WorldWideScience

Sample records for nucleotide polymorphism-based diagnostic

  1. Single nucleotide polymorphism-based validation of exonic splicing enhancers.

    Directory of Open Access Journals (Sweden)

    William G Fairbrother

    2004-09-01

    Full Text Available Because deleterious alleles arising from mutation are filtered by natural selection, mutations that create such alleles will be underrepresented in the set of common genetic variation existing in a population at any given time. Here, we describe an approach based on this idea called VERIFY (variant elimination reinforces functionality, which can be used to assess the extent of natural selection acting on an oligonucleotide motif or set of motifs predicted to have biological activity. As an application of this approach, we analyzed a set of 238 hexanucleotides previously predicted to have exonic splicing enhancer (ESE activity in human exons using the relative enhancer and silencer classification by unanimous enrichment (RESCUE-ESE method. Aligning the single nucleotide polymorphisms (SNPs from the public human SNP database to the chimpanzee genome allowed inference of the direction of the mutations that created present-day SNPs. Analyzing the set of SNPs that overlap RESCUE-ESE hexamers, we conclude that nearly one-fifth of the mutations that disrupt predicted ESEs have been eliminated by natural selection (odds ratio = 0.82 +/- 0.05. This selection is strongest for the predicted ESEs that are located near splice sites. Our results demonstrate a novel approach for quantifying the extent of natural selection acting on candidate functional motifs and also suggest certain features of mutations/SNPs, such as proximity to the splice site and disruption or alteration of predicted ESEs, that should be useful in identifying variants that might cause a biological phenotype.

  2. Estimating population size using single-nucleotide polymorphism-based pedigree data.

    Science.gov (United States)

    Spitzer, Robert; Norman, Anita J; Schneider, Michael; Spong, Göran

    2016-05-01

    Reliable population estimates are an important aspect of sustainable wildlife management and conservation but can be difficult to obtain for rare and elusive species. Here, we test a new census method based on pedigree reconstruction recently developed by Creel and Rosenblatt (2013). Using a panel of 96 single-nucleotide polymorphisms (SNPs), we genotyped fecal samples from two Swedish brown bear populations for pedigree reconstruction. Based on 433 genotypes from central Sweden (CS) and 265 from northern Sweden (NS), the population estimates (N = 630 for CS, N = 408 for NS) fell within the 95% CI of the official estimates. The precision and accuracy improved with increasing sampling intensity. Like genetic capture-mark-recapture methods, this method can be applied to data from a single sampling session. Pedigree reconstruction combined with noninvasive genetic sampling may thus augment population estimates, particularly for rare and elusive species for which sampling may be challenging.

  3. A single-nucleotide-polymorphism-based genotyping assay for simultaneous detection of different carbendazim-resistant genotypes in the Fusarium graminearum species complex

    Science.gov (United States)

    Zhang, Hao; Brankovics, Balázs; van der Lee, Theo A.J.; Waalwijk, Cees; van Diepeningen, Anne A.D.; Xu, Jin; Xu, Jingsheng

    2016-01-01

    The occurrence resistance to methyl benzimidazole carbamates (MBC)-fungicides in the Fusarium graminearum species complex (FGSC) is becoming a serious problem in the control of Fusarium head blight in China. The resistance is caused by point mutations in the β2-tubulingene. So far, five resistant genotypes (F167Y, E198Q, E198L, E198K and F200Y) have been reported in the field. To establish a high-throughput method for rapid detection of all the five mutations simultaneously, an efficient single-nucleotide-polymorphism-based genotyping method was developed based on the Luminex xMAP system. One pair of amplification primers and five allele specific primer extension probes were designed and optimized to specially distinguish the different genotypes within one single reaction. This method has good extensibility and can be combined with previous reported probes to form a highly integrated tool for species, trichothecene chemotype and MBC resistance detection. Using this method, carbendazim resistant FGSC isolates from Jiangsu, Anhui and Sichuan Province in China were identified. High and moderate frequencies of resistance were observed in Jiangsu and Anhui Province, respectively. Carbendazim resistance in F. asiaticum is only observed in the 3ADON genotype. Overall, our method proved to be useful for early detection of MBC resistance in the field and the result aids in the choice of fungicide type. PMID:27812414

  4. A Novel 7-Single Nucleotide Polymorphism-Based Clonotyping Test Allows Rapid Prediction of Antimicrobial Susceptibility of Extraintestinal Escherichia coli Directly From Urine Specimens

    Science.gov (United States)

    Tchesnokova, Veronika; Avagyan, Hovhannes; Billig, Mariya; Chattopadhyay, Sujay; Aprikian, Pavel; Chan, Diana; Pseunova, Julietta; Rechkina, Elena; Riddell, Kim; Scholes, Delia; Fang, Ferric C.; Johnson, James R.; Sokurenko, Evgeni V.

    2016-01-01

    Background. Escherichia coli is a highly clonal pathogen. Extraintestinal isolates belong to a limited number of genetically related groups, which often exhibit characteristic antimicrobial resistance profiles. Methods. We developed a rapid clonotyping method for extraintestinal E coli based on detection of the presence or absence of 7 single nucleotide polymorphisms (SNPs) within 2 genes (fumC and fimH). A reference set of 2559 E coli isolates, primarily of urinary origin, was used to predict the resolving power of the 7-SNP-based typing method, and 582 representative strains from this set were used to evaluate test robustness. Results. Fifty-four unique SNP combinations (“septatypes”) were identified in the reference strains. These septatypes yielded a clonal group resolution power on par with that of traditional multilocus sequence typing. In 72% of isolates, septatype identity predicted sequence type identity with at least 90% (mean, 97%) accuracy. Most septatypes exhibited highly distinctive antimicrobial susceptibility profiles. The 7-SNP-based test could be performed with high specificity and sensitivity using single or multiplex conventional polymerase chain reaction (PCR) and quantitative PCR. In the latter format, E coli presence and septatype identity were determined directly in urine specimens within 45 minutes with bacterial loads as low as 102 colony-forming units/mL and, at clinically significant bacterial loads, with 100% sensitivity and specificity. Conclusions. 7-SNP-based typing of E coli can be used for both epidemiological studies and clinical diagnostics, which could greatly improve the empirical selection of antimicrobial therapy. PMID:26925427

  5. Single nucleotide polymorphism-based molecular typing of M. leprae from multicase families of leprosy patients and their surroundings to understand the transmission of leprosy.

    Science.gov (United States)

    Turankar, R P; Lavania, M; Chaitanya, V S; Sengupta, U; Darlong, J; Darlong, F; Siva Sai, K S R; Jadhav, R S

    2014-03-01

    The exact mode of transmission of leprosy is not clearly understood; however, many studies have demonstrated active transmission of leprosy around a source case. Families of five active leprosy cases and their household contacts were chosen from a high endemic area in Purulia. Fifty-two soil samples were also collected from different areas of their houses. DNA was extracted from slit-skin smears (SSS) and soil samples and the Mycobacterium leprae-specific RLEP (129 bp) region was amplified using PCR. Molecular typing of M. leprae was performed for all RLEP PCR-positive samples by single nucleotide polymorphism (SNP) typing and confirmation by DNA sequencing. SSS of these five patients and six out of the total 28 contacts were PCR positive for RLEP whereas 17 soil samples out of 52 showed the presence of M. leprae DNA. SNP typing of M. leprae from all RLEP PCR-positive subjects (patients and smear-positive contacts) and 10 soil samples showed the SNP type 1 genotype. M. leprae DNA from the five leprosy patients and the six contacts was further subtyped and the D subtype was noted in all patients and contacts, except for one contact where the C subtype was identified. Typing followed by subtyping of M. leprae clearly revealed that either the contacts were infected by the patients or both patients and contacts had the same source of infection. It also revealed that the type of M. leprae in the soil in the inhabited areas where patients resided was also of the same type as that found in patients.

  6. Genome-wide single nucleotide polymorphism-based assay for high-resolution epidemiological analysis of the methicillin-resistant Staphylococcus aureus hospital clone EMRSA-15.

    Science.gov (United States)

    Holmes, A; McAllister, G; McAdam, P R; Hsien Choi, S; Girvan, K; Robb, A; Edwards, G; Templeton, K; Fitzgerald, J R

    2014-02-01

    The EMRSA-15 clone is a major cause of nosocomial methicillin-resistant Staphylococcus aureus (MRSA) infections in the UK and elsewhere but existing typing methodologies have limited capacity to discriminate closely related strains, and are often poorly reproducible between laboratories. Here, we report the design, development and validation of a genome-wide single nucleotide polymorphism (SNP) typing method and compare it to established methods for typing of EMRSA-15. In order to identify discriminatory SNPs, the genomes of 17 EMRSA-15 strains, selected to represent the breadth of genotypic and phenotypic diversity of EMRSA-15 isolates in Scotland, were determined and phylogenetic reconstruction was carried out. In addition to 17 phylogenetically informative SNPs, five binary markers were included to form the basis of an EMRSA-15 genotyping assay. The SNP-based typing assay was as discriminatory as pulsed-field gel electrophoresis, and significantly more discriminatory than staphylococcal protein A (spa) typing for typing of a representative panel of diverse EMRSA-15 strains, isolates from two EMRSA-15 hospital outbreak investigations, and a panel of bacteraemia isolates obtained in healthcare facilities in the east of Scotland during a 12-month period. The assay is a rapid, and reproducible approach for epidemiological analysis of EMRSA-15 clinical isolates in Scotland. Unlike established methods the DNA sequence-based method is ideally suited for inter-laboratory comparison of identified genotypes, and its flexibility lends itself to supplementation with additional SNPs or markers for the identification of novel S. aureus strains in other regions of the world.

  7. Identification of Diagnostic Mitochondrial DNA Single Nucleotide Polymorphisms Specific to Sumatran Orangutan (Pongo abelii Populations

    Directory of Open Access Journals (Sweden)

    Puji Rianti

    2015-10-01

    Full Text Available The hypervariable region I of mitochondrial DNA has frequently been used to distinguish among populations, in particular in species with strong female philopatry. In such cases, populations are expected to diverge rapidly for hypervariable region I markers because of the smaller effective population size and thus increased genetic drift. This rapid divergence leads to the accumulation of mutations exclusively found in one population, which may serve as diagnostic single nucleotide polymorphisms (SNPs. To date, diagnostic SNPs distinctive to Sumatran orangutan populations have not yet been described. However, given the continuously declining numbers of Sumatran orangutans, this information can be vital for effective conservation measures, especially regarding reintroductions of orangutans in rehabilitation centers. Phylogenetic analyses of 54 samples of Sumatran orangutans from nine sampling sites with good provenance, we found five major clades and a total of 20 haplotypes. We propose a total of 52 diagnostic SNPs that are specific to Sumatran orangutan populations. Data can be used to develop restriction fragment length polymorphism assays to carry out genetic assignments using basic laboratory equipment to assign Sumatran orangutan to their population of origin.

  8. Genotyping for Glycophorin GYP(B-A-B) Hybrid Genes Using a Single Nucleotide Polymorphism-Based Algorithm by Matrix-Assisted Laser Desorption/Ionisation, Time-of-Flight Mass Spectrometry.

    Science.gov (United States)

    Wei, Ling; Lopez, Genghis H; Ji, Yanli; Condon, Jennifer A; Irwin, Darryl L; Luo, Guangping; Hyland, Catherine A; Flower, Robert L

    2016-10-01

    The genetic basis for five GP(B-A-B) MNS system hybrid glycophorin blood group antigens results from rearrangement between the homologous GYPA and GYPB genes. Each hybrid glycophorin displays a characteristic profile of antigens. Currently, no commercial serological reagents are currently available to serologically type for these antigens. The aim of this study was to develop a single nucleotide polymorphism (SNP) mapping genotyping technique to allow characterisation of various GYP(B-A-B) hybrid alleles. Matrix-assisted laser desorption/ionisation time-of-flight (MALDI-TOF) mass spectrometry (MS) assays were designed to genotype five GYP(B-A-B) hybrid alleles. Eight nucleotide positions were targeted and incorporated into the SNP mapping protocol. The allelic frequencies were calculated using peak areas. Sanger sequencing was performed to resolve a GYP*Hop 3' breakpoint. Observed allelic peak area ratios either coincided with the expected ratio or were skewed (above or below) from the expected ratio with switching occurring at and after the expected break point to generate characteristic mass spectral plots for each hybrid. Sequencing showed that the GYP*Hop crossover in the intron 3 region, for this example, was identical to that for GYP*Bun reference sequence. An analytical algorithm using MALDI-TOF MS genotyping platform defined GYPA inserts for five GYP(B-A-B) hybrids. The SNP mapping technique described here demonstrates proof of concept that this technology is viable for genotyping hybrid glycophorins, GYP(A-B-A), GYP(A-B) and GYP(B-A), and addresses the gap in current typing technologies.

  9. Single-Nucleotide-Polymorphism-Based Association Mapping of Dog Stereotypes

    OpenAIRE

    Jones, Paul; Chase, Kevin; Martin, Alan; Davern, Pluis; Ostrander, Elaine A.; Lark, Karl G.

    2008-01-01

    Phenotypic stereotypes are traits, often polygenic, that have been stringently selected to conform to specific criteria. In dogs, Canis familiaris, stereotypes result from breed standards set for conformation, performance (behaviors), etc. As a consequence, phenotypic values measured on a few individuals are representative of the breed stereotype. We used DNA samples isolated from 148 dog breeds to associate SNP markers with breed stereotypes. Using size as a trait to test the method, we iden...

  10. Single-Nucleotide Variations in Cardiac Arrhythmias: Prospects for Genomics and Proteomics Based Biomarker Discovery and Diagnostics

    Directory of Open Access Journals (Sweden)

    Ayman Abunimer

    2014-03-01

    Full Text Available Cardiovascular diseases are a large contributor to causes of early death in developed countries. Some of these conditions, such as sudden cardiac death and atrial fibrillation, stem from arrhythmias—a spectrum of conditions with abnormal electrical activity in the heart. Genome-wide association studies can identify single nucleotide variations (SNVs that may predispose individuals to developing acquired forms of arrhythmias. Through manual curation of published genome-wide association studies, we have collected a comprehensive list of 75 SNVs associated with cardiac arrhythmias. Ten of the SNVs result in amino acid changes and can be used in proteomic-based detection methods. In an effort to identify additional non-synonymous mutations that affect the proteome, we analyzed the post-translational modification S-nitrosylation, which is known to affect cardiac arrhythmias. We identified loss of seven known S-nitrosylation sites due to non-synonymous single nucleotide variations (nsSNVs. For predicted nitrosylation sites we found 1429 proteins where the sites are modified due to nsSNV. Analysis of the predicted S-nitrosylation dataset for over- or under-representation (compared to the complete human proteome of pathways and functional elements shows significant statistical over-representation of the blood coagulation pathway. Gene Ontology (GO analysis displays statistically over-represented terms related to muscle contraction, receptor activity, motor activity, cystoskeleton components, and microtubule activity. Through the genomic and proteomic context of SNVs and S-nitrosylation sites presented in this study, researchers can look for variation that can predispose individuals to cardiac arrhythmias. Such attempts to elucidate mechanisms of arrhythmia thereby add yet another useful parameter in predicting susceptibility for cardiac diseases.

  11. A Chromosome 7 Pericentric Inversion Defined at Single-Nucleotide Resolution Using Diagnostic Whole Genome Sequencing in a Patient with Hand-Foot-Genital Syndrome.

    Directory of Open Access Journals (Sweden)

    Christopher M Watson

    Full Text Available Next generation sequencing methodologies are facilitating the rapid characterisation of novel structural variants at nucleotide resolution. These approaches are particularly applicable to variants initially identified using alternative molecular methods. We report a child born with bilateral postaxial syndactyly of the feet and bilateral fifth finger clinodactyly. This was presumed to be an autosomal recessive syndrome, due to the family history of consanguinity. Karyotype analysis revealed a homozygous pericentric inversion of chromosome 7 (46,XX,inv(7(p15q21x2 which was confirmed to be heterozygous in both unaffected parents. Since the resolution of the karyotype was insufficient to identify any putatively causative gene, we undertook medium-coverage whole genome sequencing using paired-end reads, in order to elucidate the molecular breakpoints. In a two-step analysis, we first narrowed down the region by identifying discordant read-pairs, and then determined the precise molecular breakpoint by analysing the mapping locations of "soft-clipped" breakpoint-spanning reads. PCR and Sanger sequencing confirmed the identified breakpoints, both of which were located in intergenic regions. Significantly, the 7p15 breakpoint was located 523 kb upstream of HOXA13, the locus for hand-foot-genital syndrome. By inference from studies of HOXA locus control in the mouse, we suggest that the inversion has delocalised a HOXA13 enhancer to produce the phenotype observed in our patient. This study demonstrates how modern genetic diagnostic approach can characterise structural variants at nucleotide resolution and provide potential insights into functional regulation.

  12. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolism....... The aim of this article is to provide knowledge of nucleotide metabolism and its regulation to facilitate interpretation of data arising from genetics, proteomics, and transcriptomics in connection with biotechnological processes and beyond....

  13. Nucleotide Metabolism

    DEFF Research Database (Denmark)

    Martinussen, Jan; Willemoës, M.; Kilstrup, Mogens

    2011-01-01

    Metabolic pathways are connected through their utilization of nucleotides as supplier of energy, allosteric effectors, and their role in activation of intermediates. Therefore, any attempt to exploit a given living organism in a biotechnological process will have an impact on nucleotide metabolism....... The aim of this article is to provide knowledge of nucleotide metabolism and its regulation to facilitate interpretation of data arising from genetics, proteomics, and transcriptomics in connection with biotechnological processes and beyond....

  14. The Prediction of Radiotherapy Toxicity Using Single Nucleotide Polymorphism-Based Models: A Step Toward Prevention

    NARCIS (Netherlands)

    S.L. Kerns (Sarah L.); S. Kundu (Suman); J.H. Oh (Jung Hun); S.K. Singhal (Sandeep K.); M. Janelsins (Michelle); L.B. Travis (Lois B.); J.O. Deasy (Joseph O.); A.C.J.W. Janssens (Cécile); H. Ostrer (Harry); M. Parliament (Matthew); N. Usmani (Nawaid); B.S. Rosenstein (Barry S.)

    2015-01-01

    textabstractRadiotherapy is a mainstay of cancer treatment, used in either a curative or palliative manner to treat approximately 50% of patients with cancer. Normal tissue toxicity limits the doses used in standard radiation therapy protocols and impedes improvements in radiotherapy efficacy. Damag

  15. Analysis of single nucleotide polymorphisms based on RNA sequencing data of diverse bio-geographical accessions in barley

    Science.gov (United States)

    Takahagi, Kotaro; Uehara-Yamaguchi, Yukiko; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo; Mochida, Keiichi; Saisho, Daisuke

    2016-01-01

    Barley is one of the founder crops of Old world agriculture and has become the fourth most important cereal worldwide. Information on genome-scale DNA polymorphisms allows elucidating the evolutionary history behind domestication, as well as discovering and isolating useful genes for molecular breeding. Deep transcriptome sequencing enables the exploration of sequence variations in transcribed sequences; such analysis is particularly useful for species with large and complex genomes, such as barley. In this study, we performed RNA sequencing of 20 barley accessions, comprising representatives of several biogeographic regions and a wild ancestor. We identified 38,729 to 79,949 SNPs in the 19 domesticated accessions and 55,403 SNPs in the wild barley and revealed their genome-wide distribution using a reference genome. Genome-scale comparisons among accessions showed a clear differentiation between oriental and occidental barley populations. The results based on population structure analyses provide genome-scale properties of sub-populations grouped to oriental, occidental and marginal groups in barley. Our findings suggest that the oriental population of domesticated barley has genomic variations distinct from those in occidental groups, which might have contributed to barley’s domestication. PMID:27616653

  16. Rapid and Reliable Single Nucleotide Polymorphism-Based Differentiation of Brucella Live Vaccine Strains from Field Strains

    Science.gov (United States)

    Brucellosis is a major zoonotic disease responsible for substantial social and economic problems, particularly in the developing world. One element that can implemented as part of control programs tackling animal disease is the use of one of the OIE recommended vaccines to protect against either Bru...

  17. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available -acting regulatory DNA elements Database kome_place_search_result.zip kome_place_search_result ... ...Nucleotide Analysis PLACE search result Result of signal search against PLACE : cis

  18. Main: Nucleotide Analysis [KOME

    Lifescience Database Archive (English)

    Full Text Available Nucleotide Analysis Japonica genome blast search result Result of blastn search against japon...ica genome sequence kome_japonica_genome_blast_search_result.zip kome_japonica_genome_blast_search_result ...

  19. Single Nucleotide Polymorphism

    DEFF Research Database (Denmark)

    Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

    2014-01-01

    Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification and bri...

  20. The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara

    2016-05-11

    Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  1. [Nucleotide receptors and renal function].

    Science.gov (United States)

    Jankowski, Maciej

    2014-01-01

    Kidney plays a key role in homeostasis of human body. It has heterogenic structure and is characterized by complicated vascular beds and numbers of sympathetic nerves endings. Nucleotides receptors are involved in the regulation of blood flow, a fundamental process for renal function. Plasma is filtrated in renal glomerulus and activity of nucleotides receptors located on cells of glomerular filter modifies the physi- cochemical properties of filter and affects the filtration process. Electrolytes, water and low molecular weight molecules are reabsorbed from tubular fluid or secreted into fluid in proximal and distal tubules. Glomerular filtration rate and activity of tubular processes are regulated via nucleotides receptors by glomerulotubularbalance and tubuloglomerular feedback. Nucleotides receptors are involved in systemic regulation of blood pressure and carbohydrate metabolism.

  2. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  3. Identification of cyclic nucleotide gated channels using regular expressions

    KAUST Repository

    Zelman, Alice K.

    2013-09-03

    Cyclic nucleotide-gated channels (CNGCs) are nonselective cation channels found in plants, animals, and some bacteria. They have a six-transmembrane/one- pore structure, a cytosolic cyclic nucleotide-binding domain, and a cytosolic calmodulin-binding domain. Despite their functional similarities, the plant CNGC family members appear to have different conserved amino acid motifs within corresponding functional domains than animal and bacterial CNGCs do. Here we describe the development and application of methods employing plant CNGC-specific sequence motifs as diagnostic tools to identify novel candidate channels in different plants. These methods are used to evaluate the validity of annotations of putative orthologs of CNGCs from plant genomes. The methods detail how to employ regular expressions of conserved amino acids in functional domains of annotated CNGCs and together with Web tools such as PHI-BLAST and ScanProsite to identify novel candidate CNGCs in species including Physcomitrella patens. © Springer Science+Business Media New York 2013.

  4. Human molecular cytogenetics: From cells to nucleotides.

    Science.gov (United States)

    Riegel, Mariluce

    2014-03-01

    The field of cytogenetics has focused on studying the number, structure, function and origin of chromosomal abnormalities and the evolution of chromosomes. The development of fluorescent molecules that either directly or via an intermediate molecule bind to DNA has led to the development of fluorescent in situ hybridization (FISH), a technology linking cytogenetics to molecular genetics. This technique has a wide range of applications that increased the dimension of chromosome analysis. The field of cytogenetics is particularly important for medical diagnostics and research as well as for gene ordering and mapping. Furthermore, the increased application of molecular biology techniques, such as array-based technologies, has led to improved resolution, extending the recognized range of microdeletion/microduplication syndromes and genomic disorders. In adopting these newly expanded methods, cytogeneticists have used a range of technologies to study the association between visible chromosome rearrangements and defects at the single nucleotide level. Overall, molecular cytogenetic techniques offer a remarkable number of potential applications, ranging from physical mapping to clinical and evolutionary studies, making a powerful and informative complement to other molecular and genomic approaches. This manuscript does not present a detailed history of the development of molecular cytogenetics; however, references to historical reviews and experiments have been provided whenever possible. Herein, the basic principles of molecular cytogenetics, the technologies used to identify chromosomal rearrangements and copy number changes, and the applications for cytogenetics in biomedical diagnosis and research are presented and discussed.

  5. Human molecular cytogenetics: from cells to nucleotides

    Directory of Open Access Journals (Sweden)

    Mariluce Riegel

    2014-01-01

    Full Text Available The field of cytogenetics has focused on studying the number, structure, function and origin of chromosomal abnormalities and the evolution of chromosomes. The development of fluorescent molecules that either directly or via an intermediate molecule bind to DNA has led to the development of fluorescent in situ hybridization (FISH, a technology linking cytogenetics to molecular genetics. This technique has a wide range of applications that increased the dimension of chromosome analysis. The field of cytogenetics is particularly important for medical diagnostics and research as well as for gene ordering and mapping. Furthermore, the increased application of molecular biology techniques, such as array-based technologies, has led to improved resolution, extending the recognized range of microdeletion/microduplication syndromes and genomic disorders. In adopting these newly expanded methods, cytogeneticists have used a range of technologies to study the association between visible chromosome rearrangements and defects at the single nucleotide level. Overall, molecular cytogenetic techniques offer a remarkable number of potential applications, ranging from physical mapping to clinical and evolutionary studies, making a powerful and informative complement to other molecular and genomic approaches. This manuscript does not present a detailed history of the development of molecular cytogenetics; however, references to historical reviews and experiments have been provided whenever possible. Herein, the basic principles of molecular cytogenetics, the technologies used to identify chromosomal rearrangements and copy number changes, and the applications for cytogenetics in biomedical diagnosis and research are presented and discussed.

  6. European Nucleotide Archive in 2016

    Science.gov (United States)

    Toribio, Ana Luisa; Alako, Blaise; Amid, Clara; Cerdeño-Tarrága, Ana; Clarke, Laura; Cleland, Iain; Fairley, Susan; Gibson, Richard; Goodgame, Neil; ten Hoopen, Petra; Jayathilaka, Suran; Kay, Simon; Leinonen, Rasko; Liu, Xin; Martínez-Villacorta, Josué; Pakseresht, Nima; Rajan, Jeena; Reddy, Kethi; Rosello, Marc; Silvester, Nicole; Smirnov, Dmitriy; Vaughan, Daniel; Zalunin, Vadim; Cochrane, Guy

    2017-01-01

    The European Nucleotide Archive (ENA; http://www.ebi.ac.uk/ena) offers a rich platform for data sharing, publishing and archiving and a globally comprehensive data set for onward use by the scientific community. With a broad scope spanning raw sequencing reads, genome assemblies and functional annotation, the resource provides extensive data submission, search and download facilities across web and programmatic interfaces. Here, we outline ENA content and major access modalities, highlight major developments in 2016 and outline a number of examples of data reuse from ENA. PMID:27899630

  7. Nucleotide Metabolism and DNA Replication.

    Science.gov (United States)

    Warner, Digby F; Evans, Joanna C; Mizrahi, Valerie

    2014-10-01

    The development and application of a highly versatile suite of tools for mycobacterial genetics, coupled with widespread use of "omics" approaches to elucidate the structure, function, and regulation of mycobacterial proteins, has led to spectacular advances in our understanding of the metabolism and physiology of mycobacteria. In this article, we provide an update on nucleotide metabolism and DNA replication in mycobacteria, highlighting key findings from the past 10 to 15 years. In the first section, we focus on nucleotide metabolism, ranging from the biosynthesis, salvage, and interconversion of purine and pyrimidine ribonucleotides to the formation of deoxyribonucleotides. The second part of the article is devoted to DNA replication, with a focus on replication initiation and elongation, as well as DNA unwinding. We provide an overview of replication fidelity and mutation rates in mycobacteria and summarize evidence suggesting that DNA replication occurs during states of low metabolic activity, and conclude by suggesting directions for future research to address key outstanding questions. Although this article focuses primarily on observations from Mycobacterium tuberculosis, it is interspersed, where appropriate, with insights from, and comparisons with, other mycobacterial species as well as better characterized bacterial models such as Escherichia coli. Finally, a common theme underlying almost all studies of mycobacterial metabolism is the potential to identify and validate functions or pathways that can be exploited for tuberculosis drug discovery. In this context, we have specifically highlighted those processes in mycobacterial DNA replication that might satisfy this critical requirement.

  8. Electroanalysis of single-nucleotide polymorphism by hairpin DNA architectures.

    Science.gov (United States)

    Abi, Alireza; Ferapontova, Elena E

    2013-04-01

    Genetic analysis of infectious and genetic diseases and cancer diagnostics require the development of efficient tools for fast and reliable analysis of single-nucleotide polymorphism (SNP) in targeted DNA and RNA sequences often responsible for signalling disease onset. Here, we highlight the main trends in the development of electrochemical genosensors for sensitive and selective detection of SNP that are based on hairpin DNA architectures exhibiting better SNP recognition properties compared with linear DNA probes. SNP detection by electrochemical hairpin DNA beacons is discussed, and comparative analysis of the existing SNP sensing strategies based on enzymatic and nanoparticle signal amplification schemes is presented.

  9. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-09-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  10. Nucleotide Selectivity in Abiotic RNA Polymerization Reactions

    Science.gov (United States)

    Coari, Kristin M.; Martin, Rebecca C.; Jain, Kopal; McGown, Linda B.

    2017-02-01

    In order to establish an RNA world on early Earth, the nucleotides must form polymers through chemical rather than biochemical reactions. The polymerization products must be long enough to perform catalytic functions, including self-replication, and to preserve genetic information. These functions depend not only on the length of the polymers, but also on their sequences. To date, studies of abiotic RNA polymerization generally have focused on routes to polymerization of a single nucleotide and lengths of the homopolymer products. Less work has been done the selectivity of the reaction toward incorporation of some nucleotides over others in nucleotide mixtures. Such information is an essential step toward understanding the chemical evolution of RNA. To address this question, in the present work RNA polymerization reactions were performed in the presence of montmorillonite clay catalyst. The nucleotides included the monophosphates of adenosine, cytosine, guanosine, uridine and inosine. Experiments included reactions of mixtures of an imidazole-activated nucleotide (ImpX) with one or more unactivated nucleotides (XMP), of two or more ImpX, and of XMP that were activated in situ in the polymerization reaction itself. The reaction products were analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS) to identify the lengths and nucleotide compositions of the polymerization products. The results show that the extent of polymerization, the degree of heteropolymerization vs. homopolymerization, and the composition of the polymeric products all vary among the different nucleotides and depend upon which nucleotides and how many different nucleotides are present in the mixture.

  11. Astrovirus Diagnostics

    Science.gov (United States)

    Pérot, Philippe; Lecuit, Marc; Eloit, Marc

    2017-01-01

    Various methods exist to detect an astrovirus infection. Current methods include electron microscopy (EM), cell culture, immunoassays, polymerase chain reaction (PCR) and various other molecular approaches that can be applied in the context of diagnostic or in surveillance studies. With the advent of metagenomics, novel human astrovirus (HAstV) strains have been found in immunocompromised individuals in association with central nervous system (CNS) infections. This work reviews the past and current methods for astrovirus detection and their uses in both research laboratories and for medical diagnostic purposes. PMID:28085120

  12. Sublingual nucleotides and immune response to exercise

    Directory of Open Access Journals (Sweden)

    Ostojic Sergej M

    2012-07-01

    Full Text Available Abstract Evidence exists regarding the potential role of exogenous nucleotides as regulators of the immune function in physically active humans, yet the potential use of nucleotides has been hindered by their low bioavailability after oral administration. We conducted a double-blind, placebo-controlled, randomized trial to assess the effect of sublingual nucleotides (50 mg/day on salivary and serum immunity indicators as compared to placebo, both administered to healthy males aged 20 to 25 years for 14 days. Sublingual administration of nucleotides for 14 days increased serum immunoglobulin A, natural killer cells count and cytotoxic activity, and offset the post-exercise drop of salivary immunoglobulins and lactoferrin (P  0.05. It seems that sublingual administration of nucleotides for two weeks considerably affected immune function in healthy males.

  13. Nucleotide Salvage Deficiencies, DNA Damage and Neurodegeneration

    Directory of Open Access Journals (Sweden)

    Michael Fasullo

    2015-04-01

    Full Text Available Nucleotide balance is critically important not only in replicating cells but also in quiescent cells. This is especially true in the nervous system, where there is a high demand for adenosine triphosphate (ATP produced from mitochondria. Mitochondria are particularly prone to oxidative stress-associated DNA damage because nucleotide imbalance can lead to mitochondrial depletion due to low replication fidelity. Failure to maintain nucleotide balance due to genetic defects can result in infantile death; however there is great variability in clinical presentation for particular diseases. This review compares genetic diseases that result from defects in specific nucleotide salvage enzymes and a signaling kinase that activates nucleotide salvage after DNA damage exposure. These diseases include Lesch-Nyhan syndrome, mitochondrial depletion syndromes, and ataxia telangiectasia. Although treatment options are available to palliate symptoms of these diseases, there is no cure. The conclusions drawn from this review include the critical role of guanine nucleotides in preventing neurodegeneration, the limitations of animals as disease models, and the need to further understand nucleotide imbalances in treatment regimens. Such knowledge will hopefully guide future studies into clinical therapies for genetic diseases.

  14. Nucleotides and inorganic phosphates as potential antioxidants.

    Science.gov (United States)

    Richter, Yael; Fischer, Bilha

    2006-11-01

    Highly reactive OH radicals, formed in an iron-ion catalyzed Fenton reaction, are implicated in many pathological conditions. The quest for Fenton reaction inhibitors, either radical scavenger or metal-ion chelator antioxidants, spans the previous decades. Purine nucleotides were previously studied as natural modulators of the Fenton reaction; however, the modulatory role of purine nucleotides remained in dispute. Here, we have resolved this long-standing dispute and demonstrated a concentration-dependent biphasic modulation of the Fenton reaction by nucleotides. By electron spin resonance measurements with 0.1 mM Fe(II), we observed an increase of *OH production at low purine nucleotide concentrations (up to 0.15 mM), while at higher nucleotide concentrations, an exponential decay of *OH concentration was observed. We found that the phosphate moiety, not the nucleoside, determines the pro/antioxidant properties of a nucleotide, suggesting a chelation-based modulation. Furthermore, the biphasic modulation mode is probably due to diverse nucleotide-Fe(II) complexes formed in a concentration-dependent manner. At ATP concentrations much greater than Fe(II) concentrations, multiligand chelates are formed which inhibit the Fenton reaction owing to a full Fe(II) coordination sphere. In addition to natural nucleotides, we investigated a series of base- or phosphate-modified nucleotides, dinucleotides, and inorganic phosphates, as potential biocompatible antioxidants. Ap5A, inorganic thiophosphate and ATP-gamma-S proved highly potent antioxidants with IC50 values of 40, 30, and 10 microM, respectively. ATP-gamma-S proved 100 and 20 times more active than ATP and the potent antioxidant Trolox, respectively. In the presence of 30 microM ATP-gamma-S no *OH was detected after 5 min in the Fenton reaction mixture. The most potent antioxidants identified inhibit the Fenton reaction by forming full coordination sphere chelates.

  15. Nucleotide excision repair in the test tube.

    NARCIS (Netherlands)

    N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

    1995-01-01

    textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

  16. Effects of nucleotides and nucleosides on coagulation

    DEFF Research Database (Denmark)

    Bune, Laurids; Thaning, Pia; Johansson, Pär I;

    2010-01-01

    Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminated...... intravascular coagulation. We investigated whether nucleotide-induced cardiovascular collapse as provoked by systemic infusion of adenosine, ADP, ATP, UTP and nitric oxide affected the haemostatic system as assessed by whole blood thromboelastography (TEG) analysis. Ten pigs received a randomized infusion...

  17. Development and Evaluation of a Molecular Diagnostic Method for Rapid Detection of Histoplasma capsulatum var. farciminosum, the Causative Agent of Epizootic Lymphangitis, in Equine Clinical Samples.

    Science.gov (United States)

    Scantlebury, C E; Pinchbeck, G L; Loughnane, P; Aklilu, N; Ashine, T; Stringer, A P; Gordon, L; Marshall, M; Christley, R M; McCarthy, A J

    2016-12-01

    Histoplasma capsulatum var. farciminosum, the causative agent of epizootic lymphangitis (EZL), is endemic in parts of Africa. Diagnosis based on clinical signs and microscopy lacks specificity and is a barrier to further understanding this neglected disease. Here, a nested PCR method targeting the internal transcribed spacer (ITS) region of the rRNA operon was validated for application to equine clinical samples. Twenty-nine horses with signs of EZL from different climatic regions of Ethiopia were clinically examined. Blood samples and aspirates of pus from cutaneous nodules were taken, along with blood from a further 20 horses with no cutaneous EZL lesions. Among the 29 horses with suspected cases of EZL, H. capsulatum var. farciminosum was confirmed by extraction of DNA from pus and blood samples from 25 and 17 horses, respectively. Positive PCR results were also obtained with heat-inactivated pus (24 horses) and blood (23 horses) spotted onto Whatman FTA cards. Two positive results were obtained among blood samples from 20 horses that did not exhibit clinical signs of EZL. These are the first reports of the direct detection of H. capsulatum var. farciminosum in equine blood and at high frequency among horses exhibiting cutaneous lesions. The nested PCR outperformed conventional microscopic diagnosis, as characteristic yeast cells could be observed only in 14 pus samples. The presence of H. capsulatum var. farciminosum DNA was confirmed by sequencing the cloned PCR products, and while alignment of the ITS amplicons showed very little sequence variation, there was preliminary single nucleotide polymorphism-based evidence for the existence of two subgroups of H. capsulatum var. farciminosum This molecular diagnostic method now permits investigation of the epidemiology of EZL.

  18. Single-strand conformation polymorphism-based analysis reveals genetic variation within Spirometra erinacei (Cestoda: Pseudophyllidea) from Australia.

    Science.gov (United States)

    Zhu, X Q; Beveridge, I; Berger, L; Barton, D; Gasser, R B

    2002-04-01

    This study examined genetic variability within Spirometra erinacei (Cestoda: Pseudophyllidea) from different host species and geographical origins in Australia using a polymerase chain reaction (PCR)-based mutation detection approach, followed by DNA sequencing. Part of the cytochrome c oxidase subunit 1 gene (p cox 1) was amplified by PCR, scanned for sequence variation by single-strand conformation polymorphism (SSCP), and representative samples from different host species were selected for DNA sequencing. While no variation in SSCP profiles was detected among S. erinacei samples from dog, fox, cat, tiger snake and python, they differed in profile from 5 specimens from the green tree frog (Litoria caerulea). This was supported by sequence data which demonstrated that p cox 1 sequences of samples from the latter host species differed at 8 of 393 (2%) nucleotide positions from those from the non-amphibian host. Using a nucleotide difference in the p cox 1 sequence, a PCR-linked restriction fragment length polymorphism (RFLP) could be employed to unequivocally delineate between samples from non-amphibian and amphibian hosts. These findings demonstrate the existence of at least two genotypes within S. erinacei, which may have important implications for studying the epidemiology, ecology and systematics of this cestode.

  19. Thyroid diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Scriba, P.C.; Boerner, W.; Emrich, S.; Gutekunst, R.; Herrmann, J.; Horn, K.; Klett, M.; Krueskemper, H.L.; Pfannenstiel, P.; Pickardt, C.R.

    1985-03-01

    None of the in-vitro and in-vivo methods listed permits on unambiguous diagnosis when applied alone, owing to the fact that similar or even identical findings are obtained for various individual parameters in different thyroid diseases. Further, especially the in-vitro tests are also subject to extrathyroidal effects which may mask the typical findings. The limited and varying specificity and sensitivity of the tests applied, as well as the falsification of results caused by the patients' idiosyncracies and the methodology, make it necessary to interpret and evaluate the in-vivo and in-vitro findings only if the clinical situation (anamnesis and physical examination) is known. For maximum diagnostic quality of the tests, the initial probability of the assumed type of thyroid disease must be increased (formulation of the clinical problem). The concepts of exclusion diagnosis and identification must be distinguished as well as the diagnosis of functional disturbances on the one hand and of thyroid diseases on the other. Both of this requires a qualified, specific and detailed anamnesis and examination procedure, and the clinical examination remains the obligatory basis of clinical diagnostics. In case of inexplicable discrepancies between the clinical manifestations and the findings obtained with specific methods, or between the findings obtained with a specific method, the patient should be referred to an expert institution, or the expert institution should be consulted.

  20. EST, COSII, and arbitrary gene markers give similar estimates of nucleotide diversity in cultivated tomato (Solanum lycopersicum L.).

    Science.gov (United States)

    Labate, Joanne A; Robertson, Larry D; Wu, Feinan; Tanksley, Steven D; Baldo, Angela M

    2009-03-01

    Because cultivated tomato (Solanum lycopersicum L.) is low in genetic diversity, public, verified single nucleotide polymorphism (SNP) markers within the species are in demand. To promote marker development we resequenced approximately 23 kb in a diverse set of 31 tomato lines including TA496. Three classes of markers were sampled: (1) 26 expressed-sequence tag (EST), all of which were predicted to be polymorphic based on TA496, (2) 14 conserved ortholog set II (COSII) or unigene, and (3) ten published sequences, composed of nine fruit quality genes and one anonymous RFLP marker. The latter two types contained mostly noncoding DNA. In total, 154 SNPs and 34 indels were observed. The distributions of nucleotide diversity estimates among marker types were not significantly different from each other. Ascertainment bias of SNPs was evaluated for the EST markers. Despite the fact that the EST markers were developed using SNP prediction within a sample consisting of only one TA496 allele and one additional allele, the majority of polymorphisms in the 26 EST markers were represented among the other 30 tomato lines. Fifteen EST markers with published SNPs were more closely examined for bias. Mean SNP diversity observations were not significantly different between the original discovery sample of two lines (53 SNPs) and the 31 line diversity panel (56 SNPs). Furthermore, TA496 shared its haplotype with at least one other line at 11 of the 15 markers. These data demonstrate that public EST databases and noncoding regions are a valuable source of unbiased SNP markers in tomato.

  1. Rotorcraft Diagnostics

    Science.gov (United States)

    Haste, Deepak; Azam, Mohammad; Ghoshal, Sudipto; Monte, James

    2012-01-01

    Health management (HM) in any engineering systems requires adequate understanding about the system s functioning; a sufficient amount of monitored data; the capability to extract, analyze, and collate information; and the capability to combine understanding and information for HM-related estimation and decision-making. Rotorcraft systems are, in general, highly complex. Obtaining adequate understanding about functioning of such systems is quite difficult, because of the proprietary (restricted access) nature of their designs and dynamic models. Development of an EIM (exact inverse map) solution for rotorcraft requires a process that can overcome the abovementioned difficulties and maximally utilize monitored information for HM facilitation via employing advanced analytic techniques. The goal was to develop a versatile HM solution for rotorcraft for facilitation of the Condition Based Maintenance Plus (CBM+) capabilities. The effort was geared towards developing analytic and reasoning techniques, and proving the ability to embed the required capabilities on a rotorcraft platform, paving the way for implementing the solution on an aircraft-level system for consolidation and reporting. The solution for rotorcraft can he used offboard or embedded directly onto a rotorcraft system. The envisioned solution utilizes available monitored and archived data for real-time fault detection and identification, failure precursor identification, and offline fault detection and diagnostics, health condition forecasting, optimal guided troubleshooting, and maintenance decision support. A variant of the onboard version is a self-contained hardware and software (HW+SW) package that can be embedded on rotorcraft systems. The HM solution comprises components that gather/ingest data and information, perform information/feature extraction, analyze information in conjunction with the dependency/diagnostic model of the target system, facilitate optimal guided troubleshooting, and offer

  2. Design and synthesis of ATP-based nucleotide analogues and profiling of nucleotide-binding proteins

    NARCIS (Netherlands)

    Wolters, Justina. C.; Roelfes, Gerard; Poolman, Bert

    2011-01-01

    Two nucleotide-based probes were designed and synthesized in order to enrich samples for specific classes of proteins by affinity-based protein profiling. We focused on the profiling of adenine nucleotide-binding proteins. Two properties were considered in the design of the probes: the bait needs to

  3. Design and synthesis of ATP-based nucleotide analogues and profiling of nucleotide-binding proteins

    NARCIS (Netherlands)

    Wolters, Justina. C.; Roelfes, Gerard; Poolman, Bert

    Two nucleotide-based probes were designed and synthesized in order to enrich samples for specific classes of proteins by affinity-based protein profiling. We focused on the profiling of adenine nucleotide-binding proteins. Two properties were considered in the design of the probes: the bait needs to

  4. The International Nucleotide Sequence Database Collaboration

    Science.gov (United States)

    Cochrane, Guy; Karsch-Mizrachi, Ilene; Takagi, Toshihisa; Sequence Database Collaboration, International Nucleotide

    2016-01-01

    The International Nucleotide Sequence Database Collaboration (INSDC; http://www.insdc.org) comprises three global partners committed to capturing, preserving and providing comprehensive public-domain nucleotide sequence information. The INSDC establishes standards, formats and protocols for data and metadata to make it easier for individuals and organisations to submit their nucleotide data reliably to public archives. This work enables the continuous, global exchange of information about living things. Here we present an update of the INSDC in 2015, including data growth and diversification, new standards and requirements by publishers for authors to submit their data to the public archives. The INSDC serves as a model for data sharing in the life sciences. PMID:26657633

  5. A genotype-by-sequencing-single nucleotide polymorphism based linkage map and quantitative trait loci (QTL) associated with resistance to Fusarium oxysporum f. sp. niveum race 2 identified in Citrullus lanatus var. citroides

    Science.gov (United States)

    Fusarium wilt, a fungal disease caused by Fusarium oxysporum f. sp. niveum (Fon), devastates watermelon crop production worldwide. Several races, which are differentiated by host range, of the pathogen exist. Resistance to Fon race 2, a particularly virulent strain prevalent in the United States, do...

  6. Effects of nucleotides and nucleosides on coagulation

    DEFF Research Database (Denmark)

    Bune, Laurids; Thaning, Pia; Johansson, Pär I;

    2010-01-01

    intravascular coagulation. We investigated whether nucleotide-induced cardiovascular collapse as provoked by systemic infusion of adenosine, ADP, ATP, UTP and nitric oxide affected the haemostatic system as assessed by whole blood thromboelastography (TEG) analysis. Ten pigs received a randomized infusion......Nucleotides, including ADP, ATP and uridine triphosphate (UTP), are discharged profusely in the circulation during many pathological conditions including sepsis. Sepsis can cause hypotension and systemic activation of the coagulation and fibrinolytic systems in humans, which may cause disseminated.......7 ng/ml; P blood was evaluated by TEG. Circulating ADP induces hypocoagulation without signs of increased fibrinolysis as evaluated by TEG. The potential...

  7. Introduction of an single nucleodite polymorphism-based "Major Y-chromosome haplogroup typing kit" suitable for predicting the geographical origin of male lineages

    DEFF Research Database (Denmark)

    Brión, María; Sanchez, Juan J; Balogh, Kinga

    2005-01-01

    The European Consortium "High-throughput analysis of single nucleotide polymorphisms for the forensic identification of persons--SNPforID", has performed a selection of candidate Y-chromosome single nucleotide polymorphisms (SNPs) for making inferences on the geographic origin of an unknown sampl...

  8. Diagnostic thoracoscopy

    Directory of Open Access Journals (Sweden)

    Plavec Goran

    2002-01-01

    Full Text Available Diagnostic thoracoscopy in patients with pleural effusion of unclear origin mostly provides the correct diagnosis. Results from published reports of previous researches are not uniform. In 47 male and 20 female patients with pleural effusion of unknown etiology, after receiving negative results obtained from cytological finding of pleural effusion and percutaneous needle biopsy, thoracoscopy with biopsy of one or both pleurae was performed. Procedure was done in local anesthesia using Stortz rigid thoracoscope. In 37 patients with malignant disease (primary or metastatic diagnosis was confirmed histopathologically in 31 patient (81.12%. In 27 patients with inflammatory pleural disease diagnosis was confirmed histopathologically in 22 patients (81.4%. Among 11 patients with specific pleural effusions, tuberculosis was confirmed in 10 (90.91%. Normal finding in cases of spontaneous pneumothorax and pulmonary embolism was taken as a positive result. Total number of positive findings was 55 (82.10%. In one patient, the third spontaneous pneumothorax was the indication for thoracoscopy, and after numerous bullae were seen during the procedure, talcum powder pleurodesis was done. In four patients low intensity subcutaneous emphysema occurred one day after thoracoscopy. It can be concluded that thoracoscopy in local anesthesia out of the operating room is good and practical method for solving the unclear pleural effusions, with neglectable rate of complications.

  9. [Sublicons containing amino acids and nucleotides].

    Science.gov (United States)

    Kaĭmakov, E A

    1979-01-01

    Sublicons have been obtained. Sublicons are threadlike structures appearing during sublimation of frozen solutions of small concentrations, containing racemate mixture of amino acids and nucleotides. It is suggested that close location of chains and their zonal distribution by the section of helix spire forming sublicon wall, should provide the formation of stereohomogenous and complementary successions of biomonomers of different clases.

  10. Diagnostic value of array-based single nucleotide polymorphisms comparative genomic hybridization in An-gelman syndrome%单核苷酸多态性比较基因组杂交技术对Angelman综合征的诊断价值

    Institute of Scientific and Technical Information of China (English)

    高晶; 何玺玉; 杨尧; 吴虹林

    2015-01-01

    Objective To analyze the genotype-phenotype correlations of Angelman syndrome ( AS ) , and to discuss the advantage of applying array-based single nucleotide polymorphisms comparative genomic hybridization ( SNP aCGH) in diagnosis of AS. Methods Examination of electroencephalogram( EEG) and intelligence quotient( IQ) evaluation were done for 11 cases diagnosed as AS clinically. Gesell scares were chosen as the evaluation criterion of IQ. The screening techniques was methylation polymerase chain reaction( MS-PCR) ,then SNP aCGH was used to make genetic diagnosis. Results (1)Eleven cases of AS were confirmed:1 case had UPD(uniparental disomy),10 cases were type of deletion, from which 6 cases were deletion (Ⅱ) , 4 cases were deletion (Ⅰ) . ( 2 ) The copy number variations were detected in the region of 15q11-q13,which contained genes like MKRN3,MAGEL2,NDN,SNRPN, SNURF,GABRB3,GABRA5,GABRG3,UBE3A,OCA2,ATP10A. To search online Mendelian inheritance in man,genes above were correlated with AS manifestation. (3)All cases of deletion were 3-5 standard deviation(SD) in weight and height to normal children at the same age and with the same sex,while UPD was below 1. 5 SD. Gesell scares showed that the deletion(Ⅰ) was the most serious in mental retardation,deletion(Ⅱ) was moderate,and the UPD was mild. Eight cases were hypopigmentation,and one was the UPD. EEG revealed that 1 case of deletion(Ⅰ) and the UPD were spike occasionally,another one deletion(Ⅰ) was limit EEG. The rest cases displayed slow and spike waves paroxysmal-ly,with amplitude of medium or high,2. 5-3. 0 Hz. Conclusions Not only can SNP aCGH make a diagnosis of AS but discriminate the types of genetic pathology. Since different type contributes to a diverse of clinical features and the rate of recurrence is also different,it is significant for family genetic consultation. Moreover,the technology is advantageous for the study on the pathogenesis and gene function.%目的:分析Angelman

  11. Radiation and thermal stabilities of adenine nucleotides.

    Science.gov (United States)

    Demidov, V V; Potaman, V N; Solyanina, I P; Trofimov, V I

    1995-03-01

    We have investigated in detail radiation and thermal stabilities and transformations of adenosine mono- and triphosphates in liquid and frozen solid aqueous solutions within a wide range of absorbed radiation dose (up to 75 kGy) and temperature (up to 160 degrees C). Dephosphorylation is the main pathway of high temperature hydrolysis of adenine nucleotides. Basic thermodynamic and kinetic parameters of this process have been determined. Radiolysis of investigated compounds at room temperature results in scission of N-glycosidic bond with a radiation yield about of 1 mol/100 eV. Solution freezing significantly enhances radiation stability of nucleotides as well as other biomolecules. This circumstance is essential in the discussion of panspermia concepts.

  12. Nucleotide sequence of papaya mosaic virus RNA.

    Science.gov (United States)

    Sit, T L; Abouhaidar, M G; Holy, S

    1989-09-01

    The RNA genome of papaya mosaic virus is 6656 nucleotides long [excluding the poly(A) tail] with six open reading frames (ORFs) more than 200 nucleotides long. The four nearest the 5' end each overlap with adjacent ORFs and could code for proteins with Mr 176307, 26248, 11949 and 7224 (ORFs 1 to 4). The fifth ORF produces the capsid protein of Mr 23043 and the sixth ORF, located completely within ORF1, could code for a protein with Mr 14113. The translation products of ORFs 1 to 3 show strong similarity with those of other potexviruses but the ORF 4 protein has only limited similarity with the other potexvirus ORF 4 proteins of 7K to 11K.

  13. Nucleotide Manipulatives to Illustrate the Central Dogma

    Directory of Open Access Journals (Sweden)

    Sonja B. Yung

    2015-08-01

    Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

  14. Visualization of cyclic nucleotide dynamics in neurons

    Directory of Open Access Journals (Sweden)

    Kirill eGorshkov

    2014-12-01

    Full Text Available The second messengers cAMP and cGMP transduce many neuromodulatory signals from hormones and neurotransmitters into specific functional outputs. Their production, degradation and signaling are spatiotemporally regulated to achieve high specificity in signal transduction. The development of genetically encodable fluorescent biosensors has provided researchers with useful tools to study these versatile second messengers and their downstream effectors with unparalleled spatial and temporal resolution in cultured cells and living animals. In this review, we introduce the general design of these fluorescent biosensors and describe several of them in more detail. Then we discuss a few examples of using cyclic nucleotide fluorescent biosensors to study regulation of neuronal function and finish with a discussion of advances in the field. Although there has been significant progress made in understanding how the specific signaling of cyclic nucleotide second messengers is achieved, the mechanistic details in complex cell types like neurons are only just beginning to surface. Current and future fluorescent protein reporters will be essential to elucidate the role of cyclic nucleotide signaling dynamics in the functions of individual neurons and their networks.

  15. Nucleotide-Dependent Bioautocatalytic Timer Reaction.

    Science.gov (United States)

    Chen, Ting-Ru; Hsu, Ching-Fong; Chen, Chih-Lin; Witek, Henryk A; Urban, Pawel L

    2016-09-16

    We describe a biochemical timer composed of three biocatalytic reactions involving three types of adenylate nucleotides: adenosine triphosphate (ATP), adenosine diphosphate (ADP), and adenosine monophosphate (AMP). The timer is triggered by a small amount of ATP or ADP. An abrupt increase in the ATP concentration (following numerous amplification cycles) leads to a sudden increase of luminescence from the reaction mixture. The time point when the luminescence appears is found to be a function of the initial concentration of the triggering nucleotide (5.0 × 10(-8)-1.0 × 10(-6) M), even in the presence of a complex biological matrix. The mechanism of the observed dependence of the time of luminescence increase on the concentration has been confirmed with simple kinetic models. Due to the biocompatibility of the proposed trienzymatic reaction scheme (sensitivity to common nucleotides and occurrence in a neutral pH aqueous environment), the scheme can be used in bioengineered systems that require modulation of the response time (light emission) by concentration.

  16. Multiphasic interactions between nucleotides and target proteins

    CERN Document Server

    Nissen, Per

    2016-01-01

    The nucleotides guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) bind to target proteins to promote bacterial survival (Corrigan et al. 2016). Thus, the binding of the nucleotides to RsgA, a GTPase, inhibits the hydrolysis of GTP. The dose response, taken to be curvilinear with respect to the logarithm of the inhibitor concentration, is instead much better (P<0.001 when the 6 experiments are combined) represented as multiphasic, with high to exceedingly high absolute r values for the straight lines, and with transitions in the form of non-contiguities (jumps). Profiles for the binding of radiolabeled nucleotides to HprT and Gmk, GTP synthesis enzymes, were, similarly, taken to be curvilinear with respect to the logarithm of the protein concentration. However, the profiles are again much better represented as multiphasic than as curvilinear (the P values range from 0.047 to <0.001 for each of the 8 experiments for binding of ppGpp and pppGpp to HprT). The binding of GTP to HprT and ...

  17. Vacuum ultraviolet photoionization of carbohydrates and nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Joong-Won, E-mail: jshin@govst.edu [Division of Science, Governors State University, University Park, Illinois 60484-0975 (United States); Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States); Bernstein, Elliot R., E-mail: erb@lamar.colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-28

    Carbohydrates (2-deoxyribose, ribose, and xylose) and nucleotides (adenosine-, cytidine-, guanosine-, and uridine-5{sup ′}-monophosphate) are generated in the gas phase, and ionized with vacuum ultraviolet photons (VUV, 118.2 nm). The observed time of flight mass spectra of the carbohydrate fragmentation are similar to those observed [J.-W. Shin, F. Dong, M. Grisham, J. J. Rocca, and E. R. Bernstein, Chem. Phys. Lett. 506, 161 (2011)] for 46.9 nm photon ionization, but with more intensity in higher mass fragment ions. The tendency of carbohydrate ions to fragment extensively following ionization seemingly suggests that nucleic acids might undergo radiation damage as a result of carbohydrate, rather than nucleobase fragmentation. VUV photoionization of nucleotides (monophosphate-carbohydrate-nucleobase), however, shows that the carbohydrate-nucleobase bond is the primary fragmentation site for these species. Density functional theory (DFT) calculations indicate that the removed carbohydrate electrons by the 118.2 nm photons are associated with endocyclic C–C and C–O ring centered orbitals: loss of electron density in the ring bonds of the nascent ion can thus account for the observed fragmentation patterns following carbohydrate ionization. DFT calculations also indicate that electrons removed from nucleotides under these same conditions are associated with orbitals involved with the nucleobase-saccharide linkage electron density. The calculations give a general mechanism and explanation of the experimental results.

  18. Dbl family guanine nucleotide exchange factors.

    Science.gov (United States)

    Zheng, Y

    2001-12-01

    The Dbl family of guanine nucleotide exchange factors are multifunctional molecules that transduce diverse intracellular signals leading to the activation of Rho GTPases. The tandem Dbl-homology and pleckstrin-homology domains shared by all members of this family represent the structural module responsible for catalyzing the GDP-GTP exchange reaction of Rho proteins. Recent progress in genomic, genetic, structural and biochemical studies has implicated Dbl family members in diverse biological processes, including growth and development, skeletal muscle formation, neuronal axon guidance and tissue organization. The detailed pictures of their autoregulation, agonist-controlled activation and mechanism of interaction with Rho GTPase substrates, have begun to emerge.

  19. Histone displacement during nucleotide excision repair

    DEFF Research Database (Denmark)

    Dinant, C.; Bartek, J.; Bekker-Jensen, S.

    2012-01-01

    Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER. © 2012 by the authors; licensee MDPI, Basel...

  20. In Vitro Selection Using Modified or Unnatural Nucleotides

    Science.gov (United States)

    Stovall, Gwendolyn M.; Bedenbaugh, Robert S.; Singh, Shruti; Meyer, Adam J.; Hatala, Paul J.; Ellington, Andrew D.; Hall, Bradley

    2014-01-01

    Incorporation of modified nucleotides into in vitro RNA or DNA selections offer many potential advantages, such as the increased stability of selected nucleic acids against nuclease degradation, improved affinities, expanded chemical functionality, and increased library diversity. This unit provides useful information and protocols for in vitro selection using modified nucleotides. It includes a discussion of when to use modified nucleotides; protocols for evaluating and optimizing transcription reactions, as well as confirming the incorporation of the modified nucleotides; protocols for evaluating modified nucleotide transcripts as template in reverse transcription reactions; protocols for the evaluation of the fidelity of modified nucleotides in the replication and the regeneration of the pool; and a protocol to compare modified nucleotide pools and selection conditions. PMID:25606981

  1. [Identification of single nucleotide polymorphisms in centenarians].

    Science.gov (United States)

    Gambini, Juan; Gimeno-Mallench, Lucía; Inglés, Marta; Olaso, Gloria; Abdelaziz, Kheira Mohamed; Avellana, Juan Antonio; Belenguer, Ángel; Cruz, Raquel; Mas-Bargues, Cristina; Borras, Consuelo; Viña, José

    2016-01-01

    Longevity is determined by genetic and external factors, such as nutritional, environmental, social, etc. Nevertheless, when living conditions are optimal, longevity is determined by genetic variations between individuals. In a same population, with relative genotypic homogeneity, subtle changes in the DNA sequence affecting a single nucleotide can be observed. These changes, called single nucleotide polymorphisms (SNP) are present in 1-5% of the population. A total of 92 subjects were recruited, including 28 centenarians and 64 controls, in order to find SNP that maybe implicated in the extreme longevity, as in the centenarians. Blood samples were collected to isolate and amplify the DNA in order to perform the analysis of SPN by Axiom™ Genotyping of Affymetrix technology. Statistical analyses were performed using the Plink program and libraries SNPassoc and skatMeta. Our results show 12 mutations with a p<.001, where 5 of these (DACH1, LOC91948, BTB16, NFIL3 y HDAC4) have regulatory functions of the expressions of others genes. Therefore, these results suggest that the genetic variation between centenarians and controls occurs in five genes that are involved in the regulation of gene expression to adapt to environmental changes better than controls. Copyright © 2015 SEGG. Published by Elsevier Espana. All rights reserved.

  2. Estimation of evolutionary distances between nucleotide sequences.

    Science.gov (United States)

    Zharkikh, A

    1994-09-01

    A formal mathematical analysis of the substitution process in nucleotide sequence evolution was done in terms of the Markov process. By using matrix algebra theory, the theoretical foundation of Barry and Hartigan's (Stat. Sci. 2:191-210, 1987) and Lanave et al.'s (J. Mol. Evol. 20:86-93, 1984) methods was provided. Extensive computer simulation was used to compare the accuracy and effectiveness of various methods for estimating the evolutionary distance between two nucleotide sequences. It was shown that the multiparameter methods of Lanave et al.'s (J. Mol. Evol. 20:86-93, 1984), Gojobori et al.'s (J. Mol. Evol. 18:414-422, 1982), and Barry and Hartigan's (Stat. Sci. 2:191-210, 1987) are preferable to others for the purpose of phylogenetic analysis when the sequences are long. However, when sequences are short and the evolutionary distance is large, Tajima and Nei's (Mol. Biol. Evol. 1:269-285, 1984) method is superior to others.

  3. Classifying Coding DNA with Nucleotide Statistics

    Directory of Open Access Journals (Sweden)

    Nicolas Carels

    2009-10-01

    Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

  4. Rasp21 sequences opposite the nucleotide binding pocket are required for GRF-mediated nucleotide release

    DEFF Research Database (Denmark)

    Leonardsen, L; DeClue, J E; Lybaek, H;

    1996-01-01

    , the sensitivity of H-Ras to GRF was abolished when residues 130-139 were replaced by proline-aspartic acid-glutamine, whereas substitution of the entire loop 8 (residues 123-130 replaced by leucine-isoleucine-arginine) had no effect on the stimulation of guanine nucleotide release by GRF. Substrate activity...

  5. Mutations of PKA cyclic nucleotide-binding domains reveal novel aspects of cyclic nucleotide selectivity.

    Science.gov (United States)

    Lorenz, Robin; Moon, Eui-Whan; Kim, Jeong Joo; Schmidt, Sven H; Sankaran, Banumathi; Pavlidis, Ioannis V; Kim, Choel; Herberg, Friedrich W

    2017-07-06

    Cyclic AMP and cyclic GMP are ubiquitous second messengers that regulate the activity of effector proteins in all forms of life. The main effector proteins, the 3',5'-cyclic adenosine monophosphate (cAMP)-dependent protein kinase (PKA) and the 3',5'-cyclic guanosine monophosphate (cGMP)-dependent protein kinase (PKG), are preferentially activated by cAMP and cGMP, respectively. However, the molecular basis of this cyclic nucleotide selectivity is still not fully understood. Analysis of isolated cyclic nucleotide-binding (CNB) domains of PKA regulatory subunit type Iα (RIα) reveals that the C-terminal CNB-B has a higher cAMP affinity and selectivity than the N-terminal CNB-A. Here, we show that introducing cGMP-specific residues using site-directed mutagenesis reduces the selectivity of CNB-B, while the combination of two mutations (G316R/A336T) results in a cGMP-selective binding domain. Furthermore, introducing the corresponding mutations (T192R/A212T) into the PKA RIα CNB-A turns this domain into a highly cGMP-selective domain, underlining the importance of these contacts for achieving cGMP specificity. Binding data with the generic purine nucleotide 3',5'-cyclic inosine monophosphate (cIMP) reveal that introduced arginine residues interact with the position 6 oxygen of the nucleobase. Co-crystal structures of an isolated CNB-B G316R/A336T double mutant with either cAMP or cGMP reveal that the introduced threonine and arginine residues maintain their conserved contacts as seen in PKG I CNB-B. These results improve our understanding of cyclic nucleotide binding and the molecular basis of cyclic nucleotide specificity. © 2017 The Author(s); published by Portland Press Limited on behalf of the Biochemical Society.

