ectonucleotidase activity is inhibited by ADP and the ADP analog alpha, beta-methylene ADP. Collectively, these results indicate that the enzymes and the uptake system whereby chemosensory sensilla of the lobster inactivate excitatory nucleotides and clear adenosine from extracellular spaces are very similar to those present in the internal tissues of vertebrates, where nucleotides have many neuroactive effects.

  18. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides

    Science.gov (United States)

    Lehninger, Albert L.; Vercesi, Anibal; Bababunmi, Enitan A.

    1978-01-01

    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca2+ and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca2+ is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as β-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca2+. Successive cycles of Ca2+ release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca2+-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca2+, mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport. Images PMID:25436

  19. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

    Science.gov (United States)

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

    2010-11-19

    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  20. [Genetic diagnostics of pathogenic splicing abnormalities in the clinical laboratory--pitfalls and screening approaches].

    Science.gov (United States)

    Niimi, Hideki; Ogawa, Tomomi; Note, Rhougou; Hayashi, Shirou; Ueno, Tomohiro; Harada, Kenu; Uji, Yoshinori; Kitajima, Isao

    2010-12-01

    In recent years, genetic diagnostics of pathogenic splicing abnormalities are increasingly recognized as critically important in the clinical genetic diagnostics. It is reported that approximately 10% of pathogenic mutations causing human inherited diseases are splicing mutations. Nonetheless, it is still difficult to identify splicing abnormalities in routine genetic diagnostic settings. Here, we studied two different kinds of cases with splicing abnormalities. The first case is a protein S deficiency. Nucleotide analyses revealed that the proband had a previously reported G to C substitution in the invariant AG dinucleotide at the splicing acceptor site of intronl/exon2, which produces multiple splicing abnormalities resulting in protein S deficiency. The second case is an antithrombin (AT) deficiency. This proband had a previously reported G to A substitution, at nucleotide position 9788 in intron 4, 14 bp in front of exon 5, which created a de novo exon 5 splice site and resulted in AT deficiency. From a practical standpoint, we discussed the pitfalls, attentions, and screening approaches in genetic diagnostics of pathogenic splicing abnormalities. Due to the difficulty with full-length sequence analysis of introns, and the lack of RNA samples, splicing mutations may escape identification. Although current genetic testing remains to be improved, to screen for splicing abnormalities more efficiently, it is significant to use an appropriate combination of various approaches such as DNA and/or RNA samples, splicing mutation databases, bioinformatic tools to detect splice sites and cis-regulatory elements, and in vitro and/or in vivo experimentally methods as needed.

  1. Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

    Directory of Open Access Journals (Sweden)

    Desirée Villahermosa

    2017-05-01

    Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

  2. Plasma diagnostics on large tokamaks

    International Nuclear Information System (INIS)

    Orlinskij, D.V.; Magyar, G.

    1988-01-01

    The main tasks of the large tokamaks which are under construction (T-15 and Tore Supra) and of those which have already been built (TFTR, JET, JT-60 and DIII-D) together with their design features which are relevant to plasma diagnostics are briefly discussed. The structural features and principal characteristics of the diagnostic systems being developed or already being used on these devices are also examined. The different diagnostic methods are described according to the physical quantities to be measured: electric and magnetic diagnostics, measurements of electron density, electron temperature, the ion components of the plasma, radiation loss measurements, spectroscopy of impurities, edge diagnostics and study of plasma stability. The main parameters of the various diagnostic systems used on the six large tokamaks are summarized in tables. (author). 351 refs, 44 figs, 22 tabs

  3. Cognitive aspect of diagnostic errors.

    Science.gov (United States)

    Phua, Dong Haur; Tan, Nigel C K

    2013-01-01

    Diagnostic errors can result in tangible harm to patients. Despite our advances in medicine, the mental processes required to make a diagnosis exhibits shortcomings, causing diagnostic errors. Cognitive factors are found to be an important cause of diagnostic errors. With new understanding from psychology and social sciences, clinical medicine is now beginning to appreciate that our clinical reasoning can take the form of analytical reasoning or heuristics. Different factors like cognitive biases and affective influences can also impel unwary clinicians to make diagnostic errors. Various strategies have been proposed to reduce the effect of cognitive biases and affective influences when clinicians make diagnoses; however evidence for the efficacy of these methods is still sparse. This paper aims to introduce the reader to the cognitive aspect of diagnostic errors, in the hope that clinicians can use this knowledge to improve diagnostic accuracy and patient outcomes.

  4. Generator for radiological diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Seissl, J; Broenner, K; Krause, H

    1978-10-02

    A generator is described for X-ray diagnostics, with a high-voltage transformer with a primary coil connected or with the grid and a secondary coil feeding the X-ray tube and with a rectifier bridge situated in the primary circuit of the high-voltage transformer. The direct current branch of the rectifier bridge contains a filter capacitor and a thyristor which is opened and closed by means of a pulse duty factor determining the capacitor voltage and thus the voltage of the X-ray tube. An LC-tuned circuit is connected to the thyristor whose capacity is discharged to the conductive thyristor so that the thyristor is quenched via a free-wheel diode arranged in parallel to the thyristor. In this way, a high switching frequency of the thyristor and, consequently, a low ripple of the X-ray tube voltage is obtained.

  5. Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.

    Science.gov (United States)

    Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O

    1987-06-01

    The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.

  6. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions.

    Science.gov (United States)

    Hesketh, Andy; Vergnano, Marta; Wan, Chris; Oliver, Stephen G

    2017-07-25

    We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP), cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA) and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR) inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection. IMPORTANCE During infections, pathogenic bacteria can release nucleotides into the cells of their eukaryotic hosts. These nucleotides are recognized as signals that contribute to the initiation of defensive immune responses that help the infected

  7. Molecular diagnostic PCR handbook

    International Nuclear Information System (INIS)

    Viljoen, G.J.; Crowther, J.R.; Nel, L.H.

    2005-01-01

    The uses of nucleic acid-directed methods have increased significantly in the past five years and have made important contributions to disease control country programmes for improving national and international trade. These developments include the more routine use of PCR as a diagnostic tool in veterinary diagnostic laboratories. However, there are many problems associated with the transfer and particularly, the application of this technology. These include lack of consideration of: the establishment of quality-assured procedures, the required set-up of the laboratory and the proper training of staff. This can lead to a situation where results are not assured. This book gives a comprehensive account of the practical aspects of PCR and strong consideration is given to ensure its optimal use in a laboratory environment. This includes the setting-up of a PCR laboratory; Good Laboratory Practice and standardised PCR protocols to detect animal disease pathogens. Examples of Standard Operating Procedures as used in individual specialist laboratories and an outline of training materials necessary for PCR technology transfer are presented. The difficulties, advantages and disadvantages in PCR applications are explained and placed in context with other test systems. Emphasis is placed on the use of PCR for detection of pathogens, with a particular focus on diagnosticians and scientists from the developing world. It is hoped that this book will enable readers from various disciplines and levels of expertise to better judge the merits of PCR and to increase their skills and knowledge in order to assist in a more logical, efficient and assured use of this technology

  8. Oral vs. salivary diagnostics

    Science.gov (United States)

    Marques, Joana; Corby, Patricia M.; Barber, Cheryl A.; Abrams, William R.; Malamud, Daniel

    2015-05-01

    The field of "salivary diagnostics" includes studies utilizing samples obtained from a variety of sources within the oral cavity. These samples include; whole unstimulated saliva, stimulated whole saliva, duct saliva collected directly from the parotid, submandibular/sublingual glands or minor salivary glands, swabs of the buccal mucosa, tongue or tonsils, and gingival crevicular fluid. Many publications state "we collected saliva from subjects" without fully describing the process or source of the oral fluid. Factors that need to be documented in any study include the time of day of the collection, the method used to stimulate and collect the fluid, and how much fluid is being collected and for how long. The handling of the oral fluid during and post-collection is also critical and may include addition of protease or nuclease inhibitors, centrifugation, and cold or frozen storage prior to assay. In an effort to create a standard protocol for determining a biomarker's origin we carried out a pilot study collecting oral fluid from 5 different sites in the mouth and monitoring the concentrations of pro- and anti-inflammatory cytokines detected using MesoScaleDiscovery (MSD) electrochemiluminesence assays. Our data suggested that 3 of the cytokines are primarily derived from the submandibular gland, while 7 of the cytokines come from a source other than the major salivary glands such as the minor salivary glands or cells in the oral mucosae. Here we review the literature on monitoring biomarkers in oral samples and stress the need for determining the blood/saliva ratio when a quantitative determination is needed and suggest that the term oral diagnostic be used if the source of an analyte in the oral cavity is unknown.

  9. Nova target diagnostics control system

    International Nuclear Information System (INIS)

    Severyn, J.R.

    1985-01-01

    During the past year the Nova target diagnostics control system was finished and put in service. The diagnostics loft constructed to the north of the target room provides the environmental conditions required to collect reliable target diagnostic data. These improvements include equipment cooling and isolation of the power source with strict control of instrumentation grounds to eliminate data corruption due to electromagnetic pulses from the laser power-conditioning system or from target implosion effects

  10. Picosecond image-converter diagnostics

    International Nuclear Information System (INIS)

    Schelev, M.Ya.

    1975-01-01

    A brief review is presented of the improvements in picosecond image-converter diagnostics carried out since the previous Congress in 1972. The account is given under the following headings: picosecond image converter cameras for visible and x-ray radiation diagnostics; Nd:glass and ruby mode-locked laser measurements; x-ray plasma emission diagnostics; computer treatment of pictures produced by picosecond cameras. (U.K.)

  11. Plant diagnostics in power stations

    International Nuclear Information System (INIS)

    Sturm, A.; Doering, D.

    1985-01-01

    The method of noise diagnostics is dealt with as a part of plant diagnostics in nuclear power stations. The following special applications are presented: (1) The modular noise diagnostics system is used for monitoring primary coolant circuits and detecting abnormal processes due to mechanical vibrations, loose parts or leaks. (2) The diagnostics of machines and plants with antifriction bearings is based on bearing vibration measurements. (3) The measurement of the friction moment by means of acoustic emission analysis is used for evaluating the operational state of slide bearings

  12. Team building and diagnostic training

    International Nuclear Information System (INIS)

    Bulmer, S.

    1987-01-01

    While developing a commercial training program to improve teamwork in control room crews, General Electric's Nuclear Training Services made an important discovery. Traditional training methods for developing teamwork and enhancing diagnostics capabilities are incomplete. Traditional methods generally help, but fail to fulfill the long-term needs of most teams. Teamwork has been treated as a short-term performance problem. Traditional diagnostic training suffers from a similar problem. Too often, it covers only the basic principles of decision-making, ignoring the development of expert diagnostic capabilities. In response to this discovery, they have developed comprehensive training in Team Building and Diagnostics

  13. Association of the IL4R single-nucleotide polymorphism I50V with recurrent spontaneous abortion (RSA).

    Science.gov (United States)

    Tavasolian, Fataneh; Abdollahi, Elham; Samadi, Morteza

    2014-07-01

    Recurrent spontaneous abortion (RSA) is defined as three or more consecutive abortions before the 20th week of gestation. There is increasing evidence to support an immunological mechanism for the occurrence of RSA. The purpose of our study was to examine whether single-nucleotide polymorphisms (SNPs) of the interleukin-4 receptor gene IL4R influence susceptibility to, recurrent spontaneous abortion. This is a case-control study. We recruited 200 patients with RSA (case group) using established diagnostic criteria and 200, normal individuals (control group) at the fertility and infertility center in Yazd city and Isfahan city during 2012 to 2013. We screened the I50V variant in IL-4R in patients and controls by PCR-RFLF method, and we performed an association analysis between I50V variant and RSA.the data was analyzed by spss 16 software using Chi-square test. No differences in the genotype and allele frequencies of the I50V SNPs were identified between patients with RSA and healthy controls. The frequency of SNP in IL-4 receptor (I50V) in patients with recurrent spontaneous abortion did not differ significantly compared with the control group. Analysis of IL4R SNP haplotypes or complex alleles suggested no dominant protection in patients with RSA.

  14. Real-Time PCR Typing of Escherichia coli Based on Multiple Single Nucleotide Polymorphisms--a Convenient and Rapid Method.

    Science.gov (United States)

    Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan

    2016-01-01

    Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.

  15. Complete nucleotide sequences of a new bipartite begomovirus from Malvastrum sp. plants with bright yellow mosaic symptoms in South Texas.

    Science.gov (United States)

    Alabi, Olufemi J; Villegas, Cecilia; Gregg, Lori; Murray, K Daniel

    2016-06-01

    Two isolates of a novel bipartite begomovirus, tentatively named malvastrum bright yellow mosaic virus (MaBYMV), were molecularly characterized from naturally infected plants of the genus Malvastrum showing bright yellow mosaic disease symptoms in South Texas. Six complete DNA-A and five DNA-B genome sequences of MaBYMV obtained from the isolates ranged in length from 2,608 to 2,609 nucleotides (nt) and 2,578 to 2,605 nt, respectively. Both genome segments shared a 178- to 180-nt common region. In pairwise comparisons, the complete DNA-A and DNA-B sequences of MaBYMV were most similar (87-88 % and 79-81 % identity, respectively) and phylogenetically related to the corresponding sequences of sida mosaic Sinaloa virus-[MX-Gua-06]. Further analysis revealed that MaBYMV is a putative recombinant virus, thus supporting the notion that malvaceous hosts may be influencing the evolution of several begomoviruses. The design of new diagnostic primers enabled the detection of MaBYMV in cohorts of Bemisia tabaci collected from symptomatic Malvastrum sp. plants, thus implicating whiteflies as potential vectors of the virus.

  16. Interferometric Reflectance Imaging Sensor (IRIS—A Platform Technology for Multiplexed Diagnostics and Digital Detection

    Directory of Open Access Journals (Sweden)

    Oguzhan Avci

    2015-07-01

    Full Text Available Over the last decade, the growing need in disease diagnostics has stimulated rapid development of new technologies with unprecedented capabilities. Recent emerging infectious diseases and epidemics have revealed the shortcomings of existing diagnostics tools, and the necessity for further improvements. Optical biosensors can lay the foundations for future generation diagnostics by providing means to detect biomarkers in a highly sensitive, specific, quantitative and multiplexed fashion. Here, we review an optical sensing technology, Interferometric Reflectance Imaging Sensor (IRIS, and the relevant features of this multifunctional platform for quantitative, label-free and dynamic detection. We discuss two distinct modalities for IRIS: (i low-magnification (ensemble biomolecular mass measurements and (ii high-magnification (digital detection of individual nanoparticles along with their applications, including label-free detection of multiplexed protein chips, measurement of single nucleotide polymorphism, quantification of transcription factor DNA binding, and high sensitivity digital sensing and characterization of nanoparticles and viruses.

  17. Cognitive diagnostic assessment via Bayesian evaluation of informative diagnostic hypotheses.

    NARCIS (Netherlands)

    Hoijtink, Herbert; Béland, Sébastien; Vermeulen, Jorine A.

    2014-01-01

    There exist diverse approaches that can be used for cognitive diagnostic assessment, such as mastery testing, constrained latent class analysis, rule space methodology, diagnostic cognitive modeling, and person-fit analysis. Each of these approaches can be used within 1 of the 4 psychometric

  18. Cognitive Diagnostic Assessment via Bayesian Evaluation of Informative Diagnostic Hypotheses

    NARCIS (Netherlands)

    Hoitink, Herbert; Beland, Sebastien; Vermeulen, Jorine

    2014-01-01

    There exist diverse approaches that can be used for cognitive diagnostic assessment, such as mastery testing, constrained latent class analysis, rule space methodology, diagnostic cognitive modeling, and person-fit analysis. Each of these approaches can be used within 1 of the 4 psychometric

  19. Novel applications of array comparative genomic hybridization in molecular diagnostics.

    Science.gov (United States)

    Cheung, Sau W; Bi, Weimin

    2018-05-31

    In 2004, the implementation of array comparative genomic hybridization (array comparative genome hybridization [CGH]) into clinical practice marked a new milestone for genetic diagnosis. Array CGH and single-nucleotide polymorphism (SNP) arrays enable genome-wide detection of copy number changes in a high resolution, and therefore microarray has been recognized as the first-tier test for patients with intellectual disability or multiple congenital anomalies, and has also been applied prenatally for detection of clinically relevant copy number variations in the fetus. Area covered: In this review, the authors summarize the evolution of array CGH technology from their diagnostic laboratory, highlighting exonic SNP arrays developed in the past decade which detect small intragenic copy number changes as well as large DNA segments for the region of heterozygosity. The applications of array CGH to human diseases with different modes of inheritance with the emphasis on autosomal recessive disorders are discussed. Expert commentary: An exonic array is a powerful and most efficient clinical tool in detecting genome wide small copy number variants in both dominant and recessive disorders. However, whole-genome sequencing may become the single integrated platform for detection of copy number changes, single-nucleotide changes as well as balanced chromosomal rearrangements in the near future.

  20. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  1. Vγ9Vδ2 T cell activation by strongly agonistic nucleotidic phosphoantigens.

    Science.gov (United States)

    Moulin, Morgane; Alguacil, Javier; Gu, Siyi; Mehtougui, Asmaa; Adams, Erin J; Peyrottes, Suzanne; Champagne, Eric

    2017-12-01

    Human Vγ9Vδ2 T cells can sense through their TCR tumor cells producing the weak endogenous phosphorylated antigen isopentenyl pyrophosphate (IPP), or bacterially infected cells producing the strong agonist hydroxyl dimethylallyl pyrophosphate (HDMAPP). The recognition of the phosphoantigen is dependent on its binding to the intracellular B30.2 domain of butyrophilin BTN3A1. Most studies have focused on pyrophosphate phosphoantigens. As triphosphate nucleotide derivatives are naturally co-produced with IPP and HDMAPP, we analyzed their specific properties using synthetic nucleotides derived from HDMAPP. The adenylated, thymidylated and uridylated triphosphate derivatives were found to activate directly Vγ9Vδ2 cell lines as efficiently as HDMAPP in the absence of accessory cells. These antigens were inherently resistant to terminal phosphatases, but apyrase, when added during a direct stimulation of Vγ9Vδ2 cells, abrogated their stimulating activity, indicating that their activity required transformation into strong pyrophosphate agonists by a nucleotide pyrophosphatase activity which is present in serum. Tumor cells can be sensitized with nucleotide phosphoantigens in the presence of apyrase to become stimulatory, showing that this can occur before their hydrolysis into pyrophosphates. Whereas tumors sensitized with HDMAPP rapidly lost their stimulatory activity, sensitization with nucleotide derivatives, in particular with the thymidine derivative, induced long-lasting stimulating ability. Using isothermal titration calorimetry, binding of some nucleotide derivatives to BTN3A1 intracellular domain was found to occur with an affinity similar to that of IPP, but much lower than that of HDMAPP. Thus, nucleotide phosphoantigens are precursors of pyrophosphate antigens which can deliver strong agonists intracellularly resulting in prolonged and strengthened activity.

  2. Genetic stability of the VHSV consensus sequence of G-gene in diagnostic samples from an acute outbreak

    DEFF Research Database (Denmark)

    Einer-Jensen, Katja; Ahrens, Peter; Lorenzen, Niels

    2006-01-01

    The negative stranded RNA virus viral haemorrhagic septicaemia virus (VHSV) is an important disease-causing agent in aquacultured fish and internationally harmonized diagnostic procedures are continuously under development. The present study concerns the suitability of genotyping by sequencing...... collected tissue material as well as from inoculated cell culture. No nucleotide substitutions where identified when aligning the obtained sequence data for the two sample types. The presented data indicate that the overall consensus sequence of the virus outbreak was stable during the survey...

  3. Plasma diagnostics discharge parameters and chemistry

    CERN Document Server

    Auciello, Orlando

    1989-01-01

    Plasma Diagnostics, Volume 1: Discharge Parameters and Chemistry covers seven chapters on the important diagnostic techniques for plasmas and details their use in particular applications. The book discusses optical diagnostic techniques for low pressure plasmas and plasma processing; plasma diagnostics for electrical discharge light sources; as well as Langmuir probes. The text also describes the mass spectroscopy of plasmas, microwave diagnostics, paramagnetic resonance diagnostics, and diagnostics in thermal plasma processing. Electrical engineers, nuclear engineers, microwave engineers, che

  4. Regression models of reactor diagnostic signals

    International Nuclear Information System (INIS)

    Vavrin, J.

    1989-01-01

    The application is described of an autoregression model as the simplest regression model of diagnostic signals in experimental analysis of diagnostic systems, in in-service monitoring of normal and anomalous conditions and their diagnostics. The method of diagnostics is described using a regression type diagnostic data base and regression spectral diagnostics. The diagnostics is described of neutron noise signals from anomalous modes in the experimental fuel assembly of a reactor. (author)

  5. Dual Processing and Diagnostic Errors

    Science.gov (United States)

    Norman, Geoff

    2009-01-01

    In this paper, I review evidence from two theories in psychology relevant to diagnosis and diagnostic errors. "Dual Process" theories of thinking, frequently mentioned with respect to diagnostic error, propose that categorization decisions can be made with either a fast, unconscious, contextual process called System 1 or a slow, analytical,…

  6. Laser-aided plasma diagnostics

    NARCIS (Netherlands)

    Donne, A. J. H.; Barth, C. J.

