WorldWideScience

Sample records for nuclear rdna sequences

  1. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    Science.gov (United States)

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  2. Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

    Science.gov (United States)

    El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

    2013-07-01

    Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

  3. Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

    Science.gov (United States)

    Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

    2004-01-01

    In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae. Copyright 2004 WILEY-VCH Verlag GmbH & Co.

  4. Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.

    Science.gov (United States)

    Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly

    2016-11-01

    Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

  5. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  6. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  7. Fascioliasis transmission by Lymnaea neotropica confirmed by nuclear rDNA and mtDNA sequencing in Argentina.

    Science.gov (United States)

    Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores

    2009-12-03

    Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix

  8. [Phylogenetic relationships among the genera of Taxodiaceae and Cupressaceae from 28S rDNA sequences].

    Science.gov (United States)

    Li, Chun-Xiang; Yang, Qun

    2003-03-01

    DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.

  9. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  10. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes.

    Science.gov (United States)

    Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang

    2010-09-13

    The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  11. The Large Subunit rDNA Sequence of Plasmodiophora brassicae Does not Contain Intra-species Polymorphism.

    Science.gov (United States)

    Schwelm, Arne; Berney, Cédric; Dixelius, Christina; Bass, David; Neuhauser, Sigrid

    2016-12-01

    Clubroot disease caused by Plasmodiophora brassicae is one of the most important diseases of cultivated brassicas. P. brassicae occurs in pathotypes which differ in the aggressiveness towards their Brassica host plants. To date no DNA based method to distinguish these pathotypes has been described. In 2011 polymorphism within the 28S rDNA of P. brassicae was reported which potentially could allow to distinguish pathotypes without the need of time-consuming bioassays. However, isolates of P. brassicae from around the world analysed in this study do not show polymorphism in their LSU rDNA sequences. The previously described polymorphism most likely derived from soil inhabiting Cercozoa more specifically Neoheteromita-like glissomonads. Here we correct the LSU rDNA sequence of P. brassicae. By using FISH we demonstrate that our newly generated sequence belongs to the causal agent of clubroot disease. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

  12. Characterization of Fasciola samples by ITS of rDNA sequences revealed the existence of Fasciola hepatica and Fasciola gigantica in Yunnan Province, China.

    Science.gov (United States)

    Shu, Fan-Fan; Lv, Rui-Qing; Zhang, Yi-Fang; Duan, Gang; Wu, Ding-Yu; Li, Bi-Feng; Yang, Jian-Fa; Zou, Feng-Cai

    2012-08-01

    On mainland China, liver flukes of Fasciola spp. (Digenea: Fasciolidae) can cause serious acute and chronic morbidity in numerous species of mammals such as sheep, goats, cattle, and humans. The objective of the present study was to examine the taxonomic identity of Fasciola species in Yunnan province by sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA). The ITS rDNA was amplified from 10 samples representing Fasciola species in cattle from 2 geographical locations in Yunnan Province, by polymerase chain reaction (PCR), and the products were sequenced directly. The lengths of the ITS-1 and ITS-2 sequences were 422 and 361-362 base pairs, respectively, for all samples sequenced. Using ITS sequences, 2 Fasciola species were revealed, namely Fasciola hepatica and Fasciola gigantica. This is the first demonstration of F. gigantica in cattle in Yunnan Province, China using a molecular approach; our findings have implications for studying the population genetic characterization of the Chinese Fasciola species and for the prevention and control of Fasciola spp. in this province.

  13. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    Science.gov (United States)

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  14. Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

    Science.gov (United States)

    Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

    2015-08-01

    Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

  15. Evolution of rDNA in Nicotiana Allopolyploids: A Potential Link between rDNA Homogenization and Epigenetics

    Science.gov (United States)

    Kovarik, Ales; Dadejova, Martina; Lim, Yoong K.; Chase, Mark W.; Clarkson, James J.; Knapp, Sandra; Leitch, Andrew R.

    2008-01-01

    Background The evolution and biology of rDNA have interested biologists for many years, in part, because of two intriguing processes: (1) nucleolar dominance and (2) sequence homogenization. We review patterns of evolution in rDNA in the angiosperm genus Nicotiana to determine consequences of allopolyploidy on these processes. Scope Allopolyploid species of Nicotiana are ideal for studying rDNA evolution because phylogenetic reconstruction of DNA sequences has revealed patterns of species divergence and their parents. From these studies we also know that polyploids formed over widely different timeframes (thousands to millions of years), enabling comparative and temporal studies of rDNA structure, activity and chromosomal distribution. In addition studies on synthetic polyploids enable the consequences of de novo polyploidy on rDNA activity to be determined. Conclusions We propose that rDNA epigenetic expression patterns established even in F1 hybrids have a material influence on the likely patterns of divergence of rDNA. It is the active rDNA units that are vulnerable to homogenization, which probably acts to reduce mutational load across the active array. Those rDNA units that are epigenetically silenced may be less vulnerable to sequence homogenization. Selection cannot act on these silenced genes, and they are likely to accumulate mutations and eventually be eliminated from the genome. It is likely that whole silenced arrays will be deleted in polyploids of 1 million years of age and older. PMID:18310159

  16. [The use of 16S rDNA sequencing in species diversity analysis for sputum of patients with ventilator-associated pneumonia].

    Science.gov (United States)

    Yang, Xiaojun; Wang, Xiaohong; Liang, Zhijuan; Zhang, Xiaoya; Wang, Yanbo; Wang, Zhenhai

    2014-05-01

    To study the species and amount of bacteria in sputum of patients with ventilator-associated pneumonia (VAP) by using 16S rDNA sequencing analysis, and to explore the new method for etiologic diagnosis of VAP. Bronchoalveolar lavage sputum samples were collected from 31 patients with VAP. Bacterial DNA of the samples were extracted and identified by polymerase chain reaction (PCR). At the same time, sputum specimens were processed for routine bacterial culture. The high flux sequencing experiment was conducted on PCR positive samples with 16S rDNA macro genome sequencing technology, and sequencing results were analyzed using bioinformatics, then the results between the sequencing and bacteria culture were compared. (1) 550 bp of specific DNA sequences were amplified in sputum specimens from 27 cases of the 31 patients with VAP, and they were used for sequencing analysis. 103 856 sequences were obtained from those sputum specimens using 16S rDNA sequencing, yielding approximately 39 Mb of raw data. Tag sequencing was able to inform genus level in all 27 samples. (2) Alpha-diversity analysis showed that sputum samples of patients with VAP had significantly higher variability and richness in bacterial species (Shannon index values 1.20, Simpson index values 0.48). Rarefaction curve analysis showed that there were more species that were not detected by sequencing from some VAP sputum samples. (3) Analysis of 27 sputum samples with VAP by using 16S rDNA sequences yielded four phyla: namely Acitinobacteria, Bacteroidetes, Firmicutes, Proteobacteria. With genus as a classification, it was found that the dominant species included Streptococcus 88.9% (24/27), Limnohabitans 77.8% (21/27), Acinetobacter 70.4% (19/27), Sphingomonas 63.0% (17/27), Prevotella 63.0% (17/27), Klebsiella 55.6% (15/27), Pseudomonas 55.6% (15/27), Aquabacterium 55.6% (15/27), and Corynebacterium 55.6% (15/27). (4) Pyrophosphate sequencing discovered that Prevotella, Limnohabitans, Aquabacterium

  17. Morphology and 18S rDNA gene sequence of Spirostomum minus and Spirostomum teres (Ciliophora: Heterotrichea from Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Noemi M. Fernandes

    2013-02-01

    Full Text Available Species of Spirostomum Ehrenberg, 1838 are widely used as model organisms in ecological studies of environmental impacts and symbioses between ciliates and human pathogenic bacteria. However, the taxonomy of this genus is confused by the superficiality of the morphological descriptions of its included species, and the use of only a few characters for their differentiation. The present study provides details of total infraciliature, nuclear apparatus, morphometric data and 18S rDNA gene sequences of Spirostomum teres Claparède & Lachmann, 1858 and Spirostomum minus Roux, 1901, isolated from a sewage treatment plant and a freshwater lake in the city of Rio de Janeiro, Brazil, respectively. For the morphological descriptions of S. teres and S. minus, living cells were observed using bright-field and differential interference contrast (DIC microscopy, the total infraciliature and nuclear apparatus were revealed by staining with protargol, and ciliary patterns were observed also with scanning electron microscopy (SEM. The complete sequences of the 18S rDNA of S. teres and S. minus were obtained using eukaryotic universal primers, and then compared with sequences of other species and populations of Spirostomum deposited in the GenBank database. Living S. minus measured 400-800 µm in length and 55-115 µm in width, with the following characteristics: adoral zone of membranelles approximately 112 µm long; inconspicuous paroral kinety; 30-40 kineties in somatic ciliature; moniliform macronucleus with 9-25 nodes, approximately 12 micronuclei; single and posterior contractile vacuole; and yellow-brown cytoplasm. Living and fully extended S. teres measured approximately 250 µm in length and 65 ìm in width, with the following characteristics: adoral zone of membranelles approximately 92 µm long; approximately 30 somatic kineties; compact macronucleus, approximately five micronuclei; macronuclear groove present; single and posterior contractile vacuole

  18. Ulva and Enteromorpha (Ulvaceae, Chlorophyta) from two sides of the Yellow Sea: analysis of nuclear rDNA ITS and plastid rbcL sequence data

    Science.gov (United States)

    Wang, Jinfeng; Li, Nan; Jiang, Peng; Boo, Sung Min; Lee, Wook Jae; Cui, Yulin; Lin, Hanzhi; Zhao, Jin; Liu, Zhengyi; Qin, Song

    2010-07-01

    Ulvacean green seaweeds are common worldwide; they formed massive green tides in the Yellow Sea in recent years, which caused marine ecological problems as well as a social issue. We investigated two major genera of the Ulvaceae, Ulva and Enteromorpha, and collected the plastid rbcL and nuclear ITS sequences of specimens of the genera in two sides of the Yellow Sea and analyzed them. Phylogenetic trees of rbcL data show the occurrence of five species of Enteromorpha ( E. compressa, E. flexuosa, E. intestinalis, E. linza and E. prolifera) and three species of Ulva ( U. pertusa, U. rigida and U. ohnoi). However, we found U. ohnoi, which is known as a subtropical to tropical species, at two sites on Jeju Island, Korea. Four ribotypes in partial sequences of 5.8S rDNA and ITS2 from E. compressa were also found. Ribotype network analysis revealed that the common ribotype, occurring in China, Korea and Europe, is connected with ribotypes from Europe and China/Japan. Although samples of the same species were collected from both sides of the Yellow Sea, intraspecific genetic polymorphism of each species was low among samples collected worldwide.

  19. The Comparison of Biochemical and Sequencing 16S rDNA Gene Methods to Identify Nontuberculous Mycobacteria

    Directory of Open Access Journals (Sweden)

    Shafipour1, M.

    2014-11-01

    Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.

  20. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

    Science.gov (United States)

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.

  1. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    Science.gov (United States)

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

  2. Regulation of rDNA stability by sumoylation

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2009-01-01

    Repair of DNA lesions by homologous recombination relies on the copying of genetic information from an intact homologous sequence. However, many eukaryotic genomes contain repetitive sequences such as the ribosomal gene locus (rDNA), which poses a risk for illegitimate recombination. Therefore, t......6 complex and sumoylation of Rad52, which directs DNA double-strand breaks in the rDNA to relocalize from within the nucleolus to the nucleoplasm before association with the recombination machinery. The relocalization before repair is important for maintaining rDNA stability. The focus...

  3. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  4. Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

    Science.gov (United States)

    Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

    2012-12-01

    The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

  5. Phylogenetic analysis of Thai oyster (Ostreidae) based on partial sequences of the mitochondrial 16S rDNA gene

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik

    2006-01-01

    Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...

  6. Genetic diversity based on 28S rDNA sequences among populations of Culex quinquefasciatus collected at different locations in Tamil Nadu, India.

    Science.gov (United States)

    Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S

    2015-09-01

    The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.

  7. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  8. A Simple Method for the Extraction, PCR-amplification, Cloning, and Sequencing of Pasteuria 16S rDNA from Small Numbers of Endospores.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Ciancio, A

    2004-03-01

    For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 x 10 endospores ml(-1) were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis.

  9. Community structure of arbuscular mycorrhizal fungi in undisturbed vegetation revealed by analyses of LSU rdna sequences

    DEFF Research Database (Denmark)

    Rosendahl, Søren; Holtgrewe-Stukenbrock, Eva

    2004-01-01

    Arbuscular mycorrhizal fungi (AMF) form a mutualistic symbiosis with plant roots and are found in most ecosystems. In this study the community structure of AMF in a clade of the genus Glomus was examined in undisturbed costal grassland using LSU rDNA sequences amplified from roots of Hieracium...

  10. Navigating the tip of the genomic iceberg: Next-generation sequencing for plant systematics.

    Science.gov (United States)

    Straub, Shannon C K; Parks, Matthew; Weitemier, Kevin; Fishbein, Mark; Cronn, Richard C; Liston, Aaron

    2012-02-01

    Just as Sanger sequencing did more than 20 years ago, next-generation sequencing (NGS) is poised to revolutionize plant systematics. By combining multiplexing approaches with NGS throughput, systematists may no longer need to choose between more taxa or more characters. Here we describe a genome skimming (shallow sequencing) approach for plant systematics. Through simulations, we evaluated optimal sequencing depth and performance of single-end and paired-end short read sequences for assembly of nuclear ribosomal DNA (rDNA) and plastomes and addressed the effect of divergence on reference-guided plastome assembly. We also used simulations to identify potential phylogenetic markers from low-copy nuclear loci at different sequencing depths. We demonstrated the utility of genome skimming through phylogenetic analysis of the Sonoran Desert clade (SDC) of Asclepias (Apocynaceae). Paired-end reads performed better than single-end reads. Minimum sequencing depths for high quality rDNA and plastome assemblies were 40× and 30×, respectively. Divergence from the reference significantly affected plastome assembly, but relatively similar references are available for most seed plants. Deeper rDNA sequencing is necessary to characterize intragenomic polymorphism. The low-copy fraction of the nuclear genome was readily surveyed, even at low sequencing depths. Nearly 160000 bp of sequence from three organelles provided evidence of phylogenetic incongruence in the SDC. Adoption of NGS will facilitate progress in plant systematics, as whole plastome and rDNA cistrons, partial mitochondrial genomes, and low-copy nuclear markers can now be efficiently obtained for molecular phylogenetics studies.

  11. Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.

    Science.gov (United States)

    Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří

    2016-11-01

    Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.

  12. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. A global meta-analysis of Tuber ITS rDNA sequences: species diversity, host associations and long-distance dispersal

    Science.gov (United States)

    Gregory M. Bonito; Andrii P. Gryganskyi; James M. Trappe; Rytas. Vilgalys

    2010-01-01

    Truffles (Tuber) are ectomycorrhizal fungi characterized by hypogeous fruitbodies. Their biodiversity, host associations and geographical distributions are not well documented. ITS rDNA sequences of Tuber are commonly recovered from molecular surveys of fungal communities, but most remain insufficiently identified making it...

  14. Pattern of morphological diversification in the Leptocarabus ground beetles (Coleoptera: Carabidae) as deduced from mitochondrial ND5 gene and nuclear 28S rDNA sequences.

    Science.gov (United States)

    Kim, C G; Zhou, H Z; Imura, Y; Tominaga, O; Su, Z H; Osawa, S

    2000-01-01

    Most of the mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and a part of nuclear 28S ribosomal RNA gene were sequenced for 14 species of ground beetles belonging to the genus Leptocarabus. In both the ND5 and the 28S rDNA phylogenetic trees of Leptocarabus, three major lineages were recognized: (1) L. marcilhaci/L. yokoael/Leptocarabus sp. from China, (2) L. koreanus/L. truncaticollis/L. seishinensis/L. semiopacus/L. canaliculatus/L. kurilensis from the northern Eurasian continent including Korea and Hokkaido, Japan, and (3) all of the Japanese species except L. kurilensis. Clustering of the species in the trees is largely linked to their geographic distribution and does not correlate with morphological characters. The species belonging to different species groups are clustered in the same lineages, and those in the same species group are scattered among the different lineages. One of the possible interpretations of the present results would be that morphological transformations independently took place in the different lineages, sometimes with accompanying parallel morphological evolution, resulting in the occurrence of the morphological species belonging to the same species group (= type) in the different lineages.

  15. Is ITS-2 rDNA suitable marker for genetic characterization of Sarcoptes mites from different wild animals in different geographic areas?

    Science.gov (United States)

    Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L

    2009-02-05

    The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.

  16. Molecular characterization of Fasciola gigantica from Mauritania based on mitochondrial and nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-10-01

    Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All

  17. Time spans and spacers : Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    NARCIS (Netherlands)

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be

  18. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    Science.gov (United States)

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. © 2014 S. Karger AG, Basel.

  19. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex

    Science.gov (United States)

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

    2016-01-01

    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  20. Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast

    International Nuclear Information System (INIS)

    Lin, Y.H.; Keil, R.L.

    1991-01-01

    HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination

  1. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  2. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish.

    Science.gov (United States)

    Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane

    2018-04-15

    Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.

  3. A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).

    Science.gov (United States)

    Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao

    2017-01-01

    In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.

  4. Asymmetric epigenetic modification and elimination of rDNA sequences by polyploidization in wheat.

    Science.gov (United States)

    Guo, Xiang; Han, Fangpu

    2014-11-01

    rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. © 2014 American Society of Plant Biologists. All rights reserved.

  5. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  6. A two-locus DNA sequence database for typing plant and human pathogens within the Fusarium oxysporum species complex

    DEFF Research Database (Denmark)

    O'Donnell, Kerry; Gueidan, C; Sink, S

    2009-01-01

    We constructed a two-locus database, comprising partial translation elongation factor (EF-1alpha) gene sequences and nearly full-length sequences of the nuclear ribosomal intergenic spacer region (IGS rDNA) for 850 isolates spanning the phylogenetic breadth of the Fusarium oxysporum species compl...... of the IGS rDNA sequences may be non-orthologous. We also evaluated enniatin, fumonisin and moniliformin mycotoxin production in vitro within a phylogenetic framework....

  7. Time spans and spacers: Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    OpenAIRE

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be paraphyletic with respect to Cladophora species and includes several genera shich werde traditionally ascribed to the Siphonocladales (Chapter 3). ... Zie: Summary/Samenvatting

  8. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Science.gov (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  9. Phylogenetic position of the North American isolate of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, as inferred from 16S rDNA sequence analysis.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Domier, L L

    2000-03-01

    A 1341 bp sequence of the 16S rDNA of an undescribed species of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, was determined and then compared with a homologous sequence of Pasteuria ramosa, a parasite of cladoceran water fleas of the family Daphnidae. The two Pasteuria sequences, which diverged from each other by a dissimilarity index of 7%, also were compared with the 16S rDNA sequences of 30 other bacterial species to determine the phylogenetic position of the genus Pasteuria among the Gram-positive eubacteria. Phylogenetic analyses using maximum-likelihood, maximum-parsimony and neighbour-joining methods showed that the Heterodera glycines-infecting Pasteuria and its sister species, P. ramosa, form a distinct line of descent within the Alicyclobacillus group of the Bacillaceae. These results are consistent with the view that the genus Pasteuria is a deeply rooted member of the Clostridium-Bacillus-Streptococcus branch of the Gram-positive eubacteria, neither related to the actinomycetes nor closely related to true endospore-forming bacteria.

  10. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

    Science.gov (United States)

    Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo

    2002-12-01

    The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

  11. ITS rDNA sequences of Pomphorhynchus laevis (Zoega in Müller, 1776) and P. lucyi Williams & Rogers, 1984 (Acanthocephala: Palaeacanthocephala)

    Czech Academy of Sciences Publication Activity Database

    Kráľová-Hromadová, I.; Tietz, David František; Shinn, A.; Špakulová, M.

    2003-01-01

    Roč. 56, č. 2 (2003), s. 141-145 ISSN 0165-5752 R&D Projects: GA ČR GA524/01/1314 Grant - others:GA SR(SK) VEGA2/1020/21; GA SR(SK) VEGA2/3212/23 Institutional research plan: CEZ:AV0Z6022909 Keywords : Acanthocephala * ITS rDNA sequence * taxonomy Subject RIV: EG - Zoology Impact factor: 0.642, year: 2003

  12. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    Science.gov (United States)

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  13. Bacterial diversity of soil under eucalyptus assessed by 16S rDNA sequencing analysis Diversidade bacteriana de solo sob eucaliptos obtida por seqüenciamento do 16S rDNA

    Directory of Open Access Journals (Sweden)

    Érico Leandro da Silveira

    2006-10-01

    Full Text Available Studies on the impact of Eucalyptus spp. on Brazilian soils have focused on soil chemical properties and isolating interesting microbial organisms. Few studies have focused on microbial diversity and ecology in Brazil due to limited coverage of traditional cultivation and isolation methods. Molecular microbial ecology methods based on PCR amplified 16S rDNA have enriched the knowledge of soils microbial biodiversity. The objective of this work was to compare and estimate the bacterial diversity of sympatric communities within soils from two areas, a native forest (NFA and an eucalyptus arboretum (EAA. PCR primers, whose target soil metagenomic 16S rDNA were used to amplify soil DNA, were cloned using pGEM-T and sequenced to determine bacterial diversity. From the NFA soil 134 clones were analyzed, while 116 clones were analyzed from the EAA soil samples. The sequences were compared with those online at the GenBank. Phylogenetic analyses revealed differences between the soil types and high diversity in both communities. Soil from the Eucalyptus spp. arboretum was found to have a greater bacterial diversity than the soil investigated from the native forest area.Estudos sobre impacto do Eucalyptus spp. em solos brasileiros têm focalizado propriedades químicas do solo e isolamento de microrganismos de interesse. No Brasil há pouco enfoque em ecologia e diversidade microbiana, devido às limitações dos métodos tradicionais de cultivo e isolamento. A utilização de métodos moleculares no estudo da ecologia microbiana baseados na amplificação por PCR do 16S rDNA têm enriquecido o conhecimento da biodiversidade microbiana dos solos. O objetivo deste trabalho foi comparar e estimar a diversidade bacteriana de comunidades simpátricas em solos de duas áreas: uma floresta nativa (NFA e outra adjacente com arboreto de eucaliptos (EAA. Oligonucleotídeos iniciadores foram utilizados para amplificar o 16S rDNA metagenômico do solo, o qual foi

  14. Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region

    OpenAIRE

    Rabello, Aline R.; Queiroz, Paulo R.; Simões, Kenya C.C.; Hiragi, Cássia O.; Lima, Luzia H.C.; Oliveira, Maria Regina V.; Mehta, Angela

    2008-01-01

    The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR) occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distin...

  15. Details of the evolutionary history from invertebrates to vertebrates, as deduced from the sequences of 18S rDNA.

    Science.gov (United States)

    Wada, H; Satoh, N

    1994-01-01

    Almost the entire sequences of 18S rDNA were determined for two chaetognaths, five echinoderms, a hemichordate, and two urochordates (a larvacean and a salp). Phylogenetic comparisons of the sequences, together with those of other deuterostomes (an ascidian, a cephalochordate, and vertebrates) and protostomes (an arthropod and a mollusc), suggest the monophyly of the deuterostomes, with the exception of the chaetognaths. Chaetognaths may not be a group of deuterostomes. The deuterostome group closest to vertebrates was the group of cephalochordates. Ascidians, larvaceans, and salps seem to form a discrete group (urochordates), in which the early divergence of larvaceans is evident. These results support the hypothesis that chordates evolved from free-living ancestors. PMID:8127885

  16. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    Science.gov (United States)

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  17. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Science.gov (United States)

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S rDNA

  18. Selectivity by host plants affects the distribution of arbuscular mycorrhizal fungi: evidence from ITS rDNA sequence metadata

    Directory of Open Access Journals (Sweden)

    Yang Haishui

    2012-04-01

    Full Text Available Abstract Background Arbuscular mycorrhizal fungi (AMF can form obligate symbioses with the vast majority of land plants, and AMF distribution patterns have received increasing attention from researchers. At the local scale, the distribution of AMF is well documented. Studies at large scales, however, are limited because intensive sampling is difficult. Here, we used ITS rDNA sequence metadata obtained from public databases to study the distribution of AMF at continental and global scales. We also used these sequence metadata to investigate whether host plant is the main factor that affects the distribution of AMF at large scales. Results We defined 305 ITS virtual taxa (ITS-VTs among all sequences of the Glomeromycota by using a comprehensive maximum likelihood phylogenetic analysis. Each host taxonomic order averaged about 53% specific ITS-VTs, and approximately 60% of the ITS-VTs were host specific. Those ITS-VTs with wide host range showed wide geographic distribution. Most ITS-VTs occurred in only one type of host functional group. The distributions of most ITS-VTs were limited across ecosystem, across continent, across biogeographical realm, and across climatic zone. Non-metric multidimensional scaling analysis (NMDS showed that AMF community composition differed among functional groups of hosts, and among ecosystem, continent, biogeographical realm, and climatic zone. The Mantel test showed that AMF community composition was significantly correlated with plant community composition among ecosystem, among continent, among biogeographical realm, and among climatic zone. The structural equation modeling (SEM showed that the effects of ecosystem, continent, biogeographical realm, and climatic zone were mainly indirect on AMF distribution, but plant had strongly direct effects on AMF. Conclusion The distribution of AMF as indicated by ITS rDNA sequences showed a pattern of high endemism at large scales. This pattern indicates high specificity

  19. Selectivity by host plants affects the distribution of arbuscular mycorrhizal fungi: evidence from ITS rDNA sequence metadata.

    Science.gov (United States)

    Yang, Haishui; Zang, Yanyan; Yuan, Yongge; Tang, Jianjun; Chen, Xin

    2012-04-12

    Arbuscular mycorrhizal fungi (AMF) can form obligate symbioses with the vast majority of land plants, and AMF distribution patterns have received increasing attention from researchers. At the local scale, the distribution of AMF is well documented. Studies at large scales, however, are limited because intensive sampling is difficult. Here, we used ITS rDNA sequence metadata obtained from public databases to study the distribution of AMF at continental and global scales. We also used these sequence metadata to investigate whether host plant is the main factor that affects the distribution of AMF at large scales. We defined 305 ITS virtual taxa (ITS-VTs) among all sequences of the Glomeromycota by using a comprehensive maximum likelihood phylogenetic analysis. Each host taxonomic order averaged about 53% specific ITS-VTs, and approximately 60% of the ITS-VTs were host specific. Those ITS-VTs with wide host range showed wide geographic distribution. Most ITS-VTs occurred in only one type of host functional group. The distributions of most ITS-VTs were limited across ecosystem, across continent, across biogeographical realm, and across climatic zone. Non-metric multidimensional scaling analysis (NMDS) showed that AMF community composition differed among functional groups of hosts, and among ecosystem, continent, biogeographical realm, and climatic zone. The Mantel test showed that AMF community composition was significantly correlated with plant community composition among ecosystem, among continent, among biogeographical realm, and among climatic zone. The structural equation modeling (SEM) showed that the effects of ecosystem, continent, biogeographical realm, and climatic zone were mainly indirect on AMF distribution, but plant had strongly direct effects on AMF. The distribution of AMF as indicated by ITS rDNA sequences showed a pattern of high endemism at large scales. This pattern indicates high specificity of AMF for host at different scales (plant taxonomic

  20. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences.

    Science.gov (United States)

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K; Maitra, S S

    2015-01-01

    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about "methanogenic archaea composition" and "abundance" in the contrasting ecosystems like "landfill" and "marshland" may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  1. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

    Directory of Open Access Journals (Sweden)

    Shailendra Yadav

    2015-01-01

    Full Text Available Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic and Thaumarchaeota (mesophilic, were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  2. Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley

    DEFF Research Database (Denmark)

    Pedersen, C.; Linde-Laursen, I.

    1994-01-01

    is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...

  3. Enterohemorrhagic Escherichia coli O157 in milk and dairy products from Libya: Isolation and molecular identification by partial sequencing of 16S rDNA

    Directory of Open Access Journals (Sweden)

    Aboubaker M. Garbaj

    2016-11-01

    Full Text Available Aim: The aim of this work was to isolate and molecularly identify enterohemorrhagic Escherichia coli (EHEC O157 in milk and dairy products in Libya, in addition; to clear the accuracy of cultural and biochemical identification as compared with molecular identification by partial sequencing of 16S rDNA for the existing isolates. Materials and Methods: A total of 108 samples of raw milk (cow, she-camel, and goat and locally made dairy products (fermented cow’s milk, Maasora, Ricotta and ice cream were collected from some regions (Janzour, Tripoli, Kremiya, Tajoura and Tobruk in Libya. Samples were subjected to microbiological analysis for isolation of E. coli that was detected by conventional cultural and molecular method using polymerase chain reaction and partial sequencing of 16S rDNA. Results: Out of 108 samples, only 27 isolates were found to be EHEC O157 based on their cultural characteristics (Tellurite-Cefixime-Sorbitol MacConkey that include 3 isolates from cow’s milk (11%, 3 isolates from she-camel’s milk (11%, two isolates from goat’s milk (7.4% and 7 isolates from fermented raw milk samples (26%, isolates from fresh locally made soft cheeses (Maasora and Ricotta were 9 (33% and 3 (11%, respectively, while none of the ice cream samples revealed any growth. However, out of these 27 isolates, only 11 were confirmed to be E. coli by partial sequencing of 16S rDNA and E. coli O157 Latex agglutination test. Phylogenetic analysis revealed that majority of local E. coli isolates were related to E. coli O157:H7 FRIK944 strain. Conclusion: These results can be used for further studies on EHEC O157 as an emerging foodborne pathogen and its role in human infection in Libya.

  4. Morphology and 18S rDNA gene sequence of Spirostomum minus and Spirostomum teres (Ciliophora: Heterotrichea) from Rio de Janeiro, Brazil

    OpenAIRE

    Noemi M. Fernandes; Inácio D. da Silva Neto

    2013-01-01

    Species of Spirostomum Ehrenberg, 1838 are widely used as model organisms in ecological studies of environmental impacts and symbioses between ciliates and human pathogenic bacteria. However, the taxonomy of this genus is confused by the superficiality of the morphological descriptions of its included species, and the use of only a few characters for their differentiation. The present study provides details of total infraciliature, nuclear apparatus, morphometric data and 18S rDNA gene sequen...

  5. High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

    Science.gov (United States)

    van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

    2010-11-01

    The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

  6. Metagenomic Analysis of Slovak Bryndza Cheese Using Next-Generation 16S rDNA Amplicon Sequencing

    Directory of Open Access Journals (Sweden)

    Planý Matej

    2016-06-01

    Full Text Available Knowledge about diversity and taxonomic structure of the microbial population present in traditional fermented foods plays a key role in starter culture selection, safety improvement and quality enhancement of the end product. Aim of this study was to investigate microbial consortia composition in Slovak bryndza cheese. For this purpose, we used culture-independent approach based on 16S rDNA amplicon sequencing using next generation sequencing platform. Results obtained by the analysis of three commercial (produced on industrial scale in winter season and one traditional (artisanal, most valued, produced in May Slovak bryndza cheese sample were compared. A diverse prokaryotic microflora composed mostly of the genera Lactococcus, Streptococcus, Lactobacillus, and Enterococcus was identified. Lactococcus lactis subsp. lactis and Lactococcus lactis subsp. cremoris were the dominant taxons in all tested samples. Second most abundant species, detected in all bryndza cheeses, were Lactococcus fujiensis and Lactococcus taiwanensis, independently by two different approaches, using different reference 16S rRNA genes databases (Greengenes and NCBI respectively. They have been detected in bryndza cheese samples in substantial amount for the first time. The narrowest microbial diversity was observed in a sample made with a starter culture from pasteurised milk. Metagenomic analysis by high-throughput sequencing using 16S rRNA genes seems to be a powerful tool for studying the structure of the microbial population in cheeses.

  7. EVOLUTION OF NUCLEAR RDNA ITS SEQUENCES IN THE CLADOPHORA ALBIDA/SERICEA CLADE (CHLOROPHYTA)

    NARCIS (Netherlands)

    BAKKER, FT; OLSEN, JL; STAM, WT

    Ribosomal DNA ITS sequences were compared among 13 different species and biogeographic isolates from the monophyletic ''abbida/sericea clade'' in the green algal genus Cladophora. Six distinct ITS sequence types were found, characterized by multiple insertions and deletions and high levels of

  8. Evidence that two types of 18S rDNA coexist in the genome of Dugesia (Schmidtea) mediterranea (Platyhelminthes, Turbellaria, Tricladida).

    Science.gov (United States)

    Carranza, S; Giribet, G; Ribera, C; Baguñà; Riutort, M

    1996-07-01

    Sequences of 18S ribosomal DNA (rDNA) are increasingly being used to infer phylogenetic relationships among living taxa. Although the 18S rDNA belongs to a multigene family, all its copies are kept homogeneous by concerted evolution (Dover 1982; Hillis and Dixon 1991). To date, there is only one well-characterized exception to this rule, the protozoan Plasmodium (Gunderson et al. 1987; Waters, Syin, and McCutchan 1989; Qari et al. 1994). Here we report the 1st case of 18S rDNA polymorphism within a metazoan species. Two types (I and II) of 18S rDNA have been found and sequenced in the platyhelminth Dugesia (Schmidtea) mediterranea (Turbellaria, Seriata, Tricladida). Southern blot analysis suggested that both types of rDNA are present in the genome of this flatworm. This was confirmed through sequence comparisons and phylogenetic analysis using the neighbor-joining method and bootstrap test. Although secondary structure analysis suggests that both types are functional, only type I seems to be transcribed to RNA, as demonstrated by Northern blot analysis. The finding of different types of 18S rDNAs in a single genome stresses the need for analyzing a large number of clones whenever 18S sequences obtained by PCR amplification and cloning are being used in phylogenetic reconstruction.

  9. Molecular phylogeny of Oncaeidae (Copepoda using nuclear ribosomal internal transcribed spacer (ITS rDNA.

    Directory of Open Access Journals (Sweden)

    Iole Di Capua

    Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.

  10. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  11. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Science.gov (United States)

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  12. [Variability of nuclear 18S-25S rDNA of Gentiana lutea L. in nature and in tissue culture in vitro].

    Science.gov (United States)

    Mel'nyk, V M; Spiridonova, K V; Andrieiev, I O; Strashniuk, N M; Kunakh, V A

    2004-01-01

    18S-25S rDNA sequence in genomes of G. lutea plants from different natural populations and from tissue culture has been studied with blot-hybridization method. It was shown that ribosomal repeats are represented by the variants which differ for their size and for the presence of additional HindIII restriction site. Genome of individual plant usually possesses several variants of DNA repeats. Interpopulation variability according to their quantitative ratio and to the presence of some of them has been shown. Modifications of the range of rDNA repeats not exceeding intraspecific variability were observed in callus tissues in comparison with the plants of initial population. Non-randomness of genome modifications in the course of cell adaptation to in vitro conditions makes it possible to some extent to forecast these modifications in tissue culture.

  13. Identifying the bacterial community on the surface of Intralox belting in a meat boning room by culture-dependent and culture-independent 16S rDNA sequence analysis.

    Science.gov (United States)

    Brightwell, Gale; Boerema, Jackie; Mills, John; Mowat, Eilidh; Pulford, David

    2006-05-25

    We examined the bacterial community present on an Intralox conveyor belt system in an operating lamb boning room by sequencing the 16S ribosomal DNA (rDNA) of bacteria extracted in the presence or absence of cultivation. RFLP patterns for 16S rDNA clone library and cultures were generated using HaeIII and MspI restriction endonucleases. 16S rDNA amplicons produced 8 distinct RFLP pattern groups. RFLP groups I-IV were represented in the clone library and RFLP groups I and V-VIII were represented amongst the cultured isolates. Partial DNA sequences from each RFLP group revealed that all group I, II and VIII representatives were Pseudomonas spp., group III were Sphingomonas spp., group IV clones were most similar to an uncultured alpha proteobacterium, group V was similar to a Serratia spp., group VI with an Alcaligenes spp., and group VII with Microbacterium spp. Sphingomonads were numerically dominant in the culture-independent clone library and along with the group IV alpha proteobacterium were not represented amongst the cultured isolates. Serratia, Alcaligenes and Microbacterium spp. were only represented with cultured isolates. Pseudomonads were detected by both culture-dependent (84% of isolates) and culture-independent (12.5% of clones) methods and their presence at high frequency does pose the risk of product spoilage if transferred onto meat stored under aerobic conditions. The detection of sphingomonads in large numbers by the culture-independent method demands further analysis because sphingomonads may represent a new source of meat spoilage that has not been previously recognised in the meat processing environment. The 16S rDNA collections generated by both methods were important at representing the diversity of the bacterial population associated with an Intralox conveyor belt system.

  14. Polymorphism of Paramecium pentaurelia (Ciliophora, Oligohymenophorea) strains revealed by rDNA and mtDNA sequences.

    Science.gov (United States)

    Przyboś, Ewa; Tarcz, Sebastian; Greczek-Stachura, Magdalena; Surmacz, Marta

    2011-05-01

    Paramecium pentaurelia is one of 15 known sibling species of the Paramecium aurelia complex. It is recognized as a species showing no intra-specific differentiation on the basis of molecular fingerprint analyses, whereas the majority of other species are polymorphic. This study aimed at assessing genetic polymorphism within P. pentaurelia including new strains recently found in Poland (originating from two water bodies, different years, seasons, and clones of one strain) as well as strains collected from distant habitats (USA, Europe, Asia), and strains representing other species of the complex. We compared two DNA fragments: partial sequences (349 bp) of the LSU rDNA and partial sequences (618 bp) of cytochrome B gene. A correlation between the geographical origin of the strains and the genetic characteristics of their genotypes was not observed. Different genotypes were found in Kraków in two types of water bodies (Opatkowice-natural pond; Jordan's Park-artificial pond). Haplotype diversity within a single water body was not recorded. Likewise, seasonal haplotype differences between the strains within the artificial water body, as well as differences between clones originating from one strain, were not detected. The clustering of some strains belonging to different species was observed in the phylogenies. Copyright © 2010 Elsevier GmbH. All rights reserved.

  15. High and uneven levels of 45S rDNA site-number variation across wild populations of a diploid plant genus (Anacyclus, Asteraceae).

    Science.gov (United States)

    Rosato, Marcela; Álvarez, Inés; Nieto Feliner, Gonzalo; Rosselló, Josep A

    2017-01-01

    The nuclear genome harbours hundreds to several thousand copies of ribosomal DNA. Despite their essential role in cellular ribogenesis few studies have addressed intrapopulation, interpopulation and interspecific levels of rDNA variability in wild plants. Some studies have assessed the extent of rDNA variation at the sequence and copy-number level with large sampling in several species. However, comparable studies on rDNA site number variation in plants, assessed with extensive hierarchical sampling at several levels (individuals, populations, species) are lacking. In exploring the possible causes for ribosomal loci dynamism, we have used the diploid genus Anacyclus (Asteraceae) as a suitable system to examine the evolution of ribosomal loci. To this end, the number and chromosomal position of 45S rDNA sites have been determined in 196 individuals from 47 populations in all Anacyclus species using FISH. The 45S rDNA site-number has been assessed in a significant sample of seed plants, which usually exhibit rather consistent features, except for polyploid plants. In contrast, the level of rDNA site-number variation detected in Anacyclus is outstanding in the context of angiosperms particularly regarding populations of the same species. The number of 45S rDNA sites ranged from four to 11, accounting for 14 karyological ribosomal phenotypes. Our results are not even across species and geographical areas, and show that there is no clear association between the number of 45S rDNA loci and the life cycle in Anacyclus. A single rDNA phenotype was detected in several species, but a more complex pattern that included intra-specific and intra-population polymorphisms was recorded in A. homogamos, A. clavatus and A. valentinus, three weedy species showing large and overlapping distribution ranges. It is likely that part of the cytogenetic changes and inferred dynamism found in these species have been triggered by genomic rearrangements resulting from contemporary

  16. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Science.gov (United States)

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  17. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    Science.gov (United States)

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  18. Improving the Analysis of Dinoflagellate Phylogeny based on rDNA

    DEFF Research Database (Denmark)

    Murray, Shauna; Jørgensen, Mårten Flø; Ho, Simon Y.W.

    2005-01-01

    Phylogenetic studies of dinoflagellates are often conducted using rDNA sequences. In analyses to date, the monophyly of some of the major lineages of dinoflagellates remain to be demonstrated. There are several reasons for this uncertainty, one of which may be the use of models of evolution that ...

  19. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    Science.gov (United States)

    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  20. Colletotrichum isolates related to Anthracnose of cashew trees in Brazil: morphological and molecular description using LSU rDNA sequences

    Directory of Open Access Journals (Sweden)

    Ana Maria Queijeiro Lopez

    2010-08-01

    Full Text Available Thirty six isolates of fungi obtained from anthracnose lesions of cashew and associated host plants in Brazil, were compared by their cultural, morphological and partial sequences of the 28S ribosomal DNA characters. They showed a high degree of cultural variability. The average mycelial growth rate on all tested media ranged from 10.2-13.3 mm/day between the isolates. Most of them produced perithecia (sterile and fertile and some produced setae (sterile and fertile. All the isolates produced acervuli with predominantly cylindrical conidia (12.4-17.7 µmX 4.8-6.0 µm in width with round ends, which became septate on germination, and produced unlobed or slightlylobed appressoria. Comparison of the D2 domain of the large subunit (LSU rDNA sequences with those of other defined species of Colletotrichum and Glomerella grouped 35 of the isolates with known strains of C. gloeosporioides from different hosts (> 98.9% homology. The one exception (LARS 921 was identical to G. cingulata (LARS 238 from Vigna unguiculata.Trinta e seis isolados de fungos obtidos de lesões de antracnose em cajueiros e outras plantas consorciadas no Brasil, foram comparados quanto a seus aspectos culturais, morfológicos e seqüências parciais do rDNA 28S. Os isolados apresentaram elevado grau de variabilidade cultural, com taxa de crescimento médio, em todos os meios testados, entre 10,2 e 13,3 mm/dia. A maioria deles produziu peritécios (estéreis e férteis, e alguns produziram setas (estéreis e férteis nos diferentes meios. Todos apresentaram acérvulos com predominância de conídios cilíndricos (12,4-17,7 µm X 4,8-6,0 µm, de extremidades arredondadas, formando septos durante a germinação e produzindo apressórios ligeiramente lobados ou lisos. Comparando as seqüências do domínio D2 da larga subunidade (LSU do rDNA dos isolados com aquelas já identificadas de espécies de Colletotrichum/ Glomerella, verificou-se que 35 deles correspondem a C

  1. Isolation and 16s rdna sequence analysis of bacteria from dieback affected mango orchards in southern pakistan

    International Nuclear Information System (INIS)

    Khan, I.A.; Khan, A.; Asif, H.; Azim, M.K.; Muhlbach, H.P.

    2014-01-01

    A broad range of microorganisms are involved in various mango plant diseases such as fungi, algae and bacteria. In order to study the role of bacteria in mango dieback, a survey of infected mango plants in southern Pakistan was carried out. A number of bacterial isolates were obtained from healthy looking and infected mango trees, and their characterization was undertaken by colony PCR and subsequent sequence analysis of 16S rDNA. These analyses revealed the presence of various genera including Acinetobacter, Bacillus, Burkholderia, Cronobacter, Curtobacterium, Enterobacter, Erwinia, Exiguobacterium, Halotelea, Lysinibacillus, Micrococcus, Microbacterium, Pantoea, Pseudomonas, Salmonella and Staphylococcus. It is noteworthy that several members of these genera have been reported as plant pathogens. The present study provided baseline information regarding the phytopathogenic bacteria associated with mango trees in southern Pakistan. (author)

  2. Uncovering the molecular organization of unusual highly scattered 5S rDNA: The case of Chariesterus armatus (Heteroptera).

    Science.gov (United States)

    Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti

    2018-03-10

    One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.

  3. Systematics of Penicillium simplicissimum based on rDNA sequences, morphology and secondary metabolites

    DEFF Research Database (Denmark)

    Tuthill, D.E.; Frisvad, Jens Christian; Christensen, M.

    2001-01-01

    supported by differences in micromorphological characters, particularly of the conidia and phialides, and the production of distinct profiles of secondary metabolites by each species. Group-I introns, located in the SSU rDNA, were identified in six of the 21 isolates; their presence was used to test...

  4. Comparative molecular analysis of Herbaspirillum strains by RAPD, RFLP, and 16S rDNA sequencing

    Directory of Open Access Journals (Sweden)

    Soares-Ramos Juliana R.L.

    2003-01-01

    Full Text Available Herbaspirillum spp. are endophytic diazotrophic bacteria associated with important agricultural crops. In this work, we analyzed six strains of H. seropedicae (Z78, M2, ZA69, ZA95, Z152, and Z67 and one strain of H. rubrisubalbicans (M4 by restriction fragment length polymorphism (RFLP using HindIII or DraI restriction endonucleases, random amplified polymorphic DNA (RAPD, and partial sequencing of 16S rDNA. The results of these analyses ascribed the strains studied to three distinct groups: group I, consisting of M2 and M4; group II, of ZA69; and group III, of ZA95, Z78, Z67, and Z152. RAPD fingerprinting showed a higher variability than the other methods, and each strain had a unique electrophoretic pattern with five of the six primers used. Interestingly, H. seropedicae M2 was found by all analyses to be genetically very close to H. rubrisubalbicans M4. Our results show that RAPD can distinguish between all Herbaspirillum strains tested.

  5. ON THE IDENTITY OF KARLODINIUM VENEFICUM AND DESCRIPTION OF KARLODINIUM ARMIGER SP. NOV. (DINOPHYCEAE), BASED ON LIGHT AND ELECTRON MICROSCOPY, NUCLEAR-ENCODED LSU RDNA, AND PIGMENT COMPOSITION

    DEFF Research Database (Denmark)

    Bergholtz, Trine; Daugbjerg, Niels; Moestrup, Øjvind

    2006-01-01

    An undescribed species of the dinoflagellate genus Karlodinium J. Larsen (viz. K. armiger sp. nov.) is described from Alfacs Bay (Spain), using light and electron microscopy, pigment composition, and partial large subunit (LSU) rDNA sequence. The new species differs from the type species of Karlo......An undescribed species of the dinoflagellate genus Karlodinium J. Larsen (viz. K. armiger sp. nov.) is described from Alfacs Bay (Spain), using light and electron microscopy, pigment composition, and partial large subunit (LSU) rDNA sequence. The new species differs from the type species...... of Karlodinium (K. micrum (Leadbeater et Dodge) J. Larsen) by lacking rows of amphiesmal plugs, a feature presently considered to be a characteristic of Karlodinium. In K. armiger, an outer membrane is underlain by a complex system of cisternae and vacuoles. The pigment profile of K. armiger revealed...... sequence, differed in only 0.3% of 1438 bp. We consider the two taxa to belong to the same species. This necessitates a change of name for the most widely found species, K. micrum, to K. veneficum. The three genera Karlodinium, Takayama, and Karenia constitute a separate evolutionary lineage, for which...

  6. Analysis of bacterial flora associated with peri-implantitis using obligate anaerobic culture technique and 16S rDNA gene sequence.

    Science.gov (United States)

    Tamura, Naoki; Ochi, Morio; Miyakawa, Hiroshi; Nakazawa, Futoshi

    2013-01-01

    To analyze and characterize the predominant bacterial flora associated with peri-implantitis by using culture techniques under obligate anaerobic conditions and 16S rDNA gene sequences. Subgingival bacterial specimens were taken from 30 patients: control (n = 15), consisting of patients with only healthy implants; and test (n = 15), consisting of patients with peri-implantitis. In both groups, subgingival bacterial specimens were taken from the deepest sites. An anaerobic glove box system was used to cultivate bacterial strains. The bacterial strains were identified by 16S rDNA genebased polymerase chain reaction and comparison of the gene sequences. Peri-implantitis sites had approximately 10-fold higher mean colony forming units (per milliliter) than healthy implant sites. A total of 69 different bacterial species were identified in the peri-implantitis sites and 53 in the healthy implant sites. The predominant bacterial species in the peri-implantitis sites were Eubacterium nodatum, E. brachy, E. saphenum, Filifactor alocis, Slackia exigua, Parascardovia denticolens, Prevotella intermedia, Fusobacterium nucleatum, Porphyromonas gingivalis, Centipeda periodontii, and Parvimonas micra. The predominant bacteria in healthy implant sites apart from Streptococcus were Pseudoramibacter alactolyticus, Veillonella species, Actinomyces israelii, Actinomyces species, Propionibacterium acnes, and Parvimonas micra. These results suggest that the environment in the depths of the sulcus showing peri-implantitis is well suited for growth of obligate anaerobic bacteria. The present study demonstrated that the sulcus around oral implants with peri-implantitis harbors high levels of asaccharolytic anaerobic gram-positive rods (AAGPRs) such as E. nodatum, E. brachy, E. saphenum, Filifactor alocis, Slackia exigua, and gram-negative anaerobic rods, suggesting that conventional periodontopathic bacteria are not the only periodontal pathogens active in peri-implantitis, and that AAGPRs

  7. Neurospora ribosomal DNA sequences are indistinguishable within cell types but distinguishable among heterothallic species

    International Nuclear Information System (INIS)

    Chambers, C.; Dutta, S.K.

    1983-01-01

    High molecular nuclear DNAs were isolated from three developmental cell types of N. crassa: conidia, mycelia and germinated conidia, and from mycelial cells of two other heterothallic species, N. intermedia and N. sitophila. These nuclear DNAs were treated with several restriction enzymes: EcoR1, Bam H1, Hind III, Hinc II, Bgl II, Sma I and Pst 1. All seven restriction enzymes were tested on 0.7% agarose gels. EcoR1, Hind III, Pst 1, and Hinc II showed band differences among the species, but not among the cell types. Southern blot transfers of restricted DNA gels were then hybridized with 32 P-labelled pMF2 rDNAs (probe). This later DNA was prepared from N. crassa rDNA cloned into pBR322 plasmid, obtained from Dr. Robert Metzenberg of the University of Wisconsin. Autoradiograms of these hybrids between southern blots and probe DNA revealed similar rDNA band patterns confirming the observations on restriction gels. In the case of EcoR1 restriction analysis there were differences in fragments on 0.7% agarose gel, but after hybridization of southern blots no differences in band patterns were seen in autoradiograms. This raises the question whether the background bands were all of rDNA sequences. These studies are being continued using ITS (internal transcribed spacer) sequences of N. crassa rDNAs cloned in pBR322 plasmid

  8. Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.

    Science.gov (United States)

    Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo

    2004-06-15

    The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples.

  9. The β-1,3-glucanosyltransferase Gas1 regulates Sir2-mediated rDNA stability in Saccharomyces cerevisiae.

    Science.gov (United States)

    Ha, Cheol Woong; Kim, Kwantae; Chang, Yeon Ji; Kim, Bongkeun; Huh, Won-Ki

    2014-07-01

    In Saccharomyces cerevisiae, the stability of highly repetitive rDNA array is maintained through transcriptional silencing. Recently, a β-1,3-glucanosyltransferase Gas1 has been shown to play a significant role in the regulation of transcriptional silencing in S. cerevisiae. Here, we show that the gas1Δ mutation increases rDNA silencing in a Sir2-dependent manner. Remarkably, the gas1Δ mutation induces nuclear localization of Msn2/4 and stimulates the expression of PNC1, a gene encoding a nicotinamidase that functions as a Sir2 activator. The lack of enzymatic activity of Gas1 or treatment with a cell wall-damaging agent, Congo red, exhibits effects similar to those of the gas1Δ mutation. Furthermore, the loss of Gas1 or Congo red treatment lowers the cAMP-dependent protein kinase (PKA) activity in a cell wall integrity MAP kinase Slt2-dependent manner. Collectively, our results suggest that the dysfunction of Gas1 plays a positive role in the maintenance of rDNA integrity by decreasing PKA activity and inducing the accumulation of Msn2/4 in the nucleus. It seems that nuclear-localized Msn2/4 stimulate the expression of Pnc1, thereby enhancing the association of Sir2 with rDNA and promoting rDNA stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides AT+CG in the mitogenome of Kamimuria wangi.

    Science.gov (United States)

    Seligmann, Hervé

    2016-07-01

    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

  11. BIOGEOGRAPHY OF CLADOPHOROPSIS-MEMBRANACEA (CHLOROPHYTA) BASED ON COMPARISONS OF NUCLEAR RDNA ITS SEQUENCES

    NARCIS (Netherlands)

    KOOISTRA, WHCF; STAM, WT; OLSEN, JL; VANDENHOEK, C

    1992-01-01

    Nucleotides were compared at 988 sites, spanning both internal transcribed spacers (ITS1 and ITS2) of the nuclear ribosomal DNA, among 17 isolates of the green alga Cladophoropsis membranacea (Hofman Bang ex C. Agardh) Boergesen and two isolates of Struvea anastomosans (Harvey) Piccone and Grunow.

  12. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).

    Science.gov (United States)

    Mahelka, Václav; Kopecky, David; Baum, Bernard R

    2013-09-01

    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.

  13. Comparative genomics and repetitive sequence divergence in the species of diploid Nicotiana section Alatae.

    Science.gov (United States)

    Lim, K Yoong; Kovarik, Ales; Matyasek, Roman; Chase, Mark W; Knapp, Sandra; McCarthy, Elizabeth; Clarkson, James J; Leitch, Andrew R

    2006-12-01

    Combining phylogenetic reconstructions of species relationships with comparative genomic approaches is a powerful way to decipher evolutionary events associated with genome divergence. Here, we reconstruct the history of karyotype and tandem repeat evolution in species of diploid Nicotiana section Alatae. By analysis of plastid DNA, we resolved two clades with high bootstrap support, one containing N. alata, N. langsdorffii, N. forgetiana and N. bonariensis (called the n = 9 group) and another containing N. plumbaginifolia and N. longiflora (called the n = 10 group). Despite little plastid DNA sequence divergence, we observed, via fluorescent in situ hybridization, substantial chromosomal repatterning, including altered chromosome numbers, structure and distribution of repeats. Effort was focussed on 35S and 5S nuclear ribosomal DNA (rDNA) and the HRS60 satellite family of tandem repeats comprising the elements HRS60, NP3R and NP4R. We compared divergence of these repeats in diploids and polyploids of Nicotiana. There are dramatic shifts in the distribution of the satellite repeats and complete replacement of intergenic spacers (IGSs) of 35S rDNA associated with divergence of the species in section Alatae. We suggest that sequence homogenization has replaced HRS60 family repeats at sub-telomeric regions, but that this process may not occur, or occurs more slowly, when the repeats are found at intercalary locations. Sequence homogenization acts more rapidly (at least two orders of magnitude) on 35S rDNA than 5S rDNA and sub-telomeric satellite sequences. This rapid rate of divergence is analogous to that found in polyploid species, and is therefore, in plants, not only associated with polyploidy.

  14. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  15. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  16. Eukaryotic Plankton Species Diversity in the Western Channel of the Korea Strait using 18S rDNA Sequences and its Implications for Water Masses

    Science.gov (United States)

    Lee, Sang-Rae; Song, Eun Hye; Lee, Tongsup

    2018-03-01

    Organisms entering the East Sea (Sea of Japan) through the Korea Strait, together with water, salt, and energy, affect the East Sea ecosystem. In this study, we report on the biodiversity of eukaryotic plankton found in the Western Channel of the Korea Strait for the first time using small subunit ribosomal RNA gene (18S rDNA) sequences. We also discuss the characteristics of water masses and their physicochemical factors. Diverse taxonomic groups were recovered from 18S rDNA clone libraries, including putative novel, higher taxonomic entities affiliated with Cercozoa, Raphidophyceae, Picozoa, and novel marine Stramenopiles. We also found that there was cryptic genetic variation at both the intraspecific and interspecific levels among arthropods, diatoms, and green algae. Specific plankton assemblages were identified at different sampling depths and they may provide useful information that could be used to interpret the origin and the subsequent mixing history of the water masses that contribute to the Tsushima Warm Current waters. Furthermore, the biological information highlighted in this study may help improve our understanding about the complex water mass interactions that were highlighted in the Korea Strait.

  17. Comparative study of Gymnodinium mikimotoi and Gymnodinium aureolum comb. nov. (= Gyrodinium aureolum) based on morphology, pigment composition, and molecular data

    DEFF Research Database (Denmark)

    Hansen, Gert; Daugbjerg, Niels; Henriksen, Peter

    2000-01-01

    Light and electron microscopy, nuclear-encoded LSU rDNA sequences, and pigment analyses were performed on five geographically separate isolates of Gymnodinium mikimotoi. The morphological variation between the isolates equals that found within the isolates. The nuclear-encoded LSU rDNA sequences...

  18. Dinoflagellate phylogeny as inferred from heat shock protein 90 and ribosomal gene sequences.

    Directory of Open Access Journals (Sweden)

    Mona Hoppenrath

    2010-10-01

    Full Text Available Interrelationships among dinoflagellates in molecular phylogenies are largely unresolved, especially in the deepest branches. Ribosomal DNA (rDNA sequences provide phylogenetic signals only at the tips of the dinoflagellate tree. Two reasons for the poor resolution of deep dinoflagellate relationships using rDNA sequences are (1 most sites are relatively conserved and (2 there are different evolutionary rates among sites in different lineages. Therefore, alternative molecular markers are required to address the deeper phylogenetic relationships among dinoflagellates. Preliminary evidence indicates that the heat shock protein 90 gene (Hsp90 will provide an informative marker, mainly because this gene is relatively long and appears to have relatively uniform rates of evolution in different lineages.We more than doubled the previous dataset of Hsp90 sequences from dinoflagellates by generating additional sequences from 17 different species, representing seven different orders. In order to concatenate the Hsp90 data with rDNA sequences, we supplemented the Hsp90 sequences with three new SSU rDNA sequences and five new LSU rDNA sequences. The new Hsp90 sequences were generated, in part, from four additional heterotrophic dinoflagellates and the type species for six different genera. Molecular phylogenetic analyses resulted in a paraphyletic assemblage near the base of the dinoflagellate tree consisting of only athecate species. However, Noctiluca was never part of this assemblage and branched in a position that was nested within other lineages of dinokaryotes. The phylogenetic trees inferred from Hsp90 sequences were consistent with trees inferred from rDNA sequences in that the backbone of the dinoflagellate clade was largely unresolved.The sequence conservation in both Hsp90 and rDNA sequences and the poor resolution of the deepest nodes suggests that dinoflagellates reflect an explosive radiation in morphological diversity in their recent

  19. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Directory of Open Access Journals (Sweden)

    Garcia Sònia

    2012-06-01

    Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.