  6. Thioaptamer Diagnostic System Project

    Data.gov (United States)

    National Aeronautics and Space Administration — AM Biotechnologies (AM) will develop a diagnostic system in response to SBIR Topic X10.01 Reusable Diagnostic Lab Technology that will simultaneously detect and...

  7. Diagnostic Algorithm Benchmarking

    Science.gov (United States)

    Poll, Scott

    2011-01-01

    A poster for the NASA Aviation Safety Program Annual Technical Meeting. It describes empirical benchmarking on diagnostic algorithms using data from the ADAPT Electrical Power System testbed and a diagnostic software framework.

  8. Assessing patterns of hybridization between North Atlantic eels using diagnostic single-nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Pujolar, José Martin; Jacobsen, M.W.; Als, Thomas Damm

    2014-01-01

    The two North Atlantic eel species, the European eel (Anguilla anguilla) and the American eel (Anguilla rostrata), spawn in partial sympatry in the Sargasso Sea, providing ample opportunity to interbreed. In this study, we used a RAD (Restriction site Associated DNA) sequencing approach to identify...... eel) collected in the Sargasso Sea. Our SNP survey showed that the majority of Icelandic eels are pure European eels but there is also an important contribution of individuals of admixed ancestry (10.7%). Although most of the hybrids were identified as F1 hybrids from European eel female × American......, no hybrids were observed in the Faroe Islands, the closest bodies of land to Iceland. It is possible that hybrids show an intermediate migratory behaviour between the two parental species that ultimately brings hybrid larvae to the shores of Iceland, situated roughly halfway between the Sargasso Sea...

  9. Regulation of nucleotide excision repair through ubiquitination

    Institute of Scientific and Technical Information of China (English)

    Jia Li; Audesh Bhat; Wei Xiao

    2011-01-01

    Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

  10. [Nucleotide receptors--structure and function, history and perspectives].

    Science.gov (United States)

    Barańska, Jolanta

    2014-01-01

    First nucleotide receptors were discovered by Geoffrey Burnstock in 70ties of the last century, as a purinoreceptors activated by ATP. It was further found that they may be activated both by purine and pyrimidine nucleotides and their name was changed to nucleotide receptors. They are divided into two fsamilies: P1, activated by adenosine and P2, activated by nucleotides which are further divided into P2X and P2Y subfamilies. P2X are ionotropic receptors activated by ATP, P2Y (as the P1) are metabotropic receptors coupled with protein G. P2Y receptors are activated by ATP, ADP, UTP, UDP and UDP-sugar derivatives. This review describes early history of extracellular nucleotide signaling studies and presents current knowledge of the particular nucleotide receptors subtypes. The article also describes the structure and functional roles of these receptors and speculates about future research and therapeutic directions in this field.

  11. Frequency and Correlation of Nearest Neighboring Nucleotides in Human Genome

    Science.gov (United States)

    Jin, Neng-zhi; Liu, Zi-xian; Qiu, Wen-yuan

    2009-02-01

    Zipf's approach in linguistics is utilized to analyze the statistical features of frequency and correlation of 16 nearest neighboring nucleotides (AA, AC, AG, ..., TT) in 12 human chromosomes (Y, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, and 12). It is found that these statistical features of nearest neighboring nucleotides in human genome: (i) the frequency distribution is a linear function, and (ii) the correlation distribution is an inverse function. The coefficients of the linear function and inverse function depend on the GC content. It proposes the correlation distribution of nearest neighboring nucleotides for the first time and extends the descriptor about nearest neighboring nucleotides.

  12. Fluoride ion promoted deprotection and transesterification in nucleotide triesters.

    Science.gov (United States)

    Ogilvie, K K; Beaucage, S L

    1979-10-10

    Tetrabutylammonium fluoride will remove phenyl, trichloroethyl and cyanoethyl groups from nucleotides. In addition to the desired nucleotide products other results including chain cleavage, phosphofluoridates and cyanoethylated thymidine units may be obtained depending on the conditions used. Fluoride ion has been used to successfully exchange phenyl and trichloroethyl groups for methyl, ethyl and butyl groups in nucleotide triesters. This represents a rapid high yield route to a variety of phosphate esters. The synthesis of a novel nucleotide analogue in which two chains are bridged through their phosphates is described.

  13. Correlated Evolution of Nucleotide Positions within Splice Sites in Mammals.

    Science.gov (United States)

    Denisov, Stepan; Bazykin, Georgii; Favorov, Alexander; Mironov, Andrey; Gelfand, Mikhail

    2015-01-01

    Splice sites (SSs)--short nucleotide sequences flanking introns--are under selection for spliceosome binding, and adhere to consensus sequences. However, non-consensus nucleotides, many of which probably reduce SS performance, are frequent. Little is known about the mechanisms maintaining such apparently suboptimal SSs. Here, we study the correlations between strengths of nucleotides occupying different positions of the same SS. Such correlations may arise due to epistatic interactions between positions (i.e., a situation when the fitness effect of a nucleotide in one position depends on the nucleotide in another position), their evolutionary history, or to other reasons. Within both the intronic and the exonic parts of donor SSs, nucleotides that increase (decrease) SS strength tend to co-occur with other nucleotides increasing (respectively, decreasing) it, consistent with positive epistasis. Between the intronic and exonic parts of donor SSs, the correlations of nucleotide strengths tend to be negative, consistent with negative epistasis. In the course of evolution, substitutions at a donor SS tend to decrease the strength of its exonic part, and either increase or do not change the strength of its intronic part. In acceptor SSs, the situation is more complicated; the correlations between adjacent positions appear to be driven mainly by avoidance of the AG dinucleotide which may cause aberrant splicing. In summary, both the content and the evolution of SSs is shaped by a complex network of interdependences between adjacent nucleotides that respond to a range of sometimes conflicting selective constraints.

  14. Association of prediabetes-associated single nucleotide polymorphisms with microalbuminuria

    Science.gov (United States)

    Choi, Jong Wook; Moon, Shinje; Jang, Eun Jung; Lee, Chang Hwa; Park, Joon-Sung

    2017-01-01

    Increased glycemic exposure, even below the diagnostic criteria for diabetes mellitus, is crucial in the pathogenesis of diabetic microvascular complications represented by microalbuminuria. Nonetheless, there is limited evidence regarding which single nucleotide polymorphisms (SNPs) are associated with prediabetes and whether genetic predisposition to prediabetes is related to microalbuminuria, especially in the general population. Our objective was to answer these questions. We conducted a genomewide association study (GWAS) separately on two population-based cohorts, Ansung and Ansan, in the Korean Genome and Epidemiology Study (KoGES). The initial GWAS was carried out on the Ansung cohort, followed by a replication study on the Ansan cohort. A total of 5682 native Korean participants without a significant medical illness were classified into either control group (n = 3153) or prediabetic group (n = 2529). In the GWAS, we identified two susceptibility loci associated with prediabetes, one at 17p15.3-p15.1 in the GCK gene and another at 7p15.1 in YKT6. When variations in GCK and YKT6 were used as a model of prediabetes, this genetically determined prediabetes increased microalbuminuria. Multiple logistic regression analyses revealed that fasting glucose concentration in plasma and SNP rs2908289 in GCK were associated with microalbuminuria, and adjustment for age, gender, smoking history, systolic blood pressure, waist circumference, and serum triglyceride levels did not attenuate this association. Our results suggest that prediabetes and the associated SNPs may predispose to microalbuminuria before the diagnosis of diabetes mellitus. Further studies are needed to explore the details of the physiological and molecular mechanisms underlying this genetic association. PMID:28158221

  15. Implementation of Targeted Next Generation Sequencing in Clinical Diagnostics

    DEFF Research Database (Denmark)

    Larsen, Martin Jakob; Burton, Mark; Thomassen, Mads;

    Accurate mutation detection is essential in clinical genetic diagnostics of monogenic hereditary diseases. Targeted next generation sequencing (NGS) provides a promising and cost-effective alternative to Sanger sequencing and MLPA analysis currently used in most diagnostic laboratories. One...... advantage of targeted NGS is that multiple disease-specific genes can easily be sequenced simultaneously, which is favorable in genetic heterogeneous diseases. Prior to implementation in our diagnostic setting, we aimed to assess the sensitivity and specificity of targeted NGS by sequencing a collection......, respectively. For diagnostics, the sequencing coverage is essential, wherefore a minimum coverage of 30x per nucleotide in the coding regions was used as our primary quality criterion. For the majority of the included genes, we obtained adequate gene coverage, in which we were able to detect 100% of the known...

  16. Naked-eye fingerprinting of single nucleotide polymorphisms on psoriasis patients

    Science.gov (United States)

    Valentini, Paola; Marsella, Alessandra; Tarantino, Paolo; Mauro, Salvatore; Baglietto, Silvia; Congedo, Maurizio; Paolo Pompa, Pier

    2016-05-01

    We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics.We report a low-cost test, based on gold nanoparticles, for the colorimetric (naked-eye) fingerprinting of a panel of single nucleotide polymorphisms (SNPs), relevant for the personalized therapy of psoriasis. Such pharmacogenomic tests are not routinely performed on psoriasis patients, due to the high cost of standard technologies. We demonstrated high sensitivity and specificity of our colorimetric test by validating it on a cohort of 30 patients, through a double-blind comparison with two state-of-the-art instrumental techniques, namely reverse dot blotting and sequencing, finding 100% agreement. This test offers high parallelization capabilities and can be easily generalized to other SNPs of clinical relevance, finding broad utility in diagnostics and pharmacogenomics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02200f

  17. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  18. Nucleotide Excision Repair in Caenorhabditis elegans

    Directory of Open Access Journals (Sweden)

    Hannes Lans

    2011-01-01

    Full Text Available Nucleotide excision repair (NER plays an essential role in many organisms across life domains to preserve and faithfully transmit DNA to the next generation. In humans, NER is essential to prevent DNA damage-induced mutation accumulation and cell death leading to cancer and aging. NER is a versatile DNA repair pathway that repairs many types of DNA damage which distort the DNA helix, such as those induced by solar UV light. A detailed molecular model of the NER pathway has emerged from in vitro and live cell experiments, particularly using model systems such as bacteria, yeast, and mammalian cell cultures. In recent years, the versatility of the nematode C. elegans to study DNA damage response (DDR mechanisms including NER has become increasingly clear. In particular, C. elegans seems to be a convenient tool to study NER during the UV response in vivo, to analyze this process in the context of a developing and multicellular organism, and to perform genetic screening. Here, we will discuss current knowledge gained from the use of C. elegans to study NER and the response to UV-induced DNA damage.

  19. Adenine nucleotides of the stria vascularis.

    Science.gov (United States)

    Thalmann, I; Marcus, N Y; Thalmann, R

    1979-01-01

    The levels of the adenine nucleotides ATP, ADP, and AMP in the stria vascularis were measured under normal conditions, and following various durations of ischemia. The concentrations of these compounds were used for the calculation of the adenylate energy charge, the energy status and the phosphorylation state of the stria. Following 10 min of ischemia the adenylate energy charge had decreased three fold, the energy status seven fold and the phosphorylation state 14 fold. To study the potential for recovery of strial function following various brief and prolonged ischemic intervals, a method for the perfusion of the ear via the anterior inferior cerebellar artery was developed. For various reasons it was found advantageous to use "artifical blood" as perfusate, relying upon fluorocarbons as oxygen carriers. The endolymphatic potential was used as electrical indicator of strial function. Recovery of the endolymphatic potential following brief periods of ischemia was paralleled by a corresponding increase of the ATP levels and a drastic decrease of the AMP levels of the stria vascularis. Preliminary results on the effects of substrate-free perfusion are presented.

  20. Condensing the information in DNA with double-headed nucleotides

    DEFF Research Database (Denmark)

    Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

    2017-01-01

    A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information to be ...

  1. Supplementary Material for: The arabidopsis cyclic nucleotide interactome

    KAUST Repository

    Donaldson, Lara

    2016-01-01

    Abstract Background Cyclic nucleotides have been shown to play important signaling roles in many physiological processes in plants including photosynthesis and defence. Despite this, little is known about cyclic nucleotide-dependent signaling mechanisms in plants since the downstream target proteins remain unknown. This is largely due to the fact that bioinformatics searches fail to identify plant homologs of protein kinases and phosphodiesterases that are the main targets of cyclic nucleotides in animals. Methods An affinity purification technique was used to identify cyclic nucleotide binding proteins in Arabidopsis thaliana. The identified proteins were subjected to a computational analysis that included a sequence, transcriptional co-expression and functional annotation analysis in order to assess their potential role in plant cyclic nucleotide signaling. Results A total of twelve cyclic nucleotide binding proteins were identified experimentally including key enzymes in the Calvin cycle and photorespiration pathway. Importantly, eight of the twelve proteins were shown to contain putative cyclic nucleotide binding domains. Moreover, the identified proteins are post-translationally modified by nitric oxide, transcriptionally co-expressed and annotated to function in hydrogen peroxide signaling and the defence response. The activity of one of these proteins, GLYGOLATE OXIDASE 1, a photorespiratory enzyme that produces hydrogen peroxide in response to Pseudomonas, was shown to be repressed by a combination of cGMP and nitric oxide treatment. Conclusions We propose that the identified proteins function together as points of cross-talk between cyclic nucleotide, nitric oxide and reactive oxygen species signaling during the defence response.

  2. Prebiotic nucleotide synthesis demonstration of a geologically plausible pathway

    NARCIS (Netherlands)

    Schwartz, A.W.; Veen, van der M.; Bisseling, T.; Chittenden, G.J.

    1975-01-01

    Mineral phosphate (apatite) is activated for the synthesis of nucleotides when dilute solutions containing nucleoside and ammonium oxalate are evaporated in its presence. A natural, igneous fluorapatite was found to be even more effective in nucleotide synthesis than the more soluble hydroxylapatite

  3. Diagnostic Development on NSTX

    Energy Technology Data Exchange (ETDEWEB)

    A.L. Roquemore; D. Johnson; R. Kaita; et al

    1999-12-16

    Diagnostics are described which are currently installed or under active development for the newly commissioned NSTX device. The low aspect ratio (R/a less than or equal to 1.3) and low toroidal field (0.1-0.3T) used in this device dictate adaptations in many standard diagnostic techniques. Technical summaries of each diagnostic are given, and adaptations, where significant, are highlighted.

  4. Empirical Bayes analysis of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Ickstadt Katja

    2008-03-01

    Full Text Available Abstract Background An important goal of whole-genome studies concerned with single nucleotide polymorphisms (SNPs is the identification of SNPs associated with a covariate of interest such as the case-control status or the type of cancer. Since these studies often comprise the genotypes of hundreds of thousands of SNPs, methods are required that can cope with the corresponding multiple testing problem. For the analysis of gene expression data, approaches such as the empirical Bayes analysis of microarrays have been developed particularly for the detection of genes associated with the response. However, the empirical Bayes analysis of microarrays has only been suggested for binary responses when considering expression values, i.e. continuous predictors. Results In this paper, we propose a modification of this empirical Bayes analysis that can be used to analyze high-dimensional categorical SNP data. This approach along with a generalized version of the original empirical Bayes method are available in the R package siggenes version 1.10.0 and later that can be downloaded from http://www.bioconductor.org. Conclusion As applications to two subsets of the HapMap data show, the empirical Bayes analysis of microarrays cannot only be used to analyze continuous gene expression data, but also be applied to categorical SNP data, where the response is not restricted to be binary. In association studies in which typically several ten to a few hundred SNPs are considered, our approach can furthermore be employed to test interactions of SNPs. Moreover, the posterior probabilities resulting from the empirical Bayes analysis of (prespecified interactions/genotypes can also be used to quantify the importance of these interactions.

  5. Nucleotide excision repair in differentiated cells

    Energy Technology Data Exchange (ETDEWEB)

    Wees, Caroline van der [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Jansen, Jacob [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Vrieling, Harry [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Laarse, Arnoud van der [Department of Cardiology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert van [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands); Mullenders, Leon [Department of Toxicogenetics, Leiden University Medical Center, Leiden (Netherlands)]. E-mail: l.mullenders@lumc.nl

    2007-01-03

    Nucleotide excision repair (NER) is the principal pathway for the removal of a wide range of DNA helix-distorting lesions and operates via two NER subpathways, i.e. global genome repair (GGR) and transcription-coupled repair (TCR). Although detailed information is available on expression and efficiency of NER in established mammalian cell lines, little is known about the expression of NER pathways in (terminally) differentiated cells. The majority of studies in differentiated cells have focused on repair of UV-induced cyclobutane pyrimidine dimers (CPD) and 6-4-photoproducts (6-4PP) because of the high frequency of photolesions at low level of toxicity and availability of sensitive technologies to determine photolesions in defined regions of the genome. The picture that emerges from these studies is blurred and rather complex. Fibroblasts and terminally differentiated myocytes of the rat heart display equally efficient GGR of 6-4PP but poor repair of CPD due to the absence of p48 expression. This repair phenotype is clearly different from human terminal differentiated neurons. Furthermore, both cell types were found to carry out TCR of CPD, thus mimicking the repair phenotype of established rodent cell lines. In contrast, in intact rat spermatogenic cells repair was very inefficient at the genome overall level and in transcriptionally active genes indicating that GGR and TCR are non-functional. Also, non-differentiated mouse embryonic stem (ES) cells exhibit low levels of NER after UV irradiation. However, the mechanisms that lead to low NER activity are clearly different: in differentiated spermatogenic cells differences in chromatin compaction and sequestering of NER proteins may underlie the lack of NER activity in pre-meiotic cells, whereas in non-differentiated ES cells NER is impaired by a strong apoptotic response.

  6. Diagnostics of Nanodusty Plasma

    Science.gov (United States)

    Greiner, Franko; Groth, Sebastian; Tadsen, Bejamin; Piel, Alexander

    2015-11-01

    The diagnostic of nanodusty plasmas, i.e. plasmas including nano-sized dust particles, is a challenging task. For both, the diagnostic of the nanodusty plasma itself, and the in-situ diagnostic of the nanoparticles, no standard diagnostic exist. Nanodust particle size and density can be estimated using light scattering techniques, namely kinetic Mie ellipsometry and extinction measurements. The charge of the nanoparticles can be estimated from the analysis of dust density waves (DDW). Parameters like the electron density, which give information about the plasma itself, may be deduced from the DDW analysis. We present detailed investigations on nanodust in a reactive Argon-Acetylene plasma created in an rf-driven parallel plate reactor at low pressure using the above mentioned portfolio of diagnostic. Funded by DFG under contract SFB TR-24/A2.

  7. Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

    Directory of Open Access Journals (Sweden)

    Simon Reed

    2012-09-01

    Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

  8. Identifying 2'-O-methylationation sites by integrating nucleotide chemical properties and nucleotide compositions.

    Science.gov (United States)

    Chen, Wei; Feng, Pengmian; Tang, Hua; Ding, Hui; Lin, Hao

    2016-06-01

    2'-O-methylationation is an important post-transcriptional modification and plays important roles in many biological processes. Although experimental technologies have been proposed to detect 2'-O-methylationation sites, they are cost-ineffective. As complements to experimental techniques, computational methods will facilitate the identification of 2'-O-methylationation sites. In the present study, we proposed a support vector machine-based method to identify 2'-O-methylationation sites. In this method, RNA sequences were formulated by nucleotide chemical properties and nucleotide compositions. In the jackknife cross-validation test, the proposed method obtained an accuracy of 95.58% for identifying 2'-O-methylationation sites in the human genome. Moreover, the model was also validated by identifying 2'-O-methylation sites in the Mus musculus and Saccharomyces cerevisiae genomes, and the obtained accuracies are also satisfactory. These results indicate that the proposed method will become a useful tool for the research on 2'-O-methylation.

  9. Frequency and Correlation of Nearest Neighboring Nucleotides in Human Genome

    Institute of Scientific and Technical Information of China (English)

    Neng-zhi Jin; Zi-xian Liu; Wen-yuan Qiu

    2009-01-01

    Zipf's approach in linguistics is utilized to analyze the statistical features of frequency and mosomes (Y, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, and 12). It is found that these statistical features of nearest neighboring nucleotides in human genome: (ⅰ) the frequency distribution is a linear function, and (ⅱ) the correlation distribution is an inverse function. The coeffi-cients of the linear function and inverse function depend on the GC content. It proposes the correlation distribution of nearest neighboring nucleotides for the first time and extends the descriptor about nearest neighboring nucleotides.

  10. Building phylogenetic trees by using gene Nucleotide Genomic Signals.

    Science.gov (United States)

    Cristea, Paul Dan

    2012-01-01

    Nucleotide genomic signal (NuGS) methodology allows a molecular level approach to determine distances between homologous genes or between conserved equivalent non-coding genome regions in various species or individuals of the same species. Therefore, distances between the genes of species or individuals can be computed and phylogenetic trees can be built. The paper illustrates the use of the nucleotide imbalance (N) and nucleotide pair imbalance (P) signals to determine the distances between the genes of several Hominidae. The results are in accordance with those of other genetic or phylogenetic approaches to establish distances between Hominidae species.

  11. Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

    Science.gov (United States)

    Kondo, Jiro; Westhof, Eric

    2011-10-01

    Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

  12. Diagnostics in critical conditions

    Directory of Open Access Journals (Sweden)

    SadchikovD.V.

    2011-09-01

    Full Text Available The purpose of research: improvement of quality of diagnostics at the patients in a critical condition in intensive care unit. Material and methods. In total have analyzed 1957 medical cards of the patients who have died in ICU»s. At the first stage studied the factors influencing on diagnostics of critically ill patients (medical cards of 1557 patients; at the second stage investigated influence of the diagnostic standards in ICU»s practice on improvement of quality of diag- nostics of critically ill patients (400 medical cards of the patients who have died. Entry criterions were standards and algorithm of diagnostics. Techniques of research: average bed-day in groups, first-day lethality, quantity of the carried out laboratory tests and tool methods of research, level of consciousness of the patients (Glasgow come score, severity of disease by ICU»s patients (APACHE II scores. Results. Quality of diagnostics depend on carried out laboratory tests and tool methods of research, level of consciousness of the patients (Glasgow come score, severity of disease by ICU»s patients (APACHE II score. The conclusion. The laboratory tests and tool methods of research conforming to the standards of diagnostics are necessary for improvement of quality of diagnostics, it is necessary to take into account an altered level of consciousness (Glasgow come score and severity of disease by ICU»s patients (APACHE II scores

  13. Cable Diagnostic Focused Initiative

    Energy Technology Data Exchange (ETDEWEB)

    Hartlein, R.A.; Hampton, R.N.

    2010-12-30

    This report summarizes an extensive effort made to understand how to effectively use the various diagnostic technologies to establish the condition of medium voltage underground cable circuits. These circuits make up an extensive portion of the electric delivery infrastructure in the United States. Much of this infrastructure is old and experiencing unacceptable failure rates. By deploying efficient diagnostic testing programs, electric utilities can replace or repair circuits that are about to fail, providing an optimal approach to improving electric system reliability. This is an intrinsically complex topic. Underground cable systems are not homogeneous. Cable circuits often contain multiple branches with different cable designs and a range of insulation materials. In addition, each insulation material ages differently as a function of time, temperature and operating environment. To complicate matters further, there are a wide variety of diagnostic technologies available for assessing the condition of cable circuits with a diversity of claims about the effectiveness of each approach. As a result, the benefits of deploying cable diagnostic testing programs have been difficult to establish, leading many utilities to avoid the their use altogether. This project was designed to help address these issues. The information provided is the result of a collaborative effort between Georgia Tech NEETRAC staff, Georgia Tech academic faculty, electric utility industry participants, as well as cable system diagnostic testing service providers and test equipment providers. Report topics include: •How cable systems age and fail, •The various technologies available for detecting potential failure sites, •The advantages and disadvantages of different diagnostic technologies, •Different approaches for utilities to employ cable system diagnostics. The primary deliverables of this project are this report, a Cable Diagnostic Handbook (a subset of this report) and an online

  14. Melioidosis Diagnostic Workshop, 20131

    Science.gov (United States)

    AuCoin, David; Baccam, Prasith; Baggett, Henry C.; Baird, Rob; Bhengsri, Saithip; Blaney, David D.; Brett, Paul J.; Brooks, Timothy J.G.; Brown, Katherine A.; Chantratita, Narisara; Cheng, Allen C.; Dance, David A.B.; Decuypere, Saskia; Defenbaugh, Dawn; Gee, Jay E.; Houghton, Raymond; Jorakate, Possawat; Lertmemongkolchai, Ganjana; Limmathurotsakul, Direk; Merlin, Toby L.; Mukhopadhyay, Chiranjay; Norton, Robert; Peacock, Sharon J.; Rolim, Dionne B.; Simpson, Andrew J.; Steinmetz, Ivo; Stoddard, Robyn A.; Stokes, Martha M.; Sue, David; Tuanyok, Apichai; Whistler, Toni; Wuthiekanun, Vanaporn; Walke, Henry T.

    2015-01-01

    Melioidosis is a severe disease that can be difficult to diagnose because of its diverse clinical manifestations and a lack of adequate diagnostic capabilities for suspected cases. There is broad interest in improving detection and diagnosis of this disease not only in melioidosis-endemic regions but also outside these regions because melioidosis may be underreported and poses a potential bioterrorism challenge for public health authorities. Therefore, a workshop of academic, government, and private sector personnel from around the world was convened to discuss the current state of melioidosis diagnostics, diagnostic needs, and future directions. PMID:25626057

  15. Overview of the application of nucleotide in aquaculture

    Directory of Open Access Journals (Sweden)

    Hoang Do Huu

    2016-10-01

    Full Text Available Although long history application in infant formula, dietary nucleotide supplementation has been used only recently in the evaluation of growth performance, stress and pathogen resistance in aquaculture species. This paper addresses the present knowledge of the use of nucleotide supplemented in the diet for culture species. Research reveals that dietary nucleotide may have significant impact and is recommended to add to the feed of aquatic species to get better performance. However, more studies should also be conducted to have better understandings on dose requirement, duration of application, impact on different life stage and under different environmental stress and pathogens. Further study should also examine the effects of dietary nucleotide supplementation of intestinal microbiota and gut morphology, and immune response of aquaculture species.

  16. Nucleotide Metabolism and its Control in Lactic Acid Bacteria

    DEFF Research Database (Denmark)

    Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

    2005-01-01

    Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

  17. Overview of the application of nucleotide in aquaculture

    Institute of Scientific and Technical Information of China (English)

    Hoang Do Huu

    2016-01-01

    Although long history application in infant formula, dietary nucleotide supplementation has been used only recently in the evaluation of growth performance, stress and pathogen resistance in aquaculture species. This paper addresses the present knowledge of the use of nucleotide supplemented in the diet for culture species. Research reveals that dietary nucleotide may have significant impact and is recommended to add to the feed of aquatic species to get better performance. However, more studies should also be conducted to have better understandings on dose requirement, duration of application, impact on different life stage and under different environmental stress and pathogens. Further study should also examine the effects of dietary nucleotide supplementation of intestinal microbiota and gut morphology, and immune response of aquaculture species.

  18. Association study of nonsynonymous single nucleotide polymorphisms in schizophrenia

    DEFF Research Database (Denmark)

    Carrera, Noa; Arrojo, Manuel; Sanjuán, Julio

    2012-01-01

    Genome-wide association studies using several hundred thousand anonymous markers present limited statistical power. Alternatively, association studies restricted to common nonsynonymous single nucleotide polymorphisms (nsSNPs) have the advantage of strongly reducing the multiple testing problem, ...

  19. The effect of mitochondrial dysfunction on cytosolic nucleotide metabolism

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Lykke, Anne; Rasmussen, Lene Juel

    2010-01-01

    of cytosolic ribonucleotides and deoxyribonucleotides, which in turn can result in aberrant RNA and DNA synthesis. Mitochondrial dysfunction has been linked to genomic instability, and it is possible that the limiting effect of mitochondrial dysfunction on the levels of nucleotides and resulting aberrant RNA...... and DNA synthesis in part can be responsible for this link. This paper summarizes the parts of the metabolic pathways responsible for nucleotide metabolism that can be affected by mitochondrial dysfunction....

  20. Nucleotide binding switches the information flow in ras GTPases.

    Science.gov (United States)

    Raimondi, Francesco; Portella, Guillem; Orozco, Modesto; Fanelli, Francesca

    2011-03-01

    The Ras superfamily comprises many guanine nucleotide-binding proteins (G proteins) that are essential to intracellular signal transduction. The guanine nucleotide-dependent intrinsic flexibility patterns of five G proteins were investigated in atomic detail through Molecular Dynamics simulations of the GDP- and GTP-bound states (S(GDP) and S(GTP), respectively). For all the considered systems, the intrinsic flexibility of S(GDP) was higher than that of S(GTP), suggesting that Guanine Exchange Factor (GEF) recognition and nucleotide switch require higher amplitude motions than effector recognition or GTP hydrolysis. Functional mode, dynamic domain, and interaction energy correlation analyses highlighted significant differences in the dynamics of small G proteins and Gα proteins, especially in the inactive state. Indeed, S(GDP) of Gα(t), is characterized by a more extensive energy coupling between nucleotide binding site and distal regions involved in GEF recognition compared to small G proteins, which attenuates in the active state. Moreover, mechanically distinct domains implicated in nucleotide switch could be detected in the presence of GDP but not in the presence of GTP. Finally, in small G proteins, functional modes are more detectable in the inactive state than in the active one and involve changes in solvent exposure of two highly conserved amino acids in switches I and II involved in GEF recognition. The average solvent exposure of these amino acids correlates in turn with the rate of GDP release, suggesting for them either direct or indirect roles in the process of nucleotide switch. Collectively, nucleotide binding changes the information flow through the conserved Ras-like domain, where GDP enhances the flexibility of mechanically distinct portions involved in nucleotide switch, and favors long distance allosteric communication (in Gα proteins), compared to GTP.

  1. Nucleotide binding switches the information flow in ras GTPases.

    Directory of Open Access Journals (Sweden)

    Francesco Raimondi

    2011-03-01

    Full Text Available The Ras superfamily comprises many guanine nucleotide-binding proteins (G proteins that are essential to intracellular signal transduction. The guanine nucleotide-dependent intrinsic flexibility patterns of five G proteins were investigated in atomic detail through Molecular Dynamics simulations of the GDP- and GTP-bound states (S(GDP and S(GTP, respectively. For all the considered systems, the intrinsic flexibility of S(GDP was higher than that of S(GTP, suggesting that Guanine Exchange Factor (GEF recognition and nucleotide switch require higher amplitude motions than effector recognition or GTP hydrolysis. Functional mode, dynamic domain, and interaction energy correlation analyses highlighted significant differences in the dynamics of small G proteins and Gα proteins, especially in the inactive state. Indeed, S(GDP of Gα(t, is characterized by a more extensive energy coupling between nucleotide binding site and distal regions involved in GEF recognition compared to small G proteins, which attenuates in the active state. Moreover, mechanically distinct domains implicated in nucleotide switch could be detected in the presence of GDP but not in the presence of GTP. Finally, in small G proteins, functional modes are more detectable in the inactive state than in the active one and involve changes in solvent exposure of two highly conserved amino acids in switches I and II involved in GEF recognition. The average solvent exposure of these amino acids correlates in turn with the rate of GDP release, suggesting for them either direct or indirect roles in the process of nucleotide switch. Collectively, nucleotide binding changes the information flow through the conserved Ras-like domain, where GDP enhances the flexibility of mechanically distinct portions involved in nucleotide switch, and favors long distance allosteric communication (in Gα proteins, compared to GTP.

  2. Nucleotide-sugar transporters: structure, function and roles in vivo

    Directory of Open Access Journals (Sweden)

    Handford M.

    2006-01-01

    Full Text Available The glycosylation of glycoconjugates and the biosynthesis of polysaccharides depend on nucleotide-sugars which are the substrates for glycosyltransferases. A large proportion of these enzymes are located within the lumen of the Golgi apparatus as well as the endoplasmic reticulum, while many of the nucleotide-sugars are synthesized in the cytosol. Thus, nucleotide-sugars are translocated from the cytosol to the lumen of the Golgi apparatus and endoplasmic reticulum by multiple spanning domain proteins known as nucleotide-sugar transporters (NSTs. These proteins were first identified biochemically and some of them were cloned by complementation of mutants. Genome and expressed sequence tag sequencing allowed the identification of a number of sequences that may encode for NSTs in different organisms. The functional characterization of some of these genes has shown that some of them can be highly specific in their substrate specificity while others can utilize up to three different nucleotide-sugars containing the same nucleotide. Mutations in genes encoding for NSTs can lead to changes in development in Drosophila melanogaster or Caenorhabditis elegans, as well as alterations in the infectivity of Leishmania donovani. In humans, the mutation of a GDP-fucose transporter is responsible for an impaired immune response as well as retarded growth. These results suggest that, even though there appear to be a fair number of genes encoding for NSTs, they are not functionally redundant and seem to play specific roles in glycosylation.

  3. Mammalian mismatches in nucleotide metabolism: implications for xenotransplantation.

    Science.gov (United States)

    Khalpey, Zain; Yuen, Ada H Y; Lavitrano, Marialuisa; McGregor, Christopher G A; Kalsi, Kameljit K; Yacoub, Magdi H; Smolenski, Ryszard T

    2007-10-01

    Acute humoral rejection (AHR) limits the clinical application of animal organs for xenotransplantation. Mammalian disparities in nucleotide metabolism may contribute significantly to the microvascular component in AHR; these, however remain ill-defined. We evaluated the extent of species-specific differences in nucleotide metabolism. HPLC analysis was performed on venous blood samples (nucleotide metabolites) and heart biopsies (purine enzymes) from wild type mice, rats, pigs, baboons, and human donors.Ecto-5'-nucleotidase (E5'N) activities were 4-fold lower in pigs and baboon hearts compared to human and mice hearts while rat activity was highest. Similar differences between pigs and humans were also observed with kidneys and endothelial cells. More than 10-fold differences were observed with other purine enzymes. AMP deaminase (AMPD) activity was exceptionally high in mice but very low in pig and baboon hearts. Adenosine deaminase (ADA) activity was highest in baboons. Adenosine kinase (AK) activity was more consistent across different species. Pig blood had the highest levels of hypoxanthine, inosine and adenine. Human blood uric acid concentration was almost 100 times higher than in other species studied. We conclude that species-specific differences in nucleotide metabolism may affect compatibility of pig organs within a human metabolic environment. Furthermore, nucleotide metabolic mismatches may affect clinical relevance of animal organ transplant models. Supplementation of deficient precursors or application of inhibitors of nucleotide metabolism (e.g., allopurinol) or transgenic upregulation of E5'N may overcome some of these differences.

  4. Thioaptamer Diagnostic System Project

    Data.gov (United States)

    National Aeronautics and Space Administration — AM Biotechnologies (AM) in partnership with Sandia National Laboratories will develop a Thioaptamer Diagnostic System (TDS) in response to Topic X10.01 Reusable...

  5. Rotorcraft Diagnostics Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Under this SBIR program, Ridgetop will introduce the first low-cost, low-power, and lightweight data monitoring solution for rotorcraft diagnostics. The solution is...

  6. National Convective Weather Diagnostic

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Current convective hazards identified by the National Convective Weather Detection algorithm. The National Convective Weather Diagnostic (NCWD) is an automatically...

  7. Prenatal Genetic Diagnostic Tests

    Science.gov (United States)

    ... are offered to all pregnant women. What is amniocentesis? Amniocentesis is a diagnostic test. It usually is done ... a very small chance of pregnancy loss with amniocentesis. Leakage of amniotic fluid and slight bleeding can ...

  8. [Diagnostics in osteology].

    Science.gov (United States)

    Jakob, F; Genest, F; Seefried, L; Tsourdi, E; Lapa, C; Hofbauer, L C

    2016-07-01

    Clinical diagnostics in metabolic bone diseases cover a broad spectrum of conventional and state of the art methods ranging from the medical history and clinical examination to molecular imaging. Patient treatment is carried out in an interdisciplinary team due to the multiple interactions of bone with other organ systems. Diagnosis of osteoporosis is supported by high level national guidelines. A paradigm shift concerning the clinical relevance of bone mineral density measurement renders this now to be a strong risk factor rather than a diagnostic parameter, while strengthening the value of other clinical factors for risk assessment. The impact of parameters for muscle mass, structure and function is steadily increasing in all age groups. In order to identify underlying diseases that influence bone metabolism a panel of general laboratory diagnostic parameters is recommended. Markers for bone formation and resorption and specific parameters for the regulation of calcium and phosphate metabolism should be evaluated by specialists because they require diligence in preanalytics and experience in interpretation. Genetic diagnosis is well established for rare bone diseases while diagnostic panels are not yet available for routine diagnostics in polygenetic diseases such as osteoporosis. Conventional radiology is still very important to identify, e. g. fractures, osteolytic and osteoblastic lesions and extraosseous calcifications; however tomography-based methods which combine, e. g. scintigraphy or positron emission technologies with anatomical imaging are of increasing significance. Clinical diagnostics in osteology require profound knowledge and are subject to a dynamic evolution.

  9. Optics/Optical Diagnostics Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — The Optics/Optical Diagnostics Laboratory supports graduate instruction in optics, optical and laser diagnostics and electro-optics. The optics laboratory provides...

  10. Single-nucleotide polymorphisms among microRNA: big effects on cancer

    Institute of Scientific and Technical Information of China (English)

    Feng-Ju Song; Ke-Xin Chen

    2011-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression at the transcriptional or posttranscriptional level. Many miRNAs are found to play a significant role in cancer development either as tumor suppressor genes or as oncogenes. Examination of tumor-specific miRNA expression profiles in diverse cancers has revealed widespread deregulation of these molecules, whose loss and overexpression respectively have diagnostic and prognostic significance. Genetic variations, mostly single-nucleotide polymorphisms (SNPs) within miRNA sequences or their target sites, have been found to be associated with many kinds of cancers. In this review, we summarize the current knowledge of miRNAs including their biogenesis and role in cancer development, and finally, how SNPs among miRNAs affect miRNA biogenesis and contribute to cancer.

  11. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015.

    Science.gov (United States)

    Furuse, Yuki; Okamoto, Michiko; Oshitani, Hitoshi

    2015-11-01

    Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV) is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  12. Conservation of nucleotide sequences for molecular diagnosis of Middle East respiratory syndrome coronavirus, 2015

    Directory of Open Access Journals (Sweden)

    Yuki Furuse

    2015-11-01

    Full Text Available Infection due to the Middle East respiratory syndrome coronavirus (MERS-CoV is widespread. The present study was performed to assess the protocols used for the molecular diagnosis of MERS-CoV by analyzing the nucleotide sequences of viruses detected between 2012 and 2015, including sequences from the large outbreak in eastern Asia in 2015. Although the diagnostic protocols were established only 2 years ago, mismatches between the sequences of primers/probes and viruses were found for several of the assays. Such mismatches could lead to a lower sensitivity of the assay, thereby leading to false-negative diagnosis. A slight modification in the primer design is suggested. Protocols for the molecular diagnosis of viral infections should be reviewed regularly after they are established, particularly for viruses that pose a great threat to public health such as MERS-CoV.

  13. Evolutionary and structural perspectives of plant cyclic nucleotide-gated cation channels

    KAUST Repository

    Zelman, Alice K.

    2012-05-29

    Ligand-gated cation channels are a frequent component of signaling cascades in eukaryotes. Eukaryotes contain numerous diverse gene families encoding ion channels, some of which are shared and some of which are unique to particular kingdoms. Among the many different types are cyclic nucleotide-gated channels (CNGCs). CNGCs are cation channels with varying degrees of ion conduction selectivity. They are implicated in numerous signaling pathways and permit diffusion of divalent and monovalent cations, including Ca2+ and K+. CNGCs are present in both plant and animal cells, typically in the plasma membrane; recent studies have also documented their presence in prokaryotes. All eukaryote CNGC polypeptides have a cyclic nucleotide-binding domain and a calmodulin binding domain as well as a six transmembrane/one pore tertiary structure. This review summarizes existing knowledge about the functional domains present in these cation-conducting channels, and considers the evidence indicating that plant and animal CNGCs evolved separately. Additionally, an amino acid motif that is only found in the phosphate binding cassette and hinge regions of plant CNGCs, and is present in all experimentally confirmed CNGCs but no other channels was identified. This CNGC-specific amino acid motif provides an additional diagnostic tool to identify plant CNGCs, and can increase confidence in the annotation of open reading frames in newly sequenced genomes as putative CNGCs. Conversely, the absence of the motif in some plant sequences currently identified as probable CNGCs may suggest that they are misannotated or protein fragments. 2012 Zelman, Dawe, Gehring and Berkowitz.

  14. Phosphate-Modified Nucleotides for Monitoring Enzyme Activity.

    Science.gov (United States)

    Ermert, Susanne; Marx, Andreas; Hacker, Stephan M

    2017-04-01

    Nucleotides modified at the terminal phosphate position have been proven to be interesting entities to study the activity of a variety of different protein classes. In this chapter, we present various types of modifications that were attached as reporter molecules to the phosphate chain of nucleotides and briefly describe the chemical reactions that are frequently used to synthesize them. Furthermore, we discuss a variety of applications of these molecules. Kinase activity, for instance, was studied by transfer of a phosphate modified with a reporter group to the target proteins. This allows not only studying the activity of kinases, but also identifying their target proteins. Moreover, kinases can also be directly labeled with a reporter at a conserved lysine using acyl-phosphate probes. Another important application for phosphate-modified nucleotides is the study of RNA and DNA polymerases. In this context, single-molecule sequencing is made possible using detection in zero-mode waveguides, nanopores or by a Förster resonance energy transfer (FRET)-based mechanism between the polymerase and a fluorophore-labeled nucleotide. Additionally, fluorogenic nucleotides that utilize an intramolecular interaction between a fluorophore and the nucleobase or an intramolecular FRET effect have been successfully developed to study a variety of different enzymes. Finally, also some novel techniques applying electron paramagnetic resonance (EPR)-based detection of nucleotide cleavage or the detection of the cleavage of fluorophosphates are discussed. Taken together, nucleotides modified at the terminal phosphate position have been applied to study the activity of a large diversity of proteins and are valuable tools to enhance the knowledge of biological systems.

  15. Evolution of Nucleotide Punctuation Marks: From Structural to Linear Signals.

    Science.gov (United States)

    El Houmami, Nawal; Seligmann, Hervé

    2017-01-01

    We present an evolutionary hypothesis assuming that signals marking nucleotide synthesis (DNA replication and RNA transcription) evolved from multi- to unidimensional structures, and were carried over from transcription to translation. This evolutionary scenario presumes that signals combining secondary and primary nucleotide structures are evolutionary transitions. Mitochondrial replication initiation fits this scenario. Some observations reported in the literature corroborate that several signals for nucleotide synthesis function in translation, and vice versa. (a) Polymerase-induced frameshift mutations occur preferentially at translational termination signals (nucleotide deletion is interpreted as termination of nucleotide polymerization, paralleling the role of stop codons in translation). (b) Stem-loop hairpin presence/absence modulates codon-amino acid assignments, showing that translational signals sometimes combine primary and secondary nucleotide structures (here codon and stem-loop). (c) Homopolymer nucleotide triplets (AAA, CCC, GGG, TTT) cause transcriptional and ribosomal frameshifts. Here we find in recently described human mitochondrial RNAs that systematically lack mono-, dinucleotides after each trinucleotide (delRNAs) that delRNA triplets include 2x more homopolymers than mitogenome regions not covered by delRNA. Further analyses of delRNAs show that the natural circular code X (a little-known group of 20 translational signals enabling ribosomal frame retrieval consisting of 20 codons {AAC, AAT, ACC, ATC, ATT, CAG, CTC, CTG, GAA, GAC, GAG, GAT, GCC, GGC, GGT, GTA, GTC, GTT, TAC, TTC} universally overrepresented in coding versus other frames of gene sequences), regulates frameshift in transcription and translation. This dual transcription and translation role confirms for X the hypothesis that translational signals were carried over from transcriptional signals.

  16. Uncovering the polymerase-induced cytotoxicity of an oxidized nucleotide

    Science.gov (United States)

    Freudenthal, Bret D.; Beard, William A.; Perera, Lalith; Shock, David D.; Kim, Taejin; Schlick, Tamar; Wilson, Samuel H.

    2015-01-01

    Oxidative stress promotes genomic instability and human diseases. A common oxidized nucleoside is 8-oxo-7,8-dihydro-2'-deoxyguanosine, which is found both in DNA (8-oxo-G) and as a free nucleotide (8-oxo-dGTP). Nucleotide pools are especially vulnerable to oxidative damage. Therefore cells encode an enzyme (MutT/MTH1) that removes free oxidized nucleotides. This cleansing function is required for cancer cell survival and to modulate Escherichia coli antibiotic sensitivity in a DNA polymerase (pol)-dependent manner. How polymerases discriminate between damaged and non-damaged nucleotides is not well understood. This analysis is essential given the role of oxidized nucleotides in mutagenesis, cancer therapeutics, and bacterial antibiotics. Even with cellular sanitizing activities, nucleotide pools contain enough 8-oxo-dGTP to promote mutagenesis. This arises from the dual coding potential where 8-oxo-dGTP(anti) base pairs with cytosine and 8-oxo-dGTP(syn) uses its Hoogsteen edge to base pair with adenine. Here we use time-lapse crystallography to follow 8-oxo-dGTP insertion opposite adenine or cytosine with human pol β, to reveal that insertion is accommodated in either the syn- or anti-conformation, respectively. For 8-oxo-dGTP(anti) insertion, a novel divalent metal relieves repulsive interactions between the adducted guanine base and the triphosphate of the oxidized nucleotide. With either templating base, hydrogen-bonding interactions between the bases are lost as the enzyme reopens after catalysis, leading to a cytotoxic nicked DNA repair intermediate. Combining structural snapshots with kinetic and computational analysis reveals how 8-oxo-dGTP uses charge modulation during insertion that can lead to a blocked DNA repair intermediate.

  17. Development of Companion Diagnostics.

    Science.gov (United States)

    Mankoff, David A; Edmonds, Christine E; Farwell, Michael D; Pryma, Daniel A

    2016-01-01

    The goal of individualized and targeted treatment and precision medicine requires the assessment of potential therapeutic targets to direct treatment selection. The biomarkers used to direct precision medicine, often termed companion diagnostics, for highly targeted drugs have thus far been almost entirely based on in vitro assay of biopsy material. Molecular imaging companion diagnostics offer a number of features complementary to those from in vitro assay, including the ability to measure the heterogeneity of each patient's cancer across the entire disease burden and to measure early changes in response to treatment. We discuss the use of molecular imaging methods as companion diagnostics for cancer therapy with the goal of predicting response to targeted therapy and measuring early (pharmacodynamic) response as an indication of whether the treatment has "hit" the target. We also discuss considerations for probe development for molecular imaging companion diagnostics, including both small-molecule probes and larger molecules such as labeled antibodies and related constructs. We then describe two examples where both predictive and pharmacodynamic molecular imaging markers have been tested in humans: endocrine therapy for breast cancer and human epidermal growth factor receptor type 2-targeted therapy. The review closes with a summary of the items needed to move molecular imaging companion diagnostics from early studies into multicenter trials and into the clinic.

  18. Pitfalls in diagnostic radiology

    Energy Technology Data Exchange (ETDEWEB)

    Peh, Wilfred C.G. (ed.) [Khoo Teck Puat Hospital (Singapore). Dept. of Diagnostic Radiology

    2015-04-01

    Only textbook to focus primarily on the topic of pitfalls in diagnostic radiology. Highlights the pitfalls in a comprehensive and systematic manner. Written by experts in different imaging modalities and subspecialties from reputable centers across the world. The practice of diagnostic radiology has become increasingly complex, with the use of numerous imaging modalities and division into many subspecialty areas. It is becoming ever more difficult for subspecialist radiologists, general radiologists, and residents to keep up with the advances that are occurring year on year, and this is particularly true for less familiar topics. Failure to appreciate imaging pitfalls often leads to diagnostic error and misinterpretation, and potential medicolegal problems. Diagnostic errors may be due to various factors such as inadequate imaging technique, imaging artifacts, failure to recognize normal structures or variants, lack of correlation with clinical and other imaging findings, and poor training or inexperience. Many, if not most, of these factors are potentially recognizable, preventable, or correctable. This textbook, written by experts from reputable centers across the world, systematically and comprehensively highlights the pitfalls that may occur in diagnostic radiology. Both pitfalls specific to different modalities and techniques and those specific to particular organ systems are described with the help of numerous high-quality illustrations. Recognition of these pitfalls is crucial in helping the practicing radiologist to achieve a more accurate diagnosis.

  19. MJO Simulation Diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Waliser, D; Sperber, K; Hendon, H; Kim, D; Maloney, E; Wheeler, M; Weickmann, K; Zhang, C; Donner, L; Gottschalck, J; Higgins, W; Kang, I; Legler, D; Moncrieff, M; Schubert, S; Stern, W; Vitart, F; Wang, B; Wang, W; Woolnough, S

    2008-06-02

    The Madden-Julian Oscillation (MJO) interacts with, and influences, a wide range of weather and climate phenomena (e.g., monsoons, ENSO, tropical storms, mid-latitude weather), and represents an important, and as yet unexploited, source of predictability at the subseasonal time scale. Despite the important role of the MJO in our climate and weather systems, current global circulation models (GCMs) exhibit considerable shortcomings in representing this phenomenon. These shortcomings have been documented in a number of multi-model comparison studies over the last decade. However, diagnosis of model performance has been challenging, and model progress has been difficult to track, due to the lack of a coherent and standardized set of MJO diagnostics. One of the chief objectives of the US CLIVAR MJO Working Group is the development of observation-based diagnostics for objectively evaluating global model simulations of the MJO in a consistent framework. Motivation for this activity is reviewed, and the intent and justification for a set of diagnostics is provided, along with specification for their calculation, and illustrations of their application. The diagnostics range from relatively simple analyses of variance and correlation, to more sophisticated space-time spectral and empirical orthogonal function analyses. These diagnostic techniques are used to detect MJO signals, to construct composite life-cycles, to identify associations of MJO activity with the mean state, and to describe interannual variability of the MJO.

  20. Insertions/deletions-associated nucleotide polymorphism in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Changjiang Guo

    2016-11-01

    Full Text Available Although high levels of within-species variation are commonly observed, a general mechanism for the origin of such variation is still lacking. Insertions and deletions (indels are a widespread feature of genomes and we hypothesize that there might be an association between indels and patterns of nucleotide polymorphism. Here, we investigate flanking sequences around 18 indels (>100bp among a large number of accessions of the plant, Arabidopsis thaliana. We found two distinct haplotypes, i.e. a nucleotide dimorphism, present around each of these indels and dimorphic haplotypes always corresponded to the indel-present/-absent patterns. In addition, the peaks of nucleotide diversity between the two divergent alleles were closely associated with these indels. Thus, there exists a close association between indels and dimorphisms. Further analysis suggests that indel-associated substitutions could be an important component of genetic variation shaping nucleotide polymorphism in Arabidopsis. Finally, we suggest a mechanism by which indels might generate these highly divergent haplotypes. This study provides evidence that nucleotide dimorphisms, which are frequently regarded as evidence of frequency-dependent selection, could be explained simply by structural variation in the genome.

  1. Moss Phylogeny Reconstruction Using Nucleotide Pangenome of Complete Mitogenome Sequences.

    Science.gov (United States)

    Goryunov, D V; Nagaev, B E; Nikolaev, M Yu; Alexeevski, A V; Troitsky, A V

    2015-11-01

    Stability of composition and sequence of genes was shown earlier in 13 mitochondrial genomes of mosses (Rensing, S. A., et al. (2008) Science, 319, 64-69). It is of interest to study the evolution of mitochondrial genomes not only at the gene level, but also on the level of nucleotide sequences. To do this, we have constructed a "nucleotide pangenome" for mitochondrial genomes of 24 moss species. The nucleotide pangenome is a set of aligned nucleotide sequences of orthologous genome fragments covering the totality of all genomes. The nucleotide pangenome was constructed using specially developed new software, NPG-explorer (NPGe). The stable part of the mitochondrial genome (232 stable blocks) is shown to be, on average, 45% of its length. In the joint alignment of stable blocks, 82% of positions are conserved. The phylogenetic tree constructed with the NPGe program is in good correlation with other phylogenetic reconstructions. With the NPGe program, 30 blocks have been identified with repeats no shorter than 50 bp. The maximal length of a block with repeats is 140 bp. Duplications in the mitochondrial genomes of mosses are rare. On average, the genome contains about 500 bp in large duplications. The total length of insertions and deletions was determined in each genome. The losses and gains of DNA regions are rather active in mitochondrial genomes of mosses, and such rearrangements presumably can be used as additional markers in the reconstruction of phylogeny.

  2. ORION laser target diagnostics.

    Science.gov (United States)

    Bentley, C D; Edwards, R D; Andrew, J E; James, S F; Gardner, M D; Comley, A J; Vaughan, K; Horsfield, C J; Rubery, M S; Rothman, S D; Daykin, S; Masoero, S J; Palmer, J B; Meadowcroft, A L; Williams, B M; Gumbrell, E T; Fyrth, J D; Brown, C R D; Hill, M P; Oades, K; Wright, M J; Hood, B A; Kemshall, P

    2012-10-01

    The ORION laser facility is one of the UK's premier laser facilities which became operational at AWE in 2010. Its primary mission is one of stockpile stewardship, ORION will extend the UK's experimental plasma physics capability to the high temperature, high density regime relevant to Atomic Weapons Establishment's (AWE) program. The ORION laser combines ten laser beams operating in the ns regime with two sub ps short pulse chirped pulse amplification beams. This gives the UK a unique combined long pulse/short pulse laser capability which is not only available to AWE personnel but also gives access to our international partners and visiting UK academia. The ORION laser facility is equipped with a comprehensive suite of some 45 diagnostics covering optical, particle, and x-ray diagnostics all able to image the laser target interaction point. This paper focuses on a small selection of these diagnostics.

  3. Beamlet laser diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Burkhart, S.C.; Behrendt, W.C.; Smith, I.

    1996-06-01

    Beamlet is instrumented extensively to monitor the performance of the overall laser system and many of its subsystems. Beam diagnostics, installed in key locations, are used to fully characterize the beam during its propagation through the multipass cavity and the laser`s output section. This article describes the diagnostics stations located on Beamlet and discusses the design, calibration, and performance of the Beamlet calorimeters. The authors used Nova`s diagnostics packages to develop the Beamlet design to determine beam energy, spatial profile, temporal profile, and other beam parameters. Technologic improvements within the last several years in controls, charge-coupled device (CCD) cameras, and fast oscilloscopes have allowed the authors to obtain more accurate measurements on the Beamlet laser system. They briefly cover some of these techniques, including a description of their LabVIEW based data acquisition system.

  4. ORION laser target diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Bentley, C. D.; Edwards, R. D.; Andrew, J. E.; James, S. F.; Gardner, M. D.; Comley, A. J.; Vaughan, K.; Horsfield, C. J.; Rubery, M. S.; Rothman, S. D.; Daykin, S.; Masoero, S. J.; Palmer, J. B.; Meadowcroft, A. L.; Williams, B. M.; Gumbrell, E. T.; Fyrth, J. D.; Brown, C. R. D.; Hill, M. P.; Oades, K. [Plasma Physics Department, Atomic Weapons Establishment, Aldermaston, Reading, Berkshire RG7 4PR (United Kingdom); and others

    2012-10-15

    The ORION laser facility is one of the UK's premier laser facilities which became operational at AWE in 2010. Its primary mission is one of stockpile stewardship, ORION will extend the UK's experimental plasma physics capability to the high temperature, high density regime relevant to Atomic Weapons Establishment's (AWE) program. The ORION laser combines ten laser beams operating in the ns regime with two sub ps short pulse chirped pulse amplification beams. This gives the UK a unique combined long pulse/short pulse laser capability which is not only available to AWE personnel but also gives access to our international partners and visiting UK academia. The ORION laser facility is equipped with a comprehensive suite of some 45 diagnostics covering optical, particle, and x-ray diagnostics all able to image the laser target interaction point. This paper focuses on a small selection of these diagnostics.

  5. [Cytology in uropathological diagnostics].

    Science.gov (United States)

    Gaisa, N T; Lindemann-Docter, K

    2015-11-01

    Cytology in uropathological diagnostics is mainly performed for oncological purposes. The assessment of malignancy by urothelial cell morphology is therefore decisive; however, cytology is only sensitive enough to detect high-grade tumor cells and the different low-grade tumors cannot be reliably diagnosed. Thus, the four-tier classification system of cytological findings (i.e. negative, atypical cells but significance uncertain, suspicious and positive) refers to high-grade tumor cells only. Furthermore, for valid cytological diagnostics not only the cytological specimen but also clinical information on cystoscopy findings and, if applicable, a biopsy should be evaluated together. In difficult differential diagnostic settings, e.g. differentiation between reactive versus neoplastic atypia or difficult to access lesions in the upper urinary tract, additional fluorescence in situ hybridization of cytological preparations might be helpful. At the moment there are no indications for further immunocytology or additional biomarker tests.

  6. Diagnostic hematology of reptiles.

    Science.gov (United States)

    Stacy, Nicole I; Alleman, A Rick; Sayler, Katherine A

    2011-03-01

    The hematologic evaluation of reptiles is an indispensable diagnostic tool in exotic veterinary practice. The diversity of reptile species, their characteristic physiologic features, and effects of intrinsic and extrinsic factors present unique challenges for accurate interpretation of the hemogram. Combining the clinical presentation with hematologic findings provides valuable information in the diagnosis and monitoring of disease and helps guide the clinician toward therapy and further diagnostic testing. This article outlines the normal and pathologic morphology of blood cells of reptile species. The specific comparative aspects of reptiles are emphasized, and structural and functional abnormalities in the reptilian hemogram are described.

  7. Beam Instrumentation and Diagnostics

    CERN Document Server

    Strehl, Peter

    2006-01-01

    This treatise covers all aspects of the design and the daily operations of a beam diagnostic system for a large particle accelerator. A very interdisciplinary field, it involves contributions from physicists, electrical and mechanical engineers and computer experts alike so as to satisfy the ever-increasing demands for beam parameter variability for a vast range of operation modi and particles. The author draws upon 40 years of research and work, most of them spent as the head of the beam diagnostics group at GSI. He has illustrated the more theoretical aspects with many real-life examples that will provide beam instrumentation designers with ideas and tools for their work.

  8. [Molecular diagnostics and imaging].

    Science.gov (United States)

    Fink, Christian; Fisseler-Eckhoff, Annette; Huss, Ralf; Nestle, Ursula

    2009-01-01

    Molecular diagnostic methods and biological imaging techniques can make a major contribution to tailoring patients' treatment needs with regard to medical, ethical and pharmaco-economic aspects. Modern diagnostic methods are already being used to help identify different sub-groups of patients with thoracic tumours who are most likely to benefit significantly from a particular type of treatment. This contribution looks at the most recent developments that have been made in the field of thoracic tumour diagnosis and analyses the pros and cons of new molecular and other imaging techniques in day-to-day clinical practice.

  9. Palladium-Catalyzed Modification of Unprotected Nucleosides, Nucleotides, and Oligonucleotides

    Directory of Open Access Journals (Sweden)

    Kevin H. Shaughnessy

    2015-05-01

    Full Text Available Synthetic modification of nucleoside structures provides access to molecules of interest as pharmaceuticals, biochemical probes, and models to study diseases. Covalent modification of the purine and pyrimidine bases is an important strategy for the synthesis of these adducts. Palladium-catalyzed cross-coupling is a powerful method to attach groups to the base heterocycles through the formation of new carbon-carbon and carbon-heteroatom bonds. In this review, approaches to palladium-catalyzed modification of unprotected nucleosides, nucleotides, and oligonucleotides are reviewed. Polar reaction media, such as water or polar aprotic solvents, allow reactions to be performed directly on the hydrophilic nucleosides and nucleotides without the need to use protecting groups. Homogeneous aqueous-phase coupling reactions catalyzed by palladium complexes of water-soluble ligands provide a general approach to the synthesis of modified nucleosides, nucleotides, and oligonucleotides.

  10. Compositions and methods for detecting single nucleotide polymorphisms

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  11. Dynamics of Charge Transfer in Ordered and Chaotic Nucleotide Sequences

    CERN Document Server

    Fialko, N S

    2013-01-01

    Charge transfer is considered in systems composed of a donor, an acceptor and bridge sites of (AT) nucleotide pairs. For a bridge consisting of 180 (AT) pairs, three cases are dealt with: a uniform case, when all the nucleotides in each strand are identical; an ordered case, when nucleotides in each DNA strand are arranged in an orderly fashion; a chaotic case, when (AT) and (TA) pairs are arranged randomly. It is shown that in all the cases a charge transfer from a donor to an acceptor can take place. All other factors being equal, the transfer is the most efficient in the uniform case, the ordered and chaotic cases are less and the least efficient, accordingly. The results obtained are in agreement with experimental data on long-range charge transfer in DNA.

  12. Extracellular nucleotide derivatives protect cardiomyctes against hypoxic stress

    DEFF Research Database (Denmark)

    Golan, O; Issan, Y; Isak, A

    2011-01-01

    in cardioprotection against hypoxic stress has not been reported. OBJECTIVE: To investigate the role of purine and pyrimidine nucleotides and nucleosides in protective effects in cardiomyocytes subjected to hypoxia. METHODS AND RESULTS: Rat cultured cardiomyocytes were treated with various extracellular nucleotides...... and nucleosides, before or during hypoxic stress. The results revealed that GTP or CTP exhibit cardioprotective ability, as revealed by lactate dehydrogenase (LDH) release, by propidium iodide (PI) staining, by cell morphology, and by preserved mitochondrial activity. Pretreatment with various P2 antagonists...... (suramin, RB-2, or PPADS) did not abolish the cardioprotective effect of the nucleotides. Moreover, P2Y₂ -/- , P2Y₄ -/-, and P2Y₂ -/-/P2Y₄ -/- receptor knockouts mouse cardiomyocytes were significantly protected against hypoxic stress when treated with UTP. These results indicate that the protective effect...

  13. Effect of nucleotides on broiler performance and carcass yield

    Directory of Open Access Journals (Sweden)

    VC Pelícia

    2010-03-01

    Full Text Available This study aimed at evaluating the effect of nucleotides on the performance and carcass yield of broilers fed diets with no antibiotic growth promoters (AGP, anticoccidials, or animal feedstuffs. In the trial, 600 Ross 308 male broilers were distributed in a completely randomized experimental design into six treatments with four replicates of 25 birds each. Treatments consisted of a control diet (CD, CD + AGP, CD + 0.04%, CD + 0.05%, CD + 0.06%, and CD + 0.07% nucleotides. The experimental diets did not contain anticoccidials, and birds were vaccinated against coccidiosis at three days of age. No significant differences were detected among broilers submitted to the different treatments in none of the studied parameters. Under the conditions of this experiment, diets supplemented with nucleotides did not influence broiler performance or carcass yield at 42 days of age, and were not different from the feeds not containing any additive or with AGP.

  14. Fixed-gap tunnel junction for reading DNA nucleotides.

    Science.gov (United States)

    Pang, Pei; Ashcroft, Brian Alan; Song, Weisi; Zhang, Peiming; Biswas, Sovan; Qing, Quan; Yang, Jialing; Nemanich, Robert J; Bai, Jingwei; Smith, Joshua T; Reuter, Kathleen; Balagurusamy, Venkat S K; Astier, Yann; Stolovitzky, Gustavo; Lindsay, Stuart

    2014-12-23

    Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events.

  15. Nucleotide frequencies in human genome and fibonacci numbers.

    Science.gov (United States)

    Yamagishi, Michel E Beleza; Shimabukuro, Alex Itiro

    2008-04-01

    This work presents a mathematical model that establishes an interesting connection between nucleotide frequencies in human single-stranded DNA and the famous Fibonacci's numbers. The model relies on two assumptions. First, Chargaff's second parity rule should be valid, and second, the nucleotide frequencies should approach limit values when the number of bases is sufficiently large. Under these two hypotheses, it is possible to predict the human nucleotide frequencies with accuracy. This result may be used as evidence to the Fibonacci string model that was proposed to the sequence growth of DNA repetitive sequences. It is noteworthy that the predicted values are solutions of an optimization problem, which is commonplace in many of nature's phenomena.