    2008-01-01

    This paper will focus on two types of laser-aided diagnostics: Thomson scattering and laser-induced fluorescence. Thomson scattering is a very powerful diagnostic, which is applied at nearly every magnetic confinement device. Depending on the experimental conditions different plasma parameters can

  7. Student Interpretations of Diagnostic Feedback

    Science.gov (United States)

    Doe, Christine

    2015-01-01

    Diagnostic assessment is increasingly being recognized as a potentially beneficial tool for teaching and learning (Jang, 2012). There have been calls in the research literature for students to receive diagnostic feedback and for researchers to investigate how such feedback is used by students. Therefore, this study examined how students…

  8. Technical diagnostics of steam turbines

    International Nuclear Information System (INIS)

    Vlckova, B.; Drahy, J.

    1987-01-01

    This paper deals with practical experience in application of technical diagnostics methods to steam turbines, in particular using pedestal and shaft vibration measurements as well as estimation of bearing metal temperature and ultrasound emission signals. An estimation of effectiveness of the diagnostics methods used is given on the basis of experimental investigations made on a 30-MW turbine. (author)

  9. Psychometric perspectives on diagnostic systems

    NARCIS (Netherlands)

    Borsboom, D.

    2008-01-01

    The author identifies four conceptualizations of the relation between symptoms and disorders as utilized in diagnostic systems such as the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition (DSM-IV; American Psychiatric Association, 1994): A constructivist perspective, which holds

  10. Reversal of Proximal Renal Tubular Dysfunction after Nucleotide Analogue Withdrawal in Chronic Hepatitis B

    Directory of Open Access Journals (Sweden)

    Abhasnee Sobhonslidsuk

    2017-01-01

    Full Text Available Aims. Proximal renal tubular dysfunction (PRTD is an infrequent complication after nucleotide analogue therapy. We evaluated the outcomes of PRTD and nephrotoxicity after nucleotide analogue withdrawal in chronic hepatitis B (CHB. Methods. A longitudinal follow-up study was performed in patients with PRTD after nucleotide analogue discontinuation. Serum and urine were collected at baseline and every 3 months for one year. The fractional excretion of phosphate (PO4, uric acid (UA, and potassium and tubular maximal reabsorption rate of PO4 to glomerular filtration rate (TmPO4/GFR were calculated. Renal losses were defined based on the criteria of substance losses. Subclinical PRTD and overt PRTD were diagnosed when 2 and ≥3 criteria were identified. Results. Eight subclinical and eight overt PRTD patients were enrolled. After nucleotide analogue withdrawal, there were overall improvements in GFR, serum PO4, and UA. Renal loss of PO4, UA, protein, and β2-microglobulin reduced over time. At one year, complete reversal of PRTD was seen in 13 patients (81.2%. Improvements in PRTD were seen in all but one patient. Conclusion. One year after nucleotide analogue withdrawal, PRTD was resolved in most patients. Changes in TmPO4/GFR, urinary protein, and β2-microglobulin indicate that urinary biomarkers may represent an early sign of PRTD recovery.

  11. Enhanced NMR signal detection of imino protons in RNA molecules containing 3' dangling nucleotides

    International Nuclear Information System (INIS)

    Amborski, Andrew N.; Johnson, Philip E.

    2008-01-01

    We present a method for improving the quality of nuclear magnetic resonance (NMR) spectra involving exchangeable protons near the base of the stem of RNA hairpin molecules. NMR spectra of five different RNA hairpins were compared. These hairpins consisted of a native RNA structure and four molecules each having different unpaired, or dangling, nucleotides at the 3' end. NMR experiments were acquired in water for each construct and the quality of the imino proton spectral regions were examined. The imino resonances near the base of the stem of the wild type RNA structure were not observed due to breathing motions. However, a significant increase in spectral quality for molecules with dangling 3' adenosine or guanosine nucleotides was observed, with imino protons detected in these constructs that were not observed in the wild type construct. A modest improvement in spectral quality was seen for the construct with a 3' unpaired uridine, whereas no significant improvement was observed for a 3' unpaired cytidine. This improvement in NMR spectral quality mirrors the increased thermodynamic stability observed for 3' unpaired nucleotides which is dependant on the stacking interactions of these nucleotides against the base of the stem. The use of a dangling 3' adenosine nucleotide represents an easy method to significantly improve the quality of NMR spectra of RNA molecules

  12. Diagnostic evaluation of rhabdomyolysis.

    Science.gov (United States)

    Nance, Jessica R; Mammen, Andrew L

    2015-06-01

    Rhabdomyolysis is characterized by severe acute muscle injury resulting in muscle pain, weakness, and/or swelling with release of myofiber contents into the bloodstream. Symptoms develop over hours to days after an inciting factor and may be associated with dark pigmentation of the urine. Serum creatine kinase and urine myoglobin levels are markedly elevated. Clinical examination, history, laboratory studies, muscle biopsy, and genetic testing are useful tools for diagnosis of rhabdomyolysis, and they can help differentiate acquired from inherited causes of rhabdomyolysis. Acquired causes include substance abuse, medication or toxic exposures, electrolyte abnormalities, endocrine disturbances, and autoimmune myopathies. Inherited predisposition to rhabdomyolysis can occur with disorders of glycogen metabolism, fatty acid β-oxidation, and mitochondrial oxidative phosphorylation. Less common inherited causes of rhabdomyolysis include structural myopathies, channelopathies, and sickle-cell disease. This review focuses on the differentiation of acquired and inherited causes of rhabdomyolysis and proposes a practical diagnostic algorithm. Muscle Nerve 51: 793-810, 2015. © 2015 Wiley Periodicals, Inc.

  13. Laboratory diagnostics of malaria

    Science.gov (United States)

    Siahaan, L.

    2018-03-01

    Even now, malaria treatment should only be administered after laboratory confirmation. There are several principal methods for diagnosing malaria. All these methods have their disadvantages.Presumptive treatment of malaria is widely practiced where laboratory tests are not readily available. Microscopy of Giemsa-stained thick and thin blood films remains the gold standard for the diagnosis of malaria infection. The technique of slide preparation, staining and reading are well known and standardized, and so is the estimate of the parasite density and parasite stages. Microscopy is not always available or feasible at primary health services in limited resource settings due to cost, lack of skilled manpower, accessories and reagents required. Rapid diagnostic tests (RDTs) are potential tools for parasite-based diagnosis since the tests are accurate in detecting malaria infections and are easy to use. The test is based on the capture of parasite antigen that released from parasitized red blood cells using monoclonal antibodies prepared against malaria antigen target. Polymerase Chain Reaction (PCR), depend on DNA amplification approaches and have higher sensitivity than microscopy. PCR it is not widely used due to the lack of a standardized methodology, high costs, and the need for highly-trained staff.

  14. Moyamoya disease: Diagnostic imaging

    International Nuclear Information System (INIS)

    Tarasów, Eugeniusz; Kułakowska, Alina; Łukasiewicz, Adam; Kapica-Topczewska, Katarzyna; Korneluk-Sadzyńska, Alicja; Brzozowska, Joanna; Drozdowski, Wiesław

    2011-01-01

    Moyamoya disease is a progressive vasculopathy leading to stenosis of the main intracranial arteries. The incidence of moyamoya disease is high in Asian countries; in Europe and North America, the prevalence of the disease is considerably lower. Clinically, the disease may be of ischaemic, haemorrhagic and epileptic type. Cognitive dysfunction and behavioral disturbance are atypical symptoms of moyamoya disease. Characteristic angiographic features of the disease include stenosis or occlusion of the arteries of the circle of Willis, as well as the development of collateral vasculature. Currently, magnetic resonance angiography and CT angiography with multi-row systems are the main imaging methods of diagnostics of the entire range of vascular changes in moyamoya disease. The most common surgical treatment combines the direct arterial anastomosis between the superficial temporal artery and middle cerebral, and the indirect synangiosis involving placement of vascularised tissue in the brain cortex, in order to promote neoangiogenesis. Due to progressive changes, correct and early diagnosis is of basic significance in selecting patients for surgery, which is the only effective treatment of the disease. An appropriate qualification to surgery should be based on a comprehensive angiographic and imaging evaluation of brain structures. Despite the rare occurrence of moyamoya disease in European population, it should be considered as one of causes of ischaemic or haemorrhagic strokes, especially in young patients

  15. Radiologic diagnostics of dementia

    International Nuclear Information System (INIS)

    Essig, M.; Schoenberg, S.O.

    2003-01-01

    Dementia is one of the most common diseases in the elderly population and is getting more and more important with the ageing of the population. A radiologic structural examination with CT or MRI is meanwhile a standard procedure in the diagnostic work up of patients with dementia syndrome. Radiology enables an early diagnosis and a differential diagnosis between different causes of dementia. Because structural changes occur only late in the disease process, a more detailed structural analysis using volumetric techniques or the use of functional imaging techniques is mandatory. These days, structural imaging uses MRI which enables to detect early atrophic changes at the medial temporal lobe with focus on the amygdala hippocampal complex. These changes are also present in the normal ageing process. In patients with Alzheimer's disease, however, they are more rapid and more pronounced. The use of functional imaging methods such as perfusion MRI, diffusion MRI or fMRI allow new insights into the pathophysiologic changes of dementia. The article gives an overview of the current status of structural imaging and an outlook into the potential of functional imaging methods. Detailed results of structural and functional imaging are presented in other articles of this issue. (orig.) [de

  16. Recent diagnostic developments on LHD

    International Nuclear Information System (INIS)

    Sudo, S.; Nagayama, Y.; Peterson, B.J.

    2003-01-01

    Standard diagnostics for fundamental plasma parameters and for plasma physics are routinely utilized for daily operation and physics study in the large helical device (LHD) with high reliability. Diagnostics for steady state plasma are intensively developed, especially for T e , n e (YAG laser Thomson, CO 2 laser polarimeter), data acquisition in steady state, heat resistant probes. To clarify the plasma property of the helical structure, 2-D or 3-D diagnostics are intensively developed: Tangential cameras (Fast SX TV, Photon counting CCD, H α TV); Tomography (Tangential SX CCD, Bolometer); Imaging (Bolometer, ECE, Reflectometer). Divertor and edge physics are one of important key issues for steady state operation. Diagnostics for neutral flux (H α array, Zeeman spectroscopy) and n e (Fast scanning probe, Li beam probe, Pulsed radar reflectometer). In addition to these, advanced diagnostics are being intensively developed with national and international collaborations in LHD. (author)

  17. The engineering of JET diagnostics

    International Nuclear Information System (INIS)

    Walker, C.I.; Dillon, S.F.; Hammond, N.P.; Hancock, C.J.; Lam, N.; McCarron, E.J.; Prior, P.C.S.; Reid, J.; Sanders, S.; Tellier, X.; Tiscornia, A.J.; Whitfield, G.A.H.; Wilson, C.H.; Wilson, D.J.

    1995-01-01

    There are some 62 identifiably different diagnostic systems on JET. 22 were installed new at the last, Pumped Divertor, shutdown and a further 22 which were modified, upgraded or repositioned. This paper describes some of the engineering aspects peculiar to the renewed diagnostic systems, reviews their construction and installation and gives an overview of the design of presently installed diagnostic equipment at the Torus. Examples are considered that illustrate the breakdown into a categorisation based on their installation method. This is useful for discussion of many of the associated engineering problems of method and quality control of manufacture, vulnerability, access for installation and maintenance and ultimately system safety and reliability. The function and measured plasma parameter of specific diagnostics is covered in other papers and is not attempted here, neither is a full catalogue of Diagnostics on JET. (orig.)

  18. ITER diagnostic system: Vacuum interface

    International Nuclear Information System (INIS)

    Patel, K.M.; Udintsev, V.S.; Hughes, S.; Walker, C.I.; Andrew, P.; Barnsley, R.; Bertalot, L.; Drevon, J.M.; Encheva, A.; Kashchuk, Y.; Maquet, Ph.; Pearce, R.; Taylor, N.; Vayakis, G.; Walsh, M.J.

    2013-01-01

    Diagnostics play an essential role for the successful operation of the ITER tokamak. They provide the means to observe control and to measure plasma during the operation of ITER tokamak. The components of the diagnostic system in the ITER tokamak will be installed in the vacuum vessel, in the cryostat, in the upper, equatorial and divertor ports, in the divertor cassettes and racks, as well as in various buildings. Diagnostic components that are placed in a high radiation environment are expected to operate for the life of ITER. There are approx. 45 diagnostic systems located on ITER. Some diagnostics incorporate direct or independently pumped extensions to maintain their necessary vacuum conditions. They require a base pressure less than 10 −7 Pa, irrespective of plasma operation, and a leak rate of less than 10 −10 Pa m 3 s −1 . In all the cases it is essential to maintain the ITER closed fuel cycle. These directly coupled diagnostic systems are an integral part of the ITER vacuum containment and are therefore subject to the same design requirements for tritium and active gas confinement, for all normal and accidental conditions. All the diagnostics, whether or not pumped, incorporate penetration of the vacuum boundary (i.e. window assembly, vacuum feedthrough etc.) and demountable joints. Monitored guard volumes are provided for all elements of the vacuum boundary that are judged to be vulnerable by virtue of their construction, material, load specification etc. Standard arrangements are made for their construction and for the monitoring, evacuating and leak testing of these volumes. Diagnostic systems are incorporated at more than 20 ports on ITER. This paper will describe typical and particular arrangements of pumped diagnostic and monitored guard volume. The status of the diagnostic vacuum systems, which are at the start of their detailed design, will be outlined and the specific features of the vacuum systems in ports and extensions will be described

  19. ITER diagnostic system: Vacuum interface

    Energy Technology Data Exchange (ETDEWEB)

    Patel, K.M., E-mail: Kaushal.Patel@iter.org [ITER Organization, Route de Vinon sur Verdon, 13115 St Paul-Lez-Durance (France); Udintsev, V.S.; Hughes, S.; Walker, C.I.; Andrew, P.; Barnsley, R.; Bertalot, L. [ITER Organization, Route de Vinon sur Verdon, 13115 St Paul-Lez-Durance (France); Drevon, J.M. [Bertin Technologies, BP 22, 13762 Aix-en Provence cedex 3 (France); Encheva, A. [ITER Organization, Route de Vinon sur Verdon, 13115 St Paul-Lez-Durance (France); Kashchuk, Y. [Institution “PROJECT CENTER ITER”, 1, Akademika Kurchatova pl., Moscow (Russian Federation); Maquet, Ph. [Bertin Technologies, BP 22, 13762 Aix-en Provence cedex 3 (France); Pearce, R.; Taylor, N.; Vayakis, G.; Walsh, M.J. [ITER Organization, Route de Vinon sur Verdon, 13115 St Paul-Lez-Durance (France)

    2013-10-15

    Diagnostics play an essential role for the successful operation of the ITER tokamak. They provide the means to observe control and to measure plasma during the operation of ITER tokamak. The components of the diagnostic system in the ITER tokamak will be installed in the vacuum vessel, in the cryostat, in the upper, equatorial and divertor ports, in the divertor cassettes and racks, as well as in various buildings. Diagnostic components that are placed in a high radiation environment are expected to operate for the life of ITER. There are approx. 45 diagnostic systems located on ITER. Some diagnostics incorporate direct or independently pumped extensions to maintain their necessary vacuum conditions. They require a base pressure less than 10{sup −7} Pa, irrespective of plasma operation, and a leak rate of less than 10{sup −10} Pa m{sup 3} s{sup −1}. In all the cases it is essential to maintain the ITER closed fuel cycle. These directly coupled diagnostic systems are an integral part of the ITER vacuum containment and are therefore subject to the same design requirements for tritium and active gas confinement, for all normal and accidental conditions. All the diagnostics, whether or not pumped, incorporate penetration of the vacuum boundary (i.e. window assembly, vacuum feedthrough etc.) and demountable joints. Monitored guard volumes are provided for all elements of the vacuum boundary that are judged to be vulnerable by virtue of their construction, material, load specification etc. Standard arrangements are made for their construction and for the monitoring, evacuating and leak testing of these volumes. Diagnostic systems are incorporated at more than 20 ports on ITER. This paper will describe typical and particular arrangements of pumped diagnostic and monitored guard volume. The status of the diagnostic vacuum systems, which are at the start of their detailed design, will be outlined and the specific features of the vacuum systems in ports and extensions

  20. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    Science.gov (United States)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

    2015-11-01

    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  1. Optimization time synthesis of nucleotide labelled [γ-32P]-ATP

    International Nuclear Information System (INIS)

    Rahman, Wira Y; Sarmini, Endang; Herlina; Lubis, Hotman; Triyanto; Hambali

    2013-01-01

    Adenosine triphosphate-labelled with γ- 32 P([γ- 32 p]-ATP) has been widely used in the biotechnology research, usually as a tracer to study aspects of physiological and pathological processes. In order to support biotechnology research in Indonesia, a process for production of [γ- 32 P]-ATP with enzymatic reaction was used as precursors DL-glyceraldehydde 3-phosphate, Adenosine Diphosphate (ADP) and H 3 32 PO 4 , and enzyme glyceraldehid 3-phosphate dehydrogenase, 3-phosphoglyceryc phosphokinase and lactate dehydrogenase. Optimization of incubation time labeled nucleotide synthesis process is performed to find the optimum conditions, in terms of the most advantageous time in the synthesis process. With the success of the synthesis and optimization is done incubation time of synthesis labeled nucleotide, the result suggested can be used for producing [γ- 32 P] -ATP to support the provision of radiolabeled nucleotide for biotechnology research in Indonesia. (author)

  2. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  3. The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Ian R Kelsall

    Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

  4. De novo synthesis of purine nucleotides in different fiber types of rat skeletal muscle

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.; Hood, D.A.; Terjung, R.L.

    1986-01-01

    The contribution of de novo purine nucleotide synthesis to nucleotide metabolism in skeletal muscles is not known. The authors have determined rates of de novo synthesis in soleus (slow-twitch red), red gastrocnemius (fast-twitch red), and white gastrocnemius (fast-twitch white) using the perfused rat hindquarter. 14 C glycine incorporation into ATP was linear after 1 and 2 hours of perfusion with 0.2 mM added glycine. The intracellular (I) and extracellular (E) specific activity of 14 C glycine was determined by HPLC of phenylisothiocyanate derivatives of neutralized PCA extracts. The rates of de novo synthesis when expressed relative to muscle ATP content show slow and fast-twitch red muscles to be similar and about twice as great as fast-twitch white muscles. This could represent a greater turnover of the adenine nucleotide pool in more oxidative red muscle types

  5. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  6. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  7. Nucleotide sequence and genetic organization of Hungarian grapevine chrome mosaic nepovirus RNA2.

    Science.gov (United States)

    Brault, V; Hibrand, L; Candresse, T; Le Gall, O; Dunez, J

    1989-10-11

    The complete nucleotide sequence of hungarian grapevine chrome mosaic nepovirus (GCMV) RNA2 has been determined. The RNA sequence is 4441 nucleotides in length, excluding the poly(A) tail. A polyprotein of 1324 amino acids with a calculated molecular weight of 146 kDa is encoded in a single long open reading frame extending from nucleotides 218 to 4190. This polyprotein is homologous with the protein encoded by the S strain of tomato black ring virus (TBRV) RNA2, the only other nepovirus sequenced so far. Direct sequencing of the viral coat protein and in vitro translation of transcripts derived from cDNA sequences demonstrate that, as for comoviruses, the coat protein is located at the carboxy terminus of the polyprotein. A model for the expression of GCMV RNA2 is presented.

  8. [Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

    Science.gov (United States)

    Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

    1985-11-01

    The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

  9. Plasma diagnostics for tokamaks and stellarators

    Energy Technology Data Exchange (ETDEWEB)

    Stott, P E; Sanchez, J

    1994-07-01

    A collection of papers on plasma diagnostics is presented. The papers show the state of the art developments in a series of techniques: Magnetic diagnostics, Edge diagnostics, Langmuir probes, Spectroscopy, Microwave and FIR diagnostics as well as Thomson Scattering. Special interest was focused on those diagnostics oriented to fluctuations measurements in the plasma. (Author) 451 refs.

  10. Plasma diagnostics for tokamaks and stellarators

    International Nuclear Information System (INIS)

    Stott, P.E.; Sanchez, J.

    1994-01-01

    A collection of papers on plasma diagnostics is presented. The papers show the state of the art developments in a series of techniques: magnetic diagnostics, Edge diagnostics, Langmuir probes, Spectroscopy, Microwave and FIR diagnostics as well as Thomson Sattering. Special interest was focused on those diagnostics oriented to fluctuations measurements in the plasma

  11. Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

    Directory of Open Access Journals (Sweden)

    Elaine C Thomas

    Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

  12. Guanine nucleotide regulation of α1-adrenergic receptors of muscle and kidney eptihelial cells

    International Nuclear Information System (INIS)

    Terman, B.I.; Hughes, R.J.; Slivka, S.R.; Insel, P.A.

