WorldWideScience

Sample records for nuclear rdna sequences

  1. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    Science.gov (United States)

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  2. Fascioliasis transmission by Lymnaea neotropica confirmed by nuclear rDNA and mtDNA sequencing in Argentina.

    Science.gov (United States)

    Mera y Sierra, Roberto; Artigas, Patricio; Cuervo, Pablo; Deis, Erika; Sidoti, Laura; Mas-Coma, Santiago; Bargues, Maria Dolores

    2009-12-03

    Fascioliasis is widespread in livestock in Argentina. Among activities included in a long-term initiative to ascertain which are the fascioliasis areas of most concern, studies were performed in a recreational farm, including liver fluke infection in different domestic animal species, classification of the lymnaeid vector and verification of natural transmission of fascioliasis by identification of the intramolluscan trematode larval stages found in naturally infected snails. The high prevalences in the domestic animals appeared related to only one lymnaeid species present. Lymnaeid and trematode classification was verified by means of nuclear ribosomal DNA and mitochondrial DNA marker sequencing. Complete sequences of 18S rRNA gene and rDNA ITS-2 and ITS-1, and a fragment of the mtDNA cox1 gene demonstrate that the Argentinian lymnaeid belongs to the species Lymnaea neotropica. Redial larval stages found in a L. neotropica specimen were ascribed to Fasciola hepatica after analysis of the complete ITS-1 sequence. The finding of L. neotropica is the first of this lymnaeid species not only in Argentina but also in Southern Cone countries. The total absence of nucleotide differences between the sequences of specimens from Argentina and the specimens from the Peruvian type locality at the levels of rDNA 18S, ITS-2 and ITS-1, and the only one mutation at the mtDNA cox1 gene suggest a very recent spread. The ecological characteristics of this lymnaeid, living in small, superficial water collections frequented by livestock, suggest that it may be carried from one place to another by remaining in dried mud stuck to the feet of transported animals. The presence of L. neotropica adds pronounced complexity to the transmission and epidemiology of fascioliasis in Argentina, due to the great difficulties in distinguishing, by traditional malacological methods, between the three similar lymnaeid species of the controversial Galba/Fossaria group present in this country: L. viatrix

  3. EVOLUTION OF NUCLEAR RDNA ITS SEQUENCES IN THE CLADOPHORA ALBIDA/SERICEA CLADE (CHLOROPHYTA)

    NARCIS (Netherlands)

    BAKKER, FT; OLSEN, JL; STAM, WT

    Ribosomal DNA ITS sequences were compared among 13 different species and biogeographic isolates from the monophyletic ''abbida/sericea clade'' in the green algal genus Cladophora. Six distinct ITS sequence types were found, characterized by multiple insertions and deletions and high levels of

  4. BIOGEOGRAPHY OF CLADOPHOROPSIS-MEMBRANACEA (CHLOROPHYTA) BASED ON COMPARISONS OF NUCLEAR RDNA ITS SEQUENCES

    NARCIS (Netherlands)

    KOOISTRA, WHCF; STAM, WT; OLSEN, JL; VANDENHOEK, C

    1992-01-01

    Nucleotides were compared at 988 sites, spanning both internal transcribed spacers (ITS1 and ITS2) of the nuclear ribosomal DNA, among 17 isolates of the green alga Cladophoropsis membranacea (Hofman Bang ex C. Agardh) Boergesen and two isolates of Struvea anastomosans (Harvey) Piccone and Grunow.

  5. Ulva and Enteromorpha (Ulvaceae, Chlorophyta) from two sides of the Yellow Sea: analysis of nuclear rDNA ITS and plastid rbcL sequence data

    Science.gov (United States)

    Wang, Jinfeng; Li, Nan; Jiang, Peng; Boo, Sung Min; Lee, Wook Jae; Cui, Yulin; Lin, Hanzhi; Zhao, Jin; Liu, Zhengyi; Qin, Song

    2010-07-01

    Ulvacean green seaweeds are common worldwide; they formed massive green tides in the Yellow Sea in recent years, which caused marine ecological problems as well as a social issue. We investigated two major genera of the Ulvaceae, Ulva and Enteromorpha, and collected the plastid rbcL and nuclear ITS sequences of specimens of the genera in two sides of the Yellow Sea and analyzed them. Phylogenetic trees of rbcL data show the occurrence of five species of Enteromorpha ( E. compressa, E. flexuosa, E. intestinalis, E. linza and E. prolifera) and three species of Ulva ( U. pertusa, U. rigida and U. ohnoi). However, we found U. ohnoi, which is known as a subtropical to tropical species, at two sites on Jeju Island, Korea. Four ribotypes in partial sequences of 5.8S rDNA and ITS2 from E. compressa were also found. Ribotype network analysis revealed that the common ribotype, occurring in China, Korea and Europe, is connected with ribotypes from Europe and China/Japan. Although samples of the same species were collected from both sides of the Yellow Sea, intraspecific genetic polymorphism of each species was low among samples collected worldwide.

  6. Pattern of morphological diversification in the Leptocarabus ground beetles (Coleoptera: Carabidae) as deduced from mitochondrial ND5 gene and nuclear 28S rDNA sequences.

    Science.gov (United States)

    Kim, C G; Zhou, H Z; Imura, Y; Tominaga, O; Su, Z H; Osawa, S

    2000-01-01

    Most of the mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and a part of nuclear 28S ribosomal RNA gene were sequenced for 14 species of ground beetles belonging to the genus Leptocarabus. In both the ND5 and the 28S rDNA phylogenetic trees of Leptocarabus, three major lineages were recognized: (1) L. marcilhaci/L. yokoael/Leptocarabus sp. from China, (2) L. koreanus/L. truncaticollis/L. seishinensis/L. semiopacus/L. canaliculatus/L. kurilensis from the northern Eurasian continent including Korea and Hokkaido, Japan, and (3) all of the Japanese species except L. kurilensis. Clustering of the species in the trees is largely linked to their geographic distribution and does not correlate with morphological characters. The species belonging to different species groups are clustered in the same lineages, and those in the same species group are scattered among the different lineages. One of the possible interpretations of the present results would be that morphological transformations independently took place in the different lineages, sometimes with accompanying parallel morphological evolution, resulting in the occurrence of the morphological species belonging to the same species group (= type) in the different lineages.

  7. Species composition of the genus Saprolegnia in fin fish aquaculture environments, as determined by nucleotide sequence analysis of the nuclear rDNA ITS regions.

    Science.gov (United States)

    de la Bastide, Paul Y; Leung, Wai Lam; Hintz, William E

    2015-01-01

    The ITS region of the rDNA gene was compared for Saprolegnia spp. in order to improve our understanding of nucleotide sequence variability within and between species of this genus, determine species composition in Canadian fin fish aquaculture facilities, and to assess the utility of ITS sequence variability in genetic marker development. From a collection of more than 400 field isolates, ITS region nucleotide sequences were studied and it was determined that there was sufficient consistent inter-specific variation to support the designation of species identity based on ITS sequence data. This non-subjective approach to species identification does not rely upon transient morphological features. Phylogenetic analyses comparing our ITS sequences and species designations with data from previous studies generally supported the clade scheme of Diéguez-Uribeondo et al. (2007) and found agreement with the molecular taxonomic cluster system of Sandoval-Sierra et al. (2014). Our Canadian ITS sequence collection will thus contribute to the public database and assist the clarification of Saprolegnia spp. taxonomy. The analysis of ITS region sequence variability facilitated genus- and species-level identification of unknown samples from aquaculture facilities and provided useful information on species composition. A unique ITS-RFLP for the identification of S. parasitica was also described. Copyright © 2014 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  8. Divergent nuclear 18S rDNA paralogs in a turkey coccidium, Eimeria meleagrimitis, complicate molecular systematics and identification.

    Science.gov (United States)

    El-Sherry, Shiem; Ogedengbe, Mosun E; Hafeez, Mian A; Barta, John R

    2013-07-01

    Multiple 18S rDNA sequences were obtained from two single-oocyst-derived lines of each of Eimeria meleagrimitis and Eimeria adenoeides. After analysing the 15 new 18S rDNA sequences from two lines of E. meleagrimitis and 17 new sequences from two lines of E. adenoeides, there were clear indications that divergent, paralogous 18S rDNA copies existed within the nuclear genome of E. meleagrimitis. In contrast, mitochondrial cytochrome c oxidase subunit I (COI) partial sequences from all lines of a particular Eimeria sp. were identical and, in phylogenetic analyses, COI sequences clustered unambiguously in monophyletic and highly-supported clades specific to individual Eimeria sp. Phylogenetic analysis of the new 18S rDNA sequences from E. meleagrimitis showed that they formed two distinct clades: Type A with four new sequences; and Type B with nine new sequences; both Types A and B sequences were obtained from each of the single-oocyst-derived lines of E. meleagrimitis. Together these rDNA types formed a well-supported E. meleagrimitis clade. Types A and B 18S rDNA sequences from E. meleagrimitis had a mean sequence identity of only 97.4% whereas mean sequence identity within types was 99.1-99.3%. The observed intraspecific sequence divergence among E. meleagrimitis 18S rDNA sequence types was even higher (approximately 2.6%) than the interspecific sequence divergence present between some well-recognized species such as Eimeria tenella and Eimeria necatrix (1.1%). Our observations suggest that, unlike COI sequences, 18S rDNA sequences are not reliable molecular markers to be used alone for species identification with coccidia, although 18S rDNA sequences have clear utility for phylogenetic reconstruction of apicomplexan parasites at the genus and higher taxonomic ranks. Copyright © 2013. Published by Elsevier Ltd.

  9. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Directory of Open Access Journals (Sweden)

    Moore JE

    2006-01-01

    Full Text Available Abstract Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted.

  10. Homogeneity of the 16S rDNA sequence among geographically disparate isolates of Taylorella equigenitalis

    Science.gov (United States)

    Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC

    2006-01-01

    Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935

  11. [Phylogenetic relationships among the genera of Taxodiaceae and Cupressaceae from 28S rDNA sequences].

    Science.gov (United States)

    Li, Chun-Xiang; Yang, Qun

    2003-03-01

    DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.

  12. Utility of 16S rDNA Sequencing for Identification of Rare Pathogenic Bacteria.

    Science.gov (United States)

    Loong, Shih Keng; Khor, Chee Sieng; Jafar, Faizatul Lela; AbuBakar, Sazaly

    2016-11-01

    Phenotypic identification systems are established methods for laboratory identification of bacteria causing human infections. Here, the utility of phenotypic identification systems was compared against 16S rDNA identification method on clinical isolates obtained during a 5-year study period, with special emphasis on isolates that gave unsatisfactory identification. One hundred and eighty-seven clinical bacteria isolates were tested with commercial phenotypic identification systems and 16S rDNA sequencing. Isolate identities determined using phenotypic identification systems and 16S rDNA sequencing were compared for similarity at genus and species level, with 16S rDNA sequencing as the reference method. Phenotypic identification systems identified ~46% (86/187) of the isolates with identity similar to that identified using 16S rDNA sequencing. Approximately 39% (73/187) and ~15% (28/187) of the isolates showed different genus identity and could not be identified using the phenotypic identification systems, respectively. Both methods succeeded in determining the species identities of 55 isolates; however, only ~69% (38/55) of the isolates matched at species level. 16S rDNA sequencing could not determine the species of ~20% (37/187) of the isolates. The 16S rDNA sequencing is a useful method over the phenotypic identification systems for the identification of rare and difficult to identify bacteria species. The 16S rDNA sequencing method, however, does have limitation for species-level identification of some bacteria highlighting the need for better bacterial pathogen identification tools. © 2016 Wiley Periodicals, Inc.

  13. Community structure of arbuscular mycorrhizal fungi in undisturbed vegetation revealed by analyses of LSU rdna sequences

    DEFF Research Database (Denmark)

    Rosendahl, Søren; Holtgrewe-Stukenbrock, Eva

    2004-01-01

    Arbuscular mycorrhizal fungi (AMF) form a mutualistic symbiosis with plant roots and are found in most ecosystems. In this study the community structure of AMF in a clade of the genus Glomus was examined in undisturbed costal grassland using LSU rDNA sequences amplified from roots of Hieracium...

  14. Phylogenetic study on Shiraia bambusicola by rDNA sequence analyses.

    Science.gov (United States)

    Cheng, Tian-Fan; Jia, Xiao-Ming; Ma, Xiao-Hang; Lin, Hai-Ping; Zhao, Yu-Hua

    2004-01-01

    In this study, 18S rDNA and ITS-5.8S rDNA regions of four Shiraia bambusicola isolates collected from different species of bamboos were amplified by PCR with universal primer pairs NS1/NS8 and ITS5/ITS4, respectively, and sequenced. Phylogenetic analyses were conducted on three selected datasets of rDNA sequences. Maximum parsimony, distance and maximum likelihood criteria were used to infer trees. Morphological characteristics were also observed. The positioning of Shiraia in the order Pleosporales was well supported by bootstrap, which agreed with the placement by Amano (1980) according to their morphology. We did not find significant inter-hostal differences among these four isolates from different species of bamboos. From the results of analyses and comparison of their rDNA sequences, we conclude that Shiraia should be classified into Pleosporales as Amano (1980) proposed and suggest that it might be positioned in the family Phaeosphaeriaceae. Copyright 2004 WILEY-VCH Verlag GmbH & Co.

  15. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  16. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes.

    Science.gov (United States)

    Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang

    2010-09-13

    The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  17. Phylogenetic analysis of Demodex caprae based on mitochondrial 16S rDNA sequence.

    Science.gov (United States)

    Zhao, Ya-E; Hu, Li; Ma, Jun-Xian

    2013-11-01

    Demodex caprae infests the hair follicles and sebaceous glands of goats worldwide, which not only seriously impairs goat farming, but also causes a big economic loss. However, there are few reports on the DNA level of D. caprae. To reveal the taxonomic position of D. caprae within the genus Demodex, the present study conducted phylogenetic analysis of D. caprae based on mt16S rDNA sequence data. D. caprae adults and eggs were obtained from a skin nodule of the goat suffering demodicidosis. The mt16S rDNA sequences of individual mite were amplified using specific primers, and then cloned, sequenced, and aligned. The sequence divergence, genetic distance, and transition/transversion rate were computed, and the phylogenetic trees in Demodex were reconstructed. Results revealed the 339-bp partial sequences of six D. caprae isolates were obtained, and the sequence identity was 100% among isolates. The pairwise divergences between D. caprae and Demodex canis or Demodex folliculorum or Demodex brevis were 22.2-24.0%, 24.0-24.9%, and 22.9-23.2%, respectively. The corresponding average genetic distances were 2.840, 2.926, and 2.665, and the average transition/transversion rates were 0.70, 0.55, and 0.54, respectively. The divergences, genetic distances, and transition/transversion rates of D. caprae versus the other three species all reached interspecies level. The five phylogenetic trees all presented that D. caprae clustered with D. brevis first, and then with D. canis, D. folliculorum, and Demodex injai in sequence. In conclusion, D. caprae is an independent species, and it is closer to D. brevis than to D. canis, D. folliculorum, or D. injai.

  18. Phylogenetic analysis of Thai oyster (Ostreidae) based on partial sequences of the mitochondrial 16S rDNA gene

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik

    2006-01-01

    Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...