  16. Characterization of nucleotide misincorporation patterns in the iceman's mitochondrial DNA.

    Directory of Open Access Journals (Sweden)

    Cristina Olivieri

    Full Text Available BACKGROUND: The degradation of DNA represents one of the main issues in the genetic analysis of archeological specimens. In the recent years, a particular kind of post-mortem DNA modification giving rise to nucleotide misincorporation ("miscoding lesions" has been the object of extensive investigations. METHODOLOGY/PRINCIPAL FINDINGS: To improve our knowledge regarding the nature and incidence of ancient DNA nucleotide misincorporations, we have utilized 6,859 (629,975 bp mitochondrial (mt DNA sequences obtained from the 5,350-5,100-years-old, freeze-desiccated human mummy popularly known as the Tyrolean Iceman or Otzi. To generate the sequences, we have applied a mixed PCR/pyrosequencing procedure allowing one to obtain a particularly high sequence coverage. As a control, we have produced further 8,982 (805,155 bp mtDNA sequences from a contemporary specimen using the same system and starting from the same template copy number of the ancient sample. From the analysis of the nucleotide misincorporation rate in ancient, modern, and putative contaminant sequences, we observed that the rate of misincorporation is significantly lower in modern and putative contaminant sequence datasets than in ancient sequences. In contrast, type 2 transitions represent the vast majority (85% of the observed nucleotide misincorporations in ancient sequences. CONCLUSIONS/SIGNIFICANCE: This study provides a further contribution to the knowledge of nucleotide misincorporation patterns in DNA sequences obtained from freeze-preserved archeological specimens. In the Iceman system, ancient sequences can be clearly distinguished from contaminants on the basis of nucleotide misincorporation rates. This observation confirms a previous identification of the ancient mummy sequences made on a purely phylogenetical basis. The present investigation provides further indication that the majority of ancient DNA damage is reflected by type 2 (cytosine

  17. MAC: identifying and correcting annotation for multi-nucleotide variations.

    Science.gov (United States)

    Wei, Lei; Liu, Lu T; Conroy, Jacob R; Hu, Qiang; Conroy, Jeffrey M; Morrison, Carl D; Johnson, Candace S; Wang, Jianmin; Liu, Song

    2015-08-01

    Next-Generation Sequencing (NGS) technologies have rapidly advanced our understanding of human variation in cancer. To accurately translate the raw sequencing data into practical knowledge, annotation tools, algorithms and pipelines must be developed that keep pace with the rapidly evolving technology. Currently, a challenge exists in accurately annotating multi-nucleotide variants (MNVs). These tandem substitutions, when affecting multiple nucleotides within a single protein codon of a gene, result in a translated amino acid involving all nucleotides in that codon. Most existing variant callers report a MNV as individual single-nucleotide variants (SNVs), often resulting in multiple triplet codon sequences and incorrect amino acid predictions. To correct potentially misannotated MNVs among reported SNVs, a primary challenge resides in haplotype phasing which is to determine whether the neighboring SNVs are co-located on the same chromosome. Here we describe MAC (Multi-Nucleotide Variant Annotation Corrector), an integrative pipeline developed to correct potentially mis-annotated MNVs. MAC was designed as an application that only requires a SNV file and the matching BAM file as data inputs. Using an example data set containing 3024 SNVs and the corresponding whole-genome sequencing BAM files, we show that MAC identified eight potentially mis-annotated SNVs, and accurately updated the amino acid predictions for seven of the variant calls. MAC can identify and correct amino acid predictions that result from MNVs affecting multiple nucleotides within a single protein codon, which cannot be handled by most existing SNV-based variant pipelines. The MAC software is freely available and represents a useful tool for the accurate translation of genomic sequence to protein function.

  18. Fluorescence chemosensors with pyrene and their interaction with nucleotide phosphate

    Institute of Scientific and Technical Information of China (English)

    李华平; 汪鹏飞; 吴世康

    1999-01-01

    A group of fluorescence chemosensor with pyrene, compounds (Ⅰ), (Ⅱ) and (Ⅲ), were synthesized The fluorescence spectra and the lifetime of these compounds were carefully measured. The fluorescence quenching spec tra of pyrenyl butyric acid, compounds (Ⅰ), (Ⅱ) and (Ⅲ) by different nucleotide phosphates, AMP ADP, ATP dTTP, were also recorded and studied. The quenching and the stability constants were calculated by Stern-Volmer equa tion and eq. (2), respectively. The mechanism of interaction between fluorescence chemosensor and nucleotide phos phate was didscussed based on the comparison of the results obtained with the CPK model of free molecules of these com pounds in the ground state.

  19. Effect of nucleotides on broiler performance and carcass yield

    OpenAIRE

    VC Pelícia; JR Sartori; KC Zavarize; AC Pezzato; AC Stradiotti; PC Araujo; MAO Mituo; LA Madeira

    2010-01-01

    This study aimed at evaluating the effect of nucleotides on the performance and carcass yield of broilers fed diets with no antibiotic growth promoters (AGP), anticoccidials, or animal feedstuffs. In the trial, 600 Ross 308 male broilers were distributed in a completely randomized experimental design into six treatments with four replicates of 25 birds each. Treatments consisted of a control diet (CD), CD + AGP, CD + 0.04%, CD + 0.05%, CD + 0.06%, and CD + 0.07% nucleotides. The experimental ...

  20. Diagnostic and interventional radiology

    Energy Technology Data Exchange (ETDEWEB)

    Vogl, Thomas J. [Klinikum der Johann Wolfgang Goethe-Universitaet, Frankfurt am Main (Germany). Inst. fuer Diagnostische und Interventionelle Radiologie; Reith, Wolfgang [Universitaetsklinikum des Saarlandes, Homburg/Saar (Germany). Klinik fuer Diagnostische und Interventionelle Neuroradiologie; Rummeny, Ernst J. (ed.) [Technische Univ. Muenchen Klinikum rechts der Isar, Muenchen (Germany). Inst. fuer Radiologie

    2016-08-01

    This exceptional book covers all aspects of diagnostic and interventional radiology within one volume, at a level appropriate for the specialist. From the basics through diagnosis to intervention: the reader will find a complete overview of all areas of radiology. The clear, uniform structure, with chapters organized according to organ system, facilitates the rapid retrieval of information. Features include: Presentation of the normal radiological anatomy Classification of the different imaging procedures according to their diagnostic relevance Imaging diagnosis with many reference images Precise description of the interventional options The inclusion of many instructive aids will be of particular value to novices in decision making: Important take home messages and summaries of key radiological findings smooth the path through the jungle of facts Numerous tables on differential diagnosis and typical findings in the most common diseases offer a rapid overview and orientation Diagnostic flow charts outline the sequence of diagnostic evaluation All standard procedures within the field of interventional radiology are presented in a clinically relevant and readily understandable way, with an abundance of illustrations. This is a textbook, atlas, and reference in one: with more than 2500 images for comparison with the reader's own findings. This comprehensive and totally up-to-date book provides a superb overview of everything that the radiology specialist of today needs to know.

  1. Beamlet focal plane diagnostic

    Energy Technology Data Exchange (ETDEWEB)

    Caird, J.A.; Nielsen, N.D.; Patton, H.G.; Seppala, L.G.; Thompson, C.E.; Wegner, P.J.

    1996-12-01

    This paper describes the major optical and mechanical design features of the Beamlet Focal Plane Diagnostic system as well as measurements of the system performance, and typical data obtained to date. We also discuss the NIF requirements on the focal spot that we are interested in measuring, and some of our plans for future work using this system.

  2. dbQSNP: a database of SNPs in human promoter regions with allele frequency information determined by single-strand conformation polymorphism-based methods.

    Science.gov (United States)

    Tahira, Tomoko; Baba, Shingo; Higasa, Koichiro; Kukita, Yoji; Suzuki, Yutaka; Sugano, Sumio; Hayashi, Kenshi

    2005-08-01

    We present a database, dbQSNP (http://qsnp.gen.kyushu-u.ac.jp/), that provides sequence and allele frequency information for single-nucleotide polymorphisms (SNPs) located in the promoter regions of human genes, which were defined by the 5' ends of full-length cDNA clones. We searched for the SNPs in these regions by sequencing or single-strand conformation polymorphism (SSCP) analysis. The allele frequencies of the identified SNPs in two ethnic groups were quantified by SSCP analyses of pooled DNA samples. The accuracy of our estimation is supported by strong correlations between the frequencies in our data and those in other databases for the same ethnic groups. The frequencies vary considerably between the two ethnic groups studied, suggesting the need for population-based collections and allele frequency determination of SNPs, in, e.g., association studies of diseases. We show profiles of SNP densities that are characteristic of transcription start site regions. A fraction of the SNPs revealed a significantly different allele frequency between the groups, suggesting differential selection of the genes involved.

  3. Functional PTGS2 polymorphism-based models as novel predictive markers in metastatic renal cell carcinoma patients receiving first-line sunitinib

    Science.gov (United States)

    Cebrián, Arancha; Gómez del Pulgar, Teresa; Méndez-Vidal, María José; Gonzálvez, María Luisa; Lainez, Nuria; Castellano, Daniel; García-Carbonero, Iciar; Esteban, Emilio; Sáez, Maria Isabel; Villatoro, Rosa; Suárez, Cristina; Carrato, Alfredo; Munárriz-Ferrándiz, Javier; Basterrechea, Laura; García-Alonso, Mirta; González-Larriba, José Luis; Perez-Valderrama, Begoña; Cruz-Jurado, Josefina; González del Alba, Aránzazu; Moreno, Fernando; Reynés, Gaspar; Rodríguez-Remírez, María; Boni, Valentina; Mahillo-Fernández, Ignacio; Martin, Yolanda; Viqueira, Andrea; García-Foncillas, Jesús

    2017-01-01

    Sunitinib is the currently standard treatment for metastatic renal cell carcinoma (mRCC). Multiple candidate predictive biomarkers for sunitinib response have been evaluated but none of them has been implemented in the clinic yet. The aim of this study was to analyze single nucleotide polymorphisms (SNPs) in genes linked to mode of action of sunitinib and immune response as biomarkers for mRCC. This is a multicenter, prospective and observational study involving 20 hospitals. Seventy-five mRCC patients treated with sunitinib as first line were used to assess the impact of 63 SNPs in 31 candidate genes on clinical outcome. rs2243250 (IL4) and rs5275 (PTGS2) were found to be significantly associated with shorter cancer-specific survival (CSS). Moreover, allele C (rs5275) was associated with higher PTGS2 expression level confirming its functional role. Combination of rs5275 and rs7651265 or rs2243250 for progression free survival (PFS) or CSS, respectively, was a more valuable predictive biomarker remaining significant after correction for multiple testing. It is the first time that association of rs5275 with survival in mRCC patients is described. Two-SNP models containing this functional variant may serve as more predictive biomarkers for sunitinib and could suppose a clinically relevant tool to improve the mRCC patient management. PMID:28117391

  4. Role of a GAG hinge in the nucleotide-induced conformational change governing nucleotide specificity by T7 DNA polymerase.

    Science.gov (United States)

    Jin, Zhinan; Johnson, Kenneth A

    2011-01-14

    A nucleotide-induced change in DNA polymerase structure governs the kinetics of polymerization by high fidelity DNA polymerases. Mutation of a GAG hinge (G542A/G544A) in T7 DNA polymerase resulted in a 1000-fold slower rate of conformational change, which then limited the rate of correct nucleotide incorporation. Rates of misincorporation were comparable to that seen for wild-type enzyme so that the net effect of the mutation was a large decrease in fidelity. We demonstrate that a presumably modest change from glycine to alanine 20 Å from the active site can severely restrict the flexibility of the enzyme structure needed to recognize and incorporate correct substrates with high specificity. These results emphasize the importance of the substrate-induced conformational change in governing nucleotide selectivity by accelerating the incorporation of correct base pairs but not mismatches.

  5. Requirements for ITER diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Young, K.M.

    1991-01-01

    The development and design of plasma diagnostics for the International Thermonuclear Experimental Reactor (ITER) present a formidable challenge for experimental plasma physicists. The large plasma size, the high central density and temperature and the very high thermal wall loadings provide new challenges for present measurement techniques and lead to a search for new methods. But the physics and control requirements for the long burn phase of the discharge, combined with very limited access to the plasma, constrained by the requirement for radiation shielding of the coils and sharing of access ports with heating and current drive power, remote manipulation, fueling and turn blanket modules, make for very difficult design choices. An initial attempt at these choices has been made by an international team of diagnostic physicists, gathering together in a series of three workshops during the ITER Conceptual Design Activity. This paper is based on that report and provides a summary of its most important points. To provide a background against which to place the diagnostic requirements and design concepts, the ITER device, its most important plasma properties and the proposed experimental program will be described. The specifications for the measurement of the plasma parameters and the proposed diagnostics for these measurements will then be addressed, followed by some examples of the design concepts that have been proposed. As a result of these design studies, it was clear that there were many uncertainties associated with these concepts, particularly because of the nuclear radiation environment, so that a Research and Development Program for diagnostic hardware was established. It will also be briefly summarized.

  6. Nucleotide excision repair: ERCC1 and TFIIH complexes

    NARCIS (Netherlands)

    A.J. van Vuuren (Hanneke)

    1995-01-01

    textabstractDNA is the carrier of genetic information in living organisms. The information stored in the nucleotide sequence of DNA is transmitted to the offspring by generating identical copies of the parental DNA molecules. Damage in DNA can cause loss of genetic information. Nevertheless, the DNA

  7. Single nucleotide polymorphisms associated with rat expressed sequences

    NARCIS (Netherlands)

    Guryev, Victor; Berezikov, Eugene; Malik, Rainer; Plasterk, Ronald H A; Cuppen, Edwin

    2004-01-01

    Single nucleotide polymorphisms (SNPs) are the most common source of genetic variation in populations and are thus most likely to account for the majority of phenotypic and behavioral differences between individuals or strains. Although the rat is extensively studied for the latter, data on naturall

  8. Nucleotide excision repair syndromes: molecular basis and clinical symptoms.

    NARCIS (Netherlands)

    D. Bootsma (Dirk); G. Weeda (Geert); W. Vermeulen (Wim); H. van Vuuren; C. Troelstra (Christine); J.H.J. Hoeijmakers (Jan); P.J. van der Spek (Peter)

    1995-01-01

    textabstractThe phenotypic consequences of a nucleotide excision repair (NER) defect in man are apparent from three distinct inborn diseases characterized by hypersensitivity of the skin to ultraviolet light and a remarkable clinical and genetic heterogeneity. These are the prototype repair

  9. Nucleotide Sequence of the Protective Antigen Gene of Bacillus Anthracis

    Science.gov (United States)

    1988-02-02

    Montie, S. Kadis, and S. I. Ajl (ed.), Microbial toxins, vol. 3. Academic Press, Inc., New York. 23. Little, S. F., and G. B. Knudaon. 1986...Takkinen, and L. Kaariainen. 1981. Nucleotide sequence of the promoter and NHa-terminal signal peptide region of the a- amylase gene from Bacillus

  10. Single nucleotide polymorphism in genome-wide association of ...

    African Journals Online (AJOL)

    Mohd Fareed

    2012-09-25

    Sep 25, 2012 ... The arrival of new technologies that type more than millions of the single nucleotide polymor- .... and quality control now permit affordable, reliable genotyping of up to 1 million ... disease. Such pooled studies, like all genetic association stud- .... to researchers interested in evolutionary biology, and hence.

  11. Environmental heat stress, hyperammonemia and nucleotide metabolism during intermittent exercise

    DEFF Research Database (Denmark)

    Mohr, Magni; Rasmussen, Peter; Drust, Barry

    2006-01-01

    Abstract  This study investigated the influence of environmental heat stress on ammonia (NH3) accumulation in relation to nucleotide metabolism and fatigue during intermittent exercise. Eight males performed 40 min of intermittent exercise (15 s at 306±22 W alternating with 15 s of unloaded cycli...

  12. Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-06-17

    Jun 17, 2009 ... 3Technical Center for Inspection and Quarantine, Beijing Entry-Exit Inspection ... differentiation related to geographical distribution in C. japonica ... gene sequences of C. japonica in China to assess nucleotide ... Map of China with locations from which Caligula japonica was sampled indicated a black dot.

  13. THE NUCLEOTIDE RECEPTORS ON MOUSE C2C12 MYOTUBES

    NARCIS (Netherlands)

    HENNING, RH; NELEMANS, A; VANDENAKKER, J; DENHERTOG, A

    1992-01-01

    1 The response of C2C12 mouse myotubes to stimulation with adenosine triphosphate (ATP) and other nucleotides was studied by measuring changes in membrane potential. 2 A transient hyperpolarization followed by a slowly declining depolarization of the cells was observed in the presence of ATP (10-mu-

  14. Increased nucleotide diversity with transient Y linkage in Drosophila americana.

    Directory of Open Access Journals (Sweden)

    Bryant F McAllister

    Full Text Available Recombination shapes nucleotide variation within genomes. Patterns are thought to arise from the local recombination landscape, influencing the degree to which neutral variation experiences hitchhiking with selected variation. This study examines DNA polymorphism along Chromosome 4 (element B of Drosophila americana to identify effects of hitchhiking arising as a consequence of Y-linked transmission. A centromeric fusion between the X and 4(th chromosomes segregates in natural populations of D. americana. Frequency of the X-4 fusion exhibits a strong positive correlation with latitude, which has explicit consequences for unfused 4(th chromosomes. Unfused Chromosome 4 exists as a non-recombining Y chromosome or as an autosome proportional to the frequency of the X-4 fusion. Furthermore, Y linkage along the unfused 4 is disrupted as a function of the rate of recombination with the centromere. Inter-population and intra-chromosomal patterns of nucleotide diversity were assayed using six regions distributed along unfused 4(th chromosomes derived from populations with different frequencies of the X-4 fusion. No difference in overall level of nucleotide diversity was detected among populations, yet variation along the chromosome exhibits a distinct pattern in relation to the X-4 fusion. Sequence diversity is inflated at loci experiencing the strongest Y linkage. These findings are inconsistent with the expected reduction in nucleotide diversity resulting from hitchhiking due to background selection or selective sweeps. In contrast, excessive polymorphism is accruing in association with transient Y linkage, and furthermore, hitchhiking with sexually antagonistic alleles is potentially responsible.

  15. Nucleotide excision repair of DNA: The very early history.

    Science.gov (United States)

    Friedberg, Errol C

    2011-07-15

    This article, taken largely from the book Correcting the Blueprint of Life: An Historical Account of the Discovery of DNA Repair Mechanisms, summarizes the very early history of the discovery of nucleotide excision repair. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. The nucleotide sequences of two leghemoglobin genes from soybean

    DEFF Research Database (Denmark)

    Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

    1982-01-01

    We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

  17. [Tabular excel editor for analysis of aligned nucleotide sequences].

    Science.gov (United States)

    Demkin, V V

    2010-01-01

    Excel platform was used for transition of results of multiple aligned nucleotide sequences obtained using the BLAST network service to the form appropriate for visual analysis and editing. Two macros operators for MS Excel 2007 were constructed. The array of aligned sequences transformed into Excel table and processed using macros operators is more appropriate for analysis than initial html data.

  18. Single Nucleotide Polymorphisms Predict Symptom Severity of Autism Spectrum Disorder

    Science.gov (United States)

    Jiao, Yun; Chen, Rong; Ke, Xiaoyan; Cheng, Lu; Chu, Kangkang; Lu, Zuhong; Herskovits, Edward H.

    2012-01-01

    Autism is widely believed to be a heterogeneous disorder; diagnosis is currently based solely on clinical criteria, although genetic, as well as environmental, influences are thought to be prominent factors in the etiology of most forms of autism. Our goal is to determine whether a predictive model based on single-nucleotide polymorphisms (SNPs)…

  19. THE NUCLEOTIDE RECEPTORS ON MOUSE C2C12 MYOTUBES

    NARCIS (Netherlands)

    HENNING, RH; NELEMANS, A; VANDENAKKER, J; DENHERTOG, A

    1 The response of C2C12 mouse myotubes to stimulation with adenosine triphosphate (ATP) and other nucleotides was studied by measuring changes in membrane potential. 2 A transient hyperpolarization followed by a slowly declining depolarization of the cells was observed in the presence of ATP

  20. Synthesis, bioanalysis and pharmacology of nucleoside and nucleotide analogs

    NARCIS (Netherlands)

    Jansen, R.S.

    2009-01-01

    Nucleoside analogs are an important class of drugs in anticancer and antiviral therapy. The compounds are, however, only active after intracellular conversion to their mono-, di- and triphosphate nucleotide form. In this thesis the development of sensitive liquid chromatography coupled to tandem mas

  1. DNA Nucleotides Detection via capacitance properties of Graphene

    Science.gov (United States)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  2. A Laboratory Exercise for Genotyping Two Human Single Nucleotide Polymorphisms

    Science.gov (United States)

    Fernando, James; Carlson, Bradley; LeBard, Timothy; McCarthy, Michael; Umali, Finianne; Ashton, Bryce; Rose, Ferrill F., Jr.

    2016-01-01

    The dramatic decrease in the cost of sequencing a human genome is leading to an era in which a wide range of students will benefit from having an understanding of human genetic variation. Since over 90% of sequence variation between humans is in the form of single nucleotide polymorphisms (SNPs), a laboratory exercise has been devised in order to…

  3. Mining for Single Nucleotide Polymorphisms in Pig genome sequence data

    NARCIS (Netherlands)

    Kerstens, H.H.D.; Kollers, S.; Kommandath, A.; Rosario, del M.; Dibbits, B.W.; Kinders, S.M.; Crooijmans, R.P.M.A.; Groenen, M.A.M.

    2009-01-01

    Background - Single nucleotide polymorphisms (SNPs) are ideal genetic markers due to their high abundance and the highly automated way in which SNPs are detected and SNP assays are performed. The number of SNPs identified in the pig thus far is still limited. Results - A total of 4.8 million whole g

  4. Global regulation of nucleotide biosynthetic genes by c-Myc.

    Directory of Open Access Journals (Sweden)

    Yen-Chun Liu

    Full Text Available BACKGROUND: The c-Myc transcription factor is a master regulator and integrates cell proliferation, cell growth and metabolism through activating thousands of target genes. Our identification of direct c-Myc target genes by chromatin immunoprecipitation (ChIP coupled with pair-end ditag sequencing analysis (ChIP-PET revealed that nucleotide metabolic genes are enriched among c-Myc targets, but the role of Myc in regulating nucleotide metabolic genes has not been comprehensively delineated. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report that the majority of genes in human purine and pyrimidine biosynthesis pathway were induced and directly bound by c-Myc in the P493-6 human Burkitt's lymphoma model cell line. The majority of these genes were also responsive to the ligand-activated Myc-estrogen receptor fusion protein, Myc-ER, in a Myc null rat fibroblast cell line, HO.15 MYC-ER. Furthermore, these targets are also responsive to Myc activation in transgenic mouse livers in vivo. To determine the functional significance of c-Myc regulation of nucleotide metabolism, we sought to determine the effect of loss of function of direct Myc targets inosine monophosphate dehydrogenases (IMPDH1 and IMPDH2 on c-Myc-induced cell growth and proliferation. In this regard, we used a specific IMPDH inhibitor mycophenolic acid (MPA and found that MPA dramatically inhibits c-Myc-induced P493-6 cell proliferation through S-phase arrest and apoptosis. CONCLUSIONS/SIGNIFICANCE: Taken together, these results demonstrate the direct induction of nucleotide metabolic genes by c-Myc in multiple systems. Our finding of an S-phase arrest in cells with diminished IMPDH activity suggests that nucleotide pool balance is essential for c-Myc's orchestration of DNA replication, such that uncoupling of these two processes create DNA replication stress and apoptosis.

  5. Diagnostic evaluation of dysphagia.

    Science.gov (United States)

    Cook, Ian J

    2008-07-01

    Taking a careful history is vital for the evaluation of dysphagia. The history will yield the likely underlying pathophysiologic process and anatomic site of the problem in most patients, and is crucial for determining whether subsequently detected radiographic or endoscopic 'anomalies' are relevant or incidental. Although the symptoms of pharyngeal dysphagia can be multiple and varied, the typical features of neurogenic pharyngeal dysphagia are highly specific, and can accurately distinguish pharyngeal from esophageal disorders. The history will also dictate whether the next diagnostic procedure should be endoscopy, a barium swallow or esophageal manometry. In some difficult cases, all three diagnostic techniques may need to be performed to establish an accurate diagnosis. Stroke is the most common cause of pharyngeal dysphagia. A videoradiographic swallow study is vital in such cases to determine the extent and timing of aspiration and the severity and mechanics of dysfunction as a prelude to therapy.

  6. Nanobiosensors in diagnostics

    Directory of Open Access Journals (Sweden)

    Alejandro Chamorro-Garcia

    2016-11-01

    Full Text Available Medical diagnosis has been greatly improved thanks to the development of new techniques capable of performing very sensitive detection and quantifying certain parameters. These parameters can be correlated with the presence of specific molecules and their quantity. Unfortunately, these techniques are demanding, expensive, and often complicated. On the other side, progress in other fields of science and technology has contributed to the rapid growth of nanotechnology. Although being an emerging discipline, nanotechnology has raised huge interest and expectations. Most of the enthusiasm comes from new possibilities and properties of nanomaterials. Biosensors (simple, robust, sensitive, cost-effective combined with nanomaterials, also called nanobiosensors, are serving as bridge between advanced detection/diagnostics and daily/routine tests. Here we review some of the latest applications of nanobiosensors in diagnostics field.

  7. Gene Disease Diagnostic System

    Institute of Scientific and Technical Information of China (English)

    黄国亮; 张腾飞; 程京; 周玉祥; 刘诚迅; 金国藩; 邬敏贤; 严瑛白; 杨蓉

    2002-01-01

    Binary optics, where the optical element can be fabricated on a thin glass plate with micro-ion-etching film layer, has been widely applied in recent years. A novel optical scanning system for gene disease diagnostics described in this paper has four kinds of optical devices, including beam splitters, an array lens, an array filter and detection arrays. A software was developed to design the binary optics system using an iterative method. Two beam splitters were designed and fabricated, which can divide a beam into a 9×9 array or into a 13×13 array. The beam splitters have good diffraction efficiencies (>70%) and an even energy distribution. The gene disease diagnostic system is a portable biochip and binary optics technology. The binary optical devices in the non-confocal scanning system can raise the fluorescence detection sensitivity of the micro-array hybrid biochip.

  8. Cardiovascular modeling and diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Kangas, L.J.; Keller, P.E.; Hashem, S.; Kouzes, R.T. [Pacific Northwest Lab., Richland, WA (United States)

    1995-12-31

    In this paper, a novel approach to modeling and diagnosing the cardiovascular system is introduced. A model exhibits a subset of the dynamics of the cardiovascular behavior of an individual by using a recurrent artificial neural network. Potentially, a model will be incorporated into a cardiovascular diagnostic system. This approach is unique in that each cardiovascular model is developed from physiological measurements of an individual. Any differences between the modeled variables and the variables of an individual at a given time are used for diagnosis. This approach also exploits sensor fusion to optimize the utilization of biomedical sensors. The advantage of sensor fusion has been demonstrated in applications including control and diagnostics of mechanical and chemical processes.

  9. PROcess Based Diagnostics PROBE

    Science.gov (United States)

    Clune, T.; Schmidt, G.; Kuo, K.; Bauer, M.; Oloso, H.

    2013-01-01

    Many of the aspects of the climate system that are of the greatest interest (e.g., the sensitivity of the system to external forcings) are emergent properties that arise via the complex interplay between disparate processes. This is also true for climate models most diagnostics are not a function of an isolated portion of source code, but rather are affected by multiple components and procedures. Thus any model-observation mismatch is hard to attribute to any specific piece of code or imperfection in a specific model assumption. An alternative approach is to identify diagnostics that are more closely tied to specific processes -- implying that if a mismatch is found, it should be much easier to identify and address specific algorithmic choices that will improve the simulation. However, this approach requires looking at model output and observational data in a more sophisticated way than the more traditional production of monthly or annual mean quantities. The data must instead be filtered in time and space for examples of the specific process being targeted.We are developing a data analysis environment called PROcess-Based Explorer (PROBE) that seeks to enable efficient and systematic computation of process-based diagnostics on very large sets of data. In this environment, investigators can define arbitrarily complex filters and then seamlessly perform computations in parallel on the filtered output from their model. The same analysis can be performed on additional related data sets (e.g., reanalyses) thereby enabling routine comparisons between model and observational data. PROBE also incorporates workflow technology to automatically update computed diagnostics for subsequent executions of a model. In this presentation, we will discuss the design and current status of PROBE as well as share results from some preliminary use cases.

  10. Idiopathic chondrolysis - diagnostic difficulties

    Energy Technology Data Exchange (ETDEWEB)

    Kozlowski, K.; Scougall, J.

    1984-07-01

    Four cases of idiopathic chondrolysis of the hip in three white girls and one Maori girl are reported. The authors stress the causes why a disease with characteristic clinical and radiographic appearances and normal biochemical findings presents diagnostic difficulties. It is suspected that idiopathic chondrolysis is a metabolic disorder of chondrocytes, triggered by environment circumstances in susceptible individuals. Idiopathic chondrolysis is probably one of the most common causes of coxarthrosis in women.

  11. STELLA Experiment - Microbunch Diagnostic

    Energy Technology Data Exchange (ETDEWEB)

    He, P.; Liu, Y.; Cline, D. B.; Babzien, M.; Gallardo, J. C.; Kusche, K. P.; Pogorelsky, I. V.; Skaritka, J.; van Steenbergen, A.; Yakimenko, V.; Kimura, W. D.

    1998-07-01

    A microbunch diagnostic system is built at the Accelerator Test Facility (ATF) of Brookhaven National Laboratory for monitoring microbunches (10-fs bunch length) produced by the Inverse Free Electron Laser accelerator in Staged Electron Laser Acceleration experiment. It is similar to one already demonstrated at the ATF. With greatly improved beam optics conditions higher order harmonic coherent transition radiation will be measurable to determine the microbunch length and shape.

  12. Diagnostic complexities of eosinophilia.

    Science.gov (United States)

    Montgomery, Nathan D; Dunphy, Cherie H; Mooberry, Micah; Laramore, Andrew; Foster, Matthew C; Park, Steven I; Fedoriw, Yuri D

    2013-02-01

    The advent of molecular tools capable of subclassifying eosinophilia has changed the diagnostic and clinical approach to what was classically called hypereosinophilic syndrome. To review the etiologies of eosinophilia and to describe the current diagnostic approach to this abnormality. Literature review. Eosinophilia is a common, hematologic abnormality with diverse etiologies. The underlying causes can be broadly divided into reactive, clonal, and idiopathic. Classically, many cases of eosinophilia were grouped together into the umbrella category of hypereosinophilic syndrome, a clinical diagnosis of exclusion. In recent years, an improved mechanistic understanding of many eosinophilias has revolutionized the way these disorders are understood, diagnosed, and treated. As a result, specific diagnoses can now be assigned in many cases that were previously defined as hypereosinophilic syndrome. Most notably, chromosomal rearrangements, such as FIP1L1-PDGFRA fusions caused by internal deletions in chromosome 4, are now known to be associated with many chronic eosinophilic leukemias. When present, these specific molecular abnormalities predict response to directed therapies. Although an improved molecular understanding is revolutionizing the treatment of patients with rare causes of eosinophilia, it has also complicated the approach to evaluating and treating eosinophilia. Here, we review causes of eosinophilia and present a framework by which the practicing pathologist may approach this diagnostic dilemma. Finally, we consider recent cases as clinical examples of eosinophilia from a single institution, demonstrating the diversity of etiologies that must be considered.

  13. [Histopathological meniscus diagnostic].

    Science.gov (United States)

    Fisseler-Eckhoff, A; Müller, K-M

    2009-06-01

    Menisci fulfill many functions within the complex biomechanics of the knee joint. In the case of meniscus lesions, sparing arthroscopic resections and operative refixation are the treatments of choice. With regard to diagnostics, this means that in general terms, the histopathologic diagnostics are carried out on detached meniscus fragments of between 5 mm and 2 cm in size. An experienced pathologist's knowledge of physiologically possible cellular and fibrous histological meniscus damage, as opposed to nonphysiological change regarded as normal with respect to age, is essential during a diagnostic meniscus evaluation. The clinician expects clear statements from the pathologist regarding the severity of previous or secondary degenerative meniscus damage, the age and type of traumatic tears, and appraisal of the relationship between trauma and meniscus damage from an insurance point of view. Close cooperation between the clinician and the pathologist allows for fast and unambiguous correlation of anamnesis, the clinical picture, and morphological reporting so that cases involving insurance problems - which are numerous, often long-term, and often unsatisfactory - can be clarified quickly.

  14. Diagnostics for Developing Countries

    Directory of Open Access Journals (Sweden)

    Ruth McNerney

    2015-05-01

    Full Text Available Improving the availability of high quality diagnostic tests for infectious diseases is a global priority. Lack of access by people living in low income countries may deprive them of life saving treatment and reduces opportunities to prevent onward transmission and spread of the disease. Diagnostic laboratories are often poorly resourced in developing countries, and sparsely distributed. Improved access may be achieved by using tests that do not require laboratory support, including rapid tests for use at the point-of-care. Despite increased interest, few new in vitro diagnostic (IVD products reach the majority populations in low income countries. Barriers to uptake include cost and lack of robustness, with reduced test performances due to environmental pressures such as high ambient temperatures or dust. In addition to environmental factors test developers must consider the local epidemiology. Confounding conditions such as immunosuppression or variations in antigen presentation or genotype can affect test performance. Barriers to product development include access to finance to establish manufacturing capacity and cover the costs of market entry for new devices. Costs and delays may be inflated by current regulatory preregistration processes to ensure product safety and quality, and more harmonized approaches are needed.

  15. SNS Diagnostics Timing Integration

    CERN Document Server

    Long, Cary D; Murphy, Darryl J; Pogge, James; Purcell, John D; Sundaram, Madhan

    2005-01-01

    The Spallation Neutron Source (SNS) accelerator systems will deliver a 1.0 GeV, 1.4 MW proton beam to a liquid mercury target for neutron scattering research. The accelerator complex consists of a 1 GeV linear accelerator, an accumulator ring and associated transport lines. The SNS diagnostics platform is PC-based running Windows XP Embedded for its OS and LabVIEW as its programming language. Coordinating timing among the various diagnostics instruments with the generation of the beam pulse is a challenging task that we have chosen to divide into three phases. First, timing was derived from VME based systems. In the second phase, described in this paper, timing pulses are generated by an in house designed PCI timing card installed in ten diagnostics PCs. Using fan-out modules, enough triggers were generated for all instruments. This paper describes how the Timing NAD (Network Attached Device) was rapidly developed using our NAD template, LabVIEW's PCI driver wizard, and LabVIEW Channel Access library. The NAD...

  16. Molecular diagnostics of periodontitis

    Directory of Open Access Journals (Sweden)

    Izabela Korona-Głowniak

    2017-01-01

    Full Text Available The microorganisms that form dental plaque are the main cause of periodontitis. Their identification and the understanding of the complex relationships and interactions that involve these microorganisms, environmental factors and the host’s health status enable improvement in diagnostics and targeted therapy in patients with periodontitis. To this end, molecular diagnostics techniques (both techniques based on the polymerase chain reaction and those involving nucleic acid analysis via hybridization come increasingly into use. On the basis of a literature review, the following methods are presented: polymerase chain reaction (PCR, real-time polymerase chain reaction (real-time PCR, 16S rRNA-encoding gene sequencing, checkerboard and reverse-capture checkerboard hybridization, microarrays, denaturing gradient gel electrophoresis (DGGE, temperature gradient gel electrophoresis (TGGE, as well as terminal restriction fragment length polymorphism (TRFLP and next generation sequencing (NGS. The advantages and drawbacks of each method in the examination of periopathogens are indicated. The techniques listed above allow fast detection of even small quantities of pathogen present in diagnostic material and prove particularly useful to detect microorganisms that are difficult or impossible to grow in a laboratory.

  17. Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.

    Directory of Open Access Journals (Sweden)

    Gómez Marcela

    2009-12-01

    Full Text Available Abstract Background Expressed sequence tags (ESTs are an important source of gene-based markers such as those based on insertion-deletions (Indels or single-nucleotide polymorphisms (SNPs. Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs, to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction

  18. The nucleotide exchange factors of Hsp70 molecular chaperone

    Directory of Open Access Journals (Sweden)

    Andreas eBracher

    2015-04-01

    Full Text Available Molecular chaperones of the Hsp70 family form an important hub in the cellular protein folding networks in bacteria and eukaryotes, connecting translation with the downstream machineries of protein folding and degradation. The Hsp70 folding cycle is driven by two types of cochaperones: J-domain proteins stimulate ATP hydrolysis by Hsp70, while nucleotide exchange factors (NEFs promote replacement of Hsp70-bound ADP with ATP. Bacteria and organelles of bacterial origin have only one known NEF type for Hsp70, GrpE. In contrast, a large diversity of Hsp70 NEFs has been discovered in the eukaryotic cell. These NEFs belong to the Hsp110/Grp170, HspBP1/Sil1 and BAG domain protein families. In this short review we compare the structures and molecular mechanisms of nucleotide exchange factors for Hsp70 and discuss how these cochaperones contribute to protein folding and quality control in the cell.

  19. Genome-wide patterns of nucleotide polymorphism in domesticated rice

    DEFF Research Database (Denmark)

    Caicedo, Ana L; Williamson, Scott H; Hernandez, Ryan D

    2007-01-01

    Domesticated Asian rice (Oryza sativa) is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments......, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs) in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models...... explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that selection...

  20. Diagnostic phylogenetics reveals a new Porcine circovirus 2 cluster.

    Science.gov (United States)

    Davies, Brendan; Wang, Xiong; Dvorak, Cheryl M T; Marthaler, Douglas; Murtaugh, Michael P

    2016-06-02

    Porcine circovirus 2 (PCV2) was prevalent in swine in the United States before PCV2-associated disease (PCVAD) appeared in 2006. Limited nucleotide sequencing of open reading frame 2 (ORF2) encoding capsid, the only structural protein, revealed the presence of two genotypes, PCV2a and PCV2b. Later, PCV2c and mutant PCV2b, or PCV2d, were also described. However, extensive PCV2 ORF2 sequence databases in veterinary diagnostic laboratories have not been analyzed systematically to determine the genetic diversity of field isolates. Here, we interrogated >1100 PCV2 ORF2 nucleotide sequences to assess population diversity and genetic variation. We detected a novel PCV2 genotype that is substantially different, primarily in ORF2, from all known PCV2. Notably, ORF2 contains a unique carboxyl terminal amino acid insertion resulting in a 238 amino acid ORF2. All other PCV2 ORF2 proteins are 233 or 234 aa in length. Phylogenetic analysis indicates that it is more ancient than other PCV2 genotypes. The findings demonstrate the value of analyzing routine diagnostic laboratory sequence databases in population genetic analyses of animal pathogens.

  1. Exonuclease activity and P nucleotide addition in the generation of the expressed immunoglobulin repertoire

    Directory of Open Access Journals (Sweden)

    Sewell William

    2004-09-01

    Full Text Available Abstract Background Immunoglobulin rearrangement involves random and imprecise processes that act to both create and constrain diversity. Two such processes are the loss of nucleotides through the action of unknown exonuclease(s and the addition of P nucleotides. The study of such processes has been compromised by difficulties in reliably aligning immunoglobulin genes and in the partitioning of nucleotides between segment ends, and between N and P nucleotides. Results A dataset of 294 human IgM sequences was created and partitioned with the aid of a probabilistic model. Non-random removal of nucleotides is seen between the three IGH gene types with the IGHV gene averaging removals of 1.2 nucleotides compared to 4.7 for the other gene ends (p Conclusions The loss of nucleotides due to the action of exonucleases is not random, but is influenced by the nucleotide composition of the genes. P nucleotides do not make a significant contribution to diversity of immunoglobulin sequences. Although palindromic sequences are present in 10% of immunologlobulin rearrangements, most of the 'palindromic' nucleotides are likely to have been inserted into the junction during the process of N nucleotide addition. P nucleotides can only be stated with confidence to contribute to diversity of less than 1% of sequences. Any attempt to identify P nucleotides in immunoglobulins is therefore likely to introduce errors into the partitioning of such sequences.

  2. Invasive mycoses: diagnostic challenges.

    Science.gov (United States)

    Ostrosky-Zeichner, Luis

    2012-01-01

    Despite the availability of newer antifungal drugs, outcomes for patients with invasive fungal infections (IFIs) continue to be poor, in large part due to delayed diagnosis and initiation of appropriate antifungal therapy. Standard histopathologic diagnostic techniques are often untenable in at-risk patients, and culture-based diagnostics typically are too insensitive or nonspecific, or provide results after too long a delay for optimal IFI management. Newer surrogate markers of IFIs with improved sensitivity and specificity are needed to enable earlier diagnosis and, ideally, to provide prognostic information and/or permit therapeutic monitoring. Surrogate assays should also be accessible and easy to implement in the hospital. Several nonculture-based assays of newer surrogates are making their way into the medical setting or are currently under investigation. These new or up-and-coming surrogates include antigens/antibodies (mannan and antimannan antibodies) or fungal metabolites (d-arabinitol) for detection of invasive candidiasis, the Aspergillus cell wall component galactomannan used to detect invasive aspergillosis, or the fungal cell wall component and panfungal marker β-glucan. In addition, progress continues with use of polymerase chain reaction- or other nucleic acid- or molecular-based assays for diagnosis of either specific or generic IFIs, although the various methods must be better standardized before any of these approaches can be more fully implemented into the medical setting. Investigators are also beginning to explore the possibility of combining newer surrogate markers with each other or with more standard diagnostic approaches to improve sensitivity, specificity, and capacity for earlier diagnosis, at a time when fungal burden is still relatively low and more responsive to antifungal therapy.

  3. Genetic code correlations - Amino acids and their anticodon nucleotides

    Science.gov (United States)

    Weber, A. L.; Lacey, J. C., Jr.

    1978-01-01

    The data here show direct correlations between both the hydrophobicity and the hydrophilicity of the homocodonic amino acids and their anticodon nucleotides. While the differences between properties of uracil and cytosine derivatives are small, further data show that uracil has an affinity for charged species. Although these data suggest that molecular relationships between amino acids and anticodons were responsible for the origin of the code, it is not clear what the mechanism of the origin might have been.

  4. Nucleotide Sequence - KOME | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ..._db.zip File URL: ftp://ftp.biosciencedbc.jp/archive/kome/LATEST/kome_ine_full_se...quence_db.zip File size: 19 MB File name: FASTA: kome_ine_full_sequence_db.fasta.zip File URL: ftp://ftp.biosciencedbc.jp/archiv...rtio About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Nucleotide Sequence - KOME | LSDB Archive ...

  5. Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

    Energy Technology Data Exchange (ETDEWEB)

    Lo, A.; Yang, H.L.

    1990-02-13

    This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

  6. Adenine nucleotide concentrations in patients with erythrocyte autoantibodies.

    OpenAIRE

    Strong, V F; Sokol, R J; Rodgers, S A; Hewitt, S.

    1985-01-01

    Erythrocyte adenine nucleotide concentrations were measured in 154 patients with erythrocyte autoantibodies and 811 normal subjects using a luciferin-luciferase bioluminescent assay. The patients were initially divided into haemolysing and non-haemolysing groups. Red cell adenosine triphosphate (ATP) concentrations were significantly raised in the 96 patients with active haemolysis compared with the normal subjects and with the 58 patients in the non-haemolysing group. Although the patients c...

  7. Diagnostic electron microscopy

    Energy Technology Data Exchange (ETDEWEB)

    Dickersin, G.R.

    1988-01-01

    In this book the author presents a comprehensive reference text on diagnostic electron microscopy. Throughout the book he illustrates how ultrastructural identification can be helpful for the recognition of cell type and the identification of mechanisms of pathogenesis in various diseases. In addition to electron microscopy photographs, there are also numerous light microscopy photographs for comparison. This text presents the classification of neoplasms in the order and arrangement most familiar to the pathologist. Contents: Introduction; Diagram of a Normal Cell; Normal Cell Function; Embryology; Neoplasms; Infectious Agents; Metabolic Diseases; Renal Diseases; Skeletal Muscle and Peripheral Nerve Diseases; Index.

  8. Bijective transformation circular codes and nucleotide exchanging RNA transcription.

    Science.gov (United States)

    Michel, Christian J; Seligmann, Hervé

    2014-04-01

    The C(3) self-complementary circular code X identified in genes of prokaryotes and eukaryotes is a set of 20 trinucleotides enabling reading frame retrieval and maintenance, i.e. a framing code (Arquès and Michel, 1996; Michel, 2012, 2013). Some mitochondrial RNAs correspond to DNA sequences when RNA transcription systematically exchanges between nucleotides (Seligmann, 2013a,b). We study here the 23 bijective transformation codes ΠX of X which may code nucleotide exchanging RNA transcription as suggested by this mitochondrial observation. The 23 bijective transformation codes ΠX are C(3) trinucleotide circular codes, seven of them are also self-complementary. Furthermore, several correlations are observed between the Reading Frame Retrieval (RFR) probability of bijective transformation codes ΠX and the different biological properties of ΠX related to their numbers of RNAs in GenBank's EST database, their polymerization rate, their number of amino acids and the chirality of amino acids they code. Results suggest that the circular code X with the functions of reading frame retrieval and maintenance in regular RNA transcription, may also have, through its bijective transformation codes ΠX, the same functions in nucleotide exchanging RNA transcription. Associations with properties such as amino acid chirality suggest that the RFR of X and its bijective transformations molded the origins of the genetic code's machinery. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  9. Nucleotide Sequencing and Identification of Some Wild Mushrooms

    Directory of Open Access Journals (Sweden)

    Sudip Kumar Das

    2013-01-01

    Full Text Available The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India was amplified using ITS1 (Internal Transcribed Spacers 1 and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base of Amanita hemibapha [CN (Chota Nagpur 1, % identity 99 (JX844716.1], Amanita sp. [CN 2, % identity 98 (JX844763.1], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1], Termitomyces sp. [CN 4, % identity 90 (JF746992.1], Termitomyces sp. [CN 5, % identity 99 (GU001667.1], T. microcarpus [CN 6, % identity 82 (EF421077.1], Termitomyces sp. [CN 7, % identity 76 (JF746993.1], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  10. Single nucleotide polymorphisms and linkage disequilibrium in sunflower.

    Science.gov (United States)

    Kolkman, Judith M; Berry, Simon T; Leon, Alberto J; Slabaugh, Mary B; Tang, Shunxue; Gao, Wenxiang; Shintani, David K; Burke, John M; Knapp, Steven J

    2007-09-01

    Genetic diversity in modern sunflower (Helianthus annuus L.) cultivars (elite oilseed inbred lines) has been shaped by domestication and breeding bottlenecks and wild and exotic allele introgression(-)the former narrowing and the latter broadening genetic diversity. To assess single nucleotide polymorphism (SNP) frequencies, nucleotide diversity, and linkage disequilibrium (LD) in modern cultivars, alleles were resequenced from 81 genic loci distributed throughout the sunflower genome. DNA polymorphisms were abundant; 1078 SNPs (1/45.7 bp) and 178 insertions-deletions (INDELs) (1/277.0 bp) were identified in 49.4 kbp of DNA/genotype. SNPs were twofold more frequent in noncoding (1/32.1 bp) than coding (1/62.8 bp) sequences. Nucleotide diversity was only slightly lower in inbred lines ( = 0.0094) than wild populations ( = 0.0128). Mean haplotype diversity was 0.74. When extraploted across the genome ( approximately 3500 Mbp), sunflower was predicted to harbor at least 76.4 million common SNPs among modern cultivar alleles. LD decayed more slowly in inbred lines than wild populations (mean LD declined to 0.32 by 5.5 kbp in the former, the maximum physical distance surveyed), a difference attributed to domestication and breeding bottlenecks. SNP frequencies and LD decay are sufficient in modern sunflower cultivars for very high-density genetic mapping and high-resolution association mapping.

  11. Electrochemical Quantification of Single Nucleotide Polymorphisms Using Nanoparticle Probes

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Guodong; Lin, Yuehe

    2007-08-29

    We report a new approach for electrochemical quantification of single-nucleotide polymorphisms (SNPs) using nanoparticle probes. The principle is based on DNA polymerase I (klenow fragment)-induced coupling of the nucleotide-modified nanoparticle probe to the mutant sites of duplex DNA under the Watson-Crick base pairing rule. After liquid hybridization events occurred among biotinylated DNA probes, mutant DNA, and complementary DNA, the resulting duplex DNA helixes were captured to the surface of magnetic beads through a biotin-avidin affinity reaction and magnetic separation. A cadmium phosphate-loaded apoferritin nanoparticle probe, which is modified with nucleotides and is complementary to the mutant site, is coupled to the mutant sites of the formed duplex DNA in the presence of DNA polymerase. Subsequent electrochemical stripping analysis of the cadmium component of coupled nanoparticle probes provides a means to quantify the concentration of mutant DNA. The method is sensitive enough to detect 21.5 attomol mutant DNA, which will enable the quantitative analysis of nucleic acid without polymerase chain reaction pre-amplification. The approach was challenged with constructed samples containing mutant and complementary DNA. The results indicated that it was possible to accurately determine SNPs with frequencies as low 0.01. The proposed approach has a great potential for realizing an accurate, sensitive, rapid, and low-cost method of SNP detection.

  12. Single Nucleotide Polymorphisms and Linkage Disequilibrium in Sunflower

    Science.gov (United States)

    Kolkman, Judith M.; Berry, Simon T.; Leon, Alberto J.; Slabaugh, Mary B.; Tang, Shunxue; Gao, Wenxiang; Shintani, David K.; Burke, John M.; Knapp, Steven J.

    2007-01-01

    Genetic diversity in modern sunflower (Helianthus annuus L.) cultivars (elite oilseed inbred lines) has been shaped by domestication and breeding bottlenecks and wild and exotic allele introgression−the former narrowing and the latter broadening genetic diversity. To assess single nucleotide polymorphism (SNP) frequencies, nucleotide diversity, and linkage disequilibrium (LD) in modern cultivars, alleles were resequenced from 81 genic loci distributed throughout the sunflower genome. DNA polymorphisms were abundant; 1078 SNPs (1/45.7 bp) and 178 insertions-deletions (INDELs) (1/277.0 bp) were identified in 49.4 kbp of DNA/genotype. SNPs were twofold more frequent in noncoding (1/32.1 bp) than coding (1/62.8 bp) sequences. Nucleotide diversity was only slightly lower in inbred lines (θ = 0.0094) than wild populations (θ = 0.0128). Mean haplotype diversity was 0.74. When extraploted across the genome (∼3500 Mbp), sunflower was predicted to harbor at least 76.4 million common SNPs among modern cultivar alleles. LD decayed more slowly in inbred lines than wild populations (mean LD declined to 0.32 by 5.5 kbp in the former, the maximum physical distance surveyed), a difference attributed to domestication and breeding bottlenecks. SNP frequencies and LD decay are sufficient in modern sunflower cultivars for very high-density genetic mapping and high-resolution association mapping. PMID:17660563

  13. Nucleotide sequencing and identification of some wild mushrooms.

    Science.gov (United States)

    Das, Sudip Kumar; Mandal, Aninda; Datta, Animesh K; Gupta, Sudha; Paul, Rita; Saha, Aditi; Sengupta, Sonali; Dubey, Priyanka Kumari

    2013-01-01

    The rDNA-ITS (Ribosomal DNA Internal Transcribed Spacers) fragment of the genomic DNA of 8 wild edible mushrooms (collected from Eastern Chota Nagpur Plateau of West Bengal, India) was amplified using ITS1 (Internal Transcribed Spacers 1) and ITS2 primers and subjected to nucleotide sequence determination for identification of mushrooms as mentioned. The sequences were aligned using ClustalW software program. The aligned sequences revealed identity (homology percentage from GenBank data base) of Amanita hemibapha [CN (Chota Nagpur) 1, % identity 99 (JX844716.1)], Amanita sp. [CN 2, % identity 98 (JX844763.1)], Astraeus hygrometricus [CN 3, % identity 87 (FJ536664.1)], Termitomyces sp. [CN 4, % identity 90 (JF746992.1)], Termitomyces sp. [CN 5, % identity 99 (GU001667.1)], T. microcarpus [CN 6, % identity 82 (EF421077.1)], Termitomyces sp. [CN 7, % identity 76 (JF746993.1)], and Volvariella volvacea [CN 8, % identity 100 (JN086680.1)]. Although out of 8 mushrooms 4 could be identified up to species level, the nucleotide sequences of the rest may be relevant to further characterization. A phylogenetic tree is constructed using Neighbor-Joining method showing interrelationship between/among the mushrooms. The determined nucleotide sequences of the mushrooms may provide additional information enriching GenBank database aiding to molecular taxonomy and facilitating its domestication and characterization for human benefits.

  14. Genome-wide patterns of nucleotide polymorphism in domesticated rice.

    Directory of Open Access Journals (Sweden)

    Ana L Caicedo

    2007-09-01

    Full Text Available Domesticated Asian rice (Oryza sativa is one of the oldest domesticated crop species in the world, having fed more people than any other plant in human history. We report the patterns of DNA sequence variation in rice and its wild ancestor, O. rufipogon, across 111 randomly chosen gene fragments, and use these to infer the evolutionary dynamics that led to the origins of rice. There is a genome-wide excess of high-frequency derived single nucleotide polymorphisms (SNPs in O. sativa varieties, a pattern that has not been reported for other crop species. We developed several alternative models to explain contemporary patterns of polymorphisms in rice, including a (i selectively neutral population bottleneck model, (ii bottleneck plus migration model, (iii multiple selective sweeps model, and (iv bottleneck plus selective sweeps model. We find that a simple bottleneck model, which has been the dominant demographic model for domesticated species, cannot explain the derived nucleotide polymorphism site frequency spectrum in rice. Instead, a bottleneck model that incorporates selective sweeps, or a more complex demographic model that includes subdivision and gene flow, are more plausible explanations for patterns of variation in domesticated rice varieties. If selective sweeps are indeed the explanation for the observed nucleotide data of domesticated rice, it suggests that strong selection can leave its imprint on genome-wide polymorphism patterns, contrary to expectations that selection results only in a local signature of variation.

  15. Flavin nucleotides in human lens: regional distribution in brunescent cataracts.

    Science.gov (United States)

    Bhat, K S; Nayak, S

    1998-12-01

    The biochemical mechanism(s) underlying brunescent cataracts remain unclear. Oxidative stress due to reactive oxygen species may have a role in the pigmentation process in eye lens. We have analysed human cataractous lenses for flavins by high-performance liquid chromatography (HPLC), since flavins are light sensitive and act as endogenous sensitizers generating reactive oxygen species in the eye. The most significant observation in this study is that higher levels of flavin nucleotides occur in brown lens compared to yellow lens. The concentration of flavin nucleotides (flavin monouncleotide, FMN + flavin adenine dinucleotide, FAD) was highest in the nuclear region of the lens followed by the cortical and capsule-epithelial regions. However, the ratio of FAD/FMN was lowest in the nuclear region of the lens followed by other regions. On the other hand, riboflavin was not detected in any of the lens (cataractous) regions. These results suggest that the observed increase in flavin nucleotides in the ocular tissue could contribute towards deepening of lens pigmentation.

  16. Broadening the scope of glycosyltransferase-catalyzed sugar nucleotide synthesis.

    Science.gov (United States)

    Gantt, Richard W; Peltier-Pain, Pauline; Singh, Shanteri; Zhou, Maoquan; Thorson, Jon S

    2013-05-07

    We described the integration of the general reversibility of glycosyltransferase-catalyzed reactions, artificial glycosyl donors, and a high throughput colorimetric screen to enable the engineering of glycosyltransferases for combinatorial sugar nucleotide synthesis. The best engineered catalyst from this study, the OleD Loki variant, contained the mutations P67T/I112P/T113M/S132F/A242I compared with the OleD wild-type sequence. Evaluated against the parental sequence OleD TDP16 variant used for screening, the OleD Loki variant displayed maximum improvements in k(cat)/K(m) of >400-fold and >15-fold for formation of NDP-glucoses and UDP-sugars, respectively. This OleD Loki variant also demonstrated efficient turnover with five variant NDP acceptors and six variant 2-chloro-4-nitrophenyl glycoside donors to produce 30 distinct NDP-sugars. This study highlights a convenient strategy to rapidly optimize glycosyltransferase catalysts for the synthesis of complex sugar nucleotides and the practical synthesis of a unique set of sugar nucleotides.

  17. THE RAPID DIAGNOSTICS OF SEX OF SALMONIDS USING DNA-MARKERS

    Directory of Open Access Journals (Sweden)

    Yu. P. Rud

    2014-12-01

    Full Text Available Based on nucleotide sequences of sex-specific DNA-markers of salmonid fishes the oligonucleotide primers for polymerase chain reaction were selected with purpose on rapid diagnostic of sex in rainbow trout Onchorhynchus mykiss, brown trout Salmo trutta, huchen Hucho hucho and grayling Thymallus thymallus. The specify of amplification was determined by nucleotide sequence analysis of PCR-products. All amplified fragments were referred to sex-specific locuses of Y chromosomes in males of investigated fish species. The PCR-products were in size of 880, 607, 521 and 558 for rainbow trout, brown trout, grayling and huchen respectively. Thus the sex determination in above mentioned fish species and identification of genotypic males under process of hormonal sex reversion can be provided using conventional PCR. Present method relates to rapid diagnostics because the data analysis and return of results back to fish farm take one single day.

  18. A single nucleotide variant in the FMR1 CGG repeat results in a "Pseudodeletion" and is not associated with the fragile X syndrome phenotype.

    Science.gov (United States)

    Cecconi, Massimiliano; Forzano, Francesca; Rinaldi, Rosanna; Cappellacci, Sandra; Grammatico, Paola; Faravelli, Francesca; Dagna Bricarelli, Franca; Di Maria, Emilio; Grasso, Marina

    2008-05-01

    The molecular diagnosis of fragile X syndrome relies on the detection of the pathogenic CGG repeat expansion in the FMR1 gene. Deletions and point mutations have occasionally been reported. Rare polymorphisms might mimic a deletion by Southern blot analysis, leading to false-positive results. We describe a novel rare nucleotide substitution within the CGG repeat. The proband was a woman with a positive family history of mental retardation. Southern blot analysis showed an additional band consistent with a deletion in the region detected by the StB12.3 probe. Sequencing of this region revealed a G>C transversion that interrupts the CGG repeat and introduces an EagI site. The same variant was observed in both the healthy son and father of the proband, supporting the hypothesis that the nucleotide substitution is a silent polymorphism, the frequency of which we estimated to be less than 1% in the general population. These findings argue for a pathogenic role of nucleotide variants within the CGG repeat and suggest possible consequences of unexpected findings in the molecular diagnostics of fragile X syndrome. Thus, although the sequence context of a single nucleotide substitution may not predict possible effects on mRNA or protein function, a specific change in the higher order structures of DNA or mRNA may be functionally relevant in the pathological phenotype.

  19. A Single Nucleotide Variant in the FMR1 CGG Repeat Results in a “Pseudodeletion” and Is Not Associated with the Fragile X Syndrome Phenotype

    Science.gov (United States)

    Cecconi, Massimiliano; Forzano, Francesca; Rinaldi, Rosanna; Cappellacci, Sandra; Grammatico, Paola; Faravelli, Francesca; Dagna Bricarelli, Franca; Di Maria, Emilio; Grasso, Marina

    2008-01-01

    The molecular diagnosis of fragile X syndrome relies on the detection of the pathogenic CGG repeat expansion in the FMR1 gene. Deletions and point mutations have occasionally been reported. Rare polymorphisms might mimic a deletion by Southern blot analysis, leading to false-positive results. We describe a novel rare nucleotide substitution within the CGG repeat. The proband was a woman with a positive family history of mental retardation. Southern blot analysis showed an additional band consistent with a deletion in the region detected by the StB12.3 probe. Sequencing of this region revealed a G>C transversion that interrupts the CGG repeat and introduces an EagI site. The same variant was observed in both the healthy son and father of the proband, supporting the hypothesis that the nucleotide substitution is a silent polymorphism, the frequency of which we estimated to be less than 1% in the general population. These findings argue for a pathogenic role of nucleotide variants within the CGG repeat and suggest possible consequences of unexpected findings in the molecular diagnostics of fragile X syndrome. Thus, although the sequence context of a single nucleotide substitution may not predict possible effects on mRNA or protein function, a specific change in the higher order structures of DNA or mRNA may be functionally relevant in the pathological phenotype. PMID:18403614

  20. The Role of Cyclic Nucleotide Signaling Pathways in Cancer: Targets for Prevention and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Fajardo, Alexandra M.; Piazza, Gary A. [Drug Discovery Research Center, Mitchell Cancer Institute, University of South Alabama, 1660 Springhill Ave, Suite 3029, Mobile, AL 36604 (United States); Tinsley, Heather N., E-mail: htinsley@montevallo.edu [Department of Biology, Chemistry, and Mathematics, University of Montevallo, Station 6480, Montevallo, AL 35115 (United States)

    2014-02-26

    For more than four decades, the cyclic nucleotides cyclic AMP (cAMP) and cyclic GMP (cGMP) have been recognized as important signaling molecules within cells. Under normal physiological conditions, cyclic nucleotides regulate a myriad of biological processes such as cell growth and adhesion, energy homeostasis, neuronal signaling, and muscle relaxation. In addition, altered cyclic nucleotide signaling has been observed in a number of pathophysiological conditions, including cancer. While the distinct molecular alterations responsible for these effects vary depending on the specific cancer type, several studies have demonstrated that activation of cyclic nucleotide signaling through one of three mechanisms—induction of cyclic nucleotide synthesis, inhibition of cyclic nucleotide degradation, or activation of cyclic nucleotide receptors—is sufficient to inhibit proliferation and activate apoptosis in many types of cancer cells. These findings suggest that targeting cyclic nucleotide signaling can provide a strategy for the discovery of novel agents for the prevention and/or treatment of selected cancers.

  1. Spontaneous formation and base pairing of plausible prebiotic nucleotides in water.

    Science.gov (United States)

    Cafferty, Brian J; Fialho, David M; Khanam, Jaheda; Krishnamurthy, Ramanarayanan; Hud, Nicholas V

    2016-04-25

    The RNA World hypothesis presupposes that abiotic reactions originally produced nucleotides, the monomers of RNA and universal constituents of metabolism. However, compatible prebiotic reactions for the synthesis of complementary (that is, base pairing) nucleotides and mechanisms for their mutual selection within a complex chemical environment have not been reported. Here we show that two plausible prebiotic heterocycles, melamine and barbituric acid, form glycosidic linkages with ribose and ribose-5-phosphate in water to produce nucleosides and nucleotides in good yields. Even without purification, these nucleotides base pair in aqueous solution to create linear supramolecular assemblies containing thousands of ordered nucleotides. Nucleotide anomerization and supramolecular assemblies favour the biologically relevant β-anomer form of these ribonucleotides, revealing abiotic mechanisms by which nucleotide structure and configuration could have been originally favoured. These findings indicate that nucleotide formation and selection may have been robust processes on the prebiotic Earth, if other nucleobases preceded those of extant life.

  2. Diagnostic approaches for cholangiocarcinoma

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    Cholangiocarcinomas arise from the epithelial cells of the bile ducts and are associated with poor prognosis. Despite new diagnostic approaches, the definite diagnosis of this malignancy continues to be challenging. Cholangiocarcinomas often grow longitudinally along the bile duct rather than in a radial direction. Thus, large tumor masses are frequently absent and imaging techniques, including ultrasound, CT, and MRI have only limited sensitivity. Tissue collection during endoscopic (ERCP) and/or percutaneous transhepatic (PTC) procedures are usually used to confirm a definitive diagnosis of cholangiocarcinoma. However, forceps biopsy and brush cytology provide positive results for malignancy in about only 50% of patients. Percutaneous and peroral cholangioscopy using fiber-optic techniques were therefore developed for direct visualization of the biliary tree, yielding additional information about endoscopic appearance and tumor extension, as well as a guided biopsy acquistion. Finally, endoscopic ultrasonography (EUS) complements endoscopic and percutaneous approaches and may provide a tissue diagnosis of tumors in the biliary region through fine- needle aspiration. In the future, new techniques allowing for early detection, including molecular markers, should be developed to improve the diagnostic sensitivity in this increasing tumor entity.