    1986-01-01

    The authors have examined the effect of guanine nucleotides on the interaction of adrenergic agents with α 1 -adrenergic receptors of two cell lines, the Madin-Darby Canine Kidney (MDCK) and BC3H-1 muscle cells. While gaunylylimidodiphosphoate (Gpp(NH)p) had no effect on the affinity or the total number of [ -3 H]prazosin binding sites in membranes prepared from these cells, the nucleotide decreased the apparent affinity of the agonist epinephrine in competing for [ 3 H]prazosin binding sites in both cell types. The EC 50 of Gpp(NH)p was ∼100 μM, and a maximal effect was seen at 500 μM. In contrast, 100 μM Gpp(NH)p yielding maximal shifts in binding of epinephrine to β-adrenergic receptors in BC3H-1 cell membranes. Guanine nucleotides were significantly more effective than adenine nucleotides in shifting agonist affinity for the α 1 -receptor and Mg ++ was required to observe a maximal effect. α 1 -receptor agonists activated phosphatidylinositol (PI) hydrolysis in both cell types, but have no direct effect on membrane adenylate cyclase activity. In intact BC3H-1 cells, α 1 -agonists inhibited β-adrenergic cAMP production, an effect which appears in preliminary studies not to result from enhanced phosphodieterase activity. These results show that agonist binding to α 1 -adrenergic receptors in mammalian kidney and muscle cells is regulated by guanine nucleotides. This regulation and inturn transmembrane signalling (PI hydrolysis) by these receptors appear to involve a guanine nucleotide binding (G) protein, which may be different than G/sub s/ and G/sub i/

  13. Plastid: nucleotide-resolution analysis of next-generation sequencing and genomics data.

    Science.gov (United States)

    Dunn, Joshua G; Weissman, Jonathan S

    2016-11-22

    Next-generation sequencing (NGS) informs many biological questions with unprecedented depth and nucleotide resolution. These assays have created a need for analytical tools that enable users to manipulate data nucleotide-by-nucleotide robustly and easily. Furthermore, because many NGS assays encode information jointly within multiple properties of read alignments - for example, in ribosome profiling, the locations of ribosomes are jointly encoded in alignment coordinates and length - analytical tools are often required to extract the biological meaning from the alignments before analysis. Many assay-specific pipelines exist for this purpose, but there remains a need for user-friendly, generalized, nucleotide-resolution tools that are not limited to specific experimental regimes or analytical workflows. Plastid is a Python library designed specifically for nucleotide-resolution analysis of genomics and NGS data. As such, Plastid is designed to extract assay-specific information from read alignments while retaining generality and extensibility to novel NGS assays. Plastid represents NGS and other biological data as arrays of values associated with genomic or transcriptomic positions, and contains configurable tools to convert data from a variety of sources to such arrays. Plastid also includes numerous tools to manipulate even discontinuous genomic features, such as spliced transcripts, with nucleotide precision. Plastid automatically handles conversion between genomic and feature-centric coordinates, accounting for splicing and strand, freeing users of burdensome accounting. Finally, Plastid's data models use consistent and familiar biological idioms, enabling even beginners to develop sophisticated analytical workflows with minimal effort. Plastid is a versatile toolkit that has been used to analyze data from multiple NGS assays, including RNA-seq, ribosome profiling, and DMS-seq. It forms the genomic engine of our ORF annotation tool, ORF-RATER, and is readily

  14. Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

    International Nuclear Information System (INIS)

    Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

    1986-01-01

    14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

  15. De novo synthesis of adenine nucleotides in different skeletal muscle fiber types

    International Nuclear Information System (INIS)

    Tullson, P.C.; John-Alder, H.B.; Hood, D.A.; Terjung, R.L.

    1988-01-01

    Management of adenine nucleotide catabolism differs among skeletal muscle fiber types. This study evaluated whether there are corresponding differences in the rates of de novo synthesis of adenine nucleotide among fiber type sections of skeletal muscle using an isolated perfused rat hindquarter preparation. Label incorporation into adenine nucleotides from the [1-14C]glycine precursor was determined and used to calculate synthesis rates based on the intracellular glycine specific radioactivity. Results show that intracellular glycine is closely related to the direct precursor pool. Rates of de novo synthesis were highest in fast-twitch red muscle (57.0 +/- 4.0, 58.2 +/- 4.4 nmol.h-1.g-1; deep red gastrocnemius and vastus lateralis), relatively high in slow-twitch red muscle (47.0 +/- 3.1; soleus), and low in fast-twitch white muscle (26.1 +/- 2.0 and 21.6 +/- 2.3; superficial white gastrocnemius and vastus lateralis). Rates for four mixed muscles were intermediate, ranging between 32.3 and 37.3. Specific de novo synthesis rates exhibited a strong correlation (r = 0.986) with muscle section citrate synthase activity. Turnover rates (de novo synthesis rate/adenine nucleotide pool size) were highest in high oxidative muscle (0.82-1.06%/h), lowest in low oxidative muscle (0.30-0.35%/h), and intermediate in mixed muscle (0.44-0.55%/h). Our results demonstrate that differences in adenine nucleotide management among fiber types extends to the process of de novo adenine nucleotide synthesis

  16. Complete nucleotide sequence of Alfalfa mosaic virus isolated from alfalfa (Medicago sativa L.) in Argentina.

    Science.gov (United States)

    Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián

    2014-06-01

    The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.

  17. Bacterial Signaling Nucleotides Inhibit Yeast Cell Growth by Impacting Mitochondrial and Other Specifically Eukaryotic Functions

    Directory of Open Access Journals (Sweden)

    Andy Hesketh

    2017-07-01

    Full Text Available We have engineered Saccharomyces cerevisiae to inducibly synthesize the prokaryotic signaling nucleotides cyclic di-GMP (cdiGMP, cdiAMP, and ppGpp in order to characterize the range of effects these nucleotides exert on eukaryotic cell function during bacterial pathogenesis. Synthetic genetic array (SGA and transcriptome analyses indicated that, while these compounds elicit some common reactions in yeast, there are also complex and distinctive responses to each of the three nucleotides. All three are capable of inhibiting eukaryotic cell growth, with the guanine nucleotides exhibiting stronger effects than cdiAMP. Mutations compromising mitochondrial function and chromatin remodeling show negative epistatic interactions with all three nucleotides. In contrast, certain mutations that cause defects in chromatin modification and ribosomal protein function show positive epistasis, alleviating growth inhibition by at least two of the three nucleotides. Uniquely, cdiGMP is lethal both to cells growing by respiration on acetate and to obligately fermentative petite mutants. cdiGMP is also synthetically lethal with the ribonucleotide reductase (RNR inhibitor hydroxyurea. Heterologous expression of the human ppGpp hydrolase Mesh1p prevented the accumulation of ppGpp in the engineered yeast and restored cell growth. Extensive in vivo interactions between bacterial signaling molecules and eukaryotic gene function occur, resulting in outcomes ranging from growth inhibition to death. cdiGMP functions through a mechanism that must be compensated by unhindered RNR activity or by functionally competent mitochondria. Mesh1p may be required for abrogating the damaging effects of ppGpp in human cells subjected to bacterial infection.

  18. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    Science.gov (United States)

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  19. Cytosolic nucleotides block and regulate the Arabidopsis vacuolar anion channel AtALMT9.

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-09-12

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al(3+) to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Cytosolic Nucleotides Block and Regulate the Arabidopsis Vacuolar Anion Channel AtALMT9*

    Science.gov (United States)

    Zhang, Jingbo; Martinoia, Enrico; De Angeli, Alexis

    2014-01-01

    The aluminum-activated malate transporters (ALMTs) form a membrane protein family exhibiting different physiological roles in plants, varying from conferring tolerance to environmental Al3+ to the regulation of stomatal movement. The regulation of the anion channels of the ALMT family is largely unknown. Identifying intracellular modulators of the activity of anion channels is fundamental to understanding their physiological functions. In this study we investigated the role of cytosolic nucleotides in regulating the activity of the vacuolar anion channel AtALMT9. We found that cytosolic nucleotides modulate the transport activity of AtALMT9. This modulation was based on a direct block of the pore of the channel at negative membrane potentials (open channel block) by the nucleotide and not by a phosphorylation mechanism. The block by nucleotides of AtALMT9-mediated currents was voltage dependent. The blocking efficiency of intracellular nucleotides increased with the number of phosphate groups and ATP was the most effective cellular blocker. Interestingly, the ATP block induced a marked modification of the current-voltage characteristic of AtALMT9. In addition, increased concentrations of vacuolar anions were able to shift the ATP block threshold to a more negative membrane potential. The block of AtALMT9-mediated anion currents by ATP at negative membrane potentials acts as a gate of the channel and vacuolar anion tune this gating mechanism. Our results suggest that anion transport across the vacuolar membrane in plant cells is controlled by cytosolic nucleotides and the energetic status of the cell. PMID:25028514

  1. Adenylate Nucleotides and 2,3-Biphosphoglycerate Concentration in Erythrocytes of Growing Wielkopolska Stallions

    OpenAIRE

    M. Suska; E. Skotnicka; W. Dudzińska; W. Orowicz; M. Brzezinska

    2006-01-01

    The aim of this study was to examine the relationships between the concentrations of adenylate nucleotides (ATP, ADP, AMP), total nucleotide pool (TAN), adenylate energy charge (AEC) and 2,3-biphosphoglycerate (2,3-BPG) in the erythrocytes of young horses in the period of their rapid growth and development. The studies were conducted on 10 young Wielkopolska breed stallions for two years; Group A: 1-month-old, Group B: 3-month-old, Group C: 6-month-old, Group D: 1-year-old, and Group E: 2-yea...

  2. NUCLEOTIDE COMPARISON OF GDF9 GENE IN INDIAN YAK AND GADDI GOAT: HIGH ALTITUDE LIVESTOCK ANIMALS

    Directory of Open Access Journals (Sweden)

    Lakshya Veer Singh

    2013-06-01

    Full Text Available The present study was undertaken to characterize exon 1 and exon 2 sequence of one of fecundity genes: GDF9 (Growth differentiation factor 9, in high altitude livestock animal (Yak and Gaddi goat. Six nucleotide differences were identified between sheep (AF078545 and goats (EF446168 in exon 1 and exon 2. Sequencing revealed nine novel single nucleotide mutations in exon 1 and exon 2 of Indian yak that compared with Bos taurus (GQ922451. These results preliminarily showed that the GDF9 gene might be a major gene that influences prolificacy of Gaddi goats and Indian yak.

  3. Hydrolytic and alcoholytic dephosphorylation of nucleotides by acid phosphatase in the presence of ethanol.

    Science.gov (United States)

    Tomaszewski, M; Buchowicz, J

    1971-08-01

    The effect of ethanol on the activity of acid phosphatase from wheat germ was studied, by using ribonucleoside monophosphates as the enzyme substrates. The nucleotides were effectively degraded to the corresponding nucleosides in the presence of ethanol at all concentrations tested, including a 96% (v/v) solution. However, the nucleotide dephosphorylation was accompanied by the liberation of orthophosphate only when the concentration of ethanol in the assay mixture did not exceed 15%. No inorganic phosphate was liberated when ethanol was present at higher concentrations. Instead, monoethyl phosphate was formed in quantities expected for orthophosphate. The results are explained in terms of phosphatase-catalysed alcoholysis.

  4. Detecting Single-Nucleotides by Tunneling Current Measurements at Sub-MHz Temporal Resolution.

    Science.gov (United States)

    Morikawa, Takanori; Yokota, Kazumichi; Tanimoto, Sachie; Tsutsui, Makusu; Taniguchi, Masateru

    2017-04-18

    Label-free detection of single-nucleotides was performed by fast tunneling current measurements in a polar solvent at 1 MHz sampling rate using SiO₂-protected Au nanoprobes. Short current spikes were observed, suggestive of trapping/detrapping of individual nucleotides between the nanoelectrodes. The fall and rise features of the electrical signatures indicated signal retardation by capacitance effects with a time constant of about 10 microseconds. The high temporal resolution revealed current fluctuations, reflecting the molecular conformation degrees of freedom in the electrode gap. The method presented in this work may enable direct characterizations of dynamic changes in single-molecule conformations in an electrode gap in liquid.

  5. Imaging systems for medical diagnostics

    International Nuclear Information System (INIS)

    Krestel, E.

    1990-01-01

    This book provides physicians and clinical physicists with detailed information on today's imaging modalities and assists them in selecting the optimal system for each clinical application. Physicists, engineers and computer specialists engaged in research and development and sales departments will also find this book to be of considerable use. It may also be employed at universities, training centers and in technical seminars. The physiological and physical fundamentals are explained in part 1. The technical solutions contained in part 2 illustrate the numerous possibilities available in X-ray diagnostics, computed tomography, nuclear medical diagnostics, magnetic resonance imaging, sonography and biomagnetic diagnostics. (orig.)

  6. [Diagnostic laparoscopy in acute abdomen].

    Science.gov (United States)

    Keller, R; Kleemann, M; Hildebrand, P; Roblick, U J; Bruch, H-P

    2006-11-01

    Acute abdomen is not a disease in itself but a description of a complex of symptoms combined with severe abdominal pain developed within a time frame of less than 24 h. All strategies for the management of acute abdomen underline the need for an interdisciplinary approach to diagnosis and therapy. This requires focused and intelligent use of efficient diagnostic procedures. Diagnostic laparoscopy may be a key to solving the diagnostic dilemma of unspecific acute abdomen. Furthermore, it allows not only direct inspection of the abdominal cavity but also surgical intervention, if needed. In particular the rate of negative laparotomies can be reduced.

  7. Screening diagnostic program breast cancer

    International Nuclear Information System (INIS)

    Portnoj, L.M.; Zhakova, I.I.; Budnikova, N.V.; Rukhlyadko, E.D.

    1995-01-01

    The authors propose their screening program for detection of breast cancer. It includes the entire complex of present-day screening diagnostic methods, starting from an original system for the formation of groups at risk of breast cancer and completed by the direct diagnostic model of detection of the condition, oriented at a differentiated approach to the use of mammographic techniques. The proposed organizational and methodologic screening measures are both economic and diagnostically effective, thus meeting the principal requirements to screening programs. Screening of 8541 risk-groups patients helped detect 867 nodular formations, 244 of which were cancer and 623 benign formations. 8 refs., 3 figs.,

  8. Mammary carcinoma diagnostics and therapy

    International Nuclear Information System (INIS)

    Fischer, Uwe; Baum, Friedemann

    2014-01-01

    The book on mammary carcinoma diagnostics and therapy covers the following issues: development, anatomy and physiology of the mammary glands, pathology of benign and malign mammary gland changes, non-imaging diagnostics; mammography; ultrasonic mammography; magnetic resonance tomography of the mammary glands; imaging diagnostics findings; mammary interventions; examination concepts; operative therapy of the mammary carcinoma; chemotherapy of the mammary carcinoma; radio-oncological therapy of the mammary carcinoma; logistics in a medical center for mammary gland diseases; logistics in an interdisciplinary center for mammary diseases; dialogue conduction and psycho-social attendance.

  9. Effect of the nucleotides surrounding the start codon on the translation of foot-and-mouth disease virus RNA.

    Science.gov (United States)

    Ma, X X; Feng, Y P; Gu, Y X; Zhou, J H; Ma, Z R

    2016-06-01

    As for the alternative AUGs in foot-and-mouth disease virus (FMDV), nucleotide bias of the context flanking the AUG(2nd) could be used as a strong signal to initiate translation. To determine the role of the specific nucleotide context, dicistronic reporter constructs were engineered to contain different versions of nucleotide context linking between internal ribosome entry site (IRES) and downstream gene. The results indicate that under FMDV IRES-dependent mechanism, the nucleotide contexts flanking start codon can influence the translation initiation efficiencies. The most optimal sequences for both start codons have proved to be UUU AUG(1st) AAC and AAG AUG(2nd) GAA.

  10. Diagnostics for the National Compact Stellarator Experiment

    International Nuclear Information System (INIS)

    Stratton, B.C.; Johnson, D.; Feder, R.; Fredrickson, E.; Neilson, H.; Takahashi, H.; Zarnstorf, M.; Cole, M.; Goranson, P.; Lazarus, E.; Nelson, B.

    2003-01-01

    The status of planning of the National Compact Stellarator Experiment (NCSX) diagnostics is presented, with the emphasis on resolution of diagnostics access issues and on diagnostics required for the early phases of operation

  11. Diagnostics of Gun Barrel Propellants

    National Research Council Canada - National Science Library

    Lederman, S

    1983-01-01

    A preliminary investigation of the applicability of the spontaneous Raman diagnostic technique to the determination of the temperature of the propellant gases in the vicinity of the muzzle of a 2Omm...

  12. Microfluidic technology for molecular diagnostics.

    Science.gov (United States)

    Robinson, Tom; Dittrich, Petra S

    2013-01-01

    Molecular diagnostics have helped to improve the lives of millions of patients worldwide by allowing clinicians to diagnose patients earlier as well as providing better ongoing therapies. Point-of-care (POC) testing can bring these laboratory-based techniques to the patient in a home setting or to remote settings in the developing world. However, despite substantial progress in the field, there still remain many challenges. Progress in molecular diagnostics has benefitted greatly from microfluidic technology. This chapter aims to summarise the more recent advances in microfluidic-based molecular diagnostics. Sections include an introduction to microfluidic technology, the challenges of molecular diagnostics, how microfluidic advances are working to solve these issues, some alternative design approaches, and detection within these systems.

  13. Thioaptamer Diagnostic System, Phase II

    Data.gov (United States)

    National Aeronautics and Space Administration — AM Biotechnologies (AM) in partnership with Sandia National Laboratories will develop a Thioaptamer Diagnostic System (TDS) in response to Topic X10.01 Reusable...

  14. Calibration issues for neutron diagnostics

    International Nuclear Information System (INIS)

    Sadler, G.J.; Adams, J.M.; Barnes, C.W.

    1997-10-01

    In order for ITER to meet its operational and programmatic goals, it will be necessary to measure a wide range of plasma parameters. Some of the required parameters e.g., neutron yield, fusion power and power density, ion temperature profile in the core plasma, and characteristics of confined and escaping alpha particle populations are best measured by fusion product diagnostic techniques. To make these measurements, ITER will have dedicated diagnostic systems, including radial and vertical neutron cameras, neutron and gamma ray spectrometers, internal and external fission chambers, a neutron activation system, and diagnostics for confined and escaping alpha particles. Engineering integration of many of these systems is in progress, and other systems are under investigation. This paper summarizes the present state of design of fusion product diagnostic systems for ITER and discusses expected measurement capability

  15. Environmental sensing and combustion diagnostics

    International Nuclear Information System (INIS)

    Santoleri, J.J.

    1991-01-01

    This book contains proceedings of Environmental Sensing and Combustion Diagnostics. Topics covered include: Incineration Systems Applications, Permitting, And Monitoring Overview; Infrared Techniques Applied to Incineration Systems; Continuous Emission Monitors; Analyzers and Sensors for Process Control And Environmental Monitoring

  16. The Downside of Diagnostic Imaging

    Science.gov (United States)

    An article about radiation exposure during computed tomography and nuclear imaging procedures and the risk of cancer. Several studies released in 2009 have helped to quantify the risk and the growing use of these diagnostic imaging methods.

  17. Saliva Preservative for Diagnostic Purposes

    Science.gov (United States)

    Pierson, Duane L.; Mehta, Satish K.

    2012-01-01

    Saliva is an important body fluid for diagnostic purposes. Glycoproteins, glucose, steroids, DNA, and other molecules of diagnostic value are found in saliva. It is easier to collect as compared to blood or urine. Unfortunately, saliva also contains large numbers of bacteria that can release enzymes, which can degrade proteins and nucleic acids. These degradative enzymes destroy or reduce saliva s diagnostic value. This innovation describes the formulation of a chemical preservative that prevents microbial growth and inactivates the degradative enzymes. This extends the time that saliva can be stored or transported without losing its diagnostic value. Multiple samples of saliva can be collected if needed without causing discomfort to the subject and it does not require any special facilities to handle after it is collected.

  18. Recent diagnostic developments on LHD

    International Nuclear Information System (INIS)

    Sudo, S; Ozaki, T; Ashikawa, N; Emoto, M; Goto, M; Hamada, Y; Ida, K; Ido, T; Iguchi, H; Inagaki, S; Isobe, M; Kawahata, K; Khlopenkov, K; Kobuchi, T; Liang, Y; Masuzaki, S; Minami, T; Morita, S; Muto, S; Nagayama, Y; Nakanishi, H; Narihara, K; Nishizawa, A; Ohdachi, S; Osakabe, M; Peterson, B J; Sakakibara, S; Sasao, M; Sato, K; Shoji, M; Tamura, N; Tanaka, K; Toi, K; Tokuzawa, T; Watanabe, K; Watanabe, T; Yamada, I; Goncharov, P; Ejiri, A; Okajima, S; Mase, A; Tsuji-Iio, S; Akiyama, T; Lyon, J F; Vyacheslavov, L N; Sanin, A

    2003-01-01

    The recent diagnostic developments on the large helical device (LHD) are described briefly. LHD is the largest helical machine with all superconducting coils, and its purpose is to prove the ability of a helical system to confine a fusion-relevant plasma in steady state. According to the missions of LHD research, the diagnostic devices are categorized as follows: diagnostics for (i) high nτ E T plasmas and transport physics; (ii) magnetohydrodynamic stability; (iii) long pulse operation and divertor function; and (iv) energetic particles. These are briefly described focusing on the recent developments of the devices. Since the LHD experiment started in March 1998, five series of experimental campaigns have been carried out. The LHD diagnostics during these periods were operated successfully, and contributed to the analysis of the experimental results

  19. Laser Diagnostics for Reacting Flows

    National Research Council Canada - National Science Library

    Hanson, Ronald K

    2007-01-01

    ... (UV) or infrared (IR) wavelengths. The cw lasers were spectrally narrow, allowing study of innovative diagnostics based on spectral lineshapes, while the pulsed lasers provided intense bursts of photons needed for techniques based on LIF...