  20. Bacterial diversity in a soil sample from Uranium mining waste pile as estimated via a culture-independent 16S rDNA approach

    International Nuclear Information System (INIS)

    Satchanska, G.; Golovinsky, E.; Selenska-Pobell, S.

    2004-01-01

    Bacterial diversity was studied in a soil sample collected from a uranium mining waste pile situated near the town of Johanngeorgenstadt, Germany. As estimated by ICP-MS analysis the studied sample was highly contaminated with Fe, Al, Mn, Zn, As, Pb and U. The 16S rDNA retrieval, applied in this study, demonstrated that more than the half of the clones of the constructed 16S rDNA library were represented by individual RFLP profiles. This indicates that the composition of the bacterial community in the sample was very complex. However, several 16S rDNA RFLP groups were found to be predominant and they were subjected to a sequence analysis. The most predominant group, which represented about 13% of the clones of the 16S rDNA library, was affiliated with the Holophaga/Acidobacterium phylum. Significant was also the number of the proteobacterial sequences which were distributed in one predominant α-proteobacterial cluster representing 11% of the total number of clones and in two equal-sized β- and γ-proteobacterial clusters representing each 6% of the clones. Two smaller groups representing both 2% of the clones were affiliated with Nitrospira and with the novel division WS3. Three of the analysed sequences were evaluated as a novel, not yet described lineage and one as a putative chimera. (authors)

  1. Molecular phylogeny and radiation time of erysiphales inferred from the nuclear ribosomal DNA sequences

    International Nuclear Information System (INIS)

    Mori, Y.; Sato, Y.; Takamatsu, S.

    2000-01-01

    Phylogenetic relationships of Erysiphales within Ascomycota were inferred from the newly determined sequences of the 18S rDNA and partial sequences of the 28S rDNA including the D1 and D2 regions of 10 Erysiphales taxa. Phylogenetic analyses revealed that the Erysiphales form a distinct clade among ascomycetous fungi suggesting that the Erysiphales diverged from a single ancestral taxon. The Myxotrichaceae of the Onygenales was distantly related to the other onygenalean families and was the sister group to the Erysiphales calde, with which it combined to form a clade. The Erysiphales/Myxotrichaceae clade was also closely related to some discomycetous fungi (Leotiales, Cyttariales and Thelebolaceae) including taxa that form cleistothecial ascomata. The present molecular analyses as well as previously reported morphological observations suggest the possible existence of a novel evolutionary pathway from cleistothecial discomycetous fungi to Erysiphales and Myxotrichaceae. However, since most of these fungi, except for the Erysiphales, are saprophytic on dung and/or plant materials, the questions of how and why an obligate biotroph like the Erysiphales radiated from the saprophytic fungi remain to be addressed. We also estimated the radiation time of the Erysiphales using the 18S rDNA sequences and the two molecular clockes that have been previously reported. The calculation showed that the Erysiphales split from the Myxotrichaceae 190–127 myr ago. Since the radiation time of the Erysiphales does not exceed 230 myr ago, even when allowance is made for the uncertainty of the molecular clocks, it is possible to consider that the Erysiphales evolved after the radiation of angiosperms. The results of our calculation also showed that the first radiation within the Erysiphales (138–92 myr ago) coincided with the date of a major diversification of angiosperms (130–90 myr ago). These results may support our early assumption that the radiation of the Erysiphales

  2. Evolutionary insight on localization of 18S, 28S rDNA genes on homologous chromosomes in Primates genomes

    Science.gov (United States)

    Mazzoleni, Sofia; Rovatsos, Michail; Schillaci, Odessa; Dumas, Francesca

    2018-01-01

    Abstract We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH) in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876) (Scandentia), in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates. PMID:29416829

  3. Evolutionary insight on localization of 18S, 28S rDNA genes on homologous chromosomes in Primates genomes

    Directory of Open Access Journals (Sweden)

    Sofia Mazzoleni

    2018-01-01

    Full Text Available We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876 (Scandentia, in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates.

  4. Description of a New Planktonic Mixotrophic Dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp from the Coastal Waters off Western Korea: Morphology, Pigments, and Ribosomal DNA Gene Sequence

    DEFF Research Database (Denmark)

    Kang, Nam Seon; Jeong, Hae Jin; Moestrup, Øjvind

    2010-01-01

    The mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. is described from living cells and from cells prepared by light, scanning electron, and transmission electron microscopy. In addition, sequences of the small subunit (SSU) and large subunit (LSU) rDNA and photosynthetic...... extension-like furrow. The cingulum is as wide as 0.2-0.3 x cell length and displaced by 0.2-0.3 x cell length. Cell length and width of live cells fed Amphidinium carterae were 8.4-19.3 and 6.1-16.0 mu m, respectively. Paragymnodinium shiwhaense does not have a nuclear envelope chamber nor a nuclear...... fibrous connective (NFC). Cells contain chloroplasts, nematocysts, trichocysts, and peduncle, though eyespots, pyrenoids, and pusules are absent. The main accessory pigment is peridinin. The sequence of the SSU rDNA of this dinoflagellate (GenBank AM408889) is 4% different from that of Gymnodinium...

  5. Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

    Science.gov (United States)

    da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

    2016-01-01

    Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

  6. A nuclear ribosomal DNA pseudogene in triatomines opens a new research field of fundamental and applied implications in Chagas disease

    Directory of Open Access Journals (Sweden)

    María Angeles Zuriaga

    2015-05-01

    Full Text Available A pseudogene, designated as "ps(5.8S+ITS-2", paralogous to the 5.8S gene and internal transcribed spacer (ITS-2 of the nuclear ribosomal DNA (rDNA, has been recently found in many triatomine species distributed throughout North America, Central America and northern South America. Among characteristics used as criteria for pseudogene verification, secondary structures and free energy are highlighted, showing a lower fit between minimum free energy, partition function and centroid structures, although in given cases the fit only appeared to be slightly lower. The unique characteristics of "ps(5.8S+ITS-2" as a processed or retrotransposed pseudogenic unit of the ghost type are reviewed, with emphasis on its potential functionality compared to the functionality of genes and spacers of the normal rDNA operon. Besides the technical problem of the risk for erroneous sequence results, the usefulness of "ps(5.8S+ITS-2" for specimen classification, phylogenetic analyses and systematic/taxonomic studies should be highlighted, based on consistence and retention index values, which in pseudogenic sequence trees were higher than in functional sequence trees. Additionally, intraindividual, interpopulational and interspecific differences in pseudogene amount and the fact that it is a pseudogene in the nuclear rDNA suggests a potential relationships with fitness, behaviour and adaptability of triatomine vectors and consequently its potential utility in Chagas disease epidemiology and control.

  7. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    Science.gov (United States)

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  8. Heterochromatin diversity and its co-localization with 5S and 45S rDNA sites in chromosomes of four Maxillaria species (Orchidaceae

    Directory of Open Access Journals (Sweden)

    Juliano S. Cabral

    2006-01-01

    Full Text Available We investigated four orchids of the genus Maxillaria (M. discolor, M. acicularis, M. notylioglossa and M. desvauxiana in regard to the position of heterochromatin blocks as revealed using chromomycin A3 (CMA and 4'-6-diamidino-2-phenylindole (DAPI fluorochrome staining and 5S and 45S rDNA sites using fluorescence in situ hybridization (FISH. The species showed differences in chromosome number and a diversified pattern of CMA+ and DAPI+ bands, including heteromorphism for CMA+ bands. The 5S and 45S rDNA sites also varied in number and most of them were co-localized with CMA+ bands. The relationship between 5S rDNA sites and CMA+ bands was more evident in M. notylioglossa, in which the brighter CMA+ bands were associated with large 5S rDNA sites. However, not all 5S and 45S rDNA sites were co-localized with CMA+ bands, probably due to technical constraints. We compare these results to banding data from other species and suggest that not all blocks of tandemly repetitive sequences, such as 5S rDNA sites, can be observed as heterochromatin blocks.

  9. CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome.

    Directory of Open Access Journals (Sweden)

    Ann L Griffen

    2011-04-01

    Full Text Available Comparing bacterial 16S rDNA sequences to GenBank and other large public databases via BLAST often provides results of little use for identification and taxonomic assignment of the organisms of interest. The human microbiome, and in particular the oral microbiome, includes many taxa, and accurate identification of sequence data is essential for studies of these communities. For this purpose, a phylogenetically curated 16S rDNA database of the core oral microbiome, CORE, was developed. The goal was to include a comprehensive and minimally redundant representation of the bacteria that regularly reside in the human oral cavity with computationally robust classification at the level of species and genus. Clades of cultivated and uncultivated taxa were formed based on sequence analyses using multiple criteria, including maximum-likelihood-based topology and bootstrap support, genetic distance, and previous naming. A number of classification inconsistencies for previously named species, especially at the level of genus, were resolved. The performance of the CORE database for identifying clinical sequences was compared to that of three publicly available databases, GenBank nr/nt, RDP and HOMD, using a set of sequencing reads that had not been used in creation of the database. CORE offered improved performance compared to other public databases for identification of human oral bacterial 16S sequences by a number of criteria. In addition, the CORE database and phylogenetic tree provide a framework for measures of community divergence, and the focused size of the database offers advantages of efficiency for BLAST searching of large datasets. The CORE database is available as a searchable interface and for download at http://microbiome.osu.edu.

  10. Xylariaceae diversity in Thailand and Philippines, based on rDNA sequencing

    Directory of Open Access Journals (Sweden)

    Natarajan Velmurugan

    2013-05-01

    Full Text Available Twenty three different Xylariaceae Tul. & C. Tul were isolatedfrom samples collected from forest zones of Thailand and Philippines.The fungal samples were characterized based on morphological characteristics and nuclear ITS1-5.8S rDNA-ITS2 region sequences. Ten species of Xylaria, two species of Hypoxylon, Biscogniauxia, Rosellinia and one species of Annulohypoxylon and Entonaema were found. Entonaema the distinctive genus of Xylariaceae, isolated in the study from Thailand samples showed a close relationship with Xylaria in phylogenetic tree. Xylariaceous species identified at molecular level showed significant similarity of the morphological characters, such as stromal structure, ascal apex and the germ slit of ascospores. In addition, three species of Arthrinium, two species of Pestalotiopsis were also isolated and characterized in the study. A phylogenetic affinity of Pestalotiopsis with Xylariaceae was found.

  11. Yeast Tdh3 (glyceraldehyde 3-phosphate dehydrogenase is a Sir2-interacting factor that regulates transcriptional silencing and rDNA recombination.

    Directory of Open Access Journals (Sweden)

    Alison E Ringel

    Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.

  12. Complete mitochondrial genome sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting domestic turkeys.

    Science.gov (United States)

    Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Barta, John R

    2014-07-17

    Clinical and subclinical coccidiosis is cosmopolitan and inflicts significant losses to the poultry industry globally. Seven named Eimeria species are responsible for coccidiosis in turkeys: Eimeria dispersa; Eimeria meleagrimitis; Eimeria gallopavonis; Eimeria meleagridis; Eimeria adenoeides; Eimeria innocua; and, Eimeria subrotunda. Although attempts have been made to characterize these parasites molecularly at the nuclear 18S rDNA and ITS loci, the maternally-derived and mitotically replicating mitochondrial genome may be more suited for species level molecular work; however, only limited sequence data are available for Eimeria spp. infecting turkeys. The purpose of this study was to sequence and annotate the complete mitochondrial genomes from 5 Eimeria species that commonly infect the domestic turkey (Meleagris gallopavo). Six single-oocyst derived cultures of five Eimeria species infecting turkeys were PCR-amplified and sequenced completely prior to detailed annotation. Resulting sequences were aligned and used in phylogenetic analyses (BI, ML, and MP) that included complete mitochondrial genomes from 16 Eimeria species or concatenated CDS sequences from each genome. Complete mitochondrial genome sequences were obtained for Eimeria adenoeides Guelph, 6211 bp; Eimeria dispersa Briston, 6238 bp; Eimeria meleagridis USAR97-01, 6212 bp; Eimeria meleagrimitis USMN08-01, 6165 bp; Eimeria gallopavonis Weybridge, 6215 bp; and Eimeria gallopavonis USKS06-01, 6215 bp). The order, orientation and CDS lengths of the three protein coding genes (COI, COIII and CytB) as well as rDNA fragments encoding ribosomal large and small subunit rRNA were conserved among all sequences. Pairwise sequence identities between species ranged from 88.1% to 98.2%; sequence variability was concentrated within CDS or between rDNA fragments (where indels were common). No phylogenetic reconstruction supported monophyly of Eimeria species infecting turkeys; Eimeria dispersa may have arisen

  13. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    Science.gov (United States)

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.

    2010-01-01

    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  14. DGGE and 16S rDNA sequencing analysis of bacterial communities in colon content and feces of pigs fed whole crop rice.

    Science.gov (United States)

    Wang, Hai-Feng; Zhu, Wei-Yun; Yao, Wen; Liu, Jian-Xin

    2007-01-01

    The effect of feeding whole crop rice (WCR) to growing-finishing pigs at three levels 0 (Control), 10% and 20% on bacterial communities in colon content and feces was analyzed using 16S rDNA-based techniques. Amplicons of the V6-V8 variable regions of bacterial 16S rDNA were analyzed by denaturing gradient gel electrophoresis (DGGE), cloning and sequencing. The total number of DGGE bands and Shannon index of diversity for feces samples were higher in the pigs fed WCR-containing diets compared with the control, while a decrease trend was observed in these two parameters for colon content samples with the inclusion of WCR in the diets, although statistical differences were not significant. In general, the intestinal bacterial communities were prone to form the cluster for pig fed the same diet. Feeding of WCR induced the presence of special DGGE band with the sequence showing 99% similarity to that of Lactobacillus reuteri (DSM 20016T). The sequences of seven amplicons in total nine clones showed less than 97% similarity with those of previously identified or unidentified bacteria, suggesting that most bacteria in gastrointestinal tracts have not been cultured or identified. The results suggest that the diet containing WCR did not affect the major groups of bacteria, but stimulated the growth of L. reuteri-like species.

  15. Molecular systematic of three species of Oithona (Copepoda, Cyclopoida from the Atlantic Ocean: comparative analysis using 28S rDNA.

    Directory of Open Access Journals (Sweden)

    Georgina D Cepeda

    Full Text Available Species of Oithona (Copepoda, Cyclopoida are highly abundant, ecologically important, and widely distributed throughout the world oceans. Although there are valid and detailed descriptions of the species, routine species identifications remain challenging due to their small size, subtle morphological diagnostic traits, and the description of geographic forms or varieties. This study examined three species of Oithona (O. similis, O. atlantica and O. nana occurring in the Argentine sector of the South Atlantic Ocean based on DNA sequence variation of a 575 base-pair region of 28S rDNA, with comparative analysis of these species from other North and South Atlantic regions. DNA sequence variation clearly resolved and discriminated the species, and revealed low levels of intraspecific variation among North and South Atlantic populations of each species. The 28S rDNA region was thus shown to provide an accurate and reliable means of identifying the species throughout the sampled domain. Analysis of 28S rDNA variation for additional species collected throughout the global ocean will be useful to accurately characterize biogeographical distributions of the species and to examine phylogenetic relationships among them.

  16. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  17. Molecular phylogeny of ocelloid-bearing dinoflagellates (Warnowiaceae) as inferred from SSU and LSU rDNA sequences.

    Science.gov (United States)

    Hoppenrath, Mona; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F; Leander, Brian S

    2009-05-25

    Dinoflagellates represent a major lineage of unicellular eukaryotes with unparalleled diversity and complexity in morphological features. The monophyly of dinoflagellates has been convincingly demonstrated, but the interrelationships among dinoflagellate lineages still remain largely unresolved. Warnowiid dinoflagellates are among the most remarkable eukaryotes known because of their possession of highly elaborate ultrastructural systems: pistons, nematocysts, and ocelloids. Complex organelles like these are evolutionary innovations found only in a few athecate dinoflagellates. Moreover, the taxonomy of warnowiids is extremely confusing and inferences about the evolutionary history of this lineage are mired by the absence of molecular phylogenetic data from any member of the group. In this study, we provide the first molecular phylogenetic data for warnowiids and couple them with a review of warnowiid morphological features in order to formulate a hypothetical framework for understanding character evolution within the group. These data also enabled us to evaluate the evolutionary relationship(s) between warnowiids and the other group of dinoflagellates with complex organelles: polykrikoids. Molecular phylogenetic analyses of SSU and LSU rDNA sequences demonstrated that warnowiids form a well-supported clade that falls within the more inclusive Gymnodinium sensu stricto clade. These data also confirmed that polykrikoids are members of the Gymnodinium sensu stricto clade as well; however, a specific sister relationship between the warnowiid clade and the polykrikoid clade was unresolved in all of our analyses. Nonetheless, the new DNA sequences from different isolates of warnowiids provided organismal anchors for several previously unidentified sequences derived from environmental DNA surveys of marine biodiversity. Comparative morphological data and molecular phylogenetic data demonstrate that the polykrikoid and the warnowiid clade are closely related to each other

  18. Molecular phylogeny of ocelloid-bearing dinoflagellates (Warnowiaceae as inferred from SSU and LSU rDNA sequences

    Directory of Open Access Journals (Sweden)

    Handy Sara M

    2009-05-01

    Full Text Available Abstract Background Dinoflagellates represent a major lineage of unicellular eukaryotes with unparalleled diversity and complexity in morphological features. The monophyly of dinoflagellates has been convincingly demonstrated, but the interrelationships among dinoflagellate lineages still remain largely unresolved. Warnowiid dinoflagellates are among the most remarkable eukaryotes known because of their possession of highly elaborate ultrastructural systems: pistons, nematocysts, and ocelloids. Complex organelles like these are evolutionary innovations found only in a few athecate dinoflagellates. Moreover, the taxonomy of warnowiids is extremely confusing and inferences about the evolutionary history of this lineage are mired by the absence of molecular phylogenetic data from any member of the group. In this study, we provide the first molecular phylogenetic data for warnowiids and couple them with a review of warnowiid morphological features in order to formulate a hypothetical framework for understanding character evolution within the group. These data also enabled us to evaluate the evolutionary relationship(s between warnowiids and the other group of dinoflagellates with complex organelles: polykrikoids. Results Molecular phylogenetic analyses of SSU and LSU rDNA sequences demonstrated that warnowiids form a well-supported clade that falls within the more inclusive Gymnodinium sensu stricto clade. These data also confirmed that polykrikoids are members of the Gymnodinium sensu stricto clade as well; however, a specific sister relationship between the warnowiid clade and the polykrikoid clade was unresolved in all of our analyses. Nonetheless, the new DNA sequences from different isolates of warnowiids provided organismal anchors for several previously unidentified sequences derived from environmental DNA surveys of marine biodiversity. Conclusion Comparative morphological data and molecular phylogenetic data demonstrate that the polykrikoid

  19. Study of endophytic Xylariaceae in Thailand: diversity and taxonomy inferred from rDNA sequence analyses with saprobes forming fruit bodies in the field

    DEFF Research Database (Denmark)

    Okane, Izumi; Srikitikulchai, Prasert; Toyama, Kyoko

    2008-01-01

    to reveal the diversity and taxonomy of endophytes and the relationships between those endophytes and saprobic Xylariaceae in Thailand that have been recorded according to fruit-body formation on decayed plant materials. Analysis of 28S rDNA D1/D2 sequences revealed 21 xylariaceous species inhabiting......A study of the diversity, taxonomy, and ecology of endophytic Xylariaceae (Ascomycota) was carried out. In this study, we obtained isolates of Xylariaceae from healthy, attached leaves and teleomorphic stromata on decayed plant materials in a permanent plot at Khao Yai National Park (Thailand......). In addition, strains deposited beforehand were selected in which both endophytic strains isolated from living plant tissues and saprobic strains from fruit bodies were included. Consequently, 405 strains of Xylariaceae (273 endophytic and 132 saprobic strains, including identified strains) were studied...

  20. Building a model: developing genomic resources for common milkweed (Asclepias syriaca) with low coverage genome sequencing.

    Science.gov (United States)

    Straub, Shannon C K; Fishbein, Mark; Livshultz, Tatyana; Foster, Zachary; Parks, Matthew; Weitemier, Kevin; Cronn, Richard C; Liston, Aaron

    2011-05-04

    Milkweeds (Asclepias L.) have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L.) could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp) and 5S rDNA (120 bp) sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp), with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae) unigenes (median coverage of 0.29×) and 66% of single copy orthologs (COSII) in asterids (median coverage of 0.14×). From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites) and phylogenetics (low-copy nuclear genes) studies were developed. The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species and its relatives. This study represents a first

  1. Evidence for 5S rDNA horizontal transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families.

    Science.gov (United States)

    Merlo, Manuel A; Cross, Ismael; Palazón, José L; Ubeda-Manzanaro, María; Sarasquete, Carmen; Rebordinos, Laureana

    2012-10-07

    The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes and Clupeiformes orders. Two

  2. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801 based on the analysis of three multigene families

    Directory of Open Access Journals (Sweden)

    Merlo Manuel A

    2012-10-01

    Full Text Available Abstract Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH. Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not

  3. Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs

    Science.gov (United States)

    M.N. lslam-Faridi; C.D. Nelson; S.P. DiFazio; L.E. Gunter; G.A. Tuskan

    2009-01-01

    The 185-285 rDNA and 55 rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 185-285 rDNA sites and one 55 rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis-type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones...

  4. Xylariaceae diversity in Thailand and Philippines, based on rDNA sequencing

    Directory of Open Access Journals (Sweden)

    Natarajan Velmurugan

    2013-07-01

    Full Text Available Twenty three different Xylariaceae Tul. & C. Tul were isolated from samples collected from forest zones of Thailand and Philippines. The fungal samples were characterized based on morphological characteristics and nuclear ITS1-5.8S rDNA-ITS2 region sequences. Ten species of Xylaria, two species of Hypoxylon, Biscogniauxia, Rosellinia and one species of Annulohypoxylon and Entonaema were found. Entonaema the distinctive genus of Xylariaceae, isolated in the study from Thailand samples showed a close relationship withXylaria in phylogenetic tree. Xylariaceous species identified at molecular level showed significant similarity of the morphological characters, such as stromal structure, ascal apex and the germ slit of ascospores. In addition, three species of Arthrinium, two species of Pestalotiopsis were also isolated and characterized in the study. A phylogenetic affinity of Pestalotiopsis with Xylariaceae was found.

  5. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    Science.gov (United States)

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Phylogeographic structure of cotton pest Adelphocoris suturalis (Hemiptera: Miridae): strong subdivision in China inferred from mtDNA and rDNA ITS markers

    OpenAIRE

    Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H.; Cai, Wanzhi

    2015-01-01

    Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populatio...

  7. Morphology and SSU rDNA sequence analysis of two hypotrichous ciliates (Protozoa, Ciliophora, Hypotrichia) including the new species Metaurostylopsis parastruederkypkeae n. sp.

    Science.gov (United States)

    Lu, Borong; Wang, Chundi; Huang, Jie; Shi, Yuhong; Chen, Xiangrui

    2016-10-01

    The morphology and phylogeny of two hypotrichous ciliates, Metaurostylopsis parastruederkypkeae n. sp. and Neourostylopsis flavicana (Wang et al., 2011) Chen et al., 2013 were investigated based on morphology, infraciliature and the small subunit (SSU) ribosomal RNA gene (rRNA) sequence. The new species, M. parastruederkypkeae n. sp. was identified according to its characteristics: body shape ellipsoidal, size about (165-200) × (45-60) μm in vivo, cell color reddish; two types of cortical granules including wheat grain-like and yellow-greenish larger ones along the marginal cirri rows and dorsal kineties and dot-like and reddish smaller ones, grouped around marginal cirri on ventral side and arranged in short lines on dorsal side; 26-41 adoral membranelles; three frontal and one parabuccal, five to seven frontoterminal, one buccal, and three to six transverse cirri; seven to thirteen midventral pairs; five to nine unpaired ventral cirri, five to seven left and three to five right marginal rows; and three complete dorsal kineties. Phylogenetic analysis based on SSU rDNA sequences showed that both Metaurostylopsis and Neourostylopsis are monophyletic. As the internal relationship between and within both genera are not clear, further studies on the species in these two genera are necessary. The key characteristics of all known twelve Metaurostylopsis-Apourostylopsis-Neourostylopsis species complex were updated.

  8. Organization and variation analysis of 5S rDNA in gynogenetic offspring of Carassius auratus red var. (♀) × Megalobrama amblycephala (♂).

    Science.gov (United States)

    Qin, QinBo; Wang, Juan; Wang, YuDe; Liu, Yun; Liu, ShaoJun

    2015-03-13

    The offspring with 100 chromosomes (abbreviated as GRCC) have been obtained in the first generation of Carassius auratus red var. (abbreviated as RCC, 2n = 100) (♀) × Megalobrama amblycephala (abbreviated as BSB, 2n = 48) (♂), in which the females and unexpected males both are found. Chromosomal and karyotypic analysis has been reported in GRCC which gynogenesis origin has been suggested, but lack genetic evidence. Fluorescence in situ hybridization with species-specific centromere probes directly proves that GRCC possess two sets of RCC-derived chromosomes. Sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (abbreviated as NTS) reveals that three types of 5S rDNA class (class I; class II and class III) in GRCC are completely inherited from their female parent (RCC), and show obvious base variations and insertions-deletions. Fluorescence in situ hybridization with the entire 5S rDNA probe reveals obvious chromosomal loci (class I and class II) variation in GRCC. This paper provides directly genetic evidence that GRCC is gynogenesis origin. In addition, our result is also reveals that distant hybridization inducing gynogenesis can lead to sequence and partial chromosomal loci of 5S rDNA gene obvious variation.

  9. Taxonomic confirmation of mud crab species (genus Scylla) in Bangladesh by nuclear and mitochondrial DNA markers.

    Science.gov (United States)

    Sarower, Mohammed Golam; Shahriar, Sheik Istiak Md; Nakamura, Hiromasa; Rouf, Muhammad Abdur; Okada, Shigeru

    2017-11-01

    Taxonomy of mud crabs genus Scylla has been misidentified for several years due to their high morphological plasticity. Several reports concerning mud crab have been published with misleading identification in Bangladesh. In this study, partial fragments of nuclear and mitochondrial DNA of Scylla species obtained from four locations along the Bangladesh coast were used to resolve taxonomical ambiguity of mud crab species. A single PCR product from the nuclear first internal transcribed spacer (ITS-1) marker and phylogenetic trees constructed based on 16S rDNA sequences indicated that all Scylla species obtained in this study were S. olivacea. Both molecular data and morphological characters revealed that S. olivacea is the only major species in Bangladesh coastal waters. Further, the 16S rDNA haplotypes significantly differed with known S. serrata by 33%. From this study it is clear that 'S. serrata' commonly reported from Bangladesh should be S. olivacea.

  10. [Comparison of rDNA internal transcribed spacer sequences in asparagus].

    Science.gov (United States)

    Ou, Li-Jun; Ye, Wei; Zeng, Gui-Ping; Jiang, Xiang-Hui; She, Chao-Wen; Xu, Dong; Yang, Jia-Qiang

    2010-10-01

    Using ITS sequence of nine species to identify counterfeiting medicine and analyse phylogenetic of Asparagus. Analysing ITS sequences by amplification, cloning,sequencing and alignment. The length range of ITS sequence of nine species was from 711 to 748 bp, the percentage of G + C content was about 60%. The phylogenetic tree constructed on the basis of the ITS sequences showed that nine species were divided into two branches: Asparagus cochinchinensis, Asparagus officinalis, Asparagus densiflorus, Asparagus densiflorus cv. Myers and Asparagus densiflorus cv. Sprengeri were a branch and the others were a branch. Asparagus densiflorus and Asparagus densflorus cv. Myers those were from Africa had priority to clustering and then clustering with Asparagus densiflorus cv. Sprengeri that was a variant of Asparagus densiflorus in the first branch. Asparagus setaceus had relatively distant genetic relationship with the others three materials in another branch. The ITS sequences could distinguish species of Asparagus to test the counterfeit. Division status in phylogenetic tree of some species were debatable and ITS sequence was combined with others analytical tools to analyze the realistic phylogeny.

  11. Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

    Science.gov (United States)

    Roa, Fernando; Guerra, Marcelo

    2015-01-01

    5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.

  12. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    Science.gov (United States)

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  13. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  14. The efficacy of 16S ribosomal DNA sequencing in the diagnosis of bacteria from blood, bone and synovial fluid samples of children with musculoskeletal infections.

    Science.gov (United States)

    Hashavya, S; Gross, I; Michael-Gayego, A; Simanovsky, N; Lamdan, R

    2018-04-01

    Musculoskeletal infections are among the most common bacterial infections in children leading to hospitalization, invasive procedures and prolonged antibiotic administration. Blood, synovial and sometimes tissue cultures are essential for the diagnosis and treatment of musculoskeletal infections; 16S ribosomal DNA (rDNA) sequencing is a novel diagnostic tool for the detection of bacteria.While the yield of 16S rDNA sequencing in synovial fluid was previously assessed, data regarding the efficacy of this method from blood samples or partially treated children with suspected musculoskeletal infections is lacking.In this study we assessed the yield of 16S rDNA sequencing in blood, bone and synovial samples of children with musculoskeletal infections. Blood, synovial and bone samples were collected from children with suspected musculoskeletal infections and analyzed for the presence of 16S rDNA, the results were then compared with the benchmark microbial cultures. During the study period, 41 children (18 boys and 23 girls) with suspected acute musculoskeletal infection were enrolled. A positive blood culture was found in 6/31 cases (19.4%) with methicillin-susceptible Staphylococcus aureus being the most commonly isolated bacterium. No significant 16S rDNA detection in blood samples was recorded.Synovial fluid culture was positive in 6/28 samples (21%), Kingella kingae being the most common pathogen. When using the 16S rDNA sequencing method, the rate of positive results in synovial fluid was higher with bacterial detection in 12/23 (52%) samples. The 16S rDNA sequencing method was also able to identify pathogens in samples taken from partially treated children where cultures were negative with 16S rDNA detection in 5/5 samples. Although 16S rDNA sequencing may increase the yield of bacterial detection in synovial samples of patients with musculoskeletal infections, there is no benefit from applying this method on blood samples. The 16S rDNA sequencing method may be

  15. Molecular Profiling of Microbial Communities from Contaminated Sources: Use of Subtractive Cloning Methods and rDNA Spacer Sequences; FINAL

    International Nuclear Information System (INIS)

    Robb, Frank T.

    2001-01-01

    The major objective of this research was to provide appropriate sequences and assemble a DNA array of oligonucleotides to be used for rapid profiling of microbial populations from polluted areas and other areas of interest. The sequences to be assigned to the DNA array were chosen from cloned genomic DNA taken from groundwater sites having well characterized pollutant histories at Hanford Nuclear Plant and Lawrence Livermore Site 300. Glass-slide arrays were made and tested; and a new multiplexed, bead-based method was developed that uses nucleic acid hybridization on the surface of microscopic polystyrene spheres to identify specific sequences in heterogeneous mixtures of DNA sequences. The test data revealed considerable strain variation between sample sites showing a striking distribution of sequences. It also suggests that diversity varies greatly with bioremediation, and that there are many bacterial intergenic spacer region sequences that can indicate its effects. The bead method exhibited superior sequence discrimination and has features for easier and more accurate measurement

  16. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

    Science.gov (United States)

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2014-07-01

    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

  17. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    Science.gov (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.

  18. Armillaria phylogeny based on tef-1α sequences suggests ongoing divergent speciation within the boreal floristic kingdom

    Science.gov (United States)

    Ned B. Klopfenstein; John W. Hanna; Amy L. Ross-Davis; Jane E. Stewart; Yuko Ota; Rosario Medel-Ortiz; Miguel Armando Lopez-Ramirez; Ruben Damian Elias-Roman; Dionicio Alvarado-Rosales; Mee-Sook Kim

    2013-01-01

    Armillaria plays diverse ecological roles in forests worldwide, which has inspired interest in understanding phylogenetic relationships within and among species of this genus. Previous rDNA sequence-based phylogenetic analyses of Armillaria have shown general relationships among widely divergent taxa, but rDNA sequences were not reliable for separating closely related...

  19. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Science.gov (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  20. Building a model: developing genomic resources for common milkweed (Asclepias syriaca with low coverage genome sequencing

    Directory of Open Access Journals (Sweden)

    Weitemier Kevin

    2011-05-01

    Full Text Available Abstract Background Milkweeds (Asclepias L. have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L. could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. Results A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp and 5S rDNA (120 bp sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp, with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae unigenes (median coverage of 0.29× and 66% of single copy orthologs (COSII in asterids (median coverage of 0.14×. From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites and phylogenetics (low-copy nuclear genes studies were developed. Conclusions The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species

  1. The nucleolus: a raft adrift in the nuclear sea or the keystone in nuclear structure?

    Science.gov (United States)

    O'Sullivan, Justin M; Pai, Dave A; Cridge, Andrew G; Engelke, David R; Ganley, Austen R D

    2013-06-01

    The nucleolus is a prominent nuclear structure that is the site of ribosomal RNA (rRNA) transcription, and hence ribosome biogenesis. Cellular demand for ribosomes, and hence rRNA, is tightly linked to cell growth and the rRNA makes up the majority of all the RNA within a cell. To fulfill the cellular demand for rRNA, the ribosomal RNA (rDNA) genes are amplified to high copy number and transcribed at very high rates. As such, understanding the rDNA has profound consequences for our comprehension of genome and transcriptional organization in cells. In this review, we address the question of whether the nucleolus is a raft adrift the sea of nuclear DNA, or actively contributes to genome organization. We present evidence supporting the idea that the nucleolus, and the rDNA contained therein, play more roles in the biology of the cell than simply ribosome biogenesis. We propose that the nucleolus and the rDNA are central factors in the spatial organization of the genome, and that rapid alterations in nucleolar structure in response to changing conditions manifest themselves in altered genomic structures that have functional consequences. Finally, we discuss some predictions that result from the nucleolus having a central role in nuclear organization.

  2. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    Science.gov (United States)

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  3. Molecular characterization of Fasciola spp. from the endemic area of northern Iran based on nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Amor, Nabil; Halajian, Ali; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-07-01

    Fasciolosis caused by Fasciola spp. (Platyhelminthes: Trematoda: Digenea) is considered as the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. In the endemic regions of the North of Iran, Fasciola hepatica and Fasciola gigantica have been previously characterized on the basis of morphometric differences, but the use of molecular markers is necessary to distinguish exactly between species and intermediate forms. Samples from buffaloes and goats from different localities of northern Iran were identified morphologically and then genetically characterized by sequences of the first (ITS-1) and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the ITS of the northern Iranian samples with sequences of Fasciola spp. from GenBank showed that the examined specimens had sequences identical to those of the most frequent haplotypes of F. hepatica (n=25, 48.1%) and F. gigantica (n=20, 38.45%), which differed from each other in different variable nucleotide positions of ITS region sequences, and their intermediate forms (n=7, 13.45%), which had nucleotides overlapped between the two Fasciola species in all the positions. The ITS sequences from populations of Fasciola isolates in buffaloes and goats had experienced introgression/hybridization as previously reported in isolates from other ruminants and humans. Based on ITS-1 and ITS-2 sequences, flukes are scattered in pure F. hepatica, F. gigantica and intermediate Fasciola clades, revealing that multiple genotypes of Fasciola are able to infect goats and buffaloes in North of Iran. Furthermore, the phylogenetic trees based upon the ITS-1 and ITS-2 sequences showed a close relationship of the Iranian samples with isolates of F. hepatica and F. gigantica from different localities of Africa and Asia. In the present study, the intergenic transcribed spacers ITS-1 and ITS-2 showed to be reliable approaches for the genetic

  4. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  5. Copy number of the transposon, Pokey, in rDNA is positively correlated with rDNA copy number in Daphnia obtuse [corrected].

    Directory of Open Access Journals (Sweden)

    Kaitlynn LeRiche

    Full Text Available Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species.

  6. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    Directory of Open Access Journals (Sweden)

    Daniël O. Warmerdam

    2016-03-01

    Full Text Available rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5 as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability.

  8. Identification of a third feline Demodex species through partial sequencing of the 16S rDNA and frequency of Demodex species in 74 cats using a PCR assay.

    Science.gov (United States)

    Ferreira, Diana; Sastre, Natalia; Ravera, Iván; Altet, Laura; Francino, Olga; Bardagí, Mar; Ferrer, Lluís

    2015-08-01

    Demodex cati and Demodex gatoi are considered the two Demodex species of cats. However, several reports have identified Demodex mites morphologically different from these two species. The differentiation of Demodex mites is usually based on morphology, but within the same species different morphologies can occur. DNA amplification/sequencing has been used effectively to identify and differentiate Demodex mites in humans, dogs and cats. The aim was to develop a PCR technique to identify feline Demodex mites and use this technique to investigate the frequency of Demodex in cats. Demodex cati, D. gatoi and Demodex mites classified morphologically as the third unnamed feline species were obtained. Hair samples were taken from 74 cats. DNA was extracted; a 330 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of D. cati and D. gatoi shared >98% identity with those published on GenBank. The sequence of the third unnamed species showed 98% identity with a recently published feline Demodex sequence and only 75.2 and 70.9% identity with D. gatoi and D. cati sequences, respectively. Demodex DNA was detected in 19 of 74 cats tested; 11 DNA sequences corresponded to Demodex canis, five to Demodex folliculorum, three to D. cati and two to Demodex brevis. Three Demodex species can be found in cats, because the third unnamed Demodex species is likely to be a distinct species. Apart from D. cati and D. gatoi, DNA from D. canis, D. folliculorum and D. brevis was found on feline skin. © 2015 ESVD and ACVD.

  9. Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov

    Science.gov (United States)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.

    1992-01-01

    Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

  10. Can abundance of protists be inferred from sequence data: a case study of foraminifera.

    Directory of Open Access Journals (Sweden)

    Alexandra A-T Weber

    Full Text Available Protists are key players in microbial communities, yet our understanding of their role in ecosystem functioning is seriously impeded by difficulties in identification of protistan species and their quantification. Current microscopy-based methods used for determining the abundance of protists are tedious and often show a low taxonomic resolution. Recent development of next-generation sequencing technologies offered a very powerful tool for studying the richness of protistan communities. Still, the relationship between abundance of species and number of sequences remains subjected to various technical and biological biases. Here, we test the impact of some of these biological biases on sequence abundance of SSU rRNA gene in foraminifera. First, we quantified the rDNA copy number and rRNA expression level of three species of foraminifera by qPCR. Then, we prepared five mock communities with these species, two in equal proportions and three with one species ten times more abundant. The libraries of rDNA and cDNA of the mock communities were constructed, Sanger sequenced and the sequence abundance was calculated. The initial species proportions were compared to the raw sequence proportions as well as to the sequence abundance normalized by rDNA copy number and rRNA expression level per species. Our results showed that without normalization, all sequence data differed significantly from the initial proportions. After normalization, the congruence between the number of sequences and number of specimens was much better. We conclude that without normalization, species abundance determination based on sequence data was not possible because of the effect of biological biases. Nevertheless, by taking into account the variation of rDNA copy number and rRNA expression level we were able to infer species abundance, suggesting that our approach can be successful in controlled conditions.

  11. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  12. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats.

    Science.gov (United States)

    Warmerdam, Daniël O; van den Berg, Jeroen; Medema, René H

    2016-03-22

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5) as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Description of a new planktonic mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. from the coastal waters off Western Korea: morphology, pigments, and ribosomal DNA gene sequence.

    Science.gov (United States)

    Kang, Nam Seon; Jeong, Hae Jin; Moestrup, Øjvind; Shin, Woongghi; Nam, Seung Won; Park, Jae Yeon; De Salas, Miguel F; Kim, Ki Woo; Noh, Jae Hoon

    2010-01-01

    The mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. is described from living cells and from cells prepared by light, scanning electron, and transmission electron microscopy. In addition, sequences of the small subunit (SSU) and large subunit (LSU) rDNA and photosynthetic pigments are reported. The episome is conical, while the hyposome is hemispherical. Cells are covered with polygonal amphiesmal vesicles arranged in 16 rows and containing a very thin plate-like component. There is neither an apical groove nor apical line of narrow plates. Instead, there is a sulcal extension-like furrow. The cingulum is as wide as 0.2-0.3 x cell length and displaced by 0.2-0.3 x cell length. Cell length and width of live cells fed Amphidinium carterae were 8.4-19.3 and 6.1-16.0 microm, respectively. Paragymnodinium shiwhaense does not have a nuclear envelope chamber nor a nuclear fibrous connective (NFC). Cells contain chloroplasts, nematocysts, trichocysts, and peduncle, though eyespots, pyrenoids, and pusules are absent. The main accessory pigment is peridinin. The sequence of the SSU rDNA of this dinoflagellate (GenBank AM408889) is 4% different from that of Gymnodinium aureolum, Lepidodinium viride, and Gymnodinium catenatum, the three closest species, while the LSU rDNA was 17-18% different from that of G. catenatum, Lepidodinium chlorophorum, and Gymnodinium nolleri. The phylogenetic trees show that this dinoflagellate belongs within the Gymnodinium sensu stricto clade. However, in contrast to Gymnodinium spp., cells lack nuclear envelope chambers, NFC, and an apical groove. Unlike Polykrikos spp., which have a taeniocyst-nematocyst complex, P. shiwhaense has nematocysts without taeniocysts. In addition, P. shiwhaense does not have ocelloids in contrast to Warnowia spp. and Nematodinium spp. Therefore, based on morphological and molecular analyses, we suggest that this taxon is a new species, also within a new genus.

  14. Rapid diagnosis of virulent Pasteurella multocida isolated from farm animals with clinical manifestation of pneumonia respiratory infection using 16S rDNA and KMT1 gene

    Directory of Open Access Journals (Sweden)

    Gamal Mohamedin Hassan

    2016-01-01

    Full Text Available Objective: To characterize intra-isolates variation between clinical isolates of Pasteurella multocida (P. multocida isolated from sheep, cattle and buffalo at molecular level to check the distribution of pneumonia and hemorrhagic septicemia in some regions of Fayoum, Egypt. Methods: These isolates were obtained from various locations in the Fayoum Governorate, Egypt and they were identified by amplifying 16S rDNA and KMT1 genes using their DNA as a template in PCR reaction. Results: The results demonstrated that the five selective isolates of P. multocida had similar size of PCR products that generated one band of 16S rDNA having 1 471 bp and KMT1 gene having 460 bp. The phylogenetic tree and similarity of the five selective isolates of P. multocida which were collected from GenBank database were calculated and analyzed for the nucleotide sequence of 16S rDNA and KMT1 genes. The sequencing result of 16S rRNA gene product (1 471 bp for the five selective isolates of P. multocida showed that the isolates of sheep (FUP2 shared 94.08%, 88.10% homology with the buffalo isolate (FUP8 and cattle isolate (FUP9 respectively, whereas, the buffalo isolate (FUP5 shared 98.18% and 94.40% homology with the cattle isolates (FUP12 and FUP9. Conclusions: The results indicated the relationships of P. multocida isolated from buffalo and cattle rather than the close relationships between P. multocida isolated from cattle and sheep. Diagnosis of P. multocida by 16S rDNA and KMT1 gene sequences was important to determine the antigen that is responsible for protective cover within the same group of animals and to help for the production of new vaccines for the control of microbial infection for domestic animals.

  15. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    OpenAIRE

    Warmerdam, Daniël O.; van den Berg, Jeroen; Medema, René H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of b...

  16. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.

    Science.gov (United States)

    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C

    2000-09-01

    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  17. Evaluation of haplotype diversity of Achatina fulica (Lissachatina) [Bowdich] from Indian sub-continent by means of 16S rDNA sequence and its phylogenetic relationships with other global populations.

    Science.gov (United States)

    Ayyagari, Vijaya Sai; Sreerama, Krupanidhi

    2017-08-01

    Achatina fulica (Lissachatina fulica) is one of the most invasive species found across the globe causing a significant damage to crops, vegetables, and horticultural plants. This terrestrial snail is native to east Africa and spread to different parts of the world by introductions. India, a hot spot for biodiversity of several endemic gastropods, has witnessed an outburst of this snail population in several parts of the country posing a serious threat to crop loss and also to human health. With an objective to evaluate the genetic diversity of this snail, we have sampled this snail from different parts of India and analyzed its haplotype diversity by means of 16S rDNA sequence information. Apart from this, we have studied the phylogenetic relationships of the isolates sequenced in the present study in relation with other global populations by Bayesian and Maximum-likelihood approaches. Of the isolates sequenced, haplotype 'C' is the predominant one. A new haplotype 'S' from the state of Odisha was observed. The isolates sequenced in the present study clustered with its conspecifics from the Indian sub-continent. Haplotype network analyses were also carried out for studying the evolution of different haplotypes. It was observed that haplotype 'S' was associated with a Mauritius haplotype 'H', indicating the possibility of multiple introductions of A. fulica to India.

  18. Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

    Science.gov (United States)

    Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

    2013-07-01

    The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.

  19. Single-strand conformation polymorphism (SSCP)-based mutation scanning approaches to fingerprint sequence variation in ribosomal DNA of ascaridoid nematodes.

    Science.gov (United States)

    Zhu, X Q; Gasser, R B

    1998-06-01

    In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.

  20. Mapping of rDNA on the chromosomes of Eleusine species by fluorescence in situ hybridization.

    Science.gov (United States)

    Bisht, M S; Mukai, Y

    2000-12-01

    Mapping of rDNA sites on the chromosomes of four diploid and two tetraploid species of Eleusine has provided valuable information on genome relationship between the species. Presence of 18S-5.8S-26S rDNA on the largest pair of the chromosomes, location of 5S rDNA at four sites on two pairs of chromosomes and presence of 18S-5.8S-26S and 5S rDNA at same location on one pair of chromosomes have clearly differentiated E. multiflora from rest of the species of Eleusine. The two tetraploid species, E. coracana and E. africana have the same number of 18S-5.8S-26S and 5S rDNA sites and located at similar position on the chromosomes. Diploid species, E. indica, E. floccifolia and E. tristachya have the same 18S-5.8S-26S sites and location on the chromosomes which also resembled with the two pairs of 18S-5.8S-26S rDNA locations in tetraploid species, E. coracana and E. africana. The 5S rDNA sites on chromosomes of E. indica and E. floccifolia were also comparable to the 5S rDNA sites of E. africana and E. coracana. The similarity of the rDNA sites and their location on chromosomes in the three diploid and two polyploid species also supports the view that genome donors to tetraploid species may be from these diploid species.

  1. Third release of the plant rDNA database with updated content and information on telomere composition and sequenced plant genomes

    Czech Academy of Sciences Publication Activity Database

    Vitales, D.; D'Ambrosio, U.; Galvez, F.; Kovařík, Aleš; Garcia, S.

    2017-01-01

    Roč. 303, č. 8 (2017), s. 1115-1121 ISSN 0378-2697 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * ribosomal-rna genes * 5s rdna Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 1.239, year: 2016

  2. rKnowledge: The Spatial Diffusion of rDNA Methods

    OpenAIRE

    Maryann Feldman; Dieter Kogler; David Rigby

    2013-01-01

    The 1980 patent granted to Stanley Cohen and Herbert Boyer for their development of rDNA technology played a critical role in the establishment of the modern biotechnology industry. From the birth of this general purpose technology in the San Francisco Bay area, rDNA-related knowledge diffused across sectors and regions of the U.S. economy. The local absorption and application of rDNA technology is tracked across metropolitan areas with USPTO patent data. The influence of cognitive, geographi...

  3. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    Directory of Open Access Journals (Sweden)

    Elizabeth X. Kwan

    2016-09-01

    Full Text Available The Saccharomyces cerevisiae ribosomal DNA (rDNA locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae.

  4. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants.

    Science.gov (United States)

    Kwan, Elizabeth X; Wang, Xiaobin S; Amemiya, Haley M; Brewer, Bonita J; Raghuraman, M K

    2016-09-08

    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. Copyright © 2016 Kwan et al.

  5. Evolution of rDNA in Nicotiana allopolyploids: A potential link between rDNa homogenization and epigenetics

    Czech Academy of Sciences Publication Activity Database

    Kovařík, Aleš; Nešpor Dadejová, Martina; Lim, Y.K.; Chase, M.W.; Clarkson, J.J.; Knapp, S.; Leitch, A.R.

    2008-01-01

    Roč. 101, č. 6 (2008), s. 815-823 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA521/07/0116 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : rDNA * allopolyploidy * evolution-Nicotiana Subject RIV: BO - Biophysics Impact factor: 2.755, year: 2008

  6. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina.

    Science.gov (United States)

    Iwanowicz, Luke R; Iwanowicz, Deborah D; Pote, Linda M; Blazer, Vicki S; Schill, William B

    2008-02-01

    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 +/- 0.3 microm (range 15.7-20.3) in length, and 5.4 +/- 0.1 microm (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 +/- 1.1 microm (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 +/- 0.1 microm (range 5.48-7.06), while the shorter is 5.7 +/- 0.1 microm (range 4.8-6.4) in length. Polar capsule width is 1.2 +/- 0.03 microm (range 1.0-1.54). The total length of the spore is 60.9 +/- 1.2 microm (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus.

  7. Ribosomal DNA sequence divergence and group I introns within the Leucostoma species L. cinctum, L. persoonii, and L. parapersoonii sp. nov., ascomycetes that cause Cytospora canker of fruit trees.

    Science.gov (United States)

    Adams, Gerard C; Surve-Iyer, Rupa S; Iezzoni, Amy F

    2002-01-01

    Leucostoma species that are the causal agents of Cytospora canker of stone and pome fruit trees were studied in detail. DNA sequence of the internal transcribed spacer regions and the 5.8S of the nuclear ribosomal DNA operon (ITS rDNA) supplied sufficient characters to assess the phylogenetic relationships among species of Leucostoma, Valsa, Valsella, and related anamorphs in Cytospora. Parsimony analysis of the aligned sequence divided Cytospora isolates from fruit trees into clades that generally agreed with the morphological species concepts, and with some of the phenetic groupings (PG 1-6) identified previously by isozyme analysis and cultural characteristics. Phylogenetic analysis inferred that isolates of L. persoonii formed two well-resolved clades distinct from isolates of L. cinctum. Phylogenetic analysis of the ITS rDNA, isozyme analysis, and cultural characteristics supported the inference that L. persoonii groups PG 2 and PG 3 were populations of a new species apparently more genetically different from L. persoonii PG 1 than from isolates representative of L. massariana, L. niveum, L. translucens, and Valsella melastoma. The new species, L. parapersoonii, was described. A diverse collection of isolates of L. cinctum, L. persoonii, and L. parapersoonii were examined for genetic variation using restriction fragment length polymorphism (RFLP) analysis of the ITS rDNA and the five prime end of the large subunit of the rDNA (LSU rDNA). HinfI and HpaII endonucleases were each useful in dividing the Leucostoma isolates into RFLP profiles corresponding to the isozyme phenetic groups, PG 1-6. RFLP analysis was more effective than isozyme analysis in uncovering variation among isolates of L. persoonii PG 1, but less effective within L. cinctum populations. Isolates representative of seven of the L. persoonii formae speciales proposed by G. Défago in 1935 were found to be genetically diverse isolates of PG 1. Two large insertions, 415 and 309 nucleotides long, in

  8. Ultrastructure and large subunit rDNA sequences of Lepidodinium viride reveal a close relationship to Lepidodinium chlorophorum comb. nov. (=Gymnodinium chlorophorum)

    DEFF Research Database (Denmark)

    Hansen, Gert; Botes, L.; DeSalas, M.

    2007-01-01

    . The flagellar apparatus was essentially identical to Gymnodinium chlorophorum Elbrächter et Schnepf, a species also containing chloroplasts of chlorophyte origin. Of particular interest was the connection of the flagellar apparatus to the nuclear envelope by means of both a fiber and a microtubular extension...... dinoflagellates, including both the 'type' culture and a new Tasmanian isolate of G. chlorophorum. These two isolates had identical sequences and differed from L. viride by only 3.75% of their partial LSU sequences, considerably less than the difference between other Gymnodinium species. Therefore, based...

  9. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

    Science.gov (United States)

    Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

    2016-04-01

    Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

  10. Monitoring of Fasciola Species Contamination in Water Dropwort by cox1 Mitochondrial and ITS-2 rDNA Sequencing Analysis.

    Science.gov (United States)

    Choi, In-Wook; Kim, Hwang-Yong; Quan, Juan-Hua; Ryu, Jae-Gee; Sun, Rubing; Lee, Young-Ha

    2015-10-01

    Fascioliasis, a food-borne trematode zoonosis, is a disease primarily in cattle and sheep and occasionally in humans. Water dropwort (Oenanthe javanica), an aquatic perennial herb, is a common second intermediate host of Fasciola, and the fresh stems and leaves are widely used as a seasoning in the Korean diet. However, no information regarding Fasciola species contamination in water dropwort is available. Here, we collected 500 samples of water dropwort in 3 areas in Korea during February and March 2015, and the water dropwort contamination of Fasciola species was monitored by DNA sequencing analysis of the Fasciola hepatica and Fasciola gigantica specific mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear ribosomal internal transcribed spacer 2 (ITS-2). Among the 500 samples assessed, the presence of F. hepatica cox1 and 1TS-2 markers were detected in 2 samples, and F. hepatica contamination was confirmed by sequencing analysis. The nucleotide sequences of cox1 PCR products from the 2 F. hepatica-contaminated samples were 96.5% identical to the F. hepatica cox1 sequences in GenBank, whereas F. gigantica cox1 sequences were 46.8% similar with the sequence detected from the cox1 positive samples. However, F. gigantica cox1 and ITS-2 markers were not detected by PCR in the 500 samples of water dropwort. Collectively, in this survey of the water dropwort contamination with Fasciola species, very low prevalence of F. hepatica contamination was detected in the samples.

  11. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  12. Multilocus Sequence Analysis of Cercospora spp. from Different Host Plant Families

    Directory of Open Access Journals (Sweden)

    Floreta Fiska Yuliarni

    2014-06-01

    Full Text Available Identification of the genus Cercospora is still complicated due to the host preferences often being used as the main criteria to propose a new name. We determined the relationship between host plants and multilocus sequence variations (ITS rDNA including 5.8S rDNA, elongation factor 1-α, and calmodulin in Cercospora spp. to investigate the host specificity. We used 53 strains of Cercospora spp. infecting 12 plant families for phylogenetic analysis. The sequences of 23 strains of Cercospora spp. infecting the plant families of Asteraceae, Cucurbitaceae, and Solanaceae were determined in this study. The sequences of 30 strains of Cercospora spp. infecting the plant families of Fabaceae, Amaranthaceae, Apiaceae, Plumbaginaceae, Malvaceae, Cistaceae, Plantaginaceae, Lamiaceae, and Poaceae were obtained from GenBank. The molecular phylogenetic analysis revealed that the majority of Cercospora species lack host specificity, and only C. zinniicola, C. zeina, C. zeae-maydis, C. cocciniae, and C. mikaniicola were found to be host-specific. Closely related species of Cercospora could not be distinguished using molecular analyses of ITS, EF, and CAL gene regions. The topology of the phylogenetic tree based on the CAL gene showed a better topology and Cercospora species separation than the trees developed based on the ITS rDNA region or the EF gene.

  13. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    Science.gov (United States)

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  14. Comparing the potential for identification of lactobacillus spp. of 16s rDNA variable regions

    International Nuclear Information System (INIS)

    Riano Pachon, Diego Mauricio; Vanegas Lopez, Maria Consuelo; Gonzalez Garcia, Laura Natalia

    2013-01-01

    16s rDNA is used for bacterial identification because its variation rate between species allows differentiation. The gene for this ribosomal subunit has 9 variable regions and some of them give more information than others. We were interested in evaluating the potential for species identification of each region and their combinations. We extracted the V1 to V8 regions of 16s rDNA from different strains and species of Lactobacillus and analyzed them using STAP (ss-RNA Taxonomy Assigning Pipeline) and RDP (Ribosomal Database Project) multiclassifier packages. Phylogenetic trees obtained by maximum likelihood analyses were compared. Classification results show that many regions give the correct genus classification using RDP and STAP; however they are not enough to classify up to the level of species. V5V6 region presents the highest quantity of informative fragments but also present the highest rate of false negatives. V1V3 region presents the highest rate of true positives (species) using STAP and the region V5V8 in RDP (genus).The phylogenetic result shows that the reference topology could be obtained using different combination of regions as V1V3 and V1V8.The experimental validation was done using commercial strains from a probiotic tampon. Sequencing analysis show that the V1V3 region gives the same information and result as the complete 16s rDNA; the three isolated strains correspond to the strains indicated in the product. We conclude that the V1V3 region is the minimum required region to classify Lactobacillus spp. in the correct way and this region is useful in metagenomics to analyze probiotics samples.