  3. The nucleotide sequence and genome organization of Plasmopara halstedii virus

    Directory of Open Access Journals (Sweden)

    Göpfert Jens C

    2011-03-01

    Full Text Available Abstract Background Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Methods Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. Results The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2 were established. RNA1 consisted of 2793 nucleotides (nt exclusive its 3' poly(A tract and a single open-reading frame (ORF1 of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR of 18 nt and a 3' untranslated region (3' UTR of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A tract and a second ORF (ORF2 of 1128 nt. ORF2 coded for the single viral coat protein (CP and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb and RNA2 (ca. 1.4 kb were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. Conclusions The results showed the presence of a single and new

  4. The nucleotide sequence and genome organization of Plasmopara halstedii virus

    Science.gov (United States)

    2011-01-01

    Background Only very few viruses of Oomycetes have been studied in detail. Isometric virions were found in different isolates of the oomycete Plasmopara halstedii, the downy mildew pathogen of sunflower. However, complete nucleotide sequences and data on the genome organization were lacking. Methods Viral RNA of different P. halstedii isolates was subjected to nucleotide sequencing and analysis of the viral genome. The N-terminal sequence of the viral coat protein was determined using Top-Down MALDI-TOF analysis. Results The complete nucleotide sequences of both single-stranded RNA segments (RNA1 and RNA2) were established. RNA1 consisted of 2793 nucleotides (nt) exclusive its 3' poly(A) tract and a single open-reading frame (ORF1) of 2745 nt. ORF1 was framed by a 5' untranslated region (5' UTR) of 18 nt and a 3' untranslated region (3' UTR) of 30 nt. ORF1 contained motifs of RNA-dependent RNA polymerases (RdRp) and showed similarities to RdRp of Scleropthora macrospora virus A (SmV A) and viruses within the Nodaviridae family. RNA2 consisted of 1526 nt exclusive its 3' poly(A) tract and a second ORF (ORF2) of 1128 nt. ORF2 coded for the single viral coat protein (CP) and was framed by a 5' UTR of 164 nt and a 3' UTR of 234 nt. The deduced amino acid sequence of ORF2 was verified by nano-LC-ESI-MS/MS experiments. Top-Down MALDI-TOF analysis revealed the N-terminal sequence of the CP. The N-terminal sequence represented a region within ORF2 suggesting a proteolytic processing of the CP in vivo. The CP showed similarities to CP of SmV A and viruses within the Tombusviridae family. Fragments of RNA1 (ca. 1.9 kb) and RNA2 (ca. 1.4 kb) were used to analyze the nucleotide sequence variation of virions in different P. halstedii isolates. Viral sequence variation was 0.3% or less regardless of their host's pathotypes, the geographical origin and the sensitivity towards the fungicide metalaxyl. Conclusions The results showed the presence of a single and new virus type in

  5. n-Nucleotide circular codes in graph theory.

    Science.gov (United States)

    Fimmel, Elena; Michel, Christian J; Strüngmann, Lutz

    2016-03-13

    The circular code theory proposes that genes are constituted of two trinucleotide codes: the classical genetic code with 61 trinucleotides for coding the 20 amino acids (except the three stop codons {TAA,TAG,TGA}) and a circular code based on 20 trinucleotides for retrieving, maintaining and synchronizing the reading frame. It relies on two main results: the identification of a maximal C(3) self-complementary trinucleotide circular code X in genes of bacteria, eukaryotes, plasmids and viruses (Michel 2015 J. Theor. Biol. 380, 156-177. (doi:10.1016/j.jtbi.2015.04.009); Arquès & Michel 1996 J. Theor. Biol. 182, 45-58. (doi:10.1006/jtbi.1996.0142)) and the finding of X circular code motifs in tRNAs and rRNAs, in particular in the ribosome decoding centre (Michel 2012 Comput. Biol. Chem. 37, 24-37. (doi:10.1016/j.compbiolchem.2011.10.002); El Soufi & Michel 2014 Comput. Biol. Chem. 52, 9-17. (doi:10.1016/j.compbiolchem.2014.08.001)). The univerally conserved nucleotides A1492 and A1493 and the conserved nucleotide G530 are included in X circular code motifs. Recently, dinucleotide circular codes were also investigated (Michel & Pirillo 2013 ISRN Biomath. 2013, 538631. (doi:10.1155/2013/538631); Fimmel et al. 2015 J. Theor. Biol. 386, 159-165. (doi:10.1016/j.jtbi.2015.08.034)). As the genetic motifs of different lengths are ubiquitous in genes and genomes, we introduce a new approach based on graph theory to study in full generality n-nucleotide circular codes X, i.e. of length 2 (dinucleotide), 3 (trinucleotide), 4 (tetranucleotide), etc. Indeed, we prove that an n-nucleotide code X is circular if and only if the corresponding graph [Formula: see text] is acyclic. Moreover, the maximal length of a path in [Formula: see text] corresponds to the window of nucleotides in a sequence for detecting the correct reading frame. Finally, the graph theory of tournaments is applied to the study of dinucleotide circular codes. It has full equivalence between the combinatorics

  6. Performance-enhancing effects of dietary nucleotides: do mitochondria play a role?

    Directory of Open Access Journals (Sweden)

    Sergej M. Ostojic

    2015-09-01

    Full Text Available Nucleotides are group of natural biomonomeric molecules and novel dietary supplements with performance-enhancing attributes. However, their mechanisms of action and target biological structures are poorly understood and identified. This short paper overviews the possible role of mitochondria during the utilization of nucleotides for exercise performance. Mitochondria-related effects of nucleotides have been identified, along with obstacles for dietary nucleotides delivery to the organelle.

  7. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    Energy Technology Data Exchange (ETDEWEB)

    McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA

    2009-02-24

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  8. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    Science.gov (United States)

    McCready, Paula M.; Radnedge, Lyndsay; Andersen, Gary L.; Ott, Linda L.; Slezak, Thomas R.; Kuczmarski, Thomas A.

    2009-02-24

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  9. Site-specific fab fragment biotinylation at the conserved nucleotide binding site for enhanced Ebola detection.

    Science.gov (United States)

    Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

    2015-07-01

    The nucleotide binding site (NBS) is a highly conserved region between the variable light and heavy chains at the Fab domains of all antibodies, and a small molecule that we identified, indole-3-butyric acid (IBA), binds specifically to this site. Fab fragment, with its small size and simple production methods compared to intact antibody, is good candidate for use in miniaturized diagnostic devices and targeted therapeutic applications. However, commonly used modification techniques are not well suited for Fab fragments as they are often more delicate than intact antibodies. Fab fragments are of particular interest for sensor surface functionalization but immobilization results in damage to the antigen binding site and greatly reduced activity due to their truncated size that allows only a small area that can bind to surfaces without impeding antigen binding. In this study, we describe an NBS-UV photocrosslinking functionalization method (UV-NBS(Biotin) in which a Fab fragment is site-specifically biotinylated with an IBA-EG11-Biotin linker via UV energy exposure (1 J/cm(2)) without affecting its antigen binding activity. This study demonstrates successful immobilization of biotinylated Ebola detecting Fab fragment (KZ52 Fab fragment) via the UV-NBS(Biotin) method yielding 1031-fold and 2-fold better antigen detection sensitivity compared to commonly used immobilization methods: direct physical adsorption and NHS-Biotin functionalization, respectively. Utilization of the UV-NBS(Biotin) method for site-specific conjugation to Fab fragment represents a proof of concept use of Fab fragment for various diagnostic and therapeutic applications with numerous fluorescent probes, affinity molecules and peptides.

  10. Improved diagnostic PCR assay for Actinobacillus pleuropneumoniae based on the nucleotide sequence of an outer membrane lipoprotein

    DEFF Research Database (Denmark)

    Gram, Trine; Ahrens, Peter

    1998-01-01

    The gene (omlA) coding for an outer membrane protein of Actinobacillus pleuropneumoniae serotypes 1 and 5 has been described earlier and has formed the basis for development of a specific PCR assay, The corresponding regions of all 12 A. pleuropneumoniae reference strains of biovar 1 were sequenc...... and sensitivity of this PCR compared to those of culture suggest the use of this PCR for routine identification of A. pleuropneumoniae.......The gene (omlA) coding for an outer membrane protein of Actinobacillus pleuropneumoniae serotypes 1 and 5 has been described earlier and has formed the basis for development of a specific PCR assay, The corresponding regions of all 12 A. pleuropneumoniae reference strains of biovar 1 were sequenced...... species related to A. pleuropneumoniae or isolated from pigs were assayed. They were all found negative in the PCR, as were tonsil cultures from 50 pigs of an A. pleuropneumoniae-negative herd. The sensitivity assessed by agarose gel analysis of the PCR product was 10(2) CFU/PCR test tube. The specificity...

  11. Diagnostics procedures in rabies

    Directory of Open Access Journals (Sweden)

    Malovrh Tadej

    2005-01-01

    Full Text Available Rabies is a major zoonosis for which diagnostic techniques can only be performed in the laboratory. Laboratory techniques are preferably oriented on tissue removed from the cranium: hippocampus (Ammon's horn, cerebellum and the medulla oblongata or tissue liquids. Clinical observation may only lead to a suspicion of rabies. The only way to perform a reliable diagnosis of the disease is to identify the virus or some of its specific components using laboratory tests such as histological identification of characteristic cell lesions, immunochemical identification of rabies virus antigen and virus isolation. Serological tests are rarely used in epidemiological surveys but much more frequently in control of the vaccination programs (e.g. oral vaccination. Most commonly used serological tests are the virus neutralization test on cell culture (FAVN, virus neutralization in mice and ELISA.

  12. Diagnostic Challenges at SNS

    CERN Document Server

    Plum, M A

    2003-01-01

    The Spallation Neutron Source now being built in Oak Ridge, Tennessee, USA, accelerates an H- ion beam to 1000 MeV with an average power of 1.4 MW. The H- beam is then stripped to H+, compressed in a storage ring to a pulse length of 695 ns, and then directed onto a mercury neutron spallation target. Most of the acceleration is accomplished with superconducting rf cavities. The presence of these cavities, the high average beam power, and the large range of beam intensity in the storage ring, provide unique challenges to the beam diagnostics systems. In this talk we will discuss these challenges and some of our solutions, including the laser profile monitor system, the residual gas ionization profile monitors, and network attached devices. Measurements performed using prototype instrumentation will also be presented.

  13. Rig Diagnostic Tools

    Science.gov (United States)

    Soileau, Kerry M.; Baicy, John W.

    2008-01-01

    Rig Diagnostic Tools is a suite of applications designed to allow an operator to monitor the status and health of complex networked systems using a unique interface between Java applications and UNIX scripts. The suite consists of Java applications, C scripts, Vx- Works applications, UNIX utilities, C programs, and configuration files. The UNIX scripts retrieve data from the system and write them to a certain set of files. The Java side monitors these files and presents the data in user-friendly formats for operators to use in making troubleshooting decisions. This design allows for rapid prototyping and expansion of higher-level displays without affecting the basic data-gathering applications. The suite is designed to be extensible, with the ability to add new system components in building block fashion without affecting existing system applications. This allows for monitoring of complex systems for which unplanned shutdown time comes at a prohibitive cost.

  14. Diagnostic and forensic toxicology.

    Science.gov (United States)

    Galey, F D

    1995-12-01

    In most competent veterinary diagnostic laboratories, analytical findings are interpreted by the veterinary toxicologist to determine the significance of the finding in view of historic, clinical, and pathologic findings. A veterinary toxicologist also will provide consultation about possible toxic rule-outs for a case, treatment of affected animals, and prevention of additional cases. Once all of the information is available, a complete summary of the findings can be provided to the client. When the procedures outlined are followed, including a systematic approach to collecting all the evidence (historic, clinical, pathologic, and analytic), proper sampling techniques, and good communication between the clinician and the client and laboratory, the usefulness of the toxicology investigation will be maximized.

  15. Diagnostics and Microelectronics

    Energy Technology Data Exchange (ETDEWEB)

    Balch, J.W.

    1993-03-01

    This report discusses activities of the Diagnostics and Microelectronics thrust area which conducts activities in semiconductor devices and semiconductor fabrication technology for programs at Lawrence Livermore National Laboratory. Our multidisciplinary engineering and scientific staff use modern computational tools and semi-conductor microfabrication equipment to develop high-performance devices. Our work concentrates on three broad technologies of semiconductor microdevices: (1) silicon on III-V semiconductor microeletronics, (2) lithium niobate-based and III-V semiconductor-based photonics, and (3) silicon-based micromaching for application to microstructures and microinstruments. In FY-92, we worked on projects in seven areas, described in this report: novel photonic detectors; a wideband phase modulator; an optoelectronic terahertz beam system; the fabrication of microelectrode electrochemical sensors; diamond heatsinks; advanced micromachining technologies; and electrophoresis using silicon microchannels.

  16. Optical Diagnostics in Medicine

    Science.gov (United States)

    Iftimia, Nicusor

    2003-03-01

    Light has a unique potential for non-invasive tissue diagnosis. The relatively short wavelength of light allows imaging of tissue at the resolution of histopathology. While strong multiple scattering of light in tissue makes attainment of this resolution difficult for thick tissues, most pathology emanates from epithelial surfaces. Therefore, high-resolution diagnosis of many important diseases may be achieved by transmitting light to the surface of interest. The recent fiber-optic implementation of technologies that reject multiple scattering, such as confocal microscopy and optical low coherence interferometry, have brought us one step closer to realizing non-invasive imaging of architectural and cellular features of tissue. Optical coherence tomography (OCT) can produce high-resolution cross-sectional images of biological structures. Clinical OCT studies conducted in the gastrointestinal tract and cardiovascular system have shown that OCT is capable of providing images of the architectural (> 20 µm) microanatomy of a variety of epithelial tissues, including the layered structure of squamous epithelium and arterial vessels. Fine Needle Aspiration- Low Coherence Interferometry (FNA-LCI) is another optical diagnostics technique, which is a suitable solution to increase the effectiveness of the FNA procedures. LCI is capable of measuring depth resolved (axial, z) tissue structure, birefringence, flow (Doppler shift), and spectra at a resolution of several microns. Since LCI systems are fiber-optic based, LCI probes may easily fit within the bore of a fine gauge needle, allowing diagnostic information to be obtained directly from the FNA biopsy site. Fiber optic spectrally encoded confocal microscopy (SECM) is a new confocal microscopy method, which eliminates the need for rapid beam scanning within the optical probe. This advance enables confocal microscopy to be performed through small diameter probes and will allow assessment of internal human tissues in vivo at

  17. Oral vs. salivary diagnostics

    Science.gov (United States)

    Marques, Joana; Corby, Patricia M.; Barber, Cheryl A.; Abrams, William R.; Malamud, Daniel

    2015-05-01

    The field of "salivary diagnostics" includes studies utilizing samples obtained from a variety of sources within the oral cavity. These samples include; whole unstimulated saliva, stimulated whole saliva, duct saliva collected directly from the parotid, submandibular/sublingual glands or minor salivary glands, swabs of the buccal mucosa, tongue or tonsils, and gingival crevicular fluid. Many publications state "we collected saliva from subjects" without fully describing the process or source of the oral fluid. Factors that need to be documented in any study include the time of day of the collection, the method used to stimulate and collect the fluid, and how much fluid is being collected and for how long. The handling of the oral fluid during and post-collection is also critical and may include addition of protease or nuclease inhibitors, centrifugation, and cold or frozen storage prior to assay. In an effort to create a standard protocol for determining a biomarker's origin we carried out a pilot study collecting oral fluid from 5 different sites in the mouth and monitoring the concentrations of pro- and anti-inflammatory cytokines detected using MesoScaleDiscovery (MSD) electrochemiluminesence assays. Our data suggested that 3 of the cytokines are primarily derived from the submandibular gland, while 7 of the cytokines come from a source other than the major salivary glands such as the minor salivary glands or cells in the oral mucosae. Here we review the literature on monitoring biomarkers in oral samples and stress the need for determining the blood/saliva ratio when a quantitative determination is needed and suggest that the term oral diagnostic be used if the source of an analyte in the oral cavity is unknown.

  18. Diagnostics for Hypersonic Engine Control

    Science.gov (United States)

    2015-02-01

    AFRL-RQ-WP-TR-2015-0037 DIAGNOSTICS FOR HYPERSONIC ENGINE CONTROL Michael S. Brown and Jeffrey M. Donbar Hypersonic Sciences Branch...DD-MM-YY) 2. REPORT TYPE 3. DATES COVERED (From - To) February 2015 Interim 01 March 2013 – 24 February 2015 4. TITLE AND SUBTITLE DIAGNOSTICS FOR...SUPPLEMENTARY NOTES PA Case Number: 88ABW-2015-0636; Clearance Date: 23 Feb 2015. 14. ABSTRACT The overall goal of the research is to find diagnostic

  19. Role of novel and rare nucleotide substitutions of the β-globin gene

    Directory of Open Access Journals (Sweden)

    Margherita Vinciguerra

    2012-11-01

    Full Text Available The Laboratory for Molecular Prenatal Diagnosis of Hemoglobinopathies at the Villa Sofia-Cervello Hospital in Palermo, Italy, carries out an intensive screening program aimed at identifying the healthy carriers of thalassemia and, consequently, the couples at risk of bearing an affected fetus. The diagnostic process is basically divided into two phases: i hematologic and hemoglobin data; ii molecular analysis of globin genes and, when possible, a genetic study of the family. Since 2003, we have been performing DNA sequence analysis on those cases in which classical molecular methods failed to give a complete diagnostic response, particularly in phenotypes with borderline values of HbA2 with mild or absent microcytosis. During ten years of screening activities (from 2003 to 2012, twenty- seven unknown or rare nucleotide changes of the β-globin gene have been identified; hematologic and hemoglobin data have been carefully evaluated and, wherever possible, we have conducted a family study to evaluate whether a phenotypic expression could be associated to these nucleotide changes. Because of the limited numbers of cases for each mutation, the significance of these nucleotide substitutions has still not been fully clarified, and this raises a number of questions that need to be answered when carrying out appropriate genetic counseling for couples presumed to be at risk. 意大利巴勒莫Villa Sofia-Cervello医院血红蛋白病分子产前诊断实验室进行密集的筛选程序,旨在识别健康的地中海贫血携带者和有怀上地中海贫血胎儿风险的夫妇。 诊断过程基本上分为两个阶段:1)血液及血红蛋白数据;2)珠蛋白基因分子分析以及家族遗传研究(如有可能)。 自2003年以来,我们已对这类病例进行DNA序列分析:传统的分子方法无法给出完整的诊断响应,尤其是有轻微小红细胞症或缺乏小红细胞症的HbA2临界值表型。

  20. The architecture of diagnostic research

    DEFF Research Database (Denmark)

    Colli, Agostino; Fraquelli, Mirella; Casazza, Giovanni

    2014-01-01

    of different index tests; phase 2B studies aim to evaluate the possible harms of incorporating the index test in a diagnostic-therapeutic strategy. In phase 3, diagnostic test-therapeutic randomized clinical trials aim to assess the benefits and harms of the new diagnostic-therapeutic strategy versus...... the present strategy. Phase 4 comprises large surveillance cohort studies that aim to assess the effectiveness of the new diagnostic-therapeutic strategy in clinical practice. As common in clinical research, putting excessive weight on the results of single studies and trials is likely to divert from...

  1. Diagnostics development plan for ZR.

    Energy Technology Data Exchange (ETDEWEB)

    Hanson, David Lester

    2003-09-01

    The Z Refurbishment (ZR) Project is a program to upgrade the Z machine at SNL with modern durable pulsed power technology, providing additional shot capacity and improved reliability as well as advanced capabilities for both pulsed x-ray production and high pressure generation. The development of enhanced diagnostic capabilities is an essential requirement for ZR to meet critical mission needs. This report presents a comprehensive plan for diagnostic instrument and infrastructure development for the first few years of ZR operation. The focus of the plan is on: (1) developing diagnostic instruments with high spatial and temporal resolution, capable of low noise operation and survival in the severe EMP, bremsstrahlung, and blast environments of ZR; and (2) providing diagnostic infrastructure improvements, including reduced diagnostic trigger signal jitter, more and flexible diagnostic line-of-sight access, and the capability for efficient exchange of diagnostics with other laboratories. This diagnostic plan is the first step in an extended process to provide enhanced diagnostic capabilities for ZR to meet the diverse programmatic needs of a broad range of defense, energy, and general science programs of an international user community into the next decade.

  2. Single Nucleotide Polymorphism Array Genotyping is Equivalent to Metaphase Cytogenetics for Diagnosis of Turner Syndrome

    Science.gov (United States)

    Prakash, Siddharth; Guo, Dongchuan; Maslen, Cheryl L.; Silberbach, Michael; Investigators, GenTAC; Milewicz, Dianna; Bondy, Carolyn A.

    2013-01-01

    Background Turner syndrome (TS) is a developmental disorder caused by partial or complete monosomy for the X chromosome in 1:2500 females. We hypothesized that single nucleotide polymorphism (SNP) array genotyping can provide superior resolution in comparison to metaphase karyotype analysis to facilitate genotype-phenotype correlations. Methods We genotyped 187 TS patients with 733,000 SNP marker arrays. All cases met diagnostic criteria for TS based on karyotypes (60%) or characteristic physical features. SNP array results confirmed the diagnosis of TS in 100% of cases. Results We identified a single X chromosome (45,X) in 113 cases. In 58 additional cases (31%), other mosaic cell lines were present including isochromosomes (16%), rings (5%) and Xp deletions (8%). The remaining cases were mosaic for monosomy X and normal male or female cell lines. Array-based models of X chromosome structure were compatible with karyotypes in 104 of 116 comparable cases (90%). We found that SNP array data did not detect X;autosome translocations (3 cases), but did identify 2 derivative Y chromosomes and 13 large copy number variants that were not detected by karyotyping. Conclusions Our data is the first systematic comparison between the two methods and supports the utility of SNP array genotyping to address clinical and research questions in TS. PMID:23743550

  3. Bioinformatics comparison of sulfate-reducing metabolism nucleotide sequences

    Science.gov (United States)

    Tremberger, G.; Dehipawala, Sunil; Nguyen, A.; Cheung, E.; Sullivan, R.; Holden, T.; Lieberman, D.; Cheung, T.

    2015-09-01

    The sulfate-reducing bacteria can be traced back to 3.5 billion years ago. The thermodynamics details of the sulfur cycle have been well documented. A recent sulfate-reducing bacteria report (Robator, Jungbluth, et al , 2015 Jan, Front. Microbiol) with Genbank nucleotide data has been analyzed in terms of the sulfite reductase (dsrAB) via fractal dimension and entropy values. Comparison to oil field sulfate-reducing sequences was included. The AUCG translational mass fractal dimension versus ATCG transcriptional mass fractal dimension for the low temperature dsrB and dsrA sequences reported in Reference Thirteen shows correlation R-sq ~ 0.79 , with a probably of about 3% in simulation. A recent report of using Cystathionine gamma-lyase sequence to produce CdS quantum dot in a biological method, where the sulfur is reduced just like in the H2S production process, was included for comparison. The AUCG mass fractal dimension versus ATCG mass fractal dimension for the Cystathionine gamma-lyase sequences was found to have R-sq of 0.72, similar to the low temperature dissimilatory sulfite reductase dsr group with 3% probability, in contrary to the oil field group having R-sq ~ 0.94, a high probable outcome in the simulation. The other two simulation histograms, namely, fractal dimension versus entropy R-sq outcome values, and di-nucleotide entropy versus mono-nucleotide entropy R-sq outcome values are also discussed in the data analysis focusing on low probability outcomes.

  4. Y-Single Nucleotide Polymorphisms Diversity in Chinese Indigenous Horse.

    Science.gov (United States)

    Han, Haoyuan; Zhang, Qin; Gao, Kexin; Yue, Xiangpeng; Zhang, Tao; Dang, Ruihua; Lan, Xianyong; Chen, Hong; Lei, Chuzhao

    2015-08-01

    In contrast to high genetic diversity of mitochondrial DNA (mtDNA), equine Y chromosome shows extremely low variability, implying limited patrilines in the domesticated horse. In this study, we applied direct sequencing and restriction fragment length polymorphism (RFLP) methods to investigate the polymorphisms of 33 Y chromosome specific loci in 304 Chinese indigenous horses from 13 breeds. Consequently, two Y-single nucleotide polymorphisms (SNPs) (Y-45701/997 and Y-50869) and one Y-indel (Y-45288) were identified. Of those, the Y-50869 (T>A) revealed the highest variation frequency (24.67%), whereas it was only 3.29% and 1.97% in Y-45288 (T/-) and Y-45701/997 (G>T) locus, respectively. These three mutations accounted for 27.96% of the total samples and identified five Y-SNP haplotypes, demonstrating genetic diversity of Y chromosome in Chinese horses. In addition, all the five Y-SNP haplotypes were shared by different breeds. Among 13 horse breeds analyzed, Balikun horse displayed the highest nucleotide diversity (π = 5.6×10(-4)) and haplotype diversity (h = 0.527), while Ningqiang horse showed the lowest nucleotide diversity (π = 0.00000) and haplotype diversity (h = 0.000). The results also revealed that Chinese horses had a different polymorphic pattern of Y chromosome from European and American horses. In conclusion, Chinese horses revealed genetic diversity of Y chromosome, however more efforts should be made to better understand the domestication and paternal origin of Chinese indigenous horses.

  5. Y-Single Nucleotide Polymorphisms Diversity in Chinese Indigenous Horse

    Directory of Open Access Journals (Sweden)

    Haoyuan Han

    2015-08-01

    Full Text Available In contrast to high genetic diversity of mitochondrial DNA (mtDNA, equine Y chromosome shows extremely low variability, implying limited patrilines in the domesticated horse. In this study, we applied direct sequencing and restriction fragment length polymorphism (RFLP methods to investigate the polymorphisms of 33 Y chromosome specific loci in 304 Chinese indigenous horses from 13 breeds. Consequently, two Y-single nucleotide polymorphisms (SNPs (Y-45701/997 and Y-50869 and one Y-indel (Y-45288 were identified. Of those, the Y-50869 (T>A revealed the highest variation frequency (24.67%, whereas it was only 3.29% and 1.97% in Y-45288 (T/- and Y-45701/997 (G>T locus, respectively. These three mutations accounted for 27.96% of the total samples and identified five Y-SNP haplotypes, demonstrating genetic diversity of Y chromosome in Chinese horses. In addition, all the five Y-SNP haplotypes were shared by different breeds. Among 13 horse breeds analyzed, Balikun horse displayed the highest nucleotide diversity (π = 5.6×10−4 and haplotype diversity (h = 0.527, while Ningqiang horse showed the lowest nucleotide diversity (π = 0.00000 and haplotype diversity (h = 0.000. The results also revealed that Chinese horses had a different polymorphic pattern of Y chromosome from European and American horses. In conclusion, Chinese horses revealed genetic diversity of Y chromosome, however more efforts should be made to better understand the domestication and paternal origin of Chinese indigenous horses.

  6. Cognitive Diagnostic Assessment via Bayesian Evaluation of Informative Diagnostic Hypotheses

    NARCIS (Netherlands)

    Hoitink, Herbert; Beland, Sebastien; Vermeulen, Jorine A.

    2014-01-01

    There exist diverse approaches that can be used for cognitive diagnostic assessment, such as mastery testing, constrained latent class analysis, rule space methodology, diagnostic cognitive modeling, and person-fit analysis. Each of these approaches can be used within 1 of the 4 psychometric perspec

  7. Cognitive diagnostic assessment via Bayesian evaluation of informative diagnostic hypotheses.

    NARCIS (Netherlands)

    Hoijtink, Herbert; Béland, Sébastien; Vermeulen, Jorine A.

    2014-01-01

    There exist diverse approaches that can be used for cognitive diagnostic assessment, such as mastery testing, constrained latent class analysis, rule space methodology, diagnostic cognitive modeling, and person-fit analysis. Each of these approaches can be used within 1 of the 4 psychometric perspec

  8. Pinched flow fractionation devices for detection of single nucleotide polymorphisms

    DEFF Research Database (Denmark)

    Larsen, Asger Vig; Poulsen, Lena; Birgens, Henrik

    2008-01-01

    We demonstrate a new and flexible micro fluidic based method for genotyping single nucleotide polymorphisms ( SNPs). The method relies on size separation of selectively hybridized polystyrene microspheres in a micro fluidic pinched flow fractionation (PFF) device. The micro fluidic PFF devices...... with 13 mu m deep channels were fabricated by thermal nanoimprint lithography ( NIL) in a thin film of cyclic-olefin copolymer (mr-I T85) on a silicon wafer substrate, and the channels were sealed by thermal polymer bonding. Streptavidin coated polystyrene microspheres with a mean diameter of 3.09 mu m...

  9. Human sapovirus classification based on complete capsid nucleotide sequences.

    Science.gov (United States)

    Oka, Tomoichiro; Mori, Kohji; Iritani, Nobuhiro; Harada, Seiya; Ueki, You; Iizuka, Setsuko; Mise, Keiji; Murakami, Kosuke; Wakita, Takaji; Katayama, Kazuhiko

    2012-02-01

    The genetically diverse sapoviruses (SaVs) are a significant cause of acute human gastroenteritis. Human SaV surveillance is becoming more critical, and a better understanding of the diversity and distribution of the viral genotypes is needed. In this study, we analyzed 106 complete human SaV capsid nucleotide sequences to provide a better understanding of their diversity. Based on those results, we propose a novel standardized classification scheme that meets the requirements of the International Calicivirus Scientific Committee. We believe the classification scheme and strains described here will be of value for the molecular characterization and classification of newly detected SaV genotypes and for comparing data worldwide.

  10. Patterns of nucleotides that flank substitutions in human orthologous genes

    Directory of Open Access Journals (Sweden)

    Huang Zhuoran

    2010-07-01

    Full Text Available Abstract Background Sequence context is an important aspect of base mutagenesis, and three-base periodicity is an intrinsic property of coding sequences. However, how three-base periodicity is influenced in the vicinity of substitutions is still unclear. The effect of context on mutagenesis should be revealed in the usage of nucleotides that flank substitutions. Relative entropy (also known as Kullback-Leibler divergence is useful for finding unusual patterns in biological sequences. Results Using relative entropy, we visualized the periodic patterns in the context of substitutions in human orthologous genes. Neighbouring patterns differed both among substitution categories and within a category that occurred at three codon positions. Transition tended to occur in periodic sequences relative to transversion. Periodic signals were stronger in a set of flanking sequences of substitutions that occurred at the third-codon positions than in those that occurred at the first- or second-codon positions. To determine how the three-base periodicity was affected near the substitution sites, we fitted a sine model to the values of the relative entropy. A sine of period equal to 3 is a good approximation for the three-base periodicity at sites not in close vicinity to some substitutions. These periods were interrupted near the substitution site and then reappeared away from substitutions. A comparative analysis between the native and codon-shuffled datasets suggested that the codon usage frequency was not the sole origin of the three-base periodicity, implying that the native order of codons also played an important role in this periodicity. Synonymous codon shuffling revealed that synonymous codon usage bias was one of the factors responsible for the observed three-base periodicity. Conclusions Our results offer an efficient way to illustrate unusual periodic patterns in the context of substitutions and provide further insight into the origin of three

  11. Copper intoxication inhibits aerobic nucleotide synthesis in Streptococcus pneumoniae

    Science.gov (United States)

    Johnson, Michael D. L.; Kehl-Fie, Thomas E.; Rosch, Jason W.

    2015-01-01

    Copper is universally toxic in excess, a feature exploited by the human immune system to facilitate bacterial clearance. The mechanism of copper intoxication remains unknown for many bacterial species. Here, we demonstrate that copper toxicity in Streptococcus pneumoniae is independent from oxidative stress but, rather, is the result of copper inhibiting the aerobic dNTP biosynthetic pathway. Furthermore, we show that copper-intoxicated S. pneumoniae is rescued by manganese, which is an essential metal in the aerobic nucleotide synthesis pathway. These data provide insight into new targets to enhance copper-mediated toxicity during bacterial clearance. PMID:25730343

  12. The complete nucleotide sequence of pelargonium leaf curl virus.

    Science.gov (United States)

    McGavin, Wendy J; MacFarlane, Stuart A

    2016-05-01

    Investigation of a tombusvirus isolated from tulip plants in Scotland revealed that it was pelargonium leaf curl virus (PLCV) rather than the originally suggested tomato bushy stunt virus. The complete sequence of the PLCV genome was determined for the first time, revealing it to be 4789 nucleotides in size and to have an organization similar to that of the other, previously described tombusviruses. Primers derived from the sequence were used to construct a full-length infectious clone of PLCV that recapitulates the disease symptoms of leaf curling in systemically infected pelargonium plants.

  13. Single nucleotide polymorphism (SNP) detection on a magnetoresistive sensor

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Østerberg, Frederik Westergaard; Dufva, Martin

    2013-01-01

    We present a magnetoresistive sensor platform for hybridization assays and demonstrate its applicability on single nucleotide polymorphism (SNP) genotyping. The sensor relies on anisotropic magnetoresistance in a new geometry with a local negative reference and uses the magnetic field from...... the sensor bias current to magnetize magnetic beads in the vicinity of the sensor. The method allows for real-time measurements of the specific bead binding to the sensor surface during DNA hybridization and washing. Compared to other magnetic biosensing platforms, our approach eliminates the need...... for external electromagnets and thus allows for miniaturization of the sensor platform....

  14. Global discovery of protein kinases and other nucleotide-binding proteins by mass spectrometry.

    Science.gov (United States)

    Xiao, Yongsheng; Wang, Yinsheng

    2016-09-01

    Nucleotide-binding proteins, such as protein kinases, ATPases and GTP-binding proteins, are among the most important families of proteins that are involved in a number of pivotal cellular processes. However, global study of the structure, function, and expression level of nucleotide-binding proteins as well as protein-nucleotide interactions can hardly be achieved with the use of conventional approaches owing to enormous diversity of the nucleotide-binding protein family. Recent advances in mass spectrometry (MS) instrumentation, coupled with a variety of nucleotide-binding protein enrichment methods, rendered MS-based proteomics a powerful tool for the comprehensive characterizations of the nucleotide-binding proteome, especially the kinome. Here, we review the recent developments in the use of mass spectrometry, together with general and widely used affinity enrichment approaches, for the proteome-wide capture, identification and quantification of nucleotide-binding proteins, including protein kinases, ATPases, GTPases, and other nucleotide-binding proteins. The working principles, advantages, and limitations of each enrichment platform in identifying nucleotide-binding proteins as well as profiling protein-nucleotide interactions are summarized. The perspectives in developing novel MS-based nucleotide-binding protein detection platform are also discussed. © 2014 Wiley Periodicals, Inc. Mass Spec Rev 35:601-619, 2016.

  15. Dietary nucleotides influence immune responses and intestinal morphology of red drum Sciaenops ocellatus.

    Science.gov (United States)

    Cheng, Zhenyan; Buentello, Alejandro; Gatlin, Delbert M

    2011-01-01

    Dietary nucleotides have been shown to benefit many physiological and nutritional functions in higher vertebrates and fish. Therefore, a 6-week feeding trial was conducted to evaluate the effects of graded levels of a commercial nucleotide product on growth performance, immune responses and intestinal morphology of juvenile red drum (initial average weight of 7.1g). The basal diet was formulated to contain 40% protein, 10% lipid and a digestible energy level of 3.5 kcal g(-1). Two levels of nucleotide (Ascogen P(®), 0.5% and 1% of diet) were added to the basal diet with menhaden fishmeal and menhaden oil adjusted to provide isonitrogenous and isolipidic diets. Nucleotide supplementation tended to improve weight gain and survival of red drum, but not at a significant level. Neutrophil oxidative radical anion production and serum lysozyme activity tended to be higher for fish fed diets supplemented with nucleotide, while extracellular superoxide anion production of head kidney macrophages from fish fed diets with 1% nucleotide was significantly (Pfish fed 0.5% nucleotide diet and the basal diet. Nucleotide supplementation significantly (Pfish fed with diets supplemented with nucleotides. It is therefore possible to use dietary nucleotides supplementation to significantly enhance the intestinal structure of red drum. Likewise, nucleotides in the diet may improve some components of the non-specific immune response of this sciaenid fish.

  16. Solid-state NMR [13C,15N] resonance assignments of the nucleotide-Binding Domain of a bacterial Cyclic Nucleotide-Gated Channel

    NARCIS (Netherlands)

    Cukkemane, A.A.; Nand, D.; Gradmann, S.H.E.; Weingarth, M.H.; Kaupp, U.B.; Baldus, M.

    2012-01-01

    Channels regulated by cyclic nucleotides are key signalling proteins in several biological pathways. The regulatory aspect is conferred by a C-terminal cyclic nucleotide-binding domain (CNBD). We report resonance assignments of the CNBD of a bacterial mlCNG channel obtained using 2D and 3D solid-sta

  17. Plasma diagnostics discharge parameters and chemistry

    CERN Document Server

    Auciello, Orlando

    1989-01-01

    Plasma Diagnostics, Volume 1: Discharge Parameters and Chemistry covers seven chapters on the important diagnostic techniques for plasmas and details their use in particular applications. The book discusses optical diagnostic techniques for low pressure plasmas and plasma processing; plasma diagnostics for electrical discharge light sources; as well as Langmuir probes. The text also describes the mass spectroscopy of plasmas, microwave diagnostics, paramagnetic resonance diagnostics, and diagnostics in thermal plasma processing. Electrical engineers, nuclear engineers, microwave engineers, che

  18. Status of US ITER Diagnostics

    Science.gov (United States)

    Stratton, B.; Delgado-Aparicio, L.; Hill, K.; Johnson, D.; Pablant, N.; Barnsley, R.; Bertschinger, G.; de Bock, M. F. M.; Reichle, R.; Udintsev, V. S.; Watts, C.; Austin, M.; Phillips, P.; Beiersdorfer, P.; Biewer, T. M.; Hanson, G.; Klepper, C. C.; Carlstrom, T.; van Zeeland, M. A.; Brower, D.; Doyle, E.; Peebles, A.; Ellis, R.; Levinton, F.; Yuh, H.

    2013-10-01

    The US is providing 7 diagnostics to ITER: the Upper Visible/IR cameras, the Low Field Side Reflectometer, the Motional Stark Effect diagnostic, the Electron Cyclotron Emission diagnostic, the Toroidal Interferometer/Polarimeter, the Core Imaging X-Ray Spectrometer, and the Diagnostic Residual Gas Analyzer. The front-end components of these systems must operate with high reliability in conditions of long pulse operation, high neutron and gamma fluxes, very high neutron fluence, significant neutron heating (up to 7 MW/m3) , large radiant and charge exchange heat flux (0.35 MW/m2) , and high electromagnetic loads. Opportunities for repair and maintenance of these components will be limited. These conditions lead to significant challenges for the design of the diagnostics. Space constraints, provision of adequate radiation shielding, and development of repair and maintenance strategies are challenges for diagnostic integration into the port plugs that also affect diagnostic design. The current status of design of the US ITER diagnostics is presented and R&D needs are identified. Supported by DOE contracts DE-AC02-09CH11466 (PPPL) and DE-AC05-00OR22725 (UT-Battelle, LLC).

  19. Motor neurone disease: diagnostic pitfalls.

    Science.gov (United States)

    Williams, Timothy L

    2013-02-01

    The misdiagnosis of MND (particularly of the ALS phenotype), is uncommon. Atypical presentations, particularly of focal onset and with pure LMN or UMN signs, present a more difficult diagnostic challenge, although perhaps reassuringly, treatable mimics are rare. A working knowledge of potential alternative conditions and MND diagnostic pitfalls should help to reduce the misdiagnosis rate, particularly if the key points are considered.

  20. Pyomyositis tropicans: a diagnostic dilemma.

    Science.gov (United States)

    Chaitow, J; Martin, H C; Knight, P; Buchanan, N

    1980-11-01

    Pyomyositis tropicans is a rare disease in non-tropical climates and thus presents diagnostic difficulties. Two children with single staphylococcal psoas muscle abscesses were recently successfully treated. Computerized axial tomography was found to be a useful diagnostic aid, allowing exact localization of the lesion. The diagnosis and therapy of these abscesses are discussed.

  1. Dual Processing and Diagnostic Errors

    Science.gov (United States)

    Norman, Geoff

    2009-01-01

    In this paper, I review evidence from two theories in psychology relevant to diagnosis and diagnostic errors. "Dual Process" theories of thinking, frequently mentioned with respect to diagnostic error, propose that categorization decisions can be made with either a fast, unconscious, contextual process called System 1 or a slow, analytical,…

  2. Structure and function of nucleotide sugar transporters: Current progress

    Directory of Open Access Journals (Sweden)

    Barbara Hadley

    2014-06-01

    Full Text Available The proteomes of eukaryotes, bacteria and archaea are highly diverse due, in part, to the complex post-translational modification of protein glycosylation. The diversity of glycosylation in eukaryotes is reliant on nucleotide sugar transporters to translocate specific nucleotide sugars that are synthesised in the cytosol and nucleus, into the endoplasmic reticulum and Golgi apparatus where glycosylation reactions occur. Thirty years of research utilising multidisciplinary approaches has contributed to our current understanding of NST function and structure. In this review, the structure and function, with reference to various disease states, of several NSTs including the UDP-galactose, UDP-N-acetylglucosamine, UDP-N-acetylgalactosamine, GDP-fucose, UDP-N-acetylglucosamine/UDP-glucose/GDP-mannose and CMP-sialic acid transporters will be described. Little is known regarding the exact structure of NSTs due to difficulties associated with crystallising membrane proteins. To date, no three-dimensional structure of any NST has been elucidated. What is known is based on computer predictions, mutagenesis experiments, epitope-tagging studies, in-vitro assays and phylogenetic analysis. In this regard the best-characterised NST to date is the CMP-sialic acid transporter (CST. Therefore in this review we will provide the current state-of-play with respect to the structure–function relationship of the (CST. In particular we have summarised work performed by a number groups detailing the affect of various mutations on CST transport activity, efficiency, and substrate specificity.

  3. Allosteric interactions of DNA and nucleotides with S. cerevisiae RSC.

    Science.gov (United States)

    Malik, Shuja Shafi; Rich, Evan; Viswanathan, Ramya; Cairns, Bradley R; Fischer, Christopher J

    2011-09-20

    RSC (remodel the structure of chromatin) is an essential chromatin remodeler of Saccharomyces cerevisiae that has been shown to have DNA translocase properties. We studied the DNA binding properties of a "trimeric minimal RSC" (RSCt) of the RSC chromatin remodeling complex and the effect of nucleotides on this interaction using fluorescence anisotropy. RSCt binds to 20 bp fluorescein-labeled double-stranded DNA with a K(d) of ∼100 nM. The affinity of RSCt for DNA is reduced in the presence of AMP-PNP and ADP in a concentration-dependent manner with the addition of AMP-PNP having more pronounced effect. These differences in the magnitude at which the binding of ADP and AMP-PNP affects the affinity of DNA binding by RSCt suggest that the physical movement of the enzyme along DNA begins between the binding of ATP and its subsequent hydrolysis. Furthermore, the fact that the highest affinity for DNA binding by RSCt occurs in the absence of bound nucleotide offers a mechanistic explanation for the apparent low processivity of DNA translocation by the enzyme.

  4. Nucleotide Docking: Prediction of Reactant State Complexes for Ribonuclease Enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Elsasser, Brigitta M.; Fels, Gregor

    2010-12-01

    Ribonuclease enzymes (RNases) play key roles in the maturation and metabolism of all RNA molecules. Computational simulations of the processes involved can help to elucidate the underlying enzymatic mechanism and is often employed in a synergistic approach together with biochemical experiments. Theoretical calculations require atomistic details regarding the starting geometries of the molecules involved, which, in the absence of crystallographic data, can only be achieved from computational docking studies. Fortunately, docking algorithms have improved tremendously in recent years, so that reliable structures of enzyme-ligand complexes can now be successfully obtained from computation. However, most docking programs are not particularly optimized for nucleotide docking. In order to assist our studies on the cleavage of RNA by the two most important ribonuclease enzymes, RNase A and RNase H, we evaluated four docking tools - MOE2009, Glide 5.5, QXP-Flo+0802, and Autodock 4.0 - for their ability to simulate complexes between these enzymes and RNA oligomers. To validate our results, we analyzed the docking results with respect to the known key interactions between the protein and the nucleotide. In addition, we compared the predicted complexes with X-ray structures of the mutated enzyme as well as with structures obtained from previous calculations. In this manner, we were able to prepare the desired reaction state complex so that it could be used as the starting structure for further DFT/B3LYP QM/MM reaction mechanism studies.

  5. Cyclic Nucleotide Monophosphates and Their Cyclases in Plant Signaling

    KAUST Repository

    Gehring, Christoph A.

    2017-10-04

    The cyclic nucleotide monophosphates (cNMPs), and notably 3′,5′-cyclic guanosine monophosphate (cGMP) and 3′,5′-cyclic adenosine monophosphate (cAMP) are now accepted as key signaling molecules in many processes in plants including growth and differentiation, photosynthesis, and biotic and abiotic defense. At the single molecule level, we are now beginning to understand how cNMPs modify specific target molecules such as cyclic nucleotide-gated channels, while at the systems level, a recent study of the Arabidopsis cNMP interactome has identified novel target molecules with specific cNMP-binding domains. A major advance came with the discovery and characterization of a steadily increasing number of guanylate cyclases (GCs) and adenylate cyclases (ACs). Several of the GCs are receptor kinases and include the brassinosteroid receptor, the phytosulfokine receptor, the Pep receptor, the plant natriuretic peptide receptor as well as a nitric oxide sensor. We foresee that in the near future many more molecular mechanisms and biological roles of GCs and ACs and their catalytic products will be discovered and further establish cNMPs as a key component of plant responses to the environment.

  6. Single Nucleotide Polymorphism Analysis of Protamine Genes in Infertile Men

    Directory of Open Access Journals (Sweden)

    Ahamad Salamian

    2008-01-01

    Full Text Available Background: Single nucleotide polymorphism (SNPs are considered as one of the underlyingcauses of male infertility. Proper sperm chromatin packaging which involves replacement ofhistones with protamines has profound effect on male fertility. Over 20 SNPs have been reportedfor the protamine 1 and 2.Materials and Methods: The aim of this study was to evaluate the frequency of two previouslyreported SNPs using polymerase chain reaction (PCR-restriction fragment length polymorphism(RFLP approach in 35, 96 and 177 normal, oligozoospermic and azoospermic individuals. TheseSNPs are: 1. A base pair substitution (G at position 197 instead of T in protamine type 1 Openreading frame (ORF including untranslated region, which causes an Arg residue change to Serresidue in a highly conserved region. 2. cytidine nucleotide change to thymidine in position of 248of protamine type 2 ORF which caused a nonsense point mutation.Results: The two mentioned SNPs were not present in the studied population, thus concluding thatthese SNPs can not serves as molecular markers for male infertility diagnosis.Conclusion: The results of our study reveal that in a selected Iranian population, the SNP G197Tand C248T are completely absent and are not associated with male infertility and therefore theseSNPs may not represent a molecular marker for genetic diagnosis of male infertility.

  7. Bayesian selection of nucleotide substitution models and their site assignments.

    Science.gov (United States)

    Wu, Chieh-Hsi; Suchard, Marc A; Drummond, Alexei J

    2013-03-01

    Probabilistic inference of a phylogenetic tree from molecular sequence data is predicated on a substitution model describing the relative rates of change between character states along the tree for each site in the multiple sequence alignment. Commonly, one assumes that the substitution model is homogeneous across sites within large partitions of the alignment, assigns these partitions a priori, and then fixes their underlying substitution model to the best-fitting model from a hierarchy of named models. Here, we introduce an automatic model selection and model averaging approach within a Bayesian framework that simultaneously estimates the number of partitions, the assignment of sites to partitions, the substitution model for each partition, and the uncertainty in these selections. This new approach is implemented as an add-on to the BEAST 2 software platform. We find that this approach dramatically improves the fit of the nucleotide substitution model compared with existing approaches, and we show, using a number of example data sets, that as many as nine partitions are required to explain the heterogeneity in nucleotide substitution process across sites in a single gene analysis. In some instances, this improved modeling of the substitution process can have a measurable effect on downstream inference, including the estimated phylogeny, relative divergence times, and effective population size histories.

  8. Thoroughbred Horse Single Nucleotide Polymorphism and Expression Database: HSDB

    Directory of Open Access Journals (Sweden)

    Joon-Ho Lee

    2014-09-01

    Full Text Available Genetics is important for breeding and selection of horses but there is a lack of well-established horse-related browsers or databases. In order to better understand horses, more variants and other integrated information are needed. Thus, we construct a horse genomic variants database including expression and other information. Horse Single Nucleotide Polymorphism and Expression Database (HSDB (http://snugenome2.snu.ac.kr/HSDB provides the number of unexplored genomic variants still remaining to be identified in the horse genome including rare variants by using population genome sequences of eighteen horses and RNA-seq of four horses. The identified single nucleotide polymorphisms (SNPs were confirmed by comparing them with SNP chip data and variants of RNA-seq, which showed a concordance level of 99.02% and 96.6%, respectively. Moreover, the database provides the genomic variants with their corresponding transcriptional profiles from the same individuals to help understand the functional aspects of these variants. The database will contribute to genetic improvement and breeding strategies of Thoroughbreds.

  9. Detecting Single-Nucleotide Substitutions Induced by Genome Editing.

    Science.gov (United States)

    Miyaoka, Yuichiro; Chan, Amanda H; Conklin, Bruce R

    2016-08-01

    The detection of genome editing is critical in evaluating genome-editing tools or conditions, but it is not an easy task to detect genome-editing events-especially single-nucleotide substitutions-without a surrogate marker. Here we introduce a procedure that significantly contributes to the advancement of genome-editing technologies. It uses droplet digital polymerase chain reaction (ddPCR) and allele-specific hydrolysis probes to detect single-nucleotide substitutions generated by genome editing (via homology-directed repair, or HDR). HDR events that introduce substitutions using donor DNA are generally infrequent, even with genome-editing tools, and the outcome is only one base pair difference in 3 billion base pairs of the human genome. This task is particularly difficult in induced pluripotent stem (iPS) cells, in which editing events can be very rare. Therefore, the technological advances described here have implications for therapeutic genome editing and experimental approaches to disease modeling with iPS cells.

  10. Multi-nucleotide de novo Mutations in Humans.

    Directory of Open Access Journals (Sweden)

    Søren Besenbacher

    2016-11-01

    Full Text Available Mutation of the DNA molecule is one of the most fundamental processes in biology. In this study, we use 283 parent-offspring trios to estimate the rate of mutation for both single nucleotide variants (SNVs and short length variants (indels in humans and examine the mutation process. We found 17812 SNVs, corresponding to a mutation rate of 1.29 × 10-8 per position per generation (PPPG and 1282 indels corresponding to a rate of 9.29 × 10-10 PPPG. We estimate that around 3% of human de novo SNVs are part of a multi-nucleotide mutation (MNM, with 558 (3.1% of mutations positioned less than 20kb from another mutation in the same individual (median distance of 525bp. The rate of de novo mutations is greater in late replicating regions (p = 8.29 × 10-19 and nearer recombination events (p = 0.0038 than elsewhere in the genome.

  11. Identification of novel cyclic nucleotide binding proteins in Trypanosoma cruzi.

    Science.gov (United States)

    Jäger, Adriana V; De Gaudenzi, Javier G; Mild, Jesica G; Mc Cormack, Bárbara; Pantano, Sergio; Altschuler, Daniel L; Edreira, Martin M

    2014-12-01

    Cyclic AMP has been implicated as second messenger in a wide range of cellular processes. In the protozoan parasite Trypanosoma cruzi, cAMP is involved in the development of the parasite's life cycle. While cAMP effectors have been widely studied in other eukaryotic cells, little is known about cAMP's mechanism of action in T. cruzi. To date, only a cAMP-dependent protein kinase A (PKA) has been cloned and characterised in this parasite; however experimental evidence indicates the existence of cAMP-dependent, PKA-independent events. In order to identify new cAMP binding proteins as potential cAMP effectors, we carried out in silico studies using the predicted T. cruzi proteome. Using a combination of search methods 27 proteins with putative cNMP binding domains (CBDs) were identified. Phylogenetic analysis of the CBDs presented a homogeneous distribution, with sequences segregated into two main branches: one containing kinases-like proteins and the other gathering hypothetical proteins with different function or no other known. Comparative modelling of the strongest candidates provides support for the hypothesis that these proteins may give rise to structurally viable cyclic nucleotide binding domains. Pull-down and nucleotide displacement assays strongly suggest that TcCLB.508523.80 could bind cAMP and eventually be a new putative PKA-independent cAMP effector in T. cruzi.

  12. Identification of widespread adenosine nucleotide binding in Mycobacterium tuberculosis

    Energy Technology Data Exchange (ETDEWEB)

    Ansong, Charles; Ortega, Corrie; Payne, Samuel H.; Haft, Daniel H.; Chauvigne-Hines, Lacie M.; Lewis, Michael P.; Ollodart, Anja R.; Purvine, Samuel O.; Shukla, Anil K.; Fortuin, Suereta; Smith, Richard D.; Adkins, Joshua N.; Grundner, Christoph; Wright, Aaron T.

    2013-01-24

    The annotation of protein function is almost completely performed by in silico approaches. However, computational prediction of protein function is frequently incomplete and error prone. In Mycobacterium tuberculosis (Mtb), ~25% of all genes have no predicted function and are annotated as hypothetical proteins. This lack of functional information severely limits our understanding of Mtb pathogenicity. Current tools for experimental functional annotation are limited and often do not scale to entire protein families. Here, we report a generally applicable chemical biology platform to functionally annotate bacterial proteins by combining activity-based protein profiling (ABPP) and quantitative LC-MS-based proteomics. As an example of this approach for high-throughput protein functional validation and discovery, we experimentally annotate the families of ATP-binding proteins in Mtb. Our data experimentally validate prior in silico predictions of >250 ATPases and adenosine nucleotide-binding proteins, and reveal 73 hypothetical proteins as novel ATP-binding proteins. We identify adenosine cofactor interactions with many hypothetical proteins containing a diversity of unrelated sequences, providing a new and expanded view of adenosine nucleotide binding in Mtb. Furthermore, many of these hypothetical proteins are both unique to Mycobacteria and essential for infection, suggesting specialized functions in mycobacterial physiology and pathogenicity. Thus, we provide a generally applicable approach for high throughput protein function discovery and validation, and highlight several ways in which application of activity-based proteomics data can improve the quality of functional annotations to facilitate novel biological insights.

  13. Verification of Loop Diagnostics

    Science.gov (United States)

    Winebarger, A.; Lionello, R.; Mok, Y.; Linker, J.; Mikic, Z.

    2014-01-01

    Many different techniques have been used to characterize the plasma in the solar corona: density-sensitive spectral line ratios are used to infer the density, the evolution of coronal structures in different passbands is used to infer the temperature evolution, and the simultaneous intensities measured in multiple passbands are used to determine the emission measure. All these analysis techniques assume that the intensity of the structures can be isolated through background subtraction. In this paper, we use simulated observations from a 3D hydrodynamic simulation of a coronal active region to verify these diagnostics. The density and temperature from the simulation are used to generate images in several passbands and spectral lines. We identify loop structures in the simulated images and calculate the loop background. We then determine the density, temperature and emission measure distribution as a function of time from the observations and compare with the true temperature and density of the loop. We find that the overall characteristics of the temperature, density, and emission measure are recovered by the analysis methods, but the details of the true temperature and density are not. For instance, the emission measure curves calculated from the simulated observations are much broader than the true emission measure distribution, though the average temperature evolution is similar. These differences are due, in part, to inadequate background subtraction, but also indicate a limitation of the analysis methods.

  14. [Diagnostic imaging of lying].

    Science.gov (United States)

    Lass, Piotr; Sławek, Jarosław; Sitek, Emilia; Szurowska, Edyta; Zimmermann, Agnieszka

    2013-01-01

    Functional diagnostic imaging has been applied in neuropsychology for more than two decades. Nowadays, the functional magnetic resonance (fMRI) seems to be the most important technique. Brain imaging in lying has been performed and discussed since 2001. There are postulates to use fMRI for forensic purposes, as well as commercially, e.g. testing the loyalty of employees, especially because of the limitations of traditional polygraph in some cases. In USA fMRI is performed in truthfulness/lying assessment by at least two commercial companies. Those applications are a matter of heated debate of practitioners, lawyers and specialists of ethics. The opponents of fMRI use for forensic purposes indicate the lack of common agreement on it and the lack of wide recognition and insufficient standardisation. Therefore it cannot serve as a forensic proof, yet. However, considering the development of MRI and a high failure rate of traditional polygraphy, forensic applications of MRI seem to be highly probable in future.

  15. Diagnostic of Horndeski theories

    Science.gov (United States)

    Perenon, Louis; Marinoni, Christian; Piazza, Federico

    2017-01-01

    We study the effects of Horndeski models of dark energy on the observables of the large-scale structure in the late time universe. A novel classification into Late dark energy, Early dark energy and Early modified gravity scenarios is proposed, according to whether such models predict deviations from the standard paradigm persistent at early time in the matter domination epoch. We discuss the physical imprints left by each specific class of models on the effective Newton constant μ, the gravitational slip parameter η, the light deflection parameter Σ and the growth function fσ8 and demonstrate that a convenient way to dress a complete portrait of the viability of the Horndeski accelerating mechanism is via two, redshift-dependent, diagnostics: the μ(z) ‑ Σ(z) and the fσ8(z) ‑ Σ(z) planes. If future, model-independent, measurements point to either Σ ‑ 1 zero or μ ‑ 1 0 at high redshifts or μ ‑ 1 > 0 with Σ ‑ 1 1.5 then Early dark energy models are definitely ruled out. On the opposite case, Late dark energy models are rejected by data if Σ 1, only Early modifications of gravity provide a viable framework to interpret data.

  16. Diagnostic of Horndeski Theories

    CERN Document Server

    Perenon, Louis; Piazza, Federico

    2016-01-01

    We study the effects of Horndeski models of dark energy on the observables of the large-scale structure in the late time universe. A novel classification into {\\it Late dark energy}, {\\it Early dark energy} and {\\it Early modified gravity} scenarios is proposed, according to whether such models predict deviations from the standard paradigm persistent at early time in the matter domination epoch. We discuss the physical imprints left by each specific class of models on the effective Newton constant $\\mu$, the gravitational slip parameter $\\eta$, the light deflection parameter $\\Sigma$ and the growth function $f\\sigma_8$ and demonstrate that a convenient way to dress a complete portrait of the viability of the Horndeski accelerating mechanism is via two, redshift-dependent, diagnostics: the $\\mu(z)-\\Sigma(z)$ and the $f\\sigma_8(z)-\\Sigma(z)$ planes. If future, model-independent, measurements point to either $\\Sigma-10$ at high redshifts or $\\mu-1>0$ with $\\Sigma-11.5$ then Early dark energy models are definitel...

  17. Diagnostic neuroimaging across diseases

    Science.gov (United States)

    Klöppel, Stefan; Abdulkadir, Ahmed; Jack, Clifford R.; Koutsouleris, Nikolaos; Mourao-Miranda, Janaina; Vemuri, Prashanthi

    2012-01-01

    Fully automated classification algorithms have been successfully applied to diagnose a wide range of neurological and psychiatric diseases. They are sufficiently robust to handle data from different scanners for many applications and in specific cases outperform radiologists. This article provides an overview of current applications taking structural imaging in Alzheimer's Disease and schizophrenia as well as functional imaging to diagnose depression as examples. In this context, we also report studies aiming to predict the future course of the disease and the response to treatment for the individual. This has obvious clinical relevance but is also important for the design of treatment studies that may aim to include a cohort with a predicted fast disease progression to be more sensitive to detect treatment effects. In the second part, we present our own opinions on i) the role these classification methods can play in the clinical setting; ii) where their limitations are at the moment and iii) how those can be overcome. Specifically, we discuss strategies to deal with disease heterogeneity, diagnostic uncertainties, a probabilistic framework for classification and multi-class classification approaches. PMID:22094642

  18. Gonorrhoea diagnostics: An update

    Directory of Open Access Journals (Sweden)

    R Verma

    2016-01-01

    Full Text Available Diagnosis of gonorrhoea is an ongoing challenge. The organism is fastidious requiring meticulous collection and transport for successful cultivation. Asymptomatic infections are common which go undetected by conventional methods thereby leading to continued transmission and the risk of complications. The nucleic acid amplification tests, now increasingly used in developed countries, offer improved sensitivity compared to bacterial culture. However, these continue to suffer sequence related problems leading to false positive and false negative results. Further, these cannot be used for generation of data on antibiotic susceptibility because genetic markers of antibiotic resistance to recommended therapies have not been fully characterised. They are unaffordable in a setting like ours where reliance is placed on syndromic approach for sexually transmitted infection (STI management. The use of syndromic approach has resulted in a considerable decline in the number of Neisseria gonorrhoeae isolates that have been cultured for diagnostic purposes. Many laboratories formerly doing so are no longer performing culture for gonococci, and the basic skills have been lost. There is a need to not only revive this skill but also adopt newer technologies that can aid in accurate diagnosis in a cost-effective manner. There is room for innovation that can facilitate the development of a point-of-care test for this bacterial STI.

  19. ITER diagnostic system: Vacuum interface

    Energy Technology Data Exchange (ETDEWEB)

    Patel, K.M., E-mail: Kaushal.Patel@iter.org [ITER Organization, Route de Vinon sur Verdon, 13115 St Paul-Lez-Durance (France); Udintsev, V.S.; Hughes, S.; Walker, C.I.; Andrew, P.; Barnsley, R.; Bertalot, L. [ITER Organization, Route de Vinon sur Verdon, 13115 St Paul-Lez-Durance (France); Drevon, J.M. [Bertin Technologies, BP 22, 13762 Aix-en Provence cedex 3 (France); Encheva, A. [ITER Organization, Route de Vinon sur Verdon, 13115 St Paul-Lez-Durance (France); Kashchuk, Y. [Institution “PROJECT CENTER ITER”, 1, Akademika Kurchatova pl., Moscow (Russian Federation); Maquet, Ph. [Bertin Technologies, BP 22, 13762 Aix-en Provence cedex 3 (France); Pearce, R.; Taylor, N.; Vayakis, G.; Walsh, M.J. [ITER Organization, Route de Vinon sur Verdon, 13115 St Paul-Lez-Durance (France)

    2013-10-15

    Diagnostics play an essential role for the successful operation of the ITER tokamak. They provide the means to observe control and to measure plasma during the operation of ITER tokamak. The components of the diagnostic system in the ITER tokamak will be installed in the vacuum vessel, in the cryostat, in the upper, equatorial and divertor ports, in the divertor cassettes and racks, as well as in various buildings. Diagnostic components that are placed in a high radiation environment are expected to operate for the life of ITER. There are approx. 45 diagnostic systems located on ITER. Some diagnostics incorporate direct or independently pumped extensions to maintain their necessary vacuum conditions. They require a base pressure less than 10{sup −7} Pa, irrespective of plasma operation, and a leak rate of less than 10{sup −10} Pa m{sup 3} s{sup −1}. In all the cases it is essential to maintain the ITER closed fuel cycle. These directly coupled diagnostic systems are an integral part of the ITER vacuum containment and are therefore subject to the same design requirements for tritium and active gas confinement, for all normal and accidental conditions. All the diagnostics, whether or not pumped, incorporate penetration of the vacuum boundary (i.e. window assembly, vacuum feedthrough etc.) and demountable joints. Monitored guard volumes are provided for all elements of the vacuum boundary that are judged to be vulnerable by virtue of their construction, material, load specification etc. Standard arrangements are made for their construction and for the monitoring, evacuating and leak testing of these volumes. Diagnostic systems are incorporated at more than 20 ports on ITER. This paper will describe typical and particular arrangements of pumped diagnostic and monitored guard volume. The status of the diagnostic vacuum systems, which are at the start of their detailed design, will be outlined and the specific features of the vacuum systems in ports and extensions

  20. Plasma diagnostics for tokamaks and stellarators

    Energy Technology Data Exchange (ETDEWEB)

    Stott, P. E.; Sanchez, J.