  20. Gonad shielding in diagnostic radiology

    International Nuclear Information System (INIS)

    Anon.

    1975-01-01

    The use of gonad shielding is an important radiation protection technique, intended to reduce unnecessary x-ray exposure of the gonads of patients from diagnostic x-ray procedures. The types of gonad shields in use are discussed as are the types of diagnostic examinations that should include gonad shielding. It was found that when properly used, most shields provided substantial gonad dose reductions

  1. Novel uses of detonator diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, John R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Wilde, Zakary Robert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Tasker, Douglas George [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Francois, Elizabeth Green [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Nakamoto, Teagan Kanakanui Junichi [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Smith, Dalton Kay [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Trujillo, Christopher J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-09-15

    A novel combination of diagnostics is being used to research the physics of detonator initiation. The explosive PETN (Pentaerythritol tetranitrate) commonly used in detonators, is also a piezo-electric material that, when sufficiently shocked, emits an electromagnetic field in the radio frequency (RF) range, along crystal fracture planes. In an effort to capture this RF signal, a new diagnostic was created. A copper foil, used as an RF antenna, was wrapped around a foam fixture encompassing a PETN pellet. Rogowski coils were used to obtain the change in current with respect to time (di/dt) the detonator circuit, in and polyvinylidene difluoride (PVDF) stress sensors were used to capture shockwave arrival time. The goal of these experiments is to use these diagnostics to study the reaction response of a PETN pellet of known particle size to shock loading with various diagnostics including an antenna to capture RF emissions. Our hypothesis is that RF feedback may signify the rate of deflagration to detonation transition (DDT) or lack thereof. The new diagnostics and methods will be used to determine the timing of start of current, bridge burst, detonator breakout timing and RF generated from detonation. These data will be compared to those of currently used diagnostics in order to validate the accuracy of these new methods. Future experiments will incorporate other methods of validation including dynamic radiography, optical initiation and use of magnetic field sensors.

  2. Diagnostic criteria in MR neurography

    International Nuclear Information System (INIS)

    Baeumer, P.

    2017-01-01

    Peripheral neuropathies are frequent and can mostly be correctly diagnosed by clinical examination and electrophysiology; however, diagnostically difficult cases are sometimes encountered especially with respect to precise localization of nerve lesions. Imaging of the peripheral nervous system has been shown to provide additional useful diagnostic information. In addition to the more widely available nerve sonography, magnetic resonance neurography (MRN) is the method of choice in diagnostically complex cases. The most important pulse sequence is a T2-weighted fat-saturated pulse sequence with high in-plane resolution and detects increased T2-weighted signals of nerve fascicles as a highly sensitive sign for nerve lesions. Further established diagnostic criteria are nerve caliber and, less commonly used, contrast agent uptake. The spatial pattern of nerve lesions aids in the diagnostic classification of neuropathies. Functional imaging techniques, such as diffusion tensor imaging (DTI) and nerve perfusion are currently under examination with respect to the clinical potential. If all other diagnostic methods, including clinical examination, electrophysiology and nerve sonography do not arrive at an unambiguous diagnosis of a peripheral neuropathy, MRN should be used. The special value of MRN is demonstrated particularly in complex nerve lesions, such as traumatic plexopathies and in partial fascicular neuropathies and many other indications. (orig.) [de

  3. Diagnostic planning in JT-60 project

    International Nuclear Information System (INIS)

    Matoba, Tohru; Suzuki, Yasuo; Funahashi, Akimasa; Itagaki, Tokiyoshi

    1977-08-01

    The diagnostic plans of JT-60 were made along with design of the main machine. Basic requirements of the diagnostic program are (1) multiple measurement of respective plasma parameters, (2) efficient usage of the discharge, (3) capable data acquisition system, (4) high reliability of the diagnostic equipments, and (5) systematic development of new diagnostic techniques. Dimensions of the diagnostic ports were determined in detailed design of the vacuum vessel, anticipating the possible diagnostic methods. The proposed diagnostic systems and the plans are shown in table and figures respectively. Problems in the diagnostics are also described. (auth.)

  4. Nucleotide composition of the Zika virus RNA genome and its codon usage

    NARCIS (Netherlands)

    van Hemert, Formijn; Berkhout, Ben

    2016-01-01

    RNA viruses have genomes with a distinct nucleotide composition and codon usage. We present the global characteristics of the RNA genome of Zika virus (ZIKV), an emerging pathogen within the Flavivirus genus. ZIKV was first isolated in 1947 in Uganda, caused a widespread epidemic in South and

  5. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  6. Building the library of RNA 3D nucleotide conformations using the clustering approach

    Directory of Open Access Journals (Sweden)

    Zok Tomasz

    2015-09-01

    Full Text Available An increasing number of known RNA 3D structures contributes to the recognition of various RNA families and identification of their features. These tasks are based on an analysis of RNA conformations conducted at different levels of detail. On the other hand, the knowledge of native nucleotide conformations is crucial for structure prediction and understanding of RNA folding. However, this knowledge is stored in structural databases in a rather distributed form. Therefore, only automated methods for sampling the space of RNA structures can reveal plausible conformational representatives useful for further analysis. Here, we present a machine learning-based approach to inspect the dataset of RNA three-dimensional structures and to create a library of nucleotide conformers. A median neural gas algorithm is applied to cluster nucleotide structures upon their trigonometric description. The clustering procedure is two-stage: (i backbone- and (ii ribose-driven. We show the resulting library that contains RNA nucleotide representatives over the entire data, and we evaluate its quality by computing normal distribution measures and average RMSD between data points as well as the prototype within each cluster.

  7. Understanding specificity in metabolic pathways-Structural biology of human nucleotide metabolism

    International Nuclear Information System (INIS)

    Welin, Martin; Nordlund, Paer

    2010-01-01

    Interactions are the foundation of life at the molecular level. In the plethora of activities in the cell, the evolution of enzyme specificity requires the balancing of appropriate substrate affinity with a negative selection, in order to minimize interactions with other potential substrates in the cell. To understand the structural basis for enzyme specificity, the comparison of structural and biochemical data between enzymes within pathways using similar substrates and effectors is valuable. Nucleotide metabolism is one of the largest metabolic pathways in the human cell and is of outstanding therapeutic importance since it activates and catabolises nucleoside based anti-proliferative drugs and serves as a direct target for anti-proliferative drugs. In recent years the structural coverage of the enzymes involved in human nucleotide metabolism has been dramatically improved and is approaching completion. An important factor has been the contribution from the Structural Genomics Consortium (SGC) at Karolinska Institutet, which recently has solved 33 novel structures of enzymes and enzyme domains in human nucleotide metabolism pathways and homologs thereof. In this review we will discuss some of the principles for substrate specificity of enzymes in human nucleotide metabolism illustrated by a selected set of enzyme families where a detailed understanding of the structural determinants for specificity is now emerging.

  8. The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.

    Science.gov (United States)

    Hori, H; Osawa, S; Murao, K; Ishikura, H

    1980-01-01

    The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979

  9. Sirtuin 1 gene rs2273773 C >T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Background: Sirtuin-1 (SIRT-1), a protein has been found to protect the cells against oxidative stress due to its deacetylase activity. In this investigation, we aimed to study SIRT-1 gene rs2273773 C >T single nucleotide polymorphism and markers of serum protein oxidation (protein carbonyl and sulfhydryl groups) in ...

  10. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.; Dawe, Adam; Gehring, Christoph A; Berkowitz, Gerald A.

    2012-01-01

    , including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a

  11. 2′-O-methyl nucleotide modified DNA substrates influence the ...

    Indian Academy of Sciences (India)

    2014-07-18

    Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

  12. Twelve single nucleotide polymorphisms on chromosome 19q13.2-13.3

    DEFF Research Database (Denmark)

    Yin, Jiaoyang; Vogel, Ulla; Gerdes, Lars Ulrik

    2003-01-01

    The genetic susceptibility to basal cell carcinoma (BCC) among Danish psoriatic patients was investigated in association studies with 12 single nucleotide polymorphisms on chromosome 19q13.2-3. The results show a significant association between BCC and the A-allele of a polymorphism in ERCCI exon4...

  13. Factor 11 single-nucleotide variants in women with heavy menstrual bleeding

    NARCIS (Netherlands)

    Wiewel-Verschueren, Sophie; Mulder, Andre B.; Meijer, Karina; Mulder, Rene

    2017-01-01

    In a previous study it was shown that lower factor XI (FXI) levels in women with heavy menstrual bleeding (HMB). Our aim was to determine the single-nucleotide variants (SNVs) in the F11 gene in women with HMB. In addition, an extensive literature search was performed to determine the clinical

  14. Single nucleotide polymorphism discovery in bovine liver using RNA-seq technology

    DEFF Research Database (Denmark)

    Pareek, Chandra Shekhar; Błaszczyk, Paweł; Dziuba, Piotr

    2017-01-01

    Background RNA-seq is a useful next-generation sequencing (NGS) technology that has been widely used to understand mammalian transcriptome architecture and function. In this study, a breed-specific RNA-seq experiment was utilized to detect putative single nucleotide polymorphisms (SNPs) in liver...

  15. Infectious mononucleosis-linked HLA class I single nucleotide polymorphism is associated with multiple sclerosis.

    Science.gov (United States)

    Jafari, Naghmeh; Broer, Linda; Hoppenbrouwers, Ilse A; van Duijn, Cornelia M; Hintzen, Rogier Q

    2010-11-01

    Multiple sclerosis is a presumed autoimmune disease associated with genetic and environmental risk factors such as infectious mononucleosis. Recent research has shown infectious mononucleosis to be associated with a specific HLA class I polymorphism. Our aim was to test if the infectious mononucleosis-linked HLA class I single nucleotide polymorphism (rs6457110) is also associated with multiple sclerosis. Genotyping of the HLA-A single nucleotide polymorphism rs6457110 using TaqMan was performed in 591 multiple sclerosis cases and 600 controls. The association of multiple sclerosis with the HLA-A single nucleotide polymorphism was tested using logistic regression adjusted for age, sex and HLA-DRB1*1501. HLA-A minor allele (A) is associated with multiple sclerosis (OR = 0.68; p = 4.08 × 10( -5)). After stratification for HLA-DRB1*1501 risk allele (T) carrier we showed a significant OR of 0.70 (p = 0.003) for HLA-A. HLA class I single nucleotide polymorphism rs6457110 is associated with infectious mononucleosis and multiple sclerosis, independent of the major class II allele, supporting the hypothesis that shared genetics may contribute to the association between infectious mononucleosis and multiple sclerosis.

  16. Nucleotide Sequence and Characterization of the Broad-Host-Range Lactococcal Plasmid pWVO1

    NARCIS (Netherlands)

    Leenhouts, Cornelis; Tolner, Berend; Bron, Sierd; Kok, Jan; Venema, Gerhardus; Seegers, Jozef

    The nucleotide sequence of the Lactococcus lactis broad-host-range plasmid pWVO1, replicating in both gram-positive and gram-negative bacteria, was determined. This analysis revealed four open reading frames (ORFs). ORF A appeared to encode a trans-acting 26.8-kDa protein (RepA), necessary for

  17. Resampling nucleotide sequences with closest-neighbor trimming and its comparison to other methods.

    Directory of Open Access Journals (Sweden)

    Kouki Yonezawa

    Full Text Available A large number of nucleotide sequences of various pathogens are available in public databases. The growth of the datasets has resulted in an enormous increase in computational costs. Moreover, due to differences in surveillance activities, the number of sequences found in databases varies from one country to another and from year to year. Therefore, it is important to study resampling methods to reduce the sampling bias. A novel algorithm-called the closest-neighbor trimming method-that resamples a given number of sequences from a large nucleotide sequence dataset was proposed. The performance of the proposed algorithm was compared with other algorithms by using the nucleotide sequences of human H3N2 influenza viruses. We compared the closest-neighbor trimming method with the naive hierarchical clustering algorithm and [Formula: see text]-medoids clustering algorithm. Genetic information accumulated in public databases contains sampling bias. The closest-neighbor trimming method can thin out densely sampled sequences from a given dataset. Since nucleotide sequences are among the most widely used materials for life sciences, we anticipate that our algorithm to various datasets will result in reducing sampling bias.

  18. Pyridine nucleotides in regulation of cell death and survival by redox and non-redox reactions.

    Science.gov (United States)

    Novak Kujundžić, Renata; Žarković, Neven; Gall Trošelj, Koraljka

    2014-01-01

    Changes of the level and ratios of pyridine nucleotides determine metabolism- dependent cellular redox status and the activity of poly(ADP-ribose) polymerases (PARPs) and sirtuins, thereby influencing several processes closely related to cell survival and death. Pyridine nucleotides participate in numerous metabolic reactions whereby their net cellular level remains constant, but the ratios of NAD+/NADP+ and NADH/NADPH oscillate according to metabolic changes in response to diverse stress signals. In non-redox reactions, NAD+ is degraded and quickly, afterward, resynthesized in the NAD+ salvage pathway, unless overwhelming activation of PARP-1 consumes NAD+ to the point of no return, when the cell can no longer generate enough ATP to accommodate NAD+ resynthesis. The activity of PARP-1 is mandatory for the onset of cytoprotective autophagy on sublethal stress signals. It has become increasingly clear that redox status, largely influenced by the metabolism-dependent composition of the pyridine nucleotides pool, plays an important role in the synthesis of pro-apoptotic and anti-apoptotic sphingolipids. Awareness of the involvement of the prosurvival sphingolipid, sphingosine-1-phosphate, in transition from inflammation to malignant transformation has recently emerged. Here, the participation of pyridine nucleotides in redox and non-redox reactions, sphingolipid metabolism, and their role in cell fate decisions is reviewed.

  19. SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

    DEFF Research Database (Denmark)

    Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin

    2015-01-01

    XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

  20. Grinding up Wheat: a Massive Loss of Nucleotide Diversity Since Domestication

    DEFF Research Database (Denmark)

    Haudry, Anabelle; Cenci, Alberto; Ravel, Catherine

    2007-01-01

    Several demographic and selective events occurred during the domestication of wheat from the allotetraploid wild emmer (Triticum turgidum ssp. dicoccoides). Cultivated wheat has since been affected by other historical events. We analyzed nucleotide diversity at 21 loci in a sample of 101 individu...

  1. A fluorimetric readout reporting the kinetics of nucleotide-induced human ribonucleotide reductase oligomerization.

    Science.gov (United States)

    Fu, Yuan; Lin, Hongyu; Wisitpitthaya, Somsinee; Blessing, William A; Aye, Yimon

    2014-11-24

    Human ribonucleotide reductase (hRNR) is a target of nucleotide chemotherapeutics in clinical use. The nucleotide-induced oligomeric regulation of hRNR subunit α is increasingly being recognized as an innate and drug-relevant mechanism for enzyme activity modulation. In the presence of negative feedback inhibitor dATP and leukemia drug clofarabine nucleotides, hRNR-α assembles into catalytically inert hexameric complexes, whereas nucleotide effectors that govern substrate specificity typically trigger α-dimerization. Currently, both knowledge of and tools to interrogate the oligomeric assembly pathway of RNR in any species in real time are lacking. We therefore developed a fluorimetric assay that reliably reports on oligomeric state changes of α with high sensitivity. The oligomerization-directed fluorescence quenching of hRNR-α, covalently labeled with two fluorophores, allows for direct readout of hRNR dimeric and hexameric states. We applied the newly developed platform to reveal the timescales of α self-assembly, driven by the feedback regulator dATP. This information is currently unavailable, despite the pharmaceutical relevance of hRNR oligomeric regulation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    International Nuclear Information System (INIS)

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.

    1988-01-01

    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity [ 3 H]fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity [ 3 H]fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils

  3. Development and characterization of 35 single nucleotide polymorphism markers for the brown alga Fucus vesiculosus

    NARCIS (Netherlands)

    Canovas, Fernando; Mota, Catarina; Ferreira-Costa, Joana; Serrao, Ester; Coyer, Jim; Olsen, Jeanine; Pearson, Gareth

    2011-01-01

    We characterized 35 single nucleotide polymorphism (SNP) markers for the brown alga Fucus vesiculosus. Based on existing Fucus Expressed Sequence Tag libraries for heat and desiccation-stressed tissue, SNPs were developed and confirmed by re-sequencing cDNA from a diverse panel of individuals. SNP

  4. Targeted Metabolic Engineering Guided by Computational Analysis of Single-Nucleotide Polymorphisms (SNPs)

    DEFF Research Database (Denmark)

    Udatha, D B R K Gupta; Rasmussen, Simon; Sicheritz-Pontén, Thomas

    2013-01-01

    The non-synonymous SNPs, the so-called non-silent SNPs, which are single-nucleotide variations in the coding regions that give "birth" to amino acid mutations, are often involved in the modulation of protein function. Understanding the effect of individual amino acid mutations on a protein...

  5. Association between nucleotide mutation of eNOS gene and serum ...

    African Journals Online (AJOL)

    Various mutation on endothelial nitric oxide synthase (eNOs) gene cause reduced production of NO, the expansion factor (VEF) and may accelerate the process of atherosclerosis. The study was designed to investigate the frequency of T-786C polymorphism of the gene or nucleotide mutation of eNOS gene in patients ...

  6. Slow spontaneous [Ca2+]i oscillations reflect nucleotide release from renal epithelia

    DEFF Research Database (Denmark)

    Geyti, Christine Stride; Odgaard, Elvin V. P.; Overgaard, Morten Thaarup

    2008-01-01

    Renal epithelia can be provoked mechanically to release nucleotides, which subsequently increases the intracellular Ca(2+) concentration [Ca(2+)](i) through activation of purinergic (P2) receptors. Cultured cells often show spontaneous [Ca(2+)](i) oscillations, a feature suggested to involve nucl...

  7. Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

    Energy Technology Data Exchange (ETDEWEB)

    Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica

    2013-12-01

    Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

  8. Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

    NARCIS (Netherlands)

    Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

    2007-01-01

    Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

  9. Determination of the Nucleic Acid Adducts Structure at the Nucleoside/Nucleotide Level by NMR Spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Dračínský, Martin; Pohl, Radek

    2015-01-01

    Roč. 28, č. 2 (2015), s. 155-165 ISSN 0893-228X R&D Projects: GA ČR GA13-24880S Institutional support: RVO:61388963 Keywords : NMR spectroscopy * nucleic acids * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.025, year: 2015

  10. Lupus-related single nucleotide polymorphisms and risk of diffuse large B-cell lymphoma

    NARCIS (Netherlands)

    Bernatsky, Sasha; Velásquez García, Héctor A; Spinelli, John; Gaffney, Patrick; Smedby, Karin E; Ramsey-Goldman, Rosalind; Wang, Sophia S.; Adami, Hans-Olov; Albanes, Demetrius; Angelucci, Emanuele; Ansell, Stephen M.; Asmann, Yan W.; Becker, Nikolaus; Benavente, Yolanda; Berndt, Sonja I.; Bertrand, Kimberly A.; Birmann, Brenda M.; Boeing, Heiner; Boffetta, Paolo; Bracci, Paige M.; Brennan, Paul; Brooks-Wilson, Angela R.; Cerhan, James R.; Chanock, Stephen J.; Clavel, Jacqueline; Conde, Lucia; Cotenbader, Karen H; Cox, David G; Cozen, Wendy; Crouch, Simon; De Roos, Anneclaire J.; De Sanjose, Silvia; Di Lollo, Simonetta; Diver, W. Ryan; Dogan, Ahmet; Foretova, Lenka; Ghesquières, Hervé; Giles, Graham G.; Glimelius, Bengt; Habermann, Thomas M.; Haioun, Corinne; Hartge, Patricia; Hjalgrim, Henrik; Holford, Theodore R.; Holly, Elizabeth A.; Jackson, Rebecca D.; Kaaks, Rudolph; Kane, Eleanor; Kelly, Rachel S.; Klein, Robert J.; Kraft, Peter; Kricker, Anne; Lan, Qing; Lawrence, Charles; Liebow, Mark; Lightfoot, Tracy; Link, Brian K.; Maynadie, Marc; McKay, James; Melbye, Mads; Molina, Thierry Jo; Monnereau, Alain; Morton, Lindsay M.; Nieters, Alexandra; North, Kari E.; Novak, Anne J.; Offit, Kenneth; Purdue, Mark P.; Rais, Marco; Riby, Jacques; Roman, Eve; Rothman, Nathaniel; Salles, Gilles; Severi, Gianluca; Severson, Richard K.; Skibola, Christine F.; Slager, Susan L.; Smith, Alex; Smith, Martyn T.; Southey, Melissa C.; Staines, Anthony; Teras, Lauren R.; Thompson, Carrie A.; Tilly, Hervé; Tinker, Lesley F.; Tjonneland, Anne; Turner, Jenny; Vajdic, Claire M.; Vermeulen, Roel C H; Vijai, Joseph; Vineis, Paolo; Virtamo, Jarmo; Wang, Zhaoming; Weinstein, Stephanie; Witzig, Thomas E.; Zelenetz, Andrew; Zeleniuch-Jacquotte, Anne; Zhang, Yawei; Zheng, Tongzhang; Zucca, Mariagrazia; Clarke, Ann E

    2017-01-01

    Objective: Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.