  15. Ribosomal DNA intergenic spacer sequence in foxtail millet, Setaria italica (L.) P. Beauv. and its characterization and application to typing of foxtail millet landraces.

    Science.gov (United States)

    Fukunaga, Kenji; Ichitani, Katsuyuki; Taura, Satoru; Sato, Muneharu; Kawase, Makoto

    2005-02-01

    We determined the sequence of ribosomal DNA (rDNA) intergenic spacer (IGS) of foxtail millet isolated in our previous study, and identified subrepeats in the polymorphic region. We also developed a PCR-based method for identifying rDNA types based on sequence information and assessed 153 accessions of foxtail millet. Results were congruent with our previous works. This study provides new findings regarding the geographical distribution of rDNA variants. This new method facilitates analyses of numerous foxtail millet accessions. It is helpful for typing of foxtail millet germplasms and elucidating the evolution of this millet.

  16. Molecular Phylogeny of Triticum and Aegilops Genera Based on ITS and MATK Sequence Data

    International Nuclear Information System (INIS)

    Dizkirici, A.; Kansu, C.; Onde, S.

    2016-01-01

    Understanding the phylogenetic relationship between Triticum and Aegilops species, which form a vast gene pool of wheat, is very important for breeding new cultivated wheat varieties. In the present study, phylogenetic relationships between Triticum (12 samples from 4 species) and Aegilops (24 samples from 8 species) were investigated using sequences of the nuclear ITS rDNA gene and partial sequences of the matK gene of chloroplast genome. The phylogenetic relationships among species were reconstructed using Maximum Likelihood method. The constructed tree based on the sequences of the nuclear component (ITS) displayed a close relationship between polyploid wheats and Aegilops speltoides species which provided new evidence for the source of the enigmatic B genome donor as Ae. speltoides. Concurrent clustering of Ae. cylindrica and Ae. tauschii and their close positioning to polyploid wheats pointed the source of the D genome as one of these species. As reported before, diploid Triticum species (i.e. T. urartu) were identified as the A genome donors and the positioning of these diploid wheats on the constructed tree are meaningful. The constructed tree based on the chloroplastic matK sequences displayed same relationship between polyploid wheats and Ae. speltoides species providing evidence for the later species being the chloroplast donors for polyploid wheats. Therefore, our results supported the idea of coinheritance of nuclear and chloroplast genomes where Ae. speltoides was the maternal donor. For both trees the remaining Aegilops species produced a distinct cluster whereas with the exception of T. urartu, diploid Triticum species displayed a monophyletic structure. (author)

  17. Isolamento e caracterização parcial de sequências homólogas a genes ribossomais (rDNA em Blastocladiella emersonii - DOI: 10.4025/actascibiolsci.v25i2.2037 Isolation and partial characterization of homologous sequences of ribosomal genes (rDNA in Blastocladiella emersonii

    Directory of Open Access Journals (Sweden)

    Luiz Carlos Correa

    2003-04-01

    Full Text Available A definição e a caracterização de regiões de origens de replicação nos eucariotos superiores são ainda controversas. A iniciação da replicação é sítio-específica em alguns sistemas e, em outros, parece estar contida em regiões extensas. Regiões rDNA são modelos atrativos para o estudo de origens de replicação pela sua organização in tandem, reduzindo a área de estudo para o espaço restrito que codifica uma unidade de transcrição. Neste trabalho nós isolamos e caracterizamos parcialmente um clone que contém uma sequência ribossomal do fungo aquático Blastocladiella emersonii, Be97M20. Southern blots mostraram diversos sítios para enzimas de restrição Eco RI, HindIII e SalI. Northern blot de RNA total hibridado contra uma sonda feita com Be97M20 confirmou a sua homologia com o gene ribossomal 18S. A caracterização detalhada, incluindo o mapeamento de restrição completo, subclonagem, sequenciamento e análise em géis bidimensionais proverão informações adicionais importantes sobre a estrutura e dinâmica desta regiãoThe definition and the characterization of replication origins regions in higher eukaryotes are still controversial. The initiation of the replication is site-specific in some systems but seems to occur in large regions in others. Because of its in tandem organization, reducing the area to the restricted space that codifies an unit of transcription, rDNA regions are attractive models to study replication origins. In this work we isolated and started to characterize a clone that contains a ribosomal sequence from the aquatic fungus B. emersonii, Be97M20. Southern blots showed several sites for the restrition enzymes Eco RI, HindIII and SalI. A northern blot of total RNA, hybridized against a probe made from Be97M20, confirmed its homology with the ribosomal 18S gene. The detailed characterization, including complete restriction map, subcloning, sequence and analysis on bidimensional gels will

  18. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  19. Molecular phylogenetics of Floridosentis ward, 1953 (Acanthocephala: Neoechinorhynchidae) parasites of mullets (Osteichthyes) from Mexico, using 28S rDNA sequences.

    Science.gov (United States)

    Rosas-Valdez, Rogelio; Morrone, Juan J; García-Varela, Martín

    2012-08-01

    Species of Floridosentis (Acanthocephala) are common parasites of mullets (Mugil spp., Mugilidae) found in tropical marine and brackish water in the Americas. Floridosentis includes 2 species distributed in Mexico, i.e., Floridosentis pacifica, restricted to the Pacific Ocean near Salina Cruz, Oaxaca, and Floridosentis mugilis, distributed along the coast of the Pacific Ocean and the Gulf of Mexico. We sampled 18 populations of F. mugilis and F. pacifica (12 from the Pacific and 6 from the Gulf of Mexico) and sequenced a fragment of the rDNA large subunit to evaluate phylogenetic relationships of populations of Floridosentis spp. from Mexico. Species identification of museum specimens of F. mugilis from the Pacific Ocean was confirmed by examination of morphology traits. Phylogenetic trees inferred with maximum parsimony, maximum likelihood, and Bayesian inference indicate that Floridosentis is monophyletic comprising of 2 major well-supported clades, the first clade corresponding to F. mugilis from the Gulf of Mexico, and the second to F. pacifica from the Pacific Ocean. Genetic divergence between species ranged from 7.68 to 8.60%. Intraspecific divergence ranged from 0.14 to 0.86% for F. mugilis and from 1.72 to 4.49% for F. pacifica. Data obtained from diagnostic characters indicate that specimens from the Pacific Ocean in Mexico have differences in some traits among locations. These results are consistent with the phylogenetic hypothesis, indicating that F. pacifica is distributed in the Pacific Ocean in Mexico with 3 major lineages.

  20. Clinorotation influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

    The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

  1. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    A strain SH 2016, capable of producing xylanase, was isolated and identified as Aspergillus awamori, based on its physiological and biochemical characteristics as well as its ITS rDNA gene sequence analysis. A xylanase gene of 591 bp was cloned from this newly isolated A. awamori and the ORF sequence predicted a ...

  2. Identification and functional characterization of a novel bipartite nuclear localization sequence in ARID1A

    Energy Technology Data Exchange (ETDEWEB)

    Bateman, Nicholas W. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); The John P. Murtha Cancer Center, Walter Reed National Military Medical Center, 8901 Wisconsin Avenue, Bethesda 20889, MD (United States); Shoji, Yutaka [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids 49503, MI (United States); Conrads, Kelly A.; Stroop, Kevin D. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); Hamilton, Chad A. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); The John P. Murtha Cancer Center, Walter Reed National Military Medical Center, 8901 Wisconsin Avenue, Bethesda 20889, MD (United States); Gynecologic Oncology Service, Department of Obstetrics and Gynecology, Walter Reed National Military Medical Center, 8901 Wisconsin Ave, MD, Bethesda, 20889 (United States); Department of Obstetrics and Gynecology, Uniformed Services University of the Health Sciences, Bethesda 20814, MD (United States); Darcy, Kathleen M. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); The John P. Murtha Cancer Center, Walter Reed National Military Medical Center, 8901 Wisconsin Avenue, Bethesda 20889, MD (United States); Maxwell, George L. [Department of Obstetrics and Gynecology, Inova Fairfax Hospital, Falls Church, VA 22042 (United States); Risinger, John I. [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids 49503, MI (United States); and others

    2016-01-01

    AT-rich interactive domain-containing protein 1A (ARID1A) is a recently identified nuclear tumor suppressor frequently altered in solid tumor malignancies. We have identified a bipartite-like nuclear localization sequence (NLS) that contributes to nuclear import of ARID1A not previously described. We functionally confirm activity using GFP constructs fused with wild-type or mutant NLS sequences. We further show that cyto-nuclear localized, bipartite NLS mutant ARID1A exhibits greater stability than nuclear-localized, wild-type ARID1A. Identification of this undescribed functional NLS within ARID1A contributes vital insights to rationalize the impact of ARID1A missense mutations observed in patient tumors. - Highlights: • We have identified a bipartite nuclear localization sequence (NLS) in ARID1A. • Confirmation of the NLS was performed using GFP constructs. • NLS mutant ARID1A exhibits greater stability than wild-type ARID1A.

  3. Accident sequences simulated at the Juragua nuclear power plant

    International Nuclear Information System (INIS)

    Carbajo, J.J.

    1998-01-01

    Different hypothetical accident sequences have been simulated at Unit 1 of the Juragua nuclear power plant in Cuba, a plant with two VVER-440 V213 units under construction. The computer code MELCOR was employed for these simulations. The sequences simulated are: (1) a design-basis accident (DBA) large loss of coolant accident (LOCA) with the emergency core coolant system (ECCS) on, (2) a station blackout (SBO), (3) a small LOCA (SLOCA) concurrent with SBO, (4) a large LOCA (LLOCA) concurrent with SBO, and (5) a LLOCA concurrent with SBO and with the containment breached at time zero. Timings of important events and source term releases have been calculated for the different sequences analyzed. Under certain weather conditions, the fission products released from the severe accident sequences may travel to southern Florida

  4. Complex programmable logic device based alarm sequencer for nuclear power plants

    International Nuclear Information System (INIS)

    Khedkar, Ravindra; Solomon, J. Selva; KrishnaKumar, B.

    2001-01-01

    Complex Programmable Logic Device based Alarm Sequencer is an instrument, which detects alarms, memorizes them and displays the sequences of occurrence of alarms. It caters to sixteen alarm signals and distinguishes the sequence among any two alarms with a time resolution of 1 ms. The system described has been designed for continuous operation in process plants, nuclear power plants etc. The system has been tested and found to be working satisfactorily. (author)

  5. Interactions of rat repetitive sequence MspI8 with nuclear matrix proteins during spermatogenesis

    International Nuclear Information System (INIS)

    Rogolinski, J.; Widlak, P.; Rzeszowska-Wolny, J.

    1996-01-01

    Using the Southwestern blot analysis we have studied the interactions between rat repetitive sequence MspI8 and the nuclear matrix proteins of rats testis cells. Starting from 2 weeks the young to adult animal showed differences in type of testis nuclear matrix proteins recognizing the MspI8 sequence. The same sets of nuclear matrix proteins were detected in some enriched in spermatocytes and spermatids and obtained after fractionation of cells of adult animal by the velocity sedimentation technique. (author). 21 refs, 5 figs

  6. Similar patterns of rDNA evolution in synthetic and recently formed natural populations of Tragopogon (Asteraceae allotetraploids

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2010-09-01

    Full Text Available Abstract Background Tragopogon mirus and T. miscellus are allotetraploids (2n = 24 that formed repeatedly during the past 80 years in eastern Washington and adjacent Idaho (USA following the introduction of the diploids T. dubius, T. porrifolius, and T. pratensis (2n = 12 from Europe. In most natural populations of T. mirus and T. miscellus, there are far fewer 35S rRNA genes (rDNA of T. dubius than there are of the other diploid parent (T. porrifolius or T. pratensis. We studied the inheritance of parental rDNA loci in allotetraploids resynthesized from diploid accessions. We investigate the dynamics and directionality of these rDNA losses, as well as the contribution of gene copy number variation in the parental diploids to rDNA variation in the derived tetraploids. Results Using Southern blot hybridization and fluorescent in situ hybridization (FISH, we analyzed copy numbers and distribution of these highly reiterated genes in seven lines of synthetic T. mirus (110 individuals and four lines of synthetic T. miscellus (71 individuals. Variation among diploid parents accounted for most of the observed gene imbalances detected in F1 hybrids but cannot explain frequent deviations from repeat additivity seen in the allotetraploid lines. Polyploid lineages involving the same diploid parents differed in rDNA genotype, indicating that conditions immediately following genome doubling are crucial for rDNA changes. About 19% of the resynthesized allotetraploid individuals had equal rDNA contributions from the diploid parents, 74% were skewed towards either T. porrifolius or T. pratensis-type units, and only 7% had more rDNA copies of T. dubius-origin compared to the other two parents. Similar genotype frequencies were observed among natural populations. Despite directional reduction of units, the additivity of 35S rDNA locus number is maintained in 82% of the synthetic lines and in all natural allotetraploids. Conclusions Uniparental reductions of

  7. Molecular characterization of the rDNA-ITS sequence and a PCR diagnostic technique for Pileolaria terebinthi, the cause of pistachio rust

    Directory of Open Access Journals (Sweden)

    Hossein ALAEI

    2013-01-01

    Full Text Available Eleven samples of the most important pistachio rust (caused by Pileolaria terebinthi (DC. Cast.,, which causes disease on Beneh (Pistacia atlantica Desf. subsp. mutica (Fisch. & Mey. Rech. F and Kasoor (Pistacia khinjuk Stocks., were collected from herbarium specimens and pistachio fields at the Pistachio Research Institute in Rafsanjan, Iran. The complete sequences of ribosomal DNA internal transcribed spacers ITS1 and ITS2 (rDNA ITS from the samples were determined and analysed. In general, very little rDNA ITS sequence variation was observed between rDNA ITS sequences of P. terebinthi samples. The length of the PCR fragments was 621 bp (for ITS1F-ITS4 and 1177 bp (for ITS1F-rust1, and consisted of 67 bp at the 3 ́ end of 18S rDNA, 93 bp of ITS1 region, 154 bp of 5.8S rDNA, 246 bp of the ITS2 region, 57 bp (for ITS1F-ITS4 and 613 bp (for ITS1F-rust1 at the 5 ́ end of the 28S rDNA. Restriction fragment length polymorphisms (RFLPs of the rDNA-ITS region were used to identify Pileolaria terebinthi. Three strong bands of 105, 134 and 381 bp and five bands of 105, 134, 200, 301 and 437 bp are observed for the fragment of “ITS1F-ITS4” and “ITS1F-rust1”, respectively. A PCR-RFLP diagnostic technique provided effective identification of the species by a unique pattern with the specific restriction enzyme XapI (ApoI.

  8. Molecular and phylogenetic characterizations of an Eimeria krijgsmanni Yakimoff & Gouseff, 1938 (Apicomplexa: Eimeriidae) mouse intestinal protozoan parasite by partial 18S ribosomal RNA gene sequence analysis.

    Science.gov (United States)

    Takeo, Toshinori; Tanaka, Tetsuya; Matsubayashi, Makoto; Maeda, Hiroki; Kusakisako, Kodai; Matsui, Toshihiro; Mochizuki, Masami; Matsuo, Tomohide

    2014-08-01

    Previously, we characterized an undocumented strain of Eimeria krijgsmanni by morphological and biological features. Here, we present a detailed molecular phylogenetic analysis of this organism. Namely, 18S ribosomal RNA gene (rDNA) sequences of E. krijgsmanni were analyzed to incorporate this species into a comprehensive Eimeria phylogeny. As a result, partial 18S rDNA sequence from E. krijgsmanni was successfully determined, and two different types, Type A and Type B, that differed by 1 base pair were identified. E. krijgsmanni was originally isolated from a single oocyst, and thus the result show that the two types might have allelic sequence heterogeneity in the 18S rDNA. Based on phylogenetic analyses, the two types of E. krijgsmanni 18S rDNA formed one of two clades among murine Eimeria spp.; these Eimeria clades reflected morphological similarity among the Eimeria spp. This is the third molecular phylogenetic characterization of a murine Eimeria spp. in addition to E. falciformis and E. papillata. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  9. Revisiting the phylogeny of Ocellularieae, the second largest tribe within Graphidaceae (lichenized Ascomycota: Ostropales)

    Science.gov (United States)

    Ekaphan Kraichak; Sittiporn Parnmen; Robert Lücking; Eimy Rivas Plata; Andre Aptroot; Marcela E.S. Caceres; Damien Ertz; Armin Mangold; Joel A. Mercado-Diaz; Khwanruan Papong; Dries Van der Broeck; Gothamie Weerakoon; H. Thorsten. Lumbsch; NO-VALUE

    2014-01-01

    We present an updated 3-locus molecular phylogeny of tribe Ocellularieae, the second largest tribe within subfamily Graphidoideae in the Graphidaceae. Adding 165 newly generated sequences from the mitochondrial small subunit rDNA (mtSSU), the nuclear large subunit rDNA (nuLSU), and the second largest subunit of the DNA-directed RNA polymerase II (RPB2), we currently...

  10. Gyrodiniellum shiwhaense n. gen., n. sp., a new planktonic heterotrophic dinoflagellate from the coastal waters of western Korea: morphology and ribosomal DNA gene sequence.

    Science.gov (United States)

    Kang, Nam Seon; Jeong, Hae Jin; Moestrup, Ojvind; Park, Tae Gyu

    2011-01-01

    The heterotrophic dinoflagellate Gyrodiniellum shiwhaense n. gen., n. sp. is described from live cells and from cells prepared for light, scanning electron, and transmission electron microscopy. Also, sequences of the small subunit (SSU) and large subunit (LSU) of rDNA have been analyzed. The episome is conical, while the hyposome is ellipsoid. Cells are covered with polygonal amphiesmal vesicles arranged in 16 horizontal rows. Unlike other Gyrodinium-like dinoflagellates, the apical end of the cell shows a loop-shaped row of five elongate amphiesmal vesicles. The cingulum is displaced by 0.3-0.5 × cell length. Cells that were feeding on the dinoflagellate Amphidinium carterae Hulburt were 9.1-21.6 μm long and 6.6-15.7 μm wide. Cells of G. shiwhaense contain nematocysts, trichocysts, a peduncle, and pusule systems, but they lack chloroplasts. The SSU rDNA sequence is >3% different from that of the six most closely related species: Warnowia sp. (FJ947040), Lepidodinium viride Watanabe, Suda, Inouye, Sawaguchi & Chihara, Gymnodinium aureolum (Hulburt) Hansen, Gymnodinium catenatum Graham, Nematodinium sp. (FJ947039), and Gymnodinium sp. MUCC284 (AF022196), while the LSU rDNA is 11-12% different from that of Warnowia sp., G. aureolum, and Nematodinium sp. (FJ947041). The phylogenetic trees show that the species belongs in the Gymnodinium sensu stricto clade. However, in contrast to Gymnodinium spp., cells lack nuclear envelope chambers and a nuclear fibrous connective. Unlike Polykrikos spp., cells of which possess a taeniocyst-nematocyst complex, G. shiwhaense has nematocysts but lacks taeniocysts. It differs from Paragymnodinium shiwhaense Kang, Jeong, Moestrup & Shin by possessing nematocysts with stylets and filaments. Gyrodiniellum shiwhaense n. gen., n. sp. furthermore lacks ocelloids, in contrast to Warnowia spp., Nematodinium spp., and Proterythropsis spp. Based on morphological and molecular data, we suggest that the taxon represents a new species within a

  11. Close sequence identity between ribosomal DNA episomes of the ...

    Indian Academy of Sciences (India)

    Unknown

    The restriction map of the E. dispar rDNA circle showed close simi- larity to EhR1 .... for 30 cycles in a DNA Thermal cycler (MJ Research,. USA). 3. .... by asterisk. The gaps show the variation between E. dispar and E. histolytica sequences.

  12. Chromosomal distribution of pTa-535, pTa-86, pTa-713, 35S rDNA repetitive sequences in interspecific hexaploid hybrids of common wheat (Triticum aestivum L. and spelt (Triticum spelta L..

    Directory of Open Access Journals (Sweden)

    Klaudia Goriewa-Duba

    Full Text Available Fluorescent in situ hybridization (FISH relies on fluorescent-labeled probes to detect specific DNA sequences in the genome, and it is widely used in cytogenetic analyses. The aim of this study was to determine the karyotype of T. aestivum and T. spelta hybrids and their parental components (three common wheat cultivars and five spelt breeding lines, to identify chromosomal aberrations in the evaluated wheat lines, and to analyze the distribution of polymorphisms of repetitive sequences in the examined hybrids. The FISH procedure was carried out with four DNA clones, pTa-86, pTa-535, pTa-713 and 35S rDNA used as probes. The observed polymorphisms between the investigated lines of common wheat, spelt and their hybrids was relatively low. However, differences were observed in the distribution of repetitive sequences on chromosomes 4A, 6A, 1B and 6B in selected hybrid genomes. The polymorphisms observed in common wheat and spelt hybrids carry valuable information for wheat breeders. The results of our study are also a valuable source of knowledge about genome organization and diversification in common wheat, spelt and their hybrids. The relevant information is essential for common wheat breeders, and it can contribute to breeding programs aimed at biodiversity preservation.

  13. Chromosomal distribution of pTa-535, pTa-86, pTa-713, 35S rDNA repetitive sequences in interspecific hexaploid hybrids of common wheat (Triticum aestivum L.) and spelt (Triticum spelta L.).

    Science.gov (United States)

    Goriewa-Duba, Klaudia; Duba, Adrian; Kwiatek, Michał; Wiśniewska, Halina; Wachowska, Urszula; Wiwart, Marian

    2018-01-01

    Fluorescent in situ hybridization (FISH) relies on fluorescent-labeled probes to detect specific DNA sequences in the genome, and it is widely used in cytogenetic analyses. The aim of this study was to determine the karyotype of T. aestivum and T. spelta hybrids and their parental components (three common wheat cultivars and five spelt breeding lines), to identify chromosomal aberrations in the evaluated wheat lines, and to analyze the distribution of polymorphisms of repetitive sequences in the examined hybrids. The FISH procedure was carried out with four DNA clones, pTa-86, pTa-535, pTa-713 and 35S rDNA used as probes. The observed polymorphisms between the investigated lines of common wheat, spelt and their hybrids was relatively low. However, differences were observed in the distribution of repetitive sequences on chromosomes 4A, 6A, 1B and 6B in selected hybrid genomes. The polymorphisms observed in common wheat and spelt hybrids carry valuable information for wheat breeders. The results of our study are also a valuable source of knowledge about genome organization and diversification in common wheat, spelt and their hybrids. The relevant information is essential for common wheat breeders, and it can contribute to breeding programs aimed at biodiversity preservation.

  14. Chromosomal localization of two novel repetitive sequences isolated from the Chenopodium quinoa Willd. genome.

    Science.gov (United States)

    Kolano, B; Gardunia, B W; Michalska, M; Bonifacio, A; Fairbanks, D; Maughan, P J; Coleman, C E; Stevens, M R; Jellen, E N; Maluszynska, J

    2011-09-01

    The chromosomal organization of two novel repetitive DNA sequences isolated from the Chenopodium quinoa Willd. genome was analyzed across the genomes of selected Chenopodium species. Fluorescence in situ hybridization (FISH) analysis with the repetitive DNA clone 18-24J in the closely related allotetraploids C. quinoa and Chenopodium berlandieri Moq. (2n = 4x = 36) evidenced hybridization signals that were mainly present on 18 chromosomes; however, in the allohexaploid Chenopodium album L. (2n = 6x = 54), cross-hybridization was observed on all of the chromosomes. In situ hybridization with rRNA gene probes indicated that during the evolution of polyploidy, the chenopods lost some of their rDNA loci. Reprobing with rDNA indicated that in the subgenome labeled with 18-24J, one 35S rRNA locus and at least half of the 5S rDNA loci were present. A second analyzed sequence, 12-13P, localized exclusively in pericentromeric regions of each chromosome of C. quinoa and related species. The intensity of the FISH signals differed considerably among chromosomes. The pattern observed on C. quinoa chromosomes after FISH with 12-13P was very similar to GISH results, suggesting that the 12-13P sequence constitutes a major part of the repetitive DNA of C. quinoa.

  15. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    NARCIS (Netherlands)

    Warmerdam, Daniel O.; van den Berg, Jeroen; Medema, Rene H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded

  16. [18S-25S rDNA variation in tissue culture of some Gentiana L. species].

    Science.gov (United States)

    Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A

    2007-01-01

    18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

  17. Relationships within the Proteobacteria of plant pathogenic Acidovorax species and subspecies, Burkholderia species, and Herbaspirillum rubrisubalbicans by sequence analysis of 16S rDNA, numerical analysis and determinative tests.

    Science.gov (United States)

    Hu, F P; Young, J M; Triggs, C M; Park, D C; Saul, D J

    2001-12-01

    Sequence data for 16S rDNA of the type strains of Acidovorax avenae subsp. avenae, A. avenae subsp. cattleyae, A. avenae subsp. citrulli, A. konjaci and Herbaspirillum rubrisubalbicans were compared with GenBank library accessions of Burkholderia spp., Comamonas sp., Ralstonia solanacearum and Variovorax sp. Maximum Parsimony analysis produced two clusters: 1. Acidovorax spp., Comamonas sp., and Variovorax sp. (all in the Comamonadaceae), and 2. Burkholderia spp., Ralstonia solanacearum, and Herbaspirillum rubrisubalbicans. Maximum Likelihood analysis produced only one cluster (of the Comamonadaceae). Using nutritional and laboratory tests, all Acidovorax spp., Burkholderia spp., and Herbaspirillum rubrisubalbicans were discriminated in distinct clusters at the species level, and could be identified by selected determinative tests. There were no phenotypic tests constituted as a circumscription of the genera and which permitted the allocation of strains to genera. Strain identification as species allowed allocation to genera only by inference. The nomenclatural implications of these data are discussed.

  18. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    Directory of Open Access Journals (Sweden)

    Hong Long

    Full Text Available The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.

  19. The formation of diploid and triploid hybrids of female grass carp × male blunt snout bream and their 5S rDNA analysis.

    Science.gov (United States)

    He, Weiguo; Xie, Lihua; Li, Tangluo; Liu, Shaojun; Xiao, Jun; Hu, Jie; Wang, Jing; Qin, Qinbo; Liu, Yun

    2013-11-23

    Hybridization is a useful strategy to alter the genotypes and phenotypes of the offspring. It could transfer the genome of one species to another through combing the different genome of parents in the hybrid offspring. And the offspring may exhibit advantages in growth rate, disease resistance, survival rate and appearance, which resulting from the combination of the beneficial traits from both parents. Diploid and triploid hybrids of female grass carp (Ctenopharyngodon idellus, GC, Cyprininae, 2n = 48) × male blunt snout bream (Megalobrama amblycephala, BSB, Cultrinae, 2n = 48) were successfully obtained by distant hybridization. Diploid hybrids had 48 chromosomes, with one set from GC and one set from BSB. Triploid hybrids possessed 72 chromosomes, with two sets from GC and one set from BSB.The morphological traits, growth rates, and feeding ecology of the parents and hybrid offspring were compared and analyzed. The two kinds of hybrid offspring exhibited significantly phenotypic divergence from GC and BSB. 2nGB hybrids showed similar growth rate compared to that of GC, and 3nGB hybrids significantly higher results. Furthermore, the feeding ecology of hybrid progeny was omnivorous.The 5S rDNA of GC, BSB and their hybrid offspring were also cloned and sequenced. There was only one type of 5S rDNA (designated type I: 180 bp) in GC and one type of 5S rDNA (designated type II: 188 bp) in BSB. However, in the hybrid progeny, diploid and triploid hybrids both inherited type I and type II from their parents, respectively. In addition, a chimera of type I and type II was observed in the genome of diploid and triploid hybrids, excepting a 10 bp of polyA insertion in type II sequence of the chimera of the diploid hybrids. This is the first report of diploid and triploid hybrids being produced by crossing GC and BSB, which have the same chromosome number. The obtainment of two new hybrid offspring has significance in fish genetic breeding. The results illustrate the effect

  20. An apparent Acanthamoeba genotype is the product of a chimeric 18S rDNA artifact.

    Science.gov (United States)

    Corsaro, Daniele; Venditti, Danielle

    2018-02-01

    Free-living amoebae of the genus Acanthamoeba are potentially pathogenic protozoa widespread in the environment. The detection/diagnosis as well as environmental survey strategies is mainly based on the identification of the 18S rDNA sequences of the strains that allow the recovery of various distinct genotypes/subgenotypes. The accurate recording of such data is important to better know the environmental distribution of distinct genotypes and how they may be preferentially associated with disease. Recently, a putative new acanthamoebal genotype T99 was introduced, which comprises only environmental clones apparently with some anomalous features. Here, we analyze these sequences through partial treeing and BLAST analyses and find that they are actually chimeras. Our results show that the putative T99 genotype is very likely formed by chimeric sequences including a middle fragment from acanthamoebae of genotype T13, while the 5'- and 3'-end fragments came from a nematode and a cercozoan, respectively. Molecular phylogenies of Acanthamoeba including T99 are consequently erroneous as genotype T99 does not exist in nature. Careful identification of Acanthamoeba genotypes is therefore critical for both phylogenetic and diagnostic applications.

  1. Reassignment of the land tortoise haemogregarine Haemogregarina fitzsimonsi Dias 1953 (Adeleorina: Haemogregarinidae) to the genus Hepatozoon Miller 1908 (Adeleorina: Hepatozoidae) based on parasite morphology, life cycle and phylogenetic analysis of 18S rDNA sequence fragments.

    Science.gov (United States)

    Cook, Courtney A; Lawton, Scott P; Davies, Angela J; Smit, Nico J

    2014-06-13

    SUMMARY Research was undertaken to clarify the true taxonomic position of the terrestrial tortoise apicomplexan, Haemogregarina fitzsimonsi (Dias, 1953). Thin blood films were screened from 275 wild and captive South African tortoises of 6 genera and 10 species between 2009-2011. Apicomplexan parasites within films were identified, with a focus on H. fitzsimonsi. Ticks from wild tortoises, especially Amblyomma sylvaticum and Amblyomma marmoreum were also screened, and sporogonic stages were identified on dissection of adult ticks of both species taken from H. fitzsimonsi infected and apparently non-infected tortoises. Parasite DNA was extracted from fixed, Giemsa-stained tortoise blood films and from both fresh and fixed ticks, and PCR was undertaken with two primer sets, HEMO1/HEMO2, and HepF300/HepR900, to amplify parasite 18S rDNA. Results indicated that apicomplexan DNA extracted from tortoise blood films and both species of tick had been amplified by one or both primer sets. Haemogregarina  fitzsimonsi 18S rDNA sequences from tortoise blood aligned with those of species of Hepatozoon, rather than those of species of Haemogregarina or Hemolivia. It is recommended therefore that this haemogregarine be re-assigned to the genus Hepatozoon, making Hepatozoon fitzsimonsi (Dias, 1953) the only Hepatozoon known currently from any terrestrial chelonian. Ticks are its likely vectors.

  2. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  3. Comparative d2/d3 LSU–rDNA sequence study of some Iranian ...

    African Journals Online (AJOL)

    SERVER

    2007-11-05

    Nov 5, 2007 ... segments yielded one fragment at over all sequenced isolates as 787 bp in size. The DNA sequences were aligned .... expansion segments of the 28S rDNA subunit (D2/D3. LSU-rDNA) are the ... isolated from different geographical location from tea shrubs infested roots of Guilan province, Iran (Table 1).

  4. Trichostrongylus colubriformis rDNA polymorphism associated with arrested development

    Czech Academy of Sciences Publication Activity Database

    Langrová, I.; Zouhar, M.; Vadlejch, J.; Borovský, M.; Jankovská, I.; Lytvynets, Andrej

    2008-01-01

    Roč. 103, č. 2 (2008), s. 401-403 ISSN 0932-0113 Institutional research plan: CEZ:AV0Z50110509 Keywords : arrested development * polymorphism * rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.473, year: 2008

  5. The RTR Complex Partner RMI2 and the DNA Helicase RTEL1 Are Both Independently Involved in Preserving the Stability of 45S rDNA Repeats in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Sarah Röhrig

    2016-10-01

    Full Text Available The stability of repetitive sequences in complex eukaryotic genomes is safeguarded by factors suppressing homologues recombination. Prominent in this is the role of the RTR complex. In plants, it consists of the RecQ helicase RECQ4A, the topoisomerase TOP3α and RMI1. Like mammals, but not yeast, plants harbor an additional complex partner, RMI2. Here, we demonstrate that, in Arabidopsis thaliana, RMI2 is involved in the repair of aberrant replication intermediates in root meristems as well as in intrastrand crosslink repair. In both instances, RMI2 is involved independently of the DNA helicase RTEL1. Surprisingly, simultaneous loss of RMI2 and RTEL1 leads to loss of male fertility. As both the RTR complex and RTEL1 are involved in suppression of homologous recombination (HR, we tested the efficiency of HR in the double mutant rmi2-2 rtel1-1 and found a synergistic enhancement (80-fold. Searching for natural target sequences we found that RTEL1 is required for stabilizing 45S rDNA repeats. In the double mutant with rmi2-2 the number of 45S rDNA repeats is further decreased sustaining independent roles of both factors in this process. Thus, loss of suppression of HR does not only lead to a destabilization of rDNA repeats but might be especially deleterious for tissues undergoing multiple cell divisions such as the male germline.

  6. The RTR Complex Partner RMI2 and the DNA Helicase RTEL1 Are Both Independently Involved in Preserving the Stability of 45S rDNA Repeats in Arabidopsis thaliana.

    Science.gov (United States)

    Röhrig, Sarah; Schröpfer, Susan; Knoll, Alexander; Puchta, Holger

    2016-10-01

    The stability of repetitive sequences in complex eukaryotic genomes is safeguarded by factors suppressing homologues recombination. Prominent in this is the role of the RTR complex. In plants, it consists of the RecQ helicase RECQ4A, the topoisomerase TOP3α and RMI1. Like mammals, but not yeast, plants harbor an additional complex partner, RMI2. Here, we demonstrate that, in Arabidopsis thaliana, RMI2 is involved in the repair of aberrant replication intermediates in root meristems as well as in intrastrand crosslink repair. In both instances, RMI2 is involved independently of the DNA helicase RTEL1. Surprisingly, simultaneous loss of RMI2 and RTEL1 leads to loss of male fertility. As both the RTR complex and RTEL1 are involved in suppression of homologous recombination (HR), we tested the efficiency of HR in the double mutant rmi2-2 rtel1-1 and found a synergistic enhancement (80-fold). Searching for natural target sequences we found that RTEL1 is required for stabilizing 45S rDNA repeats. In the double mutant with rmi2-2 the number of 45S rDNA repeats is further decreased sustaining independent roles of both factors in this process. Thus, loss of suppression of HR does not only lead to a destabilization of rDNA repeats but might be especially deleterious for tissues undergoing multiple cell divisions such as the male germline.

  7. Biofouling on austenitic stainless steels in spent nuclear fuel pools

    Energy Technology Data Exchange (ETDEWEB)

    Sarro, M I; Moreno, D A; Chicote, E; Lorenzo, P I; Garcia, A M [Universidad Politecnica de Madrid, Departamento de Ingenieria y Ciencia de los Materiales, Escuela Tecnica Superior de Ingenieros Industriales, Jose Gutierrez Abascal, 2, E-28006 Madrid (Spain); Montero, F [Iberdrola Generacion, S.A., y C.M.D.S., Centro de Tecnologia de Materiales, Paseo de la Virgen del Puerto, 53, E-28005 Madrid (Spain)

    2003-07-01

    The objective of this study was to investigate the biofilm formation on three different types of austenitic stainless steel (UNS S30400, S30466 and S31600) submerged in a spent nuclear fuel pool. The presence of microorganisms in coupons was characterised using standard culture microbiological methods, microscopic techniques (epifluorescence microscopy and scanning electron microscopy), and molecular biology techniques (denaturing gradient gel electrophoresis and sequencing fragments of 16S rDNA). The microscopy techniques showed signs of colonisation of stainless steels in spite of these extreme conditions. Based on sequencing of cultured microorganisms, different bacteria belonging to {alpha}, {beta}, {gamma}-Proteobacteria, Bacilli, and Actinobacteria classes have been identified. The biofilm radioactivity was measured using gamma-ray spectrometry and, according to the data gathered, the radionuclides present in the water pool were entrapped in the biofilm increasing the amount of radiation at the surface of the different materials. (Abstract Copyright [2003], Wiley Periodicals, Inc.)

  8. Biofouling on austenitic stainless steels in spent nuclear fuel pools

    International Nuclear Information System (INIS)

    Sarro, M.I.; Moreno, D.A.; Chicote, E.; Lorenzo, P.I.; Garcia, A.M.; Montero, F.

    2003-01-01

    The objective of this study was to investigate the biofilm formation on three different types of austenitic stainless steel (UNS S30400, S30466 and S31600) submerged in a spent nuclear fuel pool. The presence of microorganisms in coupons was characterised using standard culture microbiological methods, microscopic techniques (epifluorescence microscopy and scanning electron microscopy), and molecular biology techniques (denaturing gradient gel electrophoresis and sequencing fragments of 16S rDNA). The microscopy techniques showed signs of colonisation of stainless steels in spite of these extreme conditions. Based on sequencing of cultured microorganisms, different bacteria belonging to α, β, γ-Proteobacteria, Bacilli, and Actinobacteria classes have been identified. The biofilm radioactivity was measured using gamma-ray spectrometry and, according to the data gathered, the radionuclides present in the water pool were entrapped in the biofilm increasing the amount of radiation at the surface of the different materials. (Abstract Copyright [2003], Wiley Periodicals, Inc.)

  9. The sequence coding and search system: an approach for constructing and analyzing event sequences at commercial nuclear power plants

    International Nuclear Information System (INIS)

    Mays, G.T.

    1990-01-01

    The U.S. Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedback of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrence of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objectives of SCSS, the information it contains, and the format and approach for constructing SCSS event sequences. Examples are presented demonstrating the use of SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted. Considerable experience has been gained in the areas of evolving and changing data requirements, staffing requirements, and quality control and quality assurance procedures for addressing consistency, software/hardware considerations for developing and maintaining a complex system, documentation requirements, and end-user needs. Two other approaches for constructing and evaluating event sequences are examined including the Accident Precursor Program (ASP) where sequences having the potential for core damage are identified and analyzed, and the Significant Event Compilation Tree

  10. Detection of mucormycetes and other pathogenic fungi in formalin fixed paraffin embedded and fresh tissues using the extended region of 28S rDNA.

    Science.gov (United States)

    Gade, Lalitha; Hurst, Steven; Balajee, S Arunmozhi; Lockhart, Shawn R; Litvintseva, Anastasia P

    2017-06-01

    Molecular methods of detection based on DNA-sequencing of the internal transcribed spacer 1 and 2 (ITS1 and ITS2) or 5΄ end region of 28S (D1-D2 region) of ribosomal RNA gene (rDNA) have been used extensively for molecular identification and detection of fungal infections. However, these regions are not always informative for identification of mucormycetes and other rare fungal pathogens as they often contain large introns, heterogenic regions, and/or cannot be PCR-amplified using broad range fungal PCR primers. In addition, because of the difficulties of recovering intact fungal DNA from human specimens, smaller regions of DNA are more useful for the direct detection of fungal DNA in tissues and fluids. In this study, we investigated the utility of 12F/13R PCR primers targeting a 200-230 bp region of the extended 28S region of rDNA for molecular identification of fungal DNA in formalin fixed paraffin embedded tissues and other clinical specimens. We demonstrated that this region can be successfully used for identification of all genera and some species of clinically relevant mucormycetes, as well as other medically important fungi, such as Aspergillus, Fusarium, Coccidioides, and Cryptococcus. We also demonstrated that PCR amplification and direct sequencing of the extended 28S region of rDNA was more sensitive compared to targeting the ITS2 region, as we were able to detect and identify mucormycetes and other fungal pathogens in tissues from patients with histopathological and/or culture evidence of fungal infections that were negative with PCR using ITS-specific primers. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  11. Molecular Characterization of Fasciola Samples Using Sequences of Second Internal Transcribed Spacer-rDNA in Different Geographical Localities of Sistan and Balouchestan Province, Iran

    Directory of Open Access Journals (Sweden)

    Mahsa Shahbakhsh

    2016-02-01

    Full Text Available Background: The Fasciola trematodes are the most common liver flukes, living in a range of animals with global distribution and resulting in profound economic loss and public health challenges. Previous studies have indicated that the sequences of the second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA provide reliable genetic markers for molecular systemic studies of Fasciola. Objectives: The objective of the present study was to characterize Fasciola samples from different geographical regions of Sistan and Balouchestan province using sequences of second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA. Materials and Methods: Twenty adult trematodes were collected from the livers of slaughtered infected cattle. Total genomic DNA was extracted and ITS-2 rDNA targets were amplified by polymerase chain reaction (PCR. All samples were sequenced and investigated using the ClustalW2 sequence alignment tool and MEGA software. The sequences of some Iranian and non-Iranian isolates were used for comparison, in order to evaluate the variation in sequence homology between geographically different trematode populations. Results: The results of comparing the ITS-2 sequences with the BLAST GenBank database showed one type of sequence for F. hepatica and three different types of sequences for F. gigantica in the specimens. Conclusions: The present study demonstrated that Fasciola samples from cattle in two geographical locations in Sistan and Balouchestan province represented no genetic diversity in F. hepatica and high genetic variation in F. gigantica.

  12. Sequence comparison of the rDNA introns from six different species of Tetrahymena

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engberg, J

    1985-01-01

    model for the intron RNA of Cech et al. (Proc. Natl. Acad. Sci. U.S.A. 80, 3903 (83)). Most of the sequence variation in the four new sequences reported here is found in single stranded loops in the model. However, in four cases we found nucleotide substitutions in duplex stem regions, two of them...

  13. Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

    Science.gov (United States)

    Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

    2016-01-01

    Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

  14. Molecular profiling of microbial communities from contaminated sources: Use of subtractive cloning methods and rDNA spacer sequences. 1998 annual progress report

    International Nuclear Information System (INIS)

    Robb, F.T.

    1998-01-01

    'The major objective of the research is to provide appropriate sequences and to assemble a high-density DNA array of oligonucleotides that can be used for rapid profiling of microbial populations from polluted areas. The sequences to be assigned to the DNA array are chosen from from cloned genomic DNA sequences (the ribosomal operon, described below) from groundwater at DOE sites containing organic solvents. The sites, Hanford Nuclear Plant and Lawrence Livermore Site 300, have well characterized pollutant histories, which have been provided by the collaborators. At this mid-point of the project, over 60 unique sequence classes of intergenic spacer region have been identified from the first sample site. The use of these sequences as hybridization probes, and their frequency of occurrence, allow a clear distinction between bacterial communities before and after remediation by acetate/nitrate pumping. The authors have developed the hybridization conditions for identifying PCR products in a 96 well format, a versatile alignment and visualization program (acronym: MALIGN) developed by Dr. Dennis Maeder, has been used to align the ISRs, which are variable in length and sometimes in position of the tRNAs. Finally, in collaboration with Dr. W. Chen and Dr. J. Zhou at ORNL, they have significant evidence that mass spectrometer analysis can be used to determine the lengths of PCR amplified intergenic spacer DNA.'

  15. The occurrence of Toxocara malaysiensis in cats in China, confirmed by sequence-based analyses of ribosomal DNA.

    Science.gov (United States)

    Li, Ming-Wei; Zhu, Xing-Quan; Gasser, Robin B; Lin, Rui-Qing; Sani, Rehana A; Lun, Zhao-Rong; Jacobs, Dennis E

    2006-10-01

    Non-isotopic polymerase chain reaction (PCR)-based single-strand conformation polymorphism and sequence analyses of the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) were utilized to genetically characterise ascaridoids from dogs and cats from China by comparison with those from other countries. The study showed that Toxocara canis, Toxocara cati, and Toxascaris leonina from China were genetically the same as those from other geographical origins. Specimens from cats from Guangzhou, China, which were morphologically consistent with Toxocara malaysiensis, were the same genetically as those from Malaysia, with the exception of a polymorphism in the ITS-2 but no unequivocal sequence difference. This is the first report of T. malaysiensis in cats outside of Malaysia (from where it was originally described), supporting the proposal that this species has a broader geographical distribution. The molecular approach employed provides a powerful tool for elucidating the biology, epidemiology, and zoonotic significance of T. malaysiensis.

  16. A populational survey of 45S rDNA polymorphism in the Jefferson salamander Ambystoma jeffersonianum revealed by fluorescence in situ hybridization (FISH

    Directory of Open Access Journals (Sweden)

    Jinzhong FU

    2009-04-01

    Full Text Available The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA. Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution.

  17. Multiple group I introns in the small-subunit rDNA of Botryosphaeria dothidea: implication for intraspecific genetic diversity.

    Directory of Open Access Journals (Sweden)

    Chao Xu

    Full Text Available Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU ribosomal DNA (rDNA sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF for encoding the homing endonuclease (HE, whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron and genotype IV (Bdo.S1199-B were each found in only one strain, whereas genotype I (Bdo.S1199-A and genotype II (Bdo.S943 and Bdo.S1506 occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea.

  18. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.

    Directory of Open Access Journals (Sweden)

    Haishan Wang

    Full Text Available We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82% and two rare types 2n = 36 = 11M + 7SM (14% and 2n = 36 = 10M + 7SM + 1ST (4%. The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies.

  19. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya

    Science.gov (United States)

    Azwai, S.M.; Alfallani, E.A.; Abolghait, S.K.; Garbaj, A.M.; Naas, H.T.; Moawad, A.A.; Gammoudi, F.T.; Rayes, H.M.; Barbieri, I.; Eldaghayes, I.M.

    2016-01-01

    The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×104 CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×104 CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products. PMID:27004169

  20. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya

    Directory of Open Access Journals (Sweden)

    S.M. Azwai

    2016-03-01

    Full Text Available The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk. Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6% yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS with culture characteristics of Vibrio spp. More than half (n=27 of processed seafood samples (n=46 yielded colonies on TCBS, while only 44.6% of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 х104 CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 х104 CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9% were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products.

  1. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya.

    Science.gov (United States)

    Azwai, S M; Alfallani, E A; Abolghait, S K; Garbaj, A M; Naas, H T; Moawad, A A; Gammoudi, F T; Rayes, H M; Barbieri, I; Eldaghayes, I M

    2016-01-01

    The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×10(4) CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×10(4) CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products.

  2. Morphology and rDNA phylogeny of a Mediterranean Coolia monotis (Dinophyceae strain from Greece

    Directory of Open Access Journals (Sweden)

    Nicolas P. Dolapsakis

    2006-03-01

    Full Text Available Sequences of LSU and SSU ribosomal RNA genes and phylogeny have not been widely investigated for the dinoflagellate Coolia monotis Meunier, and no information is available on the small and large rDNA subunits of Mediterranean strains. A strain isolated from the Thermaikos Gulf in northern Greece was identified as C. monotis—a new record for the Greek algal flora—using thecal morphology by light, epifluorescence and scanning electron microscopy. The small subunit and partial (D1/D2 large subunit sequences were analyzed and compared to other strains of C. monotis and dinoflagellates from various regions. Thecal architecture showed that the Greek strain of C. monotis was phenotypically similar, but not identical, to other strains reported in literature. The partial LSU sequence (700 bp was found to vary by 113 bp positions (16% from the C. monotis strain from New Zealand, whereas the SSU (1757 bp had 15 bp differences (0.85% from the strain from Norway. Phylogenetic tree construction showed that the Greek strain fell within the Coolia clade and had a close relationship with the families Ostreopsidaceae and Goniodomaceae of the order Gonyaulacales. Preliminary findings suggest the existence of different genotype strains of C. monotis with large intraspecific genetic variability and minimal morphological differentiation (similar phenotypes. Certain ecological and evolutionary implications of these findings are discussed.

  3. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Science.gov (United States)

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  4. Myxobolus cerebralis internal transcribed spacer 1 (ITS-1) sequences support recent spread of the parasite to North America and within Europe

    Science.gov (United States)

    Whipps, Christopher M.; El-Matbouli, M.; Hedrick, R.P.; Blazer, V.; Kent, M.L.

    2004-01-01

    Molecular approaches for resolving relationships among the Myxozoa have relied mainly on small subunit (SSU) ribosomal DNA (rDNA) sequence analysis. This region of the gene is generally used for higher phylogenetic studies, and the conservative nature of this gene may make it inadequate for intraspecific comparisons. Previous intraspecific studies of Myxobolus cerebralis based on molecular analyses reported that the sequence of SSU rDNA and the internal transcribed spacer (ITS) were highly conserved in representatives of the parasite from North America and Europe. Considering that the ITS is usually a more variable region than the SSU, we reanalyzed available sequences on GenBank and obtained sequences from other M. cerebralis representatives from the states of California and West Virginia in the USA and from Germany and Russia. With the exception of 7 base pairs, most of the sequence designated as ITS-1 in GenBank was a highly conserved portion of the rDNA near the 3-prime end of the SSU region. Nonetheless, the additional ITS-1 sequences obtained from the available geographic representatives were well conserved. It is unlikely that we would have observed virtually identical ITS-1 sequences between European and American M. cerebralis samples had it spread naturally over time, particularly when compared to the variation seen between isolates of another myxozoan (Kudoa thyrsites) that has most likely spread naturally. These data further support the hypothesis that the current distribution of M. cerebralis in North America is a result of recent introductions followed by dispersal via anthropogenic means, largely through the stocking of infected trout for sport fishing.

  5. Study and realisation of a programmable generator of pulse sequences, for nuclear magnetic resonance

    International Nuclear Information System (INIS)

    Lambert, Daniel

    1974-01-01

    After having recalled the operation of pulse-based nuclear magnetic resonance and the use of pulse sequences in NMR-based measurements, and outlined the need for a pulse sequence generator, the author reports the design and realisation of such a device. He describes its general organisation with its base sequence, base clock, sequence start, duration, displays, data transfers, data processing, and signal distribution. He presents the chosen technology (ECL logics), the sequence base set, time bases, multiplexers, comparison sets, the distribution set, the sequence programming, the sampling and output set. He reports tests and the use of the so-designed generator [fr

  6. Identificarion of contaminant bacteria in cachaça yeast by 16s rDNA gene sequencing Identificação de bactérias contaminantes de fermento de cachaça por seqüenciamento do gene 16s rDNA

    Directory of Open Access Journals (Sweden)

    Osmar Vaz de Carvalho-Netto

    2008-01-01

    Full Text Available Cachaça is a typical Brazilian liquor produced from the distillation of fermented sugarcane juice mainly by Saccharomyces cerevisiae. Most of the domestic production is artisanal, and producers usually are not concerned regarding microbiological control of the fermentation. This study aimed to characterize the contaminant bacterial community of the yeast used in the production of cachaça in an artisanal still. Four samples were collected, of which one (NA was used for comparison purposes and was collected one year earlier. The remaining samples were collected at three different periods: at the end of the first day of fermentation (NP, after fifteen days (NS, and thirty days after the same yeast was used (NT. Five hundred and eighty-seven sequences were analyzed from the partial sequencing of the 16S rDNA gene. Sequence analyses revealed the presence of 170 operational taxonomic units (OTUs. Of these, only one was shared among three samples and seventeen were shared between two samples. The remaining 152 OTUs were identified only once in distinct samples indicating that the contaminant bacterial population is highly dynamic along the fermentation process. Statistical analyses revealed differences in bacterial composition among samples. Undescribed species in the literature on yeasts of cachaça were found, such as Weissella cibaria, Leuconostoc citreum, and some species of Lactobacillus, in addition to some unknown bacteria. The community of bacteria in the fermentation process is much more complex than it was previously considered. No previous report is known regarding the use of this technique to determine bacterial contaminants in yeast for the production of cachaça.A cachaça é uma bebida típica brasileira produzida a partir da destilação do caldo de cana-de-açúcar fermentado principalmente por Saccharomyces cerevisiae. Grande parte da produção nacional é artesanal, e não há uma preocupação por parte dos produtores quanto ao

  7. The analysis of energy-time sequences in the nuclear power plants construction

    International Nuclear Information System (INIS)

    Milivojevic, S.; Jovanovic, V.; Riznic, J.

    1983-01-01

    The current nuclear energy development pose many problems; one of them is nuclear power plant construction. They are evaluated energy and time features of the construction and their relative ratios by the analysis of available data. The results point at the reached efficiency of the construction and, in the same time, they are the basis for real estimation of energy-time sequences of the construction in the future. (author)

  8. A reassessment of phylogenetic relationships within the phaeophyceae based on RUBISCO large subunit and ribosomal DNA sequences

    NARCIS (Netherlands)

    Draisma, S.G A; Prud'homme van Reine, W.F; Stam, W.T.; Olsen, J.L.

    To better assess the current state of phaeophycean phylogeny, we compiled all currently available rbcL, 18S, and 26S rDNA sequences from the EMBL/GenBank database and added 21 new rbcL sequences of our own. We then developed three new alignments designed to maximize taxon sampling while minimizing

  9. Eigenimage filtering of nuclear medicine image sequences

    International Nuclear Information System (INIS)

    Windham, J.P.; Froelich, J.W.; Abd-Allah, M.

    1985-01-01

    In many nuclear medicine imaging sequences the localization of radioactivity in organs other than the target organ interferes with imaging of the desired anatomical structure or physiological process. A filtering technique has been developed which suppresses the interfering process while enhancing the desired process. This technique requires the identification of temporal sequential signatures for both the interfering and desired processes. These signatures are placed in the form of signature vectors. Signature matrices, M/sub D/ and M/sub U/, are formed by taking the outer product expansion of the temporal signature vectors for the desired and interfering processes respectively. By using the transformation from the simultaneous diagonalization of these two signature matrices a weighting vector is obtained. The technique is shown to maximize the projection of the desired process while minimizing the interfering process based upon an extension of Rayleigh's Principle. The technique is demonstrated for first pass renal and cardiac flow studies. This filter offers a potential for simplifying and extending the accuracy of diagnostic nuclear medicine procedures

  10. Ribosomal DNA sequence analysis of different geographically distributed Aloe Vera plants: Comparison with clonally regenerated plants

    International Nuclear Information System (INIS)

    Yagi, A.; Sato, Y.; Miwa, Y.; Kabbash, A.; Moustafa, S.; Shimomura, K.; El-Bassuony, A.

    2006-01-01

    A comparison of the sequences in an internally transcribed spacer (ITS) 1 region of rDNA between clonally regenerated A.vera and same species in Japan, USA and Egypt revealed the presence of two types of nucleotide sequences, 252 and 254 bps. Based on the findings in the ITS 1 region, A.vera having 252 and 254 bps clearly showed a stable sequence similarity, suggesting high conversation of the base peak sequence in the ITS 1 region. However, frequent base substitutions in the 252 bps samples leaves that came from callus tissue and micropropagated plants were observed around the regions of nucleotide positions 66, 99 and 199-201. The minor deviation in clonally regenerated A.vera may be due to the stage of regeneration and cell specification in cases of the callus tissue. In the present study, the base peak sequence of the Its 1 region of rDNA was adopted as a molecular marker for differentiating A.vera plants from geographically distributed and clonally regenerated A.vera plants and it was suggested that the base peak substitutions in the ITS 1 region may arise from the different nutritional and environmental factors in cultivation and plant growth stages. (author)

  11. Cytogenetic features of rRNA genes across land plants: analysis of the Plant rDNA database

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Kovařík, Aleš; Leitch, A. R.; Garnatje, T.

    2017-01-01

    Roč. 89, č. 5 (2017), s. 1020-1030 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * 5s rdna * 45s rdna * concerted evolution Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 5.901, year: 2016

  12. Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.

    Science.gov (United States)

    Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K

    2016-07-29

    A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults. Copyright © 2016, American Association for the Advancement of Science.

  13. Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

    Science.gov (United States)

    Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

    2010-06-12

    For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable

  14. Automatic start-up system of nuclear reactor based on sequence control technology

    International Nuclear Information System (INIS)

    Zhang Yao; Zhang Dafa; Peng Huaqing

    2009-01-01

    A conceptive design of an automatic start-up system based on the sequence control for the nuclear reactors is given in this paper, so as to solve the problems during the start-up process, such as the long operation time, low automatic control level and high accident rate. The start-up process and its requirements are analyzed in detail at first. Then,the principle, the architecture, the key technologies of the automatic start-up system of nuclear reactors are designed and discussed. With the designed system, the automatic start-up of the nuclear reactor can be realized,the work load of the operator can be reduced,and the safety and efficiency of the nuclear power plant during its start-up can be improved. (authors)

  15. Distribution of 45S rDNA in Modern Rose Cultivars (Rosa hybrida), Rosa rugosa, and Their Interspecific Hybrids Revealed by Fluorescence in situ Hybridization.

    Science.gov (United States)

    Ding, Xiao-Liu; Xu, Ting-Liang; Wang, Jing; Luo, Le; Yu, Chao; Dong, Gui-Min; Pan, Hui-Tang; Zhang, Qi-Xiang

    2016-01-01

    To elucidate the evolutionary dynamics of the location and number of rDNA loci in the process of polyploidization in the genus Rosa, we examined 45S rDNA sites in the chromosomes of 6 modern rose cultivars (R. hybrida), 5 R. rugosa cultivars, and 20 hybrid progenies by fluorescence in situ hybridization. Variation in the number of rDNA sites in parents and their interspecific hybrids was detected. As expected, 4 rDNA sites were observed in the genomes of 4 modern rose cultivars, while 3 hybridization sites were observed in the 2 others. Two expected rDNA sites were found in 2 R. rugosa cultivars, while in the other 3 R. rugosa cultivars 4 sites were present. Among the 20 R. hybrida × R. rugosa offspring, 13 carried the expected number of rDNA sites, and 1 had 6 hybridization sites, which exceeded the expected number by far. The other 6 offspring had either 2 or 3 hybridization sites, which was less than expected. Differences in the number of rDNA loci were observed in interspecific offspring, indicating that rDNA loci exhibit instability after distant hybridization events. Abnormal chromosome pairing may be the main factor explaining the variation in rDNA sites during polyploidization. © 2016 S. Karger AG, Basel.