  19. Asymmetric epigenetic modification and elimination of rDNA sequences by polyploidization in wheat.

    Science.gov (United States)

    Guo, Xiang; Han, Fangpu

    2014-11-01

    rRNA genes consist of long tandem repeats clustered on chromosomes, and their products are important functional components of the ribosome. In common wheat (Triticum aestivum), rDNA loci from the A and D genomes were largely lost during the evolutionary process. This biased DNA elimination may be related to asymmetric transcription and epigenetic modifications caused by the polyploid formation. Here, we observed both sets of parental nucleolus organizing regions (NORs) were expressed after hybridization, but asymmetric silencing of one parental NOR was immediately induced by chromosome doubling, and reversing the ploidy status could not reactivate silenced NORs. Furthermore, increased CHG and CHH DNA methylation on promoters was accompanied by asymmetric silencing of NORs. Enrichment of H3K27me3 and H3K9me2 modifications was also observed to be a direct response to increased DNA methylation and transcriptional inactivation of NOR loci. Both A and D genome NOR loci with these modifications started to disappear in the S4 generation and were completely eliminated by the S7 generation in synthetic tetraploid wheat. Our results indicated that asymmetric epigenetic modification and elimination of rDNA sequences between different donor genomes may lead to stable allopolyploid wheat with increased differentiation and diversity. © 2014 American Society of Plant Biologists. All rights reserved.

  20. The Large Subunit rDNA Sequence of Plasmodiophora brassicae Does not Contain Intra-species Polymorphism.

    Science.gov (United States)

    Schwelm, Arne; Berney, Cédric; Dixelius, Christina; Bass, David; Neuhauser, Sigrid

    2016-12-01

    Clubroot disease caused by Plasmodiophora brassicae is one of the most important diseases of cultivated brassicas. P. brassicae occurs in pathotypes which differ in the aggressiveness towards their Brassica host plants. To date no DNA based method to distinguish these pathotypes has been described. In 2011 polymorphism within the 28S rDNA of P. brassicae was reported which potentially could allow to distinguish pathotypes without the need of time-consuming bioassays. However, isolates of P. brassicae from around the world analysed in this study do not show polymorphism in their LSU rDNA sequences. The previously described polymorphism most likely derived from soil inhabiting Cercozoa more specifically Neoheteromita-like glissomonads. Here we correct the LSU rDNA sequence of P. brassicae. By using FISH we demonstrate that our newly generated sequence belongs to the causal agent of clubroot disease. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

  1. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences.

    Science.gov (United States)

    Yadav, Shailendra; Kundu, Sharbadeb; Ghosh, Sankar K; Maitra, S S

    2015-01-01

    Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic) and Thaumarchaeota (mesophilic), were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about "methanogenic archaea composition" and "abundance" in the contrasting ecosystems like "landfill" and "marshland" may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  2. Molecular Analysis of Methanogen Richness in Landfill and Marshland Targeting 16S rDNA Sequences

    Directory of Open Access Journals (Sweden)

    Shailendra Yadav

    2015-01-01

    Full Text Available Methanogens, a key contributor in global carbon cycling, methane emission, and alternative energy production, generate methane gas via anaerobic digestion of organic matter. The methane emission potential depends upon methanogenic diversity and activity. Since they are anaerobes and difficult to isolate and culture, their diversity present in the landfill sites of Delhi and marshlands of Southern Assam, India, was analyzed using molecular techniques like 16S rDNA sequencing, DGGE, and qPCR. The sequencing results indicated the presence of methanogens belonging to the seventh order and also the order Methanomicrobiales in the Ghazipur and Bhalsawa landfill sites of Delhi. Sequences, related to the phyla Crenarchaeota (thermophilic and Thaumarchaeota (mesophilic, were detected from marshland sites of Southern Assam, India. Jaccard analysis of DGGE gel using Gel2K showed three main clusters depending on the number and similarity of band patterns. The copy number analysis of hydrogenotrophic methanogens using qPCR indicates higher abundance in landfill sites of Delhi as compared to the marshlands of Southern Assam. The knowledge about “methanogenic archaea composition” and “abundance” in the contrasting ecosystems like “landfill” and “marshland” may reorient our understanding of the Archaea inhabitants. This study could shed light on the relationship between methane-dynamics and the global warming process.

  3. Molecular phylogeny of Oncaeidae (Copepoda using nuclear ribosomal internal transcribed spacer (ITS rDNA.

    Directory of Open Access Journals (Sweden)

    Iole Di Capua

    Full Text Available Copepods belonging to the Oncaeidae family are commonly and abundantly found in marine zooplankton. In the Mediterranean Sea, forty-seven oncaeid species occur, of which eleven in the Gulf of Naples. In this Gulf, several Oncaea species were morphologically analysed and described at the end of the XIX century by W. Giesbrecht. In the same area, oncaeids are being investigated over seasonal and inter-annual scales at the long-term coastal station LTER-MC. In the present work, we identified six oncaeid species using the nuclear ribosomal internal transcribed spacers (ITS rDNA and the mitochondrial cytochrome c oxidase subunit I (mtCOI. Phylogenetic analyses based on these two genomic regions validated the sisterhood of the genera Triconia and the Oncaea sensu stricto. ITS1 and ITS2 phylogenies produced incongruent results about the position of Oncaea curta, calling for further investigations on this species. We also characterised the ITS2 region by secondary structure predictions and found that all the sequences analysed presented the distinct eukaryotic hallmarks. A Compensatory Base Change search corroborated the close relationship between O. venusta and O. curta and between O. media and O. venusta already identified by ITS phylogenies. The present results, which stem from the integration of molecular and morphological taxonomy, represent an encouraging step towards an improved knowledge of copepod biodiversity: The two complementary approaches, when applied to long-term copepod monitoring, will also help to better understanding their genetic variations and ecological niches of co-occurring species.

  4. Chromosomal locations of four minor rDNA loci and a marker microsatellite sequence in barley

    DEFF Research Database (Denmark)

    Pedersen, C.; Linde-Laursen, I.

    1994-01-01

    is located about 54% out on the short arm of chromosome 4 and it has not previously been reported in barley. We have designated the new locus Nor-I6. rDNA loci on homoeologous group 4 chromosomes have not yet been reported in other Triticeae species. The origin of these 4 minor rDNA loci is discussed...

  5. Characterization of Fasciola samples by ITS of rDNA sequences revealed the existence of Fasciola hepatica and Fasciola gigantica in Yunnan Province, China.

    Science.gov (United States)

    Shu, Fan-Fan; Lv, Rui-Qing; Zhang, Yi-Fang; Duan, Gang; Wu, Ding-Yu; Li, Bi-Feng; Yang, Jian-Fa; Zou, Feng-Cai

    2012-08-01

    On mainland China, liver flukes of Fasciola spp. (Digenea: Fasciolidae) can cause serious acute and chronic morbidity in numerous species of mammals such as sheep, goats, cattle, and humans. The objective of the present study was to examine the taxonomic identity of Fasciola species in Yunnan province by sequences of the first and second internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA). The ITS rDNA was amplified from 10 samples representing Fasciola species in cattle from 2 geographical locations in Yunnan Province, by polymerase chain reaction (PCR), and the products were sequenced directly. The lengths of the ITS-1 and ITS-2 sequences were 422 and 361-362 base pairs, respectively, for all samples sequenced. Using ITS sequences, 2 Fasciola species were revealed, namely Fasciola hepatica and Fasciola gigantica. This is the first demonstration of F. gigantica in cattle in Yunnan Province, China using a molecular approach; our findings have implications for studying the population genetic characterization of the Chinese Fasciola species and for the prevention and control of Fasciola spp. in this province.

  6. Comparative molecular analysis of Herbaspirillum strains by RAPD, RFLP, and 16S rDNA sequencing

    Directory of Open Access Journals (Sweden)

    Soares-Ramos Juliana R.L.

    2003-01-01

    Full Text Available Herbaspirillum spp. are endophytic diazotrophic bacteria associated with important agricultural crops. In this work, we analyzed six strains of H. seropedicae (Z78, M2, ZA69, ZA95, Z152, and Z67 and one strain of H. rubrisubalbicans (M4 by restriction fragment length polymorphism (RFLP using HindIII or DraI restriction endonucleases, random amplified polymorphic DNA (RAPD, and partial sequencing of 16S rDNA. The results of these analyses ascribed the strains studied to three distinct groups: group I, consisting of M2 and M4; group II, of ZA69; and group III, of ZA95, Z78, Z67, and Z152. RAPD fingerprinting showed a higher variability than the other methods, and each strain had a unique electrophoretic pattern with five of the six primers used. Interestingly, H. seropedicae M2 was found by all analyses to be genetically very close to H. rubrisubalbicans M4. Our results show that RAPD can distinguish between all Herbaspirillum strains tested.

  7. Chromosomal characteristics and distribution of rDNA sequences in the brook trout Salvelinus fontinalis (Mitchill, 1814).

    Science.gov (United States)

    Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata

    2015-08-01

    Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.

  8. Co-located hAT transposable element and 5S rDNA in an interstitial telomeric sequence suggest the formation of Robertsonian fusion in armored catfish.

    Science.gov (United States)

    Glugoski, Larissa; Giuliano-Caetano, Lucia; Moreira-Filho, Orlando; Vicari, Marcelo R; Nogaroto, Viviane

    2018-04-15

    Co-located 5S rDNA genes and interstitial telomeric sites (ITS) revealed the involvement of multiple 5S rDNA clusters in chromosome rearrangements of Loricariidae. Interstitial (TTAGGG)n vestiges, in addition to telomeric sites, can coincide with locations of chromosomal rearrangements, and they are considered to be hotspots for chromosome breaks. This study aimed the molecular characterization of 5S rDNA in two Rineloricaria latirostris populations and examination of roles of 5S rDNA in breakpoint sites and its in situ localization. Rineloricaria latirostris from Brazil's Das Pedras river (2n = 46 chromosomes) presented five pairs identified using a 5S rDNA probe, in addition to a pair bearing a co-located ITS/5S rDNA. Rineloricaria latirostris from the Piumhi river (2n = 48 chromosomes) revealed two pairs containing 5S rDNA, without ITS. A 702-bp amplified sequence, using 5S rDNA primers, revealed an insertion of the hAT transposable element (TE), referred to as a degenerate 5S rDNA. Double-FISH (fluorescence in situ hybridization) demonstrated co-localization of 5S rDNA/degenerate 5S rDNA, 5S rDNA/hAT and ITS/5S rDNA from the Das Pedras river population. Piumhi river isolates possessed only 5S rDNA sites. We suggest that the degenerate 5S rDNA was generated by unequal crossing over, which was driven by invasion of hAT, establishing a breakpoint region susceptible to chromosome breakage, non-homologous recombination and Robertsonian (Rb) fusion. Furthermore, the presence of clusters of 5S rDNA at fusion points in other armored catfish species suggests its re-use and that these regions represent hotspots for evolutionary rearrangements within Loricariidae genomes. Copyright © 2018 Elsevier B.V. All rights reserved.

  9. The Comparison of Biochemical and Sequencing 16S rDNA Gene Methods to Identify Nontuberculous Mycobacteria

    Directory of Open Access Journals (Sweden)

    Shafipour1, M.

    2014-11-01

    Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.

  10. Complete sequence analysis of 18S rDNA based on genomic DNA extraction from individual Demodex mites (Acari: Demodicidae).

    Science.gov (United States)

    Zhao, Ya-E; Xu, Ji-Ru; Hu, Li; Wu, Li-Ping; Wang, Zheng-Hang

    2012-05-01

    The study for the first time attempted to accomplish 18S ribosomal DNA (rDNA) complete sequence amplification and analysis for three Demodex species (Demodex folliculorum, Demodex brevis and Demodex canis) based on gDNA extraction from individual mites. The mites were treated by DNA Release Additive and Hot Start II DNA Polymerase so as to promote mite disruption and increase PCR specificity. Determination of D. folliculorum gDNA showed that the gDNA yield reached the highest at 1 mite, tending to descend with the increase of mite number. The individual mite gDNA was successfully used for 18S rDNA fragment (about 900 bp) amplification examination. The alignments of 18S rDNA complete sequences of individual mite samples and those of pooled mite samples ( ≥ 1000mites/sample) showed over 97% identities for each species, indicating that the gDNA extracted from a single individual mite was as satisfactory as that from pooled mites for PCR amplification. Further pairwise sequence analyses showed that average divergence, genetic distance, transition/transversion or phylogenetic tree could not effectively identify the three Demodex species, largely due to the differentiation in the D. canis isolates. It can be concluded that the individual Demodex mite gDNA can satisfy the molecular study of Demodex. 18S rDNA complete sequence is suitable for interfamily identification in Cheyletoidea, but whether it is suitable for intrafamily identification cannot be confirmed until the ascertainment of the types of Demodex mites parasitizing in dogs. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. 18S rDNA Sequences from Microeukaryotes Reveal Oil Indicators in Mangrove Sediment

    Science.gov (United States)

    Santos, Henrique F.; Cury, Juliano C.; Carmo, Flavia L.; Rosado, Alexandre S.; Peixoto, Raquel S.

    2010-01-01

    Background Microeukaryotes are an effective indicator of the presence of environmental contaminants. However, the characterisation of these organisms by conventional tools is often inefficient, and recent molecular studies have revealed a great diversity of microeukaryotes. The full extent of this diversity is unknown, and therefore, the distribution, ecological role and responses to anthropogenic effects of microeukaryotes are rather obscure. The majority of oil from oceanic oil spills (e.g., the May 2010 accident in the Gulf of Mexico) converges on coastal ecosystems such as mangroves, which are threatened with worldwide disappearance, highlighting the need for efficient tools to indicate the presence of oil in these environments. However, no studies have used molecular methods to assess the effects of oil contamination in mangrove sediment on microeukaryotes as a group. Methodology/Principal Findings We evaluated the population dynamics and the prevailing 18S rDNA phylotypes of microeukaryotes in mangrove sediment microcosms with and without oil contamination, using PCR/DGGE and clone libraries. We found that microeukaryotes are useful for monitoring oil contamination in mangroves. Our clone library analysis revealed a decrease in both diversity and species richness after contamination. The phylogenetic group that showed the greatest sensitivity to oil was the Nematoda. After contamination, a large increase in the abundance of the groups Bacillariophyta (diatoms) and Biosoecida was detected. The oil-contaminated samples were almost entirely dominated by organisms related to Bacillariophyta sp. and Cafeteria minima, which indicates that these groups are possible targets for biomonitoring oil in mangroves. The DGGE fingerprints also indicated shifts in microeukaryote profiles; specific band sequencing indicated the appearance of Bacillariophyta sp. only in contaminated samples and Nematoda only in non-contaminated sediment. Conclusions/Significance We believe that

  12. Phylogenetic relationships in three species of canine Demodex mite based on partial sequences of mitochondrial 16S rDNA.