  11. Synthesis of Benzene and Pyridine 2-C-Methyl-C-ribonucleosides and -nucleotides

    Czech Academy of Sciences Publication Activity Database

    Tokarenko, Anna; Poštová Slavětínská, Lenka; Klepetářová, Blanka; Hocek, Michal

    2015-01-01

    Roč. 2015, č. 36 (2015), s. 7962-7983 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * glycosides * antiviral agents * cross - coupling Subject RIV: CC - Organic Chemistry Impact factor: 3.068, year: 2015

  12. Synthesis of Substituted Benzyl Homo-C-Ribonucleosides and -Nucleotides as Carba-Analogues of Phosphoribosylanthranilate

    Czech Academy of Sciences Publication Activity Database

    Kubelka, Tomáš; Slavětínská, Lenka; Hocek, Michal

    -, č. 26 (2012), s. 4969-4981 ISSN 1434-193X R&D Projects: GA ČR GAP207/11/0344; GA AV ČR IAA400550902 Institutional support: RVO:61388963 Keywords : C-nucleosides * homonucleosides * cross - coupling * nucleotides Subject RIV: CC - Organic Chemistry Impact factor: 3.344, year: 2012

  13. Adsorption of nucleotides onto Fe-Mg-Al rich swelling clays

    Science.gov (United States)

    Feuillie, Cécile; Daniel, Isabelle; Michot, Laurent J.; Pedreira-Segade, Ulysse

    2013-11-01

    Mineral surfaces may have played a role in the origin of the first biopolymers, by concentrating organic monomers from a dilute ocean. Swelling clays provide a high surface area for the concentration of prebiotic monomers, and have therefore been the subject of numerous investigations. In that context, montmorillonite, the most abundant swelling clay in modern environments, has been extensively studied with regard to adsorption and polymerization of nucleic acids. However, montmorillonite was probably rather marginal on the primitive ocean floor compared to iron-magnesium rich phyllosilicates such as nontronite that results from the hydrothermal alteration of a mafic or ultramafic oceanic crust. In the present paper, we study the adsorption of nucleotides on montmorillonite and nontronite, at various pH and ionic strength conditions plausible for Archean sea-water. A thorough characterization of the mineral surfaces shows that nucleotide adsorb mainly on the edge faces of the smectites by ligand exchange between the phosphate groups of the nucleotides and the -OH groups from the edge sites over a wide pH range (4-10). Nontronite is more reactive than montmorillonite. At low pH, additional ion exchange may play a role as the nucleotides become positively charged.

  14. Transmembrane Domain Single-Nucleotide Polymorphisms Impair Expression and Transport Activity of ABC Transporter ABCG2

    NARCIS (Netherlands)

    Sjostedt, N.; Heuvel, J.J.M.W. van den; Koenderink, J.B.; Kidron, H.

    2017-01-01

    PURPOSE: To study the function and expression of nine naturally occurring single-nucleotide polymorphisms (G406R, F431L, S441N, P480L, F489L, M515R, L525R, A528T and T542A) that are predicted to reside in the transmembrane regions of the ABC transporter ABCG2. METHODS: The transport activity of the

  15. Typing of canine parvovirus isolates using mini-sequencing based single nucleotide polymorphism analysis.

    Science.gov (United States)

    Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A

    2012-05-01

    The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Oligodeoxynucleotides containing 2'-amino-LNA nucleotides as constrained morpholino phosphoramidate and phosphorodiamidate monomers

    DEFF Research Database (Denmark)

    Kristensen, Kim Vejlegaard; Paul, Sibasish; Kosbar, Tamer

    2017-01-01

    Incorporation in a 2'→5' direction of a phosphorodiamidite 2'-amino-LNA-T nucleotide as the morpholino phosphoramidate and N,N-dimethylamino phosphorodiamidate monomers into six oligonucleotides is reported. Thermal denaturation studies showed that the novel 2'-amino-LNA-based morpholino monomers...

  17. Dietary nucleotide supplementation raises erythrocyte 2, 3-diphosphoglycerate concentration in neonatal rats.

    Science.gov (United States)

    Scopesi, F; Verkeste, C M; Paola, D; Gazzolo, D; Pronzato, M A; Bruschettini, P L; Marinari, U M

    1999-03-01

    The present study was designed to test if dietary intake of nucleotides increases erythrocyte 2,3-diphosphoglycerate (2,3-DPG) in neonatal rats. To this end, rat pups were fed a nucleotide-supplemented formula (S, n = 14) from d 9 until d 16 after birth. The results were compared with those obtained from a group of breast-fed pups (C, n = 14) and a group of pups artificially fed with nucleotide-free formula (NS, n = 14). Neonatal weight, 2,3-DPG concentration, hematocrit (Hct) and hemoglobin concentration (Hb) were determined before the experiment (d 9) and after 7 d of treatment (d 16). In all groups, 2,3-DPG concentration was greater at d 16 than d 9, and the increase was greater in the S group than in the NS group. Alterations in neonatal weight, Hct and Hb concentration did not differ among the groups. On d 16 the 2, 3-DPG/Hb ratio, reflecting the affinity of hemoglobin for oxygen, was significantly higher in the C and S groups than in the NS group. We conclude that in neonatal rats, dietary nucleotides increase erythrocyte 2,3-DPG concentration. Studies need to be conducted in humans to assess the effect of this increase on both neonatal peripheral hemodynamics and metabolism in this species.

  18. Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

    Czech Academy of Sciences Publication Activity Database

    Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal

    2012-01-01

    Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

  19. Single-nucleotide polymorphism of INS, INSR, IRS1, IRS2, PPAR-G ...

    Indian Academy of Sciences (India)

    2017-03-02

    Mar 2, 2017 ... Abstract. Polycystic ovary syndrome (PCOS) is the most common and a complex female endocrine disorder, and is one of the leading cause of female infertility. Here, we aimed to investigate the association of single-nucleotide polymorphism of INS, INSR,. IRS1, IRS2, PPAR-G and CAPN10 gene in the ...

  20. On the biased nucleotide composition of the human coronavirus RNA genome

    NARCIS (Netherlands)

    Berkhout, Ben; van Hemert, Formijn

    2015-01-01

    We investigated the nucleotide composition of the RNA genome of the six human coronaviruses. Some general coronavirus characteristics were apparent (e.g. high U, low C count), but we also detected species-specific signatures. Most strikingly, the high U and low C proportions are quite variable and

  1. Enhanced activity of the purine nucleotide cycle of the exercising muscle in patients with hyperthyroidism.

    Science.gov (United States)

    Fukui, H; Taniguchi , S; Ueta, Y; Yoshida, A; Ohtahara, A; Hisatome, I; Shigemasa, C

    2001-05-01

    Myopathy frequently develops in patients with hyperthyroidism, but its precise mechanism is not clearly understood. In this study we focused on the purine nucleotide cycle, which contributes to ATP balance in skeletal muscles. To investigate purine metabolism in muscles, we measured metabolites related to the purine nucleotide cycle using the semiischemic forearm test. We examined the following four groups: patients with untreated thyrotoxic Graves' disease (untreated group), patients with Graves' disease treated with methimazole (treated group), patients in remission (remission group), and healthy volunteers (control group). To trace the glycolytic process, we measured glycolytic metabolites (lactate and pyruvate) as well as purine metabolites (ammonia and hypoxanthine). In the untreated group, the levels of lactate, pyruvate, and ammonia released were remarkably higher than those in the control group. Hypoxanthine release also increased in the untreated group, but the difference among the patient groups was not statistically significant. The accelerated purine catabolism did not improve after 3 months of treatment with methimazole, but it was completely normalized in the remission group. This indicated that long-term maintenance of thyroid function was necessary for purine catabolism to recover. We presume that an unbalanced ATP supply or conversion of muscle fiber type may account for the acceleration of the purine nucleotide cycle under thyrotoxicosis. Such acceleration of the purine nucleotide cycle is thought to be in part a protective mechanism against a rapid collapse of the ATP energy balance in exercising muscles of patients with hyperthyroidism.

  2. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    International Nuclear Information System (INIS)

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.

    1987-01-01

    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced 125 I-[Tyr 1 ]somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate [Gpp(NH)p]>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg 2+ . When pancreatic acini were treated with 1 μg/ml pertussis toxin for 4 h, subsequent 125 I-[Tyr 1 ]somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor

  3. Dynamic interaction of TTDA with TFIIH is stabilized by nucleotide excision repair in living cells.

    NARCIS (Netherlands)

    G. Giglia-Mari (Giuseppina); C. Miquel (Catherine); A.F. Theil (Arjan); P.O. Mari (Pierre-Olivier); D. Hoogstraten (Deborah); J.M.Y. Ng (Jessica); C. Dinant (Christoffel); J.H.J. Hoeijmakers (Jan); W. Vermeulen (Wim)

    2006-01-01

    textabstractTranscription/repair factor IIH (TFIIH) is essential for RNA polymerase II transcription and nucleotide excision repair (NER). This multi-subunit complex consists of ten polypeptides, including the recently identified small 8-kDa trichothiodystrophy group A (TTDA)/ hTFB5 protein.

  4. Nucleotide variation in ATHK1 region of Arabidopsis thaliana and its ...

    African Journals Online (AJOL)

    The ATHK1 gene in Arabidopsis encodes a putative histidine kinase that is transcriptionally upregulated in response to changes in external osmolarity. In this work, we investigated the nucleotide variability of the ATHK1 gene in a sample of 32 core Arabidopsis accessions originating from different ecoclimatic regions and ...

  5. The binding of glucose and nucleotides to hexokinase from Saccharomyces cerevisiae.

    Science.gov (United States)

    Woolfitt, A R; Kellett, G L; Hoggett, J G

    1988-01-29

    The binding of glucose, ADP and AdoPP[NH]P, to the native PII dimer and PII monomer and the proteolytically-modified SII monomer of hexokinase (ATP:D-hexose 6-phosphotransferase, EC 2.7.1.1) from Saccharomyces cerevisiae was monitored at pH 6.7 by the concomitant quenching of protein fluorescence. The data were analysed in terms of Qmax, the maximal quenching of fluorescence at saturating concentrations of ligand, and [L]0.5, the concentration of ligand at half-maximal quenching. No changes in fluorescence were observed with free enzyme and nucleotide alone. In the presence of saturating levels of glucose, Qmax induced by nucleotide was between 2 and 7%, and [L]0.5 was between 0.12 and 0.56 mM, depending on the nucleotide and enzyme species. Qmax induced by glucose alone was between 22 and 25%, while [L]0.5 was approx. 0.4 mM for either of the monomeric hexokinase forms and 3.4 for PII dimer. In the presence of 6 mM ADP or 2 mM AdoPP[NH]P, Qmax for glucose was increased by up to 4% and [L]0.5 was diminished 3-fold for hexokinase PII monomer, 6-fold for SII monomer, and 15-fold for PII dimer. The results are interpreted in terms of nucleotide-induced conformational change of hexokinase in the presence of glucose and synergistic binding interactions between glucose and nucleotide.

  6. Ras conformational switching: simulating nucleotide-dependent conformational transitions with accelerated molecular dynamics.

    Directory of Open Access Journals (Sweden)

    Barry J Grant

    2009-03-01

    Full Text Available Ras mediates signaling pathways controlling cell proliferation and development by cycling between GTP- and GDP-bound active and inactive conformational states. Understanding the complete reaction path of this conformational change and its intermediary structures is critical to understanding Ras signaling. We characterize nucleotide-dependent conformational transition using multiple-barrier-crossing accelerated molecular dynamics (aMD simulations. These transitions, achieved for the first time for wild-type Ras, are impossible to observe with classical molecular dynamics (cMD simulations due to the large energetic barrier between end states. Mapping the reaction path onto a conformer plot describing the distribution of the crystallographic structures enabled identification of highly populated intermediate structures. These structures have unique switch orientations (residues 25-40 and 57-75 intermediate between GTP and GDP states, or distinct loop3 (46-49, loop7 (105-110, and alpha5 C-terminus (159-166 conformations distal from the nucleotide-binding site. In addition, these barrier-crossing trajectories predict novel nucleotide-dependent correlated motions, including correlations of alpha2 (residues 66-74 with alpha3-loop7 (93-110, loop2 (26-37 with loop10 (145-151, and loop3 (46-49 with alpha5 (152-167. The interconversion between newly identified Ras conformations revealed by this study advances our mechanistic understanding of Ras function. In addition, the pattern of correlated motions provides new evidence for a dynamic linkage between the nucleotide-binding site and the membrane interacting C-terminus critical for the signaling function of Ras. Furthermore, normal mode analysis indicates that the dominant collective motion that occurs during nucleotide-dependent conformational exchange, and captured in aMD (but absent in cMD simulations, is a low-frequency motion intrinsic to the structure.

  7. Far infrared fusion plasma diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Luhmann, N.C. Jr.; Peebles, W.A.

    1990-01-01

    Over the last several years, reflectometry has grown in importance as a diagnostic for both steady-state density Profiles as well as for the investigation of density fluctuations and turbulence. As a diagnostic for density profile measurement, it is generally believed to be well understood in the tokamak environment. However, its use as a fluctuation diagnostic is hampered by a lack of quantitative experimental understanding of its wavenumber sensitivity and spatial resolution. Several researchers, have theoretically investigated these questions. However, prior to the UCLA laboratory investigation, no group has experimentally investigated these questions. Because of the reflectometer's importance to the world effort in understanding plasma turbulence and transport, UCLA has, over the last year, made its primary Task IIIA effort the resolution of these questions. UCLA has taken the lead in a quantitative experimental understanding of reflectometer data as applied to the measurement of density fluctuations. In addition to this, work has proceeded on the design, construction, and installation of a reflectometer system on UCLA's CCT tokamak. This effort will allow a comparison between the improved confinement regimes (H-mode) observed on both the DIII-D and CCT machines with the goal of achieving a physics understanding of the phenomena. Preliminary investigation of a new diagnostic technique to measure density profiles as a function of time has been initiated at UCLA. The technique promises to be a valuable addition to the range of available plasma diagnostics. Work on advanced holographic reflectometry technique as applied to fluctuation diagnostics has awaited a better understanding of the reflectometer signal itself as discussed above. Efforts to ensure the transfer of the diagnostic developments have continued with particular attention devoted to the preliminary design of a multichannel FIR interferometer for MST.

  8. Nucleotide variation in Sabin type 3 poliovirus from an Albanian infant with agammaglobulinemia and vaccine associated poliomyelitis.

    Science.gov (United States)

    Foiadelli, Thomas; Savasta, Salvatore; Battistone, Andrea; Kota, Majlinda; Passera, Carolina; Fiore, Stefano; Bino, Silvia; Amato, Concetta; Lozza, Alessandro; Marseglia, Gian Luigi; Fiore, Lucia

    2016-06-10

    Vaccine-associated paralytic poliomyelitis (VAPP) and immunodeficient long-term polio excretors constitute a significant public health burden and are a major concern for the WHO global polio eradication endgame. Poliovirus type 3 characterized as Sabin-like was isolated from a 5-month-old Albanian child with X-linked agammaglobulinemia and VAPP after oral polio vaccine administration. Diagnostic workup and treatment were performed in Italy. Poliovirus replicated in the gut for 7 months. The 5' non coding region (NCR), VP1, VP3 capsid proteins and the 3D polymerase genomic regions of sequential isolates were sequenced. Increasing accumulation of nucleotide mutations in the VP1 region was detected over time, reaching 1.0 % of genome variation with respect to the Sabin reference strain, which is the threshold that defines a vaccine-derived poliovirus (VDPV). We identified mutations in the 5'NCR and VP3 regions that are associated with reversion to neurovirulence. Despite this, all isolates were characterized as Sabin-like. Several amino acid mutations were identified in the VP1 region, probably involved in growth adaptation and viral persistence in the human gut. Intertypic recombination with Sabin type 2 polio in the 3D polymerase region, possibly associated with increased virus transmissibility, was found in all isolates. Gamma-globulin replacement therapy led to viral clearance and neurological improvement, preventing the occurrence of persistent immunodeficiency-related VDPV. This is the first case of VAPP in an immunodeficient child detected in Albania through the Acute Flaccid Paralysis surveillance system and the first investigated case of vaccine associated poliomyelitis in Italy since the introduction of an all-Salk schedule in 2002. We discuss over the biological and clinical implications in the context of the Global Polio Eradication Program and emphasize on the importance of the Acute Flaccid Paralysis surveillance.

  9. DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob

    2010-01-01

    To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...

  10. Simulation of the coupling between nucleotide binding and transmembrane domains in the ABC transporter BtuCD

    DEFF Research Database (Denmark)

    Sonne, Jacob; Kandt, C.; Peters, Günther H.j.

    2007-01-01

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B12 importer BtuCD using perturbed elastic network calculations and biased molecular...

  11. Genome-wide divergence and linkage disequilibrium analyses for Capsicum baccatum revealed by genome-anchored single nucleotide polymorphisms

    Science.gov (United States)

    Principal component analysis (PCA) with 36,621 polymorphic genome-anchored single nucleotide polymorphisms (SNPs) identified collectively for Capsicum annuum and Capsicum baccatum was used to show the distribution of these 2 important incompatible cultivated pepper species. Estimated mean nucleotide...

  12. Mobile diagnostics: next-generation technologies for in vitro diagnostics.

    Science.gov (United States)

    Shin, Joonchul; Chakravarty, Sudesna; Choi, Wooseok; Lee, Kyungyeon; Han, Dongsik; Hwang, Hyundoo; Choi, Jaekyu; Jung, Hyo-Il

    2018-03-26

    The emergence of a wide range of applications of smartphones along with advances in 'liquid biopsy' has significantly propelled medical research particularly in the field of in vitro diagnostics (IVD). Herein, we have presented a detailed analysis of IVD, its associated critical concerns and probable solutions. It also demonstrates the transition in terms of analytes from minimally invasive (blood) to non-invasive (urine, saliva and sweat) and depicts how the different features of a smartphone can be integrated for specific diagnostic purposes. This review basically highlights recent advances in the applications of smartphone-based biosensors in IVD taking into account the following factors: accuracy and portability; quantitative and qualitative analysis; and centralization and decentralization tests. Furthermore, the critical concerns and future direction of diagnostics based on smartphones are also discussed.

  13. Diseases and Molecular Diagnostics: A Step Closer to Precision Medicine.

    Science.gov (United States)

    Dwivedi, Shailendra; Purohit, Purvi; Misra, Radhieka; Pareek, Puneet; Goel, Apul; Khattri, Sanjay; Pant, Kamlesh Kumar; Misra, Sanjeev; Sharma, Praveen

    2017-10-01

    The current advent of molecular technologies together with a multidisciplinary interplay of several fields led to the development of genomics, which concentrates on the detection of pathogenic events at the genome level. The structural and functional genomics approaches have now pinpointed the technical challenge in the exploration of disease-related genes and the recognition of their structural alterations or elucidation of gene function. Various promising technologies and diagnostic applications of structural genomics are currently preparing a large database of disease-genes, genetic alterations etc., by mutation scanning and DNA chip technology. Further the functional genomics also exploring the expression genetics (hybridization-, PCR- and sequence-based technologies), two-hybrid technology, next generation sequencing with Bioinformatics and computational biology. Advances in microarray "chip" technology as microarrays have allowed the parallel analysis of gene expression patterns of thousands of genes simultaneously. Sequence information collected from the genomes of many individuals is leading to the rapid discovery of single nucleotide polymorphisms or SNPs. Further advances of genetic engineering have also revolutionized immunoassay biotechnology via engineering of antibody-encoding genes and the phage display technology. The Biotechnology plays an important role in the development of diagnostic assays in response to an outbreak or critical disease response need. However, there is also need to pinpoint various obstacles and issues related to the commercialization and widespread dispersal of genetic knowledge derived from the exploitation of the biotechnology industry and the development and marketing of diagnostic services. Implementation of genetic criteria for patient selection and individual assessment of the risks and benefits of treatment emerges as a major challenge to the pharmaceutical industry. Thus this field is revolutionizing current era and

  14. Diagnostic challenges of childhood asthma.

    Science.gov (United States)

    Bakirtas, Arzu

    2017-01-01

    Diagnosis of asthma in childhood is challenging. Both underdiagnosis and overdiagnosis of asthma are important issues. The present review gives information about challenging factors for an accurate diagnosis of childhood asthma. Although underdiagnosis of asthma in childhood has always been the most important diagnostic problem, overdiagnosis of asthma has also been increasingly recognized. This is probably due to diagnosis of asthma based on symptoms and signs alone. Demonstration of variable airflow obstruction by lung function tests is the most common asthma diagnostic tests used in practice and is therefore strongly recommended in children who can cooperate. Recently, an asthma guideline combining the clinical and economic evidences with sensitivity and specificity of diagnostic procedures was developed to improve accuracy of diagnosis and to avoid overdiagnosis. This guideline provided an algorithmic clinical and cost-effective approach and included fractional exhaled nitric oxide measurement as one of the diagnostic tests in addition to lung function. Diagnosis of asthma in children should be made by combining relevant history with at least two confirmatory diagnostic tests whenever possible. Diagnosis based on short-period treatment trials should be limited to young children who are unable to cooperate with these tests.