  16. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Science.gov (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  17. Assessing the fidelity of ancient DNA sequences amplified from nuclear genes

    DEFF Research Database (Denmark)

    Binladen, Jonas; Wiuf, Carsten Henrik; Gilbert, M. Thomas P.

    2006-01-01

    To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved...... in phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from...... adenine), respectively. Type 2 transitions are by far the most dominant and increase relative to those of type 1 with damage load. The results suggest that the deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine) is the main cause of miscoding lesions in both ancient mtDNA and nu...

  18. Different patterns of rDNA distribution in Pisum sativum nucleoli correlate with different levels of nucleolar activity

    International Nuclear Information System (INIS)

    Highett, M.I.; Rawlins, D.J.; Shaw, P.J.

    1993-01-01

    We have used in situ hybridization with probes to rDNA, labelled either with digoxygenin or directly with fluorescein, to determine the arrangement of these genes within the nucleoli of Pisum sativum L. root cells. Confocal laser scanning microscopy was used to image the three-dimensional structures revealed, but we have also compared this technique with deconvolution of conventional (wide-field) fluorescence images measured with a cooled CCD camera, and have shown that the results are remarkably similar. When the deconvolution technique was applied to the confocal data it gave clearer images than could be achieved by confocal microscopy alone. We have analysed the distribution of rDNA in the different cell types observable in root tips: the quiescent centre; active meristematic cells; and relatively differentiated root cap, epidermal and cortical cells. In addition to four perinucleolar knobs of condensed, inactive rDNA genes, corresponding to the four nucleolar organizers in P. sativum, which were the most brightly labelled structures, several characteristic patterns of intranucleolar labelling were apparent, including bright foci, large central chromatin masses, and fine, decondensed interconnecting fibres. The larger and more active the nucleolus, the smaller the proportion of condensed perinucleolar rDNA. In some large and active meristematic nucleoli, all the internal rDNA is decondensed, showing that transcription cannot be restricted to the bright foci, and is most likely to occur on the decondensed fibres. (author)

  19. Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

    Science.gov (United States)

    McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

    2008-10-01

    The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

  20. Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing

    Directory of Open Access Journals (Sweden)

    Zdepski Anna

    2011-05-01

    Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.

  1. PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.

    Science.gov (United States)

    Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q

    2007-01-01

    Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.

  2. The sequence coding and search system: An approach for constructing and analyzing event sequences at commercial nuclear power plants

    International Nuclear Information System (INIS)

    Mays, G.T.

    1989-04-01

    The US Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedstock of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrences of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objective SCSS, the information it contains, and the format and approach for constructuring SCSS event sequences. Examples are presented demonstrating the use SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted

  3. Insights into the relationships of Palearctic and Nearctic lymnaeids (Mollusca : Gastropoda by rDNA ITS-2 sequencing and phylogeny of stagnicoline intermediate host species of Fasciola hepatica

    Directory of Open Access Journals (Sweden)

    Bargues M.D.

    2003-09-01

    Full Text Available Fascioliasis by Fasciola hepatica is the vector-borne disease presenting the widest latitudinal, longitudinal and altitudinal distribution known. F. hepatica shows a great adaptation power to new environmental conditions which is the consequence of its own capacities together with the adaptation and colonization abilities of its specific vector hosts, freshwater snails of the family Lymnaeidae. Several lymnaeid species only considered as secondary contributors to the liver fluke transmission have, however, played a very important role in the geographic expansion of this disease. Many of them belong to the so-called "stagnicoline" type group. Stagnicolines have, therefore, a very important applied interest in the Holarctic region, to which they are geographically restricted. The present knowledge on the genetics of stagnicolines and on their parasite-host interrelationships is, however, far from being sufficient. The present paper analyses the relationships between Palaearctic and Nearctic stagnicoline species on the base of the new light furnished by the results obtained in nuclear rDNA ITS-2 sequencing and corresponding phylogenetic studies of the lymnaeid taxa Lymnaea (Stagnicola occulta, L. (S. palustris palustris (topotype specimens and L.(S. p. turricula from Europe. Natural infections with F. hepatica have been reported in all of them. Surprisingly, ITS-2 length and G C content of L. occulta were similar and perfectly fitted within the respective ranges known in North American stagnicolines. Nucleotide differences and genetic distances were higher between L. occulta and the other European stagnicolines than between L. occulta and the North American ones. The ITS-2 sequence of L. p. turricula from Poland differed from the other genotypes known from turricula in Europe. The phylogenetic trees using the maximum-parsimony, distance and maximum-likelihood methods confirmed (i the inclusion of L. occulta in the branch of North American

  4. Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

    Directory of Open Access Journals (Sweden)

    Rawnak Laila

    2017-01-01

    Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

  5. Mutation of a Conserved Nuclear Export Sequence in Chikungunya Virus Capsid Protein Disrupts Host Cell Nuclear Import.

    Science.gov (United States)

    Jacobs, Susan C; Taylor, Adam; Herrero, Lara J; Mahalingam, Suresh; Fazakerley, John K

    2017-10-20

    Transmitted by mosquitoes; chikungunya virus (CHIKV) is responsible for frequent outbreaks of arthritic disease in humans. CHIKV is an arthritogenic alphavirus of the Togaviridae family. Capsid protein, a structural protein encoded by the CHIKV RNA genome, is able to translocate to the host cell nucleus. In encephalitic alphaviruses nuclear translocation induces host cell shut off; however, the role of capsid protein nuclear localisation in arthritogenic alphaviruses remains unclear. Using replicon systems, we investigated a nuclear export sequence (NES) in the N-terminal region of capsid protein; analogous to that found in encephalitic alphavirus capsid but uncharacterised in CHIKV. The chromosomal maintenance 1 (CRM1) export adaptor protein mediated CHIKV capsid protein export from the nucleus and a region within the N-terminal part of CHIKV capsid protein was required for active nuclear targeting. In contrast to encephalitic alphaviruses, CHIKV capsid protein did not inhibit host nuclear import; however, mutating the NES of capsid protein (∆NES) blocked host protein access to the nucleus. Interactions between capsid protein and the nucleus warrant further investigation.

  6. Chromosome mapping of repetitive sequences in four Serrasalmidae species (Characiformes

    Directory of Open Access Journals (Sweden)

    Leila Braga Ribeiro

    2014-01-01

    Full Text Available The Serrasalmidae family is composed of a number of commercially interesting species, mainly in the Amazon region where most of these fishes occur. In the present study, we investigated the genomic organization of the 18S and 5S rDNA and telomeric sequences in mitotic chromosomes of four species from the basal clade of the Serrasalmidae family: Colossoma macropomum, Mylossoma aureum, M. duriventre, and Piaractus mesopotamicus, in order to understand the chromosomal evolution in the family. All the species studied had diploid numbers 2n = 54 and exclusively biarmed chromosomes, but variations of the karyotypic formulas were observed. C-banding resulted in similar patterns among the analyzed species, with heterochromatic blocks mainly present in centromeric regions. The 18S rDNA mapping of C. macropomum and P. mesopotamicus revealed multiple sites of this gene; 5S rDNA sites were detected in two chromosome pairs in all species, although not all of them were homeologs. Hybridization with a telomeric probe revealed signals in the terminal portions of chromosomes in all the species and an interstitial signal was observed in one pair of C. macropomum.

  7. Acute Smc5/6 depletion reveals its primary role in rDNA replication by restraining recombination at fork pausing sites.

    Directory of Open Access Journals (Sweden)

    Xiao P Peng

    2018-01-01

    Full Text Available Smc5/6, a member of the conserved SMC family of complexes, is essential for growth in most organisms. Its exact functions in a mitotic cell cycle are controversial, as chronic Smc5/6 loss-of-function alleles produce varying phenotypes. To circumvent this issue, we acutely depleted Smc5/6 in budding yeast and determined the first cell cycle consequences of Smc5/6 removal. We found a striking primary defect in replication of the ribosomal DNA (rDNA array. Each rDNA repeat contains a programmed replication fork barrier (RFB established by the Fob1 protein. Fob1 removal improves rDNA replication in Smc5/6 depleted cells, implicating Smc5/6 in the management of programmed fork pausing. A similar improvement is achieved by removing the DNA helicase Mph1 whose recombinogenic activity can be inhibited by Smc5/6 under DNA damage conditions. DNA 2D gel analyses further show that Smc5/6 loss increases recombination structures at RFB regions; moreover, mph1∆ and fob1∆ similarly reduce this accumulation. These findings point to an important mitotic role for Smc5/6 in restraining recombination events when protein barriers in rDNA stall replication forks. As rDNA maintenance influences multiple essential cellular processes, Smc5/6 likely links rDNA stability to overall mitotic growth.

  8. Identification of Angiostrongylus cantonensis and other nematodes using the SSU rDNA in Achatina fulica populations of Metro Manila.

    Science.gov (United States)

    Constantino-Santos, M A; Basiao, Z U; Wade, C M; Santos, B S; Fontanilla I, K C

    2014-06-01

    Angiostrongylus cantonensis is a parasitic nematode that causes eosinophilic meningitis in humans. Accidental infection occurs by consumption of contaminated intermediates, such as the giant African land snail, Achatina fulica. This study surveyed the presence of A. cantonensis juveniles in A. fulica populations from 12 sites in Metropolitan Manila, Philippines using the SSU rDNA. Fourteen distinct sequences from 226 nematodes were obtained; of these, two matched A. cantonensis and Ancylostoma caninum, respectively, with 100% identity. Exact identities of the remaining twelve sequences could not be determined due to low percent similarities. Of the sequenced nematodes, A. cantonensis occurred with the highest frequency (139 out of 226). Most of these (131 out of 139) were collected in just one area in Quezon City. Nematode infection of A. fulica in this area and two others from Makati and another area in Quezon City, respectively, were highest, combining for 95% of the total infection. Ancylostoma caninum, on the other hand, was detected in four different sites. A. caninum is a canine parasite, and this is the first report of the nematode in A. fulica. These results cause public health concerns as both A. cantonensis and A. caninum are zoonotic to humans.

  9. (reprocessed)HeliscopeCAGE sequencing, Delve mapping and CAGE TSS aggregation - FANTOM5 | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us FANTOM...ntified by CAGE tag analysis (BED format) *.rdna.fa.gz: rDNA sequences (FASTA format) Data file File name: fantom...5_rp_exp_details.zip File URL: ftp://ftp.biosciencedbc.jp/archive/fantom5/20161221/fantom5_rp_exp_detai...tp://ftp.biosciencedbc.jp/archive/fantom5/datafiles/reprocessed/hg38_latest/basic/ File size: 1.4 TB File na...me: (reprocessed)basic (Mus musculus) File URL: ftp://ftp.biosciencedbc.jp/archive/fantom5/datafiles/reproce

  10. Morphological, molecular and ecological aspects of the South American hypogeous fungi Alpova austroalnicola sp. nov.

    Science.gov (United States)

    Eduardo R. Nouhra; Laura S. Domínguez; Alejandra G. Becerra; James M. Trappe

    2005-01-01

    Field studies in Argentina's Yunga District revealed Alpova austroalnicola sp. nov., a hypogeous fungus associated with Alnus acuminata ssp, acuminata. Morphological and molecular studies based on amplification and sequencing of the nuclear LSU rDNA gene showed its unique identity within ...

  11. Plant rDNA database: ribosomal DNA loci information goes online

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Garnatje, T.; Kovařík, Aleš

    2012-01-01

    Roč. 121, č. 4 (2012), s. 389-394 ISSN 0009-5915 R&D Projects: GA ČR(CZ) GAP501/10/0208; GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Keywords : rDNA loci * FISH * database Subject RIV: BO - Biophysics Impact factor: 3.340, year: 2012

  12. Heterochromatin and rDNA sites distribution in the holocentric chromosomes of Cuscuta approximata Bab. (Convolvulaceae).

    Science.gov (United States)

    Guerra, Marcelo; García, Miguel A

    2004-02-01

    Cuscuta is a widely distributed genus of holoparasitic plants. Holocentric chromosomes have been reported only in species of one of its subgenera (Cuscuta subg. Cuscuta). In this work, a representative of this subgenus, Cuscuta approximata, was investigated looking for its mitotic and meiotic chromosome behaviour and the heterochromatin distribution. The mitotic chromosomes showed neither primary constriction nor Rabl orientation whereas the meiotic ones exhibited the typical quadripartite structure characteristic of holocentrics, supporting the assumption of holocentric chromosomes as a synapomorphy of Cuscuta subg. Cuscuta. Chromosomes and interphase nuclei displayed many heterochromatic blocks that stained deeply with hematoxylin, 4',6-diamidino-2-phenylindole (DAPI), or after C banding. The banded karyotype showed terminal or subterminal bands in all chromosomes and central bands in some of them. The single pair of 45S rDNA sites was observed at the end of the largest chromosome pair, close to a DAPI band and a 5S rDNA site. Two other 5S rDNA site pairs were found, both closely associated with DAPI bands. The noteworthy giant nuclei of glandular cells of petals and ovary wall exhibited large chromocentres typical of polytenic nuclei. The chromosomal location of heterochromatin and rDNA sites and the structure of the endoreplicated nuclei of C. approximata seemed to be similar to those known in monocentric nuclei, suggesting that centromeric organization has little or no effect on chromatin organization.

  13. Specific nuclear localizing sequence directs two myosin isoforms to the cell nucleus in calmodulin-sensitive manner.

    Science.gov (United States)

    Dzijak, Rastislav; Yildirim, Sukriye; Kahle, Michal; Novák, Petr; Hnilicová, Jarmila; Venit, Tomáš; Hozák, Pavel

    2012-01-01

    Nuclear myosin I (NM1) was the first molecular motor identified in the cell nucleus. Together with nuclear actin, they participate in crucial nuclear events such as transcription, chromatin movements, and chromatin remodeling. NM1 is an isoform of myosin 1c (Myo1c) that was identified earlier and is known to act in the cytoplasm. NM1 differs from the "cytoplasmic" myosin 1c only by additional 16 amino acids at the N-terminus of the molecule. This amino acid stretch was therefore suggested to direct NM1 into the nucleus. We investigated the mechanism of nuclear import of NM1 in detail. Using over-expressed GFP chimeras encoding for truncated NM1 mutants, we identified a specific sequence that is necessary for its import to the nucleus. This novel nuclear localization sequence is placed within calmodulin-binding motif of NM1, thus it is present also in the Myo1c. We confirmed the presence of both isoforms in the nucleus by transfection of tagged NM1 and Myo1c constructs into cultured cells, and also by showing the presence of the endogenous Myo1c in purified nuclei of cells derived from knock-out mice lacking NM1. Using pull-down and co-immunoprecipitation assays we identified importin beta, importin 5 and importin 7 as nuclear transport receptors that bind NM1. Since the NLS sequence of NM1 lies within the region that also binds calmodulin we tested the influence of calmodulin on the localization of NM1. The presence of elevated levels of calmodulin interfered with nuclear localization of tagged NM1. We have shown that the novel specific NLS brings to the cell nucleus not only the "nuclear" isoform of myosin I (NM1 protein) but also its "cytoplasmic" isoform (Myo1c protein). This opens a new field for exploring functions of this molecular motor in nuclear processes, and for exploring the signals between cytoplasm and the nucleus.

  14. XplorSeq: a software environment for integrated management and phylogenetic analysis of metagenomic sequence data.

    Science.gov (United States)

    Frank, Daniel N

    2008-10-07

    Advances in automated DNA sequencing technology have accelerated the generation of metagenomic DNA sequences, especially environmental ribosomal RNA gene (rDNA) sequences. As the scale of rDNA-based studies of microbial ecology has expanded, need has arisen for software that is capable of managing, annotating, and analyzing the plethora of diverse data accumulated in these projects. XplorSeq is a software package that facilitates the compilation, management and phylogenetic analysis of DNA sequences. XplorSeq was developed for, but is not limited to, high-throughput analysis of environmental rRNA gene sequences. XplorSeq integrates and extends several commonly used UNIX-based analysis tools by use of a Macintosh OS-X-based graphical user interface (GUI). Through this GUI, users may perform basic sequence import and assembly steps (base-calling, vector/primer trimming, contig assembly), perform BLAST (Basic Local Alignment and Search Tool; 123) searches of NCBI and local databases, create multiple sequence alignments, build phylogenetic trees, assemble Operational Taxonomic Units, estimate biodiversity indices, and summarize data in a variety of formats. Furthermore, sequences may be annotated with user-specified meta-data, which then can be used to sort data and organize analyses and reports. A document-based architecture permits parallel analysis of sequence data from multiple clones or amplicons, with sequences and other data stored in a single file. XplorSeq should benefit researchers who are engaged in analyses of environmental sequence data, especially those with little experience using bioinformatics software. Although XplorSeq was developed for management of rDNA sequence data, it can be applied to most any sequencing project. The application is available free of charge for non-commercial use at http://vent.colorado.edu/phyloware.

  15. Molecular technique reveals high variability of 18S rDNA distribution in harvestmen (Opiliones, Phalangiidae) from South Africa.

    Science.gov (United States)

    Šťáhlavský, František; Opatova, Vera; Just, Pavel; Lotz, Leon N; Haddad, Charles R

    2018-01-01

    The knowledge of cytogenetics in the harvestmen family Phalangiidae has been based on taxa from the Northern Hemisphere. We performed cytogenetic analysis on Guruia africana (Karsch, 1878) (2n=24) and four species of the genus Rhampsinitus Simon, 1879 (2n=24, 26, 34) from South Africa. Fluorescence in situ hybridization with an 18S rDNA probe was used to analyze the number and the distribution of this cluster in the family Phalangiidae for the first time. The results support the cytogenetic characteristics typical for the majority of harvestmen taxa, i.e. the predominance of small biarmed chromosomes and the absence of morphologically well-differentiated sex chromosomes as an ancestral state. We identified the number of 18S rDNA sites ranging from two in R. qachasneki Kauri, 1962 to seven in one population of R. leighi Pocock, 1903. Moreover, we found differences in the number and localization of 18S rDNA sites in R. leighi between populations from two localities and between sexes of R. capensis (Loman, 1898). The heterozygous states of the 18S rDNA sites in these species may indicate the presence of XX/XY and ZZ/ZW sex chromosomes, and the possible existence of these systems in harvestmen is discussed. The variability of the 18S rDNA sites indicates intensive chromosomal changes during the differentiation of the karyotypes, which is in contrast to the usual uniformity in chromosomal morphology known from harvestmen so far.

  16. Single nucleus genome sequencing reveals high similarity among nuclei of an endomycorrhizal fungus.

    Directory of Open Access Journals (Sweden)

    Kui Lin

    2014-01-01

    Full Text Available Nuclei of arbuscular endomycorrhizal fungi have been described as highly diverse due to their asexual nature and absence of a single cell stage with only one nucleus. This has raised fundamental questions concerning speciation, selection and transmission of the genetic make-up to next generations. Although this concept has become textbook knowledge, it is only based on studying a few loci, including 45S rDNA. To provide a more comprehensive insight into the genetic makeup of arbuscular endomycorrhizal fungi, we applied de novo genome sequencing of individual nuclei of Rhizophagus irregularis. This revealed a surprisingly low level of polymorphism between nuclei. In contrast, within a nucleus, the 45S rDNA repeat unit turned out to be highly diverged. This finding demystifies a long-lasting hypothesis on the complex genetic makeup of arbuscular endomycorrhizal fungi. Subsequent genome assembly resulted in the first draft reference genome sequence of an arbuscular endomycorrhizal fungus. Its length is 141 Mbps, representing over 27,000 protein-coding gene models. We used the genomic sequence to reinvestigate the phylogenetic relationships of Rhizophagus irregularis with other fungal phyla. This unambiguously demonstrated that Glomeromycota are more closely related to Mucoromycotina than to its postulated sister Dikarya.

  17. The phylogenetic position of Lygodactylus angularis and the utility of using the 16S rDNA gene for delimiting species in Lygodactylus (Squamata, Gekkonidae

    Directory of Open Access Journals (Sweden)

    Riccardo Castiglia

    2011-06-01

    Full Text Available The African genus Lygodactylus Gray, is composed of roughly 60 species of diurnal geckos that inhabit tropical and temperate Africa, Madagascar, and South America. In this study, we assessed the phylogenetic position of L. angularis, for which molecular data were so far lacking, by means of sequence analysis of the mitochondrial 16S rDNA gene. We also compared intraspecific vs. interspecific genetic divergences using an extended data set (34 species, 153 sequences, to determine whether a fragment of this gene can be useful for species identification and to reveal the possible existence of new cryptic species in the genus. The analysis placed L. angularis in a monophyletic group together with members of “fischeri” and “picturatus” groups. Nevertheless, the independence of the “angularis” lineage is supported by the high genetic divergence. Comparison of intraspecific vs. interspecific genetic distances highlights that, assuming an equal molecular rate of evolution among the studied species for the used gene, the threshold value useful for recognising a candidate new species can be tentatively placed at 7%. We identified four species that showed an intraspecific divergence higher than, or close to, the 7% threshold: L. capensis (8.7%, L. gutturalis (9.3%, L. madagascariensis (6.5% and L. picturatus (8.1%. Moreover, two species, L. mombasicus and L. verticillatus, are paraphyletic in terms of gene genealogy. Thus, the study shows that a short fragment of the 16S rDNA gene can be an informative tool for species-level taxonomy in the genus Lygodactylus.

  18. Internal event analysis for Laguna Verde Unit 1 Nuclear Power Plant. Accident sequence quantification and results

    International Nuclear Information System (INIS)

    Huerta B, A.; Aguilar T, O.; Nunez C, A.; Lopez M, R.

    1994-01-01

    The Level 1 results of Laguna Verde Nuclear Power Plant PRA are presented in the I nternal Event Analysis for Laguna Verde Unit 1 Nuclear Power Plant, CNSNS-TR 004, in five volumes. The reports are organized as follows: CNSNS-TR 004 Volume 1: Introduction and Methodology. CNSNS-TR4 Volume 2: Initiating Event and Accident Sequences. CNSNS-TR 004 Volume 3: System Analysis. CNSNS-TR 004 Volume 4: Accident Sequence Quantification and Results. CNSNS-TR 005 Volume 5: Appendices A, B and C. This volume presents the development of the dependent failure analysis, the treatment of the support system dependencies, the identification of the shared-components dependencies, and the treatment of the common cause failure. It is also presented the identification of the main human actions considered along with the possible recovery actions included. The development of the data base and the assumptions and limitations in the data base are also described in this volume. The accident sequences quantification process and the resolution of the core vulnerable sequences are presented. In this volume, the source and treatment of uncertainties associated with failure rates, component unavailabilities, initiating event frequencies, and human error probabilities are also presented. Finally, the main results and conclusions for the Internal Event Analysis for Laguna Verde Nuclear Power Plant are presented. The total core damage frequency calculated is 9.03x 10-5 per year for internal events. The most dominant accident sequences found are the transients involving the loss of offsite power, the station blackout accidents, and the anticipated transients without SCRAM (ATWS). (Author)

  19. Genetic characterization and phylogenetic analysis of Eimeria arloingi in Iranian native kids.

    Science.gov (United States)

    Khodakaram-Tafti, A; Hashemnia, M; Razavi, S M; Sharifiyazdi, H; Nazifi, S

    2013-09-01

    Among the 16 species of Eimeria from goats, Eimeria arloingi and Eimeria ninakohlyakimovae are regarded as the most pathogenic species in the world and cause clinical caprine coccidiosis. E. arloingi is known to be an important cause of coccidiosis in Iranian kids. Molecular analyses of two portions of nuclear ribosomal DNA (internal transcribed spacer1 (ITS1) and 18S rDNA) were used for the genetic characterization of the E. arloingi. Comparison of the sequencing data of E. arloingi obtained in the present study (ITS1: KC507793 and 18S rDNA: KC507792) with other Eimeria species in the GenBank database revealed a particularly close relationship between E. arloingi and Eimeria spp. from the cattle and sheep. The phylogram based on the ITS1 sequences shows that the E. arloingi, Eimeria bovis, and Eimeria zuernii formed a distinct group separate from the other remaining Eimeria spp. in cattle and poultry. In pairwise alignment, 18S rDNA sequence derived from E. arloingi showed 99% similarity to Eimeria ahsata with differences observed at only three nucleotides. This study showed that the ITS1 and 18S rDNA gene are useful genetic markers for the specific identification and differentiation of Eimeria spp. in ruminants.

  20. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  1. Phylogeographic structure of cotton pest Adelphocoris suturalis (Hemiptera: Miridae): strong subdivision in China inferred from mtDNA and rDNA ITS markers.

    Science.gov (United States)

    Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H; Cai, Wanzhi

    2015-09-21

    Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populations from central China and peripheral China regions. Analysis of molecular variance showed a high level of geographical differentiation at different hierarchical levels. Isolation-by-distance test showed no significant correlation between genetic distance and geographical distance among A. suturalis populations, which suggested gene flow is not restricted by distance. In seven peripheral populations, the high levels of genetic differentiation and the small Nem values implied that geographic barriers were more likely restrict gene flow. Neutrality tests and the Bayesian skyline plot suggested population expansion likely happened during the cooling transition between Last Interglacial and Last Glacial Maximum. All lines of evidence suggest that physical barriers, Pleistocene climatic oscillations and geographical heterogeneity have affected the population structure and distribution of this insect in China.

  2. Human factors review for nuclear power plant severe accident sequence analysis

    International Nuclear Information System (INIS)

    Krois, P.A.; Haas, P.M.

    1985-01-01

    The paper discusses work conducted to: (1) support the severe accident sequence analysis of a nuclear power plant transient based on an assessment of operator actions, and (2) develop a descriptive model of operator severe accident management. Operator actions during the transient are assessed using qualitative and quantitative methods. A function-oriented accident management model provides a structure for developing technical operator guidance on mitigating core damage preventing radiological release

  3. Multigene molecular phylogenetics reveals true morels (Morchella) are especially species-rich in China

    Science.gov (United States)

    The phylogenetic diversity of true morels (Morchella) in China was estimated by initially analyzing nuclear ribosomal internal transcribed spacer (ITS) rDNA sequences from 361 specimens collected in 21 provinces during the 2003-2011 growing seasons, together with six collections obtained on loan fro...

  4. Molecular phylogeny of Laetiporus and other brown rot polypore genera in North America

    Science.gov (United States)

    Daniel L. Lindner; Mark T. Banik

    2008-01-01

    Phylogenetic relationships were investigated among North American species of Laetiporus, Leptoporus, Phaeolus, Pycnoporellus, and Wolfiporia using ITS, nuclear large subunit and mitochondrial small subunit rDNA sequences. Members of these genera have poroid hymenophores, simple septate hyphae and cause brown rots in a variety of...

  5. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

    Science.gov (United States)

    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  6. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae: Evolutionary Tendencies in the Genus

    Directory of Open Access Journals (Sweden)

    Vanessa Bueno

    2014-01-01

    Full Text Available Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  7. Severe accident sequences simulated at the Grand Gulf Nuclear Station

    International Nuclear Information System (INIS)

    Carbajo, J.J.

    1999-01-01

    Different severe accident sequences employing the MELCOR code, version 1.8.4 QK, have been simulated at the Grand Gulf Nuclear Station (Grand Gulf). The postulated severe accidents simulated are two low-pressure, short-term, station blackouts; two unmitigated small-break (SB) loss-of-coolant accidents (LOCAs) (SBLOCAs); and one unmitigated large LOCA (LLOCA). The purpose of this study was to calculate best-estimate timings of events and source terms for a wide range of severe accidents and to compare the plant response to these accidents

  8. Do we treat our patients or rather periodontal microbes with adjunctive antibiotics in periodontal therapy? A 16S rDNA microbial community analysis.

    Science.gov (United States)

    Hagenfeld, Daniel; Koch, Raphael; Jünemann, Sebastian; Prior, Karola; Harks, Inga; Eickholz, Peter; Hoffmann, Thomas; Kim, Ti-Sun; Kocher, Thomas; Meyle, Jörg; Kaner, Doğan; Schlagenhauf, Ulrich; Ehmke, Benjamin; Harmsen, Dag

    2018-01-01

    Empiric antibiotics are often used in combination with mechanical debridement to treat patients suffering from periodontitis and to eliminate disease-associated pathogens. Until now, only a few next generation sequencing 16S rDNA amplicon based publications with rather small sample sizes studied the effect of those interventions on the subgingival microbiome. Therefore, we studied subgingival samples of 89 patients with chronic periodontitis (solely non-smokers) before and two months after therapy. Forty-seven patients received mechanical periodontal therapy only, whereas 42 patients additionally received oral administered amoxicillin plus metronidazole (500 and 400 mg, respectively; 3x/day for 7 days). Samples were sequenced with Illumina MiSeq 300 base pairs paired end technology (V3 and V4 hypervariable regions of the 16S rDNA). Inter-group differences before and after therapy of clinical variables (percentage of sites with pocket depth ≥ 5mm, percentage of sites with bleeding on probing) and microbiome variables (diversity, richness, evenness, and dissimilarity) were calculated, a principal coordinate analysis (PCoA) was conducted, and differential abundance of agglomerated ribosomal sequence variants (aRSVs) classified on genus level was calculated using a negative binomial regression model. We found statistically noticeable decreased richness, and increased dissimilarity in the antibiotic, but not in the placebo group after therapy. The PCoA revealed a clear compositional separation of microbiomes after therapy in the antibiotic group, which could not be seen in the group receiving mechanical therapy only. This difference was even more pronounced on aRSV level. Here, adjunctive antibiotics were able to induce a microbiome shift by statistically noticeably reducing aRSVs belonging to genera containing disease-associated species, e.g., Porphyromonas, Tannerella, Treponema, and Aggregatibacter, and by noticeably increasing genera containing health

  9. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    International Nuclear Information System (INIS)

    Tao Weitao; Budd, Martin; Campbell, Judith L.

    2003-01-01

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1Δ double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1Δ alone. However, surprisingly, the dna2-2 sgs1Δ lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1Δ lethality is only partially suppressed by deletion of rad51Δ. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones

  10. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    Energy Technology Data Exchange (ETDEWEB)

    Tao Weitao; Budd, Martin; Campbell, Judith L

    2003-11-27

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1{delta} double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1{delta} alone. However, surprisingly, the dna2-2 sgs1{delta} lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1{delta} lethality is only partially suppressed by deletion of rad51{delta}. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones.

  11. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Science.gov (United States)

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc

  12. Evolutionary conservation of nuclear and nucleolar targeting sequences in yeast ribosomal protein S6A

    International Nuclear Information System (INIS)

    Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim

    2005-01-01

    Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs

  13. Phylogenetic analysis of subgenus vigna species using nuclear ribosomal RNA ITS: evidence of hybridization among Vigna unguiculata subspecies.

    Science.gov (United States)

    Vijaykumar, Archana; Saini, Ajay; Jawali, Narendra

    2010-01-01

    Molecular phylogeny among species belonging to subgenus Vigna (genus Vigna) was inferred based on internal transcribed spacer (ITS) sequences of 18S-5.8S-26S ribosomal RNA gene unit. Analysis showed a total of 356 polymorphic sites of which approximately 80% were parsimony informative. Phylogenetic reconstruction by neighbor joining and maximum parsimony methods placed the 57 Vigna accessions (belonging to 15 species) into 5 major clades. Five species viz. Vigna heterophylla, Vigna pubigera, Vigna parkeri, Vigna laurentii, and Vigna gracilis whose position in the subgenus was previously not known were placed in the section Vigna. A single accession (Vigna unguiculata ssp. tenuis, NI 1637) harbored 2 intragenomic ITS variants, indicative of 2 different types of ribosomal DNA (rDNA) repeat units. ITS variant type-I was close to ITS from V. unguiculata ssp. pubescens, whereas type-II was close to V. unguiculata ssp. tenuis. Transcript analysis clearly demonstrates that in accession NI 1637, rDNA repeat units with only type-II ITS variants are transcriptionally active. Evidence from sequence analysis (of 5.8S, ITS1, and ITS2) and secondary structure analysis (of ITS1 and ITS2) indicates that the type-I ITS variant probably does not belong to the pseudogenic rDNA repeat units. The results from phylogenetic and transcript analysis suggest that the rDNA units with the type-I ITS may have introgressed as a result of hybridization (between ssp. tenuis and ssp. pubescens); however, it has been epigenetically silenced. The results also demonstrate differential evolution of ITS sequence among wild and cultivated forms of V. unguiculata.

  14. Molecular phylogeny of selected species of the order Dinophysiales (Dinophyceae) - testing the hypothesis of a Dinophysioid radiation

    DEFF Research Database (Denmark)

    Jensen, Maria Hastrup; Daugbjerg, Niels

    2009-01-01

    additional information on morphology and ecology to these evolutionary lineages. We have for the first time combined morphological information with molecular phylogenies to test the dinophysioid radiation hypothesis in a modern context. Nuclear-encoded LSU rDNA sequences including domains D1-D6 from 27...

  15. Molecular phylogeny of Trametes and related genera based on ...

    African Journals Online (AJOL)

    use

    2011-12-12

    Dec 12, 2011 ... In this study, we elucidated relationships among Trametes through comparison of the nuclear internal transcribed spacer (ITS) and the nearly complete mitochondrial small subunit ribosomal DNA (mt SSU rDNA) sequences. Finally, phylogenetic trees were built. Phylogenetic analysis of the ITS and mt SSU ...

  16. Altered gravity influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; Kordyum, E. L.

    Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In

  17. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    DEFF Research Database (Denmark)

    Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert

    2015-01-01

    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...

  18. [Bacterial diversity in sequencing batch biofilm reactor (SBBR) for landfill leachate treatment using PCR-DGGE].

    Science.gov (United States)

    Xiao, Yong; Yang, Zhao-hui; Zeng, Guang-ming; Ma, Yan-he; Liu, You-sheng; Wang, Rong-juan; Xu, Zheng-yong

    2007-05-01

    For studying the bacterial diversity and the mechanism of denitrification in sequencing bath biofilm reactor (SBBR) treating landfill leachate to provide microbial evidence for technique improvements, total microbial DNA was extracted from samples which were collected from natural landfill leachate and biofilm of a SBBR that could efficiently remove NH4+ -N and COD of high concentration. 16S rDNA fragments were amplified from the total DNA successfully using a pair of universal bacterial 16S rDNA primer, GC341F and 907R, and then were used for denaturing gradient gel electrophoresis (DGGE) analysis. The bands in the gel were analyzed by statistical methods and excided from the gel for sequencing, and the sequences were used for homology analysis and then two phylogenetic trees were constructed using DNAStar software. Results indicated that the bacterial diversity of the biofilm in SBBR and the landfill leachate was abundant, and no obvious change of community structure happened during running in the biofilm, in which most bacteria came from the landfill leachate. There may be three different modes of denitrification in the reactor because several different nitrifying bacteria, denitrifying bacteria and anaerobic ammonia oxidation bacteria coexisted in it. The results provided some valuable references for studying microbiological mechanism of denitrification in SBBR.

  19. A Review on the Applications of Next Generation Sequencing Technologies as Applied to Food-Related Microbiome Studies

    Directory of Open Access Journals (Sweden)

    Yu Cao

    2017-09-01

    Full Text Available The development of next generation sequencing (NGS techniques has enabled researchers to study and understand the world of microorganisms from broader and deeper perspectives. The contemporary advances in DNA sequencing technologies have not only enabled finer characterization of bacterial genomes but also provided deeper taxonomic identification of complex microbiomes which in its genomic essence is the combined genetic material of the microorganisms inhabiting an environment, whether the environment be a particular body econiche (e.g., human intestinal contents or a food manufacturing facility econiche (e.g., floor drain. To date, 16S rDNA sequencing, metagenomics and metatranscriptomics are the three basic sequencing strategies used in the taxonomic identification and characterization of food-related microbiomes. These sequencing strategies have used different NGS platforms for DNA and RNA sequence identification. Traditionally, 16S rDNA sequencing has played a key role in understanding the taxonomic composition of a food-related microbiome. Recently, metagenomic approaches have resulted in improved understanding of a microbiome by providing a species-level/strain-level characterization. Further, metatranscriptomic approaches have contributed to the functional characterization of the complex interactions between different microbial communities within a single microbiome. Many studies have highlighted the use of NGS techniques in investigating the microbiome of fermented foods. However, the utilization of NGS techniques in studying the microbiome of non-fermented foods are limited. This review provides a brief overview of the advances in DNA sequencing chemistries as the technology progressed from first, next and third generations and highlights how NGS provided a deeper understanding of food-related microbiomes with special focus on non-fermented foods.

  20. A Review on the Applications of Next Generation Sequencing Technologies as Applied to Food-Related Microbiome Studies

    Science.gov (United States)

    Cao, Yu; Fanning, Séamus; Proos, Sinéad; Jordan, Kieran; Srikumar, Shabarinath

    2017-01-01

    The development of next generation sequencing (NGS) techniques has enabled researchers to study and understand the world of microorganisms from broader and deeper perspectives. The contemporary advances in DNA sequencing technologies have not only enabled finer characterization of bacterial genomes but also provided deeper taxonomic identification of complex microbiomes which in its genomic essence is the combined genetic material of the microorganisms inhabiting an environment, whether the environment be a particular body econiche (e.g., human intestinal contents) or a food manufacturing facility econiche (e.g., floor drain). To date, 16S rDNA sequencing, metagenomics and metatranscriptomics are the three basic sequencing strategies used in the taxonomic identification and characterization of food-related microbiomes. These sequencing strategies have used different NGS platforms for DNA and RNA sequence identification. Traditionally, 16S rDNA sequencing has played a key role in understanding the taxonomic composition of a food-related microbiome. Recently, metagenomic approaches have resulted in improved understanding of a microbiome by providing a species-level/strain-level characterization. Further, metatranscriptomic approaches have contributed to the functional characterization of the complex interactions between different microbial communities within a single microbiome. Many studies have highlighted the use of NGS techniques in investigating the microbiome of fermented foods. However, the utilization of NGS techniques in studying the microbiome of non-fermented foods are limited. This review provides a brief overview of the advances in DNA sequencing chemistries as the technology progressed from first, next and third generations and highlights how NGS provided a deeper understanding of food-related microbiomes with special focus on non-fermented foods. PMID:29033905

  1. The use of 16s rDNA methods in soil microbial ecology Uso de métodos 16S rDNA em ecologia microbiana do solo

    Directory of Open Access Journals (Sweden)

    Andrew Macrae

    2000-06-01

    Full Text Available New and exciting molecular methods, many using the 16S small sub-unit ribosomal nucleic acid molecule, are opening the microbial "black box" in soil. These studies have added much to our knowledge of microbial diversity in soils, and are beginning to advance our understanding of the relationship between this diversity and its function in soil processes. Over the next few years, the knowledge gained from molecular studies will, we hope, lead to improvements in sustainable land management and sustainable exploitation of soil genetic resources. As we enter the third millenium, it is appropriate to review the application of 16S rDNA methods to soil microbiology. This review examines 16S ribosomal DNA (rDNA methods and their application to soil. It mentions their limits and suggests how they may be applied in the future.Novas e excitantes técnicas moleculares muitas usando a fração 16S da subunidade menor da molécula de ácido nucleico ribossomal, estão abrindo a "caixa-preta" da microbiologia do solo. Esses estudos têm acrescentado muito ao nosso conhecimento acerca da diversidade microbiana no solo, e começam a avançar nosso entendimento sobre a relação entre essa diversidade a sua função nos processos no solo. Ao longo dos próximos anos, o conhecimento obtido a partir de técnicas moleculares irão, esperamos, levar a melhoramentos do manejo de áreas sustentáveis da exploração dos recursos genéticos do solo. Com a chegada do terceiro milênio, é apropriado revermos a aplicação das técnicas da fração 16S do rDNA em microbiologia de solo. Esta revisão examina aplicações das técnicas da fração 16S do DNA (RNA no solo, menciona seus limites e sugere como elas poderão ser usadas no futuro.

  2. Comparative analysis of seven viral nuclear export signals (NESs reveals the crucial role of nuclear export mediated by the third NES consensus sequence of nucleoprotein (NP in influenza A virus replication.

    Directory of Open Access Journals (Sweden)

    Nopporn Chutiwitoonchai

    Full Text Available The assembly of influenza virus progeny virions requires machinery that exports viral genomic ribonucleoproteins from the cell nucleus. Currently, seven nuclear export signal (NES consensus sequences have been identified in different viral proteins, including NS1, NS2, M1, and NP. The present study examined the roles of viral NES consensus sequences and their significance in terms of viral replication and nuclear export. Mutation of the NP-NES3 consensus sequence resulted in a failure to rescue viruses using a reverse genetics approach, whereas mutation of the NS2-NES1 and NS2-NES2 sequences led to a strong reduction in viral replication kinetics compared with the wild-type sequence. While the viral replication kinetics for other NES mutant viruses were also lower than those of the wild-type, the difference was not so marked. Immunofluorescence analysis after transient expression of NP-NES3, NS2-NES1, or NS2-NES2 proteins in host cells showed that they accumulated in the cell nucleus. These results suggest that the NP-NES3 consensus sequence is mostly required for viral replication. Therefore, each of the hydrophobic (Φ residues within this NES consensus sequence (Φ1, Φ2, Φ3, or Φ4 was mutated, and its viral replication and nuclear export function were analyzed. No viruses harboring NP-NES3 Φ2 or Φ3 mutants could be rescued. Consistent with this, the NP-NES3 Φ2 and Φ3 mutants showed reduced binding affinity with CRM1 in a pull-down assay, and both accumulated in the cell nucleus. Indeed, a nuclear export assay revealed that these mutant proteins showed lower nuclear export activity than the wild-type protein. Moreover, the Φ2 and Φ3 residues (along with other Φ residues within the NP-NES3 consensus were highly conserved among different influenza A viruses, including human, avian, and swine. Taken together, these results suggest that the Φ2 and Φ3 residues within the NP-NES3 protein are important for its nuclear export function

  3. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

    Science.gov (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

    2014-05-01

    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  4. Phylogeny and revision of Erpobdelliformes (Annelida, Arhynchobdellida from Mexico based on nuclear and mithochondrial gene sequences. Filogenia y revisión de los Erpobdelliformes (Annelida, Arhynchobdellida de México, con base en secuencias de ADN nuclear y mitocondrial

    Directory of Open Access Journals (Sweden)

    Alejandro Oceguera-Figueroa

    2005-12-01

    Full Text Available The phylogenetic relationships of the suborder Erpobdelliformes, a group of non-sanguivorous leeches, were investigated with the use of mitochondrial cytochrome c oxidase subunit I, mitochondrial 12S rDNA and nuclear 18S rDNA. The resulting hypothesis indicates that Erpobdellidae and Salifidae are monophyletic and each other closest relatives. We detect, for first time in leeches, intra-specific variation of similar amount than inter-specific variation. We formally resurrect the name Erpobdella mexicana, proposed by Dugès for Mexican specimens, and recommend the use of the name Erpobdella ochoterenai rather than Erpobdella microstoma for Mexican specimens. We record an invasive species of the family Salifidae: Barbronia arcana in Mexico, representing the first record of the species outside Australia, first record of the family in Mexico and third in the New World.Se estudian las relaciones filogenéticas del suborden Erpobdelliformes, un grupo de sanguijuelas no hematófagas de vertebrados, con base en secuencias de la subunidad I del citocromo c oxidasa del ADN mitocondrial, 12S ADNr del ADN mitocondrial y 18S ADNr del ADN nuclear. La hipótesis resultante señala que las familias Salifidae y Erpobdellidae son monofiléticas y hermanas entre sí. Se detecta por primera vez en sanguijuelas variación interespecífica de magnitud similar a la variación interespecífica. Formalmente se reslece el nombre empleado por Dugès: Erpobdella mexicana para las formas mexicanas, así como se argumenta sobre el uso del nombre Erpobdella ochoterenai en lugar de Erpobdella microstoma para las formas mexicanas. Se registra a una especie invasora de la familia Salifidae en México: Barbronia arcana, el cual constituye el primer registro de la especie fuera de Australia, primer registro de la familia en México y tercero en el continente americano.

  5. A new clade, based on partial LSU rDNA sequences, of unarmoured dinoflagellates.

    Science.gov (United States)

    Reñé, Albert; de Salas, Miguel; Camp, Jordi; Balagué, Vanessa; Garcés, Esther

    2013-09-01

    The order Gymnodiniales comprises unarmoured dinoflagellates. However, the lack of sequences hindered determining the phylogenetic positions and systematic relationships of several gymnodinioid taxa. In this study, a monophyletic clade was defined for the species Ceratoperidinium margalefii Loeblich III, Gyrodinium falcatum Kofoid & Swezy, three Cochlodinium species, and two Gymnodinium-like dinoflagellates. Despite their substantial morphotypic differentiation, Cochlodinium cf. helix, G. falcatum and 'Gymnodinium' sp. 1 share a common shape of the acrobase. The phylogenetic data led to the following conclusions: (1) C. margalefii is closely related to several unarmoured dinoflagellates. Its sulcus shape has been observed for the first time. (2) G. falcatum was erroneously assigned to the genus Gyrodinium and is transferred to Ceratoperidinium (C. falcatum (Kofoid & Swezy) Reñé & de Salas comb. nov.). (3) The genus Cochlodinium is polyphyletic and thus artificial; our data support its separation into three different genera. (4) The two Gymnodinium-like species could not be morphologically or phylogenetically related to any other gymnodinioid species sequenced to date. While not all studied species have been definitively transferred to the correct genus, our study is a step forward in the classification of inconspicuous unarmoured dinoflagellates. The family Ceratoperidiniaeceae and the genus Ceratoperidinium are emended. Copyright © 2013 Elsevier GmbH. All rights reserved.

  6. Ribosomal RNA Genes Contribute to the Formation of Pseudogenes and Junk DNA in the Human Genome.

    Science.gov (United States)

    Robicheau, Brent M; Susko, Edward; Harrigan, Amye M; Snyder, Marlene

    2017-02-01

    Approximately 35% of the human genome can be identified as sequence devoid of a selected-effect function, and not derived from transposable elements or repeated sequences. We provide evidence supporting a known origin for a fraction of this sequence. We show that: 1) highly degraded, but near full length, ribosomal DNA (rDNA) units, including both 45S and Intergenic Spacer (IGS), can be found at multiple sites in the human genome on chromosomes without rDNA arrays, 2) that these rDNA sequences have a propensity for being centromere proximal, and 3) that sequence at all human functional rDNA array ends is divergent from canonical rDNA to the point that it is pseudogenic. We also show that small sequence strings of rDNA (from 45S + IGS) can be found distributed throughout the genome and are identifiable as an "rDNA-like signal", representing 0.26% of the q-arm of HSA21 and ∼2% of the total sequence of other regions tested. The size of sequence strings found in the rDNA-like signal intergrade into the size of sequence strings that make up the full-length degrading rDNA units found scattered throughout the genome. We conclude that the displaced and degrading rDNA sequences are likely of a similar origin but represent different stages in their evolution towards random sequence. Collectively, our data suggests that over vast evolutionary time, rDNA arrays contribute to the production of junk DNA. The concept that the production of rDNA pseudogenes is a by-product of concerted evolution represents a previously under-appreciated process; we demonstrate here its importance. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Genotypic diversity of oscillatoriacean strains belonging to the genera Geitlerinema and Spirulina determined by 16S rDNA restriction analysis.

    Science.gov (United States)

    Margheri, Maria C; Piccardi, Raffaella; Ventura, Stefano; Viti, Carlo; Giovannetti, Luciana

    2003-05-01

    Genotypic diversity of several cyanobacterial strains mostly isolated from marine or brackish waters, belonging to the genera Geitlerinema and Spirulina, was investigated by amplified 16S ribosomal DNA restriction analysis and compared with morphological features and response to salinity. Cluster analysis was performed on amplified 16S rDNA restriction profiles of these strains along with profiles obtained from sequence data of five Spirulina-like strains, including three representatives of the new genus Halospirulina. Our strains with tightly coiled trichomes from hypersaline waters could be assigned to the Halospirulina genus. Among the uncoiled strains, the two strains of hypersaline origin clustered together and were found to be distant from their counterparts of marine and freshwater habitat. Moreover, another cluster, formed by alkali-tolerant strains with tightly coiled trichomes, was well delineated.

  8. Phylogenetic relationships and timing of diversification in gonorynchiform fishes inferred using nuclear gene DNA sequences (Teleostei: Ostariophysi).

    Science.gov (United States)

    Near, Thomas J; Dornburg, Alex; Friedman, Matt

    2014-11-01

    The Gonorynchiformes are the sister lineage of the species-rich Otophysi and provide important insights into the diversification of ostariophysan fishes. Phylogenies of gonorynchiforms inferred using morphological characters and mtDNA gene sequences provide differing resolutions with regard to the sister lineage of all other gonorynchiforms (Chanos vs. Gonorynchus) and support for monophyly of the two miniaturized lineages Cromeria and Grasseichthys. In this study the phylogeny and divergence times of gonorynchiforms are investigated with DNA sequences sampled from nine nuclear genes and a published morphological character matrix. Bayesian phylogenetic analyses reveal substantial congruence among individual gene trees with inferences from eight genes placing Gonorynchus as the sister lineage to all other gonorynchiforms. Seven gene trees resolve Cromeria and Grasseichthys as a clade, supporting previous inferences using morphological characters. Phylogenies resulting from either concatenating the nuclear genes, performing a multispecies coalescent species tree analysis, or combining the morphological and nuclear gene DNA sequences resolve Gonorynchus as the living sister lineage of all other gonorynchiforms, strongly support the monophyly of Cromeria and Grasseichthys, and resolve a clade containing Parakneria, Cromeria, and Grasseichthys. The morphological dataset, which includes 13 gonorynchiform fossil taxa that range in age from Early Cretaceous to Eocene, was analyzed in combination with DNA sequences from the nine nuclear genes and a relaxed molecular clock to estimate times of evolutionary divergence. This "tip dating" strategy accommodates uncertainty in the phylogenetic resolution of fossil taxa that provide calibration information in the relaxed molecular clock analysis. The estimated age of the most recent common ancestor (MRCA) of living gonorynchiforms is slightly older than estimates from previous node dating efforts, but the molecular tip dating

  9. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    Science.gov (United States)

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

  10. Systematics of a kleptoplastidal dinoflagellate, Gymnodinium eucyaneum Hu (Dinophyceae), and its cryptomonad endosymbiont.

    Science.gov (United States)

    Xia, Shuang; Zhang, Qi; Zhu, Huan; Cheng, Yingyin; Liu, Guoxiang; Hu, Zhengyu

    2013-01-01

    New specimens of the kleptoplastidal dinoflagellate Gymnodinium eucyaneum Hu were collected in China. We investigated the systematics of the dinoflagellate and the origin of its endosymbiont based on light morphology and phylogenetic analyses using multiple DNA sequences. Cells were dorsoventrally flattened with a sharply acute hypocone and a hemispherical epicone. The confusion between G. eucyaneum and G. acidotum Nygaard still needs to be resolved. We found that the hypocone was conspicuously larger than the epicone in most G. eucyaneum cells, which differed from G. acidotum, but there were a few cells whose hypocone and epicone were of nearly the same size. In addition, there was only one site difference in the partial nuclear LSU rDNA sequences of a sample from Japan given the name G. acidotum and G. eucyaneum in the present study, which suggest that G. eucyaneum may be a synonym of G. acidotum. Spectroscopic analyses and phylogenetic analyses based on nucleomorph SSU rDNA sequences and chloroplast 23 s rDNA sequences suggested that the endosymbiont of G. eucyaneum was derived from Chroomonas (Cryptophyta), and that it was most closely related to C. coerulea Skuja. Moreover, the newly reported kleptoplastidal dinoflagellates G. myriopyrenoides and G. eucyaneum in our study were very similar, and the taxonomy of kleptoplastidal dinoflagellates was discussed.

  11. Raptor, a positive regulatory subunit of mTOR complex 1, is a novel phosphoprotein of the rDNA transcription machinery in nucleoli and chromosomal nucleolus organizer regions (NORs).

    Science.gov (United States)

    Vazquez-Martin, Alejandro; Cufí, Sílvia; Oliveras-Ferraros, Cristina; Menendez, Javier A

    2011-09-15

    Raptor is the key scaffolding protein that recruits mTOR substrates to rapamycin-sensitive mTOR complex 1 (mTORC1), a molecular integrator of mitogenic and nutrient/energy environmental inputs into protein translation and cell growth. Although Raptor phosphorylation on various sites is pivotal in the regulation of mTORC1 activity, it remains to be elucidated whether site-specific phosphorylation differentially distributes Raptor to unique subcellular compartments. When exploring the spatiotemporal cell cycle dynamics of six different phospho (P)-Raptor isoforms (Thr ( 706) , Ser ( 722) , Ser ( 863) , Ser ( 792) and Ser ( 877) ), a number of remarkable events differentially defined a topological resetting of P-RaptorThr706 on interphasic and mitotic chromosomes. In interphase nuclei, P-Raptor (Thr706) co-localized with fibrillarin, a component of the nucleolar small nuclear ribonucleoprotein particle, as well as with RNA polymerase I, the enzyme that transcribes nucleolar rRNA. Upon Actinomycin D-induced nucleolar segregation and disaggregation, P-RaptorThr706 was excluded from the nucleolus to accumulate at discrete nucleoplasmic bodies. During mitosis, CDK1 inhibition-induced premature assembly of nucleoli relocated fibrillarin to the surrounding regions of chromosomal-associated P-Raptor (Thr706) , suggesting that a subpopulation of mitotic P-Raptor (Thr706) remained targeted at chromosomal loops of rDNA or nuclear organizer regions (NORs). At the end of mitosis and cytokinesis, when reassembly of incipient nucleoli begins upon NORs activation of rDNA transcription, fibrillarin spatially reorganized with P-Raptor (Thr706) to give rise to daughter nucleoli. Treatment with IGF1 exclusively hyperactivated nuclear P-Raptor (Ser706) and concomitantly promoted Ser ( 2481) autophosphorylation of mTOR, which monitors mTORC1-associated catalytic activity. Nucleolar- and NOR-associated P-Raptor (Ser706) may physically link mTORC1 signaling to ever-growing nucleolus

  12. Photobiont diversity in lichens from metal-rich substrata based on ITS rDNA sequences.

    Science.gov (United States)

    Backor, Martin; Peksa, Ondrej; Skaloud, Pavel; Backorová, Miriam

    2010-05-01

    The photobiont is considered as the more sensitive partner of lichen symbiosis in metal pollution. For this reason the presence of a metal tolerant photobiont in lichens may be a key factor of ecological success of lichens growing on metal polluted substrata. The photobiont inventory was examined for terricolous lichen community growing in Cu mine-spoil heaps derived by historical mining. Sequences of internal transcribed spacer (ITS) were phylogenetically analyzed using maximum likelihood analyses. A total of 50 ITS algal sequences were obtained from 22 selected lichen taxa collected at three Cu mine-spoil heaps and two control localities. Algae associated with Cladonia and Stereocaulon were identified as members of several Asterochloris lineages, photobionts of cetrarioid lichens clustered with Trebouxia hypogymniae ined. We did not find close relationship between heavy metal content (in localities as well as lichen thalli) and photobiont diversity. Presence of multiple algal genotypes in single lichen thallus has been confirmed. Copyright 2009 Elsevier Inc. All rights reserved.

  13. The ITS1-5.8S-ITS2 sequence region in the Musaceae: structure, diversity and use in molecular phylogeny.

    Directory of Open Access Journals (Sweden)

    Eva Hřibová

    2011-03-01

    Full Text Available Genes coding for 45S ribosomal RNA are organized in tandem arrays of up to several thousand copies and contain 18S, 5.8S and 26S rRNA units separated by internal transcribed spacers ITS1 and ITS2. While the rRNA units are evolutionary conserved, ITS show high level of interspecific divergence and have been used frequently in genetic diversity and phylogenetic studies. In this work we report on the structure and diversity of the ITS region in 87 representatives of the family Musaceae. We provide the first detailed information on ITS sequence diversity in the genus Musa and describe the presence of more than one type of ITS sequence within individual species. Both Sanger sequencing of amplified ITS regions and whole genome 454 sequencing lead to similar phylogenetic inferences. We show that it is necessary to identify putative pseudogenic ITS sequences, which may have negative effect on phylogenetic reconstruction at lower taxonomic levels. Phylogenetic reconstruction based on ITS sequence showed that the genus Musa is divided into two distinct clades--Callimusa and Australimusa and Eumusa and Rhodochlamys. Most of the intraspecific banana hybrids analyzed contain conserved parental ITS sequences, indicating incomplete concerted evolution of rDNA loci. Independent evolution of parental rDNA in hybrids enables determination of genomic constitution of hybrids using ITS. The observation of only one type of ITS sequence in some of the presumed interspecific hybrid clones warrants further study to confirm their hybrid origin and to unravel processes leading to evolution of their genomes.

  14. Nuclear Trafficking of the Rabies Virus Interferon Antagonist P-Protein Is Regulated by an Importin-Binding Nuclear Localization Sequence in the C-Terminal Domain.