    Science.gov (United States)

    Sastre, Natalia; Ravera, Ivan; Villanueva, Sergio; Altet, Laura; Bardagí, Mar; Sánchez, Armand; Francino, Olga; Ferrer, Lluís

    2012-12-01

    The historical classification of Demodex mites has been based on their hosts and morphological features. Genome sequencing has proved to be a very effective taxonomic tool in phylogenetic studies and has been applied in the classification of Demodex. Mitochondrial 16S rDNA has been demonstrated to be an especially useful marker to establish phylogenetic relationships. To amplify and sequence a segment of the mitochondrial 16S rDNA from Demodex canis and Demodex injai, as well as from the short-bodied mite called, unofficially, D. cornei and to determine their genetic proximity. Demodex mites were examined microscopically and classified as Demodex folliculorum (one sample), D. canis (four samples), D. injai (two samples) or the short-bodied species D. cornei (three samples). DNA was extracted, and a 338 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of the four D. canis mites were identical and shared 99.6 and 97.3% identity with two D. canis sequences available at GenBank. The sequences of the D. cornei isolates were identical and showed 97.8, 98.2 and 99.6% identity with the D. canis isolates. The sequences of the two D. injai isolates were also identical and showed 76.6% identity with the D. canis sequence. Demodex canis and D. injai are two different species, with a genetic distance of 23.3%. It would seem that the short-bodied Demodex mite D. cornei is a morphological variant of D. canis. © 2012 The Authors. Veterinary Dermatology © 2012 ESVD and ACVD.

  13. Systematics of Penicillium simplicissimum based on rDNA sequences, morphology and secondary metabolites

    DEFF Research Database (Denmark)

    Tuthill, D.E.; Frisvad, Jens Christian; Christensen, M.

    2001-01-01

    supported by differences in micromorphological characters, particularly of the conidia and phialides, and the production of distinct profiles of secondary metabolites by each species. Group-I introns, located in the SSU rDNA, were identified in six of the 21 isolates; their presence was used to test...

  14. Phylogenetic relationships in Demodex mites (Acari: Demodicidae) based on mitochondrial 16S rDNA partial sequences.

    Science.gov (United States)

    Zhao, Ya-E; Wu, Li-Ping

    2012-09-01

    To confirm phylogenetic relationships in Demodex mites based on mitochondrial 16S rDNA partial sequences, mtDNA 16S partial sequences of ten isolates of three Demodex species from China were amplified, recombined, and sequenced and then analyzed with two Demodex folliculorum isolates from Spain. Lastly, genetic distance was computed, and phylogenetic tree was reconstructed. MEGA 4.0 analysis showed high sequence identity among 16S rDNA partial sequences of three Demodex species, which were 95.85 % in D. folliculorum, 98.53 % in Demodex canis, and 99.71 % in Demodex brevis. The divergence, genetic distance, and transition/transversions of the three Demodex species reached interspecies level, whereas there was no significant difference of the divergence (1.1 %), genetic distance (0.011), and transition/transversions (3/1) of the two geographic D. folliculorum isolates (Spain and China). Phylogenetic trees reveal that the three Demodex species formed three separate branches of one clade, where D. folliculorum and D. canis gathered first, and then gathered with D. brevis. The two Spain and five China D. folliculorum isolates did not form sister clades. In conclusion, 16S mtDNA are suitable for phylogenetic relationship analysis in low taxa (genus or species), but not for intraspecies determination of Demodex. The differentiation among the three Demodex species has reached interspecies level.

  15. Morphology and 18S rDNA gene sequence of Spirostomum minus and Spirostomum teres (Ciliophora: Heterotrichea from Rio de Janeiro, Brazil

    Directory of Open Access Journals (Sweden)

    Noemi M. Fernandes

    2013-02-01

    Full Text Available Species of Spirostomum Ehrenberg, 1838 are widely used as model organisms in ecological studies of environmental impacts and symbioses between ciliates and human pathogenic bacteria. However, the taxonomy of this genus is confused by the superficiality of the morphological descriptions of its included species, and the use of only a few characters for their differentiation. The present study provides details of total infraciliature, nuclear apparatus, morphometric data and 18S rDNA gene sequences of Spirostomum teres Claparède & Lachmann, 1858 and Spirostomum minus Roux, 1901, isolated from a sewage treatment plant and a freshwater lake in the city of Rio de Janeiro, Brazil, respectively. For the morphological descriptions of S. teres and S. minus, living cells were observed using bright-field and differential interference contrast (DIC microscopy, the total infraciliature and nuclear apparatus were revealed by staining with protargol, and ciliary patterns were observed also with scanning electron microscopy (SEM. The complete sequences of the 18S rDNA of S. teres and S. minus were obtained using eukaryotic universal primers, and then compared with sequences of other species and populations of Spirostomum deposited in the GenBank database. Living S. minus measured 400-800 µm in length and 55-115 µm in width, with the following characteristics: adoral zone of membranelles approximately 112 µm long; inconspicuous paroral kinety; 30-40 kineties in somatic ciliature; moniliform macronucleus with 9-25 nodes, approximately 12 micronuclei; single and posterior contractile vacuole; and yellow-brown cytoplasm. Living and fully extended S. teres measured approximately 250 µm in length and 65 ìm in width, with the following characteristics: adoral zone of membranelles approximately 92 µm long; approximately 30 somatic kineties; compact macronucleus, approximately five micronuclei; macronuclear groove present; single and posterior contractile vacuole

  16. Diversity analysis of Bemisia tabaci biotypes: RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region

    OpenAIRE

    Rabello, Aline R.; Queiroz, Paulo R.; Simões, Kenya C.C.; Hiragi, Cássia O.; Lima, Luzia H.C.; Oliveira, Maria Regina V.; Mehta, Angela

    2008-01-01

    The Bemisia tabaci complex is formed by approximately 41 biotypes, two of which (B and BR) occur in Brazil. In this work we aimed at obtaining genetic markers to assess the genetic diversity of the different biotypes. In order to do that we analyzed Bemisia tabaci biotypes B, BR, Q and Cassava using molecular techniques including RAPD, PCR-RFLP and sequencing of the ITS1 rDNA region. The analyses revealed a high similarity between the individuals of the B and Q biotypes, which could be distin...

  17. Isolation and characterization of 5S rDNA sequences in catfishes genome (Heptapteridae and Pseudopimelodidae): perspectives for rDNA studies in fish by C0t method.

    Science.gov (United States)

    Gouveia, Juceli Gonzalez; Wolf, Ivan Rodrigo; de Moraes-Manécolo, Vivian Patrícia Oliveira; Bardella, Vanessa Belline; Ferracin, Lara Munique; Giuliano-Caetano, Lucia; da Rosa, Renata; Dias, Ana Lúcia

    2016-12-01

    Sequences of 5S ribosomal RNA (rRNA) are extensively used in fish cytogenomic studies, once they have a flexible organization at the chromosomal level, showing inter- and intra-specific variation in number and position in karyotypes. Sequences from the genome of Imparfinis schubarti (Heptapteridae) were isolated, aiming to understand the organization of 5S rDNA families in the fish genome. The isolation of 5S rDNA from the genome of I. schubarti was carried out by reassociation kinetics (C 0 t) and PCR amplification. The obtained sequences were cloned for the construction of a micro-library. The obtained clones were sequenced and hybridized in I. schubarti and Microglanis cottoides (Pseudopimelodidae) for chromosome mapping. An analysis of the sequence alignments with other fish groups was accomplished. Both methods were effective when using 5S rDNA for hybridization in I. schubarti genome. However, the C 0 t method enabled the use of a complete 5S rRNA gene, which was also successful in the hybridization of M. cottoides. Nevertheless, this gene was obtained only partially by PCR. The hybridization results and sequence analyses showed that intact 5S regions are more appropriate for the probe operation, due to conserved structure and motifs. This study contributes to a better understanding of the organization of multigene families in catfish's genomes.

  18. Xylariaceae diversity in Thailand and Philippines, based on rDNA sequencing

    Directory of Open Access Journals (Sweden)

    Natarajan Velmurugan

    2013-05-01

    Full Text Available Twenty three different Xylariaceae Tul. & C. Tul were isolatedfrom samples collected from forest zones of Thailand and Philippines.The fungal samples were characterized based on morphological characteristics and nuclear ITS1-5.8S rDNA-ITS2 region sequences. Ten species of Xylaria, two species of Hypoxylon, Biscogniauxia, Rosellinia and one species of Annulohypoxylon and Entonaema were found. Entonaema the distinctive genus of Xylariaceae, isolated in the study from Thailand samples showed a close relationship with Xylaria in phylogenetic tree. Xylariaceous species identified at molecular level showed significant similarity of the morphological characters, such as stromal structure, ascal apex and the germ slit of ascospores. In addition, three species of Arthrinium, two species of Pestalotiopsis were also isolated and characterized in the study. A phylogenetic affinity of Pestalotiopsis with Xylariaceae was found.

  19. Xylariaceae diversity in Thailand and Philippines, based on rDNA sequencing

    Directory of Open Access Journals (Sweden)

    Natarajan Velmurugan

    2013-07-01

    Full Text Available Twenty three different Xylariaceae Tul. & C. Tul were isolated from samples collected from forest zones of Thailand and Philippines. The fungal samples were characterized based on morphological characteristics and nuclear ITS1-5.8S rDNA-ITS2 region sequences. Ten species of Xylaria, two species of Hypoxylon, Biscogniauxia, Rosellinia and one species of Annulohypoxylon and Entonaema were found. Entonaema the distinctive genus of Xylariaceae, isolated in the study from Thailand samples showed a close relationship withXylaria in phylogenetic tree. Xylariaceous species identified at molecular level showed significant similarity of the morphological characters, such as stromal structure, ascal apex and the germ slit of ascospores. In addition, three species of Arthrinium, two species of Pestalotiopsis were also isolated and characterized in the study. A phylogenetic affinity of Pestalotiopsis with Xylariaceae was found.

  20. Genetic diversity based on 28S rDNA sequences among populations of Culex quinquefasciatus collected at different locations in Tamil Nadu, India.

    Science.gov (United States)

    Sakthivelkumar, S; Ramaraj, P; Veeramani, V; Janarthanan, S

    2015-09-01

    The basis of the present study was to distinguish the existence of any genetic variability among populations of Culex quinquefasciatus which would be a valuable tool in the management of mosquito control programmes. In the present study, population of Cx. quinquefasciatus collected at different locations in Tamil Nadu were analyzed for their genetic variation based on 28S rDNA D2 region nucleotide sequences. A high degree of genetic polymorphism was detected in the sequences of D2 region of 28S rDNA on the predicted secondary structures in spite of high nucleotide sequence similarity. The findings based on secondary structure using rDNA sequences suggested the existence of a complex genotypic diversity of Cx. quinquefasciatus population collected at different locations of Tamil Nadu, India. This complexity in genetic diversity in a single mosquito population collected at different locations is considered an important issue towards their influence and nature of vector potential of these mosquitoes.

  1. Details of the evolutionary history from invertebrates to vertebrates, as deduced from the sequences of 18S rDNA.

    Science.gov (United States)

    Wada, H; Satoh, N

    1994-01-01

    Almost the entire sequences of 18S rDNA were determined for two chaetognaths, five echinoderms, a hemichordate, and two urochordates (a larvacean and a salp). Phylogenetic comparisons of the sequences, together with those of other deuterostomes (an ascidian, a cephalochordate, and vertebrates) and protostomes (an arthropod and a mollusc), suggest the monophyly of the deuterostomes, with the exception of the chaetognaths. Chaetognaths may not be a group of deuterostomes. The deuterostome group closest to vertebrates was the group of cephalochordates. Ascidians, larvaceans, and salps seem to form a discrete group (urochordates), in which the early divergence of larvaceans is evident. These results support the hypothesis that chordates evolved from free-living ancestors. PMID:8127885

  2. Karyotype divergence and spreading of 5S rDNA sequences between genomes of two species: darter and emerald gobies ( Ctenogobius , Gobiidae).

    Science.gov (United States)

    Lima-Filho, P A; Bertollo, L A C; Cioffi, M B; Costa, G W W F; Molina, W F

    2014-01-01

    Karyotype analyses of the cryptobenthic marine species Ctenogobius boleosoma and C. smaragdus were performed by means of classical and molecular cytogenetics, including physical mapping of the multigene 18S and 5S rDNA families. C. boleosoma has 2n = 44 chromosomes (2 submetacentrics + 42 acrocentrics; FN = 46) with a single chromosome pair each carrying 18S and 5S ribosomal sites; whereas C. smaragdus has 2n = 48 chromosomes (2 submetacentrics + 46 acrocentrics; FN = 50), also with a single pair bearing 18S rDNA, but an extensive increase in the number of GC-rich 5S rDNA sites in 21 chromosome pairs. The highly divergent karyotypes among Ctenogobius species contrast with observations in several other marine fish groups, demonstrating an accelerated rate of chromosomal evolution mediated by both chromosomal rearrangements and the extensive dispersion of 5S rDNA sequences in the genome. © 2014 S. Karger AG, Basel.

  3. Time spans and spacers : Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    NARCIS (Netherlands)

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be

  4. Isolation and 16s rdna sequence analysis of bacteria from dieback affected mango orchards in southern pakistan

    International Nuclear Information System (INIS)

    Khan, I.A.; Khan, A.; Asif, H.; Azim, M.K.; Muhlbach, H.P.

    2014-01-01

    A broad range of microorganisms are involved in various mango plant diseases such as fungi, algae and bacteria. In order to study the role of bacteria in mango dieback, a survey of infected mango plants in southern Pakistan was carried out. A number of bacterial isolates were obtained from healthy looking and infected mango trees, and their characterization was undertaken by colony PCR and subsequent sequence analysis of 16S rDNA. These analyses revealed the presence of various genera including Acinetobacter, Bacillus, Burkholderia, Cronobacter, Curtobacterium, Enterobacter, Erwinia, Exiguobacterium, Halotelea, Lysinibacillus, Micrococcus, Microbacterium, Pantoea, Pseudomonas, Salmonella and Staphylococcus. It is noteworthy that several members of these genera have been reported as plant pathogens. The present study provided baseline information regarding the phytopathogenic bacteria associated with mango trees in southern Pakistan. (author)

  5. Colletotrichum isolates related to Anthracnose of cashew trees in Brazil: morphological and molecular description using LSU rDNA sequences

    Directory of Open Access Journals (Sweden)

    Ana Maria Queijeiro Lopez

    2010-08-01

    Full Text Available Thirty six isolates of fungi obtained from anthracnose lesions of cashew and associated host plants in Brazil, were compared by their cultural, morphological and partial sequences of the 28S ribosomal DNA characters. They showed a high degree of cultural variability. The average mycelial growth rate on all tested media ranged from 10.2-13.3 mm/day between the isolates. Most of them produced perithecia (sterile and fertile and some produced setae (sterile and fertile. All the isolates produced acervuli with predominantly cylindrical conidia (12.4-17.7 µmX 4.8-6.0 µm in width with round ends, which became septate on germination, and produced unlobed or slightlylobed appressoria. Comparison of the D2 domain of the large subunit (LSU rDNA sequences with those of other defined species of Colletotrichum and Glomerella grouped 35 of the isolates with known strains of C. gloeosporioides from different hosts (> 98.9% homology. The one exception (LARS 921 was identical to G. cingulata (LARS 238 from Vigna unguiculata.Trinta e seis isolados de fungos obtidos de lesões de antracnose em cajueiros e outras plantas consorciadas no Brasil, foram comparados quanto a seus aspectos culturais, morfológicos e seqüências parciais do rDNA 28S. Os isolados apresentaram elevado grau de variabilidade cultural, com taxa de crescimento médio, em todos os meios testados, entre 10,2 e 13,3 mm/dia. A maioria deles produziu peritécios (estéreis e férteis, e alguns produziram setas (estéreis e férteis nos diferentes meios. Todos apresentaram acérvulos com predominância de conídios cilíndricos (12,4-17,7 µm X 4,8-6,0 µm, de extremidades arredondadas, formando septos durante a germinação e produzindo apressórios ligeiramente lobados ou lisos. Comparando as seqüências do domínio D2 da larga subunidade (LSU do rDNA dos isolados com aquelas já identificadas de espécies de Colletotrichum/ Glomerella, verificou-se que 35 deles correspondem a C

  6. Sequence comparison of the rDNA introns from six different species of Tetrahymena

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Engberg, J

    1985-01-01

    model for the intron RNA of Cech et al. (Proc. Natl. Acad. Sci. U.S.A. 80, 3903 (83)). Most of the sequence variation in the four new sequences reported here is found in single stranded loops in the model. However, in four cases we found nucleotide substitutions in duplex stem regions, two of them...