  15. Diagnostics in Japan's microgravity experiments

    Science.gov (United States)

    Kadota, Toshikazu

    1995-01-01

    The achievement of the combustion research under microgravity depends substantially on the availability of diagnostic systems. The non-intrusive diagnostic systems are potentially applicable for providing the accurate, realistic and detailed information on momentum, mass and energy transport, complex gas phase chemistry, and phase change in the combustion field under microgravity. The non-intrusive nature of optical instruments is essential to the measurement of combustion process under microgravity which is very nervous to any perturbation. However, the implementation of the non-intrusive combustion diagnostic systems under microgravity is accompanied by several constraints. Usually, a very limited space is only available for constructing a highly sophisticated system which is so sensitive that it is easily affected by the magnitude of the gravitational force, vibration and heterogeneous field of temperature and density of the environments. The system should be properly adjusted prior to the experiment. Generally, it is quite difficult to tune the instruments during measurements. The programmed sequence of operation should also be provided. Extensive effort has been toward the development of non-intrusive diagnostic systems available for the combustion experiments under microgravity. This paper aims to describe the current art and the future strategy on the non-intrusive diagnostic systems potentially applicable to the combustion experiments under microgravity in Japan.

  16. Diagnostics for the ATA beam propagation experiments

    International Nuclear Information System (INIS)

    Fessenden, T.J.; Atchison, W.L.; Barletta, W.A.

    1981-11-01

    This report contains a discussion of the diagnostics required for the beam propagation experiment to be done with the ATA accelerator. Included are a list of the diagnostics needed; a description of the ATA experimental environment; the status of beam diagnostics available at Livermore including recent developments, and a prioritized list of accelerator and propagation diagnostics under consideration or in various stages of development

  17. Nucleotide variability and linkage disequilibrium patterns in the porcine MUC4 gene

    Directory of Open Access Journals (Sweden)

    Yang Ming

    2012-07-01

    Full Text Available Abstract Background MUC4 is a type of membrane anchored glycoprotein and serves as the major constituent of mucus that covers epithelial surfaces of many tissues such as trachea, colon and cervix. MUC4 plays important roles in the lubrication and protection of the surface epithelium, cell proliferation and differentiation, immune response, cell adhesion and cancer development. To gain insights into the evolution of the porcine MUC4 gene, we surveyed the nucleotide variability and linkage disequilibrium (LD within this gene in Chinese indigenous breeds and Western commercial breeds. Results A total of 53 SNPs covering the MUC4 gene were genotyped on 5 wild boars and 307 domestic pigs representing 11 Chinese breeds and 3 Western breeds. The nucleotide variability, haplotype phylogeny and LD extent of MUC4 were analyzed in these breeds. Both Chinese and Western breeds had considerable nucleotide diversity at the MUC4 locus. Western pig breeds like Duroc and Large White have comparable nucleotide diversity as many of Chinese breeds, thus artificial selection for lean pork production have not reduced the genetic variability of MUC4 in Western commercial breeds. Haplotype phylogeny analyses indicated that MUC4 had evolved divergently in Chinese and Western pigs. The dendrogram of genetic differentiation between breeds generally reflected demographic history and geographical distribution of these breeds. LD patterns were unexpectedly similar between Chinese and Western breeds, in which LD usually extended less than 20 kb. This is different from the presumed high LD extent (more than 100 kb in Western commercial breeds. The significant positive Tajima’D, and Fu and Li’s D statistics in a few Chinese and Western breeds implied that MUC4 might undergo balancing selection in domestic breeds. Nevertheless, we cautioned that the significant statistics could be upward biased by SNP ascertainment process. Conclusions Chinese and Western breeds have

  18. Potential hazards of diagnostic radiation

    Energy Technology Data Exchange (ETDEWEB)

    Houston, C S; Shokeir, M H

    1977-03-01

    There are no precise data for determining the extent of somatic damage from small doses of radiation used in diagnostic radiology. Diagnostic radiation given to pregnant women, knowingly or unknowingly, should rarely reach teratogenic levels causing brain and eye abnormalities. Evidence suggests that it does increase the risk of childhood malignancy, especially leukemia. Although rapidly growing tissues seem most susceptible, all radiation probably carries a very small risk of carcinogenesis. Genetic damage is equally difficult to estimate. Diagnostic radiation of females, even in childhood, may be related to an increased incidence of Down's syndrome in older mothers. Radiation also causes point mutations, which may explain the increase of some genetic abnormalities in progeny of older fathers. Whenever an abdominal or pelvic radiograph is ordered before the end of the reproductive period, there must be a potential benefit to balance the small risk involved.

  19. Molecular diagnostics of neurodegenerative disorders

    Directory of Open Access Journals (Sweden)

    Megha eAgrawal

    2015-09-01

    Full Text Available Molecular diagnostics provide a powerful method to detect and diagnose various neurological diseases such as Alzheimer’s and Parkinson’s disease. The confirmation of such diagnosis allows early detection and subsequent medical counseling that help specific patients to undergo clinically important drug trials. This provides a medical pathway to have better insight of neurogenesis and eventual cure of the neurodegenerative diseases. In this short review, we present recent advances in molecular diagnostics especially biomarkers and imaging spectroscopy for neurological diseases. We describe advances made in Alzheimer’s disease, Parkinson’s disease, Amyotrophic lateral sclerosis and Huntington’s disease, and finally present a perspective on the future directions to provide a framework for further developments and refinements of molecular diagnostics to combat neurodegenerative disorders.

  20. Diagnostic accuracy in virtual dermatopathology

    DEFF Research Database (Denmark)

    Mooney, E.; Kempf, W.; Jemec, G.B.E.

    2012-01-01

    Background Virtual microscopy is used for teaching medical students and residents and for in-training and certification examinations in the United States. However, no existing studies compare diagnostic accuracy using virtual slides and photomicrographs. The objective of this study was to compare...... diagnostic accuracy of dermatopathologists and pathologists using photomicrographs vs. digitized images, through a self-assessment examination, and to elucidate assessment of virtual dermatopathology. Methods Forty-five dermatopathologists and pathologists received a randomized combination of 15 virtual...... slides and photomicrographs with corresponding clinical photographs and information in a self-assessment examination format. Descriptive data analysis and comparison of groups were performed using a chi-square test. Results Diagnostic accuracy in dermatopathology using virtual dermatopathology...

  1. Molecular diagnostics of neurodegenerative disorders.

    Science.gov (United States)

    Agrawal, Megha; Biswas, Abhijit

    2015-01-01

    Molecular diagnostics provide a powerful method to detect and diagnose various neurological diseases such as Alzheimer's and Parkinson's disease. The confirmation of such diagnosis allows early detection and subsequent medical counseling that help specific patients to undergo clinically important drug trials. This provides a medical pathway to have better insight of neurogenesis and eventual cure of the neurodegenerative diseases. In this short review, we present recent advances in molecular diagnostics especially biomarkers and imaging spectroscopy for neurological diseases. We describe advances made in Alzheimer's disease (AD), Parkinson's disease (PD), Amyotrophic lateral sclerosis (ALS) and Huntington's disease (HD), and finally present a perspective on the future directions to provide a framework for further developments and refinements of molecular diagnostics to combat neurodegenerative disorders.

  2. CT guided diagnostic foot injections

    International Nuclear Information System (INIS)

    Saifuddin, A.; Abdus-Samee, M.; Mann, C.; Singh, D.; Angel, J.C.

    2005-01-01

    AIM: To describe a CT technique for guiding diagnostic and therapeutic injections in the hind- and mid-foot. MATERIALS AND METHODS: Over a period of 50 months, 28 individuals were referred for diagnostic and therapeutic hind- and mid-foot injections before possible arthrodesis. A CT technique was developed that allowed entry into the various joints using a vertical approach. Numbers of joints injected were as follows: posterior subtalar, 21; talonavicular, 4; calcaneonavicular, calcaneocuboid, navicular-cuneiform and 5th metatarsocuboid joints, 1 each. RESULTS: All injections but one were technically successful. Significant relief of symptoms was noted by 16 participants, whereas for 9 there was no improvement and for 3 a partial response was achieved. CONCLUSION: CT is a simple and safe alternative to fluoroscopy for guiding diagnostic and therapeutic foot injections, and may be the technique of choice in cases of disordered anatomy

  3. Enhanced NIF neutron activation diagnostics.

    Science.gov (United States)

    Yeamans, C B; Bleuel, D L; Bernstein, L A

    2012-10-01

    The NIF neutron activation diagnostic suite relies on removable activation samples, leading to operational inefficiencies and a fundamental lower limit on the half-life of the activated product that can be observed. A neutron diagnostic system measuring activation of permanently installed samples could remove these limitations and significantly enhance overall neutron diagnostic capabilities. The physics and engineering aspects of two proposed systems are considered: one measuring the (89)Zr/(89 m)Zr isomer ratio in the existing Zr activation medium and the other using potassium zirconate as the activation medium. Both proposed systems could improve the signal-to-noise ratio of the current system by at least a factor of 5 and would allow independent measurement of fusion core velocity and fuel areal density.

  4. A revolution in diagnostic imaging.

    Science.gov (United States)

    Mamula, Paul W

    2003-03-01

    In November 1966, Sandy Koufax, the star left-handed pitcher of the Los Angeles Dodgers, retired after spending his final season coping with traumatic arthritis in his elbow, the compounded effects of a sliding injury to his pitching arm the previous season and 12 years of hard throwing.1 Had his career begun a few years later, he might have been able to benefit from the advances in diagnostic imaging and treatment that were introduced at that time. Modern arthroscopy and computed tomography (CT) did not become available until the mid 1970s,2 and the first elbow reconstruction was done by Frank Jobe, MD, about 10 years after Koufax retired.1 Arthroscopy was first used as a diagnostic tool, but it later became a surgical tool, affecting treatment of knees, then, later, shoulders. Since 1973, when The Physician and Sportsmedicine was launched, we have witnessed a revolution in diagnostic imaging and are continuing to see an evolution of modalities.

  5. Fetal exposure in diagnostic radiology

    International Nuclear Information System (INIS)

    Baker, M.L.; Vandergrift, J.F.; Dalrymple, G.V.

    1979-01-01

    The problem of possible radiation damage to the fetus or embryo as a result of diagnostic radiography during pregnancy, particularly in the early stages, is discussed. Recommendations of therapeutic abortion after fetal exposure require an adequate knowledge of the doses involved. In the absence of actual dose measurements or estimates, approximate exposure levels may be determined from the literature. A summary of published values for radiography involving the lower abdomen is given. Data is also presented from a series of fetal exposures resulting mostly from routine diagnostic radiography when pregnancy was not known at the time but was established later. Results of actual dose measurements using a phantom and of dose calculations based on published values are in reasonable agreement indicating that literature values of dose provide a satisfactory alternative to measurement. These data suggest that diagnostic radiography rarely, if ever, results in fetal exposures high enough to justify therapeutic abortion. (author)

  6. Dual processing and diagnostic errors.

    Science.gov (United States)

    Norman, Geoff

    2009-09-01

    In this paper, I review evidence from two theories in psychology relevant to diagnosis and diagnostic errors. "Dual Process" theories of thinking, frequently mentioned with respect to diagnostic error, propose that categorization decisions can be made with either a fast, unconscious, contextual process called System 1 or a slow, analytical, conscious, and conceptual process, called System 2. Exemplar theories of categorization propose that many category decisions in everyday life are made by unconscious matching to a particular example in memory, and these remain available and retrievable individually. I then review studies of clinical reasoning based on these theories, and show that the two processes are equally effective; System 1, despite its reliance in idiosyncratic, individual experience, is no more prone to cognitive bias or diagnostic error than System 2. Further, I review evidence that instructions directed at encouraging the clinician to explicitly use both strategies can lead to consistent reduction in error rates.

  7. Optical beam diagnostics on PEP

    International Nuclear Information System (INIS)

    Sabersky, A.P.

    1981-02-01

    In designing the PEP optical diagnostics we have been able to build on the experience gained with SPEAR. Most of the problems at SPEAR could be traced to the optical diagnostic system being inside the tunnel. A machine shutdown is required for any maintenance or modification. This implies that in order to make such an instrument successful, a large engineering effort must be mounted to ensure 100% operation at startup. The functions that do not work at startup may never be made to work; this has happened at several machines. Experimental setups are likewise risky and time consuming. A point which has been borne out in both SPEAR and PEP is that the mechanical part of the instrument, the special vacuum chamber, the optical mounts, the alignment and adjustments, require approximately 60% of the effort and cost of the optical diagnostics. It is far better to economize on detectors and electronics than on mechanical and optical essentials

  8. Calibration issues for neutron diagnostics

    International Nuclear Information System (INIS)

    Sadler, G.J.; Adams, J.M.; Barnes, C.W.

    1997-01-01

    The performance of diagnostic systems are limited by their weakest constituents, including their calibration issues. Neutron diagnostics are notorious for problems encountered while determining their absolute calibrations, due mainly to the nature of the neutron transport problem. In order to facilitate the determination of an accurate and precise calibration, the diagnostic design should be such as to minimize the scattered neutron flux. ITER will use a comprehensive set of neutron diagnostics--comprising radial and vertical neutron cameras, neutron spectrometers, a neutron activation system and internal and external fission chambers--to provide accurate measurements of fusion power and power densities as a function of time. The calibration of such an important diagnostic system merits careful consideration. Some thoughts have already been given to this subject during the conceptual design phase in relation to the time-integrated neutron activation and time-dependent neutron yield monitors. However, no overall calibration strategy has been worked out so far. This paper represents a first attempt to address this vital issue. Experience gained from present large tokamaks (JET, TFTR and JT60U) and proposals for ITER are reviewed. The need to use a 14-MeV neutron generator as opposed to radioactive sources for in-situ calibration of D-T diagnostics will be stressed. It is clear that the overall absolute determination of fusion power will have to rely on a combination of nuclear measuring techniques, for which the provision of accurate and independent calibrations will constitute an ongoing process as ITER moves from one phase of operation to the next

  9. First Wall and Operational Diagnostics

    International Nuclear Information System (INIS)

    Lasnier, C; Allen, S; Boedo, J; Groth, M; Brooks, N; McLean, A; LaBombard, B; Sharpe, J; Skinner, C; Whyte, D; Rudakov, D; West, W; Wong, C

    2006-01-01

    In this chapter we review numerous diagnostics capable of measurements at or near the first wall, many of which contribute information useful for safe operation of a tokamak. There are sections discussing infrared cameras, visible and VUV cameras, pressure gauges and RGAs, Langmuir probes, thermocouples, and erosion and deposition measurements by insertable probes and quartz microbalance. Also discussed are dust measurements by electrostatic detectors, laser scattering, visible and IR cameras, and manual collection of samples after machine opening. In each case the diagnostic is discussed with a view toward application to a burning plasma machine such as ITER

  10. Diagnostic nerve ultrasonography; Diagnostische Nervensonographie

    Energy Technology Data Exchange (ETDEWEB)

    Baeumer, T. [Universitaet zu Luebeck CBBM, Haus 66, Institut fuer Neurogenetik, Luebeck (Germany); Grimm, A. [Universitaetsklinikum Tuebingen, Klinik und Poliklinik fuer Neurologie, Tuebingen (Germany); Schelle, T. [Staedtisches Klinikum Dessau, Neurologische Klinik, Dessau (Germany)

    2017-03-15

    For the diagnostics of nerve lesions an imaging method is necessary to visualize peripheral nerves and their surrounding structures for an etiological classification. Clinical neurological and electrophysiological investigations provide functional information about nerve lesions. The information provided by a standard magnetic resonance imaging (MRI) examination is inadequate for peripheral nerve diagnostics; however, MRI neurography is suitable but on the other hand a resource and time-consuming method. Using ultrasonography for peripheral nerve diagnostics. With ultrasonography reliable diagnostics of entrapment neuropathies and traumatic nerve lesions are possible. The use of ultrasonography for neuropathies shows that a differentiation between different forms is possible. Nerve ultrasonography is an established diagnostic tool. In addition to the clinical examination and clinical electrophysiology, structural information can be obtained, which results in a clear improvement in the diagnostics. Ultrasonography has become an integral part of the diagnostic work-up of peripheral nerve lesions in neurophysiological departments. Nerve ultrasonography is recommended for the diagnostic work-up of peripheral nerve lesions in addition to clinical and electrophysiological investigations. It should be used in the clinical work-up of entrapment neuropathies, traumatic nerve lesions and spacy-occupying lesions of nerves. (orig.) [German] Fuer die Diagnostik von Nervenlaesionen ist ein bildgebendes Verfahren zur Darstellung des peripheren Nervs und seiner ihn umgebenden Strukturen fuer eine aetiologische Einordnung erforderlich. Mit der klinisch-neurologischen Untersuchung und Elektrophysiologie ist eine funktionelle Aussage ueber die Nervenlaesion moeglich. In der Standard-MRT-Untersuchung wird der periphere Nerv nur unzureichend gut dargestellt. Die MRT-Neurographie ist ein sehr gutes, aber auch zeit- und ressourcenintensives Verfahren. Nutzung des Ultraschalls fuer die

  11. Differential diagnostics of bullous dermatoses

    Directory of Open Access Journals (Sweden)

    A. A. Kubanov

    2016-01-01

    Full Text Available Bullous dermatoses are the diseases characterized by vesication and erosion of skin and/or mucos coats, production of autoantibodies against the structural components of epidermis and/or derma. The most frequent diseases of these disorders are pemphigus, bullous pemphigoid, dermatitis herpetiformis, beningn familial chronic pemphigus (Gougerot Hailey-Hailey disease.Diagnostics of bullous dermatoses is based on assessement of clinical signs, results of cytological and histological studies and immunological tests. However none of the current diagnostic methods allows to reveal bullous dermatosis severally and with absolute certainty. Consequently it is necessary to perform wide range of clinical and laboratory tests for early diagnosis and treatment order.

  12. An edge over diagnostic setup

    Directory of Open Access Journals (Sweden)

    Sridhar Kannan

    2017-01-01

    Full Text Available Diagnostic setup proposed by H.D. Kingsley serves as a practical aid in treatment planning and diagnosis. These setups have some inherent shortcomings. A simple technique of duplication of the setups in dental stone can solve problems encountered before as well as provide many other advantages over the conventional procedure. The diagnostic setup is prepared by the conventional method [Figure 1]. An alginate impression is then taken of the setups and poured in dental stone to obtain the derived treatment model [Figure 2]. The same setup can now be further modified for alternate lines of treatment. Subsequently models could then be obtained as required [Figure 3].

  13. Diagnostic imaging in internal medicine

    International Nuclear Information System (INIS)

    Eisenberg, R.L.

    1985-01-01

    This book examines medical diagnostic techniques. Topics considered include biological considerations in the approach to clinical medicines; infectious diseases; disorders of the heart; disorders of the vascular system; disorders of the respiratory system; diseases of the kidneys and urinary tract; disorders of the alimentary tract; disorders of the hepatobiliary system and pancreas; disorders of the hematopoietic system; disorders of bone and bone mineralization; disorders of the joints, connective tissues, and striated muscles; disorders of the nervous system; miscellaneous disorders; and procedures in diagnostic imaging

  14. Optical diagnostics of intermittent flows

    DEFF Research Database (Denmark)

    Okulov, V.L.; Naumov, I.V.; Sørensen, Jens Nørkær

    2007-01-01

    The efficiency of combined use of different optical techniques for flow diagnostics is demonstrated with the practically important case of intense swirling flows. It is shown that, when applied separately, commonly used optical measuring techniques, such as laser Doppler anemometry and particle...... is for the first time applied for diagnostics of the flow pattern in a closed cylinder with a rotating end face with the aim of studying the changeover from the steady axisymmetric to unsteady asymmetric flow over a wide range of flow parameters. It is found that such a transition is notable for azimuthal...

  15. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  16. Molecular cloning and complete nucleotide sequence of a human ventricular myosin light chain 1

    Energy Technology Data Exchange (ETDEWEB)

    Hoffmann, E; Shi, Q W; Floroff, M; Mickle, D A.G.; Wu, T W; Olley, P M; Jackowski, G

    1988-03-25

    Human ventricular plasmid library was constructed. The library was screened with the oligonucleotide probe (17-mer) corresponding to a conserve region of myosin light chain 1 near the carboxy terminal. Full length cDNA recombinant plasmid containing 1100 bp insert was isolated. RNA blot hybridization with this insert detected a message of approximately 1500 bp corresponding to the size of VLCl and mRNA. Complete nucleotide sequence of the coding region was determined in M13 subclones using dideoxy chain termination method. With the isolation of this clone (pCD HLVCl), the publication of the complete nucleotide sequence of HVLCl and the predicted secondary structure of this protein will aid in understanding of the biochemistry of myosin and its function in contraction, the evolution of myosin light genes and the genetic, developmental and physiological regulation of myosin genes.

  17. Effects of preservation methods on amino acids and 5'-nucleotides of Agaricus bisporus mushrooms.

    Science.gov (United States)

    Liu, Ying; Huang, Fan; Yang, Hong; Ibrahim, S A; Wang, Yan-Feng; Huang, Wen

    2014-04-15

    In this study, the proximate composition, free amino acids content and 5'-nucleotides in frozen, canned and salted Agaricus bisporus (A. bisporus) were investigated. We found that the three kinds of A. bisporus products were good sources of protein, with amount varying in the ranges of 16.54-24.35g/100g (dry weight). Freezing, canning and salting process, followed by 6months of storage led to a significant reduction in free amino acids, especially tyrosine, alanine, glutamine and cysteine. There were medium levels of MSG-like amino acids in frozen A. bisporus and canned A. bisporus, and low levels of MSG-like amino acids in salted A. bisporus. The mount of flavor 5'-nucleotides in frozen A. bisporus was higher than that of canned and salted A. bisporus. The present study thus suggests that freezing is beneficial for the preservation of A. bisporus. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Prioritizing single-nucleotide polymorphisms and variants associated with clinical mastitis

    Directory of Open Access Journals (Sweden)

    Suravajhala P

    2017-06-01

    Full Text Available Prashanth Suravajhala,1 Alfredo Benso2 1Department of Molecular Biology and Genetics, Center for Quantitative Genetics and Genomics, Aarhus University, Aarhus, Denmark; 2Department of Control and Computer Engineering, Politecnico di Torino, Torino, Italy Abstract: Next-generation sequencing technology has provided resources to easily explore and identify candidate single-nucleotide polymorphisms (SNPs and variants. However, there remains a challenge in identifying and inferring the causal SNPs from sequence data. A problem with different methods that predict the effect of mutations is that they produce false positives. In this hypothesis, we provide an overview of methods known for identifying causal variants and discuss the challenges, fallacies, and prospects in discerning candidate SNPs. We then propose a three-point classification strategy, which could be an additional annotation method in identifying causalities. Keywords: clinical mastitis, single-nucleotide polymorphisms, variants, associations, diseases, linkage disequilibrium, GWAS

  19. Effect of ionizing radiation on calcium and cyclic nucleotides metabolism in rats of different age

    International Nuclear Information System (INIS)

    Efimova, N.I.; Libenson, S.V.