    Directory of Open Access Journals (Sweden)

    Caitlin L Rowe

    Full Text Available Rabies virus P-protein is expressed as five isoforms (P1-P5 which undergo nucleocytoplasmic trafficking important to roles in immune evasion. Although nuclear import of P3 is known to be mediated by an importin (IMP-recognised nuclear localization sequence in the N-terminal region (N-NLS, the mechanisms underlying nuclear import of other P isoforms in which the N-NLS is inactive or has been deleted have remained unresolved. Based on the previous observation that mutation of basic residues K214/R260 of the P-protein C-terminal domain (P-CTD can result in nuclear exclusion of P3, we used live cell imaging, protein interaction analysis and in vitro nuclear transport assays to examine in detail the nuclear trafficking properties of this domain. We find that the effect of mutation of K214/R260 on P3 is largely dependent on nuclear export, suggesting that nuclear exclusion of mutated P3 involves the P-CTD-localized nuclear export sequence (C-NES. However, assays using cells in which nuclear export is pharmacologically inhibited indicate that these mutations significantly inhibit P3 nuclear accumulation and, importantly, prevent nuclear accumulation of P1, suggestive of effects on NLS-mediated import activity in these isoforms. Consistent with this, molecular binding and transport assays indicate that the P-CTD mediates IMPα2/IMPβ1-dependent nuclear import by conferring direct binding to the IMPα2/IMPβ1 heterodimer, as well as to a truncated form of IMPα2 lacking the IMPβ-binding autoinhibitory domain (ΔIBB-IMPα2, and IMPβ1 alone. These properties are all dependent on K214 and R260. This provides the first evidence that P-CTD contains a genuine IMP-binding NLS, and establishes the mechanism by which P-protein isoforms other than P3 can be imported to the nucleus. These data underpin a refined model for P-protein trafficking that involves the concerted action of multiple NESs and IMP-binding NLSs, and highlight the intricate regulation of P

  15. Formal Revision of the Alexandrium tamarense Species Complex (Dinophyceae) Taxonomy: The Introduction of Five Species with Emphasis on Molecular-based (rDNA) Classification

    Science.gov (United States)

    John, Uwe; Litaker, R. Wayne; Montresor, Marina; Murray, Shauna; Brosnahan, Michael L.; Anderson, Donald M.

    2015-01-01

    The Alexandrium tamarense species complex is one of the most studied marine dinoflagellate groups due to its ecological, toxicological and economic importance. Several members of this complex produce saxitoxin and its congeners – potent neurotoxins that cause paralytic shellfish poisoning. Isolates from this complex are assigned to A. tamarense, A. fundyense, or A. catenella based on two main morphological characters: the ability to form chains and the presence/absence of a ventral pore between Plates 1′ and 4′. However, studies have shown that these characters are not consistent and/or distinctive. Further, phylogenies based on multiple regions in the rDNA operon indicate that the sequences from morphologically indistinguishable isolates partition into five clades. These clades were initially named based on their presumed geographic distribution, but recently were renamed as Groups I–V following the discovery of sympatry among some groups. In this study we present data on morphology, ITS/5.8S genetic distances, ITS2 compensatory base changes, mating incompatibilities, toxicity, the sxtA toxin synthesis gene, and rDNA phylogenies. All results were consistent with each group representing a distinct cryptic species. Accordingly, the groups were assigned species names as follows: Group I, A. fundyense; Group II, A. mediterraneum; Group III, A. tamarense; Group IV, A. pacificum; Group V, A. australiense. PMID:25460230

  16. Modulation of immune response to rDNA hepatitis B vaccination by psychological stress

    NARCIS (Netherlands)

    L. Jabaaij (Lea); J. van Hattum (Jan); A.J.J.M. Vingerhoets (Ad); F.G. Oostveen (Frank); H.J. Duivenvoorden (Hugo); R.E. Ballieux (Rudy)

    1996-01-01

    textabstractIn a previous study it was shown that antibody formation after vaccination with a low-dose recombinant DNA (rDNA) hepatitis B vaccine was negatively influenced by psychological stress. The present study was designed to assess whether the same inverse relation between HBs-antibody levels

  17. Electron microscopic in situ hybridization and autoradiography: Localization and transcription of rDNA in human lymphocyte nucleoli

    International Nuclear Information System (INIS)

    Wachtler, F.; Mosgoeller, W.S.; Schwarzacher, H.G.

    1990-01-01

    The distribution of ribosomal DNA (rDNA) in the nucleoli of human lymphocytes was revealed by in situ hybridization with a nonautoradiographic procedure at the electron microscopic level. rDNA is located in the dense fibrillar component of the nucleolus but not in the fibrillar centers. In the same cells the incorporation of tritiated uridine takes place in the dense fibrillar component of the nucleolus as seen by autoradiography followed by gold latensification. From these findings it can be concluded that the transcription of ribosomal DNA takes place in the dense fibrillar component of the nucleolus

  18. Prediction of accident sequence probabilities in a nuclear power plant due to earthquake events

    International Nuclear Information System (INIS)

    Hudson, J.M.; Collins, J.D.

    1980-01-01

    This paper presents a methodology to predict accident probabilities in nuclear power plants subject to earthquakes. The resulting computer program accesses response data to compute component failure probabilities using fragility functions. Using logical failure definitions for systems, and the calculated component failure probabilities, initiating event and safety system failure probabilities are synthesized. The incorporation of accident sequence expressions allows the calculation of terminal event probabilities. Accident sequences, with their occurrence probabilities, are finally coupled to a specific release category. A unique aspect of the methodology is an analytical procedure for calculating top event probabilities based on the correlated failure of primary events

  19. Mitochondrial DNA sequence-based phylogenetic relationship of Trichiurus lepturus (Perciformes: Trichiuridae) from the Persian Gulf

    Science.gov (United States)

    Tamadoni Jahromi, S.; Mohd Noor, S. A.; Pirian, K.; Dehghani, R.; Nazemi, M.; Khazaali, A.

    2016-01-01

    In this study, mitochondrial DNA analysis using 16S ribosomal DNA (rDNA) was performed to investigate the phylogeny relationship of Trichiurus lepturus in the Persian Gulf compared to the other investigated area. The amplification of 16S rDNA resulted in a product of 600 bp in all samples. The results showed that the isolated strain belongs to T. lepturus showing 42 divergence sites among the same reported partial sequences of 16S rRNA gene from the other area (West Atlantic and Indo-Pacific area). Phylogeny results showed that all 18 haplotypes of the species clustered into five clades with reasonably high bootstrap support of values (>64%). Overall, the tree topology for both phylogenetic and phenetic trees for 16S rDNA was similar. Both trees exposed two major clusters, one wholly containing the haplotypes of the T. lepturus species belonging to Indo-Pacific area with two major sister groups including Persian Gulf specimen and the other cleared the Western Atlantic and Japan individuals clustered in another distinct clade supporting the differentiation between the two areas. Phylogenic relationship observed between the Persian Gulf and the other Indo-Pacific Individuals suggested homogeneity between two mentioned areas. PMID:27822250

  20. Phylogeny of holoparasitic Orobanche (Orobanchaceae) inferred from nuclear ITS sequences.

    Science.gov (United States)

    Schneeweiss, Gerald M; Colwell, Alison; Park, Jeong-Mi; Jang, Chang-Gee; Stuessy, Tod F

    2004-02-01

    Orobanche is the largest genus among the holoparasitic members of Orobanchaceae. We present the first molecular phylogenetic analysis (using nuclear ITS sequences) that includes members of all sections of Orobanche, Gymnocaulis, Myzorrhiza, Trionychon, and Orobanche. Orobanche is not monophyletic, but falls into two lineages: (1) the Orobanche group comprises Orobanche sect. Orobanche and the small Near Asian genus Diphelypaea and is characterized by a chromosome base number of x=19 and (2) the Phelipanche group contains Orobanche sects. Gymnocaulis, Myzorrhiza, and Trionychon and possesses a chromosome base number of x=12. The relationships between these two groups and to other genera such as Boschniakia or Cistanche remain unresolved. Within the Orobanche group, Orobanche macrolepis and Orobanche anatolica (including Orobanche colorata) constitute two phylogenetically distinct lineages. Intrasectional structurings proposed by some authors for O. sect. Orobanche are not confirmed by the molecular data. In most cases, intraspecific sequence divergence between accessions, if present, is negligible and not correlated with morphological or ecological traits. In a few cases, however, there is evidence for the presence of cryptic taxa.

  1. Phylogeny of holoparasitic Orobanche (Orobanchaceae) inferred from nuclear ITS sequences

    Science.gov (United States)

    Schneeweiss, G.M.; Colwell, A.; Park, J.-M.; Jang, C.-G.; Stuessy, Tod F.

    2004-01-01

    Orobanche is the largest genus among the holoparasitic members of Orobanchaceae. We present the first molecular phylogenetic analysis (using nuclear ITS sequences) that includes members of all sections of Orobanche, Gymnocaulis, Myzorrhiza, Trionychon, and Orobanche. Orobanche is not monophyletic, but falls into two lineages: (1) the Orobanche group comprises Orobanche sect. Orobanche and the small Near Asian genus Diphelypaea and is characterized by a chromosome base number of x = 19 and (2) the Phelipanche group contains Orobanche sects. Gymnocaulis, Myzorrhiza, and Trionychon and possesses a chromosome base number of x = 12. The relationships between these two groups and to other genera such as Boschniakia or Cistanche remain unresolved. Within the Orobanche group, Orobanche macrolepis and Orobanche anatolica (including Orobanche colorata) constitute two phylogenetically distinct lineages. Intrasectional structurings proposed by some authors for O. sect. Orobanche are not confirmed by the molecular data. In most cases, intraspecific sequence divergence between accessions, if present, is negligible and not correlated with morphological or ecological traits. In a few cases, however, there is evidence for the presence of cryptic taxa. ?? 2003 Elsevier Science (USA). All rights reserved.

  2. Characterization of three different clusters of 18S-26S ribosomal DNA genes in the sea urchin P. lividus: Genetic and epigenetic regulation synchronous to 5S rDNA.

    Science.gov (United States)

    Bellavia, Daniele; Dimarco, Eufrosina; Caradonna, Fabio

    2016-04-15

    We previously reported the characterization 5S ribosomal DNA (rDNA) clusters in the common sea urchin Paracentrotus lividus and demonstrated the presence of DNA methylation-dependent silencing of embryo specific 5S rDNA cluster in adult tissue. In this work, we show genetic and epigenetic characterization of 18S-26S rDNA clusters in this specie. The results indicate the presence of three different 18S-26S rDNA clusters with different Non-Transcribed Spacer (NTS) regions that have different chromosomal localizations. Moreover, we show that the two largest clusters are hyper-methylated in the promoter-containing NTS regions in adult tissues, as in the 5S rDNA. These findings demonstrate an analogous epigenetic regulation in small and large rDNA clusters and support the logical synchronism in building ribosomes. In fact, all the ribosomal RNA genes must be synchronously and equally transcribed to perform their unique final product. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Grierson, Patrick M. [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Acharya, Samir, E-mail: samir.acharya@osumc.edu [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Groden, Joanna [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States)

    2013-03-15

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription.

  4. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    International Nuclear Information System (INIS)

    Grierson, Patrick M.; Acharya, Samir; Groden, Joanna

    2013-01-01

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription

  5. Complete mitochondrial genome sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting domestic turkeys

    OpenAIRE

    Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Barta, John R

    2014-01-01

    Background Clinical and subclinical coccidiosis is cosmopolitan and inflicts significant losses to the poultry industry globally. Seven named Eimeria species are responsible for coccidiosis in turkeys: Eimeria dispersa; Eimeria meleagrimitis; Eimeria gallopavonis; Eimeria meleagridis; Eimeria adenoeides; Eimeria innocua; and, Eimeria subrotunda. Although attempts have been made to characterize these parasites molecularly at the nuclear 18S rDNA and ITS loci, the maternally-derived and mitotic...

  6. Short Interspersed Nuclear Element (SINE) Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293.

    Science.gov (United States)

    Kanhayuwa, Lakkhana; Coutts, Robert H A

    2016-01-01

    Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.

  7. Biodiversity and molecular ecology of Russula and Lactarius in Alaska based on soil and sporocarp DNA sequences

    Science.gov (United States)

    Geml J.; D.L. Taylor

    2013-01-01

    Although critical for the functioning of ecosystems, fungi are poorly known in highlatitude regions. This paper summarizes the results of the first genetic diversity assessments of Russula and Lactarius, two of the most diverse and abundant fungal genera in Alaska. SU rDNA sequences from both curated sporocarp collections and soil PCR clone libraries sampled in...

  8. 18S rDNA phylogeny of lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa.

    Directory of Open Access Journals (Sweden)

    Anna Maria Fiore-Donno

    Full Text Available The phylogenetic position of the slime-mould genus Lamproderma (Myxomycetes, Amoebozoa challenges traditional taxonomy: although it displays the typical characters of the order Stemonitales, it appears to be sister to Physarales. This study provides a small subunit (18S or SSU ribosomal RNA gene-based phylogeny of Lamproderma and its allies, with new sequences from 49 specimens in 12 genera. We found that the order Stemonitales and Lamproderma were both ancestral to Physarales and that Lamproderma constitutes several clades intermingled with species of Diacheopsis, Colloderma and Elaeomyxa. We suggest that these genera may have evolved from Lamproderma by multiple losses of fruiting body stalks and that many taxonomic revisions are needed. We found such high genetic diversity within three Lamproderma species that they probably consist of clusters of sibling species. We discuss the contrasts between genetic and morphological divergence and implications for the morphospecies concept, highlighting the phylogenetically most reliable morphological characters and pointing to others that have been overestimated. In addition, we showed that the first part (~600 bases of the SSU rDNA gene is a valuable tool for phylogeny in Myxomycetes, since it displayed sufficient variability to distinguish closely related taxa and never failed to cluster together specimens considered of the same species.

  9. Comparative physical mapping of 18S rDNA in the karyotypes of six leafcutter ant species of the genera Atta and Acromyrmex (Formicidae: Myrmicinae).

    Science.gov (United States)

    Teixeira, Gisele Amaro; Barros, Luísa Antônia Campos; de Aguiar, Hilton Jeferson Alves Cardoso; das Graças Pompolo, Silvia

    2017-10-01

    Leafcutter ants of the Atta and Acromyrmex genera are important plagues in different cultures. Cytogenetic data on chromosome number, morphology, and chromosomal banding pattern are only available for 17 species of leafcutter ants. Molecular cytogenetic data for the detection of ribosomal genes by the FISH technique are scarce, and only 15 Neotropical ant species have been studied. This study aimed to physically map the 18S ribosomal RNA genes (rDNA) of six leafcutter ants belonging to the genera Atta and Acromyrmex using FISH. The results were compared with data on the fluorochrome CMA 3 currently available for these species. All analyzed species presented the 18S rDNA on one pair of chromosomes. In Acromyrmex subterraneus molestans and Ac. aspersus, FISH signals were observed in the terminal region of the short arm of the largest subtelocentric pair, while in Atta bisphaerica, A. laevigata, and A. sexdens, FISH signals were observed in the interstitial region of the long arm of the fourth metacentric pair. In Acromyrmex striatus, 18S rDNA was located in the interstitial region of the second metacentric pair. The karyotypic formula for Ac. aspersus was 2n = 38 (8m + 10sm + 16st + 4a), representing the first report in this species. The observed 18S rDNA regions in A. laevigata, A. sexdens, A. bisphaerica, Ac. aspersus, and Ac. subterraneus molestans corresponded to the CMA 3 + bands, while in Ac. striatus, several GC-rich bands and one pair of 18S rDNA bands were observed. No differential bands were visible using the DAPI fluorochrome. Karyotype uniformity with previously studied Atta spp. was also observed at the level of molecular cytogenetics using 18S rDNA FISH. A difference in the size of the chromosomal pair carrying the 18S rDNA gene was observed in Ac. striatus (2n = 22) and Atta spp. (2n = 22) highlighting the dissimilarity between these species. The results from the present study contribute to the description of 18S rDNA clusters

  10. Molecular diagnosis of Wolbachia endosymbiont from Iranian ...

    African Journals Online (AJOL)

    ... Wolbachia 16S rDNA gene. PCR product was directly sequenced and the alignment of the sequence with similar sequences in GenBank showed high similarity with 16S rDNA gene of Wolbachia endosymbiont of Drosophila melanogaster. Key words: Wolbachia, Iranian scorpion, 16S rDNA gene, Hemiscorpius lepturus.

  11. Phylogeny of five species of Nusuttodinium gen. nov. (Dinophyceae), a genus of unarmoured kleptoplastidic dinoflagellates.

    Science.gov (United States)

    Takano, Yoshihito; Yamaguchi, Haruyo; Inouye, Isao; Moestrup, Øjvind; Horiguchi, Takeo

    2014-12-01

    Cells of five unarmoured kleptoplastidic dinoflagellates, Amphidinium latum, Amphidinium poecilochroum, Gymnodinium amphidinioides, Gymnodinium acidotum and Gymnodinium aeruginosum were observed under light and/or scanning electron microscopy and subjected to single-cell PCR. The SSU rDNA and the partial LSU rDNA of all the examined species were sequenced, and the SSU rDNA of G. myriopyrenoides was sequenced. Phylogenetic analyses revealed that the unarmoured kleptoplastidic species formed a monophyletic clade within the Gymnodinium-clade sensu Daugbjerg et al. (2000). The sister taxa for this clade were Gymnodinium palustre and Spiniferodinium galeiforme, both of which possess brown-coloured chloroplasts. The results indicated that acquisition of kleptoplastidy in these unarmoured dinoflagellates was a single event and that these unarmoured kleptoplastidic dinoflagellates may have evolved from a form with permanent chloroplasts. Molecular trees suggested that the acquisition of kleptoplastidy took place in a marine habitat and later some species colonized the freshwater habitat. Because these unarmoured kleptoplastidic dinoflagellates are monophyletic and characterized by distinct morphological and cytological features (including the presence of the same type of apical groove, absence of nuclear chambers in the nuclear envelope, absence of genuine chloroplasts, and the possession of kleptochloroplasts), we propose the establishment of a new genus, Nusuttodinium, to accommodate all these dinoflagellates. Copyright © 2014 Elsevier GmbH. All rights reserved.

  12. Identification of tissue-embedded ascarid larvae by ribosomal DNA sequencing.

    Science.gov (United States)

    Ishiwata, Kenji; Shinohara, Akio; Yagi, Kinpei; Horii, Yoichiro; Tsuchiya, Kimiyuki; Nawa, Yukifumi

    2004-01-01

    Polymerase chain reaction (PCR) was applied to identify tissue-embedded ascarid nematode larvae. Two sequences of the internal transcribed spacer (ITS) regions of ribosomal DNA (rDNA), ITS1 and ITS2, of the ascarid parasites were amplified and compared with those of ascarid-nematodes registered in a DNA database (GenBank). The ITS sequences of the PCR products obtained from the ascarid parasite specimen in our laboratory were compatible with those of registered adult Ascaris and Toxocara parasites. PCR amplification of the ITS regions was sensitive enough to detect a single larva of Ascaris suum mixed with porcine liver tissue. Using this method, ascarid larvae embedded in the liver of a naturally infected turkey were identified as Toxocara canis. These results suggest that even a single larva embedded in tissues from patients with larva migrans could be identified by sequencing the ITS regions.

  13. The proteins of intra-nuclear bodies: a data-driven analysis of sequence, interaction and expression

    Directory of Open Access Journals (Sweden)

    Bodén Mikael

    2010-04-01

    Full Text Available Abstract Background Cajal bodies, nucleoli, PML nuclear bodies, and nuclear speckles are morpohologically distinct intra-nuclear structures that dynamically respond to cellular cues. Such nuclear bodies are hypothesized to play important regulatory roles, e.g. by sequestering and releasing transcription factors in a timely manner. While the nucleolus and nuclear speckles have received more attention experimentally, the PML nuclear body and the Cajal body are still incompletely characterized in terms of their roles and protein complement. Results By collating recent experimentally verified data, we find that almost 1000 proteins in the mouse nuclear proteome are known to associate with one or more of the nuclear bodies. Their gene ontology terms highlight their regulatory roles: splicing is confirmed to be a core activity of speckles and PML nuclear bodies house a range of proteins involved in DNA repair. We train support-vector machines to show that nuclear proteins contain discriminative sequence features that can be used to identify their intra-nuclear body associations. Prediction accuracy is highest for nucleoli and nuclear speckles. The trained models are also used to estimate the full protein complement of each nuclear body. Protein interactions are found primarily to link proteins in the nuclear speckles with proteins from other compartments. Cell cycle expression data provide support for increased activity in nucleoli, nuclear speckles and PML nuclear bodies especially during S and G2 phases. Conclusions The large-scale analysis of the mouse nuclear proteome sheds light on the functional organization of physically embodied intra-nuclear compartments. We observe partial support for the hypothesis that the physical organization of the nucleus mirrors functional modularity. However, we are unable to unambiguously identify proteins' intra-nuclear destination, suggesting that critical drivers behind of intra-nuclear translocation are yet to

  14. Problematic barcoding in flatworms: A case-study on monogeneans and rhabdocoels (Platyhelminthes

    Directory of Open Access Journals (Sweden)

    Maarten Vanhove

    2013-12-01

    Full Text Available Some taxonomic groups are less amenable to mitochondrial DNA barcoding than others. Due to the paucity of molecular information of understudied groups and the huge molecular diversity within flatworms, primer design has been hampered. Indeed, all attempts to develop universal flatworm-specific COI markers have failed so far. We demonstrate how high molecular variability and contamination problems limit the possibilities for barcoding using standard COI-based protocols in flatworms. As a consequence, molecular identification methods often rely on other widely applicable markers. In the case of Monogenea, a very diverse group of platyhelminth parasites, and Rhabdocoela, representing one-fourth of all free-living flatworm taxa, this has led to a relatively high availability of nuclear ITS and 18S/28S rDNA sequences on GenBank. In a comparison of the effectiveness in species assignment we conclude that mitochondrial and nuclear ribosomal markers perform equally well. In case intraspecific information is needed, rDNA sequences can guide the selection of the appropriate (i.e. taxon-specific COI primers if available.

  15. Utility of combining morphological characters, nuclear and mitochondrial genes: An attempt to resolve the conflicts of species identification for ciliated protists.

    Science.gov (United States)

    Zhao, Yan; Yi, Zhenzhen; Gentekaki, Eleni; Zhan, Aibin; Al-Farraj, Saleh A; Song, Weibo

    2016-01-01

    Ciliates comprise a highly diverse protozoan lineage inhabiting all biotopes and playing crucial roles in regulating microbial food webs. Nevertheless, subtle morphological differences and tiny sizes hinder proper species identification for many ciliates. Here, we use the species-rich taxon Frontonia and employ both nuclear and mitochondrial loci. We attempt to assess the level of genetic diversity and evaluate the potential of each marker in delineating species of Frontonia. Morphological features and ecological characteristics are also integrated into genetic results, in an attempt to resolve conflicts of species identification based on morphological and molecular methods. Our studies reveal: (1) the mitochondrial cox1 gene, nuclear ITS1 and ITS2 as well as the hypervariable D2 region of LSU rDNA are promising candidates for species delineation; (2) the cox1 gene provides the best resolution for analyses below the species level; (3) the V2 and V4 hypervariable regions of SSU rDNA, and D1 of LSU rDNA as well as the 5.8S rDNA gene do not show distinct barcoding gap due to overlap between intra- and inter-specific genetic divergences; (4) morphological character-based analysis shows promise for delimitation of Frontonia species; and (5) all gene markers and character-based analyses demonstrate that the genus Frontonia consists of three groups and monophyly of the genus Frontonia is questionable. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Randomly detected genetically modified (GM maize (Zea mays L. near a transport route revealed a fragile 45S rDNA phenotype.

    Directory of Open Access Journals (Sweden)

    Nomar Espinosa Waminal

    Full Text Available Monitoring of genetically modified (GM crops has been emphasized to prevent their potential effects on the environment and human health. Monitoring of the inadvertent dispersal of transgenic maize in several fields and transport routes in Korea was carried out by qualitative multiplex PCR, and molecular analyses were conducted to identify the events of the collected GM maize. Cytogenetic investigations through fluorescence in situ hybridization (FISH of the GM maize were performed to check for possible changes in the 45S rDNA cluster because this cluster was reported to be sensitive to replication and transcription stress. Three GM maize kernels were collected from a transport route near Incheon port, Korea, and each was found to contain NK603, stacked MON863 x NK603, and stacked NK603 x MON810 inserts, respectively. Cytogenetic analysis of the GM maize containing the stacked NK603 x MON810 insert revealed two normal compact 5S rDNA signals, but the 45S rDNA showed a fragile phenotype, demonstrating a "beads-on-a-string" fragmentation pattern, which seems to be a consequence of genetic modification. Implications of the 45S rDNA cluster fragility in GM maize are also discussed.

  17. Systematics of a kleptoplastidal dinoflagellate, Gymnodinium eucyaneum Hu (Dinophyceae, and its cryptomonad endosymbiont.

    Directory of Open Access Journals (Sweden)

    Shuang Xia

    Full Text Available New specimens of the kleptoplastidal dinoflagellate Gymnodinium eucyaneum Hu were collected in China. We investigated the systematics of the dinoflagellate and the origin of its endosymbiont based on light morphology and phylogenetic analyses using multiple DNA sequences. Cells were dorsoventrally flattened with a sharply acute hypocone and a hemispherical epicone. The confusion between G. eucyaneum and G. acidotum Nygaard still needs to be resolved. We found that the hypocone was conspicuously larger than the epicone in most G. eucyaneum cells, which differed from G. acidotum, but there were a few cells whose hypocone and epicone were of nearly the same size. In addition, there was only one site difference in the partial nuclear LSU rDNA sequences of a sample from Japan given the name G. acidotum and G. eucyaneum in the present study, which suggest that G. eucyaneum may be a synonym of G. acidotum. Spectroscopic analyses and phylogenetic analyses based on nucleomorph SSU rDNA sequences and chloroplast 23 s rDNA sequences suggested that the endosymbiont of G. eucyaneum was derived from Chroomonas (Cryptophyta, and that it was most closely related to C. coerulea Skuja. Moreover, the newly reported kleptoplastidal dinoflagellates G. myriopyrenoides and G. eucyaneum in our study were very similar, and the taxonomy of kleptoplastidal dinoflagellates was discussed.

  18. C-banding and fluorescent in situ hybridization with rDNA sequences in chromosomes of Cycloneda sanguinea Linnaeus (Coleoptera, Coccinellidae

    Directory of Open Access Journals (Sweden)

    Eliane Mariza Dortas Maffei

    2004-01-01

    Full Text Available The aim of this study was to describe mitotic and meiotic chromosomes of Cycloneda sanguinea using C-banding, fluorescent in situ hybridization (FISH rDNA probes, and sequential FISH/Ag-NOR staining. The chromosome number was 2n = 18 + XX for females and 2n = 18 + Xy for males. The X chromosome was metacentric and the Y chromosome was very small. During meiosis, the karyotypic meioformula was n = 9 + Xy p, and sex chromosomes configured a parachute at metaphase I. At the beginning of pachytene, bivalents were still individualized, and sex chromosomes were associated end-to-end through the heteropycnotic region of the X chromosome. Later in pachytene, further condensation led to the formation of a pseudo-ring by the sex bivalent. All chromosomes showed pericentromeric heterochromatin. FISH and sequential FISH/Ag-NOR staining evidenced the location of the nucleolar organizer region in one pair of autosomes (at spermatogonial metaphase. During meiosis, these genes were mapped to a region outside the sex vesicle by FISH, although Xy p was deeply stained with silver at metaphase I. These results suggest that these argyrophilic substances are of a nucleolar protein nature, and seem to be synthesized by a pair of autosomes and imported during meiosis (prophase I to the sex pair, during the association of the sex chromosomes.

  19. DNA-based approaches to identify forest fungi in Pacific Islands: A pilot study

    Science.gov (United States)

    Anna E. Case; Sara M. Ashiglar; Phil G. Cannon; Ernesto P. Militante; Edwin R. Tadiosa; Mutya Quintos-Manalo; Nelson M. Pampolina; John W. Hanna; Fred E. Brooks; Amy L. Ross-Davis; Mee-Sook Kim; Ned B. Klopfenstein

    2013-01-01

    DNA-based diagnostics have been successfully used to characterize diverse forest fungi (e.g., Hoff et al. 2004, Kim et al. 2006, Glaeser & Lindner 2011). DNA sequencing of the internal transcribed spacer (ITS) and large subunit (LSU) regions of nuclear ribosomal DNA (rDNA) has proved especially useful (Sonnenberg et al. 2007, Seifert 2009, Schoch et al. 2012) for...

  20. Short Interspersed Nuclear Element (SINE Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293.

    Directory of Open Access Journals (Sweden)

    Lakkhana Kanhayuwa

    Full Text Available Novel families of short interspersed nuclear element (SINE sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.

  1. Molecular systematics of Indian Alysicarpus (Fabaceae) based on analyses of nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Gholami, Akram; Subramaniam, Shweta; Geeta, R; Pandey, Arun K

    2017-06-01

    Alysicarpus Necker ex Desvaux (Fabaceae, Desmodieae) consists of ~30 species that are distributed in tropical and subtropical regions of theworld. In India, the genus is represented by ca. 18 species, ofwhich seven are endemic. Sequences of the nuclear Internal transcribed spacer from38 accessions representing 16 Indian specieswere subjected to phylogenetic analyses. The ITS sequence data strongly support the monophyly of the genus Alysicarpus. Analyses revealed four major well-supported clades within Alysicarpus. Ancestral state reconstructions were done for two morphological characters, namely calyx length in relation to pod (macrocalyx and microcalyx) and pod surface ornamentation (transversely rugose and nonrugose). The present study is the first report on molecular systematics of Indian Alysicarpus.

  2. Restless 5S: the re-arrangement(s) and evolution of the nuclear ribosomal DNA in land plants.

    Science.gov (United States)

    Wicke, Susann; Costa, Andrea; Muñoz, Jesùs; Quandt, Dietmar

    2011-11-01

    Among eukaryotes two types of nuclear ribosomal DNA (nrDNA) organization have been observed. Either all components, i.e. the small ribosomal subunit, 5.8S, large ribosomal subunit, and 5S occur tandemly arranged or the 5S rDNA forms a separate cluster of its own. Generalizations based on data derived from just a few model organisms have led to a superimposition of structural and evolutionary traits to the entire plant kingdom asserting that plants generally possess separate arrays. This study reveals that plant nrDNA organization into separate arrays is not a distinctive feature, but rather assignable almost solely to seed plants. We show that early diverging land plants and presumably streptophyte algae share a co-localization of all rRNA genes within one repeat unit. This raises the possibility that the state of rDNA gene co-localization had occurred in their common ancestor. Separate rDNA arrays were identified for all basal seed plants and water ferns, implying at least two independent 5S rDNA transposition events during land plant evolution. Screening for 5S derived Cassandra transposable elements which might have played a role during the transposition events, indicated that this retrotransposon is absent in early diverging vascular plants including early fern lineages. Thus, Cassandra can be rejected as a primary mechanism for 5S rDNA transposition in water ferns. However, the evolution of Cassandra and other eukaryotic 5S derived elements might have been a side effect of the 5S rDNA cluster formation. Structural analysis of the intergenic spacers of the ribosomal clusters revealed that transposition events partially affect spacer regions and suggests a slightly different transcription regulation of 5S rDNA in early land plants. 5S rDNA upstream regulatory elements are highly divergent or absent from the LSU-5S spacers of most early divergent land plant lineages. Several putative scenarios and mechanisms involved in the concerted relocation of hundreds of 5S

  3. 16S rDNA analysis of the effect of fecal microbiota transplantation on pulmonary and intestinal flora.

    Science.gov (United States)

    Liu, Tianhao; Yang, Zhongshan; Zhang, Xiaomei; Han, Niping; Yuan, Jiali; Cheng, Yu

    2017-12-01

    This study aims to explore the effect of FMT on regulations of dysbacteriosis of pulmonary and intestinal flora in rats with 16S rDNA sequencing technology. A total of 27 SPF rats (3-4 weeks old) were randomly divided into three groups: normal control group (K), model control group (MX), and fecal microbiota transplantation group (FMT); each group contained nine rats. The OTU values of the pulmonary and intestinal flora of the MX group decreased significantly compared with the normal control group. After FMT, the OTU value of pulmonary flora increased, while the value of OTU in intestinal flora declined. At the phylum level, FMT down-regulated Proteobacteria , Firmicutes , and Bacteroidetes in the pulmonary flora. At the genus level, FMT down-regulated Pseudomonas , Sphingobium , Lactobacillus , Rhizobium , and Acinetobacter , thus maintaining the balance of the pulmonary flora. Moreover, FMT could change the structure and diversity of the pulmonary and intestinal flora by positively regulating the pulmonary flora and negatively regulating intestinal flora. This study may provide a scientific basis for FMT treatment of respiratory diseases.

  4. Variation in ribosomal and mitochondrial DNA sequences demonstrates the existence of intraspecific groups in Paramecium multimicronucleatum (Ciliophora, Oligohymenophorea).

    Science.gov (United States)

    Tarcz, Sebastian; Potekhin, Alexey; Rautian, Maria; Przyboś, Ewa

    2012-05-01

    This is the first phylogenetic study of the intraspecific variability within Paramecium multimicronucleatum with the application of two-loci analysis (ITS1-5.8S-ITS2-5'LSU rDNA and COI mtDNA) carried out on numerous strains originated from different continents. The species has been shown to have a complex structure of several sibling species within taxonomic species. Our analysis revealed the existence of 10 haplotypes for the rDNA fragment and 15 haplotypes for the COI fragment in the studied material. The mean distance for all of the studied P. multimicronucleatum sequence pairs was p=0.025/0.082 (rDNA/COI). Despite the greater variation of the COI fragment, the COI-derived tree topology is similar to the tree topology constructed on the basis of the rDNA fragment. P. multimicronucleatum strains are divided into three main clades. The tree based on COI fragment analysis presents a greater resolution of the studied P. multimicronucleatum strains. Our results indicate that the strains of P. multimicronucleatum that appear in different clades on the trees could belong to different syngens. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Whole genome sequencing in clinical and public health microbiology.

    Science.gov (United States)

    Kwong, J C; McCallum, N; Sintchenko, V; Howden, B P

    2015-04-01

    Genomics and whole genome sequencing (WGS) have the capacity to greatly enhance knowledge and understanding of infectious diseases and clinical microbiology.The growth and availability of bench-top WGS analysers has facilitated the feasibility of genomics in clinical and public health microbiology.Given current resource and infrastructure limitations, WGS is most applicable to use in public health laboratories, reference laboratories, and hospital infection control-affiliated laboratories.As WGS represents the pinnacle for strain characterisation and epidemiological analyses, it is likely to replace traditional typing methods, resistance gene detection and other sequence-based investigations (e.g., 16S rDNA PCR) in the near future.Although genomic technologies are rapidly evolving, widespread implementation in clinical and public health microbiology laboratories is limited by the need for effective semi-automated pipelines, standardised quality control and data interpretation, bioinformatics expertise, and infrastructure.

  6. An N-terminal nuclear localization sequence but not the calmodulin-binding domain mediates nuclear localization of nucleomorphin, a protein that regulates nuclear number in Dictyostelium

    International Nuclear Information System (INIS)

    Myre, Michael A.; O'Day, Danton H.

    2005-01-01

    Nucleomorphin is a novel nuclear calmodulin (CaM)-binding protein (CaMBP) containing an extensive DEED (glu/asp repeat) domain that regulates nuclear number. GFP-constructs of the 38 kDa NumA1 isoform localize as intranuclear patches adjacent to the inner nuclear membrane. The translocation of CaMBPs into nuclei has previously been shown by others to be mediated by both classic nuclear localization sequences (NLSs) and CaM-binding domains (CaMBDs). Here we show that NumA1 possesses a CaMBD ( 171 EDVSRFIKGKLLQKQQKIYKDLERF 195 ) containing both calcium-dependent-binding motifs and an IQ-like motif for calcium-independent binding. GFP-constructs containing only NumA1 residues 1-129, lacking the DEED and CaMBDs, still localized as patches at the internal periphery of nuclei thus ruling out a direct role for the CaMBD in nuclear import. These constructs contained the amino acid residues 48 KKSYQDPEIIAHSRPRK 64 that include both a putative bipartite and classical NLS. GFP-bipartite NLS constructs localized uniformly within nuclei but not as patches. As with previous work, removal of the DEED domain resulted in highly multinucleate cells. However as shown here, multinuclearity only occurred when the NLS was present allowing the protein to enter nuclei. Site-directed mutation analysis in which the NLS was changed to 48 EF 49 abolished the stability of the GFP fusion at the protein but not RNA level preventing subcellular analyses. Cells transfected with the 48 EF 49 construct exhibited slowed growth when compared to parental AX3 cells and other GFP-NumA1 deletion mutants. In addition to identifying an NLS that is sufficient for nuclear translocation of nucleomorphin and ruling out CaM-binding in this event, this work shows that the nuclear localization of NumA1 is crucial to its ability to regulate nuclear number in Dictyostelium

  7. Nonviral Gene Targeting at rDNA Locus of Human Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Youjin Hu

    2013-01-01

    Full Text Available Background. Genetic modification, such as the addition of exogenous genes to the MSC genome, is crucial to their use as cellular vehicles. Due to the risks associated with viral vectors such as insertional mutagenesis, the safer nonviral vectors have drawn a great deal of attention. Methods. VEGF, bFGF, vitamin C, and insulin-transferrin-selenium-X were supplemented in the MSC culture medium. The cells’ proliferation and survival capacity was measured by MTT, determination of the cumulative number of cells, and a colony-forming efficiency assay. The plasmid pHr2-NL was constructed and nucleofected into MSCs. The recombinants were selected using G418 and characterized using PCR and Southern blotting. Results. BFGF is critical to MSC growth and it acted synergistically with vitamin C, VEGF, and ITS-X, causing the cells to expand significantly. The neomycin gene was targeted to the rDNA locus of human MSCs using a nonviral human ribosomal targeting vector. The recombinant MSCs retained multipotential differentiation capacity, typical levels of hMSC surface marker expression, and a normal karyotype, and none were tumorigenic in nude mice. Conclusions. Exogenous genes can be targeted to the rDNA locus of human MSCs while maintaining the characteristics of MSCs. This is the first nonviral gene targeting of hMSCs.

  8. Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA

    Directory of Open Access Journals (Sweden)

    Zhongai Li

    2015-01-01

    Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.

  9. Population structure of the African savannah elephant inferred from mitochondrial control region sequences and nuclear microsatellite loci

    DEFF Research Database (Denmark)

    Nyakaana, S; Arctander, P; Siegismund, H R

    2002-01-01

    Two hundred and thirty-six mitochondrial DNA nucleotide sequences were used in combination with polymorphism at four nuclear microsatellite loci to assess the amount and distribution of genetic variation within and between African savannah elephants. They were sampled from 11 localities in easter...

  10. Hedysarum L. (Fabaceae: Hedysareae) Is Not Monophyletic - Evidence from Phylogenetic Analyses Based on Five Nuclear and Five Plastid Sequences.

    Science.gov (United States)

    Liu, Pei-Liang; Wen, Jun; Duan, Lei; Arslan, Emine; Ertuğrul, Kuddisi; Chang, Zhao-Yang

    2017-01-01

    The legume family (Fabaceae) exhibits a high level of species diversity and evolutionary success worldwide. Previous phylogenetic studies of the genus Hedysarum L. (Fabaceae: Hedysareae) showed that the nuclear and the plastid topologies might be incongruent, and the systematic position of the Hedysarum sect. Stracheya clade was uncertain. In this study, phylogenetic relationships of Hedysarum were investigated based on the nuclear ITS, ETS, PGDH, SQD1, TRPT and the plastid psbA-trnH, trnC-petN, trnL-trnF, trnS-trnG, petN-psbM sequences. Both nuclear and plastid data support two major lineages in Hedysarum: the Hedysarum s.s. clade and the Sartoria clade. In the nuclear tree, Hedysarum is biphyletic with the Hedysarum s.s. clade sister to the Corethrodendron + Eversmannia + Greuteria + Onobrychis clade (the CEGO clade), whereas the Sartoria clade is sister to the genus Taverniera DC. In the plastid tree, Hedysarum is monophyletic and sister to Taverniera. The incongruent position of the Hedysarum s.s. clade between the nuclear and plastid trees may be best explained by a chloroplast capture hypothesis via introgression. The Hedysarum sect. Stracheya clade is resolved as sister to the H. sect. Hedysarum clade in both nuclear and plastid trees, and our analyses support merging Stracheya into Hedysarum. Based on our new evidence from multiple sequences, Hedysarum is not monophyletic, and its generic delimitation needs to be reconsidered.

  11. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    an intron in the 26s rRNA coding region. The evolutionary relationship among the species of the T. pyriformis complex was examined on the basis of the rDNA maps with emphasis on similarities between two of the new species and the widely studied T. thermophila and T. pigmentosa. Examination of a large number...

  12. Bacterial diversity analysis of Huanglongbing pathogen-infected citrus, using PhyloChip and 16S rRNA gene clone library sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Shankar Sagaram, U.; DeAngelis, K.M.; Trivedi, P.; Andersen, G.L.; Lu, S.-E.; Wang, N.

    2009-03-01

    The bacterial diversity associated with citrus leaf midribs was characterized 1 from citrus groves that contained the Huanglongbing (HLB) pathogen, which has yet to be cultivated in vitro. We employed a combination of high-density phylogenetic 16S rDNA microarray and 16S rDNA clone library sequencing to determine the microbial community composition of symptomatic and asymptomatic citrus midribs. Our results revealed that citrus leaf midribs can support a diversity of microbes. PhyloChip analysis indicated that 47 orders of bacteria from 15 phyla were present in the citrus leaf midribs while 20 orders from phyla were observed with the cloning and sequencing method. PhyloChip arrays indicated that nine taxa were significantly more abundant in symptomatic midribs compared to asymptomatic midribs. Candidatus Liberibacter asiaticus (Las) was detected at a very low level in asymptomatic plants, but was over 200 times more abundant in symptomatic plants. The PhyloChip analysis was further verified by sequencing 16S rDNA clone libraries, which indicated the dominance of Las in symptomatic leaves. These data implicate Las as the pathogen responsible for HLB disease. Citrus is the most important commercial fruit crop in Florida. In recent years, citrus Huanglongbing (HLB), also called citrus greening, has severely affected Florida's citrus production and hence has drawn an enormous amount of attention. HLB is one of the most devastating diseases of citrus (6,13), characterized by blotchy mottling with green islands on leaves, as well as stunting, fruit decline, and small, lopsided fruits with poor coloration. The disease tends to be associated with a phloem-limited fastidious {alpha}-proteobacterium given a provisional Candidatus status (Candidatus Liberobacter spp. later changed to Candidatus Liberibacter spp.) in nomenclature (18,25,34). Previous studies indicate that HLB infection causes disorder in the phloem and severely impairs the translocation of assimilates in

  13. Concatenated SSU and LSU rDNA data confirm the main evolutionary trends within myxosporeans (Myxozoa: Myxosporea) and provide effective tool for their molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Fiala, Ivan; Hypša, Václav

    2009-01-01

    Roč. 53, č. 1 (2009), s. 81-93 ISSN 1055-7903 R&D Projects: GA AV ČR KJB600960701; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : myxosporea * phylogeny * LBA * LSU rDNA * 28S * SSU rDNA * 18S * D domains Subject RIV: EG - Zoology Impact factor: 3.556, year: 2009

  14. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  15. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  16. Variability of chloroplast DNA and nuclear ribosomal DNA in cassava (Manihot esculenta Crantz) and its wild relatives.

    Science.gov (United States)

    Fregene, M A; Vargas, J; Ikea, J; Angel, F; Tohme, J; Asiedu, R A; Akoroda, M O; Roca, W M

    1994-11-01

    Chloroplast DNA (cp) and nuclear ribosomal DNA (rDNA) variation was investigated in 45 accessions of cultivated and wild Manihot species. Ten independent mutations, 8 point mutations and 2 length mutations were identified, using eight restriction enzymes and 12 heterologous cpDNA probes from mungbean. Restriction fragment length polymorphism analysis defined nine distinct chloroplast types, three of which were found among the cultivated accessions and six among the wild species. Cladistic analysis of the cpDNA data using parsimony yielded a hypothetical phylogeny of lineages among the cpDNAs of cassava and its wild relatives that is congruent with morphological evolutionary differentiation in the genus. The results of our survey of cpDNA, together with rDNA restriction site change at the intergenic spacer region and rDNA repeat unit length variation (using rDNA cloned fragments from taro as probe), suggest that cassava might have arisen from the domestication of wild tuberous accessions of some Manihot species, followed by intensive selection. M. esculenta subspp flabellifolia is probably a wild progenitor. Introgressive hybridization with wild forms and pressures to adapt to the widely varying climates and topography in which cassava is found might have enhanced the crop's present day variability.

  17. Extensive 5.8S nrDNA polymorphism in Mammillaria (Cactaceae) with special reference to the identification of pseudogenic internal transcribed spacer regions.

    Science.gov (United States)

    Harpke, Doerte; Peterson, Angela

    2008-05-01

    The internal transcribed spacer (ITS) region (ITS1, 5.8S rDNA, ITS2) represents the most widely applied nuclear marker in eukaryotic phylogenetics. Although this region has been assumed to evolve in concert, the number of investigations revealing high degrees of intra-individual polymorphism connected with the presence of pseudogenes has risen. The 5.8S rDNA is the most important diagnostic marker for functionality of the ITS region. In Mammillaria, intra-individual 5.8S rDNA polymorphisms of up to 36% and up to nine different types have been found. Twenty-eight of 30 cloned genomic Mammillaria sequences were identified as putative pseudogenes. For the identification of pseudogenic ITS regions, in addition to formal tests based on substitution rates, we attempted to focus on functional features of the 5.8S rDNA (5.8S motif, secondary structure). The importance of functional data for the identification of pseudogenes is outlined and discussed. The identification of pseudogenes is essential, because they may cause erroneous phylogenies and taxonomic problems.

  18. Linking maternal and somatic 5S rRNA types with different sequence-specific non-LTR retrotransposons.

    Science.gov (United States)

    Locati, Mauro D; Pagano, Johanna F B; Ensink, Wim A; van Olst, Marina; van Leeuwen, Selina; Nehrdich, Ulrike; Zhu, Kongju; Spaink, Herman P; Girard, Geneviève; Rauwerda, Han; Jonker, Martijs J; Dekker, Rob J; Breit, Timo M

    2017-04-01

    5S rRNA is a ribosomal core component, transcribed from many gene copies organized in genomic repeats. Some eukaryotic species have two 5S rRNA types defined by their predominant expression in oogenesis or adult tissue. Our next-generation sequencing study on zebrafish egg, embryo, and adult tissue identified maternal-type 5S rRNA that is exclusively accumulated during oogenesis, replaced throughout the embryogenesis by a somatic-type, and thus virtually absent in adult somatic tissue. The maternal-type 5S rDNA contains several thousands of gene copies on chromosome 4 in tandem repeats with small intergenic regions, whereas the somatic-type is present in only 12 gene copies on chromosome 18 with large intergenic regions. The nine-nucleotide variation between the two 5S rRNA types likely affects TFIII binding and riboprotein L5 binding, probably leading to storage of maternal-type rRNA. Remarkably, these sequence differences are located exactly at the sequence-specific target site for genome integration by the 5S rRNA-specific Mutsu retrotransposon family. Thus, we could define maternal- and somatic-type MutsuDr subfamilies. Furthermore, we identified four additional maternal-type and two new somatic-type MutsuDr subfamilies, each with their own target sequence. This target-site specificity, frequently intact maternal-type retrotransposon elements, plus specific presence of Mutsu retrotransposon RNA and piRNA in egg and adult tissue, suggest an involvement of retrotransposons in achieving the differential copy number of the two types of 5S rDNA loci. © 2017 Locati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  19. Discrimination of the Lactobacillus acidophilus group using sequencing, species-specific PCR and SNaPshot mini-sequencing technology based on the recA gene.

    Science.gov (United States)

    Huang, Chien-Hsun; Chang, Mu-Tzu; Huang, Mu-Chiou; Wang, Li-Tin; Huang, Lina; Lee, Fwu-Ling

    2012-10-01

    To clearly identify specific species and subspecies of the Lactobacillus acidophilus group using phenotypic and genotypic (16S rDNA sequence analysis) techniques alone is difficult. The aim of this study was to use the recA gene for species discrimination in the L. acidophilus group, as well as to develop a species-specific primer and single nucleotide polymorphism primer based on the recA gene sequence for species and subspecies identification. The average sequence similarity for the recA gene among type strains was 80.0%, and most members of the L. acidophilus group could be clearly distinguished. The species-specific primer was designed according to the recA gene sequencing, which was employed for polymerase chain reaction with the template DNA of Lactobacillus strains. A single 231-bp species-specific band was found only in L. delbrueckii. A SNaPshot mini-sequencing assay using recA as a target gene was also developed. The specificity of the mini-sequencing assay was evaluated using 31 strains of L. delbrueckii species and was able to unambiguously discriminate strains belonging to the subspecies L. delbrueckii subsp. bulgaricus. The phylogenetic relationships of most strains in the L. acidophilus group can be resolved using recA gene sequencing, and a novel method to identify the species and subspecies of the L. delbrueckii and L. delbrueckii subsp. bulgaricus was developed by species-specific polymerase chain reaction combined with SNaPshot mini-sequencing. Copyright © 2012 Society of Chemical Industry.

  20. Phylogenetic and ecological analyses of soil and sporocarp DNA sequences reveal high diversity and strong habitat partitioning in the boreal ectomycorrhizal genus Russula (Russulales; Basidiomycota)

    Science.gov (United States)

    József Geml; Gary A. Laursen; Ian C. Herriott; Jack M. McFarland; Michael G. Booth; Niall Lennon; H. Chad Nusbaum; D. Lee Taylor

    2010-01-01

    Although critical for the functioning of ecosystems, fungi are poorly known in high-latitude regions. Here, we provide the first genetic diversity assessment of one of the most diverse and abundant ectomycorrhizal genera in Alaska: Russula. We analyzed internal transcribed spacer rDNA sequences from sporocarps and soil samples using phylogenetic...

  1. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences

    OpenAIRE

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-01

    Background The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Results Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consi...

  2. Pattern of phylogenetic diversification of the Cychrini ground beetles in the world as deduced mainly from sequence comparisons of the mitochondrial genes.

    Science.gov (United States)

    Su, Zhi-Hui; Imura, Yûki; Okamoto, Munehiro; Osawa, Syozo

    2004-02-04

    The phylogenetic position of the tribe Cychrini within the subfamily Carabinae (the family Carabidae) was estimated by comparing the nucleotide sequences of the mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and the nuclear 28S ribosomal DNA (rDNA). The phylogenetic trees suggest that the Cychrini would most probably be the oldest line within the Carabinae. Phylogenetic trees were constructed by comparing the mitochondrial cytochrome C oxidase subunit I (COI) gene sequences from 33 species of the Cychrini from various localities that include the whole distribution ranges of the representative species within all the known genera in the world. The trees suggest that the Cychrini members radiated into a number of phylogenetic lineages within a short period, starting about 44 million years ago (MYA). Most of the phylogenetic lineages or sublineages are geographically linked, each consisting of a single or only a few species without scarce morphological differentiation in spite of their long evolutionary histories (silent or near-silent evolution [see Adv. Biophys. 36 (1999) 65; J. Mol. Evol. 53 (2001) 517]). The fact suggests that the geographic isolation per se did not bring about conspicuous morphological differentiation. The phylogenetic lineages of the Cychrini well correspond to the taxonomically defined genera and the subgenera.

  3. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  4. Evolutional dynamics of 45S and 5S ribosomal DNA in ancient allohexaploid Atropa belladonna.

    Science.gov (United States)

    Volkov, Roman A; Panchuk, Irina I; Borisjuk, Nikolai V; Hosiawa-Baranska, Marta; Maluszynska, Jolanta; Hemleben, Vera

    2017-01-23

    Polyploid hybrids represent a rich natural resource to study molecular evolution of plant genes and genomes. Here, we applied a combination of karyological and molecular methods to investigate chromosomal structure, molecular organization and evolution of ribosomal DNA (rDNA) in nightshade, Atropa belladonna (fam. Solanaceae), one of the oldest known allohexaploids among flowering plants. Because of their abundance and specific molecular organization (evolutionarily conserved coding regions linked to variable intergenic spacers, IGS), 45S and 5S rDNA are widely used in plant taxonomic and evolutionary studies. Molecular cloning and nucleotide sequencing of A. belladonna 45S rDNA repeats revealed a general structure characteristic of other Solanaceae species, and a very high sequence similarity of two length variants, with the only difference in number of short IGS subrepeats. These results combined with the detection of three pairs of 45S rDNA loci on separate chromosomes, presumably inherited from both tetraploid and diploid ancestor species, example intensive sequence homogenization that led to substitution/elimination of rDNA repeats of one parent. Chromosome silver-staining revealed that only four out of six 45S rDNA sites are frequently transcriptionally active, demonstrating nucleolar dominance. For 5S rDNA, three size variants of repeats were detected, with the major class represented by repeats containing all functional IGS elements required for transcription, the intermediate size repeats containing partially deleted IGS sequences, and the short 5S repeats containing severe defects both in the IGS and coding sequences. While shorter variants demonstrate increased rate of based substitution, probably in their transition into pseudogenes, the functional 5S rDNA variants are nearly identical at the sequence level, pointing to their origin from a single parental species. Localization of the 5S rDNA genes on two chromosome pairs further supports uniparental

  5. Hedysarum L. (Fabaceae: Hedysareae) Is Not Monophyletic – Evidence from Phylogenetic Analyses Based on Five Nuclear and Five Plastid Sequences

    Science.gov (United States)

    Liu, Pei-Liang; Wen, Jun; Duan, Lei; Arslan, Emine; Ertuğrul, Kuddisi; Chang, Zhao-Yang

    2017-01-01

    The legume family (Fabaceae) exhibits a high level of species diversity and evolutionary success worldwide. Previous phylogenetic studies of the genus Hedysarum L. (Fabaceae: Hedysareae) showed that the nuclear and the plastid topologies might be incongruent, and the systematic position of the Hedysarum sect. Stracheya clade was uncertain. In this study, phylogenetic relationships of Hedysarum were investigated based on the nuclear ITS, ETS, PGDH, SQD1, TRPT and the plastid psbA-trnH, trnC-petN, trnL-trnF, trnS-trnG, petN-psbM sequences. Both nuclear and plastid data support two major lineages in Hedysarum: the Hedysarum s.s. clade and the Sartoria clade. In the nuclear tree, Hedysarum is biphyletic with the Hedysarum s.s. clade sister to the Corethrodendron + Eversmannia + Greuteria + Onobrychis clade (the CEGO clade), whereas the Sartoria clade is sister to the genus Taverniera DC. In the plastid tree, Hedysarum is monophyletic and sister to Taverniera. The incongruent position of the Hedysarum s.s. clade between the nuclear and plastid trees may be best explained by a chloroplast capture hypothesis via introgression. The Hedysarum sect. Stracheya clade is resolved as sister to the H. sect. Hedysarum clade in both nuclear and plastid trees, and our analyses support merging Stracheya into Hedysarum. Based on our new evidence from multiple sequences, Hedysarum is not monophyletic, and its generic delimitation needs to be reconsidered. PMID:28122062

  6. Determination of Trichuris skrjabini by sequencing of the ITS1-5.8S-ITS2 segment of the ribosomal DNA: comparative molecular study of different species of trichurids.

    Science.gov (United States)

    Cutillas, C; Oliveros, R; de Rojas, M; Guevara, D C

    2004-06-01

    Adults of Trichuris skrjahini have been isolated from the cecum of caprine hosts (Capra hircus), Trichuris ovis and Trichuris globulosa from Ovis aries (sheep) and C. hircus (goats), and Trichuris leporis from Lepus europaeus (rabbits) in Spain. Genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from the ribosomal DNA (rDNA) was amplified and sequenced by polymerase chain reaction (PCR) techniques. The ITS1 of T. skrjabini, T. ovis, T. globulosa, and T. leporis was 495, 757, 757, and 536 nucleotides in length, respectively, and had G + C contents of 59.6, 58.7, 58.7, and 60.8%, respectively. Intraindividual variation was detected in the ITSI sequences of the 4 species. Furthermore, the 5.8S sequences of T. skrjabini, T. ovis, T. globulosa, and T. leporis were compared. A total of 157, 152, 153, and 157 nucleotides in length was observed in the 5.8S sequences of these 4 species, respectively. There were no sequence differences of ITS1 and 5.8S products between T. ovis and T. globulosa. Nevertheless, clear differences were detected between the ITS1 sequences of T. skrjabini, T. ovis, T. leporis, Trichuris muris, and T. arvicolae. The ITS2 fragment from the rDNA of T. skrjabini was sequenced. A comparative study of the ITS2 sequence of T. skrjabini with the previously published ITS2 sequence data of T. ovis, T. leporis, T. muris, and T. arvicolae suggested that the combined use of sequence data from both spacers would be useful in the molecular characterization of trichurid parasites.

  7. CONTRIBUTION TO THE PHYLOGENY OF THE PANGASIIDAE BASED ON MITOCHONDRIAL 12S RDNA

    Directory of Open Access Journals (Sweden)

    L. Pouyaud

    2016-10-01

    Full Text Available Catfishes are generally one of the economically important groups of fresh and brackish water fishes in the world. In many countries, they form a significant part of inland fisheries, and several species have been  introduced in fish culture. Judging from literature, the main constraint to cultivate wild species and to optimise the production of pangasiid catfishes is due to the poorly documented systematics of this family. In the present contribution, the phylogenetic relationships within Pangasiidae are studied to contribute to a better insight in their taxonomy and evolution. The genetic relatedness is inferred using mitochondrial 12S rDNA gene sequences. To resolve the phylogenetic position of Laides in this group of catfish, five genera of Asian and African Schilbeidae are also considered. The results showed that a species group (complex could be clearly seen in the genetic tree. Pangasius is more derive than the other genera. By using approximate molecular clock/evolutionary calibration from  mitochondrial gene, a new episode of  speciation for the family marked explosive radiation about 5- 8 million years ago (mya. This adaptive radiation extended until the Late Pleistocene. Regarding the relationships between the Pangasiidae and Schilbeidae, two families show an allopatric distribution with slight overlap. The Pangasiidae occur mainly in Southeast Asia, while the Schilbeidae are seen mainly on the Indian subcontinent (including Myanmar and Africa. It confirms the separation between  Schilbeidae and Pangasiidae occurred in the Early Miocene.