  7. [Comparison of rDNA internal transcribed spacer sequences in asparagus].

    Science.gov (United States)

    Ou, Li-Jun; Ye, Wei; Zeng, Gui-Ping; Jiang, Xiang-Hui; She, Chao-Wen; Xu, Dong; Yang, Jia-Qiang

    2010-10-01

    Using ITS sequence of nine species to identify counterfeiting medicine and analyse phylogenetic of Asparagus. Analysing ITS sequences by amplification, cloning,sequencing and alignment. The length range of ITS sequence of nine species was from 711 to 748 bp, the percentage of G + C content was about 60%. The phylogenetic tree constructed on the basis of the ITS sequences showed that nine species were divided into two branches: Asparagus cochinchinensis, Asparagus officinalis, Asparagus densiflorus, Asparagus densiflorus cv. Myers and Asparagus densiflorus cv. Sprengeri were a branch and the others were a branch. Asparagus densiflorus and Asparagus densflorus cv. Myers those were from Africa had priority to clustering and then clustering with Asparagus densiflorus cv. Sprengeri that was a variant of Asparagus densiflorus in the first branch. Asparagus setaceus had relatively distant genetic relationship with the others three materials in another branch. The ITS sequences could distinguish species of Asparagus to test the counterfeit. Division status in phylogenetic tree of some species were debatable and ITS sequence was combined with others analytical tools to analyze the realistic phylogeny.

  8. Metagenomic Analysis of Slovak Bryndza Cheese Using Next-Generation 16S rDNA Amplicon Sequencing

    Directory of Open Access Journals (Sweden)

    Planý Matej

    2016-06-01

    Full Text Available Knowledge about diversity and taxonomic structure of the microbial population present in traditional fermented foods plays a key role in starter culture selection, safety improvement and quality enhancement of the end product. Aim of this study was to investigate microbial consortia composition in Slovak bryndza cheese. For this purpose, we used culture-independent approach based on 16S rDNA amplicon sequencing using next generation sequencing platform. Results obtained by the analysis of three commercial (produced on industrial scale in winter season and one traditional (artisanal, most valued, produced in May Slovak bryndza cheese sample were compared. A diverse prokaryotic microflora composed mostly of the genera Lactococcus, Streptococcus, Lactobacillus, and Enterococcus was identified. Lactococcus lactis subsp. lactis and Lactococcus lactis subsp. cremoris were the dominant taxons in all tested samples. Second most abundant species, detected in all bryndza cheeses, were Lactococcus fujiensis and Lactococcus taiwanensis, independently by two different approaches, using different reference 16S rRNA genes databases (Greengenes and NCBI respectively. They have been detected in bryndza cheese samples in substantial amount for the first time. The narrowest microbial diversity was observed in a sample made with a starter culture from pasteurised milk. Metagenomic analysis by high-throughput sequencing using 16S rRNA genes seems to be a powerful tool for studying the structure of the microbial population in cheeses.

  9. Selectivity by host plants affects the distribution of arbuscular mycorrhizal fungi: evidence from ITS rDNA sequence metadata

    Directory of Open Access Journals (Sweden)

    Yang Haishui

    2012-04-01

    Full Text Available Abstract Background Arbuscular mycorrhizal fungi (AMF can form obligate symbioses with the vast majority of land plants, and AMF distribution patterns have received increasing attention from researchers. At the local scale, the distribution of AMF is well documented. Studies at large scales, however, are limited because intensive sampling is difficult. Here, we used ITS rDNA sequence metadata obtained from public databases to study the distribution of AMF at continental and global scales. We also used these sequence metadata to investigate whether host plant is the main factor that affects the distribution of AMF at large scales. Results We defined 305 ITS virtual taxa (ITS-VTs among all sequences of the Glomeromycota by using a comprehensive maximum likelihood phylogenetic analysis. Each host taxonomic order averaged about 53% specific ITS-VTs, and approximately 60% of the ITS-VTs were host specific. Those ITS-VTs with wide host range showed wide geographic distribution. Most ITS-VTs occurred in only one type of host functional group. The distributions of most ITS-VTs were limited across ecosystem, across continent, across biogeographical realm, and across climatic zone. Non-metric multidimensional scaling analysis (NMDS showed that AMF community composition differed among functional groups of hosts, and among ecosystem, continent, biogeographical realm, and climatic zone. The Mantel test showed that AMF community composition was significantly correlated with plant community composition among ecosystem, among continent, among biogeographical realm, and among climatic zone. The structural equation modeling (SEM showed that the effects of ecosystem, continent, biogeographical realm, and climatic zone were mainly indirect on AMF distribution, but plant had strongly direct effects on AMF. Conclusion The distribution of AMF as indicated by ITS rDNA sequences showed a pattern of high endemism at large scales. This pattern indicates high specificity

  10. Selectivity by host plants affects the distribution of arbuscular mycorrhizal fungi: evidence from ITS rDNA sequence metadata.

    Science.gov (United States)

    Yang, Haishui; Zang, Yanyan; Yuan, Yongge; Tang, Jianjun; Chen, Xin

    2012-04-12

    Arbuscular mycorrhizal fungi (AMF) can form obligate symbioses with the vast majority of land plants, and AMF distribution patterns have received increasing attention from researchers. At the local scale, the distribution of AMF is well documented. Studies at large scales, however, are limited because intensive sampling is difficult. Here, we used ITS rDNA sequence metadata obtained from public databases to study the distribution of AMF at continental and global scales. We also used these sequence metadata to investigate whether host plant is the main factor that affects the distribution of AMF at large scales. We defined 305 ITS virtual taxa (ITS-VTs) among all sequences of the Glomeromycota by using a comprehensive maximum likelihood phylogenetic analysis. Each host taxonomic order averaged about 53% specific ITS-VTs, and approximately 60% of the ITS-VTs were host specific. Those ITS-VTs with wide host range showed wide geographic distribution. Most ITS-VTs occurred in only one type of host functional group. The distributions of most ITS-VTs were limited across ecosystem, across continent, across biogeographical realm, and across climatic zone. Non-metric multidimensional scaling analysis (NMDS) showed that AMF community composition differed among functional groups of hosts, and among ecosystem, continent, biogeographical realm, and climatic zone. The Mantel test showed that AMF community composition was significantly correlated with plant community composition among ecosystem, among continent, among biogeographical realm, and among climatic zone. The structural equation modeling (SEM) showed that the effects of ecosystem, continent, biogeographical realm, and climatic zone were mainly indirect on AMF distribution, but plant had strongly direct effects on AMF. The distribution of AMF as indicated by ITS rDNA sequences showed a pattern of high endemism at large scales. This pattern indicates high specificity of AMF for host at different scales (plant taxonomic

  11. A global meta-analysis of Tuber ITS rDNA sequences: species diversity, host associations and long-distance dispersal

    Science.gov (United States)

    Gregory M. Bonito; Andrii P. Gryganskyi; James M. Trappe; Rytas. Vilgalys

    2010-01-01

    Truffles (Tuber) are ectomycorrhizal fungi characterized by hypogeous fruitbodies. Their biodiversity, host associations and geographical distributions are not well documented. ITS rDNA sequences of Tuber are commonly recovered from molecular surveys of fungal communities, but most remain insufficiently identified making it...

  12. Polymorphism of Paramecium pentaurelia (Ciliophora, Oligohymenophorea) strains revealed by rDNA and mtDNA sequences.

    Science.gov (United States)

    Przyboś, Ewa; Tarcz, Sebastian; Greczek-Stachura, Magdalena; Surmacz, Marta

    2011-05-01

    Paramecium pentaurelia is one of 15 known sibling species of the Paramecium aurelia complex. It is recognized as a species showing no intra-specific differentiation on the basis of molecular fingerprint analyses, whereas the majority of other species are polymorphic. This study aimed at assessing genetic polymorphism within P. pentaurelia including new strains recently found in Poland (originating from two water bodies, different years, seasons, and clones of one strain) as well as strains collected from distant habitats (USA, Europe, Asia), and strains representing other species of the complex. We compared two DNA fragments: partial sequences (349 bp) of the LSU rDNA and partial sequences (618 bp) of cytochrome B gene. A correlation between the geographical origin of the strains and the genetic characteristics of their genotypes was not observed. Different genotypes were found in Kraków in two types of water bodies (Opatkowice-natural pond; Jordan's Park-artificial pond). Haplotype diversity within a single water body was not recorded. Likewise, seasonal haplotype differences between the strains within the artificial water body, as well as differences between clones originating from one strain, were not detected. The clustering of some strains belonging to different species was observed in the phylogenies. Copyright © 2010 Elsevier GmbH. All rights reserved.

  13. Photobiont diversity in lichens from metal-rich substrata based on ITS rDNA sequences.

    Science.gov (United States)

    Backor, Martin; Peksa, Ondrej; Skaloud, Pavel; Backorová, Miriam

    2010-05-01

    The photobiont is considered as the more sensitive partner of lichen symbiosis in metal pollution. For this reason the presence of a metal tolerant photobiont in lichens may be a key factor of ecological success of lichens growing on metal polluted substrata. The photobiont inventory was examined for terricolous lichen community growing in Cu mine-spoil heaps derived by historical mining. Sequences of internal transcribed spacer (ITS) were phylogenetically analyzed using maximum likelihood analyses. A total of 50 ITS algal sequences were obtained from 22 selected lichen taxa collected at three Cu mine-spoil heaps and two control localities. Algae associated with Cladonia and Stereocaulon were identified as members of several Asterochloris lineages, photobionts of cetrarioid lichens clustered with Trebouxia hypogymniae ined. We did not find close relationship between heavy metal content (in localities as well as lichen thalli) and photobiont diversity. Presence of multiple algal genotypes in single lichen thallus has been confirmed. Copyright 2009 Elsevier Inc. All rights reserved.

  14. [An intriguing model for 5S rDNA sequences dispersion in the genome of freshwater stingray Potamotrygon motoro (Chondrichthyes: Potamotrygonidae)].

    Science.gov (United States)

    Cruz, V P; Oliveira, C; Foresti, F

    2015-01-01

    5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.

  15. A Simple Method for the Extraction, PCR-amplification, Cloning, and Sequencing of Pasteuria 16S rDNA from Small Numbers of Endospores.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Ciancio, A

    2004-03-01

    For many years the taxonomy of the genus Pasteuria has been marred with confusion because the bacterium could not be cultured in vitro and, therefore, descriptions were based solely on morphological, developmental, and pathological characteristics. The current study sought to devise a simple method for PCR-amplification, cloning, and sequencing of Pasteuria 16S rDNA from small numbers of endospores, with no need for prior DNA purification. Results show that DNA extracts from plain glass bead-beating of crude suspensions containing 10,000 endospores at 0.2 x 10 endospores ml(-1) were sufficient for PCR-amplification of Pasteuria 16S rDNA, when used in conjunction with specific primers. These results imply that for P. penetrans and P. nishizawae only one parasitized female of Meloidogyne spp. and Heterodera glycines, respectively, should be sufficient, and as few as eight cadavers of Belonolaimus longicaudatus with an average number of 1,250 endospores of "Candidatus Pasteuria usgae" are needed for PCR-amplification of Pasteuria 16S rDNA. The method described in this paper should facilitate the sequencing of the 16S rDNA of the many Pasteuria isolates that have been reported on nematodes and, consequently, expedite the classification of those isolates through comparative sequence analysis.

  16. Time spans and spacers: Molecular phylogenetic explorations in the Cladophora complex (Chlorophyta) from the perspective of rDNA gene and spacer sequences

    OpenAIRE

    Bakker, Frederik Theodoor

    1995-01-01

    In this study, phylogenetic relationships among genera, species and biogeographic representatives of single Cladophora species within the Cladophorales were analyzed using rDNA gene and spacer sequences. Based on phylogenetic analysis of 18S rRNA gene sequences, the Cladophora complex is shown to be paraphyletic with respect to Cladophora species and includes several genera shich werde traditionally ascribed to the Siphonocladales (Chapter 3). ... Zie: Summary/Samenvatting

  17. A new clade, based on partial LSU rDNA sequences, of unarmoured dinoflagellates.

    Science.gov (United States)

    Reñé, Albert; de Salas, Miguel; Camp, Jordi; Balagué, Vanessa; Garcés, Esther

    2013-09-01

    The order Gymnodiniales comprises unarmoured dinoflagellates. However, the lack of sequences hindered determining the phylogenetic positions and systematic relationships of several gymnodinioid taxa. In this study, a monophyletic clade was defined for the species Ceratoperidinium margalefii Loeblich III, Gyrodinium falcatum Kofoid & Swezy, three Cochlodinium species, and two Gymnodinium-like dinoflagellates. Despite their substantial morphotypic differentiation, Cochlodinium cf. helix, G. falcatum and 'Gymnodinium' sp. 1 share a common shape of the acrobase. The phylogenetic data led to the following conclusions: (1) C. margalefii is closely related to several unarmoured dinoflagellates. Its sulcus shape has been observed for the first time. (2) G. falcatum was erroneously assigned to the genus Gyrodinium and is transferred to Ceratoperidinium (C. falcatum (Kofoid & Swezy) Reñé & de Salas comb. nov.). (3) The genus Cochlodinium is polyphyletic and thus artificial; our data support its separation into three different genera. (4) The two Gymnodinium-like species could not be morphologically or phylogenetically related to any other gymnodinioid species sequenced to date. While not all studied species have been definitively transferred to the correct genus, our study is a step forward in the classification of inconspicuous unarmoured dinoflagellates. The family Ceratoperidiniaeceae and the genus Ceratoperidinium are emended. Copyright © 2013 Elsevier GmbH. All rights reserved.