    1982-01-01

    Some features of mechanism of calcium homeostasis and cyclic nucleotide exchange breakage in case of acute radiation injury of rats of various age were studied. It is established that calcium level in blood in nonpuberal animals, calcium and cAMP excretion with urine are minimal and reach maximum at puberal age. cGMP excretion with urine and concentrational levels of cAMP and cGMP in blood do not change with age. It is shown that calcium excretion with urine decreases adaptively in conditions of acute radiation injury in rats of all age groups. Maximal shifts in cAMP/cGMP ratio were noted in nonpuberal animals, whereas maximal adaptive-compensatory abilities in the regulation system of calcium homeostasis and cyclic nucleotides are typical to adolescent puberal animals

  20. Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina

    Science.gov (United States)

    Arora, Avnish Kumar; Kamaluddin

    2009-03-01

    Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.

  1. An algorithm and program for finding sequence specific oligo-nucleotide probes for species identification

    Directory of Open Access Journals (Sweden)

    Tautz Diethard

    2002-03-01

    Full Text Available Abstract Background The identification of species or species groups with specific oligo-nucleotides as molecular signatures is becoming increasingly popular for bacterial samples. However, it shows also great promise for other small organisms that are taxonomically difficult to tract. Results We have devised here an algorithm that aims to find the optimal probes for any given set of sequences. The program requires only a crude alignment of these sequences as input and is optimized for performance to deal also with very large datasets. The algorithm is designed such that the position of mismatches in the probes influences the selection and makes provision of single nucleotide outloops. Program implementations are available for Linux and Windows.

  2. Lack of nucleotide variability in a beetle pest with extreme inbreeding

    OpenAIRE

    Andreev, D.; Breilid, H.; Kirkendall, L.; Brun, Luc-Olivier; French-Constant, R.H.

    1998-01-01

    The coffee berry borer beetle #Hypothenemus hampei$ (Ferrari) (#Curculionidae$ : #Scolytinae$) is the major insect pest of coffee and has spread to most of the coffee-growing countries of the world. This beetle also displays an usual life cycle, with regular sibling mating. This regular inbreeding and the population bottlenecks occuring on colonization of new regions should lead to low levels of genetic diversity. We were therefore interested in determining the level of nucleotide variation i...

  3. Non-nucleotide Agonists Triggering P2X7 Receptor Activation and Pore Formation

    Directory of Open Access Journals (Sweden)

    Francesco Di Virgilio

    2018-02-01

    Full Text Available The P2X7 receptor (P2X7R is a ligand-gated plasma membrane ion channel belonging to the P2X receptor subfamily activated by extracellular nucleotides. General consensus holds that the physiological (and maybe the only agonist is ATP. However, scattered evidence generated over the last several years suggests that ATP might not be the only agonist, especially at inflammatory sites. Solid data show that NAD+ covalently modifies the P2X7R of mouse T lymphocytes, thus lowering the ATP threshold for activation. Other structurally unrelated agents have been reported to activate the P2X7R via a poorly understood mechanism of action: (a the antibiotic polymyxin B, possibly a positive allosteric P2X7R modulator, (b the bactericidal peptide LL-37, (c the amyloidogenic β peptide, and (d serum amyloid A. Some agents, such as Alu-RNA, have been suggested to activate the P2X7R acting on the intracellular N- or C-terminal domains. Mode of P2X7R activation by these non-nucleotide ligands is as yet unknown; however, these observations raise the intriguing question of how these different non-nucleotide ligands may co-operate with ATP at inflammatory or tumor sites. New information obtained from the cloning and characterization of the P2X7R from exotic mammalian species (e.g., giant panda and data from recent patch-clamp studies are strongly accelerating our understanding of P2X7R mode of operation, and may provide hints to the mechanism of activation of P2X7R by non-nucleotide ligands.

  4. Non-thiolate ligation of nickel by nucleotide-free UreG of Klebsiella aerogenes

    Energy Technology Data Exchange (ETDEWEB)

    Martin-Diaconescu, Vlad; Joseph, Crisjoe A.; Boer, Jodi L.; Mulrooney, Scott B.; Hausinger, Robert P.; Maroney, Michael J.

    2016-12-21

    Nickel-dependent ureases are activated by a multiprotein complex that includes the GTPase UreG. Prior studies showed that nucleotide-free UreG from Klebsiella aerogenes is monomeric and binds one nickel or zinc ion with near-equivalent affinity using an undefined binding site, whereas nucleotide-free UreG from Helicobacter pylori selectively binds one zinc ion per dimer via a universally conserved Cys-Pro-His motif in each protomer. Iodoacetamide-treated K. aerogenes UreG was nearly unaffected in nickel binding compared to non-treated sample, suggesting the absence of thiolate ligands to the metal. X-ray absorption spectroscopy of nickel-bound UreG showed the metal possessed four-coordinate geometry with all O/N donor ligands including one imidazole, thus confirming the absence of thiolate ligation. The nickel site in Strep-tag II-modified protein possessed six-coordinate geometry, again with all O/N donor ligands, but now including two or three imidazoles. An identical site was noted for the Strep-tag II-modified H74A variant, substituted in the Cys-Pro-His motif, ruling out coordination by this His residue. These results are consistent with metal binding to both His6 and a His residue of the fusion peptide in Strep-tagged K. aerogenes UreG. We conclude that the nickel- and zinc-binding site in nucleotide-free K. aerogenes UreG is distinct from that of nucleotide-free H. pylori UreG and does not involve the Cys-Pro-His motif. Further, we show the Strep-tag II can perturb metal coordination of this protein.

  5. Calcium-dependent, cyclic nucleotide-independent steroidogenesis in the bovine placenta.

    OpenAIRE

    Shemesh, M; Hansel, W; Strauss, J F

    1984-01-01

    Dispersed bovine placental cells (fetal cotyledon and maternal caruncle) were shown to synthesize progesterone. To determine if their steroidogenic activity could be modulated by a cyclic nucleotide-mediated process, we added luteinizing hormone, 8-bromoadenosine 3',5'-monophosphate, 8-bromoguanosine 3',5'-monophosphate, adenosine, or cholera toxin to dispersed cells from placentomes of 100-283 days gestational age and examined progesterone synthesis during 3-to 16-hr incubation periods. Net ...

  6. Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

    Science.gov (United States)

    Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

    2010-05-01

    This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  7. Prolinol-based nucleoside phosphonic acids: new isosteric conformationally flexible nucleotide analogues

    Czech Academy of Sciences Publication Activity Database

    Vaněk, Václav; Buděšínský, Miloš; Rinnová, Markéta; Rosenberg, Ivan

    2009-01-01

    Roč. 65, č. 4 (2009), s. 862-876 ISSN 0040-4020 R&D Projects: GA ČR GA203/05/0827; GA MŠk(CZ) LC06077; GA MŠk LC512; GA MŠk(CZ) LC06061 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotide analogues * phosphonates * prolinol derivatives * N- alkylation Subject RIV: CC - Organic Chemistry Impact factor: 3.219, year: 2009

  8. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    International Nuclear Information System (INIS)

    Edenbrandt, C.M.; Murphy, S.

    1990-01-01

    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation

  9. Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

    International Nuclear Information System (INIS)

    Steenbergh, P.H.

    1979-01-01

    The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

  10. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA

    OpenAIRE

    Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

  11. Mesenchymal stem cells from different murine tissues have differential capacity to metabolize extracellular nucleotides.

    Science.gov (United States)

    Iser, Isabele C; Bracco, Paula A; Gonçalves, Carlos E I; Zanin, Rafael F; Nardi, Nance B; Lenz, Guido; Battastini, Ana Maria O; Wink, Márcia R

    2014-10-01

    Mesenchymal stem cells (MSCs) have shown a great potential for cell-based therapy and many different therapeutic purposes. Despite the recent advances in the knowledge of MSCs biology, their biochemical and molecular properties are still poorly defined. Ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) and ecto-5'-nucleotidase (eNT/CD73) are widely expressed enzymes that hydrolyze extracellular nucleotides, generating an important cellular signaling cascade. Currently, studies have evidenced the relationship between the purinergic system and the development, maintenance, and differentiation of stem cells. The objective of this study is to identify the NTPDases and eNT/CD73 and compare the levels of nucleotide hydrolysis on MSCs isolated from different murine tissues (bone marrow, lung, vena cava, kidney, pancreas, spleen, skin, and adipose tissue). MSCs from all tissues investigated expressed the ectoenzymes at different levels. In MSCs from pancreas and adipose tissue, the hydrolysis of triphosphonucleosides was significantly higher when compared to the other cells. The diphosphonucleosides were hydrolyzed at a higher rate by MSC from pancreas when compared to MSC from other tissues. The differential nucleotide hydrolysis activity and enzyme expression in these cells suggests that MSCs play different roles in regulating the purinergic system in these tissues. Overall MSCs are an attractive adult-derived cell population for therapies, however, the fact that ecto-nucleotide metabolism can affect the microenvironment, modulating important events, such as immune response, makes the assessment of this metabolism an important part of the characterization of MSCs to be applied therapeutically. © 2014 Wiley Periodicals, Inc.

  12. Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Madura, K.; Prakash, S.

    1986-01-01

    The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

  13. Roles of phosphorylation and nucleotide binding domains in calcium transport by sarcoplasmic reticulum adenosinetriphosphatase

    International Nuclear Information System (INIS)

    Teruel, J.A.; Inesi, G.

    1988-01-01

    The roles of the phosphorylation (phosphorylated enzyme intermediate) and nucleotide binding domains in calcium transport were studied by comparing acetyl phosphate and ATP as substrates for the Ca 2+ -ATPase of sarcoplasmic reticulum vesicles. The authors found that the maximal level of phosphoenzyme obtained with either substrate is approximately 4 nmol/mg of protein, corresponding to the stoichiometry of catalytic sites in their preparation. The initial burst of phosphoenzyme formation observed in the transient state, following addition of either substrate, is accompanied by internalization of 2 mol of calcium per mole of phosphoenzyme. The internalized calcium is then translocated with a sequential pattern, independent of the substrate used. Following a rate-limiting step, the phosphoenzyme undergoes hydrolytic cleavage and proceeds to the steady-state activity which is soon back inhibited by the rise of Ca 2+ concentration in the lumen of the vesicles. When the back inhibition is released by the addition of oxalate, substrate utilization and calcium transport occur with a ratio of 1:2, independent of the substrate and its concentration. When the nucleotide binding site is derivatized with FITP, the enzyme can still utilize acetyl phosphate (but not ATP) for calcium transport. These observations demonstrate that the basic coupling mechanism of catalysis and calcium transport involves the phosphorylation and calcium binding domains, and not the nucleotide binding domain. On the other hand, occupancy of the FITC-sensitive nucleotide site is involved in kinetic regulation not only with respect to utilization of substrate for the phosphoryl transfer reaction but also for subsequent steps related to calcium translocation and phosphoenzyme turnover

  14. A single nucleotide change affects fur-dependent regulation of sodB in H. pylori.

    Directory of Open Access Journals (Sweden)

    Beth M Carpenter

    Full Text Available Helicobacter pylori is a significant human pathogen that has adapted to survive the many stresses found within the gastric environment. Superoxide Dismutase (SodB is an important factor that helps H. pylori combat oxidative stress. sodB was previously shown to be repressed by the Ferric Uptake Regulator (Fur in the absence of iron (apo-Fur regulation [1]. Herein, we show that apo regulation is not fully conserved among all strains of H. pylori. apo-Fur dependent changes in sodB expression are not observed under iron deplete conditions in H. pylori strains G27, HPAG1, or J99. However, Fur regulation of pfr and amiE occurs as expected. Comparative analysis of the Fur coding sequence between G27 and 26695 revealed a single amino acid difference, which was not responsible for the altered sodB regulation. Comparison of the sodB promoters from G27 and 26695 also revealed a single nucleotide difference within the predicted Fur binding site. Alteration of this nucleotide in G27 to that of 26695 restored apo-Fur dependent sodB regulation, indicating that a single base difference is at least partially responsible for the difference in sodB regulation observed among these H. pylori strains. Fur binding studies revealed that alteration of this single nucleotide in G27 increased the affinity of Fur for the sodB promoter. Additionally, the single base change in G27 enabled the sodB promoter to bind to apo-Fur with affinities similar to the 26695 sodB promoter. Taken together these data indicate that this nucleotide residue is important for direct apo-Fur binding to the sodB promoter.

  15. Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae.

    Science.gov (United States)

    Rosinski-Chupin, Isabelle; Sauvage, Elisabeth; Sismeiro, Odile; Villain, Adrien; Da Cunha, Violette; Caliot, Marie-Elise; Dillies, Marie-Agnès; Trieu-Cuot, Patrick; Bouloc, Philippe; Lartigue, Marie-Frédérique; Glaser, Philippe

    2015-05-30

    Streptococcus agalactiae, or Group B Streptococcus, is a leading cause of neonatal infections and an increasing cause of infections in adults with underlying diseases. In an effort to reconstruct the transcriptional networks involved in S. agalactiae physiology and pathogenesis, we performed an extensive and robust characterization of its transcriptome through a combination of differential RNA-sequencing in eight different growth conditions or genetic backgrounds and strand-specific RNA-sequencing. Our study identified 1,210 transcription start sites (TSSs) and 655 transcript ends as well as 39 riboswitches and cis-regulatory regions, 39 cis-antisense non-coding RNAs and 47 small RNAs potentially acting in trans. Among these putative regulatory RNAs, ten were differentially expressed in response to an acid stress and two riboswitches sensed directly or indirectly the pH modification. Strikingly, 15% of the TSSs identified were associated with the incorporation of pseudo-templated nucleotides, showing that reiterative transcription is a pervasive process in S. agalactiae. In particular, 40% of the TSSs upstream genes involved in nucleotide metabolism show reiterative transcription potentially regulating gene expression, as exemplified for pyrG and thyA encoding the CTP synthase and the thymidylate synthase respectively. This comprehensive map of the transcriptome at the single nucleotide resolution led to the discovery of new regulatory mechanisms in S. agalactiae. It also provides the basis for in depth analyses of transcriptional networks in S. agalactiae and of the regulatory role of reiterative transcription following variations of intra-cellular nucleotide pools.

  16. Inferring epidemiological dynamics of infectious diseases using Tajima's D statistic on nucleotide sequences of pathogens.

    Science.gov (United States)

    Kim, Kiyeon; Omori, Ryosuke; Ito, Kimihito

    2017-12-01

    The estimation of the basic reproduction number is essential to understand epidemic dynamics, and time series data of infected individuals are usually used for the estimation. However, such data are not always available. Methods to estimate the basic reproduction number using genealogy constructed from nucleotide sequences of pathogens have been proposed so far. Here, we propose a new method to estimate epidemiological parameters of outbreaks using the time series change of Tajima's D statistic on the nucleotide sequences of pathogens. To relate the time evolution of Tajima's D to the number of infected individuals, we constructed a parsimonious mathematical model describing both the transmission process of pathogens among hosts and the evolutionary process of the pathogens. As a case study we applied this method to the field data of nucleotide sequences of pandemic influenza A (H1N1) 2009 viruses collected in Argentina. The Tajima's D-based method estimated basic reproduction number to be 1.55 with 95% highest posterior density (HPD) between 1.31 and 2.05, and the date of epidemic peak to be 10th July with 95% HPD between 22nd June and 9th August. The estimated basic reproduction number was consistent with estimation by birth-death skyline plot and estimation using the time series of the number of infected individuals. These results suggested that Tajima's D statistic on nucleotide sequences of pathogens could be useful to estimate epidemiological parameters of outbreaks. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  17. Single nucleotide polymorphism in Egyptian cattle insulin-like growth factor binding protein-3 gene

    Directory of Open Access Journals (Sweden)

    Othman E. Othman

    2014-12-01

    It is concluded that the IGFBP-3/HaeIII polymorphism may be utilized as a good marker for genetic differentiation between cattle animals for different body functions such as growth, metabolism, reproduction, immunity and energy balance. The nucleotide sequences of Egyptian cattle IGFBP-3 A and C alleles were submitted to GenBank with the accession numbers KF899893 and KF899894, respectively.

  18. Nucleotide homeostasis and purinergic nociceptive signaling in rat meninges in migraine-like conditions.

    Science.gov (United States)

    Yegutkin, Gennady G; Guerrero-Toro, Cindy; Kilinc, Erkan; Koroleva, Kseniya; Ishchenko, Yevheniia; Abushik, Polina; Giniatullina, Raisa; Fayuk, Dmitriy; Giniatullin, Rashid

    2016-09-01

    Extracellular ATP is suspected to contribute to migraine pain but regulatory mechanisms controlling pro-nociceptive purinergic mechanisms in the meninges remain unknown. We studied the peculiarities of metabolic and signaling pathways of ATP and its downstream metabolites in rat meninges and in cultured trigeminal cells exposed to the migraine mediator calcitonin gene-related peptide (CGRP). Under resting conditions, meningeal ATP and ADP remained at low nanomolar levels, whereas extracellular AMP and adenosine concentrations were one-two orders higher. CGRP increased ATP and ADP levels in meninges and trigeminal cultures and reduced adenosine concentration in trigeminal cells. Degradation rates for exogenous nucleotides remained similar in control and CGRP-treated meninges, indicating that CGRP triggers nucleotide release without affecting nucleotide-inactivating pathways. Lead nitrate-based enzyme histochemistry of whole mount meninges revealed the presence of high ATPase, ADPase, and AMPase activities, primarily localized in the medial meningeal artery. ATP and ADP induced large intracellular Ca(2+) transients both in neurons and in glial cells whereas AMP and adenosine were ineffective. In trigeminal glia, ATP partially operated via P2X7 receptors. ATP, but not other nucleotides, activated nociceptive spikes in meningeal trigeminal nerve fibers providing a rationale for high degradation rate of pro-nociceptive ATP. Pro-nociceptive effect of ATP in meningeal nerves was reproduced by α,β-meATP operating via P2X3 receptors. Collectively, extracellular ATP, which level is controlled by CGRP, can persistently activate trigeminal nerves in meninges which considered as the origin site of migraine headache. These data are consistent with the purinergic hypothesis of migraine pain and suggest new targets against trigeminal pain.

  19. Fluorinated Nucleotide Modifications Modulate Allele Selectivity of SNP-Targeting Antisense Oligonucleotides

    Directory of Open Access Journals (Sweden)

    Michael E. Østergaard

    2017-06-01

    Full Text Available Antisense oligonucleotides (ASOs have the potential to discriminate between subtle RNA mismatches such as SNPs. Certain mismatches, however, allow ASOs to bind at physiological conditions and result in RNA cleavage mediated by RNase H. We showed that replacing DNA nucleotides in the gap region of an ASO with other chemical modification can improve allele selectivity. Herein, we systematically substitute every position in the gap region of an ASO targeting huntingtin gene (HTT with fluorinated nucleotides. Potency is determined in cell culture against mutant HTT (mtHTT and wild-type HTT (wtHTT mRNA and RNase H cleavage intensities, and patterns are investigated. This study profiled five different fluorinated nucleotides and showed them to have predictable, site-specific effects on RNase H cleavage, and the cleavage patterns were rationalized from a published X-ray structure of human RNase H1. The results herein can be used as a guide for future projects where ASO discrimination of SNPs is important.