  8. Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

    Czech Academy of Sciences Publication Activity Database

    Muchová, V.; Amiard, S.; Mozgová, I.; Dvořáčková, Martina; Gallego, M.E.; White, C.; Fajkus, Jiří

    2015-01-01

    Roč. 81, č. 2 (2015), s. 198-209 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GP13-11563P Institutional support: RVO:68081707 Keywords : DNA repair * genome instability * 45S rDNA Subject RIV: BO - Biophysics Impact factor: 5.468, year: 2015

  9. The directionality of the nuclear transport of the influenza A genome is driven by selective exposure of nuclear localization sequences on nucleoprotein

    Directory of Open Access Journals (Sweden)

    Panté Nelly

    2009-06-01

    Full Text Available Abstract Background Early in infection, the genome of the influenza A virus, consisting of eight complexes of RNA and proteins (termed viral ribonucleoproteins; vRNPs, enters the nucleus of infected cells for replication. Incoming vRNPs are imported into the nucleus of infected cells using at least two nuclear localization sequences on nucleoprotein (NP; NLS1 at the N terminus, and NLS2 in the middle of the protein. Progeny vRNP assembly occurs in the nucleus, and later in infection, these are exported from the nucleus to the cytoplasm. Nuclear-exported vRNPs are different from incoming vRNPs in that they are prevented from re-entering the nucleus. Why nuclear-exported vRNPs do not re-enter the nucleus is unknown. Results To test our hypothesis that the exposure of NLSs on the vRNP regulates the directionality of the nuclear transport of the influenza vRNPs, we immunolabeled the two NLSs of NP (NLS1 and NLS2 and analyzed their surface accessibility in cells infected with the influenza A virus. We found that the NLS1 epitope on NP was exposed throughout the infected cells, but the NLS2 epitope on NP was only exposed in the nucleus of the infected cells. Addition of the nuclear export inhibitor leptomycin B further revealed that NLS1 is no longer exposed in cytoplasmic NP and vRNPs that have already undergone nuclear export. Similar immunolabeling studies in the presence of leptomycin B and with cells transfected with the cDNA of NP revealed that the NLS1 on NP is hidden in nuclear exported-NP. Conclusion NLS1 mediates the nuclear import of newly-synthesized NP and incoming vRNPs. This NLS becomes hidden on nuclear-exported NP and nuclear-exported vRNPs. Thus the selective exposure of the NLS1 constitutes a critical mechanism to regulate the directionality of the nuclear transport of vRNPs during the influenza A viral life cycle.

  10. Localization of Daucus carota NMCP1 to the nuclear periphery: the role of the N-terminal region and an NLS-linked sequence motif, RYNLRR, in the tail domain

    Directory of Open Access Journals (Sweden)

    Yuta eKimura

    2014-02-01

    Full Text Available Recent ultrastructural studies revealed that a structure similar to the vertebrate nuclear lamina exists in the nuclei of higher plants. However, plant genomes lack genes for lamins and intermediate-type filament proteins, and this suggests that plant-specific nuclear coiled-coil proteins make up the lamina-like structure in plants. NMCP1 is a protein, first identified in Daucus carota cells, that localizes exclusively to the nuclear periphery in interphase cells. It has a tripartite structure comprised of head, rod, and tail domains, and includes putative nuclear localization signal (NLS motifs. We identified the functional NLS of DcNMCP1 (carrot NMCP1 and determined the protein regions required for localizing to the nuclear periphery using EGFP-fused constructs transiently expressed in Apium graveolens epidermal cells. Transcription was driven under a CaMV35S promoter, and the genes were introduced into the epidermal cells by a DNA-coated microprojectile delivery system. Of the NLS motifs, KRRRK and RRHK in the tail domain were highly functional for nuclear localization. Addition of the N-terminal 141 amino acids from DcNMCP1 shifted the localization of a region including these NLSs from the entire nucleus to the nuclear periphery. Using this same construct, the replacement of amino acids in RRHK or its preceding sequence, YNL, with alanine residues abolished localization to the nuclear periphery, while replacement of KRRRK did not affect localization. The sequence R/Q/HYNLRR/H, including YNL and the first part of the sequence of RRHK, is evolutionarily conserved in a subclass of NMCP1 sequences from many plant species. These results show that NMCP1 localizes to the nuclear periphery by a combined action of a sequence composed of R/Q/HYNLRR/H, NLS, and the N-terminal region including the head and a portion of the rod domain, suggesting that more than one binding site is implicated in localization of NMCP1.

  11. Development and evaluation of a novel fast broad-range 16S ribosomal DNA PCR and sequencing assay for diagnosis of bacterial infective endocarditis: multi-year experience in a large Canadian healthcare zone and a literature review.

    Science.gov (United States)

    Miller, Robert J H; Chow, Barbara; Pillai, Dylan; Church, Deirdre

    2016-04-12

    The study aimed to explore the sensitivity and specificity of a novel fast 16S rDNA PCR and sequencing assay for the improved diagnosis of infective endocarditis (IE) in patients with suspected native or prosthetic heart valve (HV) infection over a multi-year period at our cardiovascular center. Sixty-eight patients were prospectively enrolled who underwent HV replacement for suspected or confirmed IE between February 1, 2009 and September 1, 2014. Patient demographics, medical co-morbidities, Duke's criteria, culture results, and antibiotic therapy were collected by detailed chart reviews. Dual-priming oligonucleotide primers targeted to 500 bps of the V1-V3 region of the 16S rRNA gene were used to perform fast broad-range 16S rDNA PCR and Sanger sequencing on ribosomal DNA extracted from HV tissues. The performance/diagnostic efficiency of the molecular test was evaluated against blood cultures and Gram stain and culture of HV tissue in patients' with definite IE according to Duke's criteria. Fifty patients (73.5%) had definite IE and another 8 (11.8%) had possible IE according to Duke's criteria. Cardiac surgery was delayed an average of 15.4 days from the time of the patient's last positive blood culture, and appropriate antibiotic therapy was given in the pre-operative period. While 44/50 (88%) patients had a positive blood culture, HV tissue culture was only positive in 23 (46%) of them. Molecular testing of all HV tissues had sensitivity, specificity, NPV and PPV of 92, 77.8, 77.8 and 92% compared to 44, 100, 39.1 and 100% respectively for culture for diagnosis of definite IE. For prosthetic HV tissue, 16S rDNA PCR had sensitivity of 93% and specificity of 83% compared to 35 and 100% respectively for culture. A literature review showed that the diagnostic accuracy of our novel fast broad-range 16S rDNA PCR assay was similar or better than that of previously published studies. This novel fast broad-range 16S rDNA PCR/sequencing test had superior sensitivity

  12. Accidental sequences associated with the containment of the pressurized water nuclear installation - INAP

    International Nuclear Information System (INIS)

    Natacci, Faustina Beatriz; Correa, Francisco

    2002-01-01

    The analysis of accidental sequences associated with the Containment is one of the most important tasks during the development of the Probabilistic Safety Assessment (PSA) of nuclear plants mainly because of its importance on the mitigation of consequences of severe postulated accident initiating events. This paper presents a first approach of the Containment analysis of the INAP identifying failures and events that can compromise its performance, and outlining accidental sequences and Containment end states. The initial plant damage states, which are the input for this study, are based on the event trees developed in the PSA level 1 for the INAP. It should be emphasized that since this PSA is still in a preliminary stage it is subjected to further completion. Consequently, the Containment analysis shall also be revised in order to incorporate, in an extension as complete as possible, all initial plant damage states, the corresponding event trees, and the related Containment end states. Finally, it can be concluded that the evaluation of the qualitative analysis presented herein allows a concise and broad knowledge of the qualitative analysis presented herein allows a concise and broad knowledge of the development of accidental sequences related to the Containment of the INAP. (author)

  13. The next nuclear power station generation: Beyond-design accident concepts, methods, and action sequence

    International Nuclear Information System (INIS)

    Asmolov, V.G.; Khakh, O.Ya.; Shashkov, M.G.

    1993-01-01

    The problem of beyond-design accidents at nuclear stations will not be solved unless a safety culture becomes a basic characteristic of all lines of activity. Only then can the danger of accidents as an objective feature of nuclear stations be eliminated by purposive skilled and responsible activities of those implementing safety. Nuclear-station safety is provided by the following interacting and complementary lines of activity: (1) the design and construction of nuclear stations by properly qualified design and building organizations; (2) monitoring and supervision of safety by special state bodies; (3) control of the station by the exploiting organization; and (4) scientific examination of safety within the above framework and by independent organizations. The distribution of the responsibilities, powers, and right in these lines should be defined by a law on atomic energy, but there is not such law in Russian. The beyond-design accident problem is a key one in nuclear station safety, as it clear from the serious experience with accidents and numerous probabilistic studies. There are four features of the state of this topic in Russia that are of major significance for managing accidents: the lack of an atomic energy law, the inadequacy of the technical standards, the lack of a verified program package for nuclear-station designs in order to calculate the beyond-design accidents and analyze risks, and a lack of approach by designers to such accidents on the basis of international recommendations. This paper gives a brief description of three-forming points in the scientific activity: the general concept of nuclear-station safety, methods of analyzing and providing accident management, and the sequence of actions developed by specialists at this institute in recent years

  14. Uso de PCR e sequenciamento do rDNA 16S para identificação de bactérias do gênero Staphylococcus isoladas de mastite bovina

    Directory of Open Access Journals (Sweden)

    Carla C. Lange

    2011-01-01

    Full Text Available O objetivo deste trabalho foi identificar espécies de Staphylococcus (n=100 isoladas de mastite em rebanhos bovinos do Estado de Minas Gerais. Para esta finalidade foram utilizadas reações de PCR empregando oligonucleotídeos iniciadores descritos anteriormente para amplificar genes específicos de S. aureus (femA, S. intermedius (rDNA 16S e S. hyicus (rDNA 16S-23S e o sequenciamento do rDNA 16S. De acordo com as reações de PCR, 83 isolados foram identificados como S. aureus, 13 isolados como S. intermedius, dois como S. hyicus e dois isolados não foram identificados. Foram submetidos ao sequenciamento do rDNA 16S seis isolados identificados como S. aureus e os 17 restantes. Os seis isolados identificados como S. aureus confirmaram essa identificação. Dos outros 17 isolados, 13 foram identificados como S. chromogenes e quatro como S. hyicus, com similaridade igual ou superior a 99%. Baseando-se nos resultados da reação de PCR do gene femA e do sequenciamento do rDNA 16S, foram identificados 83 S. aureus, 13 S. chromogenes e quatro S. hyicus. Neste estudo os oligonucleotídeos iniciadores empregados na reação de PCR para S. intermedius não foram específicos, pois amplificaram também S. chromogenes; e os empregados na reação de PCR para S. hyicus não foram sensíveis, pois falharam na identificação de dois isolados de S. hyicus. A identificação definitiva das duas últimas espécies somente foi possível pelo sequenciamento do rDNA 16S.

  15. Explorability and predictability of the paleozoic sedimentary sequence beneath the Bruce nuclear site

    International Nuclear Information System (INIS)

    Parmenter, A.; Jensen, M.; Crowe, R.; Raven, K.

    2011-01-01

    Ontario Power Generation (OPG) is proposing to develop a Deep Geologic Repository (DGR) for the long-term management of its Low and Intermediate Level Waste (L&ILW) at the Bruce nuclear site located in the Municipality of Kincardine, Ontario. A 4-year program of geoscientific studies to assess the suitability of the 850 m thick Palaeozoic age sedimentary sequence beneath the site to host the DGR was completed in 2010. The studies provide evidence of a geologic setting in which the DGR concept would be safely implemented at a nominal depth of 680 m within the argillaceous limestone of the Cobourg Formation. This paper describes the geologic framework of the Bruce nuclear site with a focus on illustrating the high degree of stratigraphic continuity and traceability at site-specific and regional scales within the Ordovician sediments proposed to host and enclose the DGR. As part of the site-specific studies, a program of deep drilling/coring (6 boreholes) and in-situ testing through the sedimentary sequence was completed from 4 drill sites situated beyond the DGR footprint, approximately 1 km apart. Core logging reveals that the stratigraphic sequence comprises 34 distinct bedrock formations/members/units consistent with the known regional stratigraphic framework. These layered sedimentary formations dip 0.6 o (~10 m/km) to the southwest with highly uniform thicknesses both at the site- and regional-scale, particularly, the Ordovician sediments, which vary on the order of metres. The occurrence of steeply-dipping faults within the sedimentary sequence is not revealed through surface outcrop fracture mapping, micro-seismic (M ≥ 1) monitoring, inclined borehole coring or intersection of hydrothermal type dolomitized reservoir systems. Potential fault structures, interpreted from a 2-D seismic survey, were targeted by angled boreholes which found no evidence for their existence. Formation specific continuity is also evidence by the lateral traceability of physical rock

  16. Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

    Science.gov (United States)

    Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

    2004-09-01

    Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

  17. Cdc25A localisation and shuttling: characterisation of sequences mediating nuclear export and import

    International Nuclear Information System (INIS)

    Kaellstroem, Helena; Lindqvist, Arne; Pospisil, Vitek; Lundgren, Andreas; Karlsson Rosenthal, Christina

    2005-01-01

    The Cdc25 phosphatases play crucial roles in cell cycle progression by removing inhibitory phosphates from tyrosine and threonine residues of cyclin-dependent kinases. Cdc25A is an important regulator of the G1/S transition but functions also in the mitotic phase of the human cell cycle. In this paper, we investigate the sub-cellular localisation of exogenously expressed Cdc25A. We show that YFP-Cdc25A is localised both in the nucleus and the cytoplasm of HeLa cells and untransformed fibroblasts. Cell fusion assays and fluorescence loss in photobleaching (FLIP) assays reveal that the localisation is dynamic and the protein shuttles between the nucleus and the cytoplasm. We demonstrate that nuclear export of Cdc25A is partly mediated by an N-terminal nuclear export sequence (NES), in a manner not sensitive to the Exportin 1-inhibitor leptomycin B. A nuclear localisation signal (NLS) is also characterised, mutation of which leads to cytoplasmic localisation of Cdc25A. Our results imply that the Cdc25A phosphatase may interact with substrates and regulators both in the nucleus and the cytoplasm

  18. Diversification in insular plants: Inferring the phylogenetic relationship in Aeonium (Crassulaceae) using ITS sequences of nuclear ribosomal DNA

    DEFF Research Database (Denmark)

    Jorgensen, T.H.; Frydenberg, J.

    1999-01-01

    The ITS regions of nuclear ribosomal DNA were sequenced in 37 species of the genus Aeonium. A phylogeny obtained through the use of parsimony agrees to some extent with the sectional division of the genus and confirms the position of two newly described species. It also suggests the potential imp...

  19. Crystal structure of importin-{alpha} complexed with a classic nuclear localization sequence obtained by oriented peptide library screening

    Energy Technology Data Exchange (ETDEWEB)

    Takeda, A.A.S.; Fontes, M.R.M. [UNESP, Universidade Estadual Paulista, Botucatu, SP (Brazil); Yang, S.N.Y. [University of Melbourne, Melbourne (Australia); Harris, J.M. [Queensland University of Technology, Brisbane (Australia); Jans, D.A. [Monash University, Clayton (Australia); Kobe, B. [University of Queensland, Brisbane, QU (Australia)

    2012-07-01

    Full text: Importin-{alpha} (Imp{alpha}) plays a role in the classical nuclear import pathway, binding to cargo proteins with activities in the nucleus. Different Imp{alpha} paralogs responsible for specific cargos can be found in a single organism. The cargos contain nuclear localization sequences (NLSs), which are characterized by one or two clusters of basic amino acids (monopartite and bipartite NLSs, respectively). In this work we present the crystal structure of Imp{alpha} from M. musculus (residues 70-529, lacking the auto inhibitory domain) bound to a NLS peptide (pepTM). The peptide corresponds to the optimal sequence obtained by an oriented peptide library experiment designed to probe the specificity of the major NLS binding site. The peptide library used five degenerate positions and identified the sequence KKKRR as the optimal sequence for binding to this site for mouse Imp{alpha} (70-529). The protein was obtained using an E. coli expression system and purified by affinity chromatography followed by an ion exchange chromatography. A single crystal of Imp{alpha} -pepTM complex was grown by the hanging drop method. The data were collected using the Synchrotron Radiation Source LNLS, Brazil and processed to 2.3. Molecular replacement techniques were used to determine the crystal structure. Electron density corresponding to the peptide was present in both major and minor binding sites The peptide is bound to Imp{alpha} similar as the simian virus 40 (SV40) large tumour (T)-antigen NLS. Binding assays confirmed that the peptide bound to Imp{alpha} with low nM affinities. This is the first time that structural information has been linked to an oriented peptide library screening approach for importin-{alpha}; the results will contribute to understanding of the sequence determinants of classical NLSs, and may help identify as yet unidentified classical NLSs in novel proteins. (author)

  20. The predictable nature of the Paleozoic sedimentary sequence beneath the Bruce nuclear site in Southern Ontario, Canada

    International Nuclear Information System (INIS)

    Parmenter, Andrew; Jensen, Mark; Crowe, Richard

    2012-01-01

    Document available in extended abstract form only. A key aspect of a Deep Geologic Repository (DGR) safety case is the ability to develop and communicate an understanding of the geologic stability and resilience to change at time frames relevant to demonstrating repository performance. As part of an on-going Environmental Assessment, Ontario Power Generation (OPG) recently completed site-specific investigations within an 850 m thick Paleozoic sedimentary sequence beneath the Bruce nuclear site for the proposed development of a DGR for Low and Intermediate Level Waste (L and ILW). As envisioned, the shaft-accessed DGR would be excavated at a nominal depth of 680 m within the low permeability Ordovician argillaceous limestone of the Cobourg Formation, which is overlain by more than 200 m of low permeability Ordovician shale. The geo-scientific investigations revealed a relatively undeformed and laterally continuous architecture within the sedimentary sequence at the repository scale (1.5 km 2 ) and beyond. This paper explores the predictable nature of the sedimentary sequence that has contributed to increasing confidence in an understanding of the spatial distribution of groundwater system properties, deep groundwater system evolution and natural barrier performance. Multi-disciplinary geo-scientific investigations of the Bruce nuclear site were completed in 3 phases between 2006 and 2010. The sub-surface investigations included a deep drilling, coring and in-situ testing program and, the completion of a 19.7 km (9 lines) 2-D seismic reflection survey. The drilling program involved 6 (150 mm dia.) deep boreholes (4-vertical; 2 inclined) that were extended through the sedimentary sequence from 4 drill sites, arranged around the 0.3 km 2 footprint of the proposed repository. The more than 3.8 km of rock core (77 mm dia.) retrieved have provided, in part, a strong basis to understand bedrock lithology and mineralogy, facies assemblages, structure, and oil and gas

  1. [Structural organization of 5S ribosomal DNA of Rosa rugosa].

    Science.gov (United States)

    Tynkevych, Iu O; Volkov, R A

    2014-01-01

    In order to clarify molecular organization of the genomic region encoding 5S rRNA in diploid species Rosa rugosa several 5S rDNA repeated units were cloned and sequenced. Analysis of the obtained sequences revealed that only one length variant of 5S rDNA repeated units, which contains intact promoter elements in the intergenic spacer region (IGS) and appears to be transcriptionally active is present in the genome. Additionally, a limited number of 5S rDNA pseudogenes lacking a portion of coding sequence and the complete IGS was detected. A high level of sequence similarity (from 93.7 to 97.5%) between the IGS of major 5S rDNA variants of East Asian R. rugosa and North American R. nitida was found indicating comparatively recent divergence of these species.

  2. Cell-cycle-specific interaction of nuclear DNA-binding proteins with a CCAAT sequence from the human thymidine kinase gene

    International Nuclear Information System (INIS)

    Knight, G.B.; Gudas, J.M.; Pardee, A.B.

    1987-01-01

    Induction of thymidine kinase parallels the onset of DNA synthesis. To investigate the transcriptional regulation of the thymidine kinase gene, the authors have examined whether specific nuclear factors interact in a cell-cycle-dependent manner with sequences upstream of this gene. Two inverted CCAAT boxes near the transcriptional initiation sites were observed to form complexes with nuclear DNA-binding proteins. The nature of the complexes changes dramatically as the cells approach DNA synthesis and correlates well with the previously reported transcriptional increase of the thymidine kinase gene

  3. Identification of nucleosome assembly protein 1 (NAP1) as an interacting partner of plant ribosomal protein S6 (RPS6) and a positive regulator of rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Son, Ora [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Sunghan [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Shin, Yun-jeong [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Kim, Woo-Young [College of Pharmacy, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of); Koh, Hee-Jong, E-mail: heejkoh@snu.ac.kr [Department of Plant Science, Plant Genomics and Breeding Institute, Research Institute of Agriculture and Life Sciences, Seoul National University, Seoul 151-921 (Korea, Republic of); Cheon, Choong-Ill, E-mail: ccheon@sookmyung.ac.kr [Department of Biological Science, Sookmyung Women' s University, Seoul 140-742 (Korea, Republic of)

    2015-09-18

    The ribosomal protein S6 (RPS6) is a downstream component of the signaling mediated by the target of rapamycin (TOR) kinase that acts as a central regulator of the key metabolic processes, such as protein translation and ribosome biogenesis, in response to various environmental cues. In our previous study, we identified a novel role of plant RPS6, which negatively regulates rDNA transcription, forming a complex with a plant-specific histone deacetylase, AtHD2B. Here we report that the Arabidopsis RPS6 interacts additionally with a histone chaperone, nucleosome assembly protein 1(AtNAP1;1). The interaction does not appear to preclude the association of RPS6 with AtHD2B, as the AtNAP1 was also able to interact with AtHD2B as well as with an RPS6-AtHD2B fusion protein in the BiFC assay and pulldown experiment. Similar to a positive effect of the ribosomal S6 kinase 1 (AtS6K1) on rDNA transcription observed in this study, overexpression or down regulation of the AtNAP1;1 resulted in concomitant increase and decrease, respectively, in rDNA transcription suggesting a positive regulatory role played by AtNAP1 in plant rDNA transcription, possibly through derepression of the negative effect of the RPS6-AtHD2B complex. - Highlights: • Nucleosome assembly protein 1 (AtNAP1) interacts with RPS6 as well as with AtHD2B. • rDNA transcription is regulated S6K1. • Overexpression or down regulation of AtNAP1 results in concomitant increase or decrease in rDNA transcription.

  4. Accurate quantification of mouse mitochondrial DNA without co-amplification of nuclear mitochondrial insertion sequences.

    Science.gov (United States)

    Malik, Afshan N; Czajka, Anna; Cunningham, Phil

    2016-07-01

    Mitochondria contain an extra-nuclear genome in the form of mitochondrial DNA (MtDNA), damage to which can lead to inflammation and bioenergetic deficit. Changes in MtDNA levels are increasingly used as a biomarker of mitochondrial dysfunction. We previously reported that in humans, fragments in the nuclear genome known as nuclear mitochondrial insertion sequences (NumtS) affect accurate quantification of MtDNA. In the current paper our aim was to determine whether mouse NumtS affect the quantification of MtDNA and to establish a method designed to avoid this. The existence of NumtS in the mouse genome was confirmed using blast N, unique MtDNA regions were identified using FASTA, and MtDNA primers which do not co-amplify NumtS were designed and tested. MtDNA copy numbers were determined in a range of mouse tissues as the ratio of the mitochondrial and nuclear genome using real time qPCR and absolute quantification. Approximately 95% of mouse MtDNA was duplicated in the nuclear genome as NumtS which were located in 15 out of 21 chromosomes. A unique region was identified and primers flanking this region were used. MtDNA levels differed significantly in mouse tissues being the highest in the heart, with levels in descending order (highest to lowest) in kidney, liver, blood, brain, islets and lung. The presence of NumtS in the nuclear genome of mouse could lead to erroneous data when studying MtDNA content or mutation. The unique primers described here will allow accurate quantification of MtDNA content in mouse models without co-amplification of NumtS. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  5. Cloning and sequence analysis of hyaluronoglucosaminidase (nagH gene of Clostridium chauvoei

    Directory of Open Access Journals (Sweden)

    Saroj K. Dangi

    2017-09-01

    Full Text Available Aim: Blackleg disease is caused by Clostridium chauvoei in ruminants. Although virulence factors such as C. chauvoei toxin A, sialidase, and flagellin are well characterized, hyaluronidases of C. chauvoei are not characterized. The present study was aimed at cloning and sequence analysis of hyaluronoglucosaminidase (nagH gene of C. chauvoei. Materials and Methods: C. chauvoei strain ATCC 10092 was grown in ATCC 2107 media and confirmed by polymerase chain reaction (PCR using the primers specific for 16-23S rDNA spacer region. nagH gene of C. chauvoei was amplified and cloned into pRham-SUMO vector and transformed into Escherichia cloni 10G cells. The construct was then transformed into E. cloni cells. Colony PCR was carried out to screen the colonies followed by sequencing of nagH gene in the construct. Results: PCR amplification yielded nagH gene of 1143 bp product, which was cloned in prokaryotic expression system. Colony PCR, as well as sequencing of nagH gene, confirmed the presence of insert. Sequence was then subjected to BLAST analysis of NCBI, which confirmed that the sequence was indeed of nagH gene of C. chauvoei. Phylogenetic analysis of the sequence showed that it is closely related to Clostridium perfringens and Clostridium paraputrificum. Conclusion: The gene for virulence factor nagH was cloned into a prokaryotic expression vector and confirmed by sequencing.

  6. Insulin-induced translocation of IR to the nucleus in insulin responsive cells requires a nuclear translocation sequence.

    Science.gov (United States)

    Kesten, Dov; Horovitz-Fried, Miriam; Brutman-Barazani, Tamar; Sampson, Sanford R

    2018-04-01

    Insulin binding to its cell surface receptor (IR) activates a cascade of events leading to its biological effects. The Insulin-IR complex is rapidly internalized and then is either recycled back to the plasma membrane or sent to lysosomes for degradation. Although most of the receptor is recycled or degraded, a small amount may escape this pathway and migrate to the nucleus of the cell where it might be important in promulgation of receptor signals. In this study we explored the mechanism by which insulin induces IR translocation to the cell nucleus. Experiments were performed cultured L6 myoblasts, AML liver cells and 3T3-L1 adipocytes. Insulin treatment induced a rapid increase in nuclear IR protein levels within 2 to 5 min. Treatment with WGA, an inhibitor of nuclear import, reduced insulin-induced increases nuclear IR protein; IR was, however, translocated to a perinuclear location. Bioinformatics tools predicted a potential nuclear localization sequence (NLS) on IR. Immunofluorescence staining showed that a point mutation on the predicted NLS blocked insulin-induced IR nuclear translocation. In addition, blockade of nuclear IR activation in isolated nuclei by an IR blocking antibody abrogated insulin-induced increases in IR tyrosine phosphorylation and nuclear PKCδ levels. Furthermore, over expression of mutated IR reduced insulin-induced glucose uptake and PKB phosphorylation. When added to isolated nuclei, insulin induced IR phosphorylation but had no effect on nuclear IR protein levels. These results raise questions regarding the possible role of nuclear IR in IR signaling and insulin resistance. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. Discrimination of Shark species by simple PCR of 5S rDNA repeats

    OpenAIRE

    Pinhal, Danillo [UNESP; Gadig, Otto Bismarck Fazzano [UNESP; Wasko, Adriane Pinto [UNESP; Oliveira, Claudio [UNESP; Ron, Ernesto; Foresti, Fausto [UNESP; Martins, Cesar [UNESP

    2008-01-01

    Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat u...

  8. Evidence of birth-and-death evolution of 5S rRNA gene in Channa species (Teleostei, Perciformes).

    Science.gov (United States)

    Barman, Anindya Sundar; Singh, Mamta; Singh, Rajeev Kumar; Lal, Kuldeep Kumar

    2016-12-01

    In higher eukaryotes, minor rDNA family codes for 5S rRNA that is arranged in tandem arrays and comprises of a highly conserved 120 bp long coding sequence with a variable non-transcribed spacer (NTS). Initially the 5S rDNA repeats are considered to be evolved by the process of concerted evolution. But some recent reports, including teleost fishes suggested that evolution of 5S rDNA repeat does not fit into the concerted evolution model and evolution of 5S rDNA family may be explained by a birth-and-death evolution model. In order to study the mode of evolution of 5S rDNA repeats in Perciformes fish species, nucleotide sequence and molecular organization of five species of genus Channa were analyzed in the present study. Molecular analyses revealed several variants of 5S rDNA repeats (four types of NTS) and networks created by a neighbor net algorithm for each type of sequences (I, II, III and IV) did not show a clear clustering in species specific manner. The stable secondary structure is predicted and upstream and downstream conserved regulatory elements were characterized. Sequence analyses also shown the presence of two putative pseudogenes in Channa marulius. Present study supported that 5S rDNA repeats in genus Channa were evolved under the process of birth-and-death.

  9. Complete genome sequence and integrated protein localization and interaction map for alfalfa dwarf virus, which combines properties of both cytoplasmic and nuclear plant rhabdoviruses

    Energy Technology Data Exchange (ETDEWEB)

    Bejerman, Nicolás, E-mail: n.bejerman@uq.edu.au [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia); Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Dietzgen, Ralf G. [Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia)

    2015-09-15

    Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses.

  10. Complete genome sequence and integrated protein localization and interaction map for alfalfa dwarf virus, which combines properties of both cytoplasmic and nuclear plant rhabdoviruses

    International Nuclear Information System (INIS)

    Bejerman, Nicolás; Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio; Dietzgen, Ralf G.

    2015-01-01

    Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses

  11. Bacillus nealsonii sp. nov., isolated from a spacecraft-assembly facility, whose spores are gamma-radiation resistant

    Science.gov (United States)

    Venkateswaran, Kasthuri; Kempf, Michael; Chen, Fei; Satomi, Masataka; Nicholson, Wayne; Kern, Roger

    2003-01-01

    One of the spore-formers isolated from a spacecraft-assembly facility, belonging to the genus Bacillus, is described on the basis of phenotypic characterization, 16S rDNA sequence analysis and DNA-DNA hybridization studies. It is a Gram-positive, facultatively anaerobic, rod-shaped eubacterium that produces endospores. The spores of this novel bacterial species exhibited resistance to UV, gamma-radiation, H2O2 and desiccation. The 18S rDNA sequence analysis revealed a clear affiliation between this strain and members of the low G+C Firmicutes. High 16S rDNA sequence similarity values were found with members of the genus Bacillus and this was supported by fatty acid profiles. The 16S rDNA sequence similarity between strain FO-92T and Bacillus benzoevorans DSM 5391T was very high. However, molecular characterizations employing small-subunit 16S rDNA sequences were at the limits of resolution for the differentiation of species in this genus, but DNA-DNA hybridization data support the proposal of FO-92T as Bacillus nealsonii sp. nov. (type strain is FO-92T =ATCC BAAM-519T =DSM 15077T).

  12. Single Cell Analysis Linking Ribosomal (r)DNA and rRNA Copy Numbers to Cell Size and Growth Rate Provides Insights into Molecular Protistan Ecology.

    Science.gov (United States)

    Fu, Rao; Gong, Jun

    2017-11-01

    Ribosomal (r)RNA and rDNA have been golden molecular markers in microbial ecology. However, it remains poorly understood how ribotype copy number (CN)-based characteristics are linked with diversity, abundance, and activity of protist populations and communities observed at organismal levels. Here, we applied a single-cell approach to quantify ribotype CNs in two ciliate species reared at different temperatures. We found that in actively growing cells, the per-cell rDNA and rRNA CNs scaled with cell volume (CV) to 0.44 and 0.58 powers, respectively. The modeled rDNA and rRNA concentrations thus appear to be much higher in smaller than in larger cells. The observed rRNA:rDNA ratio scaled with CV 0.14 . The maximum growth rate could be well predicted by a combination of per-cell ribotype CN and temperature. Our empirical data and modeling on single-cell ribotype scaling are in agreement with both the metabolic theory of ecology and the growth rate hypothesis, providing a quantitative framework for linking cellular rDNA and rRNA CNs with body size, growth (activity), and biomass stoichiometry. This study also demonstrates that the expression rate of rRNA genes is constrained by cell size, and favors biomass rather than abundance-based interpretation of quantitative ribotype data in population and community ecology of protists. © 2017 The Authors. Journal of Eukaryotic Microbiology published by Wiley Periodicals, Inc. on behalf of International Society of Protistologists.

  13. Fungal Diversity in Field Mold-Damaged Soybean Fruits and Pathogenicity Identification Based on High-Throughput rDNA Sequencing

    Directory of Open Access Journals (Sweden)

    Jiang Liu

    2017-05-01

    Full Text Available Continuous rain and an abnormally wet climate during harvest can easily lead to soybean plants being damaged by field mold (FM, which can reduce seed yield and quality. However, to date, the underlying pathogen and its resistance mechanism have remained unclear. The objective of the present study was to investigate the fungal diversity of various soybean varieties and to identify and confirm the FM pathogenic fungi. A total of 62,382 fungal ITS1 sequences clustered into 164 operational taxonomic units (OTUs with 97% sequence similarity; 69 taxa were recovered from the samples by internal transcribed spacer (ITS region sequencing. The fungal community compositions differed among the tested soybeans, with 42 OTUs being amplified from all varieties. The quadratic relationships between fungal diversity and organ-specific mildew indexes were analyzed, confirming that mildew on soybean pods can mitigate FM damage to the seeds. In addition, four potentially pathogenic fungi were isolated from FM-damaged soybean fruits; morphological and molecular identification confirmed these fungi as Aspergillus flavus, A. niger, Fusarium moniliforme, and Penicillium chrysogenum. Further re-inoculation experiments demonstrated that F. moniliforme is dominant among these FM pathogenic fungi. These results lay the foundation for future studies on mitigating or preventing FM damage to soybean.

  14. Identification and evaluation of accident sequences in nuclear power reactors

    International Nuclear Information System (INIS)

    Amendola, A.; Capobianchi, S.; Mancini, G.; Olivi, L.; Volta, G.; Reina, G.

    1981-01-01

    Probabilistic analysis techniques are being more and more used for the evaluation of accident progression in nuclear power plants, especially after the issue of the Reactor Safety Study (Report WASH-1400). This study and subsequent discussions have indicated the necessity of better investigating some major items, namely: adequate data base for the probabilistic evaluations; completeness of the analysis with respect both to accident initiation and behaviour; adequate treatment of uncertainties on the physical and operational parameters governing the accident behaviour. Furthermore, recent occurrences have stressed the importance of the operational aspects of reactor safety, such as plant-specific identification of possible occurrences, their prompt recognition, on-line prediction of subsequent developments and actions to be taken. The paper reviews the contributions in progress at JRC-Ispra to all these aspects, and specifically reports on the following: (1) The set-up of a European Reliability Data System for the acquisition and organisation of operational data of LWRs in the European Community. (2) The development of more complete and realistic models of systems. This work includes multistate static models of components and systems with a view to automatic fault-tree construction and dynamic models for accident sequence identification. The dynamic modelling approach ESCS (Event Sequence and Consequences Spectrum), shown in detail with an example, represents a step forward with respect to event-tree technique and opens new possibilities in dealing with human factors and on-line diagnosis problems. (3) The development of RSM (Response Surface Methodology) for the analysis of uncertainty propagations in consequence and in probability of accident chains. (author)

  15. Blastocystis phylogeny among various isolates from humans to insects.

    Science.gov (United States)

    Yoshikawa, Hisao; Koyama, Yukiko; Tsuchiya, Erika; Takami, Kazutoshi

    2016-12-01

    Blastocystis is a common unicellular eukaryotic parasite found not only in humans, but also in various kinds of animal species worldwide. Since Blastocystis isolates are morphologically indistinguishable, many molecular biological approaches have been applied to classify these isolates. The complete or partial sequences of the small subunit rRNA gene (SSU rDNA) are mainly used for comparisons and phylogenetic analyses among Blastocystis isolates. However, various lengths of the partial SSU rDNA sequence have been used for phylogenetic inference among genetically different isolates. Based on the complete SSU rDNA sequences, consensus terminology of nine subtypes (STs) of Blastocystis sp. that were supported by phylogenetically monophyletic nine clades was proposed in 2007. Thereafter, eight additional kinds of STs comprising non-human mammalian Blastocystis isolates have been reported based on the phylogeny of SSU rDNA sequences, while STs 11 and 12 were only proposed on the base of partial sequences. Although many sequence data from mammalian and avian Blastocystis are registered in GenBank, only limited data on SSU rDNA are available for poikilotherm-derived Blastocystis isolates. Therefore, the phylogenetic positions of the reptilian/amphibian Blastocystis clades are unstable. The phylogenetic inference of various STs comprising mammalian and/or avian Blastocystis isolates was verified herein based on comparisons between partial and complete SSU rDNA sequences, and the phylogenetic positions of reptilian and amphibian Blastocystis isolates were also investigated using 14 new Blastocystis isolates from reptiles with all known isolates from other reptilians, amphibians, and insects registered in GenBank. Copyright © 2016. Published by Elsevier Ireland Ltd.

  16. Phylogenetic analysis of methanogens from the bovine rumen

    Directory of Open Access Journals (Sweden)

    Forster Robert J

    2001-05-01

    Full Text Available Abstract Background Interest in methanogens from ruminants has resulted from the role of methane in global warming and from the fact that cattle typically lose 6 % of ingested energy as methane. Several species of methanogens have been isolated from ruminants. However they are difficult to culture, few have been consistently found in high numbers, and it is likely that major species of rumen methanogens are yet to be identified. Results Total DNA from clarified bovine rumen fluid was amplified using primers specific for Archaeal 16S rRNA gene sequences (rDNA. Phylogenetic analysis of 41 rDNA sequences identified three clusters of methanogens. The largest cluster contained two distinct subclusters with rDNA sequences similar to Methanobrevibacter ruminantium 16S rDNA. A second cluster contained sequences related to 16S rDNA from Methanosphaera stadtmanae, an organism not previously described in the rumen. The third cluster contained rDNA sequences that may form a novel group of rumen methanogens. Conclusions The current set of 16S rRNA hybridization probes targeting methanogenic Archaea does not cover the phylogenetic diversity present in the rumen and possibly other gastro-intestinal tract environments. New probes and quantitative PCR assays are needed to determine the distribution of the newly identified methanogen clusters in rumen microbial communities.

  17. Authentication of ruta graveolens and its adulterant using internal transcribed spacer (its) sequences of nuclear ribosomal DNA

    International Nuclear Information System (INIS)

    Qurainy, F.A.; Khan, S.; Ali, M.A.; Hemaid, M.A.; Ashraf, M.

    2011-01-01

    Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)

  18. Development of technique for estimating primary cooling system break diameter in predicting nuclear emergency event sequence

    International Nuclear Information System (INIS)

    Tatebe, Yasumasa; Yoshida, Yoshitaka

    2012-01-01

    If an emergency event occurs in a nuclear power plant, appropriate action is selected and taken in accordance with the plant status, which changes from time to time, in order to prevent escalation and mitigate the event consequences. It is thus important to predict the event sequence and identify the plant behavior resulting from the action taken. In predicting the event sequence during a loss-of-coolant accident (LOCA), it is necessary to estimate break diameter. The conventional method for this estimation is time-consuming, since it involves multiple sensitivity analyses to determine the break diameter that is consistent with the plant behavior. To speed up the process of predicting the nuclear emergency event sequence, a new break diameter estimation technique that is applicable to pressurized water reactors was developed in this study. This technique enables the estimation of break diameter using the plant data sent from the safety parameter display system (SPDS), with focus on the depressurization rate in the reactor cooling system (RCS) during LOCA. The results of LOCA analysis, performed by varying the break diameter using the MAAP4 and RELAP5/MOD3.2 codes, confirmed that the RCS depressurization rate could be expressed by the log linear function of break diameter, except in the case of a small leak, in which RCS depressurization is affected by the coolant charging system and the high-pressure injection system. A correlation equation for break diameter estimation was developed from this function and tested for accuracy. Testing verified that the correlation equation could estimate break diameter accurately within an error of approximately 16%, even if the leak increases gradually, changing the plant status. (author)

  19. Molecular Phylogenetic Classification of Streptomycetes Isolated from the Rhizosphere of Tropical Legume (Paraserianthes falcataria (L. Nielsen

    Directory of Open Access Journals (Sweden)

    LANGKAH SEMBIRING

    2009-09-01

    Full Text Available Intrageneric diversity of 556 streptomycetes isolated from the rhizosphere of tropical legume was determined by using molecular taxonomic method based on 16S rDNA. A total of 46 isolates were taken to represent 37 colour groups of the isolates. 16S rDNA were amplified and subsequently sequenced and the sequences data were aligned with streptomycete sequences retrieved from the ribosomal data base project (RDP data. Phylogenetic trees were generated by using the PHYLIP software package and the matrix of nucleotide similarity and nucleotide difference were generated by using PHYDIT software. The results confirmed and extended the value of 16S rDNA sequencing in streptomycete systematic. The 16S rDNA sequence data showed that most of the tested colour group representatives formed new centers of taxonomic variation within the genus Streptomyces. The generic assignment of these organisms was underpinned by 16S rDNA sequence data which also suggested that most of the strains represented new centers of taxonomic variation. The taxonomic data indicate that diverse populations of streptomycetes are associated with the roots of tropical legume (P. falcataria. Therefore, the combination of selective isolation and molecular taxonomic procedures used in this study provide a powerful way of uncovering new centers of taxonomic variation within the genus Streptomyces.

  20. Molecular characterization of Giardia psittaci by multilocus sequence analysis.

    Science.gov (United States)

    Abe, Niichiro; Makino, Ikuko; Kojima, Atsushi

    2012-12-01

    Multilocus sequence analyses targeting small subunit ribosomal DNA (SSU rDNA), elongation factor 1 alpha (ef1α), glutamate dehydrogenase (gdh), and beta giardin (β-giardin) were performed on Giardia psittaci isolates from three Budgerigars (Melopsittacus undulates) and four Barred parakeets (Bolborhynchus lineola) kept in individual households or imported from overseas. Nucleotide differences and phylogenetic analyses at four loci indicate the distinction of G. psittaci from the other known Giardia species: Giardia muris, Giardia microti, Giardia ardeae, and Giardia duodenalis assemblages. Furthermore, G. psittaci was related more closely to G. duodenalis than to the other known Giardia species, except for G. microti. Conflicting signals regarded as "double peaks" were found at the same nucleotide positions of the ef1α in all isolates. However, the sequences of the other three loci, including gdh and β-giardin, which are known to be highly variable, from all isolates were also mutually identical at every locus. They showed no double peaks. These results suggest that double peaks found in the ef1α sequences are caused not by mixed infection with genetically different G. psittaci isolates but by allelic sequence heterogeneity (ASH), which is observed in diplomonad lineages including G. duodenalis. No sequence difference was found in any G. psittaci isolates at the gdh and β-giardin, suggesting that G. psittaci is indeed not more diverse genetically than other Giardia species. This report is the first to provide evidence related to the genetic characteristics of G. psittaci obtained using multilocus sequence analysis. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. Variabilidade genética na região its do rDNA de isolados de trichoderma spp. (Biocontrolador e Fusarium oxysporum f. sp. Chrysanthemi Genetic variability in rDNA ITS region of Trichoderma spp. (biocontrole agent and Fusarium oxysporum f. sp. chrysanthemi isolates

    Directory of Open Access Journals (Sweden)

    Josiane Pacheco Menezes

    2010-02-01

    Full Text Available A análise de características morfológicas e culturais podem não ser suficientes para uma caracterização precisa das espécies de Trichoderma e Fusarium. Objetivou-se, neste trabalho, caracterizar a região do Espaço Interno Transcrito (ITS do rDNA dos isolados UFSMT15.1, UFSMT16 e UFSMT17 de Trichoderma spp. utilizados no biocontrole de Fusarium oxysporum f. sp. chrysanthemi (isolado UFSMF6. A extração de DNA de cada isolado foi realizada a partir de micélio produzido em meio líquido Batata-Dextrose. As amostras de DNA genômico foram submetidas à Reação em Cadeia da Polimerase (PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4 e o produto gerado foi sequenciado. Os fragmentos gerados pela amplificação da PCR foram tratados com as enzimas de restrição HaeIII, HinfI e MboI. As regiões ITS1, ITS2 e 5.8S do rDNA desses isolados fúngicos foram amplificadas com sucesso. A região ITS dos isolados UFSMT15.1, UFSMT16 e UFSMT17 de Trichoderma e o isolado UFSMF6 de Fusarium apresentaram uma banda simples com um fragmento de aproximadamente 600 pares de base (pb. As enzimas de restrição HaeIII, HinfI e MboI geraram polimorfismo de bandas entre os isolados. Com base nas análises da sequência de DNA, os isolados UFSMT15.1, UFSMT16, UFSMT17 e UFSMF6 apresentaram maior similaridade com as espécies Trichoderma koningiopsis, Hypocrea virens, Hypocrea lixii e Fusarium oxysporum, respectivamente.The analysis of morphological and cultural characteristics may not enough for the characterization of the species of Trichoderma and Fusarium. The aim of this work was to characterize the Internal Transcribed Spacer (ITS region of the rDNA of UFSMT15.1, UFSMT16 and UFSMT17 isolates of Trichoderma spp. used in the biocontrol of Fusarium oxysporum f. sp. chrysanthemi UFSMF6. DNA extraction of each isolate was accomplished starting from hyphae produced in liquid medium Potato-Dextrose-Agar. The samples of genomic DNA were submitted to

  2. Molecular phylogenetic lineage of Plagiopogon and Askenasia (Protozoa, Ciliophora) revealed by their gene sequences

    Science.gov (United States)

    Liu, An; Yi, Zhenzhen; Lin, Xiaofeng; Hu, Xiaozhong; Al-Farraj, Saleh A.; Al-Rasheid, Khaled A. S.

    2015-08-01

    Prostomates and haptorians are two basal groups of ciliates with limited morphological characteristics available for taxonomy. Morphologically, the structures used to identify prostomates and haptorians are similar or even identical, which generate heavy taxonomic and phylogenetic confusion. In present work, phylogenetic positions lineage of two rare genera, Plagiopogon and Askenasia, were investigated. Three genes including small subunit ribosomal RNA gene (hereafter SSU rDNA), internal transcribed spacer region (ITS region), and large subunit ribosomal RNA gene (LSU rDNA) were analyzed, 10 new sequences five species each. Our findings included 1) class Prostomatea and order Haptorida are multiphyletic; 2) it may not be appropriate to place order Cyclotrichiida in subclass Haptoria, and the systematic lineage of order Cyclotrichiida needs to be verified further; 3) genus Plagiopogon branches consistently within a clade covering most prostomes and is basal of clade Colepidae, implying its close lineage to Prostomatea; and 4) Askenasia is phylogenetically distant from the subclass Haptoria but close to classes Prostomatea, Plagiopylea and Oligohymenophorea. We supposed that the toxicyst of Askenasia may be close to taxa of prostomes instead of haptorians, and the dorsal brush is a more typical morphological characteristics of haptorians than toxicysts.

  3. Molecular dating of caprines using ancient DNA sequences of Myotragus balearicus, an extinct endemic Balearic mammal

    Directory of Open Access Journals (Sweden)

    Alcover Josep Antoni

    2005-12-01

    Full Text Available Abstract Background Myotragus balearicus was an endemic bovid from the Balearic Islands (Western Mediterranean that became extinct around 6,000-4,000 years ago. The Myotragus evolutionary lineage became isolated in the islands most probably at the end of the Messinian crisis, when the desiccation of the Mediterranean ended, in a geological date established at 5.35 Mya. Thus, the sequences of Myotragus could be very valuable for calibrating the mammalian mitochondrial DNA clock and, in particular, the tree of the Caprinae subfamily, to which Myotragus belongs. Results We have retrieved the complete mitochondrial cytochrome b gene (1,143 base pairs, plus fragments of the mitochondrial 12S gene and the nuclear 28S rDNA multi-copy gene from a well preserved Myotragus subfossil bone. The best resolved phylogenetic trees, obtained with the cytochrome b gene, placed Myotragus in a position basal to the Ovis group. Using the calibration provided by the isolation of Balearic Islands, we calculated that the initial radiation of caprines can be dated at 6.2 ± 0.4 Mya. In addition, alpine and southern chamois, considered until recently the same species, split around 1.6 ± 0.3 Mya, indicating that the two chamois species have been separated much longer than previously thought. Conclusion Since there are almost no extant endemic mammals in Mediterranean islands, the sequence of the extinct Balearic endemic Myotragus has been crucial for allowing us to use the Messinian crisis calibration point for dating the caprines phylogenetic tree.

  4. rDNA mapping, heterochromatin characterization and AT/GC content of Agapanthus africanus (L. Hoffmanns (Agapanthaceae

    Directory of Open Access Journals (Sweden)

    ARYANE C. REIS

    2016-01-01

    Full Text Available ABSTRACT Agapanthus (Agapanthaceae has 10 species described. However, most taxonomists differ respect to this number because the great phenotypic plasticity of the species. The cytogenetic has been an important tool to aid the plant taxon identification, and to date, all taxa of Agapanthus L'Héritier studied cytologically, presented 2n = 30. Although the species possess large chromosomes, the group is karyologically little explored. This work aimed to increase the cytogenetic knowledge of Agapanthus africanus (L. Hoffmanns by utilization of chromosome banding techniques with DAPI / CMA3 and Fluorescent in situ Hybridization (FISH. In addition, flow cytometry was used for determination of DNA content and the percentage of AT / GC nitrogenous bases. Plants studied showed 2n = 30 chromosomes, ranging from 4.34 - 8.55 µm, with the karyotype formulae (KF = 10m + 5sm. Through FISH, one 45S rDNA signal was observed proximally to centromere of the chromosome 7, while for 5S rDNA sites we observed one signal proximally to centromere of chromosome 9. The 2C DNA content estimated for the species was 2C = 24.4 with 59% of AT and 41% of GC. Our data allowed important upgrade for biology and cytotaxonomy of Agapanthus africanus (L. Hoffmanns.

  5. Ultrastructural and autoradiographic studies of nucleolar development and rDNA transcription in preimplantation mouse embryos

    Energy Technology Data Exchange (ETDEWEB)

    Geuskens, M.; Alexandre, H. (Universite Libre de Bruxelles (Belgium). Dep. de Biologie Moleculaire)

    1984-06-01

    The development of the nucleoli and the sites of rDNA transcription have been studies by high-resolution autoradiography during the cleavage stages of mouse embryos. The appearance of fibrillar centres at the periphery of the fibrillar primary nucleoli has been observed at the 4-cell stage. Several fibrillar centres interconnected by electron-dense fibrillar strands, form a reticulated region around the fibrillar mass at the 6- to 8-cell stage. After a 10 min pulse with (/sup 3/H)uridine, only this peripheral network is labelled. At the late morula and at the blastocyst stage, the fibrillar component (nucleolonema) of the reticulated nucleoli is labelled after 10 min (/sup 3/H)uridine incorporation. When the embryos are reincubated for 2 h in cold medium, the label is localized mainly in the granular component. Fibrillar centres are not labelled. Autoradiograms of in vitro developed embryos pulsed for 2 h with (/sup 3/H)uridine confirm that the central fibrillar core of the nucleoli of 6- to 8-cell embryos is never labelled. Thus, the fibrillar constituent of this core is not homologous to the fibrillar component of the nucleoli of later stage embryos, which is the site of active rDNA transcription. An interpretation of nucleologenesis during early mouse embryogenesis is proposed.

  6. Ultrastructural and autoradiographic studies of nucleolar development and rDNA transcription in preimplantation mouse embryos

    International Nuclear Information System (INIS)

    Geuskens, M.; Alexandre, H.

    1984-01-01

    The development of the nucleoli and the sites of rDNA transcription have been studies by high-resolution autoradiography during the cleavage stages of mouse embryos. The appearance of fibrillar centres at the periphery of the fibrillar primary nucleoli has been observed at the 4-cell stage. Several fibrillar centres interconnected by electron-dense fibrillar strands, form a reticulated region around the fibrillar mass at the 6- to 8-cell stage. After a 10 min pulse with ( 3 H)uridine, only this peripheral network is labelled. At the late morula and at the blastocyst stage, the fibrillar component (nucleolonema) of the reticulated nucleoli is labelled after 10 min ( 3 H)uridine incorporation. When the embryos are reincubated for 2 h in cold medium, the label is localized mainly in the granular component. Fibrillar centres are not labelled. Autoradiograms of in vitro developed embryos pulsed for 2 h with ( 3 H)uridine confirm that the central fibrillar core of the nucleoli of 6- to 8-cell embryos is never labelled. Thus, the fibrillar constituent of this core is not homologous to the fibrillar component of the nucleoli of later stage embryos, which is the site of active rDNA transcription. An interpretation of nucleologenesis during early mouse embryogenesis is proposed. (author)

  7. Genotyping of Giardia lamblia isolates from humans in China and Korea using ribosomal DNA Sequences.

    Science.gov (United States)

    Yong, T S; Park, S J; Hwang, U W; Yang, H W; Lee, K W; Min, D Y; Rim, H J; Wang, Y; Zheng, F

    2000-08-01

    Genetic characterization of a total of 15 Giardia lamblia isolates, 8 from Anhui Province, China (all from purified cysts) and 7 from Seoul, Korea (2 from axenic cultures and 5 from purified cysts), was performed by polymerase chain reaction amplification and sequencing of a 295-bp region near the 5' end of the small subunit ribosomal DNA (eukaryotic 16S rDNA). Phylogenetic analyses were subsequently conducted using sequence data obtained in this study, as well as sequences published from other Giardia isolates. The maximum parsimony method revealed that G. lamblia isolates from humans in China and Korea are divided into 2 major lineages, assemblages A and B. All 7 Korean isolates were grouped into assemblage A, whereas 4 Chinese isolates were grouped into assemblage A and 4 into assemblage B. Two Giardia microti isolates and 2 dog-derived Giardia isolates also grouped into assemblage B, whereas Giardia ardeae and Giardia muris were unique.

  8. Image sequence analysis in nuclear medicine: (1) Parametric imaging using statistical modelling

    International Nuclear Information System (INIS)

    Liehn, J.C.; Hannequin, P.; Valeyre, J.

    1989-01-01

    This is a review of parametric imaging methods on Nuclear Medicine. A Parametric Image is an image in which each pixel value is a function of the value of the same pixel of an image sequence. The Local Model Method is the fitting of each pixel time activity curve by a model which parameter values form the Parametric Images. The Global Model Method is the modelling of the changes between two images. It is applied to image comparison. For both methods, the different models, the identification criterion, the optimization methods and the statistical properties of the images are discussed. The analysis of one or more Parametric Images is performed using 1D or 2D histograms. The statistically significant Parametric Images, (Images of significant Variances, Amplitudes and Differences) are also proposed [fr

  9. Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.

    Science.gov (United States)

    Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen

    2015-01-01

    Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods.