    1994-07-01

    A collection of papers on plasma diagnostics is presented. The papers show the state of the art developments in a series of techniques: Magnetic diagnostics, Edge diagnostics, Langmuir probes, Spectroscopy, Microwave and FIR diagnostics as well as Thomson Scattering. Special interest was focused on those diagnostics oriented to fluctuations measurements in the plasma. (Author) 451 refs.

  1. Extracellular ATP and other nucleotides-ubiquitous triggers of intercellular messenger release.

    Science.gov (United States)

    Zimmermann, Herbert

    2016-03-01

    Extracellular nucleotides, and ATP in particular, are cellular signal substances involved in the control of numerous (patho)physiological mechanisms. They provoke nucleotide receptor-mediated mechanisms in select target cells. But nucleotides can considerably expand their range of action. They function as primary messengers in intercellular communication by stimulating the release of other extracellular messenger substances. These in turn activate additional cellular mechanisms through their own receptors. While this applies also to other extracellular messengers, its omnipresence in the vertebrate organism is an outstanding feature of nucleotide signaling. Intercellular messenger substances released by nucleotides include neurotransmitters, hormones, growth factors, a considerable variety of other proteins including enzymes, numerous cytokines, lipid mediators, nitric oxide, and reactive oxygen species. Moreover, nucleotides activate or co-activate growth factor receptors. In the case of hormone release, the initially paracrine or autocrine nucleotide-mediated signal spreads through to the entire organism. The examples highlighted in this commentary suggest that acting as ubiquitous triggers of intercellular messenger release is one of the major functional roles of extracellular nucleotides. While initiation of messenger release by nucleotides has been unraveled in many contexts, it may have been overlooked in others. It can be anticipated that additional nucleotide-driven messenger functions will be uncovered with relevance for both understanding physiology and development of therapy.

  2. Method: a single nucleotide polymorphism genotyping method for Wheat streak mosaic virus

    Directory of Open Access Journals (Sweden)

    Rogers Stephanie M

    2012-05-01

    incorporated into the forensic science tool box after a thorough validation study. This method incorporates molecular biology techniques that are already well established in research and diagnostic laboratories, allowing for an easy introduction of this method into existing laboratories. Keywords: single nucleotide polymorphisms, genotyping, plant pathology, viruses, microbial forensics, Single base primer extension, SNaPshot Multiplex Kit

  3. Diagnostic Challenges in AIH

    Directory of Open Access Journals (Sweden)

    A Taghavi Ardakani

    2014-04-01

    Full Text Available Autoimmune hepatitis is a chronic hepatitis that occurs in children and adults of all ages. Diagnosis is based upon characteristic serologic and histologic findings and the exclusion of other forms of chronic liver disease. Guidelines issued by the AASLD suggest the following diagnostic considerations: The diagnosis should be made in patients with compatible clinical signs, symptoms, and laboratory abnormalities. Other conditions that can cause chronic hepatitis should be excluded. In unclear cases a standardized scoring system should be used in the assessment. In those who are negative for conventional autoantibodies, additional autoantibodies should be sought. All patients with autoimmune hepatitis and inflammatory bowel disease should undergo cholangiographic studies to exclude primary sclerosing cholangitis.   Scoring systems- A scoring system developed and subsequently revised by the International Autoimmune Hepatitis Group to standardize the diagnosis with using simplified criteria based upon titers of autoantibodies, IgG levels, liver histology, and the exclusion of viral hepatitis. Autoantibodies: assign one point if the ANA or SMA are 1:40 OR assign two points if the ANA or SMA are ≥1:80 (OR if the LKM ≥1:40 OR if the SLA is positive. IgG: assign one point if the IgG is > the upper limit of normal OR assign two points if the IgG is >1.10 times the upper limit of normal. Liver histology: assign one point if the histological features are compatible with autoimmune hepatitis OR two points if the histological features are typical of autoimmune hepatitis. Absence of viral hepatitis A probable diagnosis of autoimmune hepatitis is made if the total points are six, while a definite diagnosis is made if the total points are ≥seven.  

  4. Benchmarks for measurement of duplicate detection methods in nucleotide databases.

    Science.gov (United States)

    Chen, Qingyu; Zobel, Justin; Verspoor, Karin

    2017-01-08

    Duplication of information in databases is a major data quality challenge. The presence of duplicates, implying either redundancy or inconsistency, can have a range of impacts on the quality of analyses that use the data. To provide a sound basis for research on this issue in databases of nucleotide sequences, we have developed new, large-scale validated collections of duplicates, which can be used to test the effectiveness of duplicate detection methods. Previous collections were either designed primarily to test efficiency, or contained only a limited number of duplicates of limited kinds. To date, duplicate detection methods have been evaluated on separate, inconsistent benchmarks, leading to results that cannot be compared and, due to limitations of the benchmarks, of questionable generality. In this study, we present three nucleotide sequence database benchmarks, based on information drawn from a range of resources, including information derived from mapping to two data sections within the UniProt Knowledgebase (UniProtKB), UniProtKB/Swiss-Prot and UniProtKB/TrEMBL. Each benchmark has distinct characteristics. We quantify these characteristics and argue for their complementary value in evaluation. The benchmarks collectively contain a vast number of validated biological duplicates; the largest has nearly half a billion duplicate pairs (although this is probably only a tiny fraction of the total that is present). They are also the first benchmarks targeting the primary nucleotide databases. The records include the 21 most heavily studied organisms in molecular biology research. Our quantitative analysis shows that duplicates in the different benchmarks, and in different organisms, have different characteristics. It is thus unreliable to evaluate duplicate detection methods against any single benchmark. For example, the benchmark derived from UniProtKB/Swiss-Prot mappings identifies more diverse types of duplicates, showing the importance of expert curation, but

  5. [Novel methods for dementia diagnostics].

    Science.gov (United States)

    Wiltfang, J

    2015-04-01

    Novel diagnostic methods, such as cerebrospinal fluid-based neurochemical dementia diagnostics (CSF-NDD) and [18F] amyloid positron emission tomography (PET) are meanwhile recommended for specific indications by international guidelines for the improved early and differential diagnostics of multigenic (sporadic) Alzheimer's dementia (AD). In the case of CSF-NDD the German neuropsychiatric guidelines have already been validated on the S3 level of evidence (http://www.DGPPN.de) and the additional consideration of [18F] amyloid-PET in the current update of the guidelines is to be expected. By means of CSF-NDD and/or [18F] amyloid-PET a predictive diagnosis of incipient (preclinical) AD is also possible for patients at high risk for AD who are in prodromal stages, such as mild cognitive impairment (MCI). As accompanying (secondary) preventive therapy of AD cannot be offered a predictive molecular dementia diagnostics is not recommended by the German neuropsychiatric dementia guidelines (http://www.DGPPN.de). However, novel diagnostic approaches, which offer molecular positive diagnostics of AD have already gained high relevance in therapy research as they allow promising preventive treatment avenues to be validated directly in the clinical trial. Moreover, future blood-based dementia diagnostics by means of multiplex assays is becoming increasingly more feasible; however, so far corresponding proteomic or epigenetic assays could not be consistently validated in independent studies.

  6. [BMW diagnostic criteria for IBS].

    Science.gov (United States)

    Matsueda, Kei

    2006-08-01

    Rome I diagnostic criteria for IBS was published in 1992 and it became a global diagnostic criteria. However, the criteria was not practical and somewhat complicated. Moreover, its symptomatic duration was too long (defined as more than 3 months) to be introduced in clinical practice. Therefore, Japanese member of BMW(Bowel Motility Workshop) tried to develop a new diagnostic criteria for IBS and it was established in 1995 by way of the Delphi method. The criteria was named as BMW diagnostic criteria and it was shown below: BMW diagnostic criteria for IBS (1995) At least one month or more of repetitive symptoms of the following 1) and 2) and no evidence of organic disease that likely to explain the symptoms. 1) Existence of abdominal pain, abdominal discomfort or abdominal distension 2) Existence of abnormal bowel movement (diarrhea, constipation) Abnormal bowel movement includes at least one of the below; (1) Abnormal stool frequency (2) Abnormal stool form (lumpy/hard or loose/wartery stool) Moreover, the following test should be performed as a rule to exclude organic diseases. (1) Urinalysis, fecal occult blood testing, CBC, chemistry (2) Barium enema or colonofiberscopic examination The other diagnostic criteria for IBS was also reviewed and their characteristics were compared with BMW diagnostic criteria.

  7. Industrial applications of laser diagnostics

    CERN Document Server

    Deguchi, Yoshihiro

    2011-01-01

    Tighter regulations of harmful substances such as NOx, CO, heavy metals, particles, emissions from commercial plants and automobiles reflect a growing demand for lowering the anthropogenic burdens on the environment. It is equally important to monitor controlling factors to improve the operation of industrial machinery and plants. Among the many methods for doing this, laser diagnostics stands out. Taking a practical approach, Industrial Applications of Laser Diagnostics discusses how to apply laser diagnostics to engines, gas turbines, thermal and chemical plant systems, and disposal faciliti

  8. Computational learning on specificity-determining residue-nucleotide interactions

    KAUST Repository

    Wong, Ka-Chun

    2015-11-02

    The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

  9. Complete nucleotide sequence of primitive vertebrate immunoglobulin light chain genes.

    Science.gov (United States)

    Shamblott, M J; Litman, G W

    1989-06-01

    Antibody to Heterodontus francisci (horned shark) immunoglobulin light chain was used to screen a spleen cDNA expression library, and recombinant clones encoding light chain genes were isolated. The complete sequences of the mature coding regions of two light chain genes in this phylogenetically distant vertebrate have been determined and are reported here. Comparisons of the sequences are consistent with the presence of mammalian-like framework and complementarity-determining regions. The predicted amino acid sequences of the genes are more related to mammalian lambda than to kappa light chains. The nucleotide sequences of the genes are most related to mammalian T-cell antigen receptor beta chain. Heterodontus light chain genes may reflect characteristics of the common ancestor of immunoglobulin and T-cell antigen receptors before its evolutionary diversification.

  10. Milestones in the discovery of antiviral agents: nucleosides and nucleotides

    Directory of Open Access Journals (Sweden)

    Erik de Clercq

    2012-12-01

    Full Text Available In this review article, a number of milestones in the antiviral research field on nucleosides and nucleotides are reviewed in which the author played a significant part, especially in the initial stages of their development. Highlighted are the amino acyl esters of acyclovir, particularly valacyclovir (VACV, brivudin (BVDU and the valine ester of Cf1743 (FV-100, the 2′,3′-dideoxynucleosides (nucleoside reverse transcriptase inhibitors, NRTIs, the acyclic nucleoside phosphonates (S-HPMPA, (S-HPMPC (cidofovir and alkoxyalkyl esters thereof (HDP-, ODE-CDV, adefovir and adefovir dipivoxil, tenofovir and tenofovir disoproxil fumarate (TDF, combinations containing TDF and emtricitabine, i.e., Truvada®, Atripla®, Complera®/Eviplera® and the Quad pill, and the phosphonoamidate derivatives GS-7340, GS-9131, GS-9191 and GS-9219.

  11. iCLIP: protein-RNA interactions at nucleotide resolution.

    Science.gov (United States)

    Huppertz, Ina; Attig, Jan; D'Ambrogio, Andrea; Easton, Laura E; Sibley, Christopher R; Sugimoto, Yoichiro; Tajnik, Mojca; König, Julian; Ule, Jernej

    2014-02-01

    RNA-binding proteins (RBPs) are key players in the post-transcriptional regulation of gene expression. Precise knowledge about their binding sites is therefore critical to unravel their molecular function and to understand their role in development and disease. Individual-nucleotide resolution UV crosslinking and immunoprecipitation (iCLIP) identifies protein-RNA crosslink sites on a genome-wide scale. The high resolution and specificity of this method are achieved by an intramolecular cDNA circularization step that enables analysis of cDNAs that truncated at the protein-RNA crosslink sites. Here, we describe the improved iCLIP protocol and discuss critical optimization and control experiments that are required when applying the method to new RBPs.

  12. Large nucleotide-dependent conformational change in Rab28

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Sung Haeng; Baek, Kyuwon; Dominguez, Roberto (UPENN-MED)

    2008-12-01

    Rab GTPases are essential regulators of membrane trafficking. We report crystal structures of Rab28 in the active (GppNHp-bound) and inactive (GDP-3'P-bound) forms at 1.5 and 1.1 {angstrom} resolution. Rab28 is a distant member of the Rab family. While the overall fold of Rab28 resembles that of other Rab GTPases, it undergoes a larger nucleotide-dependent conformational change than other members of this family. Added flexibility resulting from a double-glycine motif at the beginning of switch 2 might partially account for this observation. The double-glycine motif, which is conserved in the Arf family, only occurs in Rab28 and Rab7B of the Rab family, and may have a profound effect on their catalytic activities.

  13. Efficient fidelity control by stepwise nucleotide selection in polymerase elongation

    CERN Document Server

    Yu, Jin

    2014-01-01

    Polymerases select nucleotides before incorporating them for chemical synthesis during gene replication or transcription. How the selection proceeds stepwise efficiently to achieve sufficiently high fidelity and speed is essential for polymerase function. We examined step-by-step selections that have conformational transition rates tuned one at time in the polymerase elongation cycle, with a controlled differentiation free energy at each checkpoint. The elongation is sustained at non-equilibrium steady state with constant free energy input and heat dissipation. It is found that error reduction capability does not improve for selection checkpoints down the reaction path. Hence, it is essential to select early to achieve an efficient fidelity control. In particular, for two consecutive selections that reject the wrong substrate back and inhibit it forward from a same kinetic state, the same error rates are obtained at the same free energy differentiation. The initial screening is indispensible for maintaining t...

  14. Nucleosome positioning, nucleotide excision repair and photoreactivation in Saccharomyces cerevisiae.

    Science.gov (United States)

    Guintini, Laetitia; Charton, Romain; Peyresaubes, François; Thoma, Fritz; Conconi, Antonio

    2015-12-01

    The position of nucleosomes on DNA participates in gene regulation and DNA replication. Nucleosomes can be repressors by limiting access of factors to regulatory sequences, or activators by facilitating binding of factors to exposed DNA sequences on the surface of the core histones. The formation of UV induced DNA lesions, like cyclobutane pyrimidine dimers (CPDs), is modulated by DNA bending around the core histones. Since CPDs are removed by nucleotide excision repair (NER) and photolyase repair, it is of paramount importance to understand how DNA damage and repair are tempered by the position of nucleosomes. In vitro, nucleosomes inhibit NER and photolyase repair. In vivo, nucleosomes slow down NER and considerably obstruct photoreactivation of CPDs. However, over-expression of photolyase allows repair of nucleosomal DNA in a second time scale. It is proposed that the intrinsic abilities of nucleosomes to move and transiently unwrap could facilitate damage recognition and repair in nucleosomal DNA.

  15. Computational identification of candidate nucleotide cyclases in higher plants

    KAUST Repository

    Wong, Aloysius Tze

    2013-09-03

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants. © Springer Science+Business Media New York 2013.

  16. A nucleotide-level coarse-grained model of RNA

    CERN Document Server

    Šulc, Petr; Ouldridge, Thomas E; Doye, Jonathan P K; Louis, Ard A

    2014-01-01

    We present a new, nucleotide-level model for RNA, oxRNA, based on the coarse-graining methodology recently developed for the oxDNA model of DNA. The model is designed to reproduce structural, mechanical and thermodynamic properties of RNA, and the coarse-graining level aims to retain the relevant physics for RNA hybridization and the structure of single- and double-stranded RNA. In order to explore its strengths and weaknesses, we test the model in a range of nanotechnological and biological settings. Applications explored include the folding thermodynamics of a pseudoknot, the formation of a kissing loop complex, the structure of a hexagonal RNA nanoring, and the unzipping of a hairpin motif. We argue that the model can be used for efficient simulations of the structure of systems with thousands of base pairs, and for the assembly of systems of up to hundreds of base pairs. The source code implementing the model is released for public use.

  17. Computational identification of candidate nucleotide cyclases in higher plants.

    Science.gov (United States)

    Wong, Aloysius; Gehring, Chris

    2013-01-01

    In higher plants guanylyl cyclases (GCs) and adenylyl cyclases (ACs) cannot be identified using BLAST homology searches based on annotated cyclic nucleotide cyclases (CNCs) of prokaryotes, lower eukaryotes, or animals. The reason is that CNCs are often part of complex multifunctional proteins with different domain organizations and biological functions that are not conserved in higher plants. For this reason, we have developed CNC search strategies based on functionally conserved amino acids in the catalytic center of annotated and/or experimentally confirmed CNCs. Here we detail this method which has led to the identification of >25 novel candidate CNCs in Arabidopsis thaliana, several of which have been experimentally confirmed in vitro and in vivo. We foresee that the application of this method can be used to identify many more members of the growing family of CNCs in higher plants.

  18. Cytochrome b nucleotide sequence variation among the Atlantic Alcidae.

    Science.gov (United States)

    Friesen, V L; Montevecchi, W A; Davidson, W S

    1993-01-01

    Analysis of cytochrome b nucleotide sequences of the six extant species of Atlantic alcids and a gull revealed an excess of adenines and cytosines and a deficit of guanines at silent sites on the coding strand. Phylogenetic analyses grouped the sequences of the common (Uria aalge) and Brünnich's (U. lomvia) guillemots, followed by the razorbill (Alca torda) and little auk (Alle alle). The black guillemot (Cepphus grylle) sequence formed a sister taxon, and the puffin (Fratercula arctica) fell outside the other alcids. Phylogenetic comparisons of substitutions indicated that mutabilities of bases did not differ, but that C was much more likely to be incorporated than was G. Imbalances in base composition appear to result from a strand bias in replication errors, which may result from selection on secondary RNA structure and/or the energetics of codon-anticodon interactions.

  19. A nucleotide-level coarse-grained model of RNA

    Energy Technology Data Exchange (ETDEWEB)

    Šulc, Petr; Ouldridge, Thomas E.; Louis, Ard A. [Rudolf Peierls Centre for Theoretical Physics, University of Oxford, 1 Keble Road, Oxford OX1 3NP (United Kingdom); Romano, Flavio; Doye, Jonathan P. K. [Physical and Theoretical Chemistry Laboratory, Department of Chemistry, University of Oxford, South Parks Road, Oxford OX1 3QZ (United Kingdom)

    2014-06-21

    We present a new, nucleotide-level model for RNA, oxRNA, based on the coarse-graining methodology recently developed for the oxDNA model of DNA. The model is designed to reproduce structural, mechanical, and thermodynamic properties of RNA, and the coarse-graining level aims to retain the relevant physics for RNA hybridization and the structure of single- and double-stranded RNA. In order to explore its strengths and weaknesses, we test the model in a range of nanotechnological and biological settings. Applications explored include the folding thermodynamics of a pseudoknot, the formation of a kissing loop complex, the structure of a hexagonal RNA nanoring, and the unzipping of a hairpin motif. We argue that the model can be used for efficient simulations of the structure of systems with thousands of base pairs, and for the assembly of systems of up to hundreds of base pairs. The source code implementing the model is released for public use.

  20. A model for the evolution of nucleotide polymerase directionality.

    Directory of Open Access Journals (Sweden)

    Joshua Ballanco

    Full Text Available BACKGROUND: In all known living organisms, every enzyme that synthesizes nucleic acid polymers does so by adding nucleotide 5′-triphosphates to the 3′-hydroxyl group of the growing chain. This results in the well known 5'→3' directionality of all DNA and RNA Polymerases. The lack of any alternative mechanism, e.g. addition in a 3'→5' direction, may indicate a very early founder effect in the evolution of life, or it may be the result of a selective pressure against such an alternative. METHODOLOGY/PRINCIPAL FINDINGS: In an attempt to determine whether the lack of an alternative polymerase directionality is the result of a founder effect or evolutionary selection, we have constructed a basic model of early polymerase evolution. This model is informed by the essential chemical properties of the nucleotide polymerization reaction. With this model, we are able to simulate the growth of organisms with polymerases that synthesize either 5'→3' or 3'→5' in isolation or in competition with each other. CONCLUSIONS/SIGNIFICANCE: We have found that a competition between organisms with 5'→3' polymerases and 3'→5' polymerases only results in a evolutionarily stable strategy under certain conditions. Furthermore, we have found that mutations lead to a much clearer delineation between conditions that lead to a stable coexistence of these populations and conditions which ultimately lead to success for the 5'→3' form. In addition to presenting a plausible explanation for the uniqueness of enzymatic polymerization reactions, we hope these results also provide an example of how whole organism evolution can be understood based on molecular details.

  1. Morphine enhances purine nucleotide catabolism in rive and in vitro

    Institute of Scientific and Technical Information of China (English)

    Chang LIU; Jian-kai LIU; Mu-jie KAN; Lin GAO; Hai-ying FU; Hang ZHOU; Min HONG

    2007-01-01

    Aim: To investigate the effect and mechanism of morphine on purine nucleotide catabolism. Methods: The rat model of morphine dependence and withdrawal and rat C6 glioma cells in culture were used. Concentrations of uric acid in the plasma were measured by the uricase-rap method, adenosine deaminase (ADA) and xan- thine oxidase (XO) in the plasma and tissues were measured by the ADA and XO test kit. RT-PCR and RT-PCR-Southern blotting were used to examine the relative amount of ADA and XO gene transcripts in tissues and C6 cells. Results: (i) the concentration of plasma uric acid in the morphine-administered group was signifi-cantly higher (P<0.05) than the control group; (ii) during morphine administration and withdrawal periods, the ADA and XO concentrations in the plasma increased significantly (P<0.05); (iii) the amount of ADA and XO in the parietal lobe, liver, small intestine, and skeletal muscles of the morphine-administered groups increased, while the level of ADA and XO in those tissues of the withdrawal groups decreased; (iv) the transcripts of the ADA and XO genes in the parietal lobe, liver, small intestine, and skeletal muscles were higher in the morphine-administered group. The expression of the ADA and XO genes in those tissues returned to the control level during morphine withdrawal, with the exception of the skeletal muscles; and (v) the upregulation of the expression of the ADA and XO genes induced by morphine treatment could be reversed by naloxone. Conclusion: The effects of morphine on purine nucleotide metabolism might be an important, new biochemical pharmacological mechanism of morphine action.

  2. ENGINES: exploring single nucleotide variation in entire human genomes

    Directory of Open Access Journals (Sweden)

    Salas Antonio

    2011-04-01

    Full Text Available Abstract Background Next generation ultra-sequencing technologies are starting to produce extensive quantities of data from entire human genome or exome sequences, and therefore new software is needed to present and analyse this vast amount of information. The 1000 Genomes project has recently released raw data for 629 complete genomes representing several human populations through their Phase I interim analysis and, although there are certain public tools available that allow exploration of these genomes, to date there is no tool that permits comprehensive population analysis of the variation catalogued by such data. Description We have developed a genetic variant site explorer able to retrieve data for Single Nucleotide Variation (SNVs, population by population, from entire genomes without compromising future scalability and agility. ENGINES (ENtire Genome INterface for Exploring SNVs uses data from the 1000 Genomes Phase I to demonstrate its capacity to handle large amounts of genetic variation (>7.3 billion genotypes and 28 million SNVs, as well as deriving summary statistics of interest for medical and population genetics applications. The whole dataset is pre-processed and summarized into a data mart accessible through a web interface. The query system allows the combination and comparison of each available population sample, while searching by rs-number list, chromosome region, or genes of interest. Frequency and FST filters are available to further refine queries, while results can be visually compared with other large-scale Single Nucleotide Polymorphism (SNP repositories such as HapMap or Perlegen. Conclusions ENGINES is capable of accessing large-scale variation data repositories in a fast and comprehensive manner. It allows quick browsing of whole genome variation, while providing statistical information for each variant site such as allele frequency, heterozygosity or FST values for genetic differentiation. Access to the data mart

  3. Interferometric Reflectance Imaging Sensor (IRIS—A Platform Technology for Multiplexed Diagnostics and Digital Detection

    Directory of Open Access Journals (Sweden)

    Oguzhan Avci

    2015-07-01

    Full Text Available Over the last decade, the growing need in disease diagnostics has stimulated rapid development of new technologies with unprecedented capabilities. Recent emerging infectious diseases and epidemics have revealed the shortcomings of existing diagnostics tools, and the necessity for further improvements. Optical biosensors can lay the foundations for future generation diagnostics by providing means to detect biomarkers in a highly sensitive, specific, quantitative and multiplexed fashion. Here, we review an optical sensing technology, Interferometric Reflectance Imaging Sensor (IRIS, and the relevant features of this multifunctional platform for quantitative, label-free and dynamic detection. We discuss two distinct modalities for IRIS: (i low-magnification (ensemble biomolecular mass measurements and (ii high-magnification (digital detection of individual nanoparticles along with their applications, including label-free detection of multiplexed protein chips, measurement of single nucleotide polymorphism, quantification of transcription factor DNA binding, and high sensitivity digital sensing and characterization of nanoparticles and viruses.

  4. Diagnostics for the National Compact Stellarator Experiment

    Energy Technology Data Exchange (ETDEWEB)

    B.C. Stratton; D. Johnson; R. Feder; E. Fredrickson; H. Neilson; H. Takahashi; M. Zarnstorf; M. Cole; P. Goranson; E. Lazarus; B. Nelson

    2003-09-16

    The status of planning of the National Compact Stellarator Experiment (NCSX) diagnostics is presented, with the emphasis on resolution of diagnostics access issues and on diagnostics required for the early phases of operation.

  5. Development of a nucleotide sugar purification method using a mixed mode column & mass spectrometry detection.

    Science.gov (United States)

    Eastwood, Heather; Xia, Fang; Lo, Mei-Chu; Zhou, Jing; Jordan, John B; McCarter, John; Barnhart, Wesley W; Gahm, Kyung-Hyun

    2015-11-10

    Analysis of nucleotide sugars, nucleoside di- and triphosphates and sugar-phosphates is an essential step in the process of understanding enzymatic pathways. A facile and rapid separation method was developed to analyze these compounds present in an enzymatic reaction mixture utilized to produce nucleotide sugars. The Primesep SB column explored in this study utilizes hydrophobic interactions as well as electrostatic interactions with the phosphoric portion of the nucleotide sugars. Ammonium formate buffer was selected due to its compatibility with mass spectrometry. Negative ion mode mass spectrometry was adopted for detection of the sugar phosphate (fucose-1-phophate), as the compound is not amenable to UV detection. Various mobile phase conditions such as pH, buffer concentration and organic modifier were explored. The semi-preparative separation method was developed to prepare 30mg of the nucleotide sugar. (19)F NMR was utilized to determine purity of the purified fluorinated nucleotide sugar. The collected nucleotide sugar was found to be 99% pure.

  6. Diagnostic Process of Company Productivity

    Directory of Open Access Journals (Sweden)

    Emese Tokarˇcíková

    2009-12-01

    Full Text Available This paper deals with an actual topic of how key factors of enterprise diagnostics can help to increase company productivity. Recognition and use of relevant internal and external information in this field determines the success of the enterprise. Application of the general diagnostic model of company productivity to the net income has been a frequent problem of company practice. This problem is of profit showing, which is an inevitable precondition for long-term company development and growth. Diagnostic access of company productivity allows recognition of specific problems in greater detail, which results from the activity of each company. This article also presents an introduction to the researched area of enterprise diagnostics, which opens opportunities for other publishing activities and can lead to information exchange.

  7. FEL-accelerator related diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Kevin Jordan; David Douglas; Stephen V. Benson; Pavel Evtuschenko

    2007-08-02

    Free Electron Lasers (FEL) present a unique set of beam parameters to the diagnostics suite. The FEL requires characterization of the full six dimensional phase space of the electron beam at the wiggler and accurate alignment of the electron beam to the optical mode of the laser. In addition to the FEL requirements on the diagnostics suite, the Jefferson Lab FEL is operated as an Energy Recovered Linac (ERL) which imposes additional requirements on the diagnostics. The ERL aspect of the Jefferson Lab FEL requires that diagnostics operate over a unique dynamic range and operate with simultaneous transport of the accelerated and energy recovered beams. This talk will present how these challenges are addressed at the Jefferson Lab FEL.

  8. Diagnostics and Instrumentation for FEL

    CERN Document Server

    Couprie, M E

    2001-01-01

    Free Electron Laser are coherent sources of radiation based on the interaction of a relativistic electron beam in an undulator field. According to the energy of the accelerator, they presently cover a wide spectral range, from the infra-red to the VUV. FELs combine the diagnostics of typical laser systems (for the measurement of spectral and temporal characteristics, the transverse mode pattern, the polarisation) and the diagnostics of relativistic electron beams. The electron beam is characterised in order to evaluate and control the FEL performances, but also in order to measure the effect of the FEL on the electron beam. The FEL characteristics are monitored with various types of detectors, depending mainly on the spectral range. Diagnostics for Linac based Infra Red FELs and storage ring FELs in the UV-VUV will be described. Particular instrumentation, required for FEL operation, such as the optical resonator, possible diagnostics inside the undulator will also be analysed.

  9. Saliva Preservative for Diagnostic Purposes

    Science.gov (United States)

    Pierson, Duane L.; Mehta, Satish K.

    2012-01-01

    Saliva is an important body fluid for diagnostic purposes. Glycoproteins, glucose, steroids, DNA, and other molecules of diagnostic value are found in saliva. It is easier to collect as compared to blood or urine. Unfortunately, saliva also contains large numbers of bacteria that can release enzymes, which can degrade proteins and nucleic acids. These degradative enzymes destroy or reduce saliva s diagnostic value. This innovation describes the formulation of a chemical preservative that prevents microbial growth and inactivates the degradative enzymes. This extends the time that saliva can be stored or transported without losing its diagnostic value. Multiple samples of saliva can be collected if needed without causing discomfort to the subject and it does not require any special facilities to handle after it is collected.

  10. High-speed droplet-allele-specific polymerase chain reaction for genotyping of single nucleotide polymorphisms.

    Science.gov (United States)

    Matsuda, Kazuyuki; Honda, Takayuki

    2015-01-01

    Single nucleotide alternations such as single nucleotide polymorphisms (SNPs) or single nucleotide mutations are useful genetic markers for molecular diagnosis, prognosis, drug response, and predisposition to diseases. Rapid identification of SNPs or mutations is clinically important, especially for determining drug responses and selection of molecular-targeted therapy. Here, we describe a rapid genotyping assay based on the allele-specific polymerase chain reaction (AS-PCR) by using our droplet-PCR machine (droplet-AS-PCR).

  11. The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

    Science.gov (United States)

    Štambuk, Nikola

    The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

  12. Molecular diagnostics of myeloproliferative neoplasms

    DEFF Research Database (Denmark)

    Langabeer, S. E.; Andrikovics, H.; Asp, J.;

    2015-01-01

    identified. These discoveries have been rapidly incorporated into evolving molecular diagnostic algorithms. Whilst many of these mutations appear to have prognostic implications, establishing MPN diagnosis is of immediate clinical importance with selection, implementation and the continual evaluation...... of the appropriate laboratory methodology to achieve this diagnosis similarly vital. The advantages and limitations of these approaches in identifying and quantitating the common MPN-associated mutations are considered herein with particular regard to their clinical utility. The evolution of molecular diagnostic...

  13. Diagnostic indices for vertiginous diseases

    Directory of Open Access Journals (Sweden)

    Warninghoff Jan-Christian

    2010-10-01

    Full Text Available Abstract Background Vertigo and dizziness are symptoms which are reported frequently in clinical practice. We aimed to develop diagnostic indices for four prevalent vertiginous diseases: benign paroxysmal positional vertigo (BPPV, Menière's disease (MD, vestibular migraine (VM, and phobic postural vertigo (PPV. Methods Based on a detailed questionnaire handed out to consecutive patients presenting for the first time in our dizziness clinic we preselected a set of seven questions with desirable diagnostic properties when compared with the final diagnosis after medical workup. Using exact logistic regression analysis diagnostic scores, each comprising of four to six items that can simply be added up, were built for each of the four diagnoses. Results Of 193 patients 131 questionnaires were left after excluding those with missing consent or data. Applying the suggested cut-off points, sensitivity and specificity were 87.5 and 93.5% for BPPV, 100 and 87.4% for MD, 92.3 and 83.7% for VM, 73.7 and 84.1% for PPV, respectively. By changing the cut-off points sensitivity and specificity can be adjusted to meet diagnostic needs. Conclusions The diagnostic indices showed promising diagnostic properties. Once further validated, they could provide an ease to use and yet flexible tool for screening vertigo in clinical practice and epidemiological research.

  14. Cyclic nucleotides and radioresistance. Report 2. Effect of cyclic nucleotides on mammalian radioresistance and tissular oxygen tension. [X rays; mice

    Energy Technology Data Exchange (ETDEWEB)

    Kulinskii, V.I.

    1978-01-01

    In experiments on mice, 3',5'-AMP, N/sup 6/,O/sup 2/-dibutyryl-3',5'-AMP (DB), 2',3'-AMP, theophylline, papaverine, imidazole, and nicotinate presented neither a sensitizing or radioprotective (RPE) effect. However, preadministration of ..beta..-adrenolytic agents revealed a moderate RPE in DB. Probably, along with the RPE, there is an antiprotective component in the action of cyclic nucleotides (CN), which is expressed via ..beta..-receptors. The absence of RPE in 3',5'-AMP, 2',3'-AMP, DB, theophylline, and phentolamine is combined with decline of tissular pO/sub 2/. The significance of this phenomenon is discussed.

  15. Molecular dynamics studies on the interaction and encapsulation processes of the nucleotide and peptide chains inside of a carbon nanotube matrix with inclusion of gold nanoparticles

    Science.gov (United States)

    Kholmurodov, Kholmirzo; Dushanov, Eric; Khusenov, Mirzoaziz; Rahmonov, Khaiyom; Zelenyak, Tatyana; Doroshkevich, Alexander; Majumder, Subrata

    2017-05-01

    Studying of molecular systems as single nucleotides, nucleotide and peptide chains, RNA and DNA interacting with metallic nanoparticles within a carbon nanotube matrix represents a great interest in modern research. In this respect it is worth mentioning the development of the electronics diagnostic apparatus, the biochemical and biotechnological application tools (nanorobotic design, facilities of drug delivery in a living cell), so on. In the present work using molecular dynamics (MD) simulation method the interaction process of small nucleotide chains (NCs) and elongated peptide chains with different sets of metallic nanoparticles (NPs) on a matrix from carbon nanotube (CNT) were simulated to study their mechanisms of encapsulation and folding processes. We have performed a series of the MD calculations with different NC,peptides-NP-CNT models that were aimed on the investigation of the peculiarities of NC,peptide-NP interactions, the formation of bonds and structures in the system, as well as the dynamical behavior in an environment confined by the CNT matrix.

  16. 77 FR 65537 - Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence...

    Science.gov (United States)

    2012-10-29

    ... Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request. SUMMARY: The United States....'' SUPPLEMENTARY INFORMATION: I. Abstract Patent applications that contain nucleotide and/or amino acid...

  17. Kinetic properties of a single nucleotide binding site on chloroplast coupling factor 1 (CF1).

    Science.gov (United States)

    Günther, S; Huchzermeyer, B

    1998-12-01

    The kinetics of nucleotide binding to spinach chloroplast coupling factor CF1 in a fully inhibited state were investigated by stopped-flow experiments using the fluorescent trinitrophenyl analogue (NO2)3Ph-ADP. The CF1 was in a state in which two of the three binding sites on the beta subunits were irreversibly blocked with ADP, Mg2+ and fluoroaluminate, while the three binding sites on the alpha subunits were occupied by nucleotides [Garin, J., Vincon, M., Gagnon, J. & Vignais, P. V. (1994) Biochemistry 33, 3772-3777)]. Thus, it was possible to characterise a single nucleotide-binding site without superimposed nucleotide exchange or binding to an additional site. (NO2)3Ph-ADP binding to the remaining site on the third beta subunit was characterised by a high dissociation rate of 15 s(-1), leading to a very low affinity (dissociation constant higher than 150 microM). Subsequent to isolation, CF1 preparations contained two endogenously bound nucleotides. Pre-loading with ATP yielded CF1 with five tightly bound nucleotides and one free nucleotide-binding site on a beta subunit. Pre-loading with ADP, however, resulted in a CF1 preparation containing four tightly bound nucleotides and two free nucleotide binding sites. One of the two free binding sites was located on a beta subunit, while the other was probably located on an alpha subunit.

  18. Stochastic Engine Convergence Diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Glaser, R

    2001-12-11

    ;'burn-in'' period. The MCMC process begins at a particular state, which is selected at random or by design, according to the wish of the user of the engine. After the burn-in period, the chain has essentially forgotten where it started. Moreover, the sample x{sup (t{sub 0})}, x{sup (T{sub 0}+1)},... can be used for most purposes as a random sample from f, even though the x{sup (T{sub 0}+t)}, because of Markovian dependency, are not independent. For example, averages involving x{sup (t{sub 0})}, x{sup (t{sub 0}+1)},... may have an approximate normal distribution. The purpose of this note is to discuss the monitoring techniques currently in place in the stochastic engine software that addresses the issues of burn-in, stationarity, and normality. They are loosely termed ''convergence diagnostics'', in reference to the underlying Markov chains, which converge asymptotically to the desired posterior distribution.

  19. Genomics and introgression: discovery and mapping of thousands of species-diagnostic SNPs using RAD sequencing

    Science.gov (United States)

    Hand, Brian K; Hether, Tyler D; Kovach, Ryan P.; Muhlfeld, Clint C.; Amish, Stephen J.; Boyer, Matthew C.; O’Rourke, Sean M.; Miller, Michael R.; Lowe, Winsor H.; Hohenlohe, Paul A.; Luikart, Gordon

    2015-01-01

    Invasive hybridization and introgression pose a serious threat to the persistence of many native species. Understanding the effects of hybridization on native populations (e.g., fitness consequences) requires numerous species-diagnostic loci distributed genome-wide. Here we used RAD sequencing to discover thousands of single-nucleotide polymorphisms (SNPs) that are diagnostic between rainbow trout (RBT, Oncorhynchus mykiss), the world’s most widely introduced fish, and native westslope cutthroat trout (WCT, O. clarkii lewisi) in the northern Rocky Mountains, USA. We advanced previous work that identified 4,914 species-diagnostic loci by using longer sequence reads (100 bp vs. 60 bp) and a larger set of individuals (n = 84). We sequenced RAD libraries for individuals from diverse sampling sources, including native populations of WCT and hatchery broodstocks of WCT and RBT. We also took advantage of a newly released reference genome assembly for RBT to align our RAD loci. In total, we discovered 16,788 putatively diagnostic SNPs, 10,267 of which we mapped to anchored chromosome locations on the RBT genome. A small portion of previously discovered putative diagnostic loci (325 of 4,914) were no longer diagnostic (i.e., fixed between species) based on our wider survey of non-hybridized RBT and WCT individuals. Our study suggests that RAD loci mapped to a draft genome assembly could provide the marker density required to identify genes and chromosomal regions influencing selection in admixed populations of conservation concern and evolutionary interest.

  20. Identification of novel single nucleotide polymorphisms associated with acute respiratory distress syndrome by exome-seq.

    Directory of Open Access Journals (Sweden)

    Katherine Shortt

    Full Text Available Acute respiratory distress syndrome (ARDS is a lung condition characterized by impaired gas exchange with systemic release of inflammatory mediators, causing pulmonary inflammation, vascular leak and hypoxemia. Existing biomarkers have limited effectiveness as diagnostic and therapeutic targets. To identify disease-associating variants in ARDS patients, whole-exome sequencing was performed on 96 ARDS patients, detecting 1,382,399 SNPs. By comparing these exome data to those of the 1000 Genomes Project, we identified a number of single nucleotide polymorphisms (SNP which are potentially associated with ARDS. 50,190SNPs were found in all case subgroups and controls, of which89 SNPs were associated with susceptibility. We validated three SNPs (rs78142040, rs9605146 and rs3848719 in additional ARDS patients to substantiate their associations with susceptibility, severity and outcome of ARDS. rs78142040 (C>T occurs within a histone mark (intron 6 of the Arylsulfatase D gene. rs9605146 (G>A causes a deleterious coding change (proline to leucine in the XK, Kell blood group complex subunit-related family, member 3 gene. rs3848719 (G>A is a synonymous SNP in the Zinc-Finger/Leucine-Zipper Co-Transducer NIF1 gene. rs78142040, rs9605146, and rs3848719 are associated significantly with susceptibility to ARDS. rs3848719 is associated with APACHE II score quartile. rs78142040 is associated with 60-day mortality in the overall ARDS patient population. Exome-seq is a powerful tool to identify potential new biomarkers for ARDS. We selectively validated three SNPs which have not been previously associated with ARDS and represent potential new genetic biomarkers for ARDS. Additional validation in larger patient populations and further exploration of underlying molecular mechanisms are warranted.

  1. Assignment of Streptococcus agalactiae isolates to clonal complexes using a small set of single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Gilbert Gwendolyn L

    2008-08-01

    Full Text Available Abstract Background Streptococcus agalactiae (Group B Streptococcus (GBS is an important human pathogen, particularly of newborns. Emerging evidence for a relationship between genotype and virulence has accentuated the need for efficient and well-defined typing methods. The objective of this study was to develop a single nucleotide polymorphism (SNP based method for assigning GBS isolates to multilocus sequence typing (MLST-defined clonal complexes. Results It was found that a SNP set derived from the MLST database on the basis of maximisation of Simpsons Index of Diversity provided poor resolution and did not define groups concordant with the population structure as defined by eBURST analysis of the MLST database. This was interpreted as being a consequence of low diversity and high frequency horizontal gene transfer. Accordingly, a different approach to SNP identification was developed. This entailed use of the "Not-N" bioinformatic algorithm that identifies SNPs diagnostic for groups of known sequence variants, together with an empirical process of SNP testing. This yielded a four member SNP set that divides GBS into 10 groups that are concordant with the population structure. A fifth SNP was identified that increased the sensitivity for the clinically significant clonal complex 17 to 100%. Kinetic PCR methods for the interrogation of these SNPs were developed, and used to genotype 116 well characterized isolates. Conclusion A five SNP method for dividing GBS into biologically valid groups has been developed. These SNPs are ideal for high throughput surveillance activities, and combining with more rapidly evolving loci when additional resolution is required.

  2. Adsorption of nucleotides on biomimetic apatite: The case of adenosine 5⿲ triphosphate (ATP)

    Science.gov (United States)

    Hammami, Khaled; El-Feki, Hafed; Marsan, Olivier; Drouet, Christophe

    2016-01-01

    ATP is a well-known energy supplier in cells. The idea to associate ATP to pharmaceutical formulations/biotechnological devices to promote cells activity by potentially modulating their microenvironment thus appears as an appealing novel approach. Since biomimetic nanocrystalline apatites have shown great promise for biomedical applications (bone regeneration, cells diagnostics/therapeutics, ⿦), thanks to a high surface reactivity and an intrinsically high biocompatibility, the present contribution was aimed at exploring ATP/apatite interactions. ATP adsorption on a synthetic carbonated nanocrystalline apatite preliminarily characterized (by XRD, FTIR, Raman, TG-DTA and SEM-EDX) was investigated in detail, pointing out a good agreement with Sips isothermal features. Adsorption characteristics were compared to those previously obtained on monophosphate nucleotides (AMP, CMP), unveiling some specificities. ATP was found to adsorb effectively onto biomimetic apatite: despite smaller values of the affinity constant KS and the exponential factor m, larger adsorbed amounts were reached for ATP as compared to AMP for any given concentration in solution. m guided by direct surface bonding rather than through stabilizing intermolecular interactions. Although standard οGads ° was estimated to only ⿿4 kJ/mol, the large value of Nmax led to significantly negative effective οGads values down to ⿿33 kJ/mol, reflecting the spontaneous character of adsorption process. Vibrational spectroscopy data (FTIR and Raman) pointed out spectral modifications upon adsorption, confirming chemical-like interactions where both the triphosphate group of ATP and its nucleic base were involved. The present study is intended to serve as a basis for future research works involving ATP and apatite nanocrystals/nanoparticles in view of biomedical applications (e.g. bone tissue engineering, intracellular drug delivery, ⿦).

  3. Oriented Immobilization of Fab Fragments by Site-Specific Biotinylation at the Conserved Nucleotide Binding Site for Enhanced Antigen Detection.

    Science.gov (United States)

    Mustafaoglu, Nur; Alves, Nathan J; Bilgicer, Basar

    2015-09-01

    Oriented immobilization of antibodies and antibody fragments has become increasingly important as a result of the efforts to reduce the size of diagnostic and sensor devices to miniaturized dimensions for improved accessibility to the end-user. Reduced dimensions of sensor devices necessitate the immobilized antibodies to conserve their antigen binding activity for proper operation. Fab fragments are becoming more commonly used in small-scaled diagnostic devices due to their small size and ease of manufacture. In this study, we used the previously described UV-NBS(Biotin) method to functionalize Fab fragments with IBA-EG11-Biotin linker utilizing UV energy to initiate a photo-cross-linking reaction between the nucleotide binding site (NBS) on the Fab fragment and IBA-Biotin molecule. Our results demonstrate that immobilization of biotinylated Fab fragments via UV-NBS(Biotin) method generated the highest level of immobilized Fab on surfaces when compared to other typical immobilization methods while preserving antigen binding activity. UV-NBS(Biotin) method provided 432-fold, 114-fold, and 29-fold improved antigen detection sensitivity than physical adsorption, NHS-Biotin, and ε-NH3(+), methods, respectively. Additionally, the limit of detection (LOD) for PSA utilizing Fab fragments immobilized via UV-NBS(Biotin) method was significantly lower than that of the other immobilization methods, with an LOD of 0.4 pM PSA. In summary, site-specific biotinylation of Fab fragments without structural damage or loss in antigen binding activity provides a wide range of application potential for UV-NBS immobilization technique across numerous diagnostic devices and nanotechnologies.

  4. Far infrared fusion plasma diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Luhmann, N.C. Jr.; Peebles, W.A.

    1990-01-01

    Over the last several years, reflectometry has grown in importance as a diagnostic for both steady-state density Profiles as well as for the investigation of density fluctuations and turbulence. As a diagnostic for density profile measurement, it is generally believed to be well understood in the tokamak environment. However, its use as a fluctuation diagnostic is hampered by a lack of quantitative experimental understanding of its wavenumber sensitivity and spatial resolution. Several researchers, have theoretically investigated these questions. However, prior to the UCLA laboratory investigation, no group has experimentally investigated these questions. Because of the reflectometer's importance to the world effort in understanding plasma turbulence and transport, UCLA has, over the last year, made its primary Task IIIA effort the resolution of these questions. UCLA has taken the lead in a quantitative experimental understanding of reflectometer data as applied to the measurement of density fluctuations. In addition to this, work has proceeded on the design, construction, and installation of a reflectometer system on UCLA's CCT tokamak. This effort will allow a comparison between the improved confinement regimes (H-mode) observed on both the DIII-D and CCT machines with the goal of achieving a physics understanding of the phenomena. Preliminary investigation of a new diagnostic technique to measure density profiles as a function of time has been initiated at UCLA. The technique promises to be a valuable addition to the range of available plasma diagnostics. Work on advanced holographic reflectometry technique as applied to fluctuation diagnostics has awaited a better understanding of the reflectometer signal itself as discussed above. Efforts to ensure the transfer of the diagnostic developments have continued with particular attention devoted to the preliminary design of a multichannel FIR interferometer for MST.

  5. Microarray Technologies in Fungal Diagnostics.

    Science.gov (United States)

    Rupp, Steffen

    2017-01-01

    Microarray technologies have been a major research tool in the last decades. In addition they have been introduced into several fields of diagnostics including diagnostics of infectious diseases. Microarrays are highly parallelized assay systems that initially were developed for multiparametric nucleic acid detection. From there on they rapidly developed towards a tool for the detection of all kind of biological compounds (DNA, RNA, proteins, cells, nucleic acids, carbohydrates, etc.) or their modifications (methylation, phosphorylation, etc.). The combination of closed-tube systems and lab on chip devices with microarrays further enabled a higher automation degree with a reduced contamination risk. Microarray-based diagnostic applications currently complement and may in the future replace classical methods in clinical microbiology like blood cultures, resistance determination, microscopic and metabolic analyses as well as biochemical or immunohistochemical assays. In addition, novel diagnostic markers appear, like noncoding RNAs and miRNAs providing additional room for novel nucleic acid based biomarkers. Here I focus an microarray technologies in diagnostics and as research tools, based on nucleic acid-based arrays.

  6. Diagnostic vitrectomy for infectious uveitis

    Science.gov (United States)

    Jeroudi, Abdallah; Yeh, Steven

    2014-01-01

    The identification of an infectious or noninfectious uveitis syndrome is important to determine the range of therapeutic and prognostic implications of that disease entity. Diagnostic dilemmas arise with atypical history, atypical clinical presentations, inconclusive diagnostic workup, and persistent or worsened inflammation despite appropriate immunosuppression. More invasive intraocular testing is indicated in these situations particularly in infectious uveitis where a delay in treatment may result in worsening of the patient’s disease and a poor visual outcome. Laboratory analysis of vitreous fluid via diagnostic pars plana vitrectomy is an important technique in the diagnostic armamentarium, but the most important aspects of sample collection include rapid processing, close coordination with an ophthalmic pathology laboratory, and directed testing on this limited collected sample. Culture and staining has utility in bacterial, fungal, and nocardial infection. Polymerase chain reaction (PCR) analysis has shown promising results for bacterial endophthalmitis and infection with mycobacterium tuberculosis whereas PCR testing for viral retinitides and ocular toxoplasmosis has a more established role. Antibody testing is appropriate for toxoplasmosis and toxocariasis, and may be complementary to PCR for viral retinitis. Masquerade syndromes represent neoplastic conditions that clinically appear as infectious or inflammatory conditions and should be considered as part of the differential diagnosis. Diagnostic vitrectomy and chorioretinal biopsy are thus critical tools for the management of patients in whom an infectious etiology of uveitis is suspected. PMID:24613892

  7. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.

    Directory of Open Access Journals (Sweden)

    B Josh Lane

    2008-03-01

    Full Text Available Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein. TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs, Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K, appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  8. Mitochondria as determinant of nucleotide pools and chromosomal stability

    Energy Technology Data Exchange (ETDEWEB)

    Desler, Claus; Munch-Petersen, Birgitte [Department of Science, Systems and Models, Roskilde University, 4000 Roskilde (Denmark); Stevnsner, Tinna [Department of Molecular Biology, University of Aarhus, 8000 Aarhus (Denmark); Matsui, Sei-Ichi; Kulawiec, Mariola; Singh, Keshav K. [Department og Cancer Genetics, Roswell Park Cancer Institute, Buffalo, NY 14263 (United States); Rasmussen, Lene Juel [Department of Science, Systems and Models, Roskilde University, 4000 Roskilde (Denmark)], E-mail: ljr@ruc.dk

    2007-12-01

    Mitochondrial function plays an important role in multiple human diseases and mutations in the mitochondrial genome have been detected in nearly every type of cancer investigated to date. However, the mechanism underlying the interrelation is unknown. We used human cell lines depleted of mitochondrial DNA as models and analyzed the outcome of mitochondrial dysfunction on major cellular repair activities. We show that the deoxyribonucleoside triphosphate (dNTP) pools are affected, most prominently we detect a 3-fold reduction of the dTTP pool when normalized to the number of cells in S-phase. It is known that imbalanced dNTP pools are mutagenic and in accordance, we show that mitochondrial dysfunction results in chromosomal instability, which can explain its role in tumor development. We did not find any straightforward correlation between ATP levels and dNTP pools in cells with defective mitochondrial activity. Our results suggest that mitochondria are central players in maintaining genomic stability and in controlling essential nuclear processes such as upholding a balanced supply of nucleotides.

  9. Base Sequence Context Effects on Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Yuqin Cai

    2010-01-01

    Full Text Available Nucleotide excision repair (NER plays a critical role in maintaining the integrity of the genome when damaged by bulky DNA lesions, since inefficient repair can cause mutations and human diseases notably cancer. The structural properties of DNA lesions that determine their relative susceptibilities to NER are therefore of great interest. As a model system, we have investigated the major mutagenic lesion derived from the environmental carcinogen benzo[a]pyrene (B[a]P, 10S (+-trans-anti-B[a]P-2-dG in six different sequence contexts that differ in how the lesion is positioned in relation to nearby guanine amino groups. We have obtained molecular structural data by NMR and MD simulations, bending properties from gel electrophoresis studies, and NER data obtained from human HeLa cell extracts for our six investigated sequence contexts. This model system suggests that disturbed Watson-Crick base pairing is a better recognition signal than a flexible bend, and that these can act in concert to provide an enhanced signal. Steric hinderance between the minor groove-aligned lesion and nearby guanine amino groups determines the exact nature of the disturbances. Both nearest neighbor and more distant neighbor sequence contexts have an impact. Regardless of the exact distortions, we hypothesize that they provide a local thermodynamic destabilization signal for repair.

  10. Regulation of nucleotide excision repair by nuclear lamin b1.

    Directory of Open Access Journals (Sweden)

    Veronika Butin-Israeli

    Full Text Available The nuclear lamins play important roles in the structural organization and function of the metazoan cell nucleus. Recent studies on B-type lamins identified a requirement for lamin B1 (LB1 in the regulation of cell proliferation in normal diploid cells. In order to further investigate the function of LB1 in proliferation, we disrupted its normal expression in U-2 OS human osteosarcoma and other tumor cell lines. Silencing LB1 expression induced G1 cell cycle arrest without significant apoptosis. The arrested cells are unable to mount a timely and effective response to DNA damage induced by UV irradiation. Several proteins involved in the detection and repair of UV damage by the nucleotide excision repair (NER pathway are down-regulated in LB1 silenced cells including DDB1, CSB and PCNA. We propose that LB1 regulates the DNA damage response to UV irradiation by modulating the expression of specific genes and activating persistent DNA damage signaling. Our findings are relevant to understanding the relationship between the loss of LB1 expression, DNA damage signaling, and replicative senescence.

  11. Single nucleotide polymorphism markers for genetic mapping in Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

    2001-04-16

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that have recently revolutionized human, mouse and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila using an STS-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that the genome. The majority of these markers are single nucleotide polymorphisms (SNPs) and sequences for these variants are provided in an accessible format. The average density of the new markers is 1 marker per 225 kb on the autosomes and 1 marker per 1 Mb on the X chromosome. We include in this survey a set of P-element strains that provide additional utility for high-resolution mapping. We demonstrate one application of the new markers in a simple set of crosses to map a mutation in the hedgehog gene to an interval of <1 Mb. This new map resource significantly increases the efficiency and resolution of recombination mapping and will be of immediate value to the Drosophila research community.

  12. An overview on single nucleotide polymorphism studies in mastitis research

    Directory of Open Access Journals (Sweden)

    V. N. Muhasin Asaf

    2014-06-01

    Full Text Available Mastitis is an inflammatory condition of the mammary gland caused by microorganisms as diverse as bacteria, viruses, mycoplasma, yeasts and algae. Mastitis is an economically devastating disease mainly affecting the crossbred cattle in India. Control strategies against mastitis includes antibiotic therapy, vaccination, improvements in dairy cattle husbandry, farm and feeding management etc. but has met with little success.. Mastitis tolerance/susceptibility is difficult to measure directly and hence milk somatic cell count (SCC or milk somatic cell score (SCS is used as an indicator trait for mastitis as both traits are highly positively correlated. Single nucleotide polymorphism (SNP marker is a single base change in a DNA sequence at a given position. SNP markers are the most preferred genetic markers nowadays. Currently most researches worldwide have been targeting molecular high density SNP markers that are linked to mastitis tolerance in an attempt to incorporate to understand the genetics of host resistance to mastitis and this knowledge will be helpful in formulating breeding programmes in an attempt to control mastitis. This article reviews various SNPs which are reported to be significantly associated with mastitis tolerance/susceptibility.

  13. [Thermostable extracellular cyclic nucleotide phosphodiesterase from Physarum polycephalum plasmodium].

    Science.gov (United States)

    Nezvetskiĭ, A R; Orlova, T G; Beĭlina, S I; Orlov, N Ia

    2006-01-01

    The cyclic nucleotide phosphodiesterase secreted by Physarum polycephalum plasmodium into extracellular medium has been partially purified by DEAE cellulose chromatography, ultrafiltration, and HPLC. The results obtained by gel filtration, HPLC, electrophoresis, and isoelectric focusing suggest that, the native enzyme in solution is a monomer with a molecular mass of about 90 kDa and pI in the range 3.6 - 4.0. The Km values were estimated to be about 0.9 mM and 7.7 mM, respectively, and Vm for both substrates were similar (up to several thousand micromoles of cAMP hydrolyzed/hour per mg of enzyme). The partially purified enzyme was shown to be extremely stable. It did not lose the activity after heat treatment at 100 degrees C during 30 min. The enzyme was active in the presence of 1% SDS, but it was fully inactivated under the same conditions in the presence of beta-mercaptoethanol. The properties of the phosphodiesterase from Physarum polycephalum are discussed.

  14. Unique nucleotide polymorphism of ankyrin gene cluster in Arabidopsis

    Indian Academy of Sciences (India)

    Jianchang Du; Xingna Wang; Mingsheng Zhang; Dacheng Tian; Yong-Hua Yang

    2007-01-01

    The ankyrin (ANK) gene cluster is a part of a multigene family encoding ANK transmembrane proteins in Arabidopsis thaliana, and plays an important role in protein–protein interactions and in signal pathways. In contrast to other regions of a genome, the ANK gene cluster exhibits an extremely high level of DNA polymorphism in an ∼5-kb region, without apparent decay. Phylogenetic analysis detects two clear, deeply differentiated haplotypes (dimorphism). The divergence between haplotypes of accession Col-0 and Ler-0 (Hap-C and Hap-L) is estimated to be 10.7%, approximately equal to the 10.5% average divergence between A. thaliana and A. lyrata. Sequence comparisons for the ANK gene cluster homologues in Col-0 indicate that the members evolve independently, and that the similarity among paralogues is lower than between alleles. Very little intralocus recombination or gene conversion is detected in ANK regions. All these characteristics of the ANK gene cluster are consistent with a tandem gene duplication and birth-and-death process. The possible mechanisms for and implications of this elevated nucleotide variation are also discussed, including the suggestion of balancing selection.

  15. Implication of Posttranslational Histone Modifications in Nucleotide Excision Repair

    Directory of Open Access Journals (Sweden)

    Shisheng Li

    2012-09-01

    Full Text Available Histones are highly alkaline proteins that package and order the DNA into chromatin in eukaryotic cells. Nucleotide excision repair (NER is a conserved multistep reaction that removes a wide range of generally bulky and/or helix-distorting DNA lesions. Although the core biochemical mechanism of NER is relatively well known, how cells detect and repair lesions in diverse chromatin environments is still under intensive research. As with all DNA-related processes, the NER machinery must deal with the presence of organized chromatin and the physical obstacles it presents. A huge catalogue of posttranslational histone modifications has been documented. Although a comprehensive understanding of most of these modifications is still lacking, they are believed to be important regulatory elements for many biological processes, including DNA replication and repair, transcription and cell cycle control. Some of these modifications, including acetylation, methylation, phosphorylation and ubiquitination on the four core histones (H2A, H2B, H3 and H4 or the histone H2A variant H2AX, have been found to be implicated in different stages of the NER process. This review will summarize our recent understanding in this area.

  16. ADH single nucleotide polymorphism associations with alcohol metabolism in vivo

    Science.gov (United States)

    Birley, Andrew J.; James, Michael R.; Dickson, Peter A.; Montgomery, Grant W.; Heath, Andrew C.; Martin, Nicholas G.; Whitfield, John B.

    2009-01-01

    We have previously found that variation in alcohol metabolism in Europeans is linked to the chromosome 4q region containing the ADH gene family. We have now typed 103 single nucleotide polymorphisms (SNPs) across this region to test for allelic associations with variation in blood and breath alcohol concentrations after an alcohol challenge. In vivo alcohol metabolism was modelled with three parameters that identified the absorption and rise of alcohol concentration following ingestion, and the rate of elimination. Alleles of ADH7 SNPs were associated with the early stages of alcohol metabolism, with additional effects in the ADH1A, ADH1B and ADH4 regions. Rate of elimination was associated with SNPs in the intragenic region between ADH7 and ADH1C, and across ADH1C and ADH1B. SNPs affecting alcohol metabolism did not correspond to those reported to affect alcohol dependence or alcohol-related disease. The combined SNP associations with early- and late-stage metabolism only account for approximately 20% of the total genetic variance linked to the ADH region, and most of the variance for in vivo alcohol metabolism linked to this region is yet to be explained. PMID:19193628

  17. Species radiation by DNA replication that systematically exchanges nucleotides?

    Science.gov (United States)

    Seligmann, Hervé

    2014-12-21

    RNA and DNA syntheses share many properties. Therefore, the existence of 'swinger' RNAs, presumed 'orphan' transcripts matching genomic sequences only if transcription systematically exchanged nucleotides, suggests replication producing swinger DNA. Transcripts occur in many short-lived copies, the few cellular DNA molecules are long-lived. Hence pressures for functional swinger DNAs are greater than for swinger RNAs. Protein coding properties of swinger sequences differ from original sequences, suggesting rarity of corresponding swinger DNA. For genes producing structural RNAs, such as tRNAs and rRNAs, three exchanges (AT, CG and AT+CG) conserve self-hybridization properties. All nuclear eukaryote swinger DNA sequences detected in GenBank are for rRNA genes assuming AT+CG exchanges. In brachyuran crabs, 25 species had AT+CG swinger 18S rDNA, all matching the reverse-exchanged version of regular 18S rDNA of a related species. In this taxon, swinger replication of 18S rDNA apparently associated with, or even resulted in species radiation. AT+CG transformation doesn't invert sequence direction, differing from inverted repeats. Swinger repeats (detectable only assuming swinger transformations, AT+CG swinger repeats most frequent) within regular human rRNAs, independently confirm swinger polymerizations for most swinger types. Swinger replication might be an unsuspected molecular mechanism for ultrafast speciation.

  18. Single nucleotide polymorphisms of myostatin gene in Chinese domestic horses.

    Science.gov (United States)

    Li, Ran; Liu, Dong-Hua; Cao, Chun-Na; Wang, Shao-Qiang; Dang, Rui-Hua; Lan, Xian-Yong; Chen, Hong; Zhang, Tao; Liu, Wu-Jun; Lei, Chu-Zhao

    2014-03-15

    The myostatin gene (MSTN) is a genetic determinant of skeletal muscle growth. Single nucleotide polymorphisms (SNP) in MSTN are of importance due to their strong associations with horse racing performances. In this study, we screened the SNPs in MSTN gene in 514 horses from 15 Chinese horse breeds. Six SNPs (g.26T>C, g.156T>C, g.587A>G, g.598C>T, g.1485C>T, g.2115A>G) in MSTN gene were detected by sequencing and genotyped using PCR-RFLP method. The g.587A>G and g.598C>T residing in the 5'UTR region were novel SNPs identified by this study. The g.2115A>G which have previously been associated with racing performances were present in Chinese horse breeds, providing valuable genetic information for evaluating the potential racing performances in Chinese domestic breeds. The six SNPs together defined thirteen haplotypes, demonstrating abundant haplotype diversities in Chinese horses. Most of the haplotypes were shared among different breeds with no haplotype restricted to a specific region or a single horse breed. AMOVA analysis indicated that most of the genetic variance was attributable to differences among individuals without any significant contribution by the four geographical groups. This study will provide fundamental and instrumental genetic information for evaluating the potential racing performances of Chinese horse breeds. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Bulk segregant analysis using single nucleotide polymorphism microarrays.