  18. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  19. Bacterial diversity of soil under eucalyptus assessed by 16S rDNA sequencing analysis Diversidade bacteriana de solo sob eucaliptos obtida por seqüenciamento do 16S rDNA

    Directory of Open Access Journals (Sweden)

    Érico Leandro da Silveira

    2006-10-01

    Full Text Available Studies on the impact of Eucalyptus spp. on Brazilian soils have focused on soil chemical properties and isolating interesting microbial organisms. Few studies have focused on microbial diversity and ecology in Brazil due to limited coverage of traditional cultivation and isolation methods. Molecular microbial ecology methods based on PCR amplified 16S rDNA have enriched the knowledge of soils microbial biodiversity. The objective of this work was to compare and estimate the bacterial diversity of sympatric communities within soils from two areas, a native forest (NFA and an eucalyptus arboretum (EAA. PCR primers, whose target soil metagenomic 16S rDNA were used to amplify soil DNA, were cloned using pGEM-T and sequenced to determine bacterial diversity. From the NFA soil 134 clones were analyzed, while 116 clones were analyzed from the EAA soil samples. The sequences were compared with those online at the GenBank. Phylogenetic analyses revealed differences between the soil types and high diversity in both communities. Soil from the Eucalyptus spp. arboretum was found to have a greater bacterial diversity than the soil investigated from the native forest area.Estudos sobre impacto do Eucalyptus spp. em solos brasileiros têm focalizado propriedades químicas do solo e isolamento de microrganismos de interesse. No Brasil há pouco enfoque em ecologia e diversidade microbiana, devido às limitações dos métodos tradicionais de cultivo e isolamento. A utilização de métodos moleculares no estudo da ecologia microbiana baseados na amplificação por PCR do 16S rDNA têm enriquecido o conhecimento da biodiversidade microbiana dos solos. O objetivo deste trabalho foi comparar e estimar a diversidade bacteriana de comunidades simpátricas em solos de duas áreas: uma floresta nativa (NFA e outra adjacente com arboreto de eucaliptos (EAA. Oligonucleotídeos iniciadores foram utilizados para amplificar o 16S rDNA metagenômico do solo, o qual foi

  20. [The use of 16S rDNA sequencing in species diversity analysis for sputum of patients with ventilator-associated pneumonia].

    Science.gov (United States)

    Yang, Xiaojun; Wang, Xiaohong; Liang, Zhijuan; Zhang, Xiaoya; Wang, Yanbo; Wang, Zhenhai

    2014-05-01

    To study the species and amount of bacteria in sputum of patients with ventilator-associated pneumonia (VAP) by using 16S rDNA sequencing analysis, and to explore the new method for etiologic diagnosis of VAP. Bronchoalveolar lavage sputum samples were collected from 31 patients with VAP. Bacterial DNA of the samples were extracted and identified by polymerase chain reaction (PCR). At the same time, sputum specimens were processed for routine bacterial culture. The high flux sequencing experiment was conducted on PCR positive samples with 16S rDNA macro genome sequencing technology, and sequencing results were analyzed using bioinformatics, then the results between the sequencing and bacteria culture were compared. (1) 550 bp of specific DNA sequences were amplified in sputum specimens from 27 cases of the 31 patients with VAP, and they were used for sequencing analysis. 103 856 sequences were obtained from those sputum specimens using 16S rDNA sequencing, yielding approximately 39 Mb of raw data. Tag sequencing was able to inform genus level in all 27 samples. (2) Alpha-diversity analysis showed that sputum samples of patients with VAP had significantly higher variability and richness in bacterial species (Shannon index values 1.20, Simpson index values 0.48). Rarefaction curve analysis showed that there were more species that were not detected by sequencing from some VAP sputum samples. (3) Analysis of 27 sputum samples with VAP by using 16S rDNA sequences yielded four phyla: namely Acitinobacteria, Bacteroidetes, Firmicutes, Proteobacteria. With genus as a classification, it was found that the dominant species included Streptococcus 88.9% (24/27), Limnohabitans 77.8% (21/27), Acinetobacter 70.4% (19/27), Sphingomonas 63.0% (17/27), Prevotella 63.0% (17/27), Klebsiella 55.6% (15/27), Pseudomonas 55.6% (15/27), Aquabacterium 55.6% (15/27), and Corynebacterium 55.6% (15/27). (4) Pyrophosphate sequencing discovered that Prevotella, Limnohabitans, Aquabacterium

  1. ITS rDNA sequences of Pomphorhynchus laevis (Zoega in Müller, 1776) and P. lucyi Williams & Rogers, 1984 (Acanthocephala: Palaeacanthocephala)

    Czech Academy of Sciences Publication Activity Database

    Kráľová-Hromadová, I.; Tietz, David František; Shinn, A.; Špakulová, M.

    2003-01-01

    Roč. 56, č. 2 (2003), s. 141-145 ISSN 0165-5752 R&D Projects: GA ČR GA524/01/1314 Grant - others:GA SR(SK) VEGA2/1020/21; GA SR(SK) VEGA2/3212/23 Institutional research plan: CEZ:AV0Z6022909 Keywords : Acanthocephala * ITS rDNA sequence * taxonomy Subject RIV: EG - Zoology Impact factor: 0.642, year: 2003

  2. Molecular phylogeny of ocelloid-bearing dinoflagellates (Warnowiaceae) as inferred from SSU and LSU rDNA sequences.

    Science.gov (United States)

    Hoppenrath, Mona; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F; Leander, Brian S

    2009-05-25

    Dinoflagellates represent a major lineage of unicellular eukaryotes with unparalleled diversity and complexity in morphological features. The monophyly of dinoflagellates has been convincingly demonstrated, but the interrelationships among dinoflagellate lineages still remain largely unresolved. Warnowiid dinoflagellates are among the most remarkable eukaryotes known because of their possession of highly elaborate ultrastructural systems: pistons, nematocysts, and ocelloids. Complex organelles like these are evolutionary innovations found only in a few athecate dinoflagellates. Moreover, the taxonomy of warnowiids is extremely confusing and inferences about the evolutionary history of this lineage are mired by the absence of molecular phylogenetic data from any member of the group. In this study, we provide the first molecular phylogenetic data for warnowiids and couple them with a review of warnowiid morphological features in order to formulate a hypothetical framework for understanding character evolution within the group. These data also enabled us to evaluate the evolutionary relationship(s) between warnowiids and the other group of dinoflagellates with complex organelles: polykrikoids. Molecular phylogenetic analyses of SSU and LSU rDNA sequences demonstrated that warnowiids form a well-supported clade that falls within the more inclusive Gymnodinium sensu stricto clade. These data also confirmed that polykrikoids are members of the Gymnodinium sensu stricto clade as well; however, a specific sister relationship between the warnowiid clade and the polykrikoid clade was unresolved in all of our analyses. Nonetheless, the new DNA sequences from different isolates of warnowiids provided organismal anchors for several previously unidentified sequences derived from environmental DNA surveys of marine biodiversity. Comparative morphological data and molecular phylogenetic data demonstrate that the polykrikoid and the warnowiid clade are closely related to each other

  3. Molecular phylogeny of ocelloid-bearing dinoflagellates (Warnowiaceae as inferred from SSU and LSU rDNA sequences

    Directory of Open Access Journals (Sweden)

    Handy Sara M

    2009-05-01

    Full Text Available Abstract Background Dinoflagellates represent a major lineage of unicellular eukaryotes with unparalleled diversity and complexity in morphological features. The monophyly of dinoflagellates has been convincingly demonstrated, but the interrelationships among dinoflagellate lineages still remain largely unresolved. Warnowiid dinoflagellates are among the most remarkable eukaryotes known because of their possession of highly elaborate ultrastructural systems: pistons, nematocysts, and ocelloids. Complex organelles like these are evolutionary innovations found only in a few athecate dinoflagellates. Moreover, the taxonomy of warnowiids is extremely confusing and inferences about the evolutionary history of this lineage are mired by the absence of molecular phylogenetic data from any member of the group. In this study, we provide the first molecular phylogenetic data for warnowiids and couple them with a review of warnowiid morphological features in order to formulate a hypothetical framework for understanding character evolution within the group. These data also enabled us to evaluate the evolutionary relationship(s between warnowiids and the other group of dinoflagellates with complex organelles: polykrikoids. Results Molecular phylogenetic analyses of SSU and LSU rDNA sequences demonstrated that warnowiids form a well-supported clade that falls within the more inclusive Gymnodinium sensu stricto clade. These data also confirmed that polykrikoids are members of the Gymnodinium sensu stricto clade as well; however, a specific sister relationship between the warnowiid clade and the polykrikoid clade was unresolved in all of our analyses. Nonetheless, the new DNA sequences from different isolates of warnowiids provided organismal anchors for several previously unidentified sequences derived from environmental DNA surveys of marine biodiversity. Conclusion Comparative morphological data and molecular phylogenetic data demonstrate that the polykrikoid

  4. Molecular diversity of leuconostoc mesenteroides and leuconostoc citreum isolated from traditional french cheeses as revealed by RAPD fingerprinting, 16S rDNA sequencing and 16S rDNA fragment amplification.

    Science.gov (United States)

    Cibik, R; Lepage, E; Talliez, P

    2000-06-01

    For a long time, the identification of the Leuconostoc species has been limited by a lack of accurate biochemical and physiological tests. Here, we use a combination of RAPD, 16S rDNA sequencing, and 16S rDNA fragment amplification with specific primers to classify different leuconostocs at the species and strain level. We analysed the molecular diversity of a collection of 221 strains mainly isolated from traditional French cheeses. The majority of the strains were classified as Leuconostoc mesenteroides (83.7%) or Leuconostoc citreum (14%) using molecular techniques. Despite their presence in French cheeses, the role of L. citreum in traditional technologies has not been determined, probably because of the lack of strain identification criteria. Only one strain of Leuconostoc lactis and Leuconostoc fallax were identified in this collection, and no Weissella paramesenteroides strain was found. However, dextran negative variants of L. mesenteroides, phenotypically misclassified as W. paramesenteroides, were present. The molecular techniques used did not allow us to separate strains of the three L. mesenteroides subspecies (mesenteroides, dextranicum and cremoris). In accordance with previously published results, our findings suggest that these subspecies may be classified as biovars. Correlation found between phenotypes dextranicum and mesenteroides of L. mesenteroides and cheese technology characteristics suggests that certain strains may be better adapted to particular technological environments.

  5. Morphology and 18S rDNA gene sequence of Spirostomum minus and Spirostomum teres (Ciliophora: Heterotrichea) from Rio de Janeiro, Brazil

    OpenAIRE

    Noemi M. Fernandes; Inácio D. da Silva Neto

    2013-01-01

    Species of Spirostomum Ehrenberg, 1838 are widely used as model organisms in ecological studies of environmental impacts and symbioses between ciliates and human pathogenic bacteria. However, the taxonomy of this genus is confused by the superficiality of the morphological descriptions of its included species, and the use of only a few characters for their differentiation. The present study provides details of total infraciliature, nuclear apparatus, morphometric data and 18S rDNA gene sequen...

  6. Molecular Profiling of Microbial Communities from Contaminated Sources: Use of Subtractive Cloning Methods and rDNA Spacer Sequences; FINAL

    International Nuclear Information System (INIS)

    Robb, Frank T.

    2001-01-01

    The major objective of this research was to provide appropriate sequences and assemble a DNA array of oligonucleotides to be used for rapid profiling of microbial populations from polluted areas and other areas of interest. The sequences to be assigned to the DNA array were chosen from cloned genomic DNA taken from groundwater sites having well characterized pollutant histories at Hanford Nuclear Plant and Lawrence Livermore Site 300. Glass-slide arrays were made and tested; and a new multiplexed, bead-based method was developed that uses nucleic acid hybridization on the surface of microscopic polystyrene spheres to identify specific sequences in heterogeneous mixtures of DNA sequences. The test data revealed considerable strain variation between sample sites showing a striking distribution of sequences. It also suggests that diversity varies greatly with bioremediation, and that there are many bacterial intergenic spacer region sequences that can indicate its effects. The bead method exhibited superior sequence discrimination and has features for easier and more accurate measurement

  7. Monitoring of Fasciola Species Contamination in Water Dropwort by cox1 Mitochondrial and ITS-2 rDNA Sequencing Analysis.

    Science.gov (United States)

    Choi, In-Wook; Kim, Hwang-Yong; Quan, Juan-Hua; Ryu, Jae-Gee; Sun, Rubing; Lee, Young-Ha

    2015-10-01

    Fascioliasis, a food-borne trematode zoonosis, is a disease primarily in cattle and sheep and occasionally in humans. Water dropwort (Oenanthe javanica), an aquatic perennial herb, is a common second intermediate host of Fasciola, and the fresh stems and leaves are widely used as a seasoning in the Korean diet. However, no information regarding Fasciola species contamination in water dropwort is available. Here, we collected 500 samples of water dropwort in 3 areas in Korea during February and March 2015, and the water dropwort contamination of Fasciola species was monitored by DNA sequencing analysis of the Fasciola hepatica and Fasciola gigantica specific mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear ribosomal internal transcribed spacer 2 (ITS-2). Among the 500 samples assessed, the presence of F. hepatica cox1 and 1TS-2 markers were detected in 2 samples, and F. hepatica contamination was confirmed by sequencing analysis. The nucleotide sequences of cox1 PCR products from the 2 F. hepatica-contaminated samples were 96.5% identical to the F. hepatica cox1 sequences in GenBank, whereas F. gigantica cox1 sequences were 46.8% similar with the sequence detected from the cox1 positive samples. However, F. gigantica cox1 and ITS-2 markers were not detected by PCR in the 500 samples of water dropwort. Collectively, in this survey of the water dropwort contamination with Fasciola species, very low prevalence of F. hepatica contamination was detected in the samples.

  8. 16S-23S rDNA intergenic spacer region polymorphism of Lactococcus garvieae, Lactococcus raffinolactis and Lactococcus lactis as revealed by PCR and nucleotide sequence analysis.

    Science.gov (United States)

    Blaiotta, Giuseppe; Pepe, Olimpia; Mauriello, Gianluigi; Villani, Francesco; Andolfi, Rosamaria; Moschetti, Giancarlo

    2002-12-01

    The intergenic spacer region (ISR) between the 16S and 23S rRNA genes was tested as a tool for differentiating lactococci commonly isolated in a dairy environment. 17 reference strains, representing 11 different species belonging to the genera Lactococcus, Streptococcus, Lactobacillus, Enterococcus and Leuconostoc, and 127 wild streptococcal strains isolated during the whole fermentation process of "Fior di Latte" cheese were analyzed. After 16S-23S rDNA ISR amplification by PCR, species or genus-specific patterns were obtained for most of the reference strains tested. Moreover, results obtained after nucleotide analysis show that the 16S-23S rDNA ISR sequences vary greatly, in size and sequence, among Lactococcus garvieae, Lactococcus raffinolactis, Lactococcus lactis as well as other streptococci from dairy environments. Because of the high degree of inter-specific polymorphism observed, 16S-23S rDNA ISR can be considered a good potential target for selecting species-specific molecular assays, such as PCR primer or probes, for a rapid and extremely reliable differentiation of dairy lactococcal isolates.

  9. Phylogenetic position of the North American isolate of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, as inferred from 16S rDNA sequence analysis.