  10. Karyotypic diversity in four species of the genus Gymnotus Linnaeus, 1758 (Teleostei, Gymnotiformes, Gymnotidae): physical mapping of ribosomal genes and telomeric sequences

    Science.gov (United States)

    Scacchetti, Priscilla Cardim; Pansonato-Alves, José Carlos; Utsunomia, Ricardo; Oliveira, Claudio; Foresti, Fausto

    2011-01-01

    Abstract Conventional (Giemsa, C-Banding, Ag-NORs, CMA3) and molecular (5S rDNA, 18S rDNA, telomeric sequences) cytogenetic studies were carried out in specimens of ten distinct fish populations of the genus Gymnotus (Gymnotus sylvius Albert and Fernandes-Matioli, 1999, Gymnotus inaequilabiatus Valenciennes, 1839, Gymnotus pantherinus Steindachner, 1908, and G. cf. carapo Linnaeus, 1758) from different Brazilian hydrographic basins. Gymnotus sylvius presented a diploid number of 40 chromosomes (22m+12sm+6st), Gymnotus pantherinus presented 52 chromosomes (32m+18sm+2st), while Gymnotus inaequilabiatus (42m+10sm+2a)and Gymnotus cf. carapo (38m+12sm+4st) presented 54 chromosomes. The C-banding technique revealed centromeric marks in all chromosomes of all species. Besides that, conspicuous blocks of heterochromatin were found interstitially on the chromosomes of Gymnotus inaequilabiatus, Gymnotus cf. carapo,and Gymnotus pantherinus. All four species showed single nucleolus organizing regions confirmed by results obtained through Ag-NORs and FISH experiments using 18S rDNA probes, which showed the NORs localized on the first chromosome pair in Gymnotus inaequilabiatus, Gymnotus cf. carapo,and Gymnotus pantherinus, and on pair 2 in Gymnotus sylvius. CMA3 staining revealed additional unrelated NORs marks in Gymnotus sylvius and Gymnotus pantherinus. The 5S rDNA probes revealed signals on one pair in Gymnotus sylvius and two pairs in Gymnotus pantherinus; Gymnotus inaequilabiatus had about seventeen pairs marked, and Gymnotus cf. carapo had about fifteen pairs marked. It is considered that the high amount of heterochromatin identified in the chromosomes of Gymnotus inaequilabiatus and Gymnotus cf. carapo could have facilitated the dispersion of 5S rDNA in these species. Interstitial signals were detected on the first metacentric pair of Gymnotus sylvius by telomeric probes (TTAGGG)n indicating the possible occurrence of chromosomal fusions in this species. The present

  11. Karyotypic diversity in four species of the genus Gymnotus Linnaeus, 1758 (Teleostei, Gymnotiformes, Gymnotidae: physical mapping of ribosomal genes and telomeric sequences

    Directory of Open Access Journals (Sweden)

    Priscilla Scacchetti

    2011-08-01

    Full Text Available Conventional (Giemsa, C-Banding, Ag-NORs, CMA3 and molecular (5S rDNA, 18S rDNA, telomeric sequences cytogenetic studies were carried out in specimens of ten distinct fish populations of the genus Gymnotus (G. sylvius Albert and Fernandes-Matioli, 1999, G. inaequilabiatus Valenciennes, 1839, G. pantherinus Steindachner, 1908, and G. cf. carapo Linnaeus, 1758 from different Brazilian hydrographic basins. G. sylvius presented a diploid number of 40 chromosomes (22m+12sm+6st, G. pantherinus presented 52 chromosomes (32m+18sm+2st, while G. inaequilabiatus (42m+10sm+2a and G. cf. carapo (38m+12sm+4st presented 54 chromosomes. The C-banding technique revealed centromeric marks in all chromosomes of all species. Besides that, conspicuous blocks of heterochromatin were found interstitially on the chromosomes of G. inaequilabiatus, G. cf. carapo, and G. pantherinus. All four species showed single nucleolus organizing regions confirmed by results obtained through Ag-NORs and FISH experiments using 18S rDNA probes, which showed the NORs localized on the first chromosome pair in G. inaequilabiatus, G. cf. carapo, and G. pantherinus, and on pair 2 in G. sylvius. CMA3 staining revealed additional unrelated NORs marks in G. sylvius and G. pantherinus. The 5S rDNA probes revealed signals on one pair in G. sylvius and two pairs in G. pantherinus; G. inaequilabiatus had about seventeen pairs marked, and G. cf. carapo had about fifteen pairs marked. It is considered that the high amount of heterochromatin identified in the chromosomes of G. inaequilabiatus and G. cf. carapo could have facilitated the dispersion of 5S rDNA in these species. Interstitial signals were detected on the first metacentric pair of G. sylvius by telomeric probes (TTAGGGn indicating the possible occurrence of chromosomal fusions in this species. The present study reveals valuable cytotaxonomic markers for this group and allows a more precise evaluation of the processes involved in the

  12. Estimation of physiological parameters using knowledge-based factor analysis of dynamic nuclear medicine image sequences

    International Nuclear Information System (INIS)

    Yap, J.T.; Chen, C.T.; Cooper, M.

    1995-01-01

    The authors have previously developed a knowledge-based method of factor analysis to analyze dynamic nuclear medicine image sequences. In this paper, the authors analyze dynamic PET cerebral glucose metabolism and neuroreceptor binding studies. These methods have shown the ability to reduce the dimensionality of the data, enhance the image quality of the sequence, and generate meaningful functional images and their corresponding physiological time functions. The new information produced by the factor analysis has now been used to improve the estimation of various physiological parameters. A principal component analysis (PCA) is first performed to identify statistically significant temporal variations and remove the uncorrelated variations (noise) due to Poisson counting statistics. The statistically significant principal components are then used to reconstruct a noise-reduced image sequence as well as provide an initial solution for the factor analysis. Prior knowledge such as the compartmental models or the requirement of positivity and simple structure can be used to constrain the analysis. These constraints are used to rotate the factors to the most physically and physiologically realistic solution. The final result is a small number of time functions (factors) representing the underlying physiological processes and their associated weighting images representing the spatial localization of these functions. Estimation of physiological parameters can then be performed using the noise-reduced image sequence generated from the statistically significant PCs and/or the final factor images and time functions. These results are compared to the parameter estimation using standard methods and the original raw image sequences. Graphical analysis was performed at the pixel level to generate comparable parametric images of the slope and intercept (influx constant and distribution volume)

  13. Examination of species boundaries in the Acropora cervicornis group (Scleractinia, cnidaria) using nuclear DNA sequence analyses.

    Science.gov (United States)

    Oppen, M J; Willis, B L; Vugt, H W; Miller, D J

    2000-09-01

    Although Acropora is the most species-rich genus of the scleractinian (stony) corals, only three species occur in the Caribbean: A. cervicornis, A. palmata and A. prolifera. Based on overall coral morphology, abundance and distribution patterns, it has been suggested that A. prolifera may be a hybrid between A. cervicornis and A. palmata. The species boundaries among these three morphospecies were examined using DNA sequence analyses of the nuclear Pax-C 46/47 intron and the ribosomal DNA Internal Transcribed Spacer (ITS1 and ITS2) and 5.8S regions. Moderate levels of sequence variability were observed in the ITS and 5.8S sequences (up to 5.2% overall sequence difference), but variability within species was as large as between species and all three species carried similar sequences. Since this is unlikely to represent a shared ancestral polymorphism, the data suggest that introgressive hybridization occurs among the three species. For the Pax-C intron, A. cervicornis and A. palmata had very distinct allele frequencies and A. cervicornis carried a unique allele at a frequency of 0.769 (although sequence differences between alleles were small). All A. prolifera colonies examined were heterozygous for the Pax-C intron, whereas heterozygosity was only 0.286 and 0.333 for A. cervicornis and A. palmata, respectively. These data support the hypothesis that A. prolifera is the product of hybridization between two species that have a different allelic composition for the Pax-C intron, i.e. A. cervicornis and A. palmata. We therefore suggest that A. prolifera is a hybrid between A. cervicornis and A. palmata, which backcrosses with the parental species at low frequency.

  14. Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

    1996-02-15

    Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).

  15. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  16. The ITS1-5.8S rRNA gene -ITS2 sequence variability during the divergence of sweet-grass species (gen us Glyceria R. Br.

    Directory of Open Access Journals (Sweden)

    Alexander V Rodionov

    2011-12-01

    Full Text Available Comparative analysis of the sequence ITS1-5.8S rRNA gene-ITS2 of the nuclear genome of 13 species of genus Glyceria, 4 species of Melica and a species of monotypic genus Pleuropogon showed that the species of the genus Glyceria have 3 haplotypes: 1 Haplotype A was found only in species of the subgenus Glyceria section Glyceria (G. septentrionalis, G. fluitans, G. declinata, G. occidentalis, G. notata, G. borealis, G. leptostachya and in Pleuropogon sabinii; 2 Haplotype C is characteristic of the subgenus Hydropoa, section Hydropoa (G. grandis, G. х amurensis, G. triflora, G. maxima and sect. Lithuanicae (G. leptolepis; 3 Haplotype B is found in the species of the subgenus Hydropoa sections Striatae (G. elata, G. striata, G. neogaea, G. canadensis, Scolochloiformes (G. alnasteretum, G. spiculosa and G. lithuanica of sect. Lithuanicae. Species carring haplotype B are located at the base of the phylogenetic tree of the genus Glyceria and/or clustered with low bootstrap indices. On the phylogenetic trees inferred by the analysis of the sequences ITS and 5.8S rDNA both sect. Glyceria and sect. Hydropoa represented two sister monophyly branches. The species Pleuropogon sabinii belong to the branch of subgenus Glyceria as a sister monotypic branch to the branch of the sect. Glyceria.

  17. A Nuclear Ribosomal DNA Phylogeny of Acer Inferred with Maximum Likelihood, Splits Graphs, and Motif Analysis of 606 Sequences

    Directory of Open Access Journals (Sweden)

    Guido W. Grimm

    2006-01-01

    Full Text Available The multi-copy internal transcribed spacer (ITS region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation instead of the full (partly redundant original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly.

  18. A Nuclear Ribosomal DNA Phylogeny of Acer Inferred with Maximum Likelihood, Splits Graphs, and Motif Analysis of 606 Sequences

    Science.gov (United States)

    Grimm, Guido W.; Renner, Susanne S.; Stamatakis, Alexandros; Hemleben, Vera

    2007-01-01

    The multi-copy internal transcribed spacer (ITS) region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML) and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation) instead of the full (partly redundant) original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994) 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly. PMID:19455198

  19. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    Science.gov (United States)

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Apparatus for measuring the nuclear radiation of a sequence of radioactive samples

    International Nuclear Information System (INIS)

    Lohr, W.; Berthold, F.; Allington, R.W.

    1977-01-01

    To measure the nuclear radiation of a sequence of radioactive samples, magazines that hold sample containers are removably positioned in shuttles, some of which are driven step-by-step by a toothed belt that engates racks on the sides of the shuttles from one compartment to another through a measuring station, with the shuttles that are being driven by the belt driving other shuttles not in engagement with the belt at that time. In the measuring station, the sample containers are released from the magazines one at a time through openings in their bottoms and lowered by a reciprocable support to a position adjacent to a radiation detector for the measurement, after which they are raised by the support to the magazine and the shuttle is driven one more step to the next position. 8 figures

  1. Heterogeneity in the genus Allovahlkampfia and the description of the new genus Parafumarolamoeba (Vahlkampfiidae; Heterolobosea).

    Science.gov (United States)

    Geisen, Stefan; Bonkowski, Michael; Zhang, Junling; De Jonckheere, Johan F

    2015-08-01

    Heterolobosean amoebae are common and diverse members of soil protist communities. In this study, we isolated seven strains of amoebae from soil samples taken in Tibet (at high altitude), Sardinia and the Netherlands, all resembling to belong to a similar heterolobosean morphospecies. However, sequences of the small subunit (SSU) rDNA and internal transcribed spacers, including the 5.8S rDNA, revealed a high heterogeneity in the genus Allovahlkampfia to which six of the isolates belong. Some unnamed strains, of which the sequences had been published before, are also included within the genus Allovahlkampfia. One Allovahlkampfia isolated in the Netherlands harbors a twin-ribozyme, containing a His-Cys box, similar to the one found in strain BA of Allovahlkampfia. The other SSU rDNA sequence grouped in phylogenetic analyses with sequences obtained in environmental sequencing studies as sister to the genus Fumarolamoeba. This phylogenetic placement was supported by analyses of the 5.8S rDNA leading us to describe it as a new genus Parafumarolamoeba. Copyright © 2015 Elsevier GmbH. All rights reserved.

  2. Male meiosis, heterochromatin characterization and chromosomal location of rDNA in Microtomus lunifer (Berg, 1900 (Hemiptera: Reduviidae: Hammacerinae

    Directory of Open Access Journals (Sweden)

    María Poggio

    2011-05-01

    Full Text Available In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900 by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y, including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in M. conspicillaris (Drury, 1782 (2n=28+XY. However, M. lunifer has a multiple sex chromosome system X1X2Y (male that could have originated by fragmentation of the ancestral X chromosome. Taking into account that M. conspicillaris and M. lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in M. lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants  of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity.

  3. Karyotypes and fish detection of 5s and 45s rdna loci in chinese medicinal plant atractylodes lancea subsp. luotianensis: cytological evidence for the new taxonomic unit

    International Nuclear Information System (INIS)

    Duan, Y.S.; Zhu, B.; Li, Z.Y.

    2015-01-01

    Atractylodes lancea (Thunb.) DC. in the Asteraceae family produces the atractylodes rhizome which is widely used as a traditional medicine in China. The subspecies A. lancea (Thunb.) DC subsp. Luotianensis distributed in mountainous Luotian and Yingshan regions in Hubei Province presented distinct morphology and superior medicinal quality. This study firstly reported the chromosome karyotype of this subspecies and the detection of 5S and 45S rDNA loci by fluorescent in situ hybridization. The karyotype was 2n=24=12m+12sm (2SAT). A single locus of 5S rDNA and two loci of 45S rDNA loci were identified and separated on different chromosomes. Its one pair of the satellited chromosomes rather than two pairs in other Atractylodes species yet still with 2n=24 occurred likely after its occupation of this geographic location. The evidence of karyotype differentiation of this subspecies native to the area is useful for elucidating the genome structure and identifying chromosomes. (author)

  4. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    de Oliveira, VM; Manfio, GP; Coutinho, HLD; Keijzer-Wolters, AC; van Elsas, JD

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  5. A ribosomal RNA gene intergenic spacer based PCR and DGGE fingerprinting method for the analysis of specific rhizobial communities in soil

    NARCIS (Netherlands)

    Oliveira, de V.M.; Manfio, G.P.; Coutinho, H.L.D.; Keijzer-Wolters, A.C.; Elsas, van J.D.

    2006-01-01

    A direct molecular method for assessing the diversity of specific populations of rhizobia in soil, based on nested PCR amplification of 16S-23S ribosomal RNA gene (rDNA) intergenic spacer (IGS) sequences, was developed. Initial generic amplification of bacterial rDNA IGS sequences from soil DNA was

  6. Genetic polymorphisms of Echinococcus tapeworms in China as determined by mitochondrial and nuclear DNA sequences

    Science.gov (United States)

    Nakao, Minoru; Li, Tiaoying; Han, Xiumin; Ma, Xiumin; Xiao, Ning; Qiu, Jiamin; Wang, Hu; Yanagida, Tetsuya; Mamuti, Wulamu; Wen, Hao; Moro, Pedro L.; Giraudoux, Patrick; Craig, Philip S.; Ito, Akira

    2009-01-01

    The genetic polymorphisms of Echinococcus spp. in the eastern Tibetan Plateau and the Xinjiang Uyghur Autonomous Region were evaluated by DNA sequencing analyses of genes for mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear elongation factor-1 alpha (ef1a). We collected 68 isolates of Echinococcus granulosus sensu stricto (s.s.) from Xinjiang and 113 isolates of E. granulosus s. s., 49 isolates of Echinococcus multilocularis and 34 isolates of Echinococcus shiquicus from the Tibetan Plateau. The results of molecular identification by mitochondrial and nuclear markers were identical, suggesting the infrequency of introgressive hybridization. A considerable intraspecific variation was detected in mitochondrial cox1 sequences. The parsimonious network of cox1 haplotypes showed star-like features in E. granulosus s. s. and E. multilocularis, but a divergent feature in E. shiquicus. The cox1 neutrality indexes computed by Tajima's D and Fu's Fs tests showed high negative values in E. granulosus s. s. and E. multilocularis, indicating significant deviations from neutrality. In contrast, the low positive values of both tests were obtained in E. shiquicus. These results suggest the following hypotheses: (i) recent founder effects arose in E. granulosus and E. multilocularis after introducing particular individuals into the endemic areas by anthropogenic movement or natural migration of host mammals, and (ii) the ancestor of E. shiquicus was segregated into the Tibetan Plateau by colonizing alpine mammals and its mitochondrial locus has evolved without bottleneck effects. PMID:19800346

  7. [Identification and phylogenetic analysis of one strain of Lactobacillus delbrueckii subsp. bulgaricus separated from yoghourt].

    Science.gov (United States)

    Wang, Chuan; Zhang, Chaowu; Pei, Xiaofang; Liu, Hengchuan

    2007-11-01

    For being further applied and studied, one strain of Lactobacillus delbrueckii subsp. bulgaricus (wch9901) separated from yoghourt which had been identified by phenotype characteristic analysis was identified by 16S rDNA and phylogenetic analyzed. The 16S rDNA of wch9901 was amplified with the genomic DNA of wch9901 as template, and the conservative sequences of the 16S rDNA as primers. Inserted 16S rDNA amplified into clonal vector pGEM-T under the function of T4 DNA ligase to construct recombined plasmid pGEM-wch9901 16S rDNA. The recombined plasmid was identified by restriction enzyme digestion, and the eligible plasmid was presented to sequencing company for DNA sequencing. Nucleic acid sequence was blast in GenBank and phylogenetic tree was constructed using neighbor-joining method of distance methods by Mega3.1 soft. Results of blastn showed that the homology of 16S rDNA of wch9901 with the 16S rDNA of Lactobacillus delbrueckii subsp. bulgaricus strains was higher than 96%. On the phylogenetic tree, wch9901 formed a separate branch and located between Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch and another evolution branch which was composed of Lactobacillus delbrueckii subsp. bulgaricus DL2 evolution cluster and Lactobacillus delbrueckii subsp. bulgaricus JSQ evolution cluster. The distance between wch9901 evolution branch and Lactobacillus delbrueckii subsp. bulgaricus LGM2 evolution branch was the closest. wch9901 belonged to Lactobacillus delbrueckii subsp. bulgaricus. wch9901 showed the closest evolution relationship to Lactobacillus delbrueckii subsp. bulgaricus LGM2.

  8. Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in the internal transcribed spacer rDNA region in fungi

    Science.gov (United States)

    Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud

    2013-01-01

    The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...

  9. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences.

    Science.gov (United States)

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-26

    The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consisting of N. ampullaria, N. mirabilis, N. gracilis and N. rafflesiana, and another containing both intermediately distributed species (N. albomarginata and N. benstonei) and four highland species (N. sanguinea, N. macfarlanei, N. ramispina and N. alba). The trnL intron and ITS sequences proved to provide phylogenetic informative characters for deriving a phylogeny of Nepenthes species in Peninsular Malaysia. To our knowledge, this is the first molecular phylogenetic study of Nepenthes species occurring along an altitudinal gradient in Peninsular Malaysia.

  10. Ichthyophonus parasite phylogeny based on ITS rDNA structure prediction and alignment identifies six clades, with a single dominant marine type

    Science.gov (United States)

    Gregg, Jacob; Thompson, Rachel L.; Purcell, Maureen; Friedman, Carolyn S.; Hershberger, Paul

    2016-01-01

    Despite their widespread, global impact in both wild and cultured fishes, little is known of the diversity, transmission patterns, and phylogeography of parasites generally identified as Ichthyophonus. This study constructed a phylogeny based on the structural alignment of internal transcribed spacer (ITS) rDNA sequences to compare Ichthyophonus isolates from fish hosts in the Atlantic and Pacific oceans, and several rivers and aquaculture sites in North America, Europe, and Japan. Structure of the Ichthyophonus ITS1–5.8S–ITS2 transcript exhibited several homologies with other eukaryotes, and 6 distinct clades were identified within Ichthyophonus. A single clade contained a majority (71 of 98) of parasite isolations. This ubiquitous Ichthyophonus type occurred in 13 marine and anadromous hosts and was associated with epizootics in Atlantic herring, Chinook salmon, and American shad. A second clade contained all isolates from aquaculture, despite great geographic separation of the freshwater hosts. Each of the 4 remaining clades contained isolates from single host species. This study is the first to evaluate the genetic relationships among Ichthyophonus species across a significant portion of their host and geographic range. Additionally, parasite infection prevalence is reported in 16 fish species.

  11. Ichthyophonus parasite phylogeny based on ITS rDNA structure prediction and alignment identifies six clades, with a single dominant marine type.

    Science.gov (United States)

    Gregg, Jacob L; Powers, Rachel L; Purcell, Maureen K; Friedman, Carolyn S; Hershberger, Paul K

    2016-07-07

    Despite their widespread, global impact in both wild and cultured fishes, little is known of the diversity, transmission patterns, and phylogeography of parasites generally identified as Ichthyophonus. This study constructed a phylogeny based on the structural alignment of internal transcribed spacer (ITS) rDNA sequences to compare Ichthyophonus isolates from fish hosts in the Atlantic and Pacific oceans, and several rivers and aquaculture sites in North America, Europe, and Japan. Structure of the Ichthyophonus ITS1-5.8S-ITS2 transcript exhibited several homologies with other eukaryotes, and 6 distinct clades were identified within Ichthyophonus. A single clade contained a majority (71 of 98) of parasite isolations. This ubiquitous Ichthyophonus type occurred in 13 marine and anadromous hosts and was associated with epizootics in Atlantic herring, Chinook salmon, and American shad. A second clade contained all isolates from aquaculture, despite great geographic separation of the freshwater hosts. Each of the 4 remaining clades contained isolates from single host species. This study is the first to evaluate the genetic relationships among Ichthyophonus species across a significant portion of their host and geographic range. Additionally, parasite infection prevalence is reported in 16 fish species.

  12. Phylogenetic diversity in the core group of Peziza inferred from ITS sequences and morphology

    DEFF Research Database (Denmark)

    Hansen, K.; Læssøe, Thomas; Pfister, D.H.

    2002-01-01

    Species delimitation within the core group of Peziza is highly controversial. The group, typified by P. vesiculosa, is morphologically coherent and in previous analyses of LSU rDNA sequences it formed a highly supported clade. Phylogenetic diversity and species limits were investigated within......), shallowly cup- to disc-shaped apothecia (A) and large (up to 15 cm), deeply cup-shaped to expanded apothecia (B). The overall exciple structure (a stratified or non-stratified medullary layer) and to some degree spore surface relief, likewise support the groupings. Clade A contains taxa with smooth...... that populations on a diverse array of substrates may be closely related, or indeed, conspecific....

  13. Residual DNA analysis in biologics development: review of measurement and quantitation technologies and future directions.

    Science.gov (United States)

    Wang, Xing; Morgan, Donna M; Wang, Gan; Mozier, Ned M

    2012-02-01

    Residual DNA (rDNA) is comprised of deoxyribonucleic acid (DNA) fragments and longer length molecules originating from the host organism that may be present in samples from recombinant biological processes. Although similar in basic structural base pair units, rDNA may exist in different sizes and physical forms. Interest in measuring rDNA in recombinant products is based primarily on demonstration of effective purification during manufacturing, but also on some hypothetical concerns that, in rare cases, depending on the host expression system, some DNA sequences may be potentially infectious or oncogenic (e.g., HIV virus and the Ras oncogene, respectively). Recent studies suggest that a sequence known as long interspersed nucleotide element-1 (LINE-1), widely distributed in the mammalian genome, is active as a retrotransposon that can be transcribed to RNA, reverse-transcribed into DNA and inserts into a new site in genome. This integration process could potentially disrupt critical gene functions or induce tumorigenesis in mammals. Genomic DNA from microbial sources, on the other hand, could add to risk of immunogenicity to the target recombinant protein being expressed, due to the high CpG content and unmethylated DNA sequence. For these and other reasons, it is necessary for manufacturers to show clearance of DNA throughout production processes and to confirm low levels in the final drug substance using an appropriately specific and quantitative analytical method. The heterogeneity of potential rDNA sequences that might be makes the testing of all potential analytes challenging. The most common methodology for rDNA quantitation used currently is real-time polymerase chain reaction (RT-PCR), a robust and proven technology. Like most rDNA quantitation methods, the specificity of RT-PCR is limited by the sequences to which the primers are directed. To address this, primase-based whole genome amplification is introduced herein. This paper will review the recent

  14. A rare case of silicone mammary implant infection by Streptomyces spp. in a patient with breast reconstruction after mastectomy: taxonomic characterization using molecular techniques

    DEFF Research Database (Denmark)

    Manteca, Angel; Pelaez, Ana Isabel; del Mar Garcia-Suarez, Maria

    2009-01-01

    A Streptomyces sp. isolated from a patient who had had breast reconstruction after a mastectomy was identified at the species level by comparative sequence analysis of 16S ribosomal DNA (rDNA) and the hypervariable alpha-region of the 16S rDNA.......A Streptomyces sp. isolated from a patient who had had breast reconstruction after a mastectomy was identified at the species level by comparative sequence analysis of 16S ribosomal DNA (rDNA) and the hypervariable alpha-region of the 16S rDNA....

  15. Babesia vesperuginis, a neglected piroplasmid: new host and geographical records, and phylogenetic relations.

    Science.gov (United States)

    Corduneanu, Alexandra; Hrazdilová, Kristýna; Sándor, Attila D; Matei, Ioana Adriana; Ionică, Angela Monica; Barti, Levente; Ciocănău, Marius-Alexandru; Măntoiu, Dragoş Ștefan; Coroiu, Ioan; Hornok, Sándor; Fuehrer, Hans-Peter; Leitner, Natascha; Bagó, Zoltán; Stefke, Katharina; Modrý, David; Mihalca, Andrei Daniel

    2017-12-06

    Babesia spp. are hemoparasites which infect the red blood cells of a large variety of mammals. In bats, the only known species of the genus is Babesia vesperuginis. However, except a few old reports, the host range and geographical distribution of this bat parasite have been poorly studied. This study aimed to investigate the presence of piroplasms in tissues of bats collected in four different countries from eastern and central Europe: Austria, Czech Republic, Hungary and Romania. A total of 461 bat carcasses (24 species) were collected between 2001 and 2016 from caves, mines and buildings. PCR was performed using specific primers targeting a portion of the 18S rDNA nuclear gene and cytochrome c oxidase subunit 1 mitochondrial gene, followed by sequencing. The results of this study show for the first time the presence of B. vesperuginis in bats in central and eastern Europe. The phylogenetic analysis of the 18S rDNA nuclear gene revealed no variability between the sequences and the phylogenetic analysis of the cox1 mitochondrial gene proved that B. vesperuginis could be divided into two subclades. Our study showed a broad geographical distribution of B. vesperuginis in European bats, reporting its presence in five new host species (M. cf. alcathoe, M. bechsteinii, M. myotis, Pi. nathusii and V. murinus) and three new countries.

  16. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae Inferred from Multiple Nuclear Gene Sequences

    Directory of Open Access Journals (Sweden)

    Keun-Yong Kim

    2013-01-01

    Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.

  17. Species delimitation of common reef corals in the genus Pocillopora using nucleotide sequence phylogenies, population genetics and symbiosis ecology.

    Science.gov (United States)

    Pinzón, Jorge H; LaJeunesse, Todd C

    2011-01-01

    Stony corals in the genus Pocillopora are among the most common and widely distributed of Indo-Pacific corals and, as such, are often the subject of physiological and ecological research. In the far Tropical Eastern Pacific (TEP), they are major constituents of shallow coral communities, exhibiting considerable variability in colony shape and branch morphology and marked differences in response to thermal stress. Numerous intermediates occur between morphospecies that may relate to extensive hybridization. The diversity of the Pocillopora genus in the TEP was analysed genetically using nuclear ribosomal (ITS2) and mitochondrial (ORF) sequences, and population genetic markers (seven microsatellite loci). The resident dinoflagellate endosymbiont (Symbiodinium sp.) in each sample was also characterized using sequences of the internal transcribed spacer 2 (ITS2) rDNA and the noncoding region of the chloroplast psbA minicircle. From these analyses, three symbiotically distinct, reproductively isolated, nonhybridizing, evolutionarily divergent animal lineages were identified. Designated types 1, 2 and 3, these groupings were incongruent with traditional morphospecies classification. Type 1 was abundant and widespread throughout the TEP; type 2 was restricted to the Clipperton Atoll; and type 3 was found only in Panama and the Galapagos Islands. Each type harboured a different Symbiodinium'species lineage' in Clade C, and only type 1 associated with the 'stress-tolerant'Symbiodinium glynni (D1). The accurate delineation of species and implementation of a proper taxonomy may profoundly improve our assessment of Pocillopora's reproductive biology, biogeographic distributions, and resilience to climate warming, information that must be considered when planning for the conservation of reef corals. © 2010 Blackwell Publishing Ltd.

  18. iNR-PhysChem: a sequence-based predictor for identifying nuclear receptors and their subfamilies via physical-chemical property matrix.

    Directory of Open Access Journals (Sweden)

    Xuan Xiao

    Full Text Available Nuclear receptors (NRs form a family of ligand-activated transcription factors that regulate a wide variety of biological processes, such as homeostasis, reproduction, development, and metabolism. Human genome contains 48 genes encoding NRs. These receptors have become one of the most important targets for therapeutic drug development. According to their different action mechanisms or functions, NRs have been classified into seven subfamilies. With the avalanche of protein sequences generated in the postgenomic age, we are facing the following challenging problems. Given an uncharacterized protein sequence, how can we identify whether it is a nuclear receptor? If it is, what subfamily it belongs to? To address these problems, we developed a predictor called iNR-PhysChem in which the protein samples were expressed by a novel mode of pseudo amino acid composition (PseAAC whose components were derived from a physical-chemical matrix via a series of auto-covariance and cross-covariance transformations. It was observed that the overall success rate achieved by iNR-PhysChem was over 98% in identifying NRs or non-NRs, and over 92% in identifying NRs among the following seven subfamilies: NR1--thyroid hormone like, NR2--HNF4-like, NR3--estrogen like, NR4--nerve growth factor IB-like, NR5--fushi tarazu-F1 like, NR6--germ cell nuclear factor like, and NR0--knirps like. These rates were derived by the jackknife tests on a stringent benchmark dataset in which none of protein sequences included has ≥60% pairwise sequence identity to any other in a same subset. As a user-friendly web-server, iNR-PhysChem is freely accessible to the public at either http://www.jci-bioinfo.cn/iNR-PhysChem or http://icpr.jci.edu.cn/bioinfo/iNR-PhysChem. Also a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics involved in developing the predictor. It is anticipated that iNR-PhysChem may

  19. How conserved are the bacterial communities associated with aphids? A detailed assessment of the Brevicoryne brassicae (Hemiptera: Aphididae) using 16S rDNA.

    Science.gov (United States)

    Clark, E L; Daniell, T J; Wishart, J; Hubbard, S F; Karley, A J

    2012-12-01

    Aphids harbor a community of bacteria that include obligate and facultative endosymbionts belonging to the Enterobacteriaceae along with opportunistic, commensal, or pathogenic bacteria. This study represents the first detailed analysis of the identity and diversity of the bacterial community associated with the cabbage aphid, Brevicoryne brassicae (L.). 16S rDNA sequence analysis revealed that the community of bacteria associated with B. brassicae was diverse, with at least four different bacterial community types detected among aphid lines, collected from widely dispersed sites in Northern Britain. The bacterial sequence types isolated from B. brassicae showed little similarity to any bacterial endosymbionts characterized in insects; instead, they were closely related to free-living extracellular bacterial species that have been isolated from the aphid gut or that are known to be present in the environment, suggesting that they are opportunistic bacteria transmitted between the aphid gut and the environment. To quantify variation in bacterial community between aphid lines, which was driven largely by differences in the proportions of two dominant bacterial orders, the Pseudomonales and the Enterobacteriales, we developed a novel real-time (Taqman) qPCR assay. By improving our knowledge of aphid microbial ecology, and providing novel molecular tools to examine the presence and function of the microbial community, this study forms the basis of further research to explore the influence of the extracellular bacterial community on aphid fitness, pest status, and susceptibility to control by natural enemies.

  20. Effect of preemptive weld overlay sequence on residual stress distribution for dissimilar metal weld of Kori nuclear power plant pressurizer

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Hong Yeol; Song, Tae Kwang; Chun, Yun Bae; Oh, Chang Young; Kim, Yun Jae [Korea Univ., Seoul (Korea, Republic of); Lee, Kyoung Soo; Park, Chi Yong [Korea Electric Power Research Institute, Daejeon (Korea, Republic of)

    2008-07-01

    Weld overlay is one of the residual stress mitigation method which arrest crack. An overlay weld sued in this manner is termed a Preemptive Weld OverLay(PWOL). PWOL was good for distribution of residual stress of Dissimilar Metal Weld(DMW) by previous research. Because range of overlay welding is wide relatively, residual stress distribution on PWR is affected by welding sequence. In order to examine the effect of welding sequence, PWOL was applied to a specific DMW of KORI nuclear power plant by finite element analysis method. As a result, the welding direction that from nozzle to pipe is better good for residual stress distribution on PWR.

  1. Effect of preemptive weld overlay sequence on residual stress distribution for dissimilar metal weld of Kori nuclear power plant pressurizer

    International Nuclear Information System (INIS)

    Bae, Hong Yeol; Song, Tae Kwang; Chun, Yun Bae; Oh, Chang Young; Kim, Yun Jae; Lee, Kyoung Soo; Park, Chi Yong

    2008-01-01

    Weld overlay is one of the residual stress mitigation method which arrest crack. An overlay weld sued in this manner is termed a Preemptive Weld OverLay(PWOL). PWOL was good for distribution of residual stress of Dissimilar Metal Weld(DMW) by previous research. Because range of overlay welding is wide relatively, residual stress distribution on PWR is affected by welding sequence. In order to examine the effect of welding sequence, PWOL was applied to a specific DMW of KORI nuclear power plant by finite element analysis method. As a result, the welding direction that from nozzle to pipe is better good for residual stress distribution on PWR

  2. Karyotyping and in situ chromosomal localization of rDNA sites in black cumin Bunium persicum (Boiss B. Fedtsch,1915 (Apiaceae

    Directory of Open Access Journals (Sweden)

    R. K. Chahota

    2011-11-01

    Full Text Available The fluorescent in situ hybridization (FISH technique has been applied to somatic chromosomes in the medicinally important species, Bunium persicum, to elucidate its karyotypes. The bicolour FISH technique involving 18S-5.8S-26S and 5S ribosomal RNA genes as probes was used to assign physical localization and measurement of rDNA sites on homologous pairs of chromosomes. The two 18S-5.8S-26S rRNA gene sites were at the terminal regions of the short arms of the chromosomes 1 and 2 involving NOR region of chromosome 1. The 5S rDNA sites were found on subtelomeric region of the long arm of the chromosome number 5 and at interstitial regions of the short arm of chromosome 7. Based on direct visual analysis of chromosome length, morphology and position of FISH signals, a pioneer attempt has been made to construct metaphase karyotype in B. persicum, an endangered medicinal plant of North Western Himalayas.

  3. NLSdb-major update for database of nuclear localization signals and nuclear export signals.

    Science.gov (United States)

    Bernhofer, Michael; Goldberg, Tatyana; Wolf, Silvana; Ahmed, Mohamed; Zaugg, Julian; Boden, Mikael; Rost, Burkhard

    2018-01-04

    NLSdb is a database collecting nuclear export signals (NES) and nuclear localization signals (NLS) along with experimentally annotated nuclear and non-nuclear proteins. NES and NLS are short sequence motifs related to protein transport out of and into the nucleus. The updated NLSdb now contains 2253 NLS and introduces 398 NES. The potential sets of novel NES and NLS have been generated by a simple 'in silico mutagenesis' protocol. We started with motifs annotated by experiments. In step 1, we increased specificity such that no known non-nuclear protein matched the refined motif. In step 2, we increased the sensitivity trying to match several different families with a motif. We then iterated over steps 1 and 2. The final set of 2253 NLS motifs matched 35% of 8421 experimentally verified nuclear proteins (up from 21% for the previous version) and none of 18 278 non-nuclear proteins. We updated the web interface providing multiple options to search protein sequences for NES and NLS motifs, and to evaluate your own signal sequences. NLSdb can be accessed via Rostlab services at: https://rostlab.org/services/nlsdb/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Probabilistic studies of accident sequences

    International Nuclear Information System (INIS)

    Villemeur, A.; Berger, J.P.

    1986-01-01

    For several years, Electricite de France has carried out probabilistic assessment of accident sequences for nuclear power plants. In the framework of this program many methods were developed. As the interest in these studies was increasing and as adapted methods were developed, Electricite de France has undertaken a probabilistic safety assessment of a nuclear power plant [fr

  5. Phylogeny of Eleusine (Poaceae: Chloridoideae) based on nuclear ITS and plastid trnT-trnF sequences.

    Science.gov (United States)

    Neves, Susana S; Swire-Clark, Ginger; Hilu, Khidir W; Baird, Wm Vance

    2005-05-01

    Phylogenetic relationships in the genus Eleusine (Poaceae: Chloridoideae) were investigated using nuclear ITS and plastid trnT-trnF sequences. Separate and combined data sets were analyzed using parsimony, distance, and likelihood based methods, including Bayesian. Data congruence was examined using character and topological measures. Significant data heterogeneity was detected, but there was little conflict in the topological substructure measures for triplets and quartets, and resolution and clade support increased in the combined analysis. Data incongruence may be a result of noise and insufficient information in the slower evolving trnT-trnF. Monophyly of Eleusine is strongly supported in all analyses, but basal relationships in the genus remain uncertain. There is good support for a CAIK clade (E. coracana subsp. coracana and africana, E. indica, and E. kigeziensis), with E. tristachya as its sister group. Two putative ITS homeologues (A and B loci) were identified in the allotetraploid E. coracana; the 'B' locus sequence type was not found in the remaining species. Eleusine coracana and its putative 'A' genome donor, the diploid E. indica, are confirmed close allies, but sequence data contradicts the hypothesis that E. floccifolia is its second genome donor. The 'B' genome donor remains unidentified and may be extinct.

  6. Cloning and restriction enzyme mapping of ribosomal DNA of Giardia duodenalis, Giardia ardeae and Giardia muris.

    Science.gov (United States)

    van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L

    1991-06-01

    In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.

  7. Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

    Energy Technology Data Exchange (ETDEWEB)

    McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.; Kuehl, Jennifer V.; Boore, Jeffrey L.; dePamphilis, Claude W.

    2005-08-26

    Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. A minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.

  8. Mitochondrial and nuclear sequence polymorphisms reveal geographic structuring in Amazonian populations of Echinococcus vogeli (Cestoda: Taeniidae).

    Science.gov (United States)

    Santos, Guilherme B; Soares, Manoel do C P; de F Brito, Elisabete M; Rodrigues, André L; Siqueira, Nilton G; Gomes-Gouvêa, Michele S; Alves, Max M; Carneiro, Liliane A; Malheiros, Andreza P; Póvoa, Marinete M; Zaha, Arnaldo; Haag, Karen L

    2012-12-01

    To date, nothing is known about the genetic diversity of the Echinococcus neotropical species, Echinococcus vogeli and Echinococcus oligarthrus. Here we used mitochondrial and nuclear DNA sequence polymorphisms to uncover the genetic structure, transmission and history of E. vogeli in the Brazilian Amazon, based on a sample of 38 isolates obtained from human and wild animal hosts. We confirm that the parasite is partially synanthropic and show that its populations are diverse. Furthermore, significant geographical structuring is found, with western and eastern populations being genetically divergent. Copyright © 2012 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  9. Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

    2011-09-01

    Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

  10. Cytosine hypomethylation at CHG and CHH sites in the pleiotropic ...

    Indian Academy of Sciences (India)

    Keywords. bisulphite sequencing; CMT3; DNA demethylases; DNA methyl transferases; demethylation; excision repair; mutagenic hot spots; phylogenetic relationships; 5S rDNA; 18S rDNA; RdDM; spontaneous mutagenesis.

  11. Improved Method for Direct Detection of Environmental Microorganisms Using an Amplification of 16S rDNA Region

    Science.gov (United States)

    Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.

    2004-12-01

    The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection

  12. Variation in Ribosomal DNA among Isolates of the Mycorrhizal Fungus Cenococcum Geophilum FR.

    Science.gov (United States)

    Lobuglio, Katherine Frances

    1990-01-01

    Cenococcum geophilum Fr., a cosmopolitan mycorrhizal fungus, is well-known for its extremely wide host and habitat range. The ecological diversity of C. geophilum sharply contrasts its present taxonomic status as a monotypic form -genus. Restriction fragment length polymorphisms (RFLPs) in nuclear ribosomal DNA (rDNA) was used to assess the degree of genetic variation among 72 isolates of C. geophilum. The probe used in this study was the rDNA repeat cloned from C. geophilum isolate A145 (pCG15). Length of the rDNA repeat was approximately 9 kb. The rDNA clone was mapped for 5 restriction endonucleases. Hybridization with cloned Saccharomyces cerevisiae rDNA (pSR118, and pSR125 containing the 18S, and 5.8-25S rRNA genes respectively), and alignment of restriction endonuclease sites conserved in the rDNA genes of other fungi, were used to position the corresponding rDNAs of C. geophilum. Southern hybridizations with EcoRI, HindIII, XhoI, and PstI digested DNAs indicated extensive variation among the C. geophilum isolates, greater than has been previously reported to occur within a fungal species. Most of the rDNA polymorphisms occurred in the IGS region. Restriction endonuclease site and length polymorphisms were also observed in the 5.8S-26S genic regions. Sixteen size categories of length mutations, 6 restriction endonuclease site additions, and 4 restriction endonuclease site deletions were determined using isolate A145 as a reference. The rDNA repeat length among the isolates varied from approximately 8.5 to 10.2 kb. RFLPs were also observed in the mitochondrial (mt) 24S rRNA gene and flanking regions of HindIII digested DNAs of C. geophilum isolates representing both geographically distinct and similar origins. Among the C. geophilum isolates analyzed there were fewer RFLPs in mt-DNA than in nuclear rDNA. EcoRI rDNA phenotypes between C. geophilum and Elaphomyces anthracinus, its proposed teleomorph or sexual state, did not correspond. In addition, the four

  13. A Molecular Phylogeny of Hemiptera Inferred from Mitochondrial Genome Sequences

    Science.gov (United States)

    Song, Nan; Liang, Ai-Ping; Bu, Cui-Ping

    2012-01-01

    Classically, Hemiptera is comprised of two suborders: Homoptera and Heteroptera. Homoptera includes Cicadomorpha, Fulgoromorpha and Sternorrhyncha. However, according to previous molecular phylogenetic studies based on 18S rDNA, Fulgoromorpha has a closer relationship to Heteroptera than to other hemipterans, leaving Homoptera as paraphyletic. Therefore, the position of Fulgoromorpha is important for studying phylogenetic structure of Hemiptera. We inferred the evolutionary affiliations of twenty-five superfamilies of Hemiptera using mitochondrial protein-coding genes and rRNAs. We sequenced three mitogenomes, from Pyrops candelaria, Lycorma delicatula and Ricania marginalis, representing two additional families in Fulgoromorpha. Pyrops and Lycorma are representatives of an additional major family Fulgoridae in Fulgoromorpha, whereas Ricania is a second representative of the highly derived clade Ricaniidae. The organization and size of these mitogenomes are similar to those of the sequenced fulgoroid species. Our consensus phylogeny of Hemiptera largely supported the relationships (((Fulgoromorpha,Sternorrhyncha),Cicadomorpha),Heteroptera), and thus supported the classic phylogeny of Hemiptera. Selection of optimal evolutionary models (exclusion and inclusion of two rRNA genes or of third codon positions of protein-coding genes) demonstrated that rapidly evolving and saturated sites should be removed from the analyses. PMID:23144967

  14. A molecular phylogeny of Hemiptera inferred from mitochondrial genome sequences.

    Directory of Open Access Journals (Sweden)

    Nan Song

    Full Text Available Classically, Hemiptera is comprised of two suborders: Homoptera and Heteroptera. Homoptera includes Cicadomorpha, Fulgoromorpha and Sternorrhyncha. However, according to previous molecular phylogenetic studies based on 18S rDNA, Fulgoromorpha has a closer relationship to Heteroptera than to other hemipterans, leaving Homoptera as paraphyletic. Therefore, the position of Fulgoromorpha is important for studying phylogenetic structure of Hemiptera. We inferred the evolutionary affiliations of twenty-five superfamilies of Hemiptera using mitochondrial protein-coding genes and rRNAs. We sequenced three mitogenomes, from Pyrops candelaria, Lycorma delicatula and Ricania marginalis, representing two additional families in Fulgoromorpha. Pyrops and Lycorma are representatives of an additional major family Fulgoridae in Fulgoromorpha, whereas Ricania is a second representative of the highly derived clade Ricaniidae. The organization and size of these mitogenomes are similar to those of the sequenced fulgoroid species. Our consensus phylogeny of Hemiptera largely supported the relationships (((Fulgoromorpha,Sternorrhyncha,Cicadomorpha,Heteroptera, and thus supported the classic phylogeny of Hemiptera. Selection of optimal evolutionary models (exclusion and inclusion of two rRNA genes or of third codon positions of protein-coding genes demonstrated that rapidly evolving and saturated sites should be removed from the analyses.

  15. Bacterial community composition in different sediments from the Eastern Mediterranean Sea: a comparison of four 16S ribosomal DNA clone libraries.

    Science.gov (United States)

    Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G

    2005-10-01

    The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.

  16. Repeated DNA sequences in fungi

    Energy Technology Data Exchange (ETDEWEB)

    Dutta, S K

    1974-11-01

    Several fungal species, representatives of all broad groups like basidiomycetes, ascomycetes and phycomycetes, were examined for the nature of repeated DNA sequences by DNA:DNA reassociation studies using hydroxyapatite chromatography. All of the fungal species tested contained 10 to 20 percent repeated DNA sequences. There are approximately 100 to 110 copies of repeated DNA sequences of approximately 4 x 10/sup 7/ daltons piece size of each. Repeated DNA sequence homoduplexes showed on average 5/sup 0/C difference of T/sub e/50 (temperature at which 50 percent duplexes dissociate) values from the corresponding homoduplexes of unfractionated whole DNA. It is suggested that a part of repetitive sequences in fungi constitutes mitochondrial DNA and a part of it constitutes nuclear DNA. (auth)

  17. Identification and phylogeny of Enterobacter sakazakii relative to Enterobacter and Citrobacter species

    DEFF Research Database (Denmark)

    Iversen, Carol; Waddington, Michael; On, Stephen L.W.

    2004-01-01

    The phylogenetic relationships of Enterobacter sakazakii strains were investigated using 16S ribosomal DNA (rDNA) and hsp60 sequencing. Each analysis distributed E. sakazakii strains among four clusters, indicating substantial taxonomic heterogeneity. The E. sakazakii type strain 16S rDNA sequence...... was 97.8% similar to that of Citrobacter koseri but 97.0% similar to that of Enterobacter cloacae....

  18. A decision theoretic approach to an accident sequence: when feedwater and auxiliary feedwater fail in a nuclear power plant

    International Nuclear Information System (INIS)

    Svenson, Ola

    1998-01-01

    This study applies a decision theoretic perspective on a severe accident management sequence in a processing industry. The sequence contains loss of feedwater and auxiliary feedwater in a boiling water nuclear reactor (BWR), which necessitates manual depressurization of the reactor pressure vessel to enable low pressure cooling of the core. The sequence is fast and is a major contributor to core damage in probabilistic risk analyses (PRAs) of this kind of plant. The management of the sequence also includes important, difficult and fast human decision making. The decision theoretic perspective, which is applied to a Swedish ABB-type reactor, stresses the roles played by uncertainties about plant state, consequences of different actions and goals during the management of a severe accident sequence. Based on a theoretical analysis and empirical simulator data the human error probabilities in the PRA for the plant are considered to be too small. Recommendations for how to improve safety are given and they include full automation of the sequence, improved operator training, and/or actions to assist the operators' decision making through reduction of uncertainties, for example, concerning water/steam level for sufficient cooling, time remaining before insufficient cooling level in the tank is reached and organizational cost-benefit evaluations of the events following a false alarm depressurization as well as the events following a successful depressurization at different points in time. Finally, it is pointed out that the approach exemplified in this study is applicable to any accident scenario which includes difficult human decision making with conflicting goals, uncertain information and with very serious consequences

  19. Study of event sequence database for a nuclear power domain

    International Nuclear Information System (INIS)

    Kusumi, Yoshiaki

    1998-01-01

    A retrieval engine developed to extract event sequences from an accident information database using a time series retrieval formula expressed with ordered retrieval terms is explored. This engine outputs not only a sequence which completely matches with a time series retrieval formula, but also sequence which approximately matches the formula (fuzzy retrieval). An event sequence database in which records consist of three ordered parameters, namely the causal event, the process and result. Then the database is used to assess the feasibility of this engine and favorable results were obtained. (author)

  20. Sequence analysis and typing of Saprolegnia strains isolated from freshwater fish from Southern Chinese regions

    Directory of Open Access Journals (Sweden)

    Siya Liu

    2017-09-01

    Full Text Available Saprolegniasis, caused by Saprolegnia infection, is one of the most common diseases in freshwater fish. Our study aimed to determine the epidemiological characteristics of saprolegniasis in Chinese regions of high incidence. Saprolegnia were isolated and identified by morphological and molecular methods targeting the internal transcribed spacer (ITS ribosomal DNA (rDNA and building neighbor-joining (NJ and maximum parsimony (MP phylogenetic trees. The ITS sequences of eight isolated strains were compared with GenBank sequences and all strains fell into three clades: CLADE1 (02, LP, 04 and 14, CLADE2 (S1, and CLADE3 (CP, S2, L5 and the reference ATCC200013. Isolates 02 and LP shared 80% sequence similarity with S. diclina, S. longicaulis, S. ferax, S. mixta, and S. anomalies. Further, isolates 04 and 14 shared 80% similarity with S. bulbosa and S. oliviae. Finally, extremely high ITS sequence similarities were identified between isolates S1 and S. australis (100%; CP and S. hypogyna (96%; and S2, L5, ATCC200013 and S. salmonis (98%. This research provides insights into the identification, prevention and control of saprolegniasis pathogens and the potential development of effective drugs.

  1. Sequence dependent structure and thermodynamics of DNA oligonucleotides and polynucleotides: uv melting and NMR (nuclear magnetic resonance) studies

    International Nuclear Information System (INIS)

    Aboul-ela, F.M.

    1987-12-01

    Thermodynamic parameters for double strand formation have been measured for the twenty-five DNA double helices made by mixing deoxyoligonucleotides of the sequence dCA 3 XA 3 G with the complement dCT 3 YT 3 G. Each of the bases A, C, G, T, and I (I = hypoxanthine) have been substituted at the positions labeled X and Y. The results are analyzed in terms of nearest neighbors. At higher temperatures the sequences containing a G/center dot/C base pair become more stable than those containing only A/center dot/T. All molecules containing mismatcher are destabilized with respect to those with only Watson-Crick pairing, but there is a wide range of destabilization. Large neighboring base effects upon stability were observed. For example, when (X, Y) = (I, A), the duplex is eightfold more stable than when (X, Y) = (A, I). Independent of sequence effects the order of stabilities is: I/center dot/C /succ/ I/center dot/ A/succ/ I/center dot/T ∼ I/center dot/G. All of these results are discussed within the context of models for sequence dependent DNA secondary structure, replication fidelity and mechanisms of mismatch repair, and implications for probe design. The duplex deoxyoligonucleotide d(GGATGGGAG)/center dot/d(CTCCCATCC) is a portion of the gene recognition sequence of the protein transcription factor IIIA. The crystal structure of this oligonucleotide was shown to be A-form The present study employs Nuclear Magnetic Resonance, optical, chemical and enzymatic techniques to investigate the solution structure of this DNA 9-mer. (157 refs., 19 figs., 10 tabs.)

  2. Structure-Related Roles for the Conservation of the HIV-1 Fusion Peptide Sequence Revealed by Nuclear Magnetic Resonance.

    Science.gov (United States)

    Serrano, Soraya; Huarte, Nerea; Rujas, Edurne; Andreu, David; Nieva, José L; Jiménez, María Angeles

    2017-10-17

    Despite extensive characterization of the human immunodeficiency virus type 1 (HIV-1) hydrophobic fusion peptide (FP), the structure-function relationships underlying its extraordinary degree of conservation remain poorly understood. Specifically, the fact that the tandem repeat of the FLGFLG tripeptide is absolutely conserved suggests that high hydrophobicity may not suffice to unleash FP function. Here, we have compared the nuclear magnetic resonance (NMR) structures adopted in nonpolar media by two FP surrogates, wtFP-tag and scrFP-tag, which had equal hydrophobicity but contained wild-type and scrambled core sequences LFLGFLG and FGLLGFL, respectively. In addition, these peptides were tagged at their C-termini with an epitope sequence that folded independently, thereby allowing Western blot detection without interfering with FP structure. We observed similar α-helical FP conformations for both specimens dissolved in the low-polarity medium 25% (v/v) 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), but important differences in contact with micelles of the membrane mimetic dodecylphosphocholine (DPC). Thus, whereas wtFP-tag preserved a helix displaying a Gly-rich ridge, the scrambled sequence lost in great part the helical structure upon being solubilized in DPC. Western blot analyses further revealed the capacity of wtFP-tag to assemble trimers in membranes, whereas membrane oligomers were not observed in the case of the scrFP-tag sequence. We conclude that, beyond hydrophobicity, preserving sequence order is an important feature for defining the secondary structures and oligomeric states adopted by the HIV FP in membranes.

  3. Identification Of Some Strains Of Dinoflagellates Based On Morphology And Molecular Analysis

    Directory of Open Access Journals (Sweden)

    Hikmah Thoha

    2008-11-01

    Full Text Available Dinoflagellates are the important primary producers in aquatic environments. In oceans, they play interesting role in ecological functions such as red tide forming organisms, symbiont of coral reef or sea anemone and DSP (Diarrhetic Shellfish Poisoning or PSP (Paralytic Shellfish Poisoning producing organisms. Morphology and molecular analysis of dinoflagellates were conducted on November 2002 to March 2003. The phylogenetic studies based on 18S rDNA analyses, sequence have begun to appear more frequently in the literature, as attention has turned to relationships within the major eukaryotic lineages, particular importance for the taxonomy of the armored and unarmored genera of dinoflagellates (Gyrodinium sp., Cachonina sp., Gymnodinium sp., Amphidinium sp., because many of the genera cause extensive plankton blooms, fish kills and other harmful events, were studied used to amplify 18S rDNA, present in the total DNA extracted from algal pellet. The amplify approximately 1400 bp of the nuclear-encoded LSU rDNA gene using terminal primeirs DIR, products were cheked by 1.0 % agarose gel electrophoresis, then cloning with TA cloning KIT. Sequencing were analyzed by the GENETIX Mac Software, Homology search by Blast and Phylogenetic analysis. Results of hylogenetic analysis of 18S rDNA are: Strain no. 10893 (un identified from the genera, it is belonging Gymnodinium or Polarella. Strain no. 10795 is closely related other species Cachonina hallii. We tentatively named strain no 11151 and 11160 similar to Gyrodinium or Gymnodinium based on morphology, but these strain indepently position in this tree and is not a real of Gymnodinium sensu stricto. It is possible, we can establish the new genera for strain no. 11151; 11160 because this not cluster any other unarmored species.

  4. The karyotype and 5S rRNA genes from Spanish individuals of the bat species Rhinolophus hipposideros (Rhinolophidae; Chiroptera).

    Science.gov (United States)

    Puerma, Eva; Acosta, Manuel J; Barragán, Maria José L; Martínez, Sergio; Marchal, Juan Alberto; Bullejos, Mónica; Sánchez, Antonio

    2008-11-01

    The karyotype of individuals of the species Rhinolophus hipposideros from Spain present a chromosome number of 2n = 54 (NFa = 62). The described karyotype for these specimens is very similar to another previously described in individual from Bulgaria. However, the presence of one additional pair of autosomal acrocentric chromosomes in the Bulgarian karyotype and the differences in X chromosome morphology indicated that we have described a new karyotype variant in this species. In addition, we have analyzed several clones of 1.4 and 1 kb of a PstI repeated DNA sequence from the genome of R. hipposideros. The repeated sequence included a region with high identity with the 5S rDNA genes and flanking regions, with no homology with GenBank sequences. Search for polymerase III regulatory elements demonstrated the presence of type I promoter elements (A-box, Intermediate Element and C-box) in the 5S rDNA region. In addition, upstream regulatory elements, as a D-box and Sp1 binding sequences, were present in flanking regions. All data indicated that the cloned repeated sequences are the functional rDNA genes from this species. Finally, FISH demonstrated the presence of rDNA in nine chromosome pairs, which is surprising as most mammals have only one carrier chromosome pair.

  5. Reconsidering the generation time hypothesis based on nuclear ribosomal ITS sequence comparisons in annual and perennial angiosperms

    Directory of Open Access Journals (Sweden)

    Fiz-Palacios Omar

    2008-12-01

    Full Text Available Abstract Background Differences in plant annual/perennial habit are hypothesized to cause a generation time effect on divergence rates. Previous studies that compared rates of divergence for internal transcribed spacer (ITS1 and ITS2 sequences of nuclear ribosomal DNA (nrDNA in angiosperms have reached contradictory conclusions about whether differences in generation times (or other life history features are associated with divergence rate heterogeneity. We compared annual/perennial ITS divergence rates using published sequence data, employing sampling criteria to control for possible artifacts that might obscure any actual rate variation caused by annual/perennial differences. Results Relative rate tests employing ITS sequences from 16 phylogenetically-independent annual/perennial species pairs rejected rate homogeneity in only a few comparisons, with annuals more frequently exhibiting faster substitution rates. Treating branch length differences categorically (annual faster or perennial faster regardless of magnitude with a sign test often indicated an excess of annuals with faster substitution rates. Annuals showed an approximately 1.6-fold rate acceleration in nucleotide substitution models for ITS. Relative rates of three nuclear loci and two chloroplast regions for the annual Arabidopsis thaliana compared with two closely related Arabidopsis perennials indicated that divergence was faster for the annual. In contrast, A. thaliana ITS divergence rates were sometimes faster and sometimes slower than the perennial. In simulations, divergence rate differences of at least 3.5-fold were required to reject rate constancy in > 80 % of replicates using a nucleotide substitution model observed for the combination of ITS1 and ITS2. Simulations also showed that categorical treatment of branch length differences detected rate heterogeneity > 80% of the time with a 1.5-fold or greater rate difference. Conclusion Although rate homogeneity was not rejected

  6. Severe Accident Sequence Analysis Program: Anticipated transient without scram simulations for Browns Ferry Nuclear Plant Unit 1

    International Nuclear Information System (INIS)

    Dallman, R.J.; Gottula, R.C.; Holcomb, E.E.; Jouse, W.C.; Wagoner, S.R.; Wheatley, P.D.

    1987-05-01

    An analysis of five anticipated transients without scram (ATWS) was conducted at the Idaho National Engineering Laboratory (INEL). The five detailed deterministic simulations of postulated ATWS sequences were initiated from a main steamline isolation valve (MSIV) closure. The subject of the analysis was the Browns Ferry Nuclear Plant Unit 1, a boiling water reactor (BWR) of the BWR/4 product line with a Mark I containment. The simulations yielded insights to the possible consequences resulting from a MSIV closure ATWS. An evaluation of the effects of plant safety systems and operator actions on accident progression and mitigation is presented

  7. Evolutionary relationship between dinoflagellates bearing obligate diatom endosymbionts: insight into tertiary endosymbiosis.