    Directory of Open Access Journals (Sweden)

    Anthony Becker

    Full Text Available Bulk segregant analysis (BSA using microarrays, and extreme array mapping (XAM have recently been used to rapidly identify genomic regions associated with phenotypes in multiple species. These experiments, however, require the identification of single feature polymorphisms (SFP between the cross parents for each new combination of genotypes, which raises the cost of experiments. The availability of the genomic polymorphism data in Arabidopsis thaliana, coupled with the efficient designs of Single Nucleotide Polymorphism (SNP genotyping arrays removes the requirement for SFP detection and lowers the per array cost, thereby lowering the overall cost per experiment. To demonstrate that these approaches would be functional on SNP arrays and determine confidence intervals, we analyzed hybridizations of natural accessions to the Arabidopsis ATSNPTILE array and simulated BSA or XAM given a variety of gene models, populations, and bulk selection parameters. Our results show a striking degree of correlation between the genotyping output of both methods, which suggests that the benefit of SFP genotyping in context of BSA can be had with the cheaper, more efficient SNP arrays. As a final proof of concept, we hybridized the DNA from bulks of an F2 mapping population of a Sulfur and Selenium ionomics mutant to both the Arabidopsis ATTILE1R and ATSNPTILE arrays, which produced almost identical results. We have produced R scripts that prompt the user for the required parameters and perform the BSA analysis using the ATSNPTILE1 array and have provided them as supplemental data files.

  20. Identifying sigma70 promoters with novel pseudo nucleotide composition.

    Science.gov (United States)

    Lin, Hao; Liang, Zhi-Yong; Tang, Hua; Chen, Wei

    2017-02-08

    Promoters are DNA regulatory elements located directly upstream or at the 5' end of the transcription initiation site (TSS), which are in charge of gene transcription initiation. With the completion of a large number of microorganism genomics, it is urgent to predict promoters accurately in bacteria by using computational method. In this work, a sequence-based predictor named "iPro70-PseZNC" was designed for identifying sigma70 promoters in prokaryote. In the predictor, the samples of DNA sequences are formulated by a novel pseudo nucleotide composition, called PseZNC, into which the multi-window Z-curve composition and six local DNA structural properties are incorporated. In the 5-fold cross-validation, the area under the curve of receiver operating characteristic of 0.909 was obtained on our benchmark dataset, indicating that the proposed predictor is promising and will provide important guide in this area. Further studies showed that the performance of PseZNC is better than it of multi-window Z-curve composition. For the sake of convenience for researchers, a user-friendly online service was established and can be freely accessible at http://lin.uestc.edu.cn/server/iPro70-PseZNC. The PseZNC approach can be also extended to other DNA-related problems.

  1. Factor VII activating protease. Single nucleotide polymorphisms light the way.

    Science.gov (United States)

    Kanse, S M; Etscheid, M

    2011-08-01

    Factor VII activating protease (FSAP) is a circulating serine protease with high homology to fibrinolytic enzymes. A role in the regulation of coagulation and fibrinolysis is suspected based on in vitro studies demonstrating activation of FVII or pro-urokinase plasminogen activator (uPA). However, considering the paucity of any studies in animal models or any correlative studies in humans the role of FSAP in haemostasis remains unclear. In relation to vascular remodeling processes or inflammation it has been convincingly shown that FSAP interacts with growth factors as well as protease activated receptors (PAR). Against this sparse background there are a plethora of studies which have investigated the linkage of single nucleotide polymorphisms (SNP) in the FSAP gene (HABP2) to various diseases. The G534E SNP of FSAP is associated with a low proteolytic activity due to an amino acid exchange in the protease domain. This and other SNPs have been linked to carotid stenosis, stroke as well as thrombosis in the elderly and plaque calcification. These SNP analyses indicate an important role for FSAP in the regulation of the haemostasis system as well as fibroproliferative inflammatory processes.

  2. Diagnostics for the ATA beam propagation experiments

    Energy Technology Data Exchange (ETDEWEB)

    Fessenden, T.J.; Atchison, W.L.; Barletta, W.A.

    1981-11-01

    This report contains a discussion of the diagnostics required for the beam propagation experiment to be done with the ATA accelerator. Included are a list of the diagnostics needed; a description of the ATA experimental environment; the status of beam diagnostics available at Livermore including recent developments, and a prioritized list of accelerator and propagation diagnostics under consideration or in various stages of development.

  3. Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

    DEFF Research Database (Denmark)

    Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

    2011-01-01

    A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

  4. Rationally designed squaryldiamides - a novel class of sugar-nucleotide mimics?

    Science.gov (United States)

    Niewiadomski, Sven; Beebeejaun, Zeenat; Denton, Helen; Smith, Terry K; Morris, Richard J; Wagner, Gerd K

    2010-08-07

    Sugar-nucleotides such as GDP-mannose, GDP-fucose and UDP-glucose are important biomolecules with a central role in carbohydrate and glycoconjugate biosynthesis, metabolism and cell signalling. Analogues and mimics of naturally occurring sugar-nucleotides are sought after as chemical tools and inhibitor candidates for sugar-nucleotide-dependent enzymes including glycosyltransferases. Many sugar-nucleotides bind to their target glycosyltransferases via coordination of the diphosphate group to a divalent metal cofactor in the active site. The identification of uncharged, chemically stable surrogates for the diphosphate group, with the ability to coordinate to a divalent metal, is therefore an important design criteria for the development of sugar-nucleotide mimics. Here, we describe the rational design and synthesis of a novel class of sugar-nucleotide mimics based on a squaryldiamide scaffold, an uncharged phosphate isostere. We demonstrate by comprehensive NMR titration experiments that the new sugar-nucleotide mimics coordinate efficiently to Mg(2+), and provide results from biological studies with a therapeutically relevant mannosyltransferase from Trypanosoma brucei. Our findings suggest that squaryldiamides are a promising template for the development of sugar-nucleotide mimics, and illustrate the considerable potential of the squarylamide group as a fragment for inhibitor design.

  5. De Novo Identification of Single Nucleotide Mutations in Caenorhabditis elegans Using Array Comparative Genomic Hybridization

    Science.gov (United States)

    Maydan, Jason S.; Okada, H. Mark; Flibotte, Stephane; Edgley, Mark L.; Moerman, Donald G.

    2009-01-01

    Array comparative genomic hybridization (aCGH) has been used primarily to detect copy-number variants between two genomes. Here we report using aCGH to detect single nucleotide mutations on oligonucleotide microarrays with overlapping 50-mer probes. This technique represents a powerful method for rapidly detecting novel homozygous single nucleotide mutations in any organism with a sequenced reference genome. PMID:19189945

  6. Energy efficiency trade-offs drive nucleotide usage in transcribed regions.

    Science.gov (United States)

    Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J

    2016-04-21

    Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of 'A' versus 'T' and 'G' versus 'C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides 'U' and 'C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides 'A' and 'G' at non-synonymous coding sites.

  7. Effects of hypobaric hypoxia on adenine nucleotide pools, adenine nucleotide transporter activity and protein expression in rat liver

    Institute of Scientific and Technical Information of China (English)

    Cong-Yang Li; Jun-Ze Liu; Li-Ping Wu; Bing Li; Li-Fen Chen

    2006-01-01

    AIM: To explore the effect of hypobaric hypoxia on mitochondrial energy metabolism in rat liver.METHODS: Adult male Wistar rats were exposed to a hypobaric chamber simulating 5000 m high altitude for 23 h every day for 0 (HO), 1 (H1), 5 (HS), 15 (H15) and 30 d (H30) respectively. Rats were sacrificed by decapitation and liver was removed. Liver mitochondria were isolated by differential centrifugation program. The size of adenine nucleotide pool (ATP, ADP, and AMP) in tissue and mitochondria was separated and measured by high performance liquid chromatography (HPLC). The adenine nucleotide transporter (ANT) activity was determined by isotopic technique. The ANT total protein level was determined by Western blot. RESULTS: Compared with HO group, intra-mitochondrial ATP content decreased in all hypoxia groups. However,the H5 group reached the lowest point (70.6%) (P< 0.01)when compared to the control group. Intra-mitochondrial ADP and AMP level showed similar change in all hypoxia groups and were significantly lower than that in HO group. In addition, extra-mitochondrial ATP and ADP content decreased significantly in all hypoxia groups.Furthermore, extra-mitochondrial AMP in groups H5, H15and H30 was significantly lower than that in HO group,whereas H1 group had no marked change compared to the control situation. The activity of ANT in hypoxia groups decreased significantly, which was the lowest in H5 group (55.7%) (P<0.01) when compared to HO group. ANT activity in H30 group was higher than in H15 group, but still lower than that in HO group. ANT protein level in H5, H15, H30 groups, compared with HO group decreased significantly, which in H5 group was the lowest, being 27.1% of that in HO group (P<0.01). ANT protein level in H30 group was higher than in H15 group,but still lower than in HO group.CONCLUSION: Hypobaric hypoxia decreases the mitochondrial ATP content in rat liver, while mitochondrial ATP level recovers during long-term hypoxia exposure.The lower

  8. Optical diagnostics of intermittent flows

    DEFF Research Database (Denmark)

    Okulov, V.L.; Naumov, I.V.; Sørensen, Jens Nørkær

    2007-01-01

    The efficiency of combined use of different optical techniques for flow diagnostics is demonstrated with the practically important case of intense swirling flows. It is shown that, when applied separately, commonly used optical measuring techniques, such as laser Doppler anemometry and particle...... image velocimetry, frequently give erroneous results, especially for the transition flow and developed nonstationary flow. However, their combined use in diagnostics of unsteady (intermittent) flows significantly improves both the temporal and spatial resolution of measurements. Such a complex approach...... is for the first time applied for diagnostics of the flow pattern in a closed cylinder with a rotating end face with the aim of studying the changeover from the steady axisymmetric to unsteady asymmetric flow over a wide range of flow parameters. It is found that such a transition is notable for azimuthal...

  9. Enhanced NIF neutron activation diagnostics.

    Science.gov (United States)

    Yeamans, C B; Bleuel, D L; Bernstein, L A

    2012-10-01

    The NIF neutron activation diagnostic suite relies on removable activation samples, leading to operational inefficiencies and a fundamental lower limit on the half-life of the activated product that can be observed. A neutron diagnostic system measuring activation of permanently installed samples could remove these limitations and significantly enhance overall neutron diagnostic capabilities. The physics and engineering aspects of two proposed systems are considered: one measuring the (89)Zr/(89 m)Zr isomer ratio in the existing Zr activation medium and the other using potassium zirconate as the activation medium. Both proposed systems could improve the signal-to-noise ratio of the current system by at least a factor of 5 and would allow independent measurement of fusion core velocity and fuel areal density.

  10. Molecular diagnostics of neurodegenerative disorders

    Directory of Open Access Journals (Sweden)

    Megha eAgrawal

    2015-09-01

    Full Text Available Molecular diagnostics provide a powerful method to detect and diagnose various neurological diseases such as Alzheimer’s and Parkinson’s disease. The confirmation of such diagnosis allows early detection and subsequent medical counseling that help specific patients to undergo clinically important drug trials. This provides a medical pathway to have better insight of neurogenesis and eventual cure of the neurodegenerative diseases. In this short review, we present recent advances in molecular diagnostics especially biomarkers and imaging spectroscopy for neurological diseases. We describe advances made in Alzheimer’s disease, Parkinson’s disease, Amyotrophic lateral sclerosis and Huntington’s disease, and finally present a perspective on the future directions to provide a framework for further developments and refinements of molecular diagnostics to combat neurodegenerative disorders.

  11. A Diagnostic Approach to Hemochromatosis

    Directory of Open Access Journals (Sweden)

    Anthony S Tavill

    2006-01-01

    Full Text Available In the present clinical review, a diagnostic approach to hemochromatosis is discussed from the perspective of two clinicians with extensive experience in this area. The introduction of genetic testing and large-scale population screening studies have broadened our understanding of the clinical expression of disease and the utility of biochemical iron tests for the detection of disease and for the assessment of disease severity. Liver biopsy has become more of a prognostic test than a diagnostic test. The authors offer a stepwise, diagnostic algorithm based on current evidence-based data, that they regard as most cost-effective. An early diagnosis can lead to phlebotomy therapy to prevent the development of cirrhosis.

  12. Audiologic diagnostics of vestibular schwannoma

    Directory of Open Access Journals (Sweden)

    Komazec Zoran

    2004-01-01

    Full Text Available Introduction Vestibular schwannoma (acoustic neuroma is a rare, but important cause of sensorineural hearing loss. Patients with asymmetric hearing loss, or unilateral tinnitus should be evaluated expeditiously, to prevent further neurological damage. Audiologic diagnostics Audiologic diagnostics represents the basic diagnosis for early detection of vestibular schwannoma. Patients with vestibular schwannomas may present with a variety of clinical features, including retrocochlear pattern of sensorineural hearing loss. Supraliminary audiometry, tympano- metry, stapedius reflex and otoacoustic emissions as well as vestibular response to caloric testing are methods for selection of patients with suspicion of this tumor. Conclusion The golden standard for audiologic diagnostics of vestibular schwannoma is BAEP (Brainstem Auditory Evoked Potentials. Patients with pathological findings of BAEP should undergo MRI of the posterior fossa. Gadolinium-enhanced magnetic resonance imaging is the best and final tool for making a diagnosis of vestibular schwannoma.

  13. Diagnostic accuracy in virtual dermatopathology

    DEFF Research Database (Denmark)

    Mooney, E.; Kempf, W.; Jemec, G.B.E.;

    2012-01-01

    Background Virtual microscopy is used for teaching medical students and residents and for in-training and certification examinations in the United States. However, no existing studies compare diagnostic accuracy using virtual slides and photomicrographs. The objective of this study was to compare...... slides and photomicrographs with corresponding clinical photographs and information in a self-assessment examination format. Descriptive data analysis and comparison of groups were performed using a chi-square test. Results Diagnostic accuracy in dermatopathology using virtual dermatopathology...... represented a useful tool for learning; 90% felt that virtual dermatopathology is useful tool for teaching dermatopathology. Conclusion No significant difference was observed in diagnostic accuracy using virtual dermatopathology compared to photomicrographs. Most participants felt virtual dermatopathology...

  14. Complete nucleotide sequence of a monopartite Begomovirus and associated satellites infecting Carica papaya in Nepal.

    Science.gov (United States)

    Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T

    2013-06-01

    Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.

  15. Phosphodiesterases: Regulators of cyclic nucleotide signals and novel molecular target for movement disorders.

    Science.gov (United States)

    Sharma, Sorabh; Kumar, Kushal; Deshmukh, Rahul; Sharma, Pyare Lal

    2013-08-15

    Movement disorders rank among the most common neurological disorders. During the last two decades substantial progress has been made in understanding of the pathological basis of these disorders. Although, several mechanisms have been proposed, downregulation of cyclic nucleotide mediated signaling cascade has consistently been shown to contribute to the striatal dysfunctioning as seen in movement disorders. Thus, counteracting dysregulated cyclic nucleotide signaling has been considered to be beneficial in movement disorders. Cyclic nucleotide phosphodiesterases (PDEs) are the enzymes responsible for the breakdown of cyclic nucleotides and upregulation in PDE activity has been reported in various movement disorders. Thus, PDE inhibition is considered to be a novel strategy to restore cerebral cyclic nucleotide levels and their downstream signalling cascade. Indeed, various PDE inhibitors have been tested pre-clinically and were reported to be neuroprotective in various neurodegenerative disorders associated with movement disabilities. In this review, we have discussed a putative role of PDE inhibitors in movement disorders and associated abnormalities.

  16. Diagnostic testing and educational assessment.

    Science.gov (United States)

    Tweed, Mike; Wilkinson, Tim

    2012-10-01

    Clinicians are familiar with making diagnostic decisions based on information gathered from history, clinical examination and diagnostic tests. Although many clinicians assess students, they may be less familiar with ways to assimilate assessment information to inform educational decisions. We draw parallels between the processes used to make a clinical diagnosis and the similar processes needed to make an educational decision. There are several indices that describe the performance and utility of diagnostic tests, which we have extrapolated to educational assessment. We provide a clinical diagnostic question and an education assessment question, and use examples of indices of performance and utility for both of these situations to explore: reliability, indeterminate results, certainty in decisions, acceptable levels of sensitivity and specificity, pre-test probability and dealing with limitations. Test reliability requires adequate sampling and consistency between observers. Seeking more information should be targeted to situations where decisions are not certain. Altering score cut-points alters test sensitivity and specificity, which in assessment will alter the numbers of falsely passing or falsely failing candidates. Just as the pre-test probability of a diagnosis influences how to interpret diagnostic tests, so too does the pre-test probability of failure alter the performance characteristics of assessments. In clinical situations, a 'wait and see' approach may be limited by clinical urgency. Likewise, in assessment the 'wait and see' approach may be limited by a duty to society. Clinicians familiar with the performance and utility of diagnostic tests can extrapolate that knowledge to make better interpretations of educational assessments. © Blackwell Publishing Ltd 2012.

  17. Imaging Techniques for Microwave Diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Donne, T. [FOM-Institute for Plasma Physics Rijnhuizen, Trilateral Euregio Cluster, PO Box 1207, 3430 BE Nieuwegein (Netherlands); Luhmann Jr, N.C. [University of California, Davis, CA 95616 (United States); Park, H.K. [POSTECH, Pohang, Gyeongbuk 790-784 (Korea, Republic of); Tobias, B.

    2011-07-01

    Advances in microwave technology have made it possible to develop a new generation of microwave imaging diagnostics for measuring the parameters of magnetic fusion devices. The most prominent of these diagnostics is electron cyclotron emission imaging (ECE-I). After the first generation of ECE-I diagnostics utilized at the TEXT-U, RTP and TEXTOR tokamaks and the LHD stellarator, new systems have recently come into operation on ASDEX-UG and DIII-D, soon to be followed by a system on KSTAR. The DIII-D and KSTAR systems feature dual imaging arrays that observe different parts of the plasma. The ECE-I diagnostic yields two-dimensional movies of the electron temperature in the plasma and has given already new insights into the physics of sawtooth oscillations, tearing modes and edge localized modes. Microwave Imaging Reflectometry (MIR) is used on LHD to measure electron density fluctuations. A pilot MIR system has been tested at TEXTOR and, based on the promising results, a new system is now under design for KSTAR. The system at TEXTOR was used to measure the plasma rotation velocity. The system at KSTAR and also the one on LHD will be/are used for measuring the profile of the electron density fluctuations in the plasma. Other microwave imaging diagnostics are phase imaging interferometry, and imaging microwave scattering. The emphasis in this paper will be largely focused on ECE-I. First an overview of the advances in microwave technology are discussed, followed by a description of a typical ECE-I system along with some typical experimental results. Also the utilization of imaging techniques in other types of microwave diagnostics will be briefly reviewed. This document is composed of the slides of the presentation. (authors)

  18. Diagnostic and therapeutic application of noncoding RNAsfor hepatocellular carcinoma

    Institute of Scientific and Technical Information of China (English)

    Chikako Shibata; Motoyuki Otsuka; Takahiro Kishikawa; Motoko Ohno; Takeshi Yoshikawa; Akemi Takata; Kazuhiko Koike

    2015-01-01

    MicroRNAs (miRNAs) are small, noncoding RNA moleculesthat regulate gene expression posttranscriptionally,targeting thousands of messenger RNAs. Long noncodingRNAs (lncRNAs), another class of noncodingRNAs, have been determined to be also involved intranscription regulation and translation of target genes.Since deregulated expression levels or functions ofmiRNAs and lncRNAs in hepatocellular carcinoma (HCC)are frequently observed, clinical use of noncodingRNAs for novel diagnostic and therapeutic applicationsin the management of HCCs is highly and emergentlyexpected. Here, we summarize recent findingsregarding deregulated miRNAs and lncRNAs for theirpotential clinical use as diagnostic and prognosticbiomarkers of HCC. Specifically, we emphasize thederegulated expression levels of such noncoding RNAsin patients' sera as noninvasive biomarkers, a field thatrequires urgent improvement in the clinical surveillanceof HCC. Since nucleotide-based strategies are beingapplied to clinical therapeutics, we further summarizeclinical and preclinical trials using oligonucleotidesinvolving the use of miRNAs and small interfering RNAsagainst HCC as novel therapeutics. Finally, we discusscurrent open questions, which must be clarified in thenear future for realistic clinical applications of thesenew strategies.

  19. Systematic selection of modified aptamer pairs for diagnostic sandwich assays.

    Science.gov (United States)

    Ochsner, Urs A; Green, Louis S; Gold, Larry; Janjic, Nebojsa

    2014-01-01

    Protein diagnostic applications typically require pairs of analyte-specific reagents for capture and detection. We developed methods for the systematic isolation of slow off-rate modified aptamer (SOMAmer) reagents that bind to different epitopes and allow efficient pair-wise screening of multiple ligands. SOMAmers were generated via a second systematic evolution of ligands by exponential enrichment (SELEX), using complexes of target proteins with a primary, non-amplifiable SOMAmer and employing different modified nucleotides (e.g., naphthylmethyl- or tryptaminocarbonyl-dU) to favor alternate binding epitopes. Non-competing binding of primary and secondary SOMAmers was tested in radiolabel competition and sandwich binding assays. Multiplexed high-throughput screening for sandwich pairs utilized the Luminex platform, with primary SOMAmers as capture agents attached to different types of LumAvidin beads, which were then pooled for testing the secondary SOMAmers individually as detection agents. Functional SOMAmer pairs were obtained for Clostridium difficile binary toxin (CdtA) and for a panel of human proteins (ANGPT2, TSP2, CRDL1, MATN2, GPVI, C7, PLG) that had been previously identified as promising markers for cardiovascular risk. The equilibrium dissociation constants (Kd values) ranged from 0.02-2.7 nM, and the detection limits were in the low picomolar range for these proteins in SOMAmer sandwich assays. These results indicate that SOMAmer pairs hold promise for the development of rapid tests or specific diagnostic panels.

  20. Diagnostic imaging in bovine orthopedics.

    Science.gov (United States)

    Kofler, Johann; Geissbühler, Urs; Steiner, Adrian

    2014-03-01

    Although a radiographic unit is not standard equipment for bovine practitioners in hospital or field situations, ultrasound machines with 7.5-MHz linear transducers have been used in bovine reproduction for many years, and are eminently suitable for evaluation of orthopedic disorders. The goal of this article is to encourage veterinarians to use radiology and ultrasonography for the evaluation of bovine orthopedic disorders. These diagnostic imaging techniques improve the likelihood of a definitive diagnosis in every bovine patient but especially in highly valuable cattle, whose owners demand increasingly more diagnostic and surgical interventions that require high-level specialized techniques.

  1. Diagnostic nerve ultrasonography; Diagnostische Nervensonographie

    Energy Technology Data Exchange (ETDEWEB)

    Baeumer, T. [Universitaet zu Luebeck CBBM, Haus 66, Institut fuer Neurogenetik, Luebeck (Germany); Grimm, A. [Universitaetsklinikum Tuebingen, Klinik und Poliklinik fuer Neurologie, Tuebingen (Germany); Schelle, T. [Staedtisches Klinikum Dessau, Neurologische Klinik, Dessau (Germany)

    2017-03-15

    For the diagnostics of nerve lesions an imaging method is necessary to visualize peripheral nerves and their surrounding structures for an etiological classification. Clinical neurological and electrophysiological investigations provide functional information about nerve lesions. The information provided by a standard magnetic resonance imaging (MRI) examination is inadequate for peripheral nerve diagnostics; however, MRI neurography is suitable but on the other hand a resource and time-consuming method. Using ultrasonography for peripheral nerve diagnostics. With ultrasonography reliable diagnostics of entrapment neuropathies and traumatic nerve lesions are possible. The use of ultrasonography for neuropathies shows that a differentiation between different forms is possible. Nerve ultrasonography is an established diagnostic tool. In addition to the clinical examination and clinical electrophysiology, structural information can be obtained, which results in a clear improvement in the diagnostics. Ultrasonography has become an integral part of the diagnostic work-up of peripheral nerve lesions in neurophysiological departments. Nerve ultrasonography is recommended for the diagnostic work-up of peripheral nerve lesions in addition to clinical and electrophysiological investigations. It should be used in the clinical work-up of entrapment neuropathies, traumatic nerve lesions and spacy-occupying lesions of nerves. (orig.) [German] Fuer die Diagnostik von Nervenlaesionen ist ein bildgebendes Verfahren zur Darstellung des peripheren Nervs und seiner ihn umgebenden Strukturen fuer eine aetiologische Einordnung erforderlich. Mit der klinisch-neurologischen Untersuchung und Elektrophysiologie ist eine funktionelle Aussage ueber die Nervenlaesion moeglich. In der Standard-MRT-Untersuchung wird der periphere Nerv nur unzureichend gut dargestellt. Die MRT-Neurographie ist ein sehr gutes, aber auch zeit- und ressourcenintensives Verfahren. Nutzung des Ultraschalls fuer die

  2. First Wall and Operational Diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Lasnier, C; Allen, S; Boedo, J; Groth, M; Brooks, N; McLean, A; LaBombard, B; Sharpe, J; Skinner, C; Whyte, D; Rudakov, D; West, W; Wong, C

    2006-06-19

    In this chapter we review numerous diagnostics capable of measurements at or near the first wall, many of which contribute information useful for safe operation of a tokamak. There are sections discussing infrared cameras, visible and VUV cameras, pressure gauges and RGAs, Langmuir probes, thermocouples, and erosion and deposition measurements by insertable probes and quartz microbalance. Also discussed are dust measurements by electrostatic detectors, laser scattering, visible and IR cameras, and manual collection of samples after machine opening. In each case the diagnostic is discussed with a view toward application to a burning plasma machine such as ITER.

  3. Diagnostic testing for Giardia infections.

    Science.gov (United States)

    Heyworth, Martin F

    2014-03-01

    The traditional method for diagnosing Giardia infections involves microscopic examination of faecal specimens for Giardia cysts. This method is subjective and relies on observer experience. From the 1980s onwards, objective techniques have been developed for diagnosing Giardia infections, and are superseding diagnostic techniques reliant on microscopy. Detection of Giardia antigen(s) by immunoassay is the basis of commercially available diagnostic kits. Various nucleic acid amplification techniques (NAATs) can demonstrate DNA of Giardia intestinalis, and have the potential to become standard approaches for diagnosing Giardia infections. Of such techniques, methods involving either fluorescent microspheres (Luminex) or isothermal amplification of DNA (loop-mediated isothermal amplification; LAMP) are especially promising.

  4. [The diagnostic possibilities of saliva].

    Science.gov (United States)

    Kochurova, E V; Kozlov, S V

    2014-01-01

    Saliva is a clinically informative biological fluid which contains multitude of bio-markers. This characteristic makes it possible to carry out numerous analyzes for developing mode to test patient in situ, express-tests included. The diagnostic by saliva is a new area of more simple application both markers and analyzers that can be useful in diagnostic of diseases of oral cavity, oncological diseases included. The using of saliva expands perspectives for making clinical diagnosis and establishment of dynamics and monitoring of disease.

  5. Analysis of substrate specificity and kinetics of cyclic nucleotide phosphodiesterases with N'-methylanthraniloyl-substituted purine and pyrimidine 3',5'-cyclic nucleotides by fluorescence spectrometry.

    Directory of Open Access Journals (Sweden)

    Daniel Reinecke

    Full Text Available As second messengers, the cyclic purine nucleotides adenosine 3',5'-cyclic monophosphate (cAMP and guanosine 3',5'-cyclic monophosphate (cGMP play an essential role in intracellular signaling. Recent data suggest that the cyclic pyrimidine nucleotides cytidine 3',5'-cyclic monophosphate (cCMP and uridine 3',5'-cyclic monophosphate (cUMP also act as second messengers. Hydrolysis by phosphodiesterases (PDEs is the most important degradation mechanism for cAMP and cGMP. Elimination of cUMP and cCMP is not completely understood, though. We have shown that human PDEs hydrolyze not only cAMP and cGMP but also cyclic pyrimidine nucleotides, indicating that these enzymes may be important for termination of cCMP- and cUMP effects as well. However, these findings were acquired using a rather expensive HPLC/mass spectrometry assay, the technical requirements of which are available only to few laboratories. N'-Methylanthraniloyl-(MANT-labeled nucleotides are endogenously fluorescent and suitable tools to study diverse protein/nucleotide interactions. In the present study, we report the synthesis of new MANT-substituted cyclic purine- and pyrimidine nucleotides that are appropriate to analyze substrate specificity and kinetics of PDEs with more moderate technical requirements. MANT-labeled nucleoside 3',5'-cyclic monophosphates (MANT-cNMPs are shown to be substrates of various human PDEs and to undergo a significant change in fluorescence upon cleavage, thus allowing direct, quantitative and continuous determination of hydrolysis via fluorescence detection. As substrates of several PDEs, MANT-cNMPs show similar kinetics to native nucleotides, with some exceptions. Finally, they are shown to be also appropriate tools for PDE inhibitor studies.

  6. Structure of the nucleotide complex of PyrR, the pyr attenuation protein from Bacillus caldolyticus, suggests dual regulation by pyrimidine and purine nucleotides.

    Science.gov (United States)

    Chander, Preethi; Halbig, Kari M; Miller, Jamie K; Fields, Christopher J; Bonner, Heather K S; Grabner, Gail K; Switzer, Robert L; Smith, Janet L

    2005-03-01

    PyrR is a protein that regulates the expression of genes and operons of pyrimidine nucleotide biosynthesis (pyr genes) in many bacteria. PyrR acts by binding to specific sequences on pyr mRNA and causing transcriptional attenuation when intracellular levels of uridine nucleotides are elevated. PyrR from Bacillus subtilis has been purified and extensively studied. In this work, we describe the purification to homogeneity and characterization of recombinant PyrR from the thermophile Bacillus caldolyticus and the crystal structures of unliganded PyrR and a PyrR-nucleotide complex. The B. caldolyticus pyrR gene was previously shown to restore normal regulation of the B. subtilis pyr operon in a pyrR deletion mutant. Like B. subtilis PyrR, B. caldolyticus PyrR catalyzes the uracil phosphoribosyltransferase reaction but with maximal activity at 60 degrees C. Crystal structures of B. caldolyticus PyrR reveal a dimer similar to the B. subtilis PyrR dimer and, for the first time, binding sites for nucleotides. UMP and GMP, accompanied by Mg2+, bind specifically to PyrR active sites. Nucleotide binding to PyrR is similar to other phosphoribosyltransferases, but Mg2+ binding differs. GMP binding was unexpected. The protein bound specific sequences of pyr RNA 100 to 1,000 times more tightly than B. subtilis PyrR, depending on the RNA tested and the assay method; uridine nucleotides enhanced RNA binding, but guanosine nucleotides antagonized it. The new findings of specific GMP binding and its antagonism of RNA binding suggest cross-regulation of the pyr operon by purines.

  7. Twelve-single nucleotide polymorphism genetic risk score identifies individuals at increased risk for future atrial fibrillation and stroke.

    Science.gov (United States)

    Tada, Hayato; Shiffman, Dov; Smith, J Gustav; Sjögren, Marketa; Lubitz, Steven A; Ellinor, Patrick T; Louie, Judy Z; Catanese, Joseph J; Engström, Gunnar; Devlin, James J; Kathiresan, Sekar; Melander, Olle

    2014-10-01

    Atrial fibrillation (AF) is prevalent and there is a clinical need for biomarkers to identify individuals at higher risk for AF. Fixed throughout a life course and assayable early in life, genetic biomarkers may meet this need. Here, we investigate whether multiple single nucleotide polymorphisms together as an AF genetic risk score (AF-GRS) can improve prediction of one's risk for AF. In 27 471 participants of the Malmö Diet and Cancer Study, a prospective, community-based cohort, we used Cox models that adjusted for established AF risk factors to assess the association of AF-GRS with incident AF and ischemic stroke. Median follow-up was 14.4 years for incident AF and 14.5 years for ischemic stroke. The AF-GRS comprised 12 single nucleotide polymorphisms that had been previously shown to be associated with AF at genome-wide significance. During follow-up, 2160 participants experienced a first AF event and 1495 had a first ischemic stroke event. Participants in the top AF-GRS quintile were at increased risk for incident AF (hazard ratio, 2.00; 95% confidence interval, 1.73-2.31; P=2.7×10(-21)) and ischemic stroke (hazard ratio, 1.23; 95% confidence interval, 1.04-1.46; P=0.02) when compared with the bottom quintile. Addition of the AF-GRS to established AF risk factors modestly improved both discrimination and reclassification (Pstroke. Targeting diagnostic or therapeutic interventions to this subset may prove clinically useful. © 2014 American Heart Association, Inc.

  8. Single nucleotide polymorphism mining and nucleotide sequence analysis of Mx1 gene in exonic regions of Japanese quail

    Directory of Open Access Journals (Sweden)

    Diwesh Kumar Niraj

    2015-12-01

    Full Text Available Aim: An attempt has been made to study the Myxovirus resistant (Mx1 gene polymorphism in Japanese quail. Materials and Methods: In the present, investigation four fragments viz. Fragment I of 185 bp (Exon 3 region, Fragment II of 148 bp (Exon 5 region, Fragment III of 161 bp (Exon 7 region, and Fragment IV of 176 bp (Exon 13 region of Mx1 gene were amplified and screened for polymorphism by polymerase chain reaction-single-strand conformation polymorphism technique in 170 Japanese quail birds. Results: Out of the four fragments, one fragment (Fragment II was found to be polymorphic. Remaining three fragments (Fragment I, III, and IV were found to be monomorphic which was confirmed by custom sequencing. Overall nucleotide sequence analysis of Mx1 gene of Japanese quail showed 100% homology with common quail and more than 80% homology with reported sequence of chicken breeds. Conclusion: The Mx1 gene is mostly conserved in Japanese quail. There is an urgent need of comprehensive analysis of other regions of Mx1 gene along with its possible association with the traits of economic importance in Japanese quail.

  9. Analysis of codon usage and nucleotide composition bias in polioviruses

    Directory of Open Access Journals (Sweden)

    Gu Yuan-xing

    2011-03-01

    Full Text Available Abstract Background Poliovirus, the causative agent of poliomyelitis, is a human enterovirus and a member of the family of Picornaviridae and among the most rapidly evolving viruses known. Analysis of codon usage can reveal much about the molecular evolution of the viruses. However, little information about synonymous codon usage pattern of polioviruses genome has been acquired to date. Methods The relative synonymous codon usage (RSCU values, effective number of codon (ENC values, nucleotide contents and dinucleotides were investigated and a comparative analysis of codon usage pattern for open reading frames (ORFs among 48 polioviruses isolates including 31 of genotype 1, 13 of genotype 2 and 4 of genotype 3. Results The result shows that the overall extent of codon usage bias in poliovirus samples is low (mean ENC = 53.754 > 40. The general correlation between base composition and codon usage bias suggests that mutational pressure rather than natural selection is the main factor that determines the codon usage bias in those polioviruses. Depending on the RSCU data, it was found that there was a significant variation in bias of codon usage among three genotypes. Geographic factor also has some effect on the codon usage pattern (exists in the genotype-1 of polioviruses. No significant effect in gene length or vaccine derived polioviruses (DVPVs, wild viruses and live attenuated virus was observed on the variations of synonymous codon usage in the virus genes. The relative abundance of dinucleotide (CpG in the ORFs of polioviruses are far below expected values especially in DVPVs and attenuated virus of polioviruses genotype 1. Conclusion The information from this study may not only have theoretical value in understanding poliovirus evolution, especially for DVPVs genotype 1, but also have potential value for the development of poliovirus vaccines.

  10. Genomic and single nucleotide polymorphism analysis of infectious bronchitis coronavirus.

    Science.gov (United States)

    Abolnik, Celia

    2015-06-01

    Infectious bronchitis virus (IBV) is a Gammacoronavirus that causes a highly contagious respiratory disease in chickens. A QX-like strain was analysed by high-throughput Illumina sequencing and genetic variation across the entire viral genome was explored at the sub-consensus level by single nucleotide polymorphism (SNP) analysis. Thirteen open reading frames (ORFs) in the order 5'-UTR-1a-1ab-S-3a-3b-E-M-4b-4c-5a-5b-N-6b-3'UTR were predicted. The relative frequencies of missense: silent SNPs were calculated to obtain a comparative measure of variability in specific genes. The most variable ORFs in descending order were E, 3b, 5'UTR, N, 1a, S, 1ab, M, 4c, 5a, 6b. The E and 3b protein products play key roles in coronavirus virulence, and RNA folding demonstrated that the mutations in the 5'UTR did not alter the predicted secondary structure. The frequency of SNPs in the Spike (S) protein ORF of 0.67% was below the genomic average of 0.76%. Only three SNPS were identified in the S1 subunit, none of which were located in hypervariable region (HVR) 1 or HVR2. The S2 subunit was considerably more variable containing 87% of the polymorphisms detected across the entire S protein. The S2 subunit also contained a previously unreported multi-A insertion site and a stretch of four consecutive mutated amino acids, which mapped to the stalk region of the spike protein. Template-based protein structure modelling produced the first theoretical model of the IBV spike monomer. Given the lack of diversity observed at the sub-consensus level, the tenet that the HVRs in the S1 subunit are very tolerant of amino acid changes produced by genetic drift is questioned. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Sequencing genes in silico using single nucleotide polymorphisms

    Directory of Open Access Journals (Sweden)

    Zhang Xinyi

    2012-01-01

    Full Text Available Abstract Background The advent of high throughput sequencing technology has enabled the 1000 Genomes Project Pilot 3 to generate complete sequence data for more than 906 genes and 8,140 exons representing 697 subjects. The 1000 Genomes database provides a critical opportunity for further interpreting disease associations with single nucleotide polymorphisms (SNPs discovered from genetic association studies. Currently, direct sequencing of candidate genes or regions on a large number of subjects remains both cost- and time-prohibitive. Results To accelerate the translation from discovery to functional studies, we propose an in silico gene sequencing method (ISS, which predicts phased sequences of intragenic regions, using SNPs. The key underlying idea of our method is to infer diploid sequences (a pair of phased sequences/alleles at every functional locus utilizing the deep sequencing data from the 1000 Genomes Project and SNP data from the HapMap Project, and to build prediction models using flanking SNPs. Using this method, we have developed a database of prediction models for 611 known genes. Sequence prediction accuracy for these genes is 96.26% on average (ranges 79%-100%. This database of prediction models can be enhanced and scaled up to include new genes as the 1000 Genomes Project sequences additional genes on additional individuals. Applying our predictive model for the KCNJ11 gene to the Wellcome Trust Case Control Consortium (WTCCC Type 2 diabetes cohort, we demonstrate how the prediction of phased sequences inferred from GWAS SNP genotype data can be used to facilitate interpretation and identify a probable functional mechanism such as protein changes. Conclusions Prior to the general availability of routine sequencing of all subjects, the ISS method proposed here provides a time- and cost-effective approach to broadening the characterization of disease associated SNPs and regions, and facilitating the prioritization of candidate

  12. Eukaryotic nucleotide excision repair: from understanding mechanisms to influencing biology

    Institute of Scientific and Technical Information of China (English)

    Sarah C Shuck; Emily A Short; John J Turchi

    2008-01-01

    Repair of bulky DNA adducts by the nucleotide excision repair (NER) pathway is one of the more versatile DNA repair pathways for the removal of DNA lesions. There are two subsets of the NER pathway, global genomic-NER (GG-NER) and transcription-coupled NER (TC-NER), which differ only in the step involving recognition of the DNA lesion. Following recognition of the damage, the sub-pathways then converge for the incision/excision steps and subsequent gap filling and ligation steps. This review will focus on the GGR sub-pathway of NER while the TCR sub-pathway will be covered in another article in this issue. The ability of the NER pathway to repair a wide array of adducts stems, in part, from the mechanisms involved in the initial recognition step of the damaged DNA and results in NER impacting an equally wide array of human physiological responses and events. In this review, the impact of NER on carcinogenesis, neurological function, sensitivity to environmental factors and sensitivity to cancer therapeutics will be discussed. The knowledge generated in our understanding of the NER pathway over the past 40 years has resulted from advances in the fields of animal model systems, mammalian genetics and in vitro biochemistry, as well as from reconstitution studies and structural analyses of the proteins and enzymes that participate in this pathway. Each of these avenues of research has contributed significantly to our understanding of how the NER pathway works and how alterations in NER activity, both positive and negative, influence human biology.

  13. ACG: rapid inference of population history from recombining nucleotide sequences

    Directory of Open Access Journals (Sweden)

    O'Fallon Brendan D

    2013-02-01

    Full Text Available Abstract Background Reconstruction of population history from genetic data often requires Monte Carlo integration over the genealogy of the samples. Among tools that perform such computations, few are able to consider genetic histories including recombination events, precluding their use on most alignments of nuclear DNA. Explicit consideration of recombinations requires modeling the history of the sequences with an Ancestral Recombination Graph (ARG in place of a simple tree, which presents significant computational challenges. Results ACG is an extensible desktop application that uses a Bayesian Markov chain Monte Carlo procedure to estimate the posterior likelihood of an evolutionary model conditional on an alignment of genetic data. The ancestry of the sequences is represented by an ARG, which is estimated from the data with other model parameters. Importantly, ACG computes the full, Felsenstein likelihood of the ARG, not a pairwise or composite likelihood. Several strategies are used to speed computations, and ACG is roughly 100x faster than a similar, recombination-aware program. Conclusions Modeling the ancestry of the sequences with an ARG allows ACG to estimate the evolutionary history of recombining nucleotide sequences. ACG can accurately estimate the posterior distribution of population parameters such as the (scaled population size and recombination rate, as well as many aspects of the recombinant history, including the positions of recombination breakpoints, the distribution of time to most recent common ancestor along the sequence, and the non-recombining trees at individual sites. Multiple substitution models and population size models are provided. ACG also provides a richly informative graphical interface that allows users to view the evolution of model parameters and likelihoods in real time.

  14. Network analysis of single nucleotide polymorphisms in asthma

    Science.gov (United States)

    Renkonen, Jutta; Joenväärä, Sakari; Parviainen, Ville; Mattila, Pirkko; Renkonen, Risto

    2010-01-01

    Background: Asthma is a chronic inflammatory disease of the airways with a complex genetic background. In this study, we carried out a meta-analysis of single nucleotide polymorphisms (SNPs) thought to be associated with asthma. Methods: The literature (PubMed) was searched for SNPs within genes relevant in asthma. The SNP-modified genes were converted to corresponding proteins, and their protein–protein interactions were searched from six different databases. This interaction network was analyzed using annotated vocabularies (ontologies), such as the Gene Ontology and Nature pathway interaction databases. Results: In total, 127 genes with SNPs related to asthma were found in the literature. The corresponding proteins were then entered into a large protein–protein interaction network with the help of various databases. Ninety-six SNP-related proteins had more than one interacting protein each, and a network containing 309 proteins and 644 connections was generated. This network was significantly enriched with a gene ontology entitled “protein binding” and several of its daughter categories, including receptor binding and cytokine binding, when compared with the background human proteome. In the detailed analysis, the chemokine network, including eight proteins and 13 toll-like receptors, were shown to interact with each other. Of great interest are the nonsynonymous SNPs which code for an alternative amino acid sequence of proteins and, of the toll-like receptor network, TLR1, TLR4, TLR5, TLR6, TLR10, IL4R, and IL13 are among these. Conclusions: Protein binding, toll-like receptors, and chemokines dominated in the asthma-related protein interaction network. Systems level analysis of allergy-related mutations can provide new insights into the pathogenetic mechanisms of disease. PMID:21437052

  15. tRNA nucleotide 47: an evolutionary enigma.

    Science.gov (United States)

    Cermakian, N; McClain, W H; Cedergren, R

    1998-08-01

    A previous analysis of tRNA sequences suggested a correlation between the absence of a nucleotide at position 47 (nt 47) in the extra loop and the presence of a U13:G22 base pair in the D-stem. We have evaluated the significance of this correlation by determining the in vivo activity of tRNAs containing either a C13:G22 or a U13:G22 pair in tRNA molecules with or without nt 47. Although this correlation might reflect some malfunction of tRNAs lacking nt 47, but containing the C13:G22, assays of the in vivo suppressor activity showed that this tRNA is actually more active than the tRNA with the features found in the database, i.e., a U13:G22 base pair and no nt 47. Moreover, analogous constructs with a GGC anticodon permitted the growth of an Escherichia coli strain deleted for tRNA(Ala)GGC genes equally well. On the other hand, long-term growth experiments with competing E. coli strains harboring the tRNA lacking nt 47, either with the C13:G22 or the U13:G22 base pair demonstrated that the U13:G22 tRNA overtook the C13:G22 strain even when the starting proportion of strains favored the C13:G22 strain. Thus, the preference for the U13:G22 tRNA lacking nt 47 in the sequence database is most likely due to factors that come into play during extended growth or latency rather than to the ability of the tRNA to engage in protein synthesis.

  16. Immunosensors in Clinical Laboratory Diagnostics.

    Science.gov (United States)

    Justino, Celine I L; Duarte, Armando C; Rocha-Santos, Teresa A P

    2016-01-01

    The application of simple, cost-effective, rapid, and accurate diagnostic technologies for detection and identification of cardiac and cancer biomarkers has been a central point in the clinical area. Biosensors have been recognized as efficient alternatives for the diagnostics of various diseases due to their specificity and potential for application on real samples. The role of nanotechnology in the construction of immunological biosensors, that is, immunosensors, has contributed to the improvement of sensitivity, since they are based in the affinity between antibody and antigen. Other analytes than biomarkers such as hormones, pathogenic bacteria, and virus have also been detected by immunosensors for clinical point-of-care applications. In this chapter, we first introduced the various types of immunosensors and discussed their applications in clinical diagnostics over the recent 6 years, mainly as point-of-care technologies for the determination of cardiac and cancer biomarkers, hormones, pathogenic bacteria, and virus. The future perspectives of these devices in the field of clinical diagnostics are also evaluated.

  17. Diagnostic errors in pediatric radiology

    Energy Technology Data Exchange (ETDEWEB)

    Taylor, George A.; Voss, Stephan D. [Children' s Hospital Boston, Department of Radiology, Harvard Medical School, Boston, MA (United States); Melvin, Patrice R. [Children' s Hospital Boston, The Program for Patient Safety and Quality, Boston, MA (United States); Graham, Dionne A. [Children' s Hospital Boston, The Program for Patient Safety and Quality, Boston, MA (United States); Harvard Medical School, The Department of Pediatrics, Boston, MA (United States)

    2011-03-15

    Little information is known about the frequency, types and causes of diagnostic errors in imaging children. Our goals were to describe the patterns and potential etiologies of diagnostic error in our subspecialty. We reviewed 265 cases with clinically significant diagnostic errors identified during a 10-year period. Errors were defined as a diagnosis that was delayed, wrong or missed; they were classified as perceptual, cognitive, system-related or unavoidable; and they were evaluated by imaging modality and level of training of the physician involved. We identified 484 specific errors in the 265 cases reviewed (mean:1.8 errors/case). Most discrepancies involved staff (45.5%). Two hundred fifty-eight individual cognitive errors were identified in 151 cases (mean = 1.7 errors/case). Of these, 83 cases (55%) had additional perceptual or system-related errors. One hundred sixty-five perceptual errors were identified in 165 cases. Of these, 68 cases (41%) also had cognitive or system-related errors. Fifty-four system-related errors were identified in 46 cases (mean = 1.2 errors/case) of which all were multi-factorial. Seven cases were unavoidable. Our study defines a taxonomy of diagnostic errors in a large academic pediatric radiology practice and suggests that most are multi-factorial in etiology. Further study is needed to define effective strategies for improvement. (orig.)

  18. A guide for diagnostic evaluations

    NARCIS (Netherlands)

    R.W. Peeling; P.G. Smith; P.M.M. Bossuyt

    2010-01-01

    Accurate diagnostic tests have a key role in patient management and the control of most infectious diseases. Unfortunately, in many developing countries, clinical care is often critically compromised by the lack of regulatory controls on the quality of these tests. The information available on the p

  19. A guide for diagnostic evaluations

    NARCIS (Netherlands)

    R.W. Peeling; P.G. Smith; P.M.M. Bossuyt

    2006-01-01

    Accurate diagnostic tests have a key role in patient management and the control of most infectious diseases. Unfortunately, in many developing countries, clinical care is often critically compromised by the lack of regulatory controls on the quality of these tests. The information available on the p

  20. DIAGNOSTICS OF A MODERN CAR

    Directory of Open Access Journals (Sweden)

    Khrapov Y. N.

    2016-04-01

    Full Text Available The article presents a technical diagnostics of a car as a complex of goals and tasks connected with trouble-shooting of mechanisms and systems in order to eliminate them. We have considered the stages of computer diagnostics of different automobile systems such as diagnosing the engine, the brake system, steering and suspension. We have analyzed their components, the ways of troubleshooting and elimination recommendations. The article presents the main troubles transferred from the electronic control unit. The article also presents the stages of diagnosing the engine including external examination, listening to abnormal noises, checking the operating fluids and the engine management system, diagnosing the basic engine systems and checking the cylinders being filled. The article contains the list of main troubles and their reasons. One can also see diagnosing the brake system, its defects and remedies. The article presents diagnostics and repair of the suspender and graphics describing the check of the dismantled shock strut at the stand and tests of the shock strut without being dismantled. We have analyzed computer diagnostics and the problems it solves

  1. Cognitive Diagnostic Modeling Using R

    Science.gov (United States)

    Ravand, Hamdollah

    2015-01-01

    Cognitive diagnostic models (CDM) have been around for more than a decade but their application is far from widespread for mainly two reasons: (1) CDMs are novel, as compared to traditional IRT models. Consequently, many researchers lack familiarity with them and their properties, and (2) Software programs doing CDMs have been expensive and not…

  2. Electronic DNA detection and diagnostics

    NARCIS (Netherlands)

    De, Arpita

    2013-01-01

    The Nanopill project is an ambitious undertaking with the objective to develop an early-warning cancer diagnostic pill that is ingested by the patient. The Nanopill collects intestinal fluid as the pill travels down the intestinal tract, and tests for the presence of a free floating hyper-methylated

  3. Local Sensitivity and Diagnostic Tests

    NARCIS (Netherlands)

    Magnus, J.R.; Vasnev, A.L.

    2004-01-01

    In this paper we confront sensitivity analysis with diagnostic testing.Every model is misspecified, but a model is useful if the parameters of interest (the focus) are not sensitive to small perturbations in the underlying assumptions. The study of the e ect of these violations on the focus is calle

  4. Diagnostic Ultrasound in Gynecologic Diagnosis

    OpenAIRE

    Coates, C. F.

    1983-01-01

    Diagnostic ultrasound is helpful in the assessment of many common gynecological conditions from early teens to the late postmenopause. Female pelvic anatomy and pathology are readily imaged through a distended urinary bladder. In gynecologic cancer, examination of peritoneal cavity, kidneys and liver can suggest metastatic spread, which aids tumor staging.

  5. Diagnostic Criteria for Pediatric MS

    Directory of Open Access Journals (Sweden)

    J Gordon Millichap

    2013-06-01

    Full Text Available Investigators at Northwestern University Feinberg School of Medicine and Ann & Robert H. Lurie Children’s Hospital of Chicago review the diagnostic criteria for pediatric multiple sclerosis, the differential diagnosis, the 2010 McDonald criteria, and Callen criteria.

  6. [Diagnostic dyspraxia and frontal syndrome].

    Science.gov (United States)

    Donnet, A; Schmitt, A; Poncet, M

    1998-05-01

    A 27-year-old ambidexter woman experienced a clinical and psychometric frontal syndrome associated with a partial callosal syndrome following transcallosal surgery for an intraventricular neurocytoma. She also complained of difficulties with her left hand which realized a particular form of diagnostic dyspraxia: there were specific features of an isolated dysfunction of the control of the realization of a program.

  7. When Diagnostic Labels Mask Trauma

    Science.gov (United States)

    Foltz, Robert; Dang, Sidney; Daniels, Brian; Doyle, Hillary; McFee, Scott; Quisenberry, Carolyn

    2013-01-01

    A growing body of research shows that many seriously troubled children and adolescents are reacting to adverse life experiences. Yet traditional diagnostic labels are based on checklists of surface symptoms. Distracted by disruptive behavior, the common response is to medicate, punish, or exclude rather than respond to needs of youth who have…

  8. Laser Diagnostics for Reacting Flows

    Science.gov (United States)

    2010-01-11

    absorption diagnostic for vapor-phase measurements in an evaporating n-decane aerosol,” Appied Physics B. 97, 215-225, (2009). 30. J.M. Porter, J.B...fluorescence of toluene for time- resolved imaging of gaseous flows,” Appied Physics B, 2010, in press. 35. J.M. Porter, J.B. Jeffries and R.K. Hanson

  9. Diagnostic discrepancies in clinical practice

    Science.gov (United States)

    Issa, Victor Sarli; Dinardi, Layara Fernanda Lipari; Pereira, Thiago Vicente; de Almeida, Lyna Kyria Rodrigues; Barbosa, Thaisa Silveira; Benvenutti, Luiz Alberto; Ayub-Ferreira, Silvia Moreira; Bocchi, Edimar Alcides

    2017-01-01

    Abstract Autopsies are the gold standard for diagnostic accuracy; however, no recent study has analyzed autopsies in heart failure (HF). We reviewed 1241 autopsies (January 2000–May 2005) and selected 232 patients with HF. Clinical and autopsy diagnoses were analyzed and discrepancies categorized according to their importance regarding therapy and prognosis. Mean age was 63.3 ± 15.9 years; 154 (66.4%) patients were male. The causes of death at autopsy were end-stage HF (40.9%), acute myocardial infarction (17.2%), infection (15.9), and pulmonary embolism 36 (15.5). Diagnostic discrepancies occurred in 191 (82.3%) cases; in 56 (24.1%), discrepancies were related to major diagnoses with potential influence on survival or treatment; pulmonary embolism was the cause of death for 24 (42.9%) of these patients. In 35 (15.1%), discrepancies were related to a major diagnosis with equivocal influence on survival or treatment; in 100 (43.1%), discrepancies did not influence survival or treatment. In multivariate analysis, age (OR: 1.03, 95% CI: 1.008–1.052, P = 0.007) and presence of diabetes mellitus (OR: 0.359, 95% CI: 0.168–0.767, P = 0.008) influenced the occurrence discrepancies. Diagnostic discrepancies with a potential impact on prognosis are frequent in HF. These findings warrant reconsideration in diagnostic and therapeutic practices with HF patients. PMID:28121951

  10. Physiological Effects of Nucleotide Supplementation on Resistance Exercise Stress in Men and Women.

    Science.gov (United States)

    Sterczala, Adam J; DuPont, William H; Comstock, Brett A; Flanagan, Shawn D; Szivak, Tunde K; Hooper, David R; Kupchak, Brian R; Lee, Elaine C; Volek, Jeff S; Maresh, Carl M; Kraemer, William J

    2016-02-01

    Nucleotide supplementation can reduce postexercise immunosuppression and hypothalamic-pituitary axis (HPA) axis activation in endurance exercise models. Nucleotide supplementation may aid recovery from other exercise modalities, such as heavy resistance exercise. Thus, the purpose of this investigation was to investigate the effects of nucleotide supplementation on the acute cortisol and immune responses to heavy resistance exercise and its effects on recovery. A double-blinded, crossover, mixed methods design with 10 men and 10 women was used. Each performed an acute heavy resistance exercise protocol (AHREP) after a loading period with a nucleotide or placebo supplement. Before and after the AHREP, and at 24, 48, and 72 hours post, blood samples were analyzed for cortisol, myeloperoxidase (MPO), and absolute neutrophil, lymphocyte, and monocyte counts. Creatine kinase (CK) was analyzed before and 24, 48, and 72 hours after the AHREP. Performance measures, including peak back squat isometric force and peak countermovement jump power were also analyzed. Nucleotide supplementation resulted in significant (p ≤ 0.05) decreases in cortisol and MPO immediately after the AHREP, and significantly lower CK values 24 hours later. The AHREP significantly affected leukocyte counts; however, no treatment effects were observed. Greater isometric force was observed immediately after AHREP and at 24 hours and 48 hours with nucleotide supplementation. Nucleotide supplementation seems to attenuate muscle damage, HPA axis and immune system activation, and performance decrements after heavy resistance exercise.

  11. The study of neighboring nucleotide composition and transition/transversion bias

    Institute of Scientific and Technical Information of China (English)

    ZHAO Hui; LI Qizhai; LI Jun; ZENG Changqing; HU Songnian; YU Jun

    2006-01-01

    Base substitution is one of the raw fuels that produce genetic variation and drive evolution. Recent studies have shown that the genome components affect mutation patterns to some extent. In order to infer the correlation between the Transition/Transversion ratio (Ts/Tv) and the number of immediately adjacent A&T nucleotides, we investigated 3611007 Oryza sativa SNPs (including 45462 coding SNPs, and 242811 intronic SNPs) and 32019 Arabidopsis SNPs. The results show that Ts/Tv is negatively correlated with the number of immediately adjacent A&T in O. sativa and Arabidopsis. We further calculated AT2 (the number of SNPs whose immediately adjacent nucleotides are either A or T) and AT0 (the number of SNPs whose immediately adjacent nucleotides are either C or G) for all 6 types of SNPs. C/G SNP of O. sativa and Arabidopsis has the highest AT2/AT0, which denotes C/G SNP may be influenced by the adjacent A&T nucleotides mostly. For SNPs in O. sativa, the neighboring effect of A&T nucleotides is limited to 2 nucleotides on both sides; for SNPs in Arabidopsis, the effect extends no more than 4 nucleotides on both sides.

  12. Old concepts, new molecules and current approaches applied to the bacterial nucleotide signalling field

    Science.gov (United States)

    2016-01-01

    Signalling nucleotides are key molecules that help bacteria to rapidly coordinate cellular pathways and adapt to changes in their environment. During the past 10 years, the nucleotide signalling field has seen much excitement, as several new signalling nucleotides have been discovered in both eukaryotic and bacterial cells. The fields have since advanced quickly, aided by the development of important tools such as the synthesis of modified nucleotides, which, combined with sensitive mass spectrometry methods, allowed for the rapid identification of specific receptor proteins along with other novel genome-wide screening methods. In this review, we describe the principle concepts of nucleotide signalling networks and summarize the recent work that led to the discovery of the novel signalling nucleotides. We also highlight current approaches applied to the research in the field as well as resources and methodological advances aiding in a rapid identification of nucleotide-specific receptor proteins. This article is part of the themed issue ‘The new bacteriology’. PMID:27672152

  13. ITER diagnostics ex-vessel engineering services

    Energy Technology Data Exchange (ETDEWEB)

    Arumugam, A.P., E-mail: arun.prakash@iter.org; Walker, C.I.; Andrew, P.; Barnsley, R.; Beltran, D.; Bertalot, L.; Dammann, A.; Direz, M.F.; Drevon, J.M.; Encheva, A.; Giacomin, T.; Hourtoule, J.; Kuehn, I.; Lanza, R.; Levesy, B.; Maquet, P.; Patel, K.M.; Patisson, L.; Pitcher, C.S.; Portales, M.; and others

    2013-10-15

    Highlights: • This paper describes about the ITER diagnostics ex-vessel engineering services. • It describes various diagnostics systems, its location and its environment. • Diagnostics interfaces with other services such as the buildings, HVAC, electrical services, cooling water, vacuum, liquid and gas distribution. • All the interfaces with these services are identified and defined. • Buildings services for diagnostics, such as penetrations, local shielding, embedment and temperature control are discussed. -- Abstract: Extensive diagnostics systems will be installed on the ITER machine to provide the measurements necessary to control, evaluate and optimize plasma performance in ITER and to further the understanding of plasma physics. These include measurements of temperature, density, impurity concentration, and particle and energy confinement times. ITER diagnostic systems extend from the center of the Tokamak to the various diagnostic areas, where they are controlled and acquired data is processed. This mainly includes the areas such as ports, port cells, gallery, diagnostics enclosures and cubicle areas. The diagnostics port plugs encloses the front end of the diagnostic systems and the diagnostics building houses the diagnostics equipment, instrumentation and control cubicles. There are several systems providing services to diagnostics. These mainly include ITER buildings, electrical power services, cooling water services, Heating Ventilation and Air Conditioning (HVAC), vacuum services, liquid and gas distribution services, cable engineering, de-tritiation systems, control cubicles, etc. Requirements of these service systems have to be defined, even though many of the diagnostics are at an early stage of development. It is a real challenge to define and to design diagnostics systems considering the constraints imposed by these service systems. This paper summarizes the provision of these services to the individual diagnostics and diagnostics areas

  14. Study of SV40 large T antigen nucleotide specificity for DNA unwinding.

    Science.gov (United States)

    Wang, Damian; Álvarez-Cabrera, Ana Lucia; Chen, Xiaojiang S

    2017-04-14

    Simian Virus 40 (SV40) Large Tumor Antigen (LT) is an essential enzyme that plays a vital role in viral DNA replication in mammalian cells. As a replicative helicase and initiator, LT assembles as a double-hexamer at the SV40 origin to initiate genomic replication. In this process, LT converts the chemical energy from ATP binding and hydrolysis into the mechanical work required for unwinding replication forks. It has been demonstrated that even though LT primarily utilizes ATP to unwind DNA, other NTPs can also support low DNA helicase activity. Despite previous studies on specific LT residues involved in ATP hydrolysis, no systematic study has been done to elucidate the residues participating in the selective usage of different nucleotides by LT. In this study, we performed a systematic mutational analysis around the nucleotide pocket and identified residues regulating the specificity for ATP, TTP and UTP in LT DNA unwinding. We performed site-directed mutagenesis to generate 16 LT nucleotide pocket mutants and characterized each mutant's ability to unwind double-stranded DNA, oligomerize, and bind different nucleotides using helicase assays, size-exclusion chromatography, and isothermal titration calorimetry, respectively. We identified four residues in the nucleotide pocket of LT, cS430, tK419, cW393 and cL557 that selectively displayed more profound impact on using certain nucleotides for LT DNA helicase activity. Little is known regarding the mechanisms of nucleotide specificity in SV40 LT DNA unwinding despite the abundance of information available for understanding LT nucleotide hydrolysis. The systematic residue analysis performed in this report provides significant insight into the selective usage of different nucleotides in LT helicase activity, increasing our understanding of how LT may structurally prefer different energy sources for its various targeted cellular activities.

  15. Dietary Nucleotides Supplementation and Liver Injury in Alcohol-Treated Rats: A Metabolomics Investigation

    Directory of Open Access Journals (Sweden)

    Xiaxia Cai

    2016-03-01

    Full Text Available Background: Previous studies suggested that nucleotides were beneficial for liver function, lipid metabolism and so on. The present study aimed to investigate the metabolic response of dietary nucleotides supplementation in alcohol-induced liver injury rats. Methods: Five groups of male Wistar rats were used: normal control group (basal diet, equivalent distilled water, alcohol control group (basal diet, 50% alcohol (v/v, dextrose control group (basal diet, isocaloric amount of dextrose, and 0.04% and 0.16% nucleotides groups (basal diet supplemented with 0.4 g and 1.6 g nucleotides kg−1 respectively, 50% alcohol (v/v. The liver injury was measured through traditional liver enzymes, expression of oxidative stress markers and histopathological examination. Ultra-performance liquid chromatography quadrupole-time-flight mass spectrometry (UPLC-Q-TOF-MS was applied to identify liver metabolite profiles. Results: Nucleotides supplementation prevented the progression of hepatocyte steatosis. The levels of total proteins, globulin, alanine aminotransferase, aspartate aminotransferase, total cholesterol triglyceride, as well as the oxidative stress markers altered by alcohol, were improved by nucleotides supplementation. Elevated levels of liver bile acids (glycocholic acid, chenodeoxyglycocholic acid, and taurodeoxycholic acid, as well as lipids (stearic acid, palmitic acid, oleic acid, phosphatidylcholine, and lysophosphatidylethanolamine in alcohol-treated rats were reversed by nucleotides supplementation. In addition, supplementation with nucleotides could increase the levels of amino acids, including valyl-Leucine, l-leucine, alanyl-leucine and l-phenylalanine. Conclusion: These data indicate potential biomarkers and confirm the benefit of dietary nucleotides on alcoholic liver injury.

  16. A novel genome signature based on inter-nucleotide distances profiles for visualization of metagenomic data

    Science.gov (United States)

    Xie, Xian-Hua; Yu, Zu-Guo; Ma, Yuan-Lin; Han, Guo-Sheng; Anh, Vo

    2017-09-01

    There has been a growing interest in visualization of metagenomic data. The present study focuses on the visualization of metagenomic data using inter-nucleotide distances profile. We first convert the fragment sequences into inter-nucleotide distances profiles. Then we analyze these profiles by principal component analysis. Finally the principal components are used to obtain the 2-D scattered plot according to their source of species. We name our method as inter-nucleotide distances profiles (INP) method. Our method is evaluated on three benchmark data sets used in previous published papers. Our results demonstrate that the INP method is good, alternative and efficient for visualization of metagenomic data.