    Science.gov (United States)

    Atibalentja, N; Noel, G R; Domier, L L

    2000-03-01

    A 1341 bp sequence of the 16S rDNA of an undescribed species of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, was determined and then compared with a homologous sequence of Pasteuria ramosa, a parasite of cladoceran water fleas of the family Daphnidae. The two Pasteuria sequences, which diverged from each other by a dissimilarity index of 7%, also were compared with the 16S rDNA sequences of 30 other bacterial species to determine the phylogenetic position of the genus Pasteuria among the Gram-positive eubacteria. Phylogenetic analyses using maximum-likelihood, maximum-parsimony and neighbour-joining methods showed that the Heterodera glycines-infecting Pasteuria and its sister species, P. ramosa, form a distinct line of descent within the Alicyclobacillus group of the Bacillaceae. These results are consistent with the view that the genus Pasteuria is a deeply rooted member of the Clostridium-Bacillus-Streptococcus branch of the Gram-positive eubacteria, neither related to the actinomycetes nor closely related to true endospore-forming bacteria.

  10. Enterohemorrhagic Escherichia coli O157 in milk and dairy products from Libya: Isolation and molecular identification by partial sequencing of 16S rDNA

    Directory of Open Access Journals (Sweden)

    Aboubaker M. Garbaj

    2016-11-01

    Full Text Available Aim: The aim of this work was to isolate and molecularly identify enterohemorrhagic Escherichia coli (EHEC O157 in milk and dairy products in Libya, in addition; to clear the accuracy of cultural and biochemical identification as compared with molecular identification by partial sequencing of 16S rDNA for the existing isolates. Materials and Methods: A total of 108 samples of raw milk (cow, she-camel, and goat and locally made dairy products (fermented cow’s milk, Maasora, Ricotta and ice cream were collected from some regions (Janzour, Tripoli, Kremiya, Tajoura and Tobruk in Libya. Samples were subjected to microbiological analysis for isolation of E. coli that was detected by conventional cultural and molecular method using polymerase chain reaction and partial sequencing of 16S rDNA. Results: Out of 108 samples, only 27 isolates were found to be EHEC O157 based on their cultural characteristics (Tellurite-Cefixime-Sorbitol MacConkey that include 3 isolates from cow’s milk (11%, 3 isolates from she-camel’s milk (11%, two isolates from goat’s milk (7.4% and 7 isolates from fermented raw milk samples (26%, isolates from fresh locally made soft cheeses (Maasora and Ricotta were 9 (33% and 3 (11%, respectively, while none of the ice cream samples revealed any growth. However, out of these 27 isolates, only 11 were confirmed to be E. coli by partial sequencing of 16S rDNA and E. coli O157 Latex agglutination test. Phylogenetic analysis revealed that majority of local E. coli isolates were related to E. coli O157:H7 FRIK944 strain. Conclusion: These results can be used for further studies on EHEC O157 as an emerging foodborne pathogen and its role in human infection in Libya.

  11. Eukaryotic Plankton Species Diversity in the Western Channel of the Korea Strait using 18S rDNA Sequences and its Implications for Water Masses

    Science.gov (United States)

    Lee, Sang-Rae; Song, Eun Hye; Lee, Tongsup

    2018-03-01

    Organisms entering the East Sea (Sea of Japan) through the Korea Strait, together with water, salt, and energy, affect the East Sea ecosystem. In this study, we report on the biodiversity of eukaryotic plankton found in the Western Channel of the Korea Strait for the first time using small subunit ribosomal RNA gene (18S rDNA) sequences. We also discuss the characteristics of water masses and their physicochemical factors. Diverse taxonomic groups were recovered from 18S rDNA clone libraries, including putative novel, higher taxonomic entities affiliated with Cercozoa, Raphidophyceae, Picozoa, and novel marine Stramenopiles. We also found that there was cryptic genetic variation at both the intraspecific and interspecific levels among arthropods, diatoms, and green algae. Specific plankton assemblages were identified at different sampling depths and they may provide useful information that could be used to interpret the origin and the subsequent mixing history of the water masses that contribute to the Tsushima Warm Current waters. Furthermore, the biological information highlighted in this study may help improve our understanding about the complex water mass interactions that were highlighted in the Korea Strait.

  12. [Variability of nuclear 18S-25S rDNA of Gentiana lutea L. in nature and in tissue culture in vitro].

    Science.gov (United States)

    Mel'nyk, V M; Spiridonova, K V; Andrieiev, I O; Strashniuk, N M; Kunakh, V A

    2004-01-01

    18S-25S rDNA sequence in genomes of G. lutea plants from different natural populations and from tissue culture has been studied with blot-hybridization method. It was shown that ribosomal repeats are represented by the variants which differ for their size and for the presence of additional HindIII restriction site. Genome of individual plant usually possesses several variants of DNA repeats. Interpopulation variability according to their quantitative ratio and to the presence of some of them has been shown. Modifications of the range of rDNA repeats not exceeding intraspecific variability were observed in callus tissues in comparison with the plants of initial population. Non-randomness of genome modifications in the course of cell adaptation to in vitro conditions makes it possible to some extent to forecast these modifications in tissue culture.

  13. Study of endophytic Xylariaceae in Thailand: diversity and taxonomy inferred from rDNA sequence analyses with saprobes forming fruit bodies in the field

    DEFF Research Database (Denmark)

    Okane, Izumi; Srikitikulchai, Prasert; Toyama, Kyoko

    2008-01-01

    to reveal the diversity and taxonomy of endophytes and the relationships between those endophytes and saprobic Xylariaceae in Thailand that have been recorded according to fruit-body formation on decayed plant materials. Analysis of 28S rDNA D1/D2 sequences revealed 21 xylariaceous species inhabiting......A study of the diversity, taxonomy, and ecology of endophytic Xylariaceae (Ascomycota) was carried out. In this study, we obtained isolates of Xylariaceae from healthy, attached leaves and teleomorphic stromata on decayed plant materials in a permanent plot at Khao Yai National Park (Thailand......). In addition, strains deposited beforehand were selected in which both endophytic strains isolated from living plant tissues and saprobic strains from fruit bodies were included. Consequently, 405 strains of Xylariaceae (273 endophytic and 132 saprobic strains, including identified strains) were studied...

  14. Insights into the relationships of Palearctic and Nearctic lymnaeids (Mollusca : Gastropoda by rDNA ITS-2 sequencing and phylogeny of stagnicoline intermediate host species of Fasciola hepatica

    Directory of Open Access Journals (Sweden)

    Bargues M.D.

    2003-09-01

    Full Text Available Fascioliasis by Fasciola hepatica is the vector-borne disease presenting the widest latitudinal, longitudinal and altitudinal distribution known. F. hepatica shows a great adaptation power to new environmental conditions which is the consequence of its own capacities together with the adaptation and colonization abilities of its specific vector hosts, freshwater snails of the family Lymnaeidae. Several lymnaeid species only considered as secondary contributors to the liver fluke transmission have, however, played a very important role in the geographic expansion of this disease. Many of them belong to the so-called "stagnicoline" type group. Stagnicolines have, therefore, a very important applied interest in the Holarctic region, to which they are geographically restricted. The present knowledge on the genetics of stagnicolines and on their parasite-host interrelationships is, however, far from being sufficient. The present paper analyses the relationships between Palaearctic and Nearctic stagnicoline species on the base of the new light furnished by the results obtained in nuclear rDNA ITS-2 sequencing and corresponding phylogenetic studies of the lymnaeid taxa Lymnaea (Stagnicola occulta, L. (S. palustris palustris (topotype specimens and L.(S. p. turricula from Europe. Natural infections with F. hepatica have been reported in all of them. Surprisingly, ITS-2 length and G C content of L. occulta were similar and perfectly fitted within the respective ranges known in North American stagnicolines. Nucleotide differences and genetic distances were higher between L. occulta and the other European stagnicolines than between L. occulta and the North American ones. The ITS-2 sequence of L. p. turricula from Poland differed from the other genotypes known from turricula in Europe. The phylogenetic trees using the maximum-parsimony, distance and maximum-likelihood methods confirmed (i the inclusion of L. occulta in the branch of North American

  15. Analysis of bacterial flora associated with peri-implantitis using obligate anaerobic culture technique and 16S rDNA gene sequence.

    Science.gov (United States)

    Tamura, Naoki; Ochi, Morio; Miyakawa, Hiroshi; Nakazawa, Futoshi

    2013-01-01

    To analyze and characterize the predominant bacterial flora associated with peri-implantitis by using culture techniques under obligate anaerobic conditions and 16S rDNA gene sequences. Subgingival bacterial specimens were taken from 30 patients: control (n = 15), consisting of patients with only healthy implants; and test (n = 15), consisting of patients with peri-implantitis. In both groups, subgingival bacterial specimens were taken from the deepest sites. An anaerobic glove box system was used to cultivate bacterial strains. The bacterial strains were identified by 16S rDNA genebased polymerase chain reaction and comparison of the gene sequences. Peri-implantitis sites had approximately 10-fold higher mean colony forming units (per milliliter) than healthy implant sites. A total of 69 different bacterial species were identified in the peri-implantitis sites and 53 in the healthy implant sites. The predominant bacterial species in the peri-implantitis sites were Eubacterium nodatum, E. brachy, E. saphenum, Filifactor alocis, Slackia exigua, Parascardovia denticolens, Prevotella intermedia, Fusobacterium nucleatum, Porphyromonas gingivalis, Centipeda periodontii, and Parvimonas micra. The predominant bacteria in healthy implant sites apart from Streptococcus were Pseudoramibacter alactolyticus, Veillonella species, Actinomyces israelii, Actinomyces species, Propionibacterium acnes, and Parvimonas micra. These results suggest that the environment in the depths of the sulcus showing peri-implantitis is well suited for growth of obligate anaerobic bacteria. The present study demonstrated that the sulcus around oral implants with peri-implantitis harbors high levels of asaccharolytic anaerobic gram-positive rods (AAGPRs) such as E. nodatum, E. brachy, E. saphenum, Filifactor alocis, Slackia exigua, and gram-negative anaerobic rods, suggesting that conventional periodontopathic bacteria are not the only periodontal pathogens active in peri-implantitis, and that AAGPRs

  16. DGGE and 16S rDNA sequencing analysis of bacterial communities in colon content and feces of pigs fed whole crop rice.

    Science.gov (United States)

    Wang, Hai-Feng; Zhu, Wei-Yun; Yao, Wen; Liu, Jian-Xin

    2007-01-01

    The effect of feeding whole crop rice (WCR) to growing-finishing pigs at three levels 0 (Control), 10% and 20% on bacterial communities in colon content and feces was analyzed using 16S rDNA-based techniques. Amplicons of the V6-V8 variable regions of bacterial 16S rDNA were analyzed by denaturing gradient gel electrophoresis (DGGE), cloning and sequencing. The total number of DGGE bands and Shannon index of diversity for feces samples were higher in the pigs fed WCR-containing diets compared with the control, while a decrease trend was observed in these two parameters for colon content samples with the inclusion of WCR in the diets, although statistical differences were not significant. In general, the intestinal bacterial communities were prone to form the cluster for pig fed the same diet. Feeding of WCR induced the presence of special DGGE band with the sequence showing 99% similarity to that of Lactobacillus reuteri (DSM 20016T). The sequences of seven amplicons in total nine clones showed less than 97% similarity with those of previously identified or unidentified bacteria, suggesting that most bacteria in gastrointestinal tracts have not been cultured or identified. The results suggest that the diet containing WCR did not affect the major groups of bacteria, but stimulated the growth of L. reuteri-like species.

  17. Triploblastic relationships with emphasis on the acoelomates and the position of Gnathostomulida, Cycliophora, Plathelminthes, and Chaetognatha: a combined approach of 18S rDNA sequences and morphology.

    Science.gov (United States)

    Giribet, G; Distel, D L; Polz, M; Sterrer, W; Wheeler, W C

    2000-09-01

    Triploblastic relationships were examined in the light of molecular and morphological evidence. Representatives for all triploblastic "phyla" (except Loricifera) were represented by both sources of phylogenetic data. The 18S ribosomal (rDNA) sequence data for 145 terminal taxa and 276 morphological characters coded for 36 supraspecific taxa were combined in a total evidence regime to determine the most consistent picture of triploblastic relationships for these data. Only triploblastic taxa are used to avoid rooting with distant outgroups, which seems to happen because of the extreme distance that separates diploblastic from triploblastic taxa according to the 18S rDNA data. Multiple phylogenetic analyses performed with variable analysis parameters yield largely inconsistent results for certain groups such as Chaetognatha, Acoela, and Nemertodermatida. A normalized incongruence length metric is used to assay the relative merit of the multiple analyses. The combined analysis having the least character incongruence yields the following scheme of relationships of four main clades: (1) Deuterostomia [((Echinodermata + Enteropneusta) (Cephalochordata (Urochordata + Vertebrata)))]; (2) Ecdysozoa [(((Priapulida + Kinorhyncha) (Nematoda + Nematomorpha)) ((Onychophora + Tardigrada) Arthropoda))]; (3) Trochozoa [((Phoronida + Brachiopoda) (Entoprocta (Nemertea (Sipuncula (Mollusca (Pogonophora (Echiura + Annelida)))))))]; and (4) Platyzoa [((Gnathostomulida (Cycliophora + Syndermata)) (Gastrotricha + Plathelminthes))]. Chaetognatha, Nemertodermatida, and Bryozoa cannot be assigned to any one of these four groups. For the first time, a data analysis recognizes a clade of acoelomates, the Platyzoa (sensu Cavalier-Smith, Biol. Rev. 73:203-266, 1998). Other relationships that corroborate some morphological analyses are the existence of a clade that groups Gnathostomulida + Syndermata (= Gnathifera), which is expanded to include the enigmatic phylum Cycliophora, as sister group

  18. ON THE IDENTITY OF KARLODINIUM VENEFICUM AND DESCRIPTION OF KARLODINIUM ARMIGER SP. NOV. (DINOPHYCEAE), BASED ON LIGHT AND ELECTRON MICROSCOPY, NUCLEAR-ENCODED LSU RDNA, AND PIGMENT COMPOSITION

    DEFF Research Database (Denmark)

    Bergholtz, Trine; Daugbjerg, Niels; Moestrup, Øjvind

    2006-01-01

    An undescribed species of the dinoflagellate genus Karlodinium J. Larsen (viz. K. armiger sp. nov.) is described from Alfacs Bay (Spain), using light and electron microscopy, pigment composition, and partial large subunit (LSU) rDNA sequence. The new species differs from the type species of Karlo......An undescribed species of the dinoflagellate genus Karlodinium J. Larsen (viz. K. armiger sp. nov.) is described from Alfacs Bay (Spain), using light and electron microscopy, pigment composition, and partial large subunit (LSU) rDNA sequence. The new species differs from the type species...... of Karlodinium (K. micrum (Leadbeater et Dodge) J. Larsen) by lacking rows of amphiesmal plugs, a feature presently considered to be a characteristic of Karlodinium. In K. armiger, an outer membrane is underlain by a complex system of cisternae and vacuoles. The pigment profile of K. armiger revealed...... sequence, differed in only 0.3% of 1438 bp. We consider the two taxa to belong to the same species. This necessitates a change of name for the most widely found species, K. micrum, to K. veneficum. The three genera Karlodinium, Takayama, and Karenia constitute a separate evolutionary lineage, for which...

  19. Morphology and SSU rDNA sequence analysis of two hypotrichous ciliates (Protozoa, Ciliophora, Hypotrichia) including the new species Metaurostylopsis parastruederkypkeae n. sp.