    Science.gov (United States)

    Inagaki, Y; Dacks, J B; Doolittle, W F; Watanabe, K I; Ohama, T

    2000-11-01

    The marine dinoflagellates Peridinium balticum and Peridinium foliaceum are known for bearing diatom endosymbionts instead of peridinin-containing plastids. While evidence clearly indicates that their endosymbionts are closely related, the relationship between the host dinoflagellate cells is not settled. To examine the relationship of the two dinoflagellates, the DNA sequences of nuclear small-subunit rRNA genes (SSU rDNA) from Peridinium balticum, Peridinium foliaceum and one other peridinin-containing species, Peridinium bipes, were amplified, cloned and sequenced. While phylogenetic analyses under simple models of nucleotide substitution weakly support the monophyly of Peridinium balticum and Peridinium foliaceum, analyses under more sophisticated models significantly increased the statistical support for this relationship. Combining these results with the similarity between the two endosymbionts, it is concluded that (i) the two hosts have the closest sister relationship among dinoflagellates tested, (ii) the hypothesis that the diatom endosymbiosis occurred prior to the separation of the host cells is most likely to explain their evolutionary histories, and (iii) phylogenetic inferences under complex nucleotide evolution models seem to be able to compensate significant rate variation in the two SSU rDNA.

  8. Genetic structure of typical and atypical populations of Candida albicans from Africa.

    Science.gov (United States)

    Forche, A; Schönian, G; Gräser, Y; Vilgalys, R; Mitchell, T G

    1999-11-01

    Atypical isolates of the pathogenic yeast Candida albicans have been reported with increasing frequency. To investigate the origin of a set of atypical isolates and their relationship to typical isolates, we employed a combination of molecular phylogenetic and population genetic analyses using rDNA sequencing, PCR fingerprinting, and analysis of co-dominant DNA nucleotide polymorphisms to characterize the population structure of one typical and two atypical populations of C. albicans from Angola and Madagascar. The extent of clonality and recombination was assessed in each population. The analyses revealed that the structure of all three populations of C. albicans was predominantly clonal but, as in previous studies, there was also evidence for recombination. Allele frequencies differed significantly between the typical and the atypical populations, suggesting very low levels of gene flow between them. However, allele frequencies were quite similar in the two atypical C. albicans populations, suggesting that they are closely related. Phylogenetic analysis of partial sequences encoding the nuclear 26S rDNA demonstrated that all three populations belong to a single monophyletic group, which includes the type strain of C. albicans. Copyright 1999 Academic Press.

  9. Topology of genes and nontranscribed sequences in human interphase nuclei

    International Nuclear Information System (INIS)

    Scheuermann, Markus O.; Tajbakhsh, Jian; Kurz, Anette; Saracoglu, Kaan; Eils, Roland; Lichter, Peter

    2004-01-01

    Knowledge about the functional impact of the topological organization of DNA sequences within interphase chromosome territories is still sparse. Of the few analyzed single copy genomic DNA sequences, the majority had been found to localize preferentially at the chromosome periphery or to loop out from chromosome territories. By means of dual-color fluorescence in situ hybridization (FISH), immunolabeling, confocal microscopy, and three-dimensional (3D) image analysis, we analyzed the intraterritorial and nuclear localization of 10 genomic fragments of different sequence classes in four different human cell types. The localization of three muscle-specific genes FLNA, NEB, and TTN, the oncogene BCL2, the tumor suppressor gene MADH4, and five putatively nontranscribed genomic sequences was predominantly in the periphery of the respective chromosome territories, independent from transcriptional status and from GC content. In interphase nuclei, the noncoding sequences were only rarely found associated with heterochromatic sites marked by the satellite III DNA D1Z1 or clusters of mammalian heterochromatin proteins (HP1α, HP1β, HP1γ). However, the nontranscribed sequences were found predominantly at the nuclear periphery or at the nucleoli, whereas genes tended to localize on chromosome surfaces exposed to the nuclear interior

  10. Sequencing Closterium moniliferum: Future prospects in nuclear ...

    African Journals Online (AJOL)

    Akanksha Pandey

    2012-10-06

    Oct 6, 2012 ... Abstract Genome sequencing can play a vital role in health and several other domains such as in .... ter have imposed some serious questions over the security is- ... strontium and barium from aqueous environment and store.

  11. Simple probabilistic method for relative risk evaluation of nuclear terrorism events

    International Nuclear Information System (INIS)

    Zhang Songbai; Wu Jun

    2006-01-01

    On the basis of the event-tree and probability analysis methods, a probabilistic method of nuclear terrorism risk was built, and the risk of terrorism events was analyzed. With the statistical data for and hypothetical data for relative events, the relative probabilities of the four kinds of nuclear terrorism events were obtained, as well as the relative risks of these four kinds of nuclear terrorism events were calculated by using this probabilistic method. The illustrated case show that the descending sequence of damages from the four kinds of nuclear terrorism events for single event is as following: nuclear explosive and improvised nuclear explosive, nuclear facility attacked, and 'dirty bomb'. Under the hypothetical condition, the descending sequence of possibilities for the four kinds of nuclear terrorism events is as following: 'dirty bomb', nuclear facility attacked, improvised nuclear explosive and nuclear explosive, but the descending sequence of risks is as following: 'dirty bomb', improvised nuclear explosive, nuclear facility attacked, and nuclear explosive . (authors)

  12. Complete Genome Sequence of Sporisorium scitamineum and Biotrophic Interaction Transcriptome with Sugarcane.

    Directory of Open Access Journals (Sweden)

    Lucas M Taniguti

    Full Text Available Sporisorium scitamineum is a biotrophic fungus responsible for the sugarcane smut, a worldwide spread disease. This study provides the complete sequence of individual chromosomes of S. scitamineum from telomere to telomere achieved by a combination of PacBio long reads and Illumina short reads sequence data, as well as a draft sequence of a second fungal strain. Comparative analysis to previous available sequences of another strain detected few polymorphisms among the three genomes. The novel complete sequence described herein allowed us to identify and annotate extended subtelomeric regions, repetitive elements and the mitochondrial DNA sequence. The genome comprises 19,979,571 bases, 6,677 genes encoding proteins, 111 tRNAs and 3 assembled copies of rDNA, out of our estimated number of copies as 130. Chromosomal reorganizations were detected when comparing to sequences of S. reilianum, the closest smut relative, potentially influenced by repeats of transposable elements. Repetitive elements may have also directed the linkage of the two mating-type loci. The fungal transcriptome profiling from in vitro and from interaction with sugarcane at two time points (early infection and whip emergence revealed that 13.5% of the genes were differentially expressed in planta and particular to each developmental stage. Among them are plant cell wall degrading enzymes, proteases, lipases, chitin modification and lignin degradation enzymes, sugar transporters and transcriptional factors. The fungus also modulates transcription of genes related to surviving against reactive oxygen species and other toxic metabolites produced by the plant. Previously described effectors in smut/plant interactions were detected but some new candidates are proposed. Ten genomic islands harboring some of the candidate genes unique to S. scitamineum were expressed only in planta. RNAseq data was also used to reassure gene predictions.

  13. Systematic analysis and evolution of 5S ribosomal DNA in metazoans.

    Science.gov (United States)

    Vierna, J; Wehner, S; Höner zu Siederdissen, C; Martínez-Lage, A; Marz, M

    2013-11-01

    Several studies on 5S ribosomal DNA (5S rDNA) have been focused on a subset of the following features in mostly one organism: number of copies, pseudogenes, secondary structure, promoter and terminator characteristics, genomic arrangements, types of non-transcribed spacers and evolution. In this work, we systematically analyzed 5S rDNA sequence diversity in available metazoan genomes, and showed organism-specific and evolutionary-conserved features. Putatively functional sequences (12,766) from 97 organisms allowed us to identify general features of this multigene family in animals. Interestingly, we show that each mammal species has a highly conserved (housekeeping) 5S rRNA type and many variable ones. The genomic organization of 5S rDNA is still under debate. Here, we report the occurrence of several paralog 5S rRNA sequences in 58 of the examined species, and a flexible genome organization of 5S rDNA in animals. We found heterogeneous 5S rDNA clusters in several species, supporting the hypothesis of an exchange of 5S rDNA from one locus to another. A rather high degree of variation of upstream, internal and downstream putative regulatory regions appears to characterize metazoan 5S rDNA. We systematically studied the internal promoters and described three different types of termination signals, as well as variable distances between the coding region and the typical termination signal. Finally, we present a statistical method for detection of linkage among noncoding RNA (ncRNA) gene families. This method showed no evolutionary-conserved linkage among 5S rDNAs and any other ncRNA genes within Metazoa, even though we found 5S rDNA to be linked to various ncRNAs in several clades.

  14. Identification of Paramecium bursaria syngens through molecular markers--comparative analysis of three loci in the nuclear and mitochondrial DNA.

    Science.gov (United States)

    Greczek-Stachura, Magdalena; Potekhin, Alexey; Przyboś, Ewa; Rautian, Maria; Skoblo, Inna; Tarcz, Sebastian

    2012-09-01

    This is the first attempt to resolve the phylogenetic relationship between different syngens of Paramecium bursaria and to investigate at a molecular level the intraspecific differentiation of strains originating from very distant geographical locations. Herein we introduce a new collection of five P. bursaria syngens maintained at St Petersburg State University, as the international collection of syngens was lost in the 1960s. To analyze the degree of speciation within Paramecium bursaria, we examined 26 strains belonging to five different syngens from distant and geographically isolated localities using rDNA (ITS1-5.8S-ITS2-5'LSU) fragments, mitochondrial cytochrome c oxidase subunit I (COI), and H4 gene fragments. It was shown that P. bursaria strains of the same syngens cluster together in all three inferred molecular phylogenies. The genetic diversity among the studied P. bursaria strains based on rDNA sequences was rather low. The COI divergence of Paramecium bursaria was also definitely lower than that observed in the Paramecium aurelia complex. The nucleotide sequences of the H4 gene analyzed in the present study indicate the extent of genetic differences between the syngens of Paramecium bursaria. Our study demonstrates the diagnostic value of molecular markers, which are important tools in the identification of Paramecium bursaria syngens. Copyright © 2011 Elsevier GmbH. All rights reserved.

  15. Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders.

    Science.gov (United States)

    Calo, Eliezer; Gu, Bo; Bowen, Margot E; Aryan, Fardin; Zalc, Antoine; Liang, Jialiang; Flynn, Ryan A; Swigut, Tomek; Chang, Howard Y; Attardi, Laura D; Wysocka, Joanna

    2018-02-01

    Many craniofacial disorders are caused by heterozygous mutations in general regulators of housekeeping cellular functions such as transcription or ribosome biogenesis. Although it is understood that many of these malformations are a consequence of defects in cranial neural crest cells, a cell type that gives rise to most of the facial structures during embryogenesis, the mechanism underlying cell-type selectivity of these defects remains largely unknown. By exploring molecular functions of DDX21, a DEAD-box RNA helicase involved in control of both RNA polymerase (Pol) I- and II-dependent transcriptional arms of ribosome biogenesis, we uncovered a previously unappreciated mechanism linking nucleolar dysfunction, ribosomal DNA (rDNA) damage, and craniofacial malformations. Here we demonstrate that genetic perturbations associated with Treacher Collins syndrome, a craniofacial disorder caused by heterozygous mutations in components of the Pol I transcriptional machinery or its cofactor TCOF1 (ref. 1), lead to relocalization of DDX21 from the nucleolus to the nucleoplasm, its loss from the chromatin targets, as well as inhibition of rRNA processing and downregulation of ribosomal protein gene transcription. These effects are cell-type-selective, cell-autonomous, and involve activation of p53 tumour-suppressor protein. We further show that cranial neural crest cells are sensitized to p53-mediated apoptosis, but blocking DDX21 loss from the nucleolus and chromatin rescues both the susceptibility to apoptosis and the craniofacial phenotypes associated with Treacher Collins syndrome. This mechanism is not restricted to cranial neural crest cells, as blood formation is also hypersensitive to loss of DDX21 functions. Accordingly, ribosomal gene perturbations associated with Diamond-Blackfan anaemia disrupt DDX21 localization. At the molecular level, we demonstrate that impaired rRNA synthesis elicits a DNA damage response, and that rDNA damage results in tissue-selective and

  16. 'Candidatus pasteuria usgae' sp. nov., an obligate endoparasite of the phytoparasitic nematode Belonolaimus longicaudatus.

    Science.gov (United States)

    Giblin-Davis, R M; Williams, D S; Bekal, S; Dickson, D W; Brito, J A; Becker, J O; Preston, J F

    2003-01-01

    Taxonomically relevant characteristics of a fastidiously Gram-positive, obligately endoparasitic prokaryote (strain S-1) that uses the phytoparasitic sting nematode Belonolaimus longicaudatus as its host are reviewed. 16S rDNA sequence similarity (> or = 93%) confirms its congeneric ranking with other Pasteuria species and strains from nematodes and cladocerans and corroborates morphological, morphometric and host range evidence suggesting a novel taxon. The 16S rDNA sequence of strain S-1 has greatest similarity (96%) to the 16S rDNA sequences of both Pasteuria penetrans from root-knot nematodes (Meloidogyne species) and the recently reported strain of Pasteuria isolated from the soybean cyst nematode Heterodera glycines. Because the obligately endoparasitic nature of prokaryotes in the genus Pasteuria prevents isolation of definitive type strains, strain S-1 is proposed as 'Candidatus Pasteuria usgae' sp. nov.

  17. Sequence dependent structure and thermodynamics of DNA oligonucleotides and polynucleotides: uv melting and NMR (nuclear magnetic resonance) studies

    Energy Technology Data Exchange (ETDEWEB)

    Aboul-ela, F.M.

    1987-12-01

    Thermodynamic parameters for double strand formation have been measured for the twenty-five DNA double helices made by mixing deoxyoligonucleotides of the sequence dCA/sub 3/XA/sub 3/G with the complement dCT/sub 3/YT/sub 3/G. Each of the bases A, C, G, T, and I (I = hypoxanthine) have been substituted at the positions labeled X and Y. The results are analyzed in terms of nearest neighbors. At higher temperatures the sequences containing a G)centerreverse arrowdot)C base pair become more stable than those containing only A)centerreverse arrowdot)T. All molecules containing mismatcher are destabilized with respect to those with only Watson-Crick pairing, but there is a wide range of destabilization. Large neighboring base effects upon stability were observed. For example, when (X, Y) = (I, A), the duplex is eightfold more stable than when (X, Y) = (A, I). Independent of sequence effects the order of stabilities is: I)centerreverse arrowdot)C )succ) I)centerreverse arrowdot) A)succ) I)centerreverse arrowdot)T approx. I)centerreverse arrowdot)G. All of these results are discussed within the context of models for sequence dependent DNA secondary structure, replication fidelity and mechanisms of mismatch repair, and implications for probe design. The duplex deoxyoligonucleotide d(GGATGGGAG))centerreverse arrowdot)d(CTCCCATCC) is a portion of the gene recognition sequence of the protein transcription factor IIIA. The crystal structure of this oligonucleotide was shown to be A-form The present study employs Nuclear Magnetic Resonance, optical, chemical and enzymatic techniques to investigate the solution structure of this DNA 9-mer. (157 refs., 19 figs., 10 tabs.

  18. Morphological, molecular and ecological aspects of the South American hypogeous fungus Alpova austroalnicola sp. nov.

    Science.gov (United States)

    Nouhra, Eduardo R; Dominguez, Laura S; Becerra, Alejandra G; Trappe, James M

    2005-01-01

    Field studies in Argentina's Yunga District revealed Alpova austroalnicola sp. nov., a hypogeous fungus associated with Alnus acuminata ssp. acuminata. Morphological and molecular studies based on amplification and sequencing of the nuclear LSU rDNA gene showed its unique identity within Alpova. Related genera included in the analyses were Boletus edulis, Rhizopogon spp., Suillus luteus and Truncocolumella citrina. Additional observations of animal diggings around the sites and microscopic examination of fecal pellets of the nine-banded armadillo (Dasypus novemcinctus novemcinctus) indicate A. austroalnicola is consumed and its spores dispersed by animals.

  19. Proton nuclear magnetic resonance studies on bulge-containing DNA oligonucleotides from a mutational hot-spot sequence

    International Nuclear Information System (INIS)

    Woodson, S.A.; Crothers, D.M.

    1987-01-01

    A series of bulge-containing and normal double-helical synthetic oligodeoxyribonucleotides, of sequence corresponding to a frame-shift mutational hot spot in the λ C/sub I/ gene, are compared by proton magnetic resonance spectroscopy at 500 MHz. The imino proton resonances are assigned by one-dimensional nuclear Overhauser effect spectroscopy. Nonselective T 1 inversion-recovery experiments are used to determine exchangeable proton lifetimes and to compare helix stability and dynamics of the three duplexes. An extra adenosine flanking the internal G-C base pairs has a strongly localized effect on helix stability, but the destabilizing effect of an extra cytidine in a C tract is delocalized over the entire G-C run. These data lead to the conclusion that the position of the bulge migrates along the run in the fast-exchange limit on the NMR time scale. Rapid migration of the bulge defect in homopolymeric sequences may help rationalize both frame-shift mutagenesis and translational frame shifting. The authors estimate that the unfavorable free energy of a localized bulge defect is 2.9-3.2 kcal/mol, in good agreement with earlier estimates for RNA helices

  20. Identification of two invasive Cacopsylla chinensis (Hemiptera: Psyllidae) lineages based on two mitochondrial sequences and restriction fragment length polymorphism of cytochrome oxidase I amplicon.

    Science.gov (United States)

    Lee, Hsien-Chung; Yang, Man-Miao; Yeh, Wen-Bin

    2008-08-01

    The occurrence of pear decline, a disease found in some pear (Pyrus spp.) orchards of Taiwan in recent years, is accompanied by an outbreak of Cacopsylla chinensis (Yang & Li). Two major morphological forms (summer and winter forms) with a variety of intermediate body color and two phylogenetic lineages of this psyllid have been described. The work herein used sequences of mitochondrial cytochrome oxidase I (COI) and 16S rDNA regions to delineate the genetic differentiation of this color-variable insect and to elucidate their relationship. Sequence divergence and phylogenetic analysis have shown that C. chinensis individuals could be divided into two lineages with 3.3 and 2.3% divergence of COI and 16S rDNA, respectively. All specimens from China were found to belong to lineage I. Restriction fragment length polymorphism analysis of COI with restriction enzymes AcuI, AseI, BccI, and FokI on 263 specimens of six populations from Taiwan produced two digestion patterns, which are in agreement with the two lineages described above. Both patterns could be found in each population, with most individuals belonging to lineage I and 5-21% of the individuals belonging to lineage II. Because these two lineages included summer as well as winter morphological forms, the lineage differentiation is apparently not related to morphological characters of this psyllid. Because the invasive records are not in favor of a sympatric differentiation, this psyllid is more likely introduced as different populations from countries in temperate regions.

  1. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2016-02-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.

  2. An optimum analysis sequence for environmental gamma-ray spectrometry

    International Nuclear Information System (INIS)

    De la Torre, F.; Rios M, C.; Ruvalcaba A, M. G.; Mireles G, F.; Saucedo A, S.; Davila R, I.; Pinedo, J. L.

    2010-10-01

    This work aims to obtain an optimum analysis sequence for environmental gamma-ray spectroscopy by means of Genie 2000 (Canberra). Twenty different analysis sequences were customized using different peak area percentages and different algorithms for: 1) peak finding, and 2) peak area determination, and with or without the use of a library -based on evaluated nuclear data- of common gamma-ray emitters in environmental samples. The use of an optimum analysis sequence with certified nuclear information avoids the problems originated by the significant variations in out-of-date nuclear parameters of commercial software libraries. Interference-free gamma ray energies with absolute emission probabilities greater than 3.75% were included in the customized library. The gamma-ray spectroscopy system (based on a Ge Re-3522 Canberra detector) was calibrated both in energy and shape by means of the IAEA-2002 reference spectra for software intercomparison. To test the performance of the analysis sequences, the IAEA-2002 reference spectrum was used. The z-score and the reduced χ 2 criteria were used to determine the optimum analysis sequence. The results show an appreciable variation in the peak area determinations and their corresponding uncertainties. Particularly, the combination of second derivative peak locate with simple peak area integration algorithms provides the greater accuracy. Lower accuracy comes from the combination of library directed peak locate algorithm and Genie's Gamma-M peak area determination. (Author)

  3. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.)

    Czech Academy of Sciences Publication Activity Database

    Symonová, R.; Ocalewicz, K.; Kirtiklis, L.; Delmastro, G. B.; Pelikánová, Šárka; Garcia, S.; Kovařík, Aleš

    2017-01-01

    Roč. 18, č. 391 (2017), č. článku 391. ISSN 1471-2164 R&D Projects: GA ČR GA14-02940S; GA ČR GBP501/12/G090 Institutional support: RVO:67985904 ; RVO:68081707 Keywords : rDNA * evolution * chromosome Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 3.729, year: 2016

  4. Molecular identification based on ITS sequences for Kappaphycus and Eucheuma cultivated in China

    Science.gov (United States)

    Zhao, Sufen; He, Peimin

    2011-11-01

    The systematic classification of the Eucheumatoideae is difficult because of their variable morphology and interpretation of reproductive structures. Kappaphycus and Eucheuma specimens cultivated on the Hainan and Fujian coast of China were introduced from Vietnam, the Philippines and Indonesia. Combined with morphological characteristics, all Kappaphycus and Eucheuma cultivated strains were identified by internal transcribed spacer (ITS) sequences. The phylogenetic tree was constructed using neighbor-joining and maximum likelihood methods. The results indicate that different ITS sequence lengths occurred in the different genera and species. An obvious difference in morphology could be found in the protuberance shape between Kappaphycus and Eucheuma. The protuberance in Eucheuma was thorn-like and in Kappaphycus was wartlike or papillate. Their ITS sequence lengths differed significantly in nucleotide variation rates up to 58.55%-63.90%. All nucleotide variations occurred in the ITS1 and ITS2 regions except for five nucleotide transversions in the 5.8S rDNA region. In addition, the difference was at the branches among congeneric species. Kappaphycus sp. had branches with small buds, while K. alvarezii did not have such a feature. The nucleotide variation rates varied from 7.02% to 7.48% among species; within the same species of the clades it was K. alvarezii, Kappaphycus sp., and E. denticulatum. The results indicate that ITS sequence analysis was an effective way for identification of interspecies and intraspecies phylogenetic relationships and might provide a clue for molecular identification of algal Eucheumatoideae.

  5. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  6. Diversity and Phylogeny of Gymnodiniales (Dinophyceae) from the NW Mediterranean Sea Revealed by a Morphological and Molecular Approach.

    Science.gov (United States)

    Reñé, Albert; Camp, Jordi; Garcés, Esther

    2015-05-01

    The diversity and phylogeny of dinoflagellates belonging to the Gymnodiniales were studied during a 3-year period at several coastal stations along the Catalan coast (NW Mediterranean) by combining analyses of their morphological features with rDNA sequencing. This approach resulted in the detection of 59 different morphospecies, 13 of which were observed for the first time in the Mediterranean Sea. Fifteen of the detected species were HAB producers; four represented novel detections on the Catalan coast and two in the Mediterranean Sea. Partial rDNA sequences were obtained for 50 different morphospecies, including novel LSU rDNA sequences for 27 species, highlighting the current scarcity of molecular information for this group of dinoflagellates. The combination of morphology and genetics allowed the first determinations of the phylogenetic position of several genera, i.e., Torodinium and many Gyrodinium and Warnowiacean species. The results also suggested that among the specimens belonging to the genera Gymnodinium, Apicoporus, and Cochlodinium were those representing as yet undescribed species. Furthermore, the phylogenetic data suggested taxonomic incongruences for some species, i.e., Gyrodinium undulans and Gymnodinium agaricoides. Although a species complex related to G. spirale was detected, the partial LSU rDNA sequences lacked sufficient resolution to discriminate between various other Gyrodinium morphospecies. Copyright © 2015 Elsevier GmbH. All rights reserved.

  7. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Panero, J.L.; Široký, Jiří; Kovařík, Aleš

    2010-01-01

    Roč. 10, č. 176 (2010), s. 1-18 ISSN 1471-2229 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : organization of rDNA unit * intergenic spacer * Asteraceae Subject RIV: BO - Biophysics Impact factor: 4.085, year: 2010

  8. Metschnikowia Species Share a Pool of Diverse rRNA Genes Differing in Regions That Determine Hairpin-Loop Structures and Evolve by Reticulation.

    Directory of Open Access Journals (Sweden)

    Matthias Sipiczki

    Full Text Available Modern taxonomy of yeasts is mainly based on phylogenetic analysis of conserved DNA and protein sequences. By far the most frequently used sequences are those of the repeats of the chromosomal rDNA array. It is generally accepted that the rDNA repeats of a genome have identical sequences due to the phenomenon of sequence homogenisation and can thus be used for identification and barcoding of species. Here we show that the rDNA arrays of the type strains of Metschnikowia andauensis and M. fructicola are not homogenised. Both have arrays consisting of diverse repeats that differ from each other in the D1/D2 domains by up to 18 and 25 substitutions. The variable sites are concentrated in two regions that correspond to back-folding stretches of hairpin loops in the predicted secondary structure of the RNA molecules. The substitutions do not alter significantly the overall hairpin-loop structure due to wobble base pairing at sites of C-T transitions and compensatory mutations in the complementary strand of the hairpin stem. The phylogenetic and network analyses of the cloned sequences revealed that the repeats had not evolved in a vertical tree-like way but reticulation might have shaped the rDNA arrays of both strains. The neighbour-net analysis of all cloned sequences of the type strains and the database sequences of different strains further showed that these species share a continuous pool of diverse repeats that appear to evolve by reticulate evolution.

  9. Autoantibodies from patients with systemic lupus erythematosus bind a shared sequence of SmD and Epstein-Barr virus-encoded nuclear antigen EBNA I.

    Science.gov (United States)

    Sabbatini, A; Bombardieri, S; Migliorini, P

    1993-05-01

    SmD is one of the small nuclear ribonucleoproteins frequently targeted by autoantibodies in systemic lupus erythematosus. We isolated and characterized the antibodies present in lupus sera that are specific for the C-terminal region of SmD (sequence 95-119). This region is highly homologous to sequence 35-58 of the EBNA I antigen, one of the nuclear antigens induced by infection with Epstein-Barr virus. Antibodies affinity purified over a peptide 95-119 column were able to recognize this sequence in the context of the whole SmD molecule, as they reacted with blotted recombinant SmD. Anti-SmD 95-119 antibodies bound also the EBNA I 35-58 peptide and detected the EBNA I molecule in a total cell extract from Epstein-Barr virus-infected lines. A population of anti-SmD antibodies is, therefore, able to bind an epitope shared by the autoantigen and the viral antigen EBNA I. To investigate the involvement of this shared epitope in the generation of anti-SmD antibodies, we immunized mice with the EBNA I 35-58 peptide. Sera from immunized animals displayed the same pattern of reactivity of spontaneously produced anti-SmD antibodies. They reacted in fact with the EBNA peptide as well as with SmD 95-119 and recombinant SmD. These data suggest that molecular mimicry may play a role in the induction of anti-SmD autoantibodies.

  10. Genetic diversity of archaea in deep-sea hydrothermal vent environments.

    OpenAIRE

    Takai, K; Horikoshi, K

    1999-01-01

    Molecular phylogenetic analysis of naturally occurring archaeal communities in deep-sea hydrothermal vent environments was carried out by PCR-mediated small subunit rRNA gene (SSU rDNA) sequencing. As determined through partial sequencing of rDNA clones amplified with archaea-specific primers, the archaeal populations in deep-sea hydrothermal vent environments showed a great genetic diversity, and most members of these populations appeared to be uncultivated and unidentified organisms. In the...

  11. An optimum analysis sequence for environmental gamma-ray spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    De la Torre, F.; Rios M, C.; Ruvalcaba A, M. G.; Mireles G, F.; Saucedo A, S.; Davila R, I.; Pinedo, J. L., E-mail: fta777@hotmail.co [Universidad Autonoma de Zacatecas, Centro Regional de Estudis Nucleares, Calle Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)

    2010-10-15

    This work aims to obtain an optimum analysis sequence for environmental gamma-ray spectroscopy by means of Genie 2000 (Canberra). Twenty different analysis sequences were customized using different peak area percentages and different algorithms for: 1) peak finding, and 2) peak area determination, and with or without the use of a library -based on evaluated nuclear data- of common gamma-ray emitters in environmental samples. The use of an optimum analysis sequence with certified nuclear information avoids the problems originated by the significant variations in out-of-date nuclear parameters of commercial software libraries. Interference-free gamma ray energies with absolute emission probabilities greater than 3.75% were included in the customized library. The gamma-ray spectroscopy system (based on a Ge Re-3522 Canberra detector) was calibrated both in energy and shape by means of the IAEA-2002 reference spectra for software intercomparison. To test the performance of the analysis sequences, the IAEA-2002 reference spectrum was used. The z-score and the reduced {chi}{sup 2} criteria were used to determine the optimum analysis sequence. The results show an appreciable variation in the peak area determinations and their corresponding uncertainties. Particularly, the combination of second derivative peak locate with simple peak area integration algorithms provides the greater accuracy. Lower accuracy comes from the combination of library directed peak locate algorithm and Genie's Gamma-M peak area determination. (Author)

  12. Molecular phylogenetic study at the generic boundary between the lichen-forming fungi Caloplaca and Xanthoria (Ascomycota, Teloschistaceae)

    DEFF Research Database (Denmark)

    Søchting, Ulrik; Lutzoni, François

    2003-01-01

    A molecular phylogenetic analysis of rDNA was performed for seven Caloplaca, seven Xanthoria, one Fulgensia and five outgroup species. Phylogenetic hypotheses are constructed based on nuclear small and large subunit rDNA, separately and in combination. Three strongly supported major monophyletic ...

  13. Functional analysis of bipartite begomovirus coat protein promoter sequences

    International Nuclear Information System (INIS)

    Lacatus, Gabriela; Sunter, Garry

    2008-01-01

    We demonstrate that the AL2 gene of Cabbage leaf curl virus (CaLCuV) activates the CP promoter in mesophyll and acts to derepress the promoter in vascular tissue, similar to that observed for Tomato golden mosaic virus (TGMV). Binding studies indicate that sequences mediating repression and activation of the TGMV and CaLCuV CP promoter specifically bind different nuclear factors common to Nicotiana benthamiana, spinach and tomato. However, chromatin immunoprecipitation demonstrates that TGMV AL2 can interact with both sequences independently. Binding of nuclear protein(s) from different crop species to viral sequences conserved in both bipartite and monopartite begomoviruses, including TGMV, CaLCuV, Pepper golden mosaic virus and Tomato yellow leaf curl virus suggests that bipartite begomoviruses bind common host factors to regulate the CP promoter. This is consistent with a model in which AL2 interacts with different components of the cellular transcription machinery that bind viral sequences important for repression and activation of begomovirus CP promoters

  14. Functional role of a highly repetitive DNA sequence in anchorage of the mouse genome.

    Science.gov (United States)

    Neuer-Nitsche, B; Lu, X N; Werner, D

    1988-09-12

    The major portion of the eukaryotic genome consists of various categories of repetitive DNA sequences which have been studied with respect to their base compositions, organizations, copy numbers, transcription and species specificities; their biological roles, however, are still unclear. A novel quality of a highly repetitive mouse DNA sequence is described which points to a functional role: All copies (approximately 50,000 per haploid genome) of this DNA sequence reside on genomic Alu I DNA fragments each associated with nuclear polypeptides that are not released from DNA by proteinase K, SDS and phenol extraction. By this quality the repetitive DNA sequence is classified as a member of the sub-set of DNA sequences involved in tight DNA-polypeptide complexes which have been previously shown to be components of the subnuclear structure termed 'nuclear matrix'. From these results it has to be concluded that the repetitive DNA sequence characterized in this report represents or comprises a signal for a large number of site specific attachment points of the mouse genome in the nuclear matrix.

  15. Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region

    KAUST Repository

    Arif, Chatchanit; Daniels, Camille; Bayer, Till; Banguera Hinestroza, Eulalia; Barbrook, Adrian; Howe, Christopher J.; LaJeunesse, Todd C.; Voolstra, Christian R.

    2014-01-01

    The persistence of coral reef ecosystems relies on the symbiotic relationship between scleractinian corals and intracellular, photosynthetic dinoflagellates in the genus Symbiodinium. Genetic evidence indicates that these symbionts are biologically diverse and exhibit discrete patterns of environmental and host distribution. This makes the assessment of Symbiodinium diversity critical to understanding the symbiosis ecology of corals. Here, we applied pyrosequencing to the elucidation of Symbiodinium diversity via analysis of the internal transcribed spacer 2 (ITS2) region, a multicopy genetic marker commonly used to analyse Symbiodinium diversity. Replicated data generated from isoclonal Symbiodinium cultures showed that all genomes contained numerous, yet mostly rare, ITS2 sequence variants. Pyrosequencing data were consistent with more traditional denaturing gradient gel electrophoresis (DGGE) approaches to the screening of ITS2 PCR amplifications, where the most common sequences appeared as the most intense bands. Further, we developed an operational taxonomic unit (OTU)-based pipeline for Symbiodinium ITS2 diversity typing to provisionally resolve ecologically discrete entities from intragenomic variation. A genetic distance cut-off of 0.03 collapsed intragenomic ITS2 variants of isoclonal cultures into single OTUs. When applied to the analysis of field-collected coral samples, our analyses confirm that much of the commonly observed Symbiodinium ITS2 diversity can be attributed to intragenomic variation. We conclude that by analysing Symbiodinium populations in an OTU-based framework, we can improve objectivity, comparability and simplicity when assessing ITS2 diversity in field-based studies.

  16. Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region

    KAUST Repository

    Arif, Chatchanit

    2014-09-01

    The persistence of coral reef ecosystems relies on the symbiotic relationship between scleractinian corals and intracellular, photosynthetic dinoflagellates in the genus Symbiodinium. Genetic evidence indicates that these symbionts are biologically diverse and exhibit discrete patterns of environmental and host distribution. This makes the assessment of Symbiodinium diversity critical to understanding the symbiosis ecology of corals. Here, we applied pyrosequencing to the elucidation of Symbiodinium diversity via analysis of the internal transcribed spacer 2 (ITS2) region, a multicopy genetic marker commonly used to analyse Symbiodinium diversity. Replicated data generated from isoclonal Symbiodinium cultures showed that all genomes contained numerous, yet mostly rare, ITS2 sequence variants. Pyrosequencing data were consistent with more traditional denaturing gradient gel electrophoresis (DGGE) approaches to the screening of ITS2 PCR amplifications, where the most common sequences appeared as the most intense bands. Further, we developed an operational taxonomic unit (OTU)-based pipeline for Symbiodinium ITS2 diversity typing to provisionally resolve ecologically discrete entities from intragenomic variation. A genetic distance cut-off of 0.03 collapsed intragenomic ITS2 variants of isoclonal cultures into single OTUs. When applied to the analysis of field-collected coral samples, our analyses confirm that much of the commonly observed Symbiodinium ITS2 diversity can be attributed to intragenomic variation. We conclude that by analysing Symbiodinium populations in an OTU-based framework, we can improve objectivity, comparability and simplicity when assessing ITS2 diversity in field-based studies.

  17. Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Laurent Chatre

    Full Text Available The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.

  18. Evaluation of Direct 16S rDNA Sequencing as a Metagenomics-based Approach to Screening Bacteria in Bottled Water

    DEFF Research Database (Denmark)

    Hansen, Trine; Skånseng, Beate; Hoorfar, Jeffrey

    2013-01-01

    Deliberate or accidental contamination of food, feed, and water supplies poses a threat to human health worldwide. A rapid and sensitive detection technique that could replace the current labor-intensive and time-consuming culture-based methods is highly desirable. In addition to species...... 2 B. cereus strains by the principal component plot, despite the close sequence resemblance. A linear correlation between the artificial contamination level and the relative amount of the Bacillus artificial contaminant in the metagenome was observed, and a relative amount value above 0.5 confirmed...

  19. Genomic-based restriction enzyme selection for specific detection of Piscirickettsia salmonis by 16S rDNA PCR-RFLP

    Directory of Open Access Journals (Sweden)

    Dinka eMandakovic

    2016-05-01

    Full Text Available The gram negative facultative bacterium P. salmonis is the etiological agent of Salmonid Rickettsial Septicaemia (SRS, a severe disease that causes important economic losses in the global salmon farmer industry. Despite efforts to control this disease, the high frequency of new epizootic events indicate that the vaccine and antibiotics treatments have limited effectiveness, therefore the preventive and diagnostic approaches must be improved. A comparison of several methodologies for SRS diagnostic indicate differences in their specificity and its capacity to detect other bacteria coexisting with P. salmonis in culture media (contamination and fish samples (coinfection, aspects relevant for research, vaccine development and clinical diagnostic. By computer-simulation analyses, we identified a group of restriction enzymes that generate unique P. salmonis 16S rDNA band patterns, distinguishable from all other bacteria. From this information, we designed and developed a PCR-RFLP (Polymerase Chain Reaction - Restriction Fragment Length Polymorphism assay, which was validated using 16S rDNA universal primers and restriction enzyme PmaCI for the amplification and digestion, respectively. Experimental validation was performed by comparing the restriction pattern of P. salmonis with the restriction patterns generated by bacteria that cohabit with P. salmonis (fish bacterial isolates and culture media contaminants. Our results indicate that the restriction enzyme selection pipeline was suitable to design a more specific, sensible, faster and cheaper assay than the currently used P. salmonis detection methodologies.

  20. Complete mitochondrial genomes and nuclear ribosomal RNA operons of two species of Diplostomum (Platyhelminthes: Trematoda): a molecular resource for taxonomy and molecular epidemiology of important fish pathogens.

    Science.gov (United States)

    Brabec, Jan; Kostadinova, Aneta; Scholz, Tomáš; Littlewood, D Timothy J

    2015-06-19

    The genus Diplostomum (Platyhelminthes: Trematoda: Diplostomidae) is a diverse group of freshwater parasites with complex life-cycles and global distribution. The larval stages are important pathogens causing eye fluke disease implicated in substantial impacts on natural fish populations and losses in aquaculture. However, the problematic species delimitation and difficulties in the identification of larval stages hamper the assessment of the distributional and host ranges of Diplostomum spp. and their transmission ecology. Total genomic DNA was isolated from adult worms and shotgun sequenced using Illumina MiSeq technology. Mitochondrial (mt) genomes and nuclear ribosomal RNA (rRNA) operons were assembled using established bioinformatic tools and fully annotated. Mt protein-coding genes and nuclear rRNA genes were subjected to phylogenetic analysis by maximum likelihood and the resulting topologies compared. We characterised novel complete mt genomes and nuclear rRNA operons of two closely related species, Diplostomum spathaceum and D. pseudospathaceum. Comparative mt genome assessment revealed that the cox1 gene and its 'barcode' region used for molecular identification are the most conserved regions; instead, nad4 and nad5 genes were identified as most promising molecular diagnostic markers. Using the novel data, we provide the first genome wide estimation of the phylogenetic relationships of the order Diplostomida, one of the two fundamental lineages of the Digenea. Analyses of the mitogenomic data invariably recovered the Diplostomidae as a sister lineage of the order Plagiorchiida rather than as a basal lineage of the Diplostomida as inferred in rDNA phylogenies; this was concordant with the mt gene order of Diplostomum spp. exhibiting closer match to the conserved gene order of the Plagiorchiida. Complete sequences of the mt genome and rRNA operon of two species of Diplostomum provide a valuable resource for novel genetic markers for species delineation and

  1. Protocols for 16S rDNA Array Analyses of Microbial Communities by Sequence-Specific Labeling of DNA Probes

    Directory of Open Access Journals (Sweden)

    Knut Rudi

    2003-01-01

    Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.

  2. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

    Science.gov (United States)

    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

    2016-03-01

    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

  3. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  4. Progenitor-derivative relationships of Hordeum polyploids (Poaceae, Triticeae inferred from sequences of TOPO6, a nuclear low-copy gene region.

    Directory of Open Access Journals (Sweden)

    Jonathan Brassac

    Full Text Available Polyploidization is a major mechanism of speciation in plants. Within the barley genus Hordeum, approximately half of the taxa are polyploids. While for diploid species a good hypothesis of phylogenetic relationships exists, there is little information available for the polyploids (4×, 6× of Hordeum. Relationships among all 33 diploid and polyploid Hordeum species were analyzed with the low-copy nuclear marker region TOPO6 for 341 Hordeum individuals and eight outgroup species. PCR products were either directly sequenced or cloned and on average 12 clones per individual were included in phylogenetic analyses. In most diploid Hordeum species TOPO6 is probably a single-copy locus. Most sequences found in polyploid individuals phylogenetically cluster together with sequences derived from diploid species and thus allow the identification of parental taxa of polyploids. Four groups of sequences occurring only in polyploid taxa are interpreted as footprints of extinct diploid taxa, which contributed to allopolyploid evolution. Our analysis identifies three key species involved in the evolution of the American polyploids of the genus. (i All but one of the American tetraploids have a TOPO6 copy originating from the Central Asian diploid H. roshevitzii, the second copy clustering with different American diploid species. (ii All hexaploid species from the New World have a copy of an extinct close relative of H. californicum and (iii possess the TOPO6 sequence pattern of tetraploid H. jubatum, each with an additional copy derived from different American diploids. Tetraploid H. bulbosum is an autopolyploid, while the assumed autopolyploid H. brevisubulatum (4×, 6× was identified as allopolyploid throughout most of its distribution area. The use of a proof-reading DNA polymerase in PCR reduced the proportion of chimerical sequences in polyploids in comparison to Taq polymerase.

  5. Diversity of halophilic archaea from six hypersaline environments in Turkey.

    Science.gov (United States)

    Ozcan, Birgul; Ozcengiz, Gulay; Coleri, Arzu; Cokmus, Cumhur

    2007-06-01

    The diversity of archaeal strains from six hypersaline environments in Turkey was analyzed by comparing their phenotypic characteristics and 16S rDNA sequences. Thirty-three isolates were characterized in terms of their phenotypic properties including morphological and biochemical characteristics, susceptibility to different antibiotics, and total lipid and plasmid contents, and finally compared by 16S rDNA gene sequences. The results showed that all isolates belong to the family Halobacteriaceae. Phylogenetic analyses using approximately 1,388 bp comparisions of 16S rDNA sequences demonstrated that all isolates clustered closely to species belonging to 9 genera, namely Halorubrum (8 isolates), Natrinema (5 isolates), Haloarcula (4 isolates), Natronococcus (4 isolates), Natrialba (4 isolates), Haloferax (3 isolates), Haloterrigena (3 isolates), Halalkalicoccus (1 isolate), and Halomicrobium (1 isolate). The results revealed a high diversity among the isolated halophilic strains and indicated that some of these strains constitute new taxa of extremely halophilic archaea.

  6. The sponge-associated bacterium Bacillus licheniformis SAB1: A source of antimicrobial compounds

    Digital Repository Service at National Institute of Oceanography (India)

    PrabhaDevi; Wahidullah, S.; Rodrigues, C.; DeSouza, L.

    investigation. Analysis of the nucleotide sequence of the 16S rDNA gene of Bacillus sp. SAB1 showed a strong similarity (100%) with the 16S rDNA gene of Bacillus licheniformis HNL09. The bioactive compounds produced by B. licheniformis SAB1 (GenBank accession...

  7. Determination of Molecular Genotyping of Ureaplasma SPP in Women with Genital Infections by 16S–23S rDNA PCR-RFLP Method

    Directory of Open Access Journals (Sweden)

    R. Mirnejad

    2011-04-01

    Full Text Available Introduction & Objective: So far, despite the wide range of methods such as analytic methods used for differentiation of Mycoplasma, the diagnosis of Mycoplasma species is still difficult. Generally the low-level discriminatory power of serological methods because of the rapid changes in size and phase of the dominant antigens in the immune cell surface of Mycoplasmas greatly limits their applicability to the typing of Mycoplasmas. On the contrary,molecular methods do not suffer from these drawbacks and can be used for typing of Mycoplasmas. The aim of this investigation was molecular identification and genotyping of ureaplasma SPP in women with genital infections by 16S–23S rDNA PCR-RFLP.Materials & Methods: Genital swabs were taken from 210 patients who referred to gynecology clinic of Rasool hospital in Tehran, Iran during December 2007 until June 2008. The swabs suspended in PBS, were immediately transferred to laboratory .Following DNA extraction, PCR assay was performed using a genus specific primer pair. These primer sets amplified a 559 bp fragment for Ureaplasma Spp. Samples containing bands of the expected size for Ureaplasma strains were subjected to digestion with different restriction endonuclease enzymes (AluI, Taq I, CacI8, BbsI, EcoRI. Results: Of the 210 samples, Ureaplasma Spp was isolated from 93 patients (44.3% by PCR and 69 samples by culture. In the present study only Biovar 1 (Ureaplasma parvum was isolated from clinical specimens and the results were confirmed using a cutting enzyme TaqI (enzyme specific species of ureaplasma SPP. The results of this analysis using PCR-RFLP and sequencing showed that all had the same genotype and shared identical sequence with the genome sequence of serovar 3 Ureaplasma parvum.Conclusion: Ureaplasma parvum is generally isolated from the genital samples. In this study all isolates were identical and no difference was found among the enzyme patterns of the bacteria after PCR-RFLP .So

  8. Identification of a novel nuclear localization signal and speckle-targeting sequence of tuftelin-interacting protein 11, a splicing factor involved in spliceosome disassembly

    Energy Technology Data Exchange (ETDEWEB)

    Tannukit, Sissada [Center for Craniofacial Molecular Biology, University of Southern California, 2250 Alcazar Street, CSA Rm103, Los Angeles, CA 90033-1004 (United States); Crabb, Tara L.; Hertel, Klemens J. [Department of Microbiology and Molecular Genetics, University of California Irvine, Irvine, CA 92697-4025 (United States); Wen, Xin [Center for Craniofacial Molecular Biology, University of Southern California, 2250 Alcazar Street, CSA Rm103, Los Angeles, CA 90033-1004 (United States); Jans, David A. [Department of Biochemistry and Molecular Biology, Nuclear Signalling Laboratory, Monash University, Clayton, Victoria 3800 (Australia); Paine, Michael L., E-mail: paine@usc.edu [Center for Craniofacial Molecular Biology, University of Southern California, 2250 Alcazar Street, CSA Rm103, Los Angeles, CA 90033-1004 (United States)

    2009-12-18

    Tuftelin-interacting protein 11 (TFIP11) is a protein component of the spliceosome complex that promotes the release of the lariat-intron during late-stage splicing through a direct recruitment and interaction with DHX15/PRP43. Expression of TFIP11 is essential for cell and organismal survival. TFIP11 contains a G-patch domain, a signature motif of RNA-processing proteins that is responsible for TFIP11-DHX15 interactions. No other functional domains within TFIP11 have been described. TFIP11 is localized to distinct speckled regions within the cell nucleus, although excluded from the nucleolus. In this study sequential C-terminal deletions and mutational analyses have identified two novel protein elements in mouse TFIP11. The first domain covers amino acids 701-706 (VKDKFN) and is an atypical nuclear localization signal (NLS). The second domain is contained within amino acids 711-735 and defines TFIP11's distinct speckled nuclear localization. The identification of a novel TFIP11 nuclear speckle-targeting sequence (TFIP11-STS) suggests that this domain directly interacts with additional spliceosomal components. These data help define the mechanism of nuclear/nuclear speckle localization of the splicing factor TFIP11, with implications for it's function.

  9. Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies.

    Science.gov (United States)

    van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J

    1995-06-01

    Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.

  10. Nuclear fuel rod loading apparatus

    International Nuclear Information System (INIS)

    King, H.B.

    1981-01-01

    A nuclear fuel loading apparatus, incorporating a microprocessor control unit, is described which automatically loads nuclear fuel pellets into dual fuel rods with a minimum of manual involvement and in a manner and sequence to ensure quality control and accuracy. (U.K.)

  11. Molecular Cloning and Sequencing of AlkalophilicCellulosimicrobium cellulans CKMX1 Xylanase Gene Isolated from Mushroom Compost and Characterization of the Gene Product

    Directory of Open Access Journals (Sweden)

    Abhishek Walia

    2015-12-01

    Full Text Available ABSTRACT A xylanolytic bacterium was isolated from mushroom compost by using enrichment technique. Results from the metabolic fingerprinting, whole-cell fatty acids methyl ester analysis and 16S rDNA sequencing suggested the bacterium to be Cellulosimicrobium cellulans CKMX1. Due to the xylanolytic activity of this bacterium, isolation and characterization of the xylanase gene were attempted. A distinct fragment of about 1671 bp was successfully amplified using PCR and cloned into Escherichia coli DH5α. A BLAST search confirmed that the DNA sequence from the amplified fragment was endo-1, 4-beta-xylanase, which was a member of glycoside hydrolase family 11. It showed 98% homology withCellulosimicrobium sp. xylanase gene (Accession no. FJ859907.1 reported from the gut of Eisenia fetida in Korea. In silicophysico-chemical characterization of amino acid sequence of xylanase showed an open reading frame encoding a 556 amino acid sequence with a molecular weight of 58 kDa and theoretical isolectric point (pI of 4.46 was computed using Expasy's ProtParam server. Secondary and homology based 3D structure of xylanase was analysed using SOPMA and Swiss-Prot software.

  12. Disseminated Mycosis in Veiled Chameleons (Chamaeleo calyptratus) Caused by Chamaeleomyces granulomatis, a New Fungus Related to Paecilomyces viridis

    DEFF Research Database (Denmark)

    Sigler, Lynne; Gibas, Connie Fe C.; Kokotovic, Branko

    2010-01-01

    An outbreak of disseminated granulomatous disease occurred in a group of veiled chameleons (Chamaeleo calyptratus) in a zoo collection. An adult female and six offspring developed large granulomas in multiple organs and were euthanized. At necropsy, roughly spherical yellow-to-white nodules 1 to 3...... of morphology results to represent Paecilomyces viridis, a species known only from one outbreak of fatal mycosis in carpet chameleons (Furcifer lateralis). Data obtained from morphological studies and from phylogenetic analyses of nuclear ribosomal rRNA (rDNA) sequence data revealed the Danish chameleon....... Chamaeleomyces species appear to be rare but aggressive pathogens of chameleons....

  13. Accident sequence precursor events with age-related contributors

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, G.A.; Kohn, W.E.

    1995-12-31

    The Accident Sequence Precursor (ASP) Program at ORNL analyzed about 14.000 Licensee Event Reports (LERs) filed by US nuclear power plants 1987--1993. There were 193 events identified as precursors to potential severe core accident sequences. These are reported in G/CR-4674. Volumes 7 through 20. Under the NRC Nuclear Plant Aging Research program, the authors evaluated these events to determine the extent to which component aging played a role. Events were selected that involved age-related equipment degradation that initiated an event or contributed to an event sequence. For the 7-year period, ORNL identified 36 events that involved aging degradation as a contributor to an ASP event. Except for 1992, the percentage of age-related events within the total number of ASP events over the 7-year period ({approximately}19%) appears fairly consistent up to 1991. No correlation between plant ape and number of precursor events was found. A summary list of the age-related events is presented in the report.

  14. Biological characterisation of Haliclona (?gellius) sp.: sponge and associated microorganisms.

    NARCIS (Netherlands)

    Sipkema, D.; Holmes, B.; Nichols, S.A.; Blanch, H.W.

    2009-01-01

    We have characterised the northern Pacific undescribed sponge Haliclona (?gellius) sp. based on rDNA of the sponge and its associated microorganisms. The sponge is closely related to Amphimedon queenslandica from the Great Barrier Reef as the near-complete 18S rDNA sequences of both sponges were

  15. Arabidopsis ATRX Modulates H3.3 Occupancy and Fine-Tunes Gene Expression

    KAUST Repository

    Duc, Cé line; Benoit, Matthias; Dé tourné , Gwé naë lle; Simon, Lauriane; Poulet, Axel; Jung, Matthieu; Veluchamy, Alaguraj; Latrasse, David; Le Goff, Samuel; Cotterell, Sylviane; Tatout, Christophe; Benhamed, Moussa; Probst, Aline V.

    2017-01-01

    , including the 45S ribosomal DNA (45S rDNA) loci, where loss of ATRX results in altered expression of specific 45S rDNA sequence variants. At the genome-wide scale, our data indicate that ATRX modifies gene expression concomitantly to H3.3 deposition at a set

  16. FISH-mapping of the 5S rDNA locus in chili peppers (Capsicum-Solanaceae).

    Science.gov (United States)

    Aguilera, Patricia M; Debat, Humberto J; Scaldaferro, Marisel A; Martí, Dardo A; Grabiele, Mauro

    2016-03-01

    We present here the physical mapping of the 5S rDNA locus in six wild and five cultivated taxa of Capsicum by means of a genus-specific FISH probe. In all taxa, a single 5S locus per haploid genome that persistently mapped onto the short arm of a unique metacentric chromosome pair at intercalar position, was found. 5S FISH signals of almost the same size and brightness intensity were observed in all the analyzed taxa. This is the first cytological characterization of the 5S in wild taxa of Capsicum by using a genus-derived probe, and the most exhaustive and comprehensive in the chili peppers up to now. The information provided here will aid the cytomolecular characterization of pepper germplasm to evaluate variability and can be instrumental to integrate physical, genetic and genomic maps already generated in the genus.

  17. Genetic polymorphism in Gymnodinium galatheanum chloroplast DNA sequences and development of a molecular detection assay.

    Science.gov (United States)

    Tengs, T; Bowers, H A; Ziman, A P; Stoecker, D K; Oldach, D W

    2001-02-01

    Nuclear and chloroplast-encoded small subunit ribosomal DNA sequences were obtained from several strains of the toxic dinoflagellate Gymnodinium galatheanum. Phylogenetic analyses and comparison of sequences indicate that the chloroplast sequences show a higher degree of sequence divergence than the nuclear homologue. The chloroplast sequences were chosen as targets for the development of a 5'--3' exonuclease assay for detection of the organism. The assay has a very high degree of specificity and has been used to screen environmental water samples from a fish farm where the presence of this dinoflagellate species has previously been associated with fish kills. Various hypotheses for the derived nature of the chloroplast sequences are discussed, as well as what is known about the toxicity of the species.

  18. Polynucleotide probes that target a hypervariable region of 16S rRNA genes to identify bacterial isolates corresponding to bands of community fingerprints.

    Science.gov (United States)

    Heuer, H; Hartung, K; Wieland, G; Kramer, I; Smalla, K

    1999-03-01

    Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in hybridizations with dot blotted 16S rDNA amplified from bacterial isolates. Within 16S rDNA, the hypervariable V6 region, corresponding to positions 984 to 1047 (Escherichia coli 16S rDNA sequence), which is a subset of the region used for TGGE (positions 968 to 1401), best met the criteria of high phylogenetic variability, required for sufficient probe specificity, and closely flanking conserved priming sites for amplification. Removal of flanking conserved bases was necessary to enable the differentiation of closely related species. This was achieved by 5' exonuclease digestion, terminated by phosphorothioate bonds which were synthesized into the primers. The remaining complementary strand was removed by single-strand-specific digestion. Standard hybridization with truncated probes allowed differentiation of bacteria which differed by only two bases within the probe target site and 1.2% within the complete 16S rDNA. However, a truncated probe, derived from an excised TGGE band of a rhizosphere community, hybridized with three phylogenetically related isolates with identical V6 sequences. Only one of the isolates comigrated with the excised band in TGGE, which was shown to be due to identical sequences, demonstrating the utility of a combined TGGE and V6 probe approach.

  19. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  20. Regeneration of somatic hybrids in relation to the nuclear and cytoplasmic genomes of wheat and Setaria italica.

    Science.gov (United States)

    Xiang, Fengning; Xia, Guangmin; Zhi, Daying; Wang, Jing; Nie, Hui; Chen, Huimin

    2004-08-01

    Somatic hybridization via PEG (Polyethylene 6000)-mediated protoplast fusion was achieved between two different wheat culture lines (Triticum aestivum L., "Jinan"177, T1 and T2) and Setaria italica (L.) P. Beauv. The T1 recipient originated from non-regenerable long-term cell suspensions, while T2 was derived from embryogenic calli with a high regeneration capacity. Donor protoplasts were obtained from embryogenic calli of S. italica (S) (with low regeneration capacity) irradiated with different doses of ultraviolet light. Twenty-three putative hybrid cell lines were produced in fusion combinations with the donor protoplasts treated with UV light for 30 s (combination I) and 1 min (combination II), but only one (from combination II) differentiated into green plants. Three cell lines from combination I and five cell lines from combination II possessed the nuclear genomes of T1, T2, and S. italica as revealed by cytological, isozyme, RAPD, and 5S rDNA spacer sequence analyses. Genomic in situ hybridization (GISH) analysis showed that most hybrid cell lines had 22-36 wheat chromosomes, 0-2 S. italica chromosomes, and 1-6 wheat - S. italica recombinant chromosomes, whereas the regenerable cell line had 44-56 wheat chromosomes and 3-6 recombinant chromosomes, but no intact S. italica chromosomes. RFLP analysis of organellar DNA revealed that mitochondrial and chloroplast DNA of both parents coexisted in all hybrid cell lines and recombined in most hybrid cell lines. These results indicate that the regeneration of hybrid plants involves not only the integration of S. italica nuclear and organellar DNA, but also the genome complementation of T1 and T2.