  17. Effects of six anaesthetic agents on UDP-glucuronic acid and other nucleotides in rat liver.

    Science.gov (United States)

    Christensson, P I; Eriksson, G

    1985-08-01

    Anaesthesia affects the liver nucleotide pool. It was the aim of the present study to examine how anaesthesia for 60 min with pentobarbital, ketamin + diazepam, halothane, enflurane and isoflurane may influence the nucleotide pool in the rat liver, studied with isotachophoresis. It was found that none of the agents gave both safe and reproducible anaesthesia without affecting the nucleotide pools or affecting the experiments in some other way. Halothane and isoflurane were the two best alternatives with respect to both efficiency and safety. Isoflurane may be preferable since it gives a higher energy charge.

  18. Changes of cytokinin nucleotides in an anise cell culture (Pimpinella anisum L.) during growth and embryogenesis.

    Science.gov (United States)

    Ernst, D; Oesterhelt, D

    1985-05-01

    Endogenous levels of cytokinin nucleotides in an anise cell culture were determined during proembryonal, as well as embryonal development. In both cultures the maximum level of isopentenyladenine nucleotides was found during the first four days of incubation which correlated with the beginning of logarithmic growth (embryonal: 8 ng g(-1) tresh weight; proembryonal: 17.4 ng g(-1) fresh weight). The concentration of zeatin nucleotides remained constant at a very low level. The present data and those of Ernst et al. (1984) and Ernst and Oesterhelt (1984) are concerned in ascribing a major role to cytokinins in cell division, but not in embryo differentiation.

  19. Myosin individualized: single nucleotide polymorphisms in energy transduction

    Directory of Open Access Journals (Sweden)

    Wieben Eric D

    2010-03-01

    Full Text Available Abstract Background Myosin performs ATP free energy transduction into mechanical work in the motor domain of the myosin heavy chain (MHC. Energy transduction is the definitive systemic feature of the myosin motor performed by coordinating in a time ordered sequence: ATP hydrolysis at the active site, actin affinity modulation at the actin binding site, and the lever-arm rotation of the power stroke. These functions are carried out by several conserved sub-domains within the motor domain. Single nucleotide polymorphisms (SNPs affect the MHC sequence of many isoforms expressed in striated muscle, smooth muscle, and non-muscle tissue. The purpose of this work is to provide a rationale for using SNPs as a functional genomics tool to investigate structurefunction relationships in myosin. In particular, to discover SNP distribution over the conserved sub-domains and surmise what it implies about sub-domain stability and criticality in the energy transduction mechanism. Results An automated routine identifying human nonsynonymous SNP amino acid missense substitutions for any MHC gene mined the NCBI SNP data base. The routine tested 22 MHC genes coding muscle and non-muscle isoforms and identified 89 missense mutation positions in the motor domain with 10 already implicated in heart disease and another 8 lacking sequence homology with a skeletal MHC isoform for which a crystallographic model is available. The remaining 71 SNP substitutions were found to be distributed over MHC with 22 falling outside identified functional sub-domains and 49 in or very near to myosin sub-domains assigned specific crucial functions in energy transduction. The latter includes the active site, the actin binding site, the rigid lever-arm, and regions facilitating their communication. Most MHC isoforms contained SNPs somewhere in the motor domain. Conclusions Several functional-crucial sub-domains are infiltrated by a large number of SNP substitution sites suggesting these

  20. Single nucleotide polymorphism discovery in elite north american potato germplasm

    Directory of Open Access Journals (Sweden)

    De Jong Walter S

    2011-06-01

    Full Text Available Abstract Background Current breeding approaches in potato rely almost entirely on phenotypic evaluations; molecular markers, with the exception of a few linked to disease resistance traits, are not widely used. Large-scale sequence datasets generated primarily through Sanger Expressed Sequence Tag projects are available from a limited number of potato cultivars and access to next generation sequencing technologies permits rapid generation of sequence data for additional cultivars. When coupled with the advent of high throughput genotyping methods, an opportunity now exists for potato breeders to incorporate considerably more genotypic data into their decision-making. Results To identify a large number of Single Nucleotide Polymorphisms (SNPs in elite potato germplasm, we sequenced normalized cDNA prepared from three commercial potato cultivars: 'Atlantic', 'Premier Russet' and 'Snowden'. For each cultivar, we generated 2 Gb of sequence which was assembled into a representative transcriptome of ~28-29 Mb for each cultivar. Using the Maq SNP filter that filters read depth, density, and quality, 575,340 SNPs were identified within these three cultivars. In parallel, 2,358 SNPs were identified within existing Sanger sequences for three additional cultivars, 'Bintje', 'Kennebec', and 'Shepody'. Using a stringent set of filters in conjunction with the potato reference genome, we identified 69,011 high confidence SNPs from these six cultivars for use in genotyping with the Infinium platform. Ninety-six of these SNPs were used with a BeadXpress assay to assess allelic diversity in a germplasm panel of 248 lines; 82 of the SNPs proved sufficiently informative for subsequent analyses. Within diverse North American germplasm, the chip processing market class was most distinct, clearly separated from all other market classes. The round white and russet market classes both include fresh market and processing cultivars. Nevertheless, the russet and round

  1. Predicting protein-binding RNA nucleotides using the feature-based removal of data redundancy and the interaction propensity of nucleotide triplets.

    Science.gov (United States)

    Choi, Sungwook; Han, Kyungsook

    2013-11-01

    Several learning approaches have been used to predict RNA-binding amino acids in a protein sequence, but there has been little attempt to predict protein-binding nucleotides in an RNA sequence. One of the reasons is that the differences between nucleotides in their interaction propensity are much smaller than those between amino acids. Another reason is that RNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding RNA nucleotides is much harder than predicting RNA-binding amino acids. We developed a new method that removes data redundancy in a training set of sequences based on their features. The new method constructs a larger and more informative training set than the standard redundancy removal method based on sequence similarity, and the constructed dataset is guaranteed to be redundancy-free. We computed the interaction propensity (IP) of nucleotide triplets by applying a new definition of IP to an extensive dataset of protein-RNA complexes, and developed a support vector machine (SVM) model to predict protein binding sites in RNA sequences. In a 5-fold cross-validation with 812 RNA sequences, the SVM model predicted protein-binding nucleotides with an accuracy of 86.4%, an F-measure of 84.8%, and a Matthews correlation coefficient of 0.66. With an independent dataset of 56 RNA sequences that were not used in training, the resulting accuracy was 68.1% with an F-measure of 71.7% and a Matthews correlation coefficient of 0.35. To the best of our knowledge, this is the first attempt to predict protein-binding RNA nucleotides in a given RNA sequence from the sequence data alone. The SVM model and datasets are freely available for academics at http://bclab.inha.ac.kr/primer.

  2. ULTRASOUND DIAGNOSTICS OF RETROCERVICAL ENDOMETRIOSIS

    Directory of Open Access Journals (Sweden)

    R. A. Barto

    2015-01-01

    Full Text Available Background: Endometriosis is one of the major problems in current gynecology due to steady increase of its incidence, involvement of young females, high frequency of infertility and difficulties with diagnostics and treatment. Confirmation of diagnosis of advanced endometriosis is still within the competence of research centers and big federal treatment establishments.Aim: To improve ultrasound diagnostics and to develop an algorithm of assessment in retrocervical endometriosis.Materials and methods: Seventy two females were assessed laparoscopically due to a gynecology disorder or infertility. Based on intraoperational data and results of pathomorphological assessments, two groups were formed: group 1 (control group, n = 26 comprised patients in reproductive age who had been admitted for elective surgery due to a gynecological disorder. Group 2 (main group, n = 46 included patients with various types of endometriosis. Patients from group 2 were divided into 3 subgroups: 2а (n = 17 – with superficial forms of external genital endometriosis; 2b (n = 18 – with endometrioid cysts; 2c (n = 11 – with deep infiltrative types of endometriosis.Results: Patients with superficial external genital endometriosis were characterized by positive symptom of “folding” (“freezing” of posterior uterine surface and of the walls of adjacent intestine. In endometriosis of posterior surface of cervix uteri, the diagnosis made by an ultrasound assessmentin 100% matched the diagnosis set during surgery, whereas if sacrouterine ligaments were involved, the diagnostic match was only 3%. In the group of patients with endometrioid cysts, in most of cases the cysts had specific ultrasound signs; coincidence of an ultrasound and a morphological diagnosis was seen in 98% of cases. Most cases of deep infiltrative endometriosis showed involvement of sacrouterine ligaments (72% and of parametrium (81%. There was a positive folding sign and a “Indian headdress

  3. Diagnostics

    DEFF Research Database (Denmark)

    Donné, A.J.H.; Costley, A.E.; Barnsley, R.

    2007-01-01

    In order to support the operation of ITER and the planned experimental programme an extensive set of plasma and first wall measurements will be required. The number and type of required measurements will be similar to those made on the present-day large tokamaks while the specification of the mea...

  4. 37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.

    Science.gov (United States)

    2010-07-01

    ... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data...

  5. Heteropolymeric triplex-based genomic assay to detect pathogens or single-nucleotide polymorphisms in human genomic samples.

    Directory of Open Access Journals (Sweden)

    Jasmine I Daksis

    Full Text Available Human genomic samples are complex and are considered difficult to assay directly without denaturation or PCR amplification. We report the use of a base-specific heteropolymeric triplex, formed by native duplex genomic target and an oligonucleotide third strand probe, to assay for low copy pathogen genomes present in a sample also containing human genomic duplex DNA, or to assay human genomic duplex DNA for Single Nucleotide Polymorphisms (SNP, without PCR amplification. Wild-type and mutant probes are used to identify triplexes containing FVL G1691A, MTHFR C677T and CFTR mutations. The specific triplex structure forms rapidly at room temperature in solution and may be detected without a separation step. YOYO-1, a fluorescent bis-intercalator, promotes and signals the formation of the specific triplex. Genomic duplexes may be assayed homogeneously with single base pair resolution. The specific triple-stranded structures of the assay may approximate homologous recombination intermediates, which various models suggest may form in either the major or minor groove of the duplex. The bases of the stable duplex target are rendered specifically reactive to the bases of the probe because of the activity of intercalated YOYO-1, which is known to decondense duplex locally 1.3 fold. This may approximate the local decondensation effected by recombination proteins such as RecA in vivo. Our assay, while involving triplex formation, is sui generis, as it is not homopurine sequence-dependent, as are "canonical triplexes". Rather, the base pair-specific heteropolymeric triplex of the assay is conformation-dependent. The highly sensitive diagnostic assay we present allows for the direct detection of base sequence in genomic duplex samples, including those containing human genomic duplex DNA, thereby bypassing the inherent problems and cost associated with conventional PCR based diagnostic assays.

  6. Advances in medical diagnostic technology

    CERN Document Server

    Lai, Khin Wee; Mohamad Salim, Maheza Irna; Ong, Sang-Bing; Utama, Nugraha Priya; Myint, Yin Mon; Mohd Noor, Norliza; Supriyanto, Eko

    2014-01-01

    This book provides the most recent findings and knowledge in advanced diagnostics technology, covering a wide spectrum including brain activity analysis, breast and lung cancer detection, echocardiography, computer aided skeletal assessment to mitochondrial biology imaging at the cellular level. The authors explored magneto acoustic approaches and tissue elasticity imaging for the purpose of breast cancer detection. Perspectives in fetal echocardiography from an image processing angle are included. Diagnostic imaging in the field of mitochondrial diseases as well as the use of Computer-Aided System (CAD) are also discussed in the book. This book will be useful for students, lecturers or professional researchers in the field of biomedical sciences and image processing.

  7. Huntington Disease: Molecular Diagnostics Approach.

    Science.gov (United States)

    Bastepe, Murat; Xin, Winnie

    2015-10-06

    Huntington disease (HD) is caused by expansion of a CAG trinucleotide repeat in the first exon of the Huntingtin (HTT) gene. Molecular testing of Huntington disease for diagnostic confirmation and disease prediction requires detection of the CAG repeat expansion. There are three main types of HD genetic testing: (1) diagnostic testing to confirm or rule out disease, (2) presymptomatic testing to determine whether an at-risk individual inherited the expanded allele, and (3) prenatal testing to determine whether the fetus has inherited the expanded allele. This unit includes protocols that describe the complementary use of polymerase chain reactions (PCR) and Southern blot hybridization to accurately measure the CAG trinucleotide repeat size and interpret the test results. In addition, an indirect linkage analysis that does not reveal the unwanted parental HD status in a prenatal testing will also be discussed.

  8. SALIVA AS A DIAGNOSTIC FLUID

    Directory of Open Access Journals (Sweden)

    Pezelj-Ribarić Sonja

    2015-12-01

    Full Text Available Saliva is a readily available oral fluid with many functions, from digestion, maintenance of oral tissues' integrity, to caries prevention. Changes regarding its secretion may be divided into qualitative and quantitative: both of them are a consequence of certain conditions/diseases (e.g. internal factors or nutrients/drugs ingested (e.g. external factors. During the last 15 years, technological advances gave a significant momentum to utilization of saliva as a diagnostic tool. Analysis of saliva, just like the blood analysis, has two main objectives: to identify the subjects suffering from a certain disorder, and to follow the development and progress of therapy. This paper provides an overview of possibilities for the use of saliva for diagnostic purposes and gives specific examples of some clinical investigations, with the final aim to stimulate the use of this noninvasive means for the health care promotion.

  9. [Diagnostic workup of fragrance allergy].

    Science.gov (United States)

    Geier, J; Uter, W

    2015-09-01

    The diagnostic workup of contact allergy to fragrances must not be limited to patch testing with the two well-established fragrance mixes. False-positive reactions to these mixes occur in up to 50 % of the patch tested patients. For the diagnostic work-up of positive reactions, and in cases of suspected fragrance allergy, patch testing with the single mix components and additional fragrances is mandatory. Frequently sensitizing fragrance materials are the 14 components of the two fragrance mixes and tree moss (Evernia furfuracea), ylang ylang oil (I + II; Cananga odorata), lemongrass oil (Cymbopogon schoenanthus), sandalwood oil (Santalum album), jasmine absolute (Jasminum spp.), and, less frequently, clove oil (Eugenia caryophyllus), cedarwood oil (Cedrus atlantica/deodara, Juniperus virginiana), Neroli oil (Citrus aurantium amara flower oil), salicylaldehyde, narcissus absolute (Narcissus spp.), and patchouli oil (Pogostemon cablin).

  10. Novette diagnostic support. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Cirigliano, R.; Franco, E.; Koppel, L.; Rodrigues, B.; Smith, J.

    1985-02-01

    The primary research areas were the following: (1) contribute x-ray diagnostic, experimental, and data reduction and analysis support for the Novette DANTE x-ray spectrometer experiments. This effort was expanded to improve the overall quality of the Novette database; (2) experimental and calculational characterization of the x-ray imaging properties of an ellipsoidal x-ray collection optic serving as a sensitivity enhancing component of the Transmission Grating Streak Spectrometer; (3) performance simulation of the x-ray dispersion properties of candidate x-ray laser cavity, normal incidence end-mirror optics; (4) contribute x-ray diagnostic, experimental, and data reduction and analysis support for the Novette Henway crystal spectrometer and the MCPIGS microchannel plate intensified grazing incident spectrometer experiments; and (5) perform a technical performance vs cost evaluation of commercially available hardware required to perform the NOVA neutron time-of-flight experiments.

  11. Hebephilia: quintessence of diagnostic pretextuality.

    Science.gov (United States)

    Franklin, Karen

    2010-01-01

    Hebephilia is an archaic term used to describe adult sexual attraction to adolescents. Prior to the advent of contemporary sexually violent predator laws, the term was not found in any dictionary or formal diagnostic system. Overnight, it is on the fast track toward recognition as a psychiatric condition meriting inclusion in the upcoming fifth edition of the Diagnostic and Statistical Manual of Mental Disorders. This article traces the sudden emergence and popularity of hebephilia to pressure from the legal arena and, specifically, to the legal mandate of a serious mental abnormality for civil commitment of sex offenders. Hebephilia is proposed as a quintessential example of pretextuality, in which special interests promote a pseudoscientific construct that furthers an implicit, instrumental goal. Inherent problems with the construct's reliability and validity are discussed. A warning is issued about unintended consequences if hebephilia or its relative, pedohebephilia, make their way into the DSM-5, due out in 2013. Copyright © 2010 John Wiley & Sons, Ltd.

  12. Saliva as a diagnostic fluid.

    Science.gov (United States)

    Samaranayake, Lakshman

    2007-10-01

    The use of saliva as a diagnostic fluid for various human ailments is gaining popularity as it offers distinct advantages over serum. These include the non-invasive nature of saliva collection compared with phlebotomy, simplicity of collection even for individuals with a modest training and the cost-effective applicability for screening large populations. Whole saliva is most frequently used for diagnosis of systemic diseases since it is readily collected and contains serum constituents while gland-specific saliva is useful for investigating pathology of major salivary glands. Broadly, saliva analysis is currently used for the diagnosis of infectious and malignant diseases, hereditary disorders, autoimmune diseases, and endocrine disorders, as well as for the assessment of therapeutic drug levels, particularly in monitoring drug abuse. This review addresses the current status of salivary diagnostics and their future potential.

  13. Molecular diagnostics and parasitic disease.

    Science.gov (United States)

    Vasoo, Shawn; Pritt, Bobbi S

    2013-09-01

    Molecular parasitology represents an emerging field in microbiology diagnostics. Although most assays use nonstandardized, laboratory-developed methods, a few commercial systems have recently become available and are slowly being introduced into larger laboratories. In addition, a few methodologies show promise for use in field settings in which parasitic infections are endemic. This article reviews the available techniques and their applications to major parasitic diseases such as malaria, leishmaniasis, and trichomoniasis.

  14. [Diagnostic approach to infectious endocarditis].

    Science.gov (United States)

    Parize, Perrine; Mainardi, Jean-Luc

    2012-04-01

    Major advances in imaging and microbiological procedures have changed the diagnostic approach of infective endocarditis. New imaging tools have improved the search of local complications, systemic embolism and diagnosis of infection of cardiac devices. Moreover, microbiological diagnosis has been transformed by molecular techniques as long as these procedures have highlighted microorganisms thus far neglected by classical techniques. Despite these advances, endocarditis remained a clinical diagnosis which still depends on a high index of clinical suspicion.

  15. Laser Diagnostics for Spacecraft Propulsion

    Science.gov (United States)

    2015-10-13

    AFTC/PA Clearance No. XXXX 8 Ion Engines & Hall Thrusters Operation Ion engines and Hall thrusters are electrostatic propulsion devices • Ion Engines... Hall thrusters are gridless electrostatic thrusters – Propellant ionized by electrons trapped in magnetic field – Ions accelerated by an electric field...Briefing Charts 3. DATES COVERED (From - To) 21 September 2015 – 13 October 2015 4. TITLE AND SUBTITLE Laser Diagnostics for Spacecraft Propulsion 5a

  16. Gear Fatigue Diagnostics and Prognostics

    Science.gov (United States)

    2013-01-01

    The first objective was to collect meaningful gear fault progression data starting from healthy NASA-designed spur test gears and ending with failed...and D. P. Townsend, "Analysis of the effects of surface pitting and wear on the vibration of a gear transmission system," Tribology International...Reporting Period: April 15, 2012 to September 27, 2012 Attached is the Gear Fatigue Diagnostics and Prognostics project progress report for the

  17. Biomedical photonics handbook biomedical diagnostics

    CERN Document Server

    Vo-Dinh, Tuan

    2014-01-01

    Shaped by Quantum Theory, Technology, and the Genomics RevolutionThe integration of photonics, electronics, biomaterials, and nanotechnology holds great promise for the future of medicine. This topic has recently experienced an explosive growth due to the noninvasive or minimally invasive nature and the cost-effectiveness of photonic modalities in medical diagnostics and therapy. The second edition of the Biomedical Photonics Handbook presents fundamental developments as well as important applications of biomedical photonics of interest to scientists, engineers, manufacturers, teachers, studen

  18. First rank symptoms: concepts and diagnostic utility

    African Journals Online (AJOL)

    diagnostic criteria for schizophrenia, having initially been proposed by Schneider ... frequency in a given disorder to be diagnostically useful.2. This review, whilst ... and delusional perception appearing in criterion B. In DSM. III11 and DSM IV ...

  19. A diagnostic approach to test priorization

    NARCIS (Netherlands)

    Gonzalez-Sanchez, A.; Abreu, R.; Gross, H.; Van Gemund, A.

    2010-01-01

    In development processes with high code production rates testing typically triggers fault diagnosis to localize the detected failures. However, current test prioritization algorithms are tuned for failure detection rate rather than diagnostic information. Consequently, unnecessary diagnostic effort

  20. Diagnostic performance of screening methods for urinary ...

    African Journals Online (AJOL)

    conducted using various indirect diagnostic tests such as interview ... haematuria and dysuria, visual examination of urine specimen ... Abstract. Background: Indirect diagnostic methods in urinary schistosomiasis are widely used for screening.

  1. Diagnostic guidlines for occupational epicondylitis

    Directory of Open Access Journals (Sweden)

    Patrycja Krawczyk-Szulc

    2015-07-01

    Full Text Available Making final decisions on the occupational etiology of musculoskeletal diseases is often difficult and problematic at every stage of the diagnostic procedure. Taking into account the need to facilitate decision-making about the causal relationship between the diagnosed disease entity and the working conditions guidelines for the recognition of work-related musculoskeletal diseases have been developed. This paper presents the guidelines for the diagnosis of occupational etiology of humeral epicondylitis, one of the most common occupational disease of the musculoskeletal system in Poland. The developed guidelines have been based on the literature data concerning occupational risk factors of humeral epicondylitis, workload classification, including repetitive movements, awkward postures, and force. Some criteria applied in ergonomic evaluation methods were also included. The presented diagnostic guidelines define approximate benchmarks for stating (after excluding non-occupational etiology that the identified humeral epicondylitis, is related to the way of working. Crucial work factors that should be analyzed include an operating time of movements overloading tendons connecting to the epicondyle, repetition and force used to perform occupational activities. The developed guidelines are aimed to facilitate occupational physicians diagnostic and certification procedures in case of humeral epicondylitis and determination whether there is a likelihood of its occupational etiology. Med Pr 2015;66(3:443–450

  2. [Diagnostic guidlines for occupational epicondylitis].

    Science.gov (United States)

    Krawczyk-Szulc, Patrycja; Wągrowska-Koski, Ewa; Puzder, Anna; Markowski, Przemysław; Walusiak-Skorupa, Jolanta

    2015-01-01

    Making final decisions on the occupational etiology of musculoskeletal diseases is often difficult and problematic at every stage of the diagnostic procedure. Taking into account the need to facilitate decision-making about the causal relationship between the diagnosed disease entity and the working conditions guidelines for the recognition of work-related musculoskeletal diseases have been developed. This paper presents the guidelines for the diagnosis of occupational etiology of humeral epicondylitis, one of the most common occupational disease of the musculoskeletal system in Poland. The developed guidelines have been based on the literature data concerning occupational risk factors of humeral epicondylitis, workload classification, including repetitive movements, awkward postures, and force. Some criteria applied in ergonomic evaluation methods were also included. The presented diagnostic guidelines define approximate benchmarks for stating (after excluding non-occupational etiology) that the identified humeral epicondylitis, is related to the way of working. Crucial work factors that should be analyzed include an operating time of movements overloading tendons connecting to the epicondyle, repetition and force used to perform occupational activities. The developed guidelines are aimed to facilitate occupational physicians diagnostic and certification procedures in case of humeral epicondylitis and determination whether there is a likelihood of its occupational etiology.

  3. Portable Diagnostics and Rapid Germination

    Energy Technology Data Exchange (ETDEWEB)

    Dunn, Zachary Spencer [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2016-12-01

    In the Bioenergy and Defense Department of Sandia National Laboratories, characterization of the BaDx (Bacillus anthracis diagnostic cartridge) was performed and rapid germination chemistry was investigated. BaDx was tested with complex sample matrixes inoculated with Bacillus anthracis, and the trials proved that BaDx will detect Bacillus anthracis in a variety of the medium, such as dirt, serum, blood, milk, and horse fluids. The dimensions of the device were altered to accommodate an E. coli or Listeria lateral flow immunoassay, and using a laser printer, BaDx devices were manufactured to identify E. coli and Listeria. Initial testing with E. coli versions of BaDx indicate that the device will be viable as a portable diagnostic cartridge. The device would be more effective with faster bacteria germination; hence studies were performed the use of rapid germination chemistry. Trials with calcium dipicolinic acid displayed increased cell germination, as shown by control studies using a microplate reader. Upon lyophilization the rapid germination chemistry failed to change growth patterns, indicating that the calcium dipicolinic acid was not solubilized under the conditions tested. Although incompatible with the portable diagnostic device, the experiments proved that the rapid germination chemistry was effective in increasing cell germination.

  4. Sequencing Needs for Viral Diagnostics

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Lam, M; Mulakken, N J; Torres, C L; Smith, J R; Slezak, T

    2004-01-26

    We built a system to guide decisions regarding the amount of genomic sequencing required to develop diagnostic DNA signatures, which are short sequences that are sufficient to uniquely identify a viral species. We used our existing DNA diagnostic signature prediction pipeline, which selects regions of a target species genome that are conserved among strains of the target (for reliability, to prevent false negatives) and unique relative to other species (for specificity, to avoid false positives). We performed simulations, based on existing sequence data, to assess the number of genome sequences of a target species and of close phylogenetic relatives (''near neighbors'') that are required to predict diagnostic signature regions that are conserved among strains of the target species and unique relative to other bacterial and viral species. For DNA viruses such as variola (smallpox), three target genomes provide sufficient guidance for selecting species-wide signatures. Three near neighbor genomes are critical for species specificity. In contrast, most RNA viruses require four target genomes and no near neighbor genomes, since lack of conservation among strains is more limiting than uniqueness. SARS and Ebola Zaire are exceptional, as additional target genomes currently do not improve predictions, but near neighbor sequences are urgently needed. Our results also indicate that double stranded DNA viruses are more conserved among strains than are RNA viruses, since in most cases there was at least one conserved signature candidate for the DNA viruses and zero conserved signature candidates for the RNA viruses.

  5. Temporomandibular joint diagnostics using CBCT

    Science.gov (United States)

    Abrahamsson, A-K; Kristensen, M; Arvidsson, L Z

    2015-01-01

    The present review will give an update on temporomandibular joint (TMJ) imaging using CBCT. It will focus on diagnostic accuracy and the value of CBCT compared with other imaging modalities for the evaluation of TMJs in different categories of patients; osteoarthritis (OA), juvenile OA, rheumatoid arthritis and related joint diseases, juvenile idiopathic arthritis and other intra-articular conditions. Finally, sections on other aspects of CBCT research related to the TMJ, clinical decision-making and concluding remarks are added. CBCT has emerged as a cost- and dose-effective imaging modality for the diagnostic assessment of a variety of TMJ conditions. The imaging modality has been found to be superior to conventional radiographical examinations as well as MRI in assessment of the TMJ. However, it should be emphasized that the diagnostic information obtained is limited to the morphology of the osseous joint components, cortical bone integrity and subcortical bone destruction/production. For evaluation of soft-tissue abnormalities, MRI is mandatory. There is an obvious need for research on the impact of CBCT examinations on patient outcome. PMID:25369205

  6. Diagnostic interventions in nuclear medicine

    Energy Technology Data Exchange (ETDEWEB)

    Thrall, J.H.; Swanson, D.P.

    1989-01-01

    Diagnostic interventions in nuclear medicine may be defined as the coadministration of a nonradioactive drug or application of a physical stimulus or physiologic maneuver to enhance the diagnostic utility of a nuclear medicine test. The rationale for each interventional maneuver follows from the physiology or metabolism of the particular organ or organ system under evaluation. Diagnostic inference is drawn from the pattern of change in the biodistribution of the tracer in response to the intervention-induced change in metabolism or function. In current practice, the most commonly performed interventional maneuvers are aimed at studies of the heart, genitourinary system, hepatobiliary system, and gastrointestinal tract. The single most commonly performed interventional study in the United States is the stress Thallium-201 myocardial perfusion scan aimed at the diagnosis of coronary artery disease. The stress portion of the study is accomplished with dynamic leg exercise on a treadmill and is aimed at increasing myocardial oxygen demands. Areas of myocardium distal to hemodynamically significant lesions in the coronary arteries become ischemic at peak stress due to the inability of the stenotic vessel to respond to the oxygen demand/blood flow needs of the myocardium. Ischemic areas are readily recognized as photopenic defects on scans obtained immediately after exercise, with normalization upon delayed imaging. Diuresis renography is aimed at the differential diagnosis of hydroureteronephrosis. By challenging the urinary tract collecting structures with an augmented urine flow, dilated, unobstructed systems can be differentiated from systems with significant mechanical obstruction. 137 references.

  7. Diagnostic and therapeutic peroral cholangioscopy

    Directory of Open Access Journals (Sweden)

    Jong Ho Moon

    2012-01-01

    Full Text Available Peroral cholangioscopy (POC provides direct visualization of the bile duct and facilitates diagnostic or therapeutic intervention. The currently available single-operator POC systems are "Mother-baby" scope system, SpyGlass direct visualization system, and direct POC using a regular ultra-slim upper endoscope. Direct POC using an ultra-slim upper endoscope having a larger 2-mm working channel can provide a valuable and economic solution for evaluating bile-duct lesions. Main diagnostic procedures under direct POC are visual characterization and optically guided target biopsy for the indeterminate bile duct lesion. Image-enhanced endoscopy such as narrow-band imaging has shown promise for more detailed evaluation of mucosal abnormality and can be performed under direct POC. Intracorporeal lithotripsy such as electrohydraulic lithotripsy or laser lithotripsy is a main therapeutic intervention of direct POC for patients with bile duct stones that are resistant to conventional endoscopic stone-removal procedures. Besides, tumor ablation therapy, such as photodynamic therapy and argon plasma coagulation may be also performed using direct POC. Further developments of the endoscope and specialized accessories or devices are expected to facilitate diagnostic and therapeutic role of this cholangioscopic procedure.

  8. Fluorescence diagnostics in oncological gynecology

    Science.gov (United States)

    Belyaeva, Ludmila A.; Adamyan, Leila V.; Kozachenko, Vladimir P.; Stratonnikov, Alexander A.; Stranadko, Eugene F.; Loschenov, Victor B.

    2003-10-01

    The method of fluorescent diagnostics (FD) of tumors is a promising tool that may allow to increase sensitivity of tumor detection especially at initial stages. One of the most promising photosensitizers today is 5-aminolevulinic acid (5-ALA) that, actually, is not photosensitizer itself but precursor of protoporphyrin IX (PpIX). This paper deals with cancer diagnostics in gynecology by means of ALA-induced Pp IX laser-fluorescence spectroscopy. The tissue fluorescence spectra in vivo were studied in patients with various pathologies of ovaries, uterine and vulva after 5-aminolevulinic acid administration. It was shown that different pathologies varies in accumulation of Pp IX. Coefficient of fluorescence kf for normal tissue is not high, but exceptions are endometrium and mucous membrane of uterine tubes. Benign tumors of uterus and ovary have low values of kf, but polyps of endometrium exhibit high kf. Optical express-biopsy is important for diagnosis of ovarian cancer and micrometastatic spread. Coefficients of diagnostic contrast were determined for cancer of endometrium, cervical cancer, vulvar cancer.

  9. DNA Microarray-Based Diagnostics.

    Science.gov (United States)

    Marzancola, Mahsa Gharibi; Sedighi, Abootaleb; Li, Paul C H

    2016-01-01

    The DNA microarray technology is currently a useful biomedical tool which has been developed for a variety of diagnostic applications. However, the development pathway has not been smooth and the technology has faced some challenges. The reliability of the microarray data and also the clinical utility of the results in the early days were criticized. These criticisms added to the severe competition from other techniques, such as next-generation sequencing (NGS), impacting the growth of microarray-based tests in the molecular diagnostic market.Thanks to the advances in the underlying technologies as well as the tremendous effort offered by the research community and commercial vendors, these challenges have mostly been addressed. Nowadays, the microarray platform has achieved sufficient standardization and method validation as well as efficient probe printing, liquid handling and signal visualization. Integration of various steps of the microarray assay into a harmonized and miniaturized handheld lab-on-a-chip (LOC) device has been a goal for the microarray community. In this respect, notable progress has been achieved in coupling the DNA microarray with the liquid manipulation microsystem as well as the supporting subsystem that will generate the stand-alone LOC device.In this chapter, we discuss the major challenges that microarray technology has faced in its almost two decades of development and also describe the solutions to overcome the challenges. In addition, we review the advancements of the technology, especially the progress toward developing the LOC devices for DNA diagnostic applications.

  10. Diagnostics for PLX-alpha

    Science.gov (United States)

    Gilmore, Mark; Hsu, Scott

    2015-11-01

    The goal of the Plasma Liner eXperiment PLX-alpha at Los Alamos National Laboratory is to establish the viability of creating a spherically imploding plasma liner for MIF and HED applications, using a spherical array of supersonic plasma jets launched by innovative contoured-gap coaxial plasma guns. PLX- α experiments will focus in particular on establishing the ram pressure and uniformity scalings of partial and fully spherical plasma liners. In order to characterize these parameters experimentally, a suite of diagnostics is planned, including multi-camera fast imaging, a 16-channel visible interferometer (upgraded from 8 channels) with reconfigurable, fiber-coupled front end, and visible and VUV high-resolution and survey spectroscopy. Tomographic reconstruction and data fusion techniques will be used in conjunction with interferometry, imaging, and synthetic diagnostics from modeling to characterize liner uniformity in 3D. Diagnostic and data analysis design, implementation, and status will be presented. Supported by the Advanced Research Projects Agency - Energy - U.S. Department of Energy.

  11. Diagnostic Measurements for Power Transformers

    Directory of Open Access Journals (Sweden)

    Stefan Tenbohlen

    2016-05-01

    Full Text Available With the increasing age of the primary equipment of the electrical grids there exists also an increasing need to know its internal condition. For this purpose, off- and online diagnostic methods and systems for power transformers have been developed in recent years. Online monitoring is used continuously during operation and offers possibilities to record the relevant stresses which can affect the lifetime. The evaluation of these data offers the possibility of detecting oncoming faults early. In comparison to this, offline methods require disconnecting the transformer from the electrical grid and are used during planned inspections or when the transformer is already failure suspicious. This contribution presents the status and current trends of different diagnostic techniques of power transformers. It provides significant tutorial elements, backed up by case studies, results and some analysis. The broadness and improvements of the presented diagnostic techniques show that the power transformer is not anymore a black box that does not allow a view into its internal condition. Reliable and accurate condition assessment is possible leading to more efficient maintenance strategies.

  12. Nucleotide sequences of two Korean isolates of Cucumber green mottle mosaic virus.

    Science.gov (United States)

    Kim, Sang-Min; Lee, Jung-Myung; Yim, Kyu-Ock; Oh, Man-Ho; Park, Jin-Woo; Kim, Kook-Hyung

    2003-12-31

    The nucleotide sequences of the genomic RNAs of Cucumber green mottle mosaic virus Korean watermelon isolate (CGMMV-KW) and Korean oriental melon isolate (CGMMV-KOM) were determined and compared to the sequences of other tobamoviruses including CGMMV strains W and SH. Each CGMMV isolate had a genome of 6,424 nucleotides. Each also had 60 and 176 nucleotides of 5' and 3' untranslated regions (UTRs), respectively, and four open reading frames (ORF1-4). ORFs 1 to 4 encode proteins of 129, 186, 29, and 17.4 kDa, respectively. The nucleotide and deduced amino acid sequences of CGMMV-KOM and CGMMV-KW were more than 98.3% identical. When compared to other CGMMV strains in a phylogenetic analysis they were found to form a distinct virus clade, and were more distantly related to other tobamoviruses (23.5-56.7% identity).

  13. Structural basis of transcription: nucleotide selection by rotation in the RNA polymerase II active center.

    Science.gov (United States)

    Westover, Kenneth D; Bushnell, David A; Kornberg, Roger D

    2004-11-12

    Binding of a ribonucleoside triphosphate to an RNA polymerase II transcribing complex, with base pairing to the template DNA, was revealed by X-ray crystallography. Binding of a mismatched nucleoside triphosphate was also detected, but in an adjacent site, inverted with respect to the correctly paired nucleotide. The results are consistent with a two-step mechanism of nucleotide selection, with initial binding to an entry (E) site beneath the active center in an inverted orientation, followed by rotation into the nucleotide addition (A) site for pairing with the template DNA. This mechanism is unrelated to that of single subunit RNA polymerases and so defines a new paradigm for the large, multisubunit enzymes. Additional findings from these studies include a third nucleotide binding site that may define the length of backtracked RNA; DNA double helix unwinding in advance of the polymerase active center; and extension of the diffraction limit of RNA polymerase II crystals to 2.3 A.

  14. The interaction of the Eco R1 restriction enzyme E.coli with nucleotides

    Energy Technology Data Exchange (ETDEWEB)

    Hollis, Donald F. [Univ. of California, Berkeley, CA (United States)

    1979-11-01

    The Eco R1 restriction enzyme can be shown to be inhibited by nucleotides which correspond to any part of its known site of phosphodiesterase activity. A series of di-, tetra-, and hexa-nucleotide fragments were synthesized and their effect on the activity of the enzyme upon superhelical Co1 E1 DNA studied. The inhibition caused by the individual mononucleotides were also studied. In general all the nucleotide fragments showed some form of interaction with the enzyme system. Tetranucleotides were stronger inhibitors than dinucleotides, which in turn were stronger inhibitors than the mononucleotides. Within each category of inhibitors, those containing the phosphodiester bond which is acted upon by the enzyme were the strongest inhibitors. Only those fragments which were consistent with the enzymes site of activity showed competitive inhibition kinetics. Nucleotides which do not fit within the site of phosphodiesterase activity show non-competitive inhibition kinetics.

  15. Mayaro virus: complete nucleotide sequence and phylogenetic relationships with other alphaviruses.

    Science.gov (United States)

    Lavergne, Anne; de Thoisy, Benoît; Lacoste, Vincent; Pascalis, Hervé; Pouliquen, Jean-François; Mercier, Véronique; Tolou, Hugues; Dussart, Philippe; Morvan, Jacques; Talarmin, Antoine; Kazanji, Mirdad

    2006-05-01

    Mayaro (MAY) virus is a member of the genus Alphavirus in the family Togaviridae. Alphaviruses are distributed throughout the world and cause a wide range of diseases in humans and animals. Here, we determined the complete nucleotide sequence of MAY from a viral strain isolated from a French Guianese patient. The deduced MAY genome was 11,429 nucleotides in length, excluding the 5' cap nucleotide and 3' poly(A) tail. Nucleotide and amino acid homologies, as well as phylogenetic analyses of the obtained sequence confirmed that MAY is not a recombinant virus and belongs to the Semliki Forest complex according to the antigenic complex classification. Furthermore, analyses based on the E1 region revealed that MAY is closely related to Una virus, the only other South American virus clustering with the Old World viruses. On the basis of our results and of the alphaviruses diversity and pathogenicity, we suggest that alphaviruses may have an Old World origin.

  16. The nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.

    OpenAIRE

    Takaiwa, F; Kusuda, M; Saga, N; Sugiura, M

    1982-01-01

    The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).

  17. Nucleoside, nucleotide and oligonucleotide based amphiphiles: a successful marriage of nucleic acids with lipids.

    Science.gov (United States)

    Gissot, Arnaud; Camplo, Michel; Grinstaff, Mark W; Barthélémy, Philippe

    2008-04-21

    Amphiphilic molecules based on nucleosides, nucleotides and oligonucleotides are finding more and more biotechnological applications. This Perspective highlights their synthesis, supramolecular organization as well as their applications in the field of biotechnology.

  18. The Label-Free Unambiguous Detection and Symbolic Display of Single Nucleotide Polymorphisms on DNA Origami

    Science.gov (United States)

    Subramanian, Hari K. K.; Chakraborty, Banani; Sha, Ruojie; Seeman, Nadrian C.

    2011-01-01

    Single Nucleotide Polymorphisms (SNPs) are the most common genetic variation in the human genome. Kinetic methods based on branch migration have proved successful for detecting SNPs because a mispair inhibits the progress of branch migration in the direction of the mispair. We have combined the effectiveness of kinetic methods with AFM of DNA origami patterns to produce a direct visual readout of the target nucleotide contained in the probe sequence. The origami contains graphical representations of the four nucleotide alphabetic characters, A, T, G and C, and the symbol containing the test nucleotide identity vanishes in the presence of the probe. The system also works with pairs of probes, corresponding to heterozygous diploid genomes. PMID:21235216

  19. Efficient reverse transcription using locked nucleic acid nucleotides towards the evolution of nuclease resistant RNA aptamers

    DEFF Research Database (Denmark)

    Crouzier, Lucile; Dubois, Camille; Edwards, Stacey L

    2012-01-01

    We found that SuperScript® III Reverse Transcriptase is an efficient enzyme for the recognition of LNA nucleotides, making it a prime candidate to be used in de novo selection of LNA containing RNA aptamers....

  20. Effects of cyclic nucleotide phosphodiesterases (PDEs) on mitochondrial skeletal muscle functions.

    Science.gov (United States)

    Tetsi, Liliane; Charles, Anne-Laure; Paradis, Stéphanie; Lejay, Anne; Talha, Samy; Geny, Bernard; Lugnier, Claire

    2017-05-01

    Mitochondria play a critical role in skeletal muscle metabolism and function, notably at the level of tissue respiration, which conduct muscle strength as well as muscle survival. Pathological conditions induce mitochondria dysfunctions notably characterized by free oxygen radical production disturbing intracellular signaling. In that way, the second messengers, cyclic AMP and cyclic GMP, control intracellular signaling at the physiological and transcription levels by governing phosphorylation cascades. Both nucleotides are specifically and selectively hydrolyzed in their respective 5'-nucleotide by cyclic nucleotide phosphodiesterases (PDEs), which constitute a multi-genic family differently tissue distributed and subcellularly compartmentalized. These PDEs are presently recognized as therapeutic targets for cardiovascular, pulmonary, and neurologic diseases. However, very few data concerning cyclic nucleotides and PDEs in skeletal muscle, specifically in mitochondria, are reported in the literature. The knowledge of PDE implication in mitochondrial signaling would be helpful for resolving critical mitochondrial dysfunctions in skeletal muscle.

  1. Sirtuin 1 gene rs2273773 C>T single nucleotide polymorphism and ...

    African Journals Online (AJOL)

    Aida Abdeen Mahmoud

    2015-12-24

    Dec 24, 2015 ... polymorphism and protein oxidation markers in asthmatic ... In this investigation, we aimed to study SIRT-1 gene rs2273773 C > T single nucleotide polymor- ..... proliferator-activated receptor-c (PPAR-c), PPAR-c coactiva-.

  2. Organization of Nucleotides in Different Environments and the Formation of Pre-Polymers

    OpenAIRE

    Sebastian Himbert; Mindy Chapman; Deamer, David W.; Rheinstädter, Maikel C.

    2016-01-01

    RNA is a linear polymer of nucleotides linked by a ribose-phosphate backbone. Polymerization of nucleotides occurs in a condensation reaction in which phosphodiester bonds are formed. However, in the absence of enzymes and metabolism there has been no obvious way for RNA-like molecules to be produced and then encapsulated in cellular compartments. We investigated 5′-adenosine monophosphate (AMP) and 5′-uridine monophosphate (UMP) molecules confined in multi-lamellar phospholipid bilayers, nan...

  3. Cloning and first functional characterization of a plant cyclic nucleotide-gated cation channel

    Energy Technology Data Exchange (ETDEWEB)

    Leng, Q.; Mercier, R.W.; Yao, W.; Berkowitz, G.A.

    1999-11-01

    Cyclic nucleotide-gated (cng) non-selective cation channels have been cloned from a number of animal systems. These channels are characterized by direct gating upon cAMO or cGMO binding to the intracellular portion of the channel protein, which leads to an increase in channel conductance. Animal cng channels are involved in signal transduction systems; they translate stimulus-induced changes in cytosolic cyclic nucleotide into altered cell membrane potential and/or cation flux as part of a signal cascade pathway. Putative plant homologs of animal cng channels have been identified. However, functional characterization (i.e., demonstration of cyclic-nucleotide-dependent ion currents) of a plant cng channel has not yet been accomplished. The authors report the cloning and first functional characterization of a plant member of this family of ion channels. The Arabidopsis cDNA AtCNGC2 encodes a polypeptide with deduced homology to the {alpha}-subunit of animal channels, and facilitates cyclic nucleotide-dependent cation currents upon expression in a number of heterologous systems. AtCNGC2 expression in a yeast mutant lacking a low-affinity K{sup +} uptake system complements growth inhibition only when lipophilic nucleotides are present in the culture medium. Voltage clamp analysis indicates that Xenopus lawvis oocytes injected with AtCNGC2 cRNA demonstrate cyclic-nucleotide-dependent, inward-rectifying K{sup +} currents. Human embryonic kidney cells (HEK293) transfected with AtCNGC2 cDNA demonstrate increased permeability to Ca{sup 2+} only in the presence of lipophilic cyclic nucleotides. The evidence presented here supports the functional classification of AtCNGC2 as a cyclic-nucleotide-gated cation channel, and presents the first direct evidence identifying a plant member of this ion channel family.

  4. Diagnostics of Pupils' Attitude to Education

    Science.gov (United States)

    Eminli, Tovuz

    2011-01-01

    The paper is devoted to the investigation of the questions connected with the pedagogical diagnostics, in particular, the diagnostics of pupils' attitude to education. It is considered reasonable to apply the practice of development of an individual pedagogical and psychological map for productive implementation of the pedagogical diagnostics and…

  5. Diagnostic accuracy of the care dependency scale

    NARCIS (Netherlands)

    Dijkstra, Ate; Tiesinga, LJ; Plantinga, L; Dassen, TWN; Veltman, G.

    2005-01-01

    Aim. This paper reports an investigation of the diagnostic accuracy of the Care Dependency Scale (CDS). Background. Assessment tools can be described in terms of diagnostic accuracy, or the ability to correctly classify subjects into clinically relevant subgroups. Diagnostic accuracy can be determin

  6. RNase H-dependent PCR (rhPCR: improved specificity and single nucleotide polymorphism detection using blocked cleavable primers

    Directory of Open Access Journals (Sweden)

    Powers Kristy M

    2011-08-01

    Full Text Available Abstract Background The polymerase chain reaction (PCR is commonly used to detect the presence of nucleic acid sequences both in research and diagnostic settings. While high specificity is often achieved, biological requirements sometimes necessitate that primers are placed in suboptimal locations which lead to problems with the formation of primer dimers and/or misamplification of homologous sequences. Results Pyrococcus abyssi (P.a. RNase H2 was used to enable PCR to be performed using blocked primers containing a single ribonucleotide residue which are activated via cleavage by the enzyme (rhPCR. Cleavage occurs 5'-to the RNA base following primer hybridization to the target DNA. The requirement of the primer to first hybridize with the target sequence to gain activity eliminates the formation of primer-dimers and greatly reduces misamplification of closely related sequences. Mismatches near the scissile linkage decrease the efficiency of cleavage by RNase H2, further increasing the specificity of the assay. When applied to the detection of single nucleotide polymorphisms (SNPs, rhPCR was found to be far more sensitive than standard allele-specific PCR. In general, the best discrimination occurs when the mismatch is placed at the RNA:DNA base pair. Conclusion rhPCR eliminates the formation of primer dimers and markedly improves the specificity of PCR with respect to off-target amplification. These advantages of the assay should find utility in challenging qPCR applications such as genotyping, high level multiplex assays and rare allele detection.

  7. Investigation of X- and Y-specific single nucleotide polymorphisms in taurine (Bos taurus) and indicine (Bos indicus) cattle.

    Science.gov (United States)

    Anderung, C; Hellborg, L; Seddon, J; Hanotte, O; Götherström, A

    2007-12-01

    Initially, domesticated African cattle were of taurine type. Today, we find both African Bos taurus and Bos indicus cattle, as well as their crossbreeds, on the continent of Africa and they all share the same set of African taurine mitochondrial DNA haplogroups. In this study, we report genetic variation as substitutions and insertions/deletions (indels) on both the X and Y chromosomes, and use the variation to assess hybridization between taurine and indicine cattle. Six African cattle breeds (four Sanga breeds, including Raya Azebu, Danakil, Caprivi, Nguni; and two Zebu breeds, including Kilimanjaro Zebu and South Kavirondo Zebu) were screened for six new X-chromosomal markers, specifically three single nucleotide polymorphisms and three indels in the DDX3X (previously DBX) and ZFX genes, and five previously identified Y-chromosomal markers in the DDX3Y (previously DBY) and ZFY genes. In total, 90 (57 bulls and 33 cows) samples from the African breeds were analysed. We identify five diagnostic haplotypes of indicine and taurine origins on both the X and Y chromosomes. For each breed, the level of indicine introgression varies; in addition to pure taurine, indicine and hybrid X-chromosome individuals, recombinant X-chromosome variants were also detected. These markers are useful molecular tools for assessing the level of indicine admixture in African cattle breeds.

  8. NextSearch: A Search Engine for Mass Spectrometry Data against a Compact Nucleotide Exon Graph.

    Science.gov (United States)

    Kim, Hyunwoo; Park, Heejin; Paek, Eunok

    2015-07-02

    Proteogenomics research has been using six-frame translation of the whole genome or amino acid exon graphs to overcome the limitations of reference protein sequence database; however, six-frame translation is not suitable for annotating genes that span over multiple exons, and amino acid exon graphs are not convenient to represent novel splice variants and exon skipping events between exons of incompatible reading frames. We propose a proteogenomic pipeline NextSearch (Nucleotide EXon-graph Transcriptome Search) that is based on a nucleotide exon graph. This pipeline consists of constructing a compact nucleotide exon graph that systematically incorporates novel splice variations and a search tool that identifies peptides by directly searching the nucleotide exon graph against tandem mass spectra. Because our exon graph stores nucleotide sequences, it can easily represent novel splice variations and exon skipping events between incompatible reading frame exons. Searching for peptide identification is performed against this nucleotide exon graph, without converting it into a protein sequence in FASTA format, achieving an order of magnitude reduction in the size of the sequence database storage. NextSearch outputs the proteome-genome/transcriptome mapping results in a general feature format (GFF) file, which can be visualized by public tools such as the UCSC Genome Browser.

  9. Extracellular modulation of the silkmoth sex pheromone receptor activity by cyclic nucleotides.

    Directory of Open Access Journals (Sweden)

    Tatsuro Nakagawa

    Full Text Available Odorants and pheromones are essential to insects as chemical cues for finding food or an appropriate mating partner. These volatile compounds bind to olfactory receptors (Ors expressed by olfactory sensory neurons. Each insect Or functions as a ligand-gated ion channel and is a heteromeric complex that comprises one type of canonical Or and a highly conserved Orco subunit. Because there are many Or types, insect Ors can recognize with high specificity a myriad of chemical cues. Cyclic nucleotides can modulate the activity of insect Or-Orco complexes; however, the mechanism of action of these nucleotides is under debate. Here, we show that cyclic nucleotides, including cAMP and cGMP, interact with the silkmoth sex pheromone receptor complex, BmOr-1-BmOrco, from the outside of the cell and that these nucleotides act as antagonists at low concentrations and weak agonists at high concentrations. These cyclic nucleotides do not compete with the sex pheromone, bombykol, for binding to the BmOr-1 subunit. ATP and GTP also weakly inhibited BmOr-1-BmOrco activity, but D-ribose had no effect; these findings indicated that the purine moiety was crucial for the inhibition. Only the bombykol receptors have been so far shown to be subject to modulation by nucleotide-related compounds, indicating that this responsiveness to these compounds is not common for all insect Or-Orco complexes.

  10. The Immunosuppressant Mycophenolic Acid Alters Nucleotide and Lipid Metabolism in an Intestinal Cell Model

    Science.gov (United States)

    Heischmann, Svenja; Dzieciatkowska, Monika; Hansen, Kirk; Leibfritz, Dieter; Christians, Uwe

    2017-01-01

    The study objective was to elucidate the molecular mechanisms underlying the negative effects of mycophenolic acid (MPA) on human intestinal cells. Effects of MPA exposure and guanosine supplementation on nucleotide concentrations in LS180 cells were assessed using liquid chromatography-mass spectrometry. Proteomics analysis was carried out using stable isotope labeling by amino acids in cell culture combined with gel-based liquid chromatography-mass spectrometry and lipidome analysis using 1H nuclear magnetic resonance spectroscopy. Despite supplementation, depletion of guanosine nucleotides (p < 0.001 at 24 and 72 h; 5, 100, and 250 μM MPA) and upregulation of uridine and cytidine nucleotides (p < 0.001 at 24 h; 5 μM MPA) occurred after exposure to MPA. MPA significantly altered 35 proteins mainly related to nucleotide-dependent processes and lipid metabolism. Cross-reference with previous studies of MPA-associated protein changes widely corroborated these results, but showed differences that may be model- and/or method-dependent. MPA exposure increased intracellular concentrations of fatty acids, cholesterol, and phosphatidylcholine (p < 0.01 at 72 h; 100 μM MPA) which corresponded to the changes in lipid-metabolizing proteins. MPA affected intracellular nucleotide levels, nucleotide-dependent processes, expression of structural proteins, fatty acid and lipid metabolism in LS180 cells. These changes may compromise intestinal membrane integrity and contribute to gastrointestinal toxicity. PMID:28327659

  11. NUCLEOTIDE SEQUENCE VARIATION IN LEPTIN GENE OF MURRAH BUFFALO (BUBALUS BUBALIS

    Directory of Open Access Journals (Sweden)

    Sanjoy Datta

    2012-12-01

    Full Text Available Leptin is a 16 kD protein, synthesized by adipose tissue and is involved in regulation of feed intake, energy balance, fertility and immune functions. Present study was undertaken with the objectives of sequence characterization and studying the nucleotide variation in leptin gene in Murrah buffalo. The leptin gene consists of three exons and two introns which spans about 18.9kb, of which the first exon is not transcribed into protein. In buffaloes, the leptin gene is located on chromosome eight and maps to BBU 8q32. The leptin gene was amplified by PCR using oligonucleotide primers to obtain 289 bp fragment comprising of exon 2 and 405 bp fragment containing exon 3 of leptin gene. The amplicons were sequenced to identify variation at nucleotide level. Sequence comparison of buffalo with cattle reveals variation at five nucleotide sequences at positions 983, 1083, 1147, 1152, 1221 and all the SNPs are synonymous resulting no in change in amino acids. Three of these eight nucleotide variations have been reported for the first time in buffalo. The results indicate conservation of DNA sequence between cattle and buffalo. Nucleotide sequence variations observed at leptin gene between Bubalus bubalis and Bos taurus species revealed 97% nucleotide identity.

  12. Neighboring-Nucleotide Effects on the Mutation Patterns of the Rice Genome

    Institute of Scientific and Technical Information of China (English)

    Hui Zhao; Qi-Zhai Li; Chang-Qing Zeng; Huan-Ming Yang; Jun Yu

    2005-01-01

    DNA composition dynamics across genomes of diverse taxonomy is a major subject of genome analyses. DNA composition changes are characteristics of both replication and repair machineries. We investigated 3,611,007 single nucleotide polymorphisms (SNPs) generated by comparing two sequenced rice genomes from distant inbred lines (subspecies), including those from 242,811 introns and 45,462 protein-coding sequences (CDSs). Neighboring-nucleotide effects (NNEs) of these SNPs are diverse, depending on structural content-based classifications (genomewide, intronic, and CDS) and sequence context-based categories (A/C, A/G, A/T,C/G, C/T, and G/T substitutions) of the analyzed SNPs. Strong and evident NNEs and nucleotide proportion biases surrounding the analyzed SNPs were observed in 1-3 bp sequences on both sides of an SNP. Strong biases were observed around neighboring nucleotides of protein-coding SNPs, which exhibit a periodicity of three in nucleotide content, constrained by a combined effect of codon-related rules and DNA repair mechanisms. Unlike a previous finding in the human genome,we found negative correlation between GC contents of chromosomes and the magnitude of corresponding bias of nucleotide C at -1 site and G at +1 site. These results will further our understanding of the mutation mechanism in rice as well as its evolutionary implications.

  13. Organization of Nucleotides in Different Environments and the Formation of Pre-Polymers

    Science.gov (United States)

    Himbert, Sebastian; Chapman, Mindy; Deamer, David W.; Rheinstädter, Maikel C.

    2016-08-01

    RNA is a linear polymer of nucleotides linked by a ribose-phosphate backbone. Polymerization of nucleotides occurs in a condensation reaction in which phosphodiester bonds are formed. However, in the absence of enzymes and metabolism there has been no obvious way for RNA-like molecules to be produced and then encapsulated in cellular compartments. We investigated 5‧-adenosine monophosphate (AMP) and 5‧-uridine monophosphate (UMP) molecules confined in multi-lamellar phospholipid bilayers, nanoscopic films, ammonium chloride salt crystals and Montmorillonite clay, previously proposed to promote polymerization. X-ray diffraction was used to determine whether such conditions imposed a degree of order on the nucleotides. Two nucleotide signals were observed in all matrices, one corresponding to a nearest neighbour distance of 4.6 Å attributed to nucleotides that form a disordered, glassy structure. A second, smaller distance of 3.4 Å agrees well with the distance between stacked base pairs in the RNA backbone, and was assigned to the formation of pre-polymers, i.e., the organization of nucleotides into stacks of about 10 monomers. Such ordering can provide conditions that promote the nonenzymatic polymerization of RNA strands under prebiotic conditions. Experiments were modeled by Monte-Carlo simulations, which provide details of the molecular structure of these pre-polymers.

  14. Regulation of Ca2+ release from mitochondria by the oxidation-reduction state of pyridine nucleotides.

    Science.gov (United States)

    Lehninger, A L; Vercesi, A; Bababunmi, E A

    1978-04-01

    Mitochondria from normal rat liver and heart, and also Ehrlich tumor cells, respiring on succinate as energy source in the presence of rotenone (to prevent net electron flow to oxygen from the endogenous pyridine nucleotides), rapidly take up Ca(2+) and retain it so long as the pyridine nucleotides are kept in the reduced state. When acetoacetate is added to bring the pyridine nucleotides into a more oxidized state, Ca(2+) is released to the medium. A subsequent addition of a reductant of the pyridine nucleotides such as beta-hydroxybutyrate, glutamate, or isocitrate causes reuptake of the released Ca(2+). Successive cycles of Ca(2+) release and uptake can be induced by shifting the redox state of the pyridine nucleotides to more oxidized and more reduced states, respectively. Similar observations were made when succinate oxidation was replaced as energy source by ascorbate oxidation or by the hydrolysis of ATP. These and other observations form the basis of a hypothesis for feedback regulation of Ca(2+)-dependent substrate- or energy-mobilizing enzymatic reactions by the uptake or release of mitochondrial Ca(2+), mediated by the cytosolic phosphate potential and the ATP-dependent reduction of mitochondrial pyridine nucleotides by reversal of electron transport.

  15. Direct Monitoring of Nucleotide Turnover in Human Cell Extracts and Cells by Fluorogenic ATP Analogs.

    Science.gov (United States)

    Hacker, Stephan M; Buntz, Annette; Zumbusch, Andreas; Marx, Andreas

    2015-11-20

    Nucleotides containing adenosine play pivotal roles in every living cell. Adenosine triphosphate (ATP), for example, is the universal energy currency, and ATP-consuming processes also contribute to posttranslational protein modifications. Nevertheless, detecting the turnover of adenosine nucleotides in the complex setting of a cell remains challenging. Here, we demonstrate the use of fluorogenic analogs of ATP and adenosine tetraphosphate to study nucleotide hydrolysis in lysates of human cell lines and in intact human cells. We found that the adenosine triphosphate analog is completely stable in lysates of human cell lines, whereas the adenosine tetraphosphate analog is rapidly turned over. The observed activity in human cell lysates can be assigned to a single enzyme, namely, the human diadenosine tetraphosphate hydrolase NudT2. Since NudT2 has been shown to be a prognostic factor for breast cancer, the adenosine tetraphosphate analog might contribute to a better understanding of its involvement in cancerogenesis and allow the straightforward screening for inhibitors. Studying hydrolysis of the analogs in intact cells, we found that electroporation is a suitable method to deliver nucleotide analogs into the cytoplasm and show that high FRET efficiencies can be detected directly after internalization. Time-dependent experiments reveal that adenosine triphosphate and tetraphosphate analogs are both processed in the cellular environment. This study demonstrates that these nucleotide analogs indeed bear the potential to be powerful tools for the exploration of nucleotide turnover in the context of whole cells.

  16. Genome-wide patterns of recombination, linkage disequilibrium and nucleotide diversity from pooled resequencing and single nucleotide polymorphism genotyping unlock the evolutionary history of Eucalyptus grandis.

    Science.gov (United States)

    Silva-Junior, Orzenil B; Grattapaglia, Dario

    2015-11-01

    We used high-density single nucleotide polymorphism (SNP) data and whole-genome pooled resequencing to examine the landscape of population recombination (ρ) and nucleotide diversity (ϴw ), assess the extent of linkage disequilibrium (r(2) ) and build the highest density linkage maps for Eucalyptus. At the genome-wide level, linkage disequilibrium (LD) decayed within c. 4-6 kb, slower than previously reported from candidate gene studies, but showing considerable variation from absence to complete LD up to 50 kb. A sharp decrease in the estimate of ρ was seen when going from short to genome-wide inter-SNP distances, highlighting the dependence of this parameter on the scale of observation adopted. Recombination was correlated with nucleotide diversity, gene density and distance from the centromere, with hotspots of recombination enriched for genes involved in chemical reactions and pathways of the normal metabolic processes. The high nucleotide diversity (ϴw = 0.022) of E. grandis revealed that mutation is more important than recombination in shaping its genomic diversity (ρ/ϴw = 0.645). Chromosome-wide ancestral recombination graphs allowed us to date the split of E. grandis (1.7-4.8 million yr ago) and identify a scenario for the recent demographic history of the species. Our results have considerable practical importance to Genome Wide Association Studies (GWAS), while indicating bright prospects for genomic prediction of complex phenotypes in eucalypt breeding.

  17. Deuterated nucleotides as chemical probes of RNA structure: a detailed protocol for the enzymatic synthesis of a complete set of nucleotides specifically deuterated at ribose carbons

    Directory of Open Access Journals (Sweden)

    Robert N. Azad

    2015-05-01

    Full Text Available We describe here a detailed protocol for the synthesis of ribonucleotides specifically deuterated at each ribose carbon atom. We synthesized 20 specifically deuterated ribonucleotides: ATP, CTP, GTP, and UTP, each of which contained one of five deuterated riboses (either 1′-D, 2″-D, 3′-D, 4′-D, or 5′,5″-D2. Our synthetic approach is inspired by the pioneering work of Tolbert and Williamson, who developed a method for the convenient one-pot enzymatic synthesis of nucleotides (Tolbert, T. J. and Williamson, J. R. (1996 J. Am. Chem. Soc. 118, 7929–7940. Our protocol consists of a comprehensive list of required chemical and enzymatic reagents and equipment, detailed procedures for enzymatic assays and nucleotide synthesis, and chromatographic procedures for purification of deuterated nucleotides. As an example of the utility of specifically deuterated nucleotides, we used them to synthesize specifically deuterated sarcin/ricin loop (SRL RNA and measured the deuterium kinetic isotope effect on hydroxyl radical cleavage of the SRL.

  18. Crystal structures of the ATPase subunit of the glucose ABC transporter from Sulfolobus solfataricus : Nucleotide-free and nucleotide-bound conformations

    NARCIS (Netherlands)

    Verdon, G.; Albers, S.V.; Dijkstra, B.W.; Driessen, A.J.M.; Thunnissen, A.M.W.H.

    2003-01-01

    The ABC-ATPase GlcV energizes a binding protein-dependent ABC transporter that mediates glucose uptake in Sulfolobus solfataricus. Here, we report high-resolution crystal structures of GlcV in different states along its catalytic cycle: distinct monomeric nucleotide-free states and monomeric

  19. GDP-bound and nucleotide-free intermediates of the guanine nucleotide exchange in the Rab5·Vps9 system.

    Science.gov (United States)

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

    2010-11-19

    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg(2+) and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction.