    Science.gov (United States)

    Lu, Borong; Wang, Chundi; Huang, Jie; Shi, Yuhong; Chen, Xiangrui

    2016-10-01

    The morphology and phylogeny of two hypotrichous ciliates, Metaurostylopsis parastruederkypkeae n. sp. and Neourostylopsis flavicana (Wang et al., 2011) Chen et al., 2013 were investigated based on morphology, infraciliature and the small subunit (SSU) ribosomal RNA gene (rRNA) sequence. The new species, M. parastruederkypkeae n. sp. was identified according to its characteristics: body shape ellipsoidal, size about (165-200) × (45-60) μm in vivo, cell color reddish; two types of cortical granules including wheat grain-like and yellow-greenish larger ones along the marginal cirri rows and dorsal kineties and dot-like and reddish smaller ones, grouped around marginal cirri on ventral side and arranged in short lines on dorsal side; 26-41 adoral membranelles; three frontal and one parabuccal, five to seven frontoterminal, one buccal, and three to six transverse cirri; seven to thirteen midventral pairs; five to nine unpaired ventral cirri, five to seven left and three to five right marginal rows; and three complete dorsal kineties. Phylogenetic analysis based on SSU rDNA sequences showed that both Metaurostylopsis and Neourostylopsis are monophyletic. As the internal relationship between and within both genera are not clear, further studies on the species in these two genera are necessary. The key characteristics of all known twelve Metaurostylopsis-Apourostylopsis-Neourostylopsis species complex were updated.

  20. Protocols for 16S rDNA Array Analyses of Microbial Communities by Sequence-Specific Labeling of DNA Probes

    Directory of Open Access Journals (Sweden)

    Knut Rudi

    2003-01-01

    Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.

  1. Molecular phylogenetics of Floridosentis ward, 1953 (Acanthocephala: Neoechinorhynchidae) parasites of mullets (Osteichthyes) from Mexico, using 28S rDNA sequences.

    Science.gov (United States)

    Rosas-Valdez, Rogelio; Morrone, Juan J; García-Varela, Martín

    2012-08-01

    Species of Floridosentis (Acanthocephala) are common parasites of mullets (Mugil spp., Mugilidae) found in tropical marine and brackish water in the Americas. Floridosentis includes 2 species distributed in Mexico, i.e., Floridosentis pacifica, restricted to the Pacific Ocean near Salina Cruz, Oaxaca, and Floridosentis mugilis, distributed along the coast of the Pacific Ocean and the Gulf of Mexico. We sampled 18 populations of F. mugilis and F. pacifica (12 from the Pacific and 6 from the Gulf of Mexico) and sequenced a fragment of the rDNA large subunit to evaluate phylogenetic relationships of populations of Floridosentis spp. from Mexico. Species identification of museum specimens of F. mugilis from the Pacific Ocean was confirmed by examination of morphology traits. Phylogenetic trees inferred with maximum parsimony, maximum likelihood, and Bayesian inference indicate that Floridosentis is monophyletic comprising of 2 major well-supported clades, the first clade corresponding to F. mugilis from the Gulf of Mexico, and the second to F. pacifica from the Pacific Ocean. Genetic divergence between species ranged from 7.68 to 8.60%. Intraspecific divergence ranged from 0.14 to 0.86% for F. mugilis and from 1.72 to 4.49% for F. pacifica. Data obtained from diagnostic characters indicate that specimens from the Pacific Ocean in Mexico have differences in some traits among locations. These results are consistent with the phylogenetic hypothesis, indicating that F. pacifica is distributed in the Pacific Ocean in Mexico with 3 major lineages.

  2. Molecular characterization of Fasciola gigantica from Mauritania based on mitochondrial and nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Amor, Nabil; Farjallah, Sarra; Salem, Mohamed; Lamine, Dia Mamadou; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-10-01

    Fasciolosis caused by Fasciola hepatica and Fasciola gigantica (Platyhelminthes: Trematoda: Digenea) is considered the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. From Africa, F. gigantica has been previously characterized from Burkina Faso, Senegal, Kenya, Zambia and Mali, while F. hepatica has been reported from Morocco and Tunisia, and both species have been observed from Ethiopia and Egypt on the basis of morphometric differences, while the use of molecular markers is necessary to distinguish exactly between species. Samples identified morphologically as F. gigantica (n=60) from sheep and cattle from different geographical localities of Mauritania were genetically characterized by sequences of the first (ITS-1), the 5.8S, and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA) genes and the mitochondrial Cytochrome c Oxidase I (COI) gene. Comparison of the sequences of the Mauritanian samples with sequences of Fasciola spp. from GenBank confirmed that all samples belong to the species F. gigantica. The nucleotide sequencing of ITS rDNA of F. gigantica showed no nucleotide variation in the ITS-1, 5.8S, and ITS-2 rDNA sequences among all samples examined and those from Burkina Faso, Kenya, Egypt and Iran. The phylogenetic trees based on the ITS-1 and ITS-2 sequences showed a close relationship of the Mauritanian samples with isolates of F. gigantica from different localities of Africa and Asia. The COI genotypes of the Mauritanian specimens of F. gigantica had a high level of diversity, and they belonged to the F. gigantica phylogenically distinguishable clade. The present study is the first molecular characterization of F. gigantica in sheep and cattle from Mauritania, allowing a reliable approach for the genetic differentiation of Fasciola spp. and providing basis for further studies on liver flukes in the African countries. Copyright © 2011 Elsevier Inc. All

  3. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya

    Science.gov (United States)

    Azwai, S.M.; Alfallani, E.A.; Abolghait, S.K.; Garbaj, A.M.; Naas, H.T.; Moawad, A.A.; Gammoudi, F.T.; Rayes, H.M.; Barbieri, I.; Eldaghayes, I.M.

    2016-01-01

    The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×104 CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×104 CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products. PMID:27004169

  4. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya

    Directory of Open Access Journals (Sweden)

    S.M. Azwai

    2016-03-01

    Full Text Available The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk. Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6% yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS with culture characteristics of Vibrio spp. More than half (n=27 of processed seafood samples (n=46 yielded colonies on TCBS, while only 44.6% of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 х104 CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 х104 CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9% were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products.

  5. Isolation and molecular identification of Vibrio spp. by sequencing of 16S rDNA from seafood, meat and meat products in Libya.

    Science.gov (United States)

    Azwai, S M; Alfallani, E A; Abolghait, S K; Garbaj, A M; Naas, H T; Moawad, A A; Gammoudi, F T; Rayes, H M; Barbieri, I; Eldaghayes, I M

    2016-01-01

    The genus Vibrio includes several food-borne pathogens that cause a spectrum of clinical conditions including septicemia, cholera and milder forms of gastroenteritis. Several Vibrio spp. are commonly associated with food-borne transmission including Vibrio cholerae, Vibrio parahemolyticus, and Vibrio vulnificus. Microbiological analysis for enumeration and isolation of Vibrio spp. were carried out for a total of 93 samples of seafood, meat and meat products from different geographic localities in Libya (Tripoli, Regdalin, Janzour and Tobruk). Vibrio spp. were detected by conventional cultural and molecular method using PCR and sequencing of 16S rDNA. Out of the 93 cultured samples only 48 (51.6%) yielded colonies on Thiosulfate Citrate Bile Salt agar (TCBS) with culture characteristics of Vibrio spp. More than half (n=27) of processed seafood samples (n=46) yielded colonies on TCBS, while only 44.6 % of samples of meat and meat products showed colonies on TCBS. Among cultured seafood samples, the highest bacterial count was recorded in clam with a count of 3.8 ×10(4) CFU\\g. Chicken burger samples showed the highest bacterial count with 6.5 ×10(4) CFU\\g. Molecular analysis of the isolates obtained in this study, showed that 11 samples out of 48 (22.9%) were Vibrio spp. Vibrio parahemolyticus was isolated from camel meat for the first time. This study is an initial step to provide a baseline for future molecular research targeting Vibrio spp. foodborne illnesses. This data will be used to provide information on the magnitude of such pathogens in Libyan seafood, meat and meat products.

  6. Ultrastructure and large subunit rDNA sequences of Lepidodinium viride reveal a close relationship to Lepidodinium chlorophorum comb. nov. (=Gymnodinium chlorophorum)

    DEFF Research Database (Denmark)

    Hansen, Gert; Botes, L.; DeSalas, M.

    2007-01-01

    . The flagellar apparatus was essentially identical to Gymnodinium chlorophorum Elbrächter et Schnepf, a species also containing chloroplasts of chlorophyte origin. Of particular interest was the connection of the flagellar apparatus to the nuclear envelope by means of both a fiber and a microtubular extension...... dinoflagellates, including both the 'type' culture and a new Tasmanian isolate of G. chlorophorum. These two isolates had identical sequences and differed from L. viride by only 3.75% of their partial LSU sequences, considerably less than the difference between other Gymnodinium species. Therefore, based...

  7. Identifying the bacterial community on the surface of Intralox belting in a meat boning room by culture-dependent and culture-independent 16S rDNA sequence analysis.

    Science.gov (United States)

    Brightwell, Gale; Boerema, Jackie; Mills, John; Mowat, Eilidh; Pulford, David

    2006-05-25

    We examined the bacterial community present on an Intralox conveyor belt system in an operating lamb boning room by sequencing the 16S ribosomal DNA (rDNA) of bacteria extracted in the presence or absence of cultivation. RFLP patterns for 16S rDNA clone library and cultures were generated using HaeIII and MspI restriction endonucleases. 16S rDNA amplicons produced 8 distinct RFLP pattern groups. RFLP groups I-IV were represented in the clone library and RFLP groups I and V-VIII were represented amongst the cultured isolates. Partial DNA sequences from each RFLP group revealed that all group I, II and VIII representatives were Pseudomonas spp., group III were Sphingomonas spp., group IV clones were most similar to an uncultured alpha proteobacterium, group V was similar to a Serratia spp., group VI with an Alcaligenes spp., and group VII with Microbacterium spp. Sphingomonads were numerically dominant in the culture-independent clone library and along with the group IV alpha proteobacterium were not represented amongst the cultured isolates. Serratia, Alcaligenes and Microbacterium spp. were only represented with cultured isolates. Pseudomonads were detected by both culture-dependent (84% of isolates) and culture-independent (12.5% of clones) methods and their presence at high frequency does pose the risk of product spoilage if transferred onto meat stored under aerobic conditions. The detection of sphingomonads in large numbers by the culture-independent method demands further analysis because sphingomonads may represent a new source of meat spoilage that has not been previously recognised in the meat processing environment. The 16S rDNA collections generated by both methods were important at representing the diversity of the bacterial population associated with an Intralox conveyor belt system.

  8. Molecular profiling of microbial communities from contaminated sources: Use of subtractive cloning methods and rDNA spacer sequences. 1998 annual progress report

    International Nuclear Information System (INIS)

    Robb, F.T.

    1998-01-01

    'The major objective of the research is to provide appropriate sequences and to assemble a high-density DNA array of oligonucleotides that can be used for rapid profiling of microbial populations from polluted areas. The sequences to be assigned to the DNA array are chosen from from cloned genomic DNA sequences (the ribosomal operon, described below) from groundwater at DOE sites containing organic solvents. The sites, Hanford Nuclear Plant and Lawrence Livermore Site 300, have well characterized pollutant histories, which have been provided by the collaborators. At this mid-point of the project, over 60 unique sequence classes of intergenic spacer region have been identified from the first sample site. The use of these sequences as hybridization probes, and their frequency of occurrence, allow a clear distinction between bacterial communities before and after remediation by acetate/nitrate pumping. The authors have developed the hybridization conditions for identifying PCR products in a 96 well format, a versatile alignment and visualization program (acronym: MALIGN) developed by Dr. Dennis Maeder, has been used to align the ISRs, which are variable in length and sometimes in position of the tRNAs. Finally, in collaboration with Dr. W. Chen and Dr. J. Zhou at ORNL, they have significant evidence that mass spectrometer analysis can be used to determine the lengths of PCR amplified intergenic spacer DNA.'

  9. Third release of the plant rDNA database with updated content and information on telomere composition and sequenced plant genomes

    Czech Academy of Sciences Publication Activity Database

    Vitales, D.; D'Ambrosio, U.; Galvez, F.; Kovařík, Aleš; Garcia, S.

    2017-01-01

    Roč. 303, č. 8 (2017), s. 1115-1121 ISSN 0378-2697 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * ribosomal-rna genes * 5s rdna Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Genetics and heredity (medical genetics to be 3) Impact factor: 1.239, year: 2016

  10. Evolution of rDNA in Nicotiana Allopolyploids: A Potential Link between rDNA Homogenization and Epigenetics

    Science.gov (United States)

    Kovarik, Ales; Dadejova, Martina; Lim, Yoong K.; Chase, Mark W.; Clarkson, James J.; Knapp, Sandra; Leitch, Andrew R.

    2008-01-01

    Background The evolution and biology of rDNA have interested biologists for many years, in part, because of two intriguing processes: (1) nucleolar dominance and (2) sequence homogenization. We review patterns of evolution in rDNA in the angiosperm genus Nicotiana to determine consequences of allopolyploidy on these processes. Scope Allopolyploid species of Nicotiana are ideal for studying rDNA evolution because phylogenetic reconstruction of DNA sequences has revealed patterns of species divergence and their parents. From these studies we also know that polyploids formed over widely different timeframes (thousands to millions of years), enabling comparative and temporal studies of rDNA structure, activity and chromosomal distribution. In addition studies on synthetic polyploids enable the consequences of de novo polyploidy on rDNA activity to be determined. Conclusions We propose that rDNA epigenetic expression patterns established even in F1 hybrids have a material influence on the likely patterns of divergence of rDNA. It is the active rDNA units that are vulnerable to homogenization, which probably acts to reduce mutational load across the active array. Those rDNA units that are epigenetically silenced may be less vulnerable to sequence homogenization. Selection cannot act on these silenced genes, and they are likely to accumulate mutations and eventually be eliminated from the genome. It is likely that whole silenced arrays will be deleted in polyploids of 1 million years of age and older. PMID:18310159

  11. Mutations affecting RNA polymerase I-stimulated exchange and rDNA recombination in yeast

    International Nuclear Information System (INIS)

    Lin, Y.H.; Keil, R.L.

    1991-01-01

    HOT1 is a cis-acting recombination-stimulatory sequence isolated from the rDNA repeat unit of yeast. The ability of HOT1 to stimulate mitotic exchange appears to depend on its ability to promote high levels of RNA polymerase I transcription. A qualitative colony color sectoring assay was developed to screen for trans-acting mutations that alter the activity of HOT1. Both hypo-recombination and hyper-recombination mutants were isolated. Genetic analysis of seven HOT1 recombination mutants (hrm) that decrease HOT1 activity shows that they behave as recessive nuclear mutations and belong to five linkage groups. Three of these mutations, hrm1, hrm2, and hrm3, also decrease rDNA exchange but do not alter recombination in the absence of HOT1. Another mutation, hrm4, decreases HOT1-stimulated recombination but does not affect rDNA recombination or exchange in the absence of HOT1. Two new alleles of RAD52 were also isolated using this screen. With regard to HOT1 activity, rad52 is epistatic to all four hrm mutations indicating that the products of the HRM genes and of RAD52 mediate steps in the same recombination pathway. Finding mutations that decrease both the activity of HOT1 and exchange in the rDNA supports the hypothesis that HOT1 plays a role in rDNA recombination

  12. Reassignment of the land tortoise haemogregarine Haemogregarina fitzsimonsi Dias 1953 (Adeleorina: Haemogregarinidae) to the genus Hepatozoon Miller 1908 (Adeleorina: Hepatozoidae) based on parasite morphology, life cycle and phylogenetic analysis of 18S rDNA sequence fragments.