  20. Porous silicon surfaces for metabonomics: Detection and identification of nucleotides without matrix interference

    Energy Technology Data Exchange (ETDEWEB)

    Gomez, D.; Azcarate, Sabino [Dpto. de Micro y Nanotecnologias, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain); Fernandez, Jose A.; Astigarraga, Egoitz [Dpto. de Quimica Fisica, Universidad del Pais Vasco, Campus de Lejona, Lejona (Spain); Marcaide, Arrate [Dpto. de Procesos de Fabricacion, Fundacion Tekniker, Av. Otaola 20, 20600 Eibar (Spain)

    2007-07-01

    In present work, porous silicon surfaces (PSS) have been developed for time of flight mass spectrometric experiments (TOF-MS) in the monitoring of nucleotides, commonly found as metabolites in the cell. The mass range of the studied molecules ({proportional_to} 400 amu) is common to several important messengers and other metabolites. Different porosified surfaces have been developed by means of electrochemical etching and different degree of porosity and pore size achieved as function of silicon dopant concentration, silicon resistivity, current density and the presence or absence of illumination along the process. As main conclusion, it can be said that an interesting commercial nucleotide (Cyclic adenosine monophosphate, c-AMP) has been detected on low concentrations ({proportional_to}hundreds of femtomols) for some of the fabricated porous surfaces. Taking into account that these concentrations are similar to the ones found in real samples, this result opens the possibility to the fabrication of DIOS (Desorption Ionization On Silicon) chips for the detection of nucleotides in biological fluids. (copyright 2007 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  1. Nucleotide Pool Depletion Induces G-Quadruplex-Dependent Perturbation of Gene Expression

    Directory of Open Access Journals (Sweden)

    Charikleia Papadopoulou

    2015-12-01

    Full Text Available Nucleotide pool imbalance has been proposed to drive genetic instability in cancer. Here, we show that slowing replication forks by depleting nucleotide pools with hydroxyurea (HU can also give rise to both transient and permanent epigenetic instability of a reporter locus, BU-1, in DT40 cells. HU induces stochastic formation of Bu-1low variants in dividing cells, which have lost the H3K4me3 present in untreated cells. This instability is potentiated by an intragenic G quadruplex, which also promotes local H2Ax phosphorylation and transient heterochromatinization. Genome-wide, gene expression changes induced by HU significantly overlap with those resulting from loss of the G4-helicases FANCJ, WRN, and BLM. Thus, the effects of global replication stress induced by nucleotide pool depletion can be focused by local replication impediments caused by G quadruplex formation to induce epigenetic instability and changes in gene expression, a mechanism that may contribute to selectable transcriptional changes in cancer.

  2. Nucleotide polymorphisms and haplotype diversity of RTCS gene in China elite maize inbred lines.

    Directory of Open Access Journals (Sweden)

    Enying Zhang

    Full Text Available The maize RTCS gene, encoding a LOB domain transcription factor, plays important roles in the initiation of embryonic seminal and postembryonic shoot-borne root. In this study, the genomic sequences of this gene in 73 China elite inbred lines, including 63 lines from 5 temperate heteroric groups and 10 tropic germplasms, were obtained, and the nucleotide polymorphisms and haplotype diversity were detected. A total of 63 sequence variants, including 44 SNPs and 19 indels, were identified at this locus, and most of them were found to be located in the regions of UTR and intron. The coding region of this gene in all tested inbred lines carried 14 haplotypes, which encoding 7 deferring RTCS proteins. Analysis of the polymorphism sites revealed that at least 6 recombination events have occurred. Among all 6 groups tested, only the P heterotic group had a much lower nucleotide diversity than the whole set, and selection analysis also revealed that only this group was under strong negative selection. However, the set of Huangzaosi and its derived lines possessed a higher nucleotide diversity than the whole set, and no selection signal were identified.

  3. Junctional transfer in cultured vascular endothelium: II. Dye and nucleotide transfer

    International Nuclear Information System (INIS)

    Larson, D.M.; Sheridan, J.D.

    1985-01-01

    Vascular endothelial cultures, derived from large vessels, retain many of the characteristics of their in vivo counterparts. However, the observed reduction in size and complexity of intercellular gap and tight junctions in these cultured cells suggests that important functions, thought to be mediated by these structures, may be altered in vitro. In continuing studies on intercellular communication in vessel wall cells, the authors have quantitated the extent of junctional transfer of small molecular tracers (the fluorescent dye Lucifer Yellow CH and tritiated uridine nucleotides) in confluent cultures of calf aortic (BAEC) and umbilical vein (BVEC) endothelium. Both BAEC and BVEC show extensive (and quantitatively equivalent) dye and nucleotide transfer. As an analogue of intimal endothelium, the authors have also tested dye transfer in freshly isolated sheets of endothelium. Transfer in BAEC and BVEC sheets was more rapid, extensive and homogeneous than in the cultured cells, implying a reduction in molecular coupling as endothelium adapts to culture conditions. In addition, they have documented heterocellular nucleotide transfer between cultured endothelium and vascular smooth muscle cells, of particular interest considering the prevalence of ''myo-endothelial'' junctions in vivo. These data yield further information on junctional transfer in cultured vascular endothelium and have broad implications for the functional integration of the vessel wall in the physiology and pathophysiology of the vasculature

  4. The low-dose combination preparation Vertigoheel activates cyclic nucleotide pathways and stimulates vasorelaxation.

    Science.gov (United States)

    Heinle, H; Tober, C; Zhang, D; Jäggi, R; Kuebler, W M

    2010-01-01

    Vertigo of various and often unknown aetiologies has been associated with and attributed to impaired microvascular perfusion in the inner ear or the vertebrobasilar system. Vertigoheel is a low-dose combination preparation of proven value in the symptomatic treatment of vertigo. In the present study we tested the hypothesis that Vertigoheel's anti-vertiginous properties may in part be due to a vasodilatory effect exerted via stimulation of the adenylate and/or guanylate cyclase pathways. Thus, the influence of Vertigoheel or its single constituents on synthesis and degradation of cyclic nucleotides was measured. Furthermore, vessel myography was used to observe the effect of Vertigoheel on the vasoreactivity of rat carotid arteries. Vertigoheel and one of its constituents, Anamirta cocculus, stimulated adenylate cyclase activity, while another constituent, Conium maculatum, inhibited phosphodiesterase 5, suggesting that the individual constituents of Vertigoheel contribute differentially to a synergistic stimulation of cyclic nucleotide signalling pathways. In rat carotid artery rings, Vertigoheel counteracted phenylephrine-induced tonic vasoconstriction. The present data demonstrate a vasorelaxant effect of Vertigoheel that goes along with a synergistic stimulation of cyclic nucleotide pathways and may provide a mechanistic basis for the documented anti-vertiginous effects of this combination preparation.

  5. Ethanol-induced activation of adenine nucleotide turnover. Evidence for a role of acetate

    International Nuclear Information System (INIS)

    Puig, J.G.; Fox, I.H.

    1984-01-01

    Consumption of alcohol causes hyperuricemia by decreasing urate excretion and increasing its production. Our previous studies indicate that ethanol administration increases uric acid production by increasing ATP degradation to uric acid precursors. To test the hypothesis that ethanol-induced increased urate production results from acetate metabolism and enhanced adenosine triphosphate turnover, we gave intravenous sodium acetate, sodium chloride and ethanol (0.1 mmol/kg per min for 1 h) to five normal subjects. Acetate plasma levels increased from 0.04 +/- 0.01 mM (mean +/- SE) to peak values of 0.35 +/- 0.07 mM and to 0.08 +/- 0.01 mM during acetate and ethanol infusions, respectively. Urinary oxypurines increased to 223 +/- 13% and 316 +/- 44% of the base-line values during acetate and ethanol infusions, respectively. Urinary radioactivity from the adenine nucleotide pool labeled with [8-14C] adenine increased to 171 +/- 27% and to 128 +/- 8% of the base-line values after acetate and ethanol infusions. These data indicate that both ethanol and acetate increase purine nucleotide degradation by enhancing the turnover of the adenine nucleotide pool. They support the hypothesis that acetate metabolism contributes to the increased production of urate associated with ethanol intake

  6. An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

    Science.gov (United States)

    Chen, Sherry Xi; Seelig, Georg

    2016-04-20

    Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

  7. OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

    Science.gov (United States)

    Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

    2016-02-01

    Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

  8. Endogenous adenosine produced during hypoxia attenuates neutrophil accumulation: coordination by extracellular nucleotide metabolism.

    Science.gov (United States)

    Eltzschig, Holger K; Thompson, Linda F; Karhausen, Jorn; Cotta, Richard J; Ibla, Juan C; Robson, Simon C; Colgan, Sean P

    2004-12-15

    Hypoxia is a well-documented inflammatory stimulus and results in tissue polymorphonuclear leukocyte (PMN) accumulation. Likewise, increased tissue adenosine levels are commonly associated with hypoxia, and given the anti-inflammatory properties of adenosine, we hypothesized that adenosine production via adenine nucleotide metabolism at the vascular surface triggers an endogenous anti-inflammatory response during hypoxia. Initial in vitro studies indicated that endogenously generated adenosine, through activation of PMN adenosine A(2A) and A(2B) receptors, functions as an antiadhesive signal for PMN binding to microvascular endothelia. Intravascular nucleotides released by inflammatory cells undergo phosphohydrolysis via hypoxia-induced CD39 ectoapyrase (CD39 converts adenosine triphosphate/adenosine diphosphate [ATP/ADP] to adenosine monophosphate [AMP]) and CD73 ecto-5'-nucleotidase (CD73 converts AMP to adenosine). Extensions of our in vitro findings using cd39- and cd73-null animals revealed that extracellular adenosine produced through adenine nucleotide metabolism during hypoxia is a potent anti-inflammatory signal for PMNs in vivo. These findings identify CD39 and CD73 as critical control points for endogenous adenosine generation and implicate this pathway as an innate mechanism to attenuate excessive tissue PMN accumulation.

  9. A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.

    Science.gov (United States)

    Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I

    2016-01-01

    We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.

  10. Multilocus analysis of nucleotide variation and speciation in three closely related Populus (Salicaceae) species.

    Science.gov (United States)

    Du, Shuhui; Wang, Zhaoshan; Ingvarsson, Pär K; Wang, Dongsheng; Wang, Junhui; Wu, Zhiqiang; Tembrock, Luke R; Zhang, Jianguo

    2015-10-01

    Historical tectonism and climate oscillations can isolate and contract the geographical distributions of many plant species, and they are even known to trigger species divergence and ultimately speciation. Here, we estimated the nucleotide variation and speciation in three closely related Populus species, Populus tremuloides, P. tremula and P. davidiana, distributed in North America and Eurasia. We analysed the sequence variation in six single-copy nuclear loci and three chloroplast (cpDNA) fragments in 497 individuals sampled from 33 populations of these three species across their geographic distributions. These three Populus species harboured relatively high levels of nucleotide diversity and showed high levels of nucleotide differentiation. Phylogenetic analysis revealed that P. tremuloides diverged earlier than the other two species. The cpDNA haplotype network result clearly illustrated the dispersal route from North America to eastern Asia and then into Europe. Molecular dating results confirmed that the divergence of these three species coincided with the sundering of the Bering land bridge in the late Miocene and a rapid uplift of the Qinghai-Tibetan Plateau around the Miocene/Pliocene boundary. Vicariance-driven successful allopatric speciation resulting from historical tectonism and climate oscillations most likely played roles in the formation of the disjunct distributions and divergence of these three Populus species. © 2015 John Wiley & Sons Ltd.

  11. Approach to analysis of single nucleotide polymorphisms by automated constant denaturant capillary electrophoresis

    International Nuclear Information System (INIS)

    Bjoerheim, Jens; Abrahamsen, Torveig Weum; Kristensen, Annette Torgunrud; Gaudernack, Gustav; Ekstroem, Per O.

    2003-01-01

    Melting gel techniques have proven to be amenable and powerful tools in point mutation and single nucleotide polymorphism (SNP) analysis. With the introduction of commercially available capillary electrophoresis instruments, a partly automated platform for denaturant capillary electrophoresis with potential for routine screening of selected target sequences has been established. The aim of this article is to demonstrate the use of automated constant denaturant capillary electrophoresis (ACDCE) in single nucleotide polymorphism analysis of various target sequences. Optimal analysis conditions for different single nucleotide polymorphisms on ACDCE are evaluated with the Poland algorithm. Laboratory procedures include only PCR and electrophoresis. For direct genotyping of individual SNPs, the samples are analyzed with an internal standard and the alleles are identified by co-migration of sample and standard peaks. In conclusion, SNPs suitable for melting gel analysis based on theoretical thermodynamics were separated by ACDCE under appropriate conditions. With this instrumentation (ABI 310 Genetic Analyzer), 48 samples could be analyzed without any intervention. Several institutions have capillary instrumentation in-house, thus making this SNP analysis method accessible to large groups of researchers without any need for instrument modification

  12. Nucleotide diversity analysis of three major bacterial blight resistance genes in rice.

    Directory of Open Access Journals (Sweden)

    Waikhom Bimolata

    Full Text Available Nucleotide sequence polymorphisms among R gene alleles influence the process of co-evolutionary interaction between host and pathogen by shaping the response of host plants towards invading pathogens. Here, we present the DNA sequence polymorphisms and diversities present among natural alleles of three rice bacterial blight resistance genes, Xa21, Xa26 and xa5. The diversity was examined across different wild relatives and cultivars of Oryza species. Functional significance of selected alleles was evaluated through semi-quantitative reverse transcription polymerase chain reaction and real time PCR. The greatest nucleotide diversity and singleton variable sites (SVS were present in Xa26 (π = 0.01958; SVS = 182 followed by xa5 and Xa21 alleles. The highest frequency of single nucleotide polymorphisms were observed in Xa21 alleles and least in xa5. Transition bias was observed in all the genes and 'G' to 'A' transitions were more favored than other form of transitions. Neutrality tests failed to show the presence of selection at these loci, though negative Tajima's D values indicate the presence of a rare form of polymorphisms. At the interspecies level, O. nivara exhibited more diversity than O. sativa. We have also identified two nearly identical resistant alleles of xa5 and two sequentially identical alleles of Xa21. The alleles of xa5 showed basal levels of expression while Xa21 alleles were functionally not expressed.

  13. Synthesis and degradation of cyclic nucleotides in brain after a high dose of ionizing radiation

    International Nuclear Information System (INIS)

    Hunt, W.A.; Dalton, T.K.

    1981-01-01

    Previous data from our laboratory have indicated that a high dose of ionizing radiation can deplete the cyclic nucleotides guanosine 3',5'-cyclic monophosphate (cGMP) and adenosine 3',5'-cyclic monophosphate (cAMP) on several areas of the rat brain. cGMP is more sensitive to radiation than cAMP and does not recover for at least 24 h after irradiation. The response of cAMP is transient and recovery occurs within 4 h. The purpose of the present paper is to determine whether alternations in the activity of the synthetic and degradative enzymes that regulate cyclic nucleotide levels could account for the observed effects. Guanylate and adenylate cyclase and cGMP and cAMP phosphodiesterase activities were determined 10 min after irradiation with 10,000 rad of high-energy electrons. No alteration was detected under these experimental conditions. The data suggest that the reduction in cyclic nucleotides is not a direct effect on their metabolic enzymes and is probably secondary to some as yet-undefined action of radiation on the brain

  14. The nucleotide-binding domain of NLRC5 is critical for nuclear import and transactivation activity

    International Nuclear Information System (INIS)

    Meissner, Torsten B.; Li, Amy; Liu, Yuen-Joyce; Gagnon, Etienne; Kobayashi, Koichi S.

    2012-01-01

    Highlights: ► NLRC5 requires an intact NLS for its function as MHC class I transactivator. ► Nuclear presence of NLRC5 is required for MHC class I induction. ► Nucleotide-binding controls nuclear import and transactivation activity of NLRC5. -- Abstract: Major histocompatibility complex (MHC) class I and class II are crucial for the function of the human adaptive immune system. A member of the NLR (nucleotide-binding domain, leucine-rich repeat) protein family, NLRC5, has recently been identified as a transcriptional regulator of MHC class I and related genes. While a ‘master regulator’ of MHC class II genes, CIITA, has long been known, NLRC5 specifically associates with and transactivates the proximal promoters of MHC class I genes. In this study, we analyzed the molecular requirements of NLRC5 nuclear import and transactivation activity. We show that NLRC5-mediated MHC class I gene induction requires an intact nuclear localization signal and nuclear distribution of NLRC5. In addition, we find that the nucleotide-binding domain (NBD) of NLRC5 is critical not only for nuclear translocation but also for the transactivation of MHC class I genes. Changing the cellular localization of NLRC5 is likely to immediately impact MHC class I expression as well as MHC class I-mediated antigen presentation. NLRC5 may thus provide a promising target for the modulation of MHC class I antigen presentation, especially in the setting of transplant medicine.

  15. The first 3':5'-cyclic nucleotide-amino acid complex: L-His-cIMP.

    Science.gov (United States)

    Slepokura, Katarzyna

    2012-08-01

    In the crystal structure of the L-His-cIMP complex, i.e. L-histidinium inosine 3':5'-cyclic phosphate [systematic name: 5-(2-amino-2-carboxyethyl)-1H-imidazol-3-ium 7-hydroxy-2-oxo-6-(6-oxo-6,9-dihydro-1H-purin-9-yl)-4a,6,7,7a-tetrahydro-4H-1,3,5,2λ(5)-furo[3,2-d][1,3,2λ(5)]dioxaphosphinin-2-olate], C(6)H(10)N(3)O(2)(+)·C(10)H(10)N(4)O(7)P(-), the Hoogsteen edge of the hypoxanthine (Hyp) base of cIMP and the Hyp face are engaged in specific amino acid-nucleotide (His···cIMP) recognition, i.e. by abutting edge-to-edge and by π-π stacking, respectively. The Watson-Crick edge of Hyp and the cIMP phosphate group play a role in nonspecific His···cIMP contacts. The interactions between the cIMP anions (anti/C3'-endo/trans-gauche/chair conformers) are realized mainly between riboses and phosphate groups. The results for this L-His-cIMP complex, compared with those for the previously reported solvated L-His-IMP crystal structure, indicate a different nature of amino acid-nucleotide recognition and interactions upon the 3':5'-cyclization of the nucleotide phosphate group.

  16. Pulmonary preservation studies: effects on endothelial function and pulmonary adenine nucleotides.

    Science.gov (United States)

    Paik, Hyo Chae; Hoffmann, Steven C; Egan, Thomas M

    2003-02-27

    Lung transplantation is an effective therapy plagued by a high incidence of early graft dysfunction, in part because of reperfusion injury. The optimal preservation solution for lung transplantation is unknown. We performed experiments using an isolated perfused rat lung model to test the effect of lung preservation with three solutions commonly used in clinical practice. Lungs were retrieved from Sprague-Dawley rats and flushed with one of three solutions: modified Euro-Collins (MEC), University of Wisconsin (UW), or low potassium dextran and glucose (LPDG), then stored cold for varying periods before reperfusion with Earle's balanced salt solution using the isolated perfused rat lung model. Outcome measures were capillary filtration coefficient (Kfc), wet-to-dry weight ratio, and lung tissue levels of adenine nucleotides and cyclic AMP. All lungs functioned well after 4 hr of storage. By 6 hr, UW-flushed lungs had a lower Kfc than LPDG-flushed lungs. After 8 hr of storage, only UW-flushed lungs had a measurable Kfc. Adenine nucleotide levels were higher in UW-flushed lungs after prolonged storage. Cyclic AMP levels correlated with Kfc in all groups. Early changes in endothelial permeability seemed to be better attenuated in lungs flushed with UW compared with LPDG or MEC; this was associated with higher amounts of adenine nucleotides. MEC-flushed lungs failed earlier than LPDG-flushed or UW-flushed lungs. The content of the solution may be more important for lung preservation than whether the ionic composition is intracellular or extracellular.

  17. Association Mapping and Nucleotide Sequence Variation in Five Drought Tolerance Candidate Genes in Spring Wheat

    Directory of Open Access Journals (Sweden)

    Erena A. Edae

    2013-07-01

    Full Text Available Functional markers are needed for key genes involved in drought tolerance to improve selection for crop yield under moisture stress conditions. The objectives of this study were to (i characterize five drought tolerance candidate genes, namely dehydration responsive element binding 1A (, enhanced response to abscisic acid ( and , and fructan 1-exohydrolase ( and , in wheat ( L. for nucleotide and haplotype diversity, Tajima’s D value, and linkage disequilibrium (LD and (ii associate within-gene single nucleotide polymorphisms (SNPs with phenotypic traits in a spring wheat association mapping panel ( = 126. Field trials were grown under contrasting moisture regimes in Greeley, CO, and Melkassa, Ethiopia, in 2010 and 2011. Genome-specific amplification and DNA sequence analysis of the genes identified SNPs and revealed differences in nucleotide and haplotype diversity, Tajima’s D, and patterns of LD. showed associations (false discovery rate adjusted probability value = 0.1 with normalized difference vegetation index, heading date, biomass, and spikelet number. Both and were associated with harvest index, flag leaf width, and leaf senescence. was associated with grain yield, and was associated with thousand kernel weight and test weight. If validated in relevant genetic backgrounds, the identified marker–trait associations may be applied to functional marker-assisted selection.

  18. Mjollnir Rotational Line Scan Diagnostics.

    Science.gov (United States)

    1981-05-19

    using long cavity. M8 Removable Pellicle Beam Splitter for He-Ne Lineup Beam. Removed before HF or DF laser is turned on. 27 A 27 * A r of the chopper...three probe laser lines, however three lines were sequentially measured to verify the diagnostic equipment. Two of the three lines have been monitored

  19. Heuristics Reasoning in Diagnostic Judgment.

    Science.gov (United States)

    O'Neill, Eileen S.

    1995-01-01

    Describes three heuristics--short-cut mental strategies that streamline information--relevant to diagnostic reasoning: accessibility, similarity, and anchoring and adjustment. Analyzes factors thought to influence heuristic reasoning and presents interventions to be tested for nursing practice and education. (JOW)

  20. Diagnostic interface problems on TFTR

    International Nuclear Information System (INIS)

    Goldfarb, S.

    1977-01-01

    Diagnostic equipment on TFTR has functional interfaces with many machine systems. Salient requirements include plasma access, environmental resistance to thermal, magnetic and radiation effects, automated data acquisition and controls, remote handling and personnel safety. Problems imposed by these requirements and the solutions being considered are described