  20. GDP-bound and Nucleotide-free Intermediates of the Guanine Nucleotide Exchange in the Rab5·Vps9 System*

    Science.gov (United States)

    Uejima, Tamami; Ihara, Kentaro; Goh, Tatsuaki; Ito, Emi; Sunada, Mariko; Ueda, Takashi; Nakano, Akihiko; Wakatsuki, Soichi

    2010-01-01

    Many GTPases regulate intracellular transport and signaling in eukaryotes. Guanine nucleotide exchange factors (GEFs) activate GTPases by catalyzing the exchange of their GDP for GTP. Here we present crystallographic and biochemical studies of a GEF reaction with four crystal structures of Arabidopsis thaliana ARA7, a plant homolog of Rab5 GTPase, in complex with its GEF, VPS9a, in the nucleotide-free and GDP-bound forms, as well as a complex with aminophosphonic acid-guanylate ester and ARA7·VPS9a(D185N) with GDP. Upon complex formation with ARA7, VPS9 wedges into the interswitch region of ARA7, inhibiting the coordination of Mg2+ and decreasing the stability of GDP binding. The aspartate finger of VPS9a recognizes GDP β-phosphate directly and pulls the P-loop lysine of ARA7 away from GDP β-phosphate toward switch II to further destabilize GDP for its release during the transition from the GDP-bound to nucleotide-free intermediates in the nucleotide exchange reaction. PMID:20833725

  1. Inferences of clinical diagnostic reasoning and diagnostic error.

    Science.gov (United States)

    Lawson, Anton E; Daniel, Erno S

    2011-06-01

    This paper discusses clinical diagnostic reasoning in terms of a pattern of If/then/Therefore reasoning driven by data gathering and the inference of abduction, as defined in the present paper, and the inferences of retroduction, deduction, and induction as defined by philosopher Charles Sanders Peirce. The complex inferential reasoning driving clinical diagnosis often takes place subconsciously and so rapidly that its nature remains largely hidden from the diagnostician. Nevertheless, we propose that raising such reasoning to the conscious level reveals not its basic pattern and basic inferences, it also reveals where errors can and do occur and how such errors might be reduced or even eliminated.

  2. Relating faults in diagnostic reasoning with diagnostic errors and patient harm.

    NARCIS (Netherlands)

    Zwaan, L.; Thijs, A.; Wagner, C.; Wal, G. van der; Timmermans, D.R.M.

    2012-01-01

    Purpose: The relationship between faults in diagnostic reasoning, diagnostic errors, and patient harm has hardly been studied. This study examined suboptimal cognitive acts (SCAs; i.e., faults in diagnostic reasoning), related them to the occurrence of diagnostic errors and patient harm, and studied

  3. Nucleotide sequence analysis of a DNA region involved in capsular polysaccharide biosynthesis reveals the molecular basis of the nontypeability of two Actinobacillus pleuropneumoniae isolates.

    Science.gov (United States)

    Ito, Hiroya; Ogawa, Torata; Fukamizu, Dai; Morinaga, Yuiko; Kusumoto, Masahiro

    2016-11-01

    The aim of our study was to reveal the molecular basis of the serologic nontypeability of 2 Actinobacillus pleuropneumoniae field isolates. Nine field strains of A. pleuropneumoniae, the causative agent of porcine pleuropneumonia, were isolated from pigs raised on the same farm and sent to our diagnostic laboratory for serotyping. Seven of the 9 strains were identified as serovar 15 strains by immunodiffusion tests. However, 2 strains, designated FH24-2 and FH24-5, could not be serotyped with antiserum prepared against serovars 1-15. Strain FH24-5 showed positive results in 2 serovar 15-specific PCR tests, whereas strain FH24-2 was only positive in 1 of the 2 PCR tests. The nucleotide sequence analysis of gene clusters involved in capsular polysaccharide biosynthesis of the 2 nontypeable strains revealed that both had been rendered nontypeable by the action of ISApl1, a transposable element of A. pleuropneumoniae belonging to the IS30 family. The results showed that ISApl1 of A. pleuropneumoniae can interfere with both the serologic and molecular typing methods, and that nucleotide sequence analysis across the capsular gene clusters is the best means of determining the cause of serologic nontypeability in A. pleuropneumoniae. © 2016 The Author(s).

  4. DEMO diagnostics and burn control

    Energy Technology Data Exchange (ETDEWEB)

    Biel, Wolfgang, E-mail: w.biel@fz-juelich.de [Institute of Energy and Climate Research, Forschungszentrum Jülich GmbH, Jülich (Germany); Department of Applied Physics, Ghent University (Belgium); Baar, Marco de [FOM-Institute DIFFER, Nieuwegein (Netherlands); Eindhoven University of Technology (Netherlands); Dinklage, Andreas [Max-Planck-Institut für Plasmaphysik, Greifswald (Germany); Felici, Federico [Eindhoven University of Technology (Netherlands); König, Ralf [Max-Planck-Institut für Plasmaphysik, Greifswald (Germany); Meister, Hans; Treutterer, Wolfgang [Max-Planck-Institut für Plasmaphysik, Garching (Germany); Wenninger, Ronald [Max-Planck-Institut für Plasmaphysik, Garching (Germany); EFDA Power Plant Physics and Technology, Garching (Germany)

    2015-10-15

    Highlights: • An initial concept for the DEMO diagnostic and control system is presented. • A preliminary list of control functions and candidate diagnostics is developed. • Challenges regarding disruptions, power exhaust and radiation control are highlighted. • The need for introducing realistic control margins is emphasized. • On outline of the future R&D plan is presented. - Abstract: The development of the control system for a tokamak demonstration fusion reactor (DEMO) faces unprecedented challenges. First, the requirements for control reliability and accuracy are more stringent than on existing fusion devices: any loss of plasma control on DEMO may result in a disruption which could damage the inner wall of the machine, while operating the device with larger margins against the operational limits would lead to a reduction of the electrical output power. Second, the performance of DEMO control is limited by space restrictions for the implementation of components (optimization of the tritium breeding rate), by lifetime issues for the front-end parts (neutron and gamma radiation, erosion and deposition acting on all components) and by slow, weak and indirect action of the available actuators (plasma shaping, heating and fuelling). The European DEMO conceptual design studies include the development of a reliable control system, since the details of the achievable plasma scenario and the machine design may depend on the actual performance of the control system. In the first phase of development, an initial understanding of the prime choices of diagnostic methods applicable to DEMO, implementation and performance issues, the interrelation with the plasma scenario definition, and the planning of necessary future R&D have been obtained.

  5. PDR diagnostics study with CLOUDY

    Institute of Scientific and Technical Information of China (English)

    Rui Xue; Maohai Huang

    2009-01-01

    A series of plane-parallel photodissociation region (PDR) models are calculated using the spectral synthesis code CLOUDY. These models span a wide range of physical conditions, with gas densities of n = 102 - 106 cm-3 and incident far-ultraviolet (FUV) fields of G0 = 100 - 106 (where Go is the FUV flux in units of the local interstellar value), which are comparable with various astrophysical environments from interstellar diffuse clouds to the dense neutral gas around galactic compact HII regions. Based on the calculated results, we study the thermal balance of PDR gas and the emissions of [ CII ], [ CI ] and [ OI ] fine-structure lines under different physical conditions. The intensities and strength ratios of the studied lines, which are frequently used as PDR diagnostics, are presented using contour diagrams as functions of n and Go. We compare the calculated PDR surface gas temperatures T8 with those from Kaufman et al. and find that Ts from our models are systematically higher over most of the adopted n-G0 parameter space. The predicated line intensities and ratios from our work and those from Kaufman et al. can be different by a factor greater than 10, and such large differences usually occur near the border of our parameter space. The different methods of treating the dust grain physics, the change of H2 formation and dissociation rates, and the improvement in the radiation transfer of line emissions in our CLOUDY models are likely to be the major reasons for the divergences. Our models represent an up-to-date treatment of PDR diagnostic calcula- tions and can be used to interpret observational data. Meanwhile, the uncertainties in the treatment of microphysics and chemical processes in PDR models have significant effects on PDR diagnostics.

  6. Overview of the microfluidic diagnostics commercial landscape.

    Science.gov (United States)

    Kim, Lily

    2013-01-01

    Since its birth in the late 1980s, the field of microfluidics has continued to mature, with a growing number of companies pursuing diagnostic applications. In 2009 the worldwide in vitro diagnostics market was estimated at >$40 billion USD, and microfluidic diagnostics are poised to reap a significant part of this market across a range of areas including laboratory diagnostics, point-of-care diagnostics, cancer diagnostics, and others. The potential economic advantages of microfluidics are numerous and compelling: lower reagent and/or sample volumes, lower equipment costs, improved portability, increased automation, and increased measurement speed. All of these factors may help put more information in the hands of doctors and patients sooner, enabling earlier disease detection and more tailored, effective treatments. This chapter reviews the microfluidic diagnostics commercial landscape and discusses potential commercialization challenges and opportunities.

  7. Computer-aided identification of polymorphism sets diagnostic for groups of bacterial and viral genetic variants

    Directory of Open Access Journals (Sweden)

    Huygens Flavia

    2007-08-01

    Full Text Available Abstract Background Single nucleotide polymorphisms (SNPs and genes that exhibit presence/absence variation have provided informative marker sets for bacterial and viral genotyping. Identification of marker sets optimised for these purposes has been based on maximal generalized discriminatory power as measured by Simpson's Index of Diversity, or on the ability to identify specific variants. Here we describe the Not-N algorithm, which is designed to identify small sets of genetic markers diagnostic for user-specified subsets of known genetic variants. The algorithm does not treat the user-specified subset and the remaining genetic variants equally. Rather Not-N analysis is designed to underpin assays that provide 0% false negatives, which is very important for e.g. diagnostic procedures for clinically significant subgroups within microbial species. Results The Not-N algorithm has been incorporated into the "Minimum SNPs" computer program and used to derive genetic markers diagnostic for multilocus sequence typing-defined clonal complexes, hepatitis C virus (HCV subtypes, and phylogenetic clades defined by comparative genome hybridization (CGH data for Campylobacter jejuni, Yersinia enterocolitica and Clostridium difficile. Conclusion Not-N analysis is effective for identifying small sets of genetic markers diagnostic for microbial sub-groups. The best results to date have been obtained with CGH data from several bacterial species, and HCV sequence data.

  8. Vibration diagnostics instrumentation for ILC

    Energy Technology Data Exchange (ETDEWEB)

    Bertolini, A.

    2007-06-15

    The future e{sup -}e{sup +} 500 GeV International Linear Collider will rely on unprecedented nanometer scale particle beam size at the interaction point, in order to achieve the design luminosity. Tight tolerances on static and dynamic alignment of the accelerator cavities and optical components are demanded to transport and focus the high energy electron and positron beams with reasonable position jitter and low emittance. A brief review of techniques and devices evaluated and developed so far for the vibration diagnostics of the machine is presented in this paper. (orig.)

  9. Human conjunctivitis. I. Diagnostic evaluation.

    Science.gov (United States)

    Leibowitz, H W; Pratt, M V; Flagstad, I J; Berrospi, A R; Kundsin, R

    1976-10-01

    One hundred forty-three patients (207 eyes) with conjunctivitis or blepharoconjunctivitis were studied. Attempts were made to establish an etiologic diagnosis by clinical and laboratory methods. The etiologic diagnosis that was made on the basis of the initial clinical examination correlated poorly with the results of standard laboratory tests. Conversely, the standard laboratory evaluation failed to establish a definitive diagnosis in the majority of cases. These findings suggest that the diagnostic dogmatism prevalent in conjunctivitis is unwarranted. Morphologic signs and routine laboratory tests leave us without a verified etiologic diagnosis in a substantial number of cases.¿

  10. Molecular diagnostics of foodborne pathogens

    DEFF Research Database (Denmark)

    Hansen, Trine

    of samples, an optimization of the total DNA extraction step was applied. Five different commercial available DNA extraction kits were evaluated and the MasterPure DNA Purification Kit was found to be suitable for the food and feed samples. The detection of B. cereusin food and feed samples was found...... or accidental contamination of food, feed and water supplies pose a threat to human health worldwide and the need for generic detection methods that can screen for many pathogens at the time are highly desirable. A metagenomics based direct 16S rDNA sequencing approach was evaluated as a diagnostic tool...

  11. Chordoid meningioma: A diagnostic dilemma

    Directory of Open Access Journals (Sweden)

    Fouzia Siraj

    2015-01-01

    Full Text Available Chordoid meningioma (CM, classified as Grade II/atypical meningioma according to the World Health Organization classification, is a rare subtype, which represents only 0.5% of all meningiomas. Morphologically, it can mimic other chondroid and myxoid tumors within the brain and its vicinity thus posing a diagnostic challenge. Accurate diagnosis, therefore, assumes importance as these tumors have an aggressive clinical course and propensity to recur compared to classical meningiomas. Furthermore, the prognosis and treatment strategies vary when compared to tumors with morphological overlap. We present a case of CM in a 14-year-old girl and discuss its clinicopathological and immunohistochemical features.

  12. Diagnostic management of renal colic.

    Science.gov (United States)

    Nicolau, C; Salvador, R; Artigas, J M

    2015-01-01

    Renal colic is a common reason for presentation to emergency departments, and imaging has become fundamental for the diagnosis and clinical management of this condition. Ultrasonography and particularly noncontrast computed tomography have good diagnostic performance in diagnosing renal colic. Radiologic management will depend on the tools available at the center and on the characteristics of the patient. It is essential to use computed tomography techniques that minimize radiation and to use alternatives like ultrasonography in pregnant patients and children. In this article, we review the epidemiology, clinical and radiologic presentations, and clinical management of ureteral lithiasis.

  13. Diagnostic tools for neuropathic pain

    Directory of Open Access Journals (Sweden)

    CHEN Xiang-jun

    2013-09-01

    Full Text Available Neuropathic pain (NP is a kind of chronic, severe and persistent pain syndrome. Due to the underlying mechanisms, the treatment for NP differs from that of nociceptive pain. An accurate diagnosis of NP is very important. However, the present diagnostic process which mainly depends on clinical and neurophysiological assessments is quite time-consuming and low efficient. In recent years, various screening tools and drug efficacy assessments for NP have been developed and validated. They become very useful in the diagnosis and treatment of NP, as well as in epidemiological study. These tools are also very useful in elucidating the underlying mechanism of NP.

  14. Canine Hip Dysplasia: Diagnostic Imaging.

    Science.gov (United States)

    Butler, J Ryan; Gambino, Jennifer

    2017-07-01

    Diagnostic imaging is the principal method used to screen for and diagnose hip dysplasia in the canine patient. Multiple techniques are available, each having advantages, disadvantages, and limitations. Hip-extended radiography is the most used method and is best used as a screening tool and for assessment for osteoarthritis. Distraction radiographic methods such as the PennHip method allow for improved detection of laxity and improved ability to predict future osteoarthritis development. More advanced techniques such as MRI, although expensive and not widely available, may improve patient screening and allow for improved assessment of cartilage health. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Optoelectronic tweezers for medical diagnostics

    Science.gov (United States)

    Kremer, Clemens; Neale, Steven; Menachery, Anoop; Barrett, Mike; Cooper, Jonathan M.

    2012-01-01

    Optoelectronic tweezers (OET) allows the spatial patterning of electric fields through selected illumination of a photoconductive surface. This enables the manipulation of micro particles and cells by creating non-uniform electrical fields that then produce dielectrophoretic (DEP) forces. The DEP responses of cells differ and can produce negative or positive (repelled or attracted to areas of high electric field) forces. Therefore OET can be used to manipulate individual cells and separate different cell types from each other. Thus OET has many applications for medical diagnostics, demonstrated here with work towards diagnosing Human African Trypanosomiasis, also known as sleeping sickness.

  16. Diagnostic Ophthalmic Ultrasound for Radiologists.

    Science.gov (United States)

    Kendall, Cynthia J; Prager, Thomas C; Cheng, Han; Gombos, Dan; Tang, Rosa A; Schiffman, Jade S

    2015-08-01

    Ophthalmic ultrasound is an invaluable tool that provides quick and noninvasive evaluation of the eye and the orbit. It not only allows the clinicians to view structures that may not be visible with routine ophthalmic equipment or neuroimaging techniques but also provides unique diagnostic information in various ophthalmic conditions. In this article, the basic principles of ophthalmic ultrasound and examination techniques are discussed. Its clinical application is illustrated through a variety of ocular pathologic abnormalities (eg, narrow angles, ciliary body tumor, detached retina, choroidal melanoma, and papilledema).

  17. Restriction site-associated DNA sequencing generates high-quality single nucleotide polymorphisms for assessing hybridization between bighead and silver carp in the United States and China.

    Science.gov (United States)

    Lamer, James T; Sass, Greg G; Boone, Jason Q; Arbieva, Zarema H; Green, Stefan J; Epifanio, John M

    2014-01-01

    Bighead carp (Hypophthalmichthys nobilis) and silver carp (H. molitrix) are invasive species and listed as US federally injurious species under the Lacy Act. They have established populations in much of the Mississippi River Basin (MRB; Mississippi, Illinois, and Missouri rivers) and are capable of producing fertile hybrids and complex introgression. Characterizing the composition of this admixture requires a large set of high-quality, evolutionarily conserved, diagnostic genetic markers to aid in the identification and management of these species in the midst of morphological ambiguity. Restriction site-associated DNA (RAD) sequencing of 45 barcoded bighead and silver carp from the United States and China produced reads that were aligned to the silver carp transcriptome yielded 261 candidate single nucleotide polymorphisms (SNPs) with fixed allelic differences between the two species. We selected the highest quality 112 SNP loci for validation using 194 putative pure-species and F1 hybrids from the MRB and putative bighead carp and silver carp pure species from China (Amur, Pearl and Yangtze rivers). Fifty SNPs were omitted due to design/amplification failure or lack of diagnostic utility. A total of 57 species-diagnostic SNPs conserved between carp species in US and Chinese rivers were identified; 32 were annotated to functional gene loci. Twenty-seven of the 181 (15%) putative pure species were identified as hybrid backcrosses after validation, including three backcrosses from the Amur River, where hybridization has not been documented previously. The 57 SNPs identified through RAD sequencing provide a diagnostic tool to detect population admixture and to identify hybrid and pure-species Asian carps in the United States and China.

  18. Intramolecular interactions in aminoacyl nucleotides: Implications regarding the origin of genetic coding and protein synthesis

    Science.gov (United States)

    Lacey, J. C., Jr.; Mullins, D. W., Jr.; Watkins, C. L.; Hall, L. M.

    1986-01-01

    Cellular organisms store information as sequences of nucleotides in double stranded DNA. This information is useless unless it can be converted into the active molecular species, protein. This is done in contemporary creatures first by transcription of one strand to give a complementary strand of mRNA. The sequence of nucleotides is then translated into a specific sequence of amino acids in a protein. Translation is made possible by a genetic coding system in which a sequence of three nucleotides codes for a specific amino acid. The origin and evolution of any chemical system can be understood through elucidation of the properties of the chemical entities which make up the system. There is an underlying logic to the coding system revealed by a correlation of the hydrophobicities of amino acids and their anticodonic nucleotides (i.e., the complement of the codon). Its importance lies in the fact that every amino acid going into protein synthesis must first be activated. This is universally accomplished with ATP. Past studies have concentrated on the chemistry of the adenylates, but more recently we have found, through the use of NMR, that we can observe intramolecular interactions even at low concentrations, between amino acid side chains and nucleotide base rings in these adenylates. The use of this type of compound thus affords a novel way of elucidating the manner in which amino acids and nucleotides interact with each other. In aqueous solution, when a hydrophobic amino acid is attached to the most hydrophobic nucleotide, AMP, a hydrophobic interaction takes place between the amino acid side chain and the adenine ring. The studies to be reported concern these hydrophobic interactions.

  19. Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

    Directory of Open Access Journals (Sweden)

    Arehart Eric

    2009-03-01

    Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

  20. New di:thiophosphite, di:thiophosphate, thio:phosphoramidite and thio:phosphonite compounds - are intermediates for synthesis of oligo- and poly-nucleotide(s) having phosphorothioate linkages

    DEFF Research Database (Denmark)

    1997-01-01

    interrupted by heteroatoms). USE-(I) are intermediates in the synthesis of various types of oligo- and polynucleotides containing phosphorothioate (PS) groups between the units. Such oligo- and poly-nucleotides have many potential biological, therapeutic and diagnostic applications. Examples are: as antisense...... agents; for treatment of tumours, viral and bacterial infections; for targeting to deliver drugs, metal ions, toxins or intercalating agents to specific cell and tissue sites; and, by attachment to a label (e.g. a fluorophore, antigen, antibody, protein or metal ion), for the diagnosis of diseases...

  1. Ultrasound diagnostics of thyroid diseases

    Energy Technology Data Exchange (ETDEWEB)

    Kharchenko, Vladimir P. [Russian Radiology Research Center, Moscow (Russian Federation); Kotlyarov, Peter M. [Russian Center of Roentgenradiology, Moscow (Russian Federation); Mogutov, Mikhail S.; Sencha, Alexander N.; Patrunov, Yury N.; Belyaev, Denis V. [Yaroslavl Railway Clinic (Russian Federation); Alexandrov, Yury K. [State Medical Academy, Yaroslavl (Russian Federation)

    2010-07-01

    This book is based on the authors' extensive practical experience in the use of modern ultrasound, and other radiological methods, in the diagnosis of thyroid diseases. The authors have analyzed more than 100,000 ultrasound examinations performed between 1995 and 2008 in patients with thyroid and parathyroid disease, as well as many thousands of diagnostic and therapeutic ultrasound-guided minimally invasive procedures. The opening chapters include discussion of current ultrasound techniques, pitfalls, and the specifics of ultrasound examination of the thyroid in children. Detailed attention is then devoted to findings in the normal thyroid and in the presence of diffuse and focal changes. Further chapters focus on such topics as ultrasound examination after thyroid surgery and ultrasound diagnosis of parathyroid disease, recurrent goiter, and neck masses. Ultrasound-guided minimally invasive techniques, such as fine-needle aspiration biopsy, percutaneous laser ablation, and ethanol and glucocorticoid injections, are considered in depth. This up-to-date and richly illustrated book will interest and assist specialists in ultrasound diagnostics, radiologists, endocrinologists, and neck surgeons. (orig.)

  2. Tuberculosis diagnostics: Challenges and opportunities

    Directory of Open Access Journals (Sweden)

    Vijay Nema

    2012-01-01

    Full Text Available Tuberculosis (TB has been a disease affecting almost all parts of the world since ages. Lot many efforts came in the past for improving diagnosis and treatment. Also, an effective vaccine has been sought after for long. With the emergence of resistant strains of Mycobacterium tuberculosis, the causal organisms of tuberculosis, and complexities emerging due to other associated infections and disease conditions, there is a desperate need for further research input in the field. Be it the better medication and care or better resistance management, proper diagnostics holds the key to success. It has been observed that a high burden of the disease was accompanied by resource limitations and poor research set-up. The scenario remained like this for several decades. With the refreshed vision of resourceful countries and funding agencies, funding is being provided in many areas of research in tuberculosis diagnosis and treatment. This review has been written with an aim to bring forth the limitations of available methods in the field of diagnostics and making researchers aware about the changing scenario with better funding opportunities and support. The author visualizes an enthusiasm from all over the world for the development of better modalities and urges scientists to join the struggle at this very perfect time to take the challenge and come forward with innovations in this field.

  3. Diagnostic validity of basic symptoms.

    Science.gov (United States)

    Klosterkötter, J; Ebel, H; Schultze-Lutter, F; Steinmeyer, E M

    1996-01-01

    Although the Bonn Scale for the Assessment of Basic Symptoms (BSABS) [13] has come into use in several European countries, its diagnostic validity has not yet been sufficiently examined. That is why we have assessed BSABS items on a sample of 243 consecutive admissions to the Department of Psychiatry at the RWTH University, Aachen, and 79 psychologically healthy persons. Then, a cluster analysis was calculated to identify the empirical item-grouping. Five well-interpretable BSABS subsyndromes were found. In addition, uni- and multivariate analyses were computed to evaluate the diagnostic validity of these subsyndromes. We were able to show that every BSABS subsyndrome separates at least schizophrenic, organic mental and affective disorders from personality, neurotic and substance-induced disorders, as well as from psychological health. Furthermore, the subsyndrome "information processing disturbances" differentiates between schizophrenic and organic mental disorders, on the one hand, and affective disorders, on the other, and additionally, the subsyndrome "interpersonal irritation" between schizophrenics and all other persons examined.

  4. Patient dosimetry in diagnostic radiology

    Directory of Open Access Journals (Sweden)

    Ciraj-Bjelac Olivera F.

    2003-01-01

    Full Text Available The objective of this work is to assess patient organ doses, effective doses and entrance surface doses in conventional diagnostic radiology procedures for standard adult patient. The survey consists of measurements of doses delivered to 239 patients in nine types of X-ray examinations. Three types of data were collected: X-ray machine data, patient data, and output measurements. Entrance surface dose was assessed based on the survey data and subsequently, using conversion coefficients, the organ doses and effective doses were calculated. Values of the entrance surface dose and the effective dose were estimated to be 0.4 to 5.8 mGy and 0.03 to 3.00 mSv for different examinations. Derived doses were compared with recommended general diagnostic reference levels. The impact of examination parameters on dose values was discussed. Except for posterior-anterior chest examination, all estimated doses are lower than stated reference levels. Survey data are aimed at helping development of national quality control and radiation protection programmed for medical exposures.

  5. [Vasculitis - diagnostic and therapeutic advances].

    Science.gov (United States)

    De Albuquerque, R; Machado, Filipa

    2014-01-01

    Vasculitis is characterized by inflammation and necrosis of blood vessels walls. It represents a heterogeneous group of conditions, whose etiopathogenic mechanisms remain unclear. Although uncommon, with an annual incidence of 40-54 cases per 1.000.000 persons, this is an important cause of multiorganic dysfunction and premature mortality. Depending on the affected vessels, it can cause diverse clinical presentations, which makes difficult its recognition. It is therefore a challenge for any clinician. This paper reviews the diagnostic and therapeutic advances of the most common forms of vasculitis, in order to optimize the approach and management of this clinical entity. We have conducted a search in Medline database on articles written in English, published for the last 10 years using the keywords: vasculitis, epidemiology, classification, diagnosis and treatment. To minimize the impact of vasculitis it is essential an early diagnosis, allowing a timely institution of the appropriate treatment. The diagnosis depends on the integration of clinical, laboratory, imaging and histopathologic data. According to the clinical condition, it may be indicated the removal of the offending antigen, the treatment of the underlying disease or specific treatment of the primary vasculitis. The introduction of immunosuppressive therapy with glucocorticoids and cyclophosphamide has revolutionized the prognosis of these patients but, despite its efficacy, it is associated with frequent relapses and significant toxicity. The study of the pathogenesis has been providing more effective and safer diagnostic and therapeutic options, for example B-cell depleting agents, but additional studies are needed to confirm the potential of these alternatives.

  6. New tuberculosis diagnostics and rollout

    Directory of Open Access Journals (Sweden)

    Ruth McNerney

    2015-03-01

    Full Text Available Early detection and effective treatment are crucial for tuberculosis control, but global case detection rates remain low. The diagnosis of paediatric and extrapulmonary disease is problematic and there are, as yet, no rapid screening tests to assist active case finding in the community. Progress has been made in clinic-based detection tools with the introduction of Xpert MTB/RIF, a nucleic acid amplification test that combines sample processing and analysis in a single instrument to provide a diagnostic result and detection of resistance to rifampicin in under 2 h. Enthusiasm for Xpert MTB/RIF has been high and global rollout has been facilitated by donor agencies. However, concerns remain about access and sustainability due to the high cost and infrastructure requirements. Although more sensitive than smear microscopy, early studies suggest the impact of the new test on case detection rates and patient survival has been limited. Alternative technologies are being developed, including non-sputum-based tests to assist the detection of extrapulmonary disease. Evaluation studies are needed to provide evidence of the impact of the new technologies on patient outcomes. This will enable appropriate placement of new diagnostic products in the healthcare system to support the control and eventual eradication of tuberculosis disease.

  7. Kinetics of nucleotide transport in rat heart mitochondria studied by a rapid filtration technique

    Energy Technology Data Exchange (ETDEWEB)

    Brandolin, G.; Marty, I.; Vignais, P.V. (LBIO/Laboratoire de Biochimie, Grenoble (France))

    1990-10-01

    A rapid filtration technique has been used to measure at room temperature the kinetics of ADP and ATP transport in rat heart mitochondria in the millisecond time range. Transport was stopped by cessation of the nucleotide supply, without the use of a transport inhibitor, thus avoiding any quenching delay. The kinetics of ({sup 14}C)ADP transport in energized mitochondria were apparently monophasic. The rate of transport of ({sup 14}C)ATP in energized mitochondria was 5-10 times lower than that of ({sup 14}C)ADP. Upon uncoupling, the rate of ({sup 14}C)ATP uptake was enhanced, and that of ({sup 14}C)ADP uptake was decreased. However, the two rates did not equalize, indicating that transport was not exclusively electrogenic. Transport of ({sup 14}C)ADP and ({sup 14}C)ATP by resting mitochondria followed biphasic kinetics. Depletion of nucleotides in resting mitochondria resulted in a greater decrease in the extent of the slow phase than of the rapid one. In addition, about half of the nucleotides taken up at the end of the rapid phase were not discharged into the medium upon addition of carboxyatractyloside. This suggested that matricial nucleotides are compartmentalized in two pools which are exchangeable at different rates with external nucleotides.

  8. On the role of a coumarin derivative for sensing applications: Nucleotide identification using a micellar system.

    Science.gov (United States)

    Bettoschi, Alexandre; Ceglie, Andrea; Lopez, Francesco; Meli, Valeria; Murgia, Sergio; Tamburro, Manuela; Caltagirone, Claudia; Cuomo, Francesca

    2016-09-01

    The recognition of nucleotides is of crucial importance because they are the basic constituents of nucleic acids. The present study is focused on the selective interaction between a novel amphiphilic fluorophore containing coumarin and imidazole, CI (1-methyl-3-(12-((2-oxo-2H-chromen-7-yl)oxy)dodecyl)-1H-imidazol-3-ium bromide), and different nucleotide-monophosphates (NMPs). It was supposed that the solubilization of the low water soluble CI in a micelle system of hexadecyltrimethylammonium chloride (CTAC) would make the coumarin moiety of CI available to the interaction with the water-soluble NMPs. Changes in CTAC critical micelle concentration suggested that CI strongly interacted with the host cationic surfactant, thus forming a positively charged interface enriched with coumarin able to interact with the anionic NMPs. Steady-state fluorescence quenching revealed that CI/CTAC system was capable of distinguish between purine- and pyrimidine-based nucleotides. A modified Stern-Volmer equation permitted the use of a quenching model that accounted for the possible interactions between the micelles and the nucleotides. The data analysis allowed calculating selective parameters that differentiated according to the type of nucleotide either at 25 or 50°C. Our results established the utility of the novel coumarin derivative fluorophore, supported by the simple and suitable micellar systems, as a tool for DNA sensing applications.

  9. Analysis of plant nucleotide sugars by hydrophilic interaction liquid chromatography and tandem mass spectrometry.

    Science.gov (United States)

    Ito, Jun; Herter, Thomas; Baidoo, Edward E K; Lao, Jeemeng; Vega-Sánchez, Miguel E; Michelle Smith-Moritz, A; Adams, Paul D; Keasling, Jay D; Usadel, Björn; Petzold, Christopher J; Heazlewood, Joshua L

    2014-03-01

    Understanding the intricate metabolic processes involved in plant cell wall biosynthesis is limited by difficulties in performing sensitive quantification of many involved compounds. Hydrophilic interaction liquid chromatography is a useful technique for the analysis of hydrophilic metabolites from complex biological extracts and forms the basis of this method to quantify plant cell wall precursors. A zwitterionic silica-based stationary phase has been used to separate hydrophilic nucleotide sugars involved in cell wall biosynthesis from milligram amounts of leaf tissue. A tandem mass spectrometry operating in selected reaction monitoring mode was used to quantify nucleotide sugars. This method was highly repeatable and quantified 12 nucleotide sugars at low femtomole quantities, with linear responses up to four orders of magnitude to several 100pmol. The method was also successfully applied to the analysis of purified leaf extracts from two model plant species with variations in their cell wall sugar compositions and indicated significant differences in the levels of 6 out of 12 nucleotide sugars. The plant nucleotide sugar extraction procedure was demonstrated to have good recovery rates with minimal matrix effects. The approach results in a significant improvement in sensitivity when applied to plant samples over currently employed techniques.

  10. Identification of Single Nucleotide Polymorphism on Growth Hormone Gene in Aceh Cattle

    Directory of Open Access Journals (Sweden)

    E. M. Sari

    2013-04-01

    Full Text Available This research was aimed to identify the changes of nucleotide (Single Nucleotide Polymorphism growth hormone gene in the population of Aceh cattle. There were 44 samples of DNA sequenced, and a few samples from Gen Bank (M57764. Based on the analysis using MEGA program, it was identified one new mutation on exon five on 2230 bp in which C nucleotide turned into T nucleotide, and this was called Silent Mutation (Leusine–Leusine/ CTC–CTT. The frequency of Single Nucleotide Polymorphism (SNP genotype on 2230 bp (C/T was CC (0.36, TT (0.14 and CT (0.50. The genotype TT was not possessed by Aceh cattle from Saree, but possessed by those from Banda Aceh and Indrapuri. Chi-square test showed not significant differences in allele frequencies for three population. The frequency of genotype SNP on 2291 bp (A/C was AC (0.11 and CC (0.89. The frequency of allele C was higher than allele A and T.

  11. Defective molecular timer in the absence of nucleotides leads to inefficient caspase activation.

    Science.gov (United States)

    Zhang, Honghao; Gogada, Raghu; Yadav, Neelu; Lella, Ravi K; Badeaux, Mark; Ayres, Mary; Gandhi, Varsha; Tang, Dean G; Chandra, Dhyan

    2011-01-27

    In the intrinsic death pathway, cytochrome C (CC) released from mitochondria to the cytosol triggers Apaf-1 apoptosome formation and subsequent caspase activation. This process can be recapitulated using recombinant Apaf-1 and CC in the presence of nucleotides ATP or dATP [(d)ATP] or using fresh cytosol and CC without the need of exogenous nucleotides. Surprisingly, we found that stored cytosols failed to support CC-initiated caspase activation. Storage of cytosols at different temperatures led to the loss of all (deoxy)nucleotides including (d)ATP. Addition of (d)ATP to such stored cytosols partially restored CC-initiated caspase activation. Nevertheless, CC could not induce complete caspase-9/3 activation in stored cytosols, even with the addition of (d)ATP, despite robust Apaf-1 oligomerization. The Apaf-1 apoptosome, which functions as a proteolytic-based molecular timer appeared to be defective as auto-processing of recruited procaspase-9 was inhibited. Far Western analysis revealed that procaspase-9 directly interacted with Apaf-1 and this interaction was reduced in the presence of physiological levels of ATP. Co-incubation of recombinant Apaf-1 and procaspase-9 prior to CC and ATP addition inhibited CC-induced caspase activity. These findings suggest that in the absence of nucleotide such as ATP, direct association of procaspase-9 with Apaf-1 leads to defective molecular timer, and thus, inhibits apoptosome-mediated caspase activation. Altogether, our results provide novel insight on nucleotide regulation of apoptosome.

  12. Nucleotide composition of CO1 sequences in Chelicerata (Arthropoda): detecting new mitogenomic rearrangements.

    Science.gov (United States)

    Arabi, Juliette; Judson, Mark L I; Deharveng, Louis; Lourenço, Wilson R; Cruaud, Corinne; Hassanin, Alexandre

    2012-02-01

    Here we study the evolution of nucleotide composition in third codon-positions of CO1 sequences of Chelicerata, using a phylogenetic framework, based on 180 taxa and three markers (CO1, 18S, and 28S rRNA; 5,218 nt). The analyses of nucleotide composition were also extended to all CO1 sequences of Chelicerata found in GenBank (1,701 taxa). The results show that most species of Chelicerata have a positive strand bias in CO1, i.e., in favor of C nucleotides, including all Amblypygi, Palpigradi, Ricinulei, Solifugae, Uropygi, and Xiphosura. However, several taxa show a negative strand bias, i.e., in favor of G nucleotides: all Scorpiones, Opisthothelae spiders and several taxa within Acari, Opiliones, Pseudoscorpiones, and Pycnogonida. Several reversals of strand-specific bias can be attributed to either a rearrangement of the control region or an inversion of a fragment containing the CO1 gene. Key taxa for which sequencing of complete mitochondrial genomes will be necessary to determine the origin and nature of mtDNA rearrangements involved in the reversals are identified. Acari, Opiliones, Pseudoscorpiones, and Pycnogonida were found to show a strong variability in nucleotide composition. In addition, both mitochondrial and nuclear genomes have been affected by higher substitution rates in Acari and Pseudoscorpiones. The results therefore indicate that these two orders are more liable to fix mutations of all types, including base substitutions, indels, and genomic rearrangements.

  13. Nucleotide precursors prevent folic acid-resistant neural tube defects in the mouse.

    Science.gov (United States)

    Leung, Kit-Yi; De Castro, Sandra C P; Savery, Dawn; Copp, Andrew J; Greene, Nicholas D E

    2013-09-01

    Closure of the neural tube during embryogenesis is a crucial step in development of the central nervous system. Failure of this process results in neural tube defects, including spina bifida and anencephaly, which are among the most common birth defects worldwide. Maternal use of folic acid supplements reduces risk of neural tube defects but a proportion of cases are not preventable. Folic acid is thought to act through folate one-carbon metabolism, which transfers one-carbon units for methylation reactions and nucleotide biosynthesis. Hence suboptimal performance of the intervening reactions could limit the efficacy of folic acid. We hypothesized that direct supplementation with nucleotides, downstream of folate metabolism, has the potential to support neural tube closure. Therefore, in a mouse model that exhibits folic acid-resistant neural tube defects, we tested the effect of specific combinations of pyrimidine and purine nucleotide precursors and observed a significant protective effect. Labelling in whole embryo culture showed that nucleotides are taken up by the neurulating embryo and incorporated into genomic DNA. Furthermore, the mitotic index was elevated in neural folds and hindgut of treated embryos, consistent with a proposed mechanism of neural tube defect prevention through stimulation of cellular proliferation. These findings may provide an impetus for future investigations of supplemental nucleotides as a means to prevent a greater proportion of human neural tube defects than can be achieved by folic acid alone.

  14. Sublingual Nucleotides Prolong Run Time to Exhaustion in Young Physically Active Men

    Directory of Open Access Journals (Sweden)

    Sergej M. Ostojic

    2013-11-01

    Full Text Available Although dietary nucleotides have been determined to be required for normal immune function, there is limited direct interventional evidence confirming performance-enhancing effects of sublingual nucleotides in humans. A double-blind, placebo-controlled, randomized trial was conducted to evaluate the effect of sublingual nucleotides (50 mg/day administered for 14 days in thirty young healthy physically active males, on endurance performance and immune responses. Fasting white blood cell count, natural killer cells (NKC number, NKC cytotoxic activity, and serum immunoglobulin (IgA, IgM, IgG, and time to exhaustion, peak rate of perceived exertion, peak heart rate, and peak running speed during the exercise test were measured at baseline (day 0 and post-intervention (day 14. Time to exhaustion, as well as serum immunoglobulin A and NKC cytotoxic activity, were significantly higher at day 14 (p < 0.05 in participants supplemented with nucleotides compared with those who consumed placebo. No significant differences in other parameters were observed between groups at post-intervention. No volunteers withdrew before the end of the study nor reported any vexatious side effects of supplementation. The results of the present study suggest that sublingual nucleotides may provide pertinent benefit as both an ergogenic and immunostimulatory additive in active males.

  15. Comprehensive analysis reveals how single nucleotides contribute to noncoding RNA function in bacterial quorum sensing.

    Science.gov (United States)

    Rutherford, Steven T; Valastyan, Julie S; Taillefumier, Thibaud; Wingreen, Ned S; Bassler, Bonnie L

    2015-11-01

    Five homologous noncoding small RNAs (sRNAs), called the Qrr1-5 sRNAs, function in the Vibrio harveyi quorum-sensing cascade to drive its operation. Qrr1-5 use four different regulatory mechanisms to control the expression of ∼ 20 mRNA targets. Little is known about the roles individual nucleotides play in mRNA target selection, in determining regulatory mechanism, or in defining Qrr potency and dynamics of target regulation. To identify the nucleotides vital for Qrr function, we developed a method we call RSort-Seq that combines saturating mutagenesis, fluorescence-activated cell sorting, high-throughput sequencing, and mutual information theory to explore the role that every nucleotide in Qrr4 plays in regulation of two mRNA targets, luxR and luxO. Companion biochemical assays allowed us to assign specific regulatory functions/underlying molecular mechanisms to each important base. This strategy yielded a regional map of nucleotides in Qrr4 vital for stability, Hfq interaction, stem-loop formation, and base pairing to both luxR and luxO, to luxR only, and to luxO only. In terms of nucleotides critical for sRNA function, the RSort-Seq analysis provided strikingly different results from those predicted by commonly used regulatory RNA-folding algorithms. This approach is applicable to any RNA-RNA interaction, including sRNAs in other bacteria and regulatory RNAs in higher organisms.

  16. Prebiotic synthesis of nucleotides at the Earth orbit in presence of Lunar soil.

    Science.gov (United States)

    Kuzicheva, E A; Gontareva, N B

    2002-01-01

    Modern studies now favor the fact that extraterrestrial organic molecules served as an important source of biological important substances on the primitive Earth. It is presumed that these space-made organic molecules could be transported safely to the Earth surface being associated with mineral grains. It is important to test whether nucleotides synthesized in Earth orbit could be protected by lunar surface regolite. The phosphorylation of adenosine, uridine and thymidine has been studied with respect of their further transformations and degradation in presence of mineral bed. After retrieval, HPLC analysis is used to identify all the mononucleotides of certain nucleosides. It has been shown, that exposure of the investigated nucleosides as dry films in space conditions in the presence of Lunar soil increases the yield of synthesized nucleotides in 1.1-3.0 times as compared with the exposure of the same samples in absence of Lunar soil. To identify and evaluate the principal source of energy in open space responsible for nucleotide synthesis reaction laboratory experiments were performed. It has been shown, that vacuum ultra violet (VUV 145 nm) radiation promotes nucleotide synthesis more effectively than ultra violet (UV 254 nm) while the presence of Lunar soil increases reaction yield in 1.5-2.0 times. Formation of 5'-mononucleotides seemed to be the most effective reaction both in flight and in laboratory experiments. Protective action of lunar soil on synthesized nucleotides against UV radiation has been shown in open Space conditions.

  17. Remarkable similarity in genome nucleotide sequences between the Schwarz FF-8 and AIK-C measles virus vaccine strains and apparent nucleotide differences in the phosphoprotein gene.

    Science.gov (United States)

    Ito, Chie; Ohgimoto, Shinji; Kato, Seiichi; Sharma, Luna Bhatta; Ayata, Minoru; Komase, Katsuhiro; Takeuchi, Kaoru; Ihara, Toshiaki; Ogura, Hisashi

    2011-07-01

    The Schwarz FF-8 (FF-8) and AIK-C measles virus vaccine strains are currently used for vaccination in Japan. Here, the complete genome nucleotide sequence of the FF-8 strain has been determined and its genome sequence found to be remarkably similar to that of the AIK-C strain. These two strains are differentiated only by two nucleotide differences in the phosphoprotein gene. Since the FF-8 strain does not possess the amino acid substitutions in the phospho- and fusion proteins which are responsible for the temperature-sensitivity and small syncytium formation phenotypes of the AIK-C strain, respectively, other unidentified common mechanisms likely attenuate both the FF-8 and AIK-C strains.

  18. Structural basis for dual nucleotide selectivity of aminoglycoside 2''-phosphotransferase IVa provides insight on determinants of nucleotide specificity of aminoglycoside kinases.

    Science.gov (United States)

    Shi, Kun; Berghuis, Albert M

    2012-04-13

    Enzymatic phosphorylation through a family of enzymes called aminoglycoside O-phosphotransferases (APHs) is a major mechanism by which bacteria confer resistance to aminoglycoside antibiotics. Members of the APH(2″) subfamily are of particular clinical interest because of their prevalence in pathogenic strains and their broad substrate spectra. APH(2″) enzymes display differential preferences between ATP or GTP as the phosphate donor, with aminoglycoside 2″-phosphotransferase IVa (APH(2″)-IVa) being a member that utilizes both nucleotides at comparable efficiencies. We report here four crystal structures of APH(2″)-IVa, two of the wild type enzyme and two of single amino acid mutants, each in complex with either adenosine or guanosine. Together, these structures afford a detailed look at the nucleoside-binding site architecture for this enzyme and reveal key elements that confer dual nucleotide specificity, including a solvent network in the interior of the nucleoside-binding pocket and the conformation of an interdomain linker loop. Steady state kinetic studies, as well as sequence and structural comparisons with members of the APH(2″) subfamily and other aminoglycoside kinases, rationalize the different substrate preferences for these enzymes. Finally, despite poor overall sequence similarity and structural homology, analysis of the nucleoside-binding pocket of APH(2″)-IVa shows a striking resemblance to that of eukaryotic casein kinase 2 (CK2), which also exhibits dual nucleotide specificity. These results, in complement with the multitude of existing inhibitors against CK2, can serve as a structural basis for the design of nucleotide-competitive inhibitors against clinically relevant APH enzymes.

  19. Structural Basis for Dual Nucleotide Selectivity of Aminoglycoside 2″-Phosphotransferase IVa Provides Insight on Determinants of Nucleotide Specificity of Aminoglycoside Kinases*♦

    Science.gov (United States)

    Shi, Kun; Berghuis, Albert M.

    2012-01-01

    Enzymatic phosphorylation through a family of enzymes called aminoglycoside O-phosphotransferases (APHs) is a major mechanism by which bacteria confer resistance to aminoglycoside antibiotics. Members of the APH(2″) subfamily are of particular clinical interest because of their prevalence in pathogenic strains and their broad substrate spectra. APH(2″) enzymes display differential preferences between ATP or GTP as the phosphate donor, with aminoglycoside 2″-phosphotransferase IVa (APH(2″)-IVa) being a member that utilizes both nucleotides at comparable efficiencies. We report here four crystal structures of APH(2″)-IVa, two of the wild type enzyme and two of single amino acid mutants, each in complex with either adenosine or guanosine. Together, these structures afford a detailed look at the nucleoside-binding site architecture for this enzyme and reveal key elements that confer dual nucleotide specificity, including a solvent network in the interior of the nucleoside-binding pocket and the conformation of an interdomain linker loop. Steady state kinetic studies, as well as sequence and structural comparisons with members of the APH(2″) subfamily and other aminoglycoside kinases, rationalize the different substrate preferences for these enzymes. Finally, despite poor overall sequence similarity and structural homology, analysis of the nucleoside-binding pocket of APH(2″)-IVa shows a striking resemblance to that of eukaryotic casein kinase 2 (CK2), which also exhibits dual nucleotide specificity. These results, in complement with the multitude of existing inhibitors against CK2, can serve as a structural basis for the design of nucleotide-competitive inhibitors against clinically relevant APH enzymes. PMID:22371504

  20. A GPA diagnostic system for aeroengine applications

    Institute of Scientific and Technical Information of China (English)

    Yi-Guang Li

    2007-01-01

    In this research,a GPA(Gas Path Analysis)diagnostic system enhanced with GPA Index is described for gas path sensor and component fault diagnosis.A method of measurement correction is used in order that the measurement data obtained at un-standard ambient and operating conditions can be used for diagnostic analysis.The developed diagnostic system has been implemented into a Cranfield University gas turbine performance and diagnostic analysis software PYTHIA for gas turbine performance degradation analysis.The developed method and software have been applied to a model aero gas turbine engine to test the effectiveness of the system.The analysis shows that the developed diagnostic system can diagnose degraded sensor and components effectively using performance deviation measured at un-standard ambient and operational conditions.Theoretically,the idea of the diagnostic approach can be applied to different gas turbine engines.

  1. Implementation of Rapid Molecular Infectious Disease Diagnostics: the Role of Diagnostic and Antimicrobial Stewardship.

    Science.gov (United States)

    Messacar, Kevin; Parker, Sarah K; Todd, James K; Dominguez, Samuel R

    2017-03-01

    New rapid molecular diagnostic technologies for infectious diseases enable expedited accurate microbiological diagnoses. However, diagnostic stewardship and antimicrobial stewardship are necessary to ensure that these technologies conserve, rather than consume, additional health care resources and optimally affect patient care. Diagnostic stewardship is needed to implement appropriate tests for the clinical setting and to direct testing toward appropriate patients. Antimicrobial stewardship is needed to ensure prompt appropriate clinical action to translate faster diagnostic test results in the laboratory into improved outcomes at the bedside. This minireview outlines the roles of diagnostic stewardship and antimicrobial stewardship in the implementation of rapid molecular infectious disease diagnostics.

  2. Diagnostic Ultrasound in Colorectal Cancer

    DEFF Research Database (Denmark)

    Rafaelsen, Søren Rafael

    2014-01-01

    SUMMARYBackground and purpose Colorectal cancer is a common disease in Denmark with considerable morbidity and mortality. Although survival in recent years has improved, Denmark still has the lowest 5-year survival compared to the other Nordic countries. The treatment of patients depends on local...... the potential to contribute to the staging of colorectal cancer. The purpose of these studies was to determine the usefulness of ultrasound diagnostics in patients with colorectal cancer.The purpose of the TRUS studies was to compare staging of rectal carcinomas using digital rectal exploration...... with the resulting pathological examination in relation to differentiating benign from malignant polyps and determining tumour stage and lymph node status. In this context we also performed an observer comparison using both TRUS and MRI. Consistency of tumour outgrowth of rectal cancer rated by TRUS and MRI...

  3. [Acute rhinosinusitis: diagnostics and treatment].

    Science.gov (United States)

    Lazarevich, I A; Kozlov, V S

    2013-01-01

    Acute rhinosinusitis is a challenging clinical problem due to its high prevalence. The overwhelming majority of the cases of acute rhinosinusitis (ARS) have viral etiology. Clinical manifestations of viral and bacterial rhinosinusitis can be very similar. Similar expert communities have proposed their recommendations on diagnostics and treatment of acute rhinosinusitis in the recent decade. These recommendations are underlain by the principles of evidence-based medicine, take into consideration the result of reliable investigations, and reflect the opinions of leading specialists in otorhinolaryngology, allergology and immunology. The present review contains the analysis of consensus documents and recommendations. The results of ongoing research provide convincing evidence of the effectiveness of intranasal application of corticosteroids in the patients presenting with acute rhinosinusitis. Antibacterial therapy of acute rhinosinusitis is indicated only in the case of severe or complicated clinical course of the disease.

  4. The sleepy teenager - diagnostic challenges

    Directory of Open Access Journals (Sweden)

    Anne-Marie eLandtblom

    2014-08-01

    Full Text Available The sleepy teenager is a diagnostic challenge because the problems may be physiological or pathological, with behavioural, social and pychological expressions. It is of great importance that health staff that encounter young people with sleep disturbance have good knowledge about the diseases that must be excluded. Narcolepsy, periodic hypersomnia like Kleine Levin syndrome, delayed sleep phase syndrome and obstructive sleep apnoea syndrome, depression and substance use as well as fatigue from chronic disease like multiple sclerosis should be investigated. Clinical assessment, neurophysiological and laboratory investigations constitute important support in these investigations. Functional methods, for example fMRI, are being developed. The role of computer gaming and use of social media in the night is discussed in relation to these diseases. Cognitive dysfunction may develop with several of the conditions. There is need for increased awareness of how to investigate sleep disturbance in children and young people.

  5. Improving tuberculosis diagnostics with biomarkers

    Directory of Open Access Journals (Sweden)

    Shu CC

    2015-05-01

    Full Text Available Chin-Chung Shu,1,2 Jann-Yuan Wang,2 Li-Na Lee,2,3 Chong-Jen Yu,2 Kwen-Tay Luh3 1Department of Traumatology, 2Department of Internal Medicine, 3Department of Laboratory Medicine, National Taiwan University Hospital, Taipei, Taiwan Abstract: Although many laboratory methods have been developed to expedite the diagnosis of active tuberculosis (TB and Mycobacterium tuberculosis (Mtb infection, delays in diagnosis remain a major problem in clinical practice. Biomarkers may contribute favorably or unfavorably to TB diagnosis in a clinical suspect TB case with inconclusive diagnostic findings. A good understanding of the effectiveness and practical limitations of these biomarkers is important to improve diagnosis. This review summarizes currently used biomarkers, mainly as validation, and focuses on latent TB infection, active pulmonary TB, and tuberculous pleural effusion. Keywords: tuberculosis, biomarker, diagnosis, latent tuberculosis infection, pleural effusion 

  6. Necrotizing sialometaplasia: A diagnostic dilemma!

    Directory of Open Access Journals (Sweden)

    Samir A Joshi

    2014-01-01

    Full Text Available Necrotizing sialometaplasia (NS is a benign, self-limiting inflammatory reaction of salivary gland tissue which may mimic squamous cell carcinoma or mucoepidermoid carcinoma, both clinically and histologically, that creates diagnostic dilemma leading to unwarranted aggressive surgery. Most commonly affected site is the minor salivary glands of the palate. The pathogenesis is unknown but is believed to be due to ischemia of vasculature supplying the salivary gland lobules. A simple incisional biopsy is required to confirm the histological diagnosis and to rule out more serious disease processes. It is a self-limiting disease process and requires no treatment. It will be prudent to do repeat biopsy in case if the lesion does not heal within 3 months.

  7. AI-Based Diagnostic Shell

    Directory of Open Access Journals (Sweden)

    R. L. Verma

    1989-01-01

    Full Text Available This paper datails the design and implementation of an AI-based diagnostic shell. The shell has a user-interface which takes in the complaint and aids the user throughout the consultation. The 'expert knowledge' is acquired and encoded in the form of 'IF-THEN' rules, The control mechanism routes through the rules chaining first backwards to identify a fault and then forwards to confirm it.Explanation facilities have been provided to enable the user query the reason for any question asked, a facility to go back and re-answer any previous question, and a trace and explanation of the path of reasoning.This shell was developed and first used for the diagnosis of a digital exchange. It was then applied for the fault-finding of the moving target indicator used in the radar.

  8. Interstitial lung disease: Diagnostic approach

    Directory of Open Access Journals (Sweden)

    Kaushik Saha

    2014-01-01

    Full Text Available Interstitial lung disease (ILD is a final common pathway of a broad heterogeneous group of parenchymal lung disorders. It is characterized by progressive fibrosis of the lung leading to restriction and diminished oxygen transfer. Clinically, the presenting symptoms of ILD are non-specific (cough and progressive dyspnea on exertion and are often attributed to other diseases, thus delaying diagnosis and timely therapy. Clues from the medical history along with the clinical context and radiologic findings provide the initial basis for prioritizing diagnostic possibilities for a patient with ILD. An accurate prognosis and optimal treatment strategy for patients with ILDs can only be after an accurate diagnosis. This review will assist pulmonary physicians and medicine specialist in recognition of ILD. Extensive literature search has been made through PubMed and also Book References has been used for writing this review.

  9. The Beam Diagnostics for SESAME

    CERN Document Server

    Varnasseri, S

    2005-01-01

    SESAME (Synchrotron-light for Experimental Science and Applications in the Middle East) is an Independent Intergovernmental Organization developed and officially established under the auspices of UNESCO. SESAME will become a major international research center in the Middle East, located in Allan, Jordan. The machine design is based on a 2.5 GeV 3rd generation Light Source with an emittance of 26 nm*rad and 12 straights for insertion devices. The conceptual design of the accelerator complex has been frozen and the engineering design is started. The completion of the accelerators complex construction is scheduled for the end of 2009. In the following an overview of the electron beam diagnostic system is presented, with special emphasis on the beam position monitoring system and the synchrotron light monitor.

  10. Optical tweezers for medical diagnostics.

    Science.gov (United States)

    LaFratta, Christopher N

    2013-07-01

    Laser trapping by optical tweezers makes possible the spectroscopic analysis of single cells. Use of optical tweezers in conjunction with Raman spectroscopy has allowed cells to be identified as either healthy or cancerous. This combined technique is known as laser tweezers Raman spectroscopy (LTRS), or Raman tweezers. The Raman spectra of cells are complex, since the technique probes nucleic acids, proteins, and lipids; but statistical analysis of these spectra makes possible differentiation of different classes of cells. In this article the recent development of LTRS is described along with two illustrative examples for potential application in cancer diagnostics. Techniques to expand the uses of LTRS and to improve the speed of LTRS are also suggested.

  11. Beam diagnostics in the CIRFEL

    Energy Technology Data Exchange (ETDEWEB)

    Krishnaswamy, J.; Lehrman, I.S.; Hartley, R. [Northrop Grumman Advanced Technology and Development Center, Princeton, NJ (United States)] [and others

    1995-12-31

    The CIRFEL system has been operating with electron energies in the range of 11 to 12 MeV and RF pulse length of 3 to 4 {mu}secs. The electrons produced by a Magnesium photocathode illuminated by a 261nm mode locked laser are accelerated in the RF gun, and further boosted in energy by a booster section downstream of the RIF gun. The electrons are energy selected in the bending section before insertion into a permanent magnet wiggler. We describe several recent diagnostic measurements carried out on the CIRFEL system: emittance measurements in two different sections of the beam line, energy and energy spread measurements, and jitter characteristics of the photo cathode drive laser as well as the electron beam energy.

  12. Brucellosis: Epizootiologic and diagnostic challenge

    Directory of Open Access Journals (Sweden)

    Radojičić Sonja

    2005-01-01

    Full Text Available Although it has been known as a separate etiological entity for almost 150 years, brucellosis is, on a global scale, one of the most frequent diseases that is transferred from animals to humans. It is present as an endemic disease in almost all countries of the Mediterranean Sea, which indicates that a large number of aspects in connection with the control and epizootiology of this disease still remain unexplained. Three of the six types of brucella have been officially confirmed in our country as well. They are Brucella melitensis biotip 3, Brucella suis biotip 2 and Brucella canis. Brucellosis is endemically present in Kosovo and Metohija province and in southern Serbia proper; over the past few years, the spread of brucellosis in sheep and goats as primary hosts for B. melitensis to new territories, mostly in Vojvodina province, has shown that risk analysis is one of the main factors in selecting and implementing control programmes. A correctly selected set of diagnostic tests yields reliable data in most cases, but interpretations of results are prone to result in subjective assessments as well. A special problem in the serological diagnosis of brucellosis is the cross reactivity of brucellas and some other bacteria, often a weak immunological response of the animal, or that the type of brucella that causes the infection determines the sensitivity and specificity of the applied tests, most often screenings tests. Due to the big economic losses resulting from disease control and eradication, and the serious risk to human health, brucellosis still poses an epizootiological, and, in particular, a diagnostic challenge.

  13. Motional Stark effect diagnostic on TEXTOR

    Science.gov (United States)

    Jakubowska, K.; De Bock, M.; Jaspers, R.; von Hellermann, M.; Shmaenok, L.

    2004-10-01

    A motional Stark effect diagnostic at the tokamak TEXTOR has been constructed and brought recently into operation. In contrast to diagnostics used on other tokamaks, this diagnostic reveals the direction of the magnetic field from the intensity ratio of the π and σ components of the emitted Balmer-α and not from a polarization measurement of a single line. Moreover, the complete spectrum is measured which allows determining the radial position of the measurement, and in principle the radial electric field.

  14. Unmet Diagnostic Needs in Infectious Disease

    Science.gov (United States)

    Blaschke, Anne J.; Hersh, Adam L.; Beekmann, Susan E.; Ince, Dilek; Polgreen, Philip M.; Hanson, Kimberly E.

    2014-01-01

    Accurate diagnosis is critical to providing appropriate care in infectious diseases. New technologies for infectious disease diagnostics are emerging, but gaps remain in test development and availability. The Emerging Infections Network surveyed Infectious Diseases physicians to assess unmet diagnostic needs. Responses reflected the urgent need to identify drug-resistant infections and highlighted the potential for early diagnosis to improve antibiotic stewardship. Information gained from this survey can help inform recommendations for new diagnostic test development in the future. PMID:25456043

  15. Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

    Science.gov (United States)

    Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

    2006-03-01

    Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

  16. Study of the Molecular Recognition of Nucleotides and Bases by a Novel Calixarene Derivative Containing Uracil

    Institute of Scientific and Technical Information of China (English)

    SHI,Hui-Jie; SHI,Xian-Fa; YAO,Tian-Ming; JI,Liang-Nian

    2008-01-01

    A calix[4]arene derivative containing uracil, 5-(uracil-N1-acetamido)-25,26,27,28-tetrahy droxycalix[4]-arene (UC), was designed and synthesized. The interaction with nucleotides and bases has also been studied by ESI-MS and π-A isotherms. The results of ESI-MS showed that UC could recognize adenine and adenosine from other nucleotides and bases. In addition, π-A isotherms at the air-water interface indicated that there was interaction between UC and the species in the subphase, and the respective complexes were formed in the monolayer. The mean molecular area at zero surface pressure increased with the sizes of the nucleotides and bases in the subphase in the order: water<adenine<adenosine<ATP·Na2.

  17. Fluorescence spectroscopic study of the interaction of adenine and nucleotide with trichosanthin.

    Science.gov (United States)

    Hao, Q; Zhang, Y; Yang, H; Liu, G; Huang, Z; Liu, B; Yao, Q; Li, Q

    1995-07-01

    Trichosanthin (TCS) is an N-glycosidase that can attack the 28s rRNA of the ribosome at a highly conserved adenine residue. The interactions of adenine and its derivative nucleotides with TCS are reported. The fluorescence of Trp 192 of TCS is sensitive to the proximity of adenine, and produces a marked red shift indicative of trytophan in a more hydrophilic environment. By contrast AMP and ATP quench the maximal emission at 328nm. The binding of the adenine and ATP with TCS result in lower tryptophan accessibility to the quencher acrylamide, but higher tryptophan accessibility to the quencher iodide, while AMP caused higher tryptophan accessibility to acrylamide, and lower tryptophan accessibility to iodide. Also, the binding of nucleotides induces tryptophan heterogeneity in the protein. These findings lead us to propose that binding of nucleotides and adenine base cause different microenvironmental changes of the tryptophan residue, and Trp 192 may be involved in the active site of TCS.

  18. Complete Nucleotide Sequence of a Newly Avirulent Newcastle Disease Virus Hubei 92(HB92) Strain

    Institute of Scientific and Technical Information of China (English)

    Pan Zi-shu; Chen Yu-dong; Shao Hua-bin; Yang Jun; Xiong Zhong-liang; Wen Guo-yuan; Zhang Chu-yu

    2004-01-01

    A new avirulent, heat-resistance HB92 strain of newcastle Disease Virus (NDV) was acquired from Australia V4 strain. Its complete nucleotides sequence was first determined. The entire genome of NDV HB92 consists of 15 186nucleotides (GenBank accession no. AY225110 ). It was demonstrated by sequence analysis that nucleotides homology of HB92 strain with virulent strain ZJ1 were 83.9%, and the homology compared with avirulent vaccine strain La Sota and BI were 94. 0% and 93. 5%, respectively. These results might be contributive to tbe study of the molecular mechanism of evolution of the NDV strain HB92 and to develop the engineered recombinant vaccine.

  19. The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

    Directory of Open Access Journals (Sweden)

    Ian R Kelsall

    Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

  20. Statistical analysis of nucleotide runs in coding and noncoding DNA sequences.

    Science.gov (United States)

    Sprizhitsky YuA; Nechipurenko YuD; Alexandrov, A A; Volkenstein, M V

    1988-10-01

    A statistical analysis of the occurrence of particular nucleotide runs in DNA sequences of different species has been carried out. There are considerable differences of run distributions in DNA sequences of procaryotes, invertebrates and vertebrates. There is an abundance of short runs (1-2 nucleotides long) in the coding sequences and there is a deficiency of such runs in the noncoding regions. However, some interesting exceptions from this rule exist for the run distribution of adenine in procaryotes and for the arrangement of purine-pyrimidine runs in eucaryotes. The similarity in the distributions of such runs in the coding and noncoding regions may be due to some structural features of the DNA molecule as a whole. Runs of guanine (or cytosine) of three to six nucleotides occur predominantly in noncoding DNA regions in eucaryotes, especially in vertebrates.