    Science.gov (United States)

    Cook, Courtney A; Lawton, Scott P; Davies, Angela J; Smit, Nico J

    2014-06-13

    SUMMARY Research was undertaken to clarify the true taxonomic position of the terrestrial tortoise apicomplexan, Haemogregarina fitzsimonsi (Dias, 1953). Thin blood films were screened from 275 wild and captive South African tortoises of 6 genera and 10 species between 2009-2011. Apicomplexan parasites within films were identified, with a focus on H. fitzsimonsi. Ticks from wild tortoises, especially Amblyomma sylvaticum and Amblyomma marmoreum were also screened, and sporogonic stages were identified on dissection of adult ticks of both species taken from H. fitzsimonsi infected and apparently non-infected tortoises. Parasite DNA was extracted from fixed, Giemsa-stained tortoise blood films and from both fresh and fixed ticks, and PCR was undertaken with two primer sets, HEMO1/HEMO2, and HepF300/HepR900, to amplify parasite 18S rDNA. Results indicated that apicomplexan DNA extracted from tortoise blood films and both species of tick had been amplified by one or both primer sets. Haemogregarina  fitzsimonsi 18S rDNA sequences from tortoise blood aligned with those of species of Hepatozoon, rather than those of species of Haemogregarina or Hemolivia. It is recommended therefore that this haemogregarine be re-assigned to the genus Hepatozoon, making Hepatozoon fitzsimonsi (Dias, 1953) the only Hepatozoon known currently from any terrestrial chelonian. Ticks are its likely vectors.

  13. Eigenimage filtering of nuclear medicine image sequences

    International Nuclear Information System (INIS)

    Windham, J.P.; Froelich, J.W.; Abd-Allah, M.

    1985-01-01

    In many nuclear medicine imaging sequences the localization of radioactivity in organs other than the target organ interferes with imaging of the desired anatomical structure or physiological process. A filtering technique has been developed which suppresses the interfering process while enhancing the desired process. This technique requires the identification of temporal sequential signatures for both the interfering and desired processes. These signatures are placed in the form of signature vectors. Signature matrices, M/sub D/ and M/sub U/, are formed by taking the outer product expansion of the temporal signature vectors for the desired and interfering processes respectively. By using the transformation from the simultaneous diagonalization of these two signature matrices a weighting vector is obtained. The technique is shown to maximize the projection of the desired process while minimizing the interfering process based upon an extension of Rayleigh's Principle. The technique is demonstrated for first pass renal and cardiac flow studies. This filter offers a potential for simplifying and extending the accuracy of diagnostic nuclear medicine procedures

  14. Regulation of rDNA stability by sumoylation

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2009-01-01

    Repair of DNA lesions by homologous recombination relies on the copying of genetic information from an intact homologous sequence. However, many eukaryotic genomes contain repetitive sequences such as the ribosomal gene locus (rDNA), which poses a risk for illegitimate recombination. Therefore, t......6 complex and sumoylation of Rad52, which directs DNA double-strand breaks in the rDNA to relocalize from within the nucleolus to the nucleoplasm before association with the recombination machinery. The relocalization before repair is important for maintaining rDNA stability. The focus...

  15. C-banding and fluorescent in situ hybridization with rDNA sequences in chromosomes of Cycloneda sanguinea Linnaeus (Coleoptera, Coccinellidae

    Directory of Open Access Journals (Sweden)

    Eliane Mariza Dortas Maffei

    2004-01-01

    Full Text Available The aim of this study was to describe mitotic and meiotic chromosomes of Cycloneda sanguinea using C-banding, fluorescent in situ hybridization (FISH rDNA probes, and sequential FISH/Ag-NOR staining. The chromosome number was 2n = 18 + XX for females and 2n = 18 + Xy for males. The X chromosome was metacentric and the Y chromosome was very small. During meiosis, the karyotypic meioformula was n = 9 + Xy p, and sex chromosomes configured a parachute at metaphase I. At the beginning of pachytene, bivalents were still individualized, and sex chromosomes were associated end-to-end through the heteropycnotic region of the X chromosome. Later in pachytene, further condensation led to the formation of a pseudo-ring by the sex bivalent. All chromosomes showed pericentromeric heterochromatin. FISH and sequential FISH/Ag-NOR staining evidenced the location of the nucleolar organizer region in one pair of autosomes (at spermatogonial metaphase. During meiosis, these genes were mapped to a region outside the sex vesicle by FISH, although Xy p was deeply stained with silver at metaphase I. These results suggest that these argyrophilic substances are of a nucleolar protein nature, and seem to be synthesized by a pair of autosomes and imported during meiosis (prophase I to the sex pair, during the association of the sex chromosomes.

  16. Relationships within the Proteobacteria of plant pathogenic Acidovorax species and subspecies, Burkholderia species, and Herbaspirillum rubrisubalbicans by sequence analysis of 16S rDNA, numerical analysis and determinative tests.

    Science.gov (United States)

    Hu, F P; Young, J M; Triggs, C M; Park, D C; Saul, D J

    2001-12-01

    Sequence data for 16S rDNA of the type strains of Acidovorax avenae subsp. avenae, A. avenae subsp. cattleyae, A. avenae subsp. citrulli, A. konjaci and Herbaspirillum rubrisubalbicans were compared with GenBank library accessions of Burkholderia spp., Comamonas sp., Ralstonia solanacearum and Variovorax sp. Maximum Parsimony analysis produced two clusters: 1. Acidovorax spp., Comamonas sp., and Variovorax sp. (all in the Comamonadaceae), and 2. Burkholderia spp., Ralstonia solanacearum, and Herbaspirillum rubrisubalbicans. Maximum Likelihood analysis produced only one cluster (of the Comamonadaceae). Using nutritional and laboratory tests, all Acidovorax spp., Burkholderia spp., and Herbaspirillum rubrisubalbicans were discriminated in distinct clusters at the species level, and could be identified by selected determinative tests. There were no phenotypic tests constituted as a circumscription of the genera and which permitted the allocation of strains to genera. Strain identification as species allowed allocation to genera only by inference. The nomenclatural implications of these data are discussed.

  17. Evaluation of haplotype diversity of Achatina fulica (Lissachatina) [Bowdich] from Indian sub-continent by means of 16S rDNA sequence and its phylogenetic relationships with other global populations.

    Science.gov (United States)

    Ayyagari, Vijaya Sai; Sreerama, Krupanidhi

    2017-08-01

    Achatina fulica (Lissachatina fulica) is one of the most invasive species found across the globe causing a significant damage to crops, vegetables, and horticultural plants. This terrestrial snail is native to east Africa and spread to different parts of the world by introductions. India, a hot spot for biodiversity of several endemic gastropods, has witnessed an outburst of this snail population in several parts of the country posing a serious threat to crop loss and also to human health. With an objective to evaluate the genetic diversity of this snail, we have sampled this snail from different parts of India and analyzed its haplotype diversity by means of 16S rDNA sequence information. Apart from this, we have studied the phylogenetic relationships of the isolates sequenced in the present study in relation with other global populations by Bayesian and Maximum-likelihood approaches. Of the isolates sequenced, haplotype 'C' is the predominant one. A new haplotype 'S' from the state of Odisha was observed. The isolates sequenced in the present study clustered with its conspecifics from the Indian sub-continent. Haplotype network analyses were also carried out for studying the evolution of different haplotypes. It was observed that haplotype 'S' was associated with a Mauritius haplotype 'H', indicating the possibility of multiple introductions of A. fulica to India.

  18. Isolamento e caracterização parcial de sequências homólogas a genes ribossomais (rDNA em Blastocladiella emersonii - DOI: 10.4025/actascibiolsci.v25i2.2037 Isolation and partial characterization of homologous sequences of ribosomal genes (rDNA in Blastocladiella emersonii

    Directory of Open Access Journals (Sweden)

    Luiz Carlos Correa

    2003-04-01

    Full Text Available A definição e a caracterização de regiões de origens de replicação nos eucariotos superiores são ainda controversas. A iniciação da replicação é sítio-específica em alguns sistemas e, em outros, parece estar contida em regiões extensas. Regiões rDNA são modelos atrativos para o estudo de origens de replicação pela sua organização in tandem, reduzindo a área de estudo para o espaço restrito que codifica uma unidade de transcrição. Neste trabalho nós isolamos e caracterizamos parcialmente um clone que contém uma sequência ribossomal do fungo aquático Blastocladiella emersonii, Be97M20. Southern blots mostraram diversos sítios para enzimas de restrição Eco RI, HindIII e SalI. Northern blot de RNA total hibridado contra uma sonda feita com Be97M20 confirmou a sua homologia com o gene ribossomal 18S. A caracterização detalhada, incluindo o mapeamento de restrição completo, subclonagem, sequenciamento e análise em géis bidimensionais proverão informações adicionais importantes sobre a estrutura e dinâmica desta regiãoThe definition and the characterization of replication origins regions in higher eukaryotes are still controversial. The initiation of the replication is site-specific in some systems but seems to occur in large regions in others. Because of its in tandem organization, reducing the area to the restricted space that codifies an unit of transcription, rDNA regions are attractive models to study replication origins. In this work we isolated and started to characterize a clone that contains a ribosomal sequence from the aquatic fungus B. emersonii, Be97M20. Southern blots showed several sites for the restrition enzymes Eco RI, HindIII and SalI. A northern blot of total RNA, hybridized against a probe made from Be97M20, confirmed its homology with the ribosomal 18S gene. The detailed characterization, including complete restriction map, subcloning, sequence and analysis on bidimensional gels will

  19. Identification of a third feline Demodex species through partial sequencing of the 16S rDNA and frequency of Demodex species in 74 cats using a PCR assay.

    Science.gov (United States)

    Ferreira, Diana; Sastre, Natalia; Ravera, Iván; Altet, Laura; Francino, Olga; Bardagí, Mar; Ferrer, Lluís

    2015-08-01

    Demodex cati and Demodex gatoi are considered the two Demodex species of cats. However, several reports have identified Demodex mites morphologically different from these two species. The differentiation of Demodex mites is usually based on morphology, but within the same species different morphologies can occur. DNA amplification/sequencing has been used effectively to identify and differentiate Demodex mites in humans, dogs and cats. The aim was to develop a PCR technique to identify feline Demodex mites and use this technique to investigate the frequency of Demodex in cats. Demodex cati, D. gatoi and Demodex mites classified morphologically as the third unnamed feline species were obtained. Hair samples were taken from 74 cats. DNA was extracted; a 330 bp fragment of the 16S rDNA was amplified and sequenced. The sequences of D. cati and D. gatoi shared >98% identity with those published on GenBank. The sequence of the third unnamed species showed 98% identity with a recently published feline Demodex sequence and only 75.2 and 70.9% identity with D. gatoi and D. cati sequences, respectively. Demodex DNA was detected in 19 of 74 cats tested; 11 DNA sequences corresponded to Demodex canis, five to Demodex folliculorum, three to D. cati and two to Demodex brevis. Three Demodex species can be found in cats, because the third unnamed Demodex species is likely to be a distinct species. Apart from D. cati and D. gatoi, DNA from D. canis, D. folliculorum and D. brevis was found on feline skin. © 2015 ESVD and ACVD.

  20. Chromosomal distribution of pTa-535, pTa-86, pTa-713, 35S rDNA repetitive sequences in interspecific hexaploid hybrids of common wheat (Triticum aestivum L.) and spelt (Triticum spelta L.).

    Science.gov (United States)

    Goriewa-Duba, Klaudia; Duba, Adrian; Kwiatek, Michał; Wiśniewska, Halina; Wachowska, Urszula; Wiwart, Marian

    2018-01-01

    Fluorescent in situ hybridization (FISH) relies on fluorescent-labeled probes to detect specific DNA sequences in the genome, and it is widely used in cytogenetic analyses. The aim of this study was to determine the karyotype of T. aestivum and T. spelta hybrids and their parental components (three common wheat cultivars and five spelt breeding lines), to identify chromosomal aberrations in the evaluated wheat lines, and to analyze the distribution of polymorphisms of repetitive sequences in the examined hybrids. The FISH procedure was carried out with four DNA clones, pTa-86, pTa-535, pTa-713 and 35S rDNA used as probes. The observed polymorphisms between the investigated lines of common wheat, spelt and their hybrids was relatively low. However, differences were observed in the distribution of repetitive sequences on chromosomes 4A, 6A, 1B and 6B in selected hybrid genomes. The polymorphisms observed in common wheat and spelt hybrids carry valuable information for wheat breeders. The results of our study are also a valuable source of knowledge about genome organization and diversification in common wheat, spelt and their hybrids. The relevant information is essential for common wheat breeders, and it can contribute to breeding programs aimed at biodiversity preservation.

  1. Chromosomal distribution of pTa-535, pTa-86, pTa-713, 35S rDNA repetitive sequences in interspecific hexaploid hybrids of common wheat (Triticum aestivum L. and spelt (Triticum spelta L..

    Directory of Open Access Journals (Sweden)

    Klaudia Goriewa-Duba

    Full Text Available Fluorescent in situ hybridization (FISH relies on fluorescent-labeled probes to detect specific DNA sequences in the genome, and it is widely used in cytogenetic analyses. The aim of this study was to determine the karyotype of T. aestivum and T. spelta hybrids and their parental components (three common wheat cultivars and five spelt breeding lines, to identify chromosomal aberrations in the evaluated wheat lines, and to analyze the distribution of polymorphisms of repetitive sequences in the examined hybrids. The FISH procedure was carried out with four DNA clones, pTa-86, pTa-535, pTa-713 and 35S rDNA used as probes. The observed polymorphisms between the investigated lines of common wheat, spelt and their hybrids was relatively low. However, differences were observed in the distribution of repetitive sequences on chromosomes 4A, 6A, 1B and 6B in selected hybrid genomes. The polymorphisms observed in common wheat and spelt hybrids carry valuable information for wheat breeders. The results of our study are also a valuable source of knowledge about genome organization and diversification in common wheat, spelt and their hybrids. The relevant information is essential for common wheat breeders, and it can contribute to breeding programs aimed at biodiversity preservation.

  2. Comparative sequence analyses on the 16S rRNA (rDNA) of Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus and proposal for creation of a new genus, Alicyclobacillus gen. nov

    Science.gov (United States)

    Wisotzkey, J. D.; Jurtshuk, P. Jr; Fox, G. E.; Deinhard, G.; Poralla, K.

    1992-01-01

    Comparative 16S rRNA (rDNA) sequence analyses performed on the thermophilic Bacillus species Bacillus acidocaldarius, Bacillus acidoterrestris, and Bacillus cycloheptanicus revealed that these organisms are sufficiently different from the traditional Bacillus species to warrant reclassification in a new genus, Alicyclobacillus gen. nov. An analysis of 16S rRNA sequences established that these three thermoacidophiles cluster in a group that differs markedly from both the obligately thermophilic organisms Bacillus stearothermophilus and the facultatively thermophilic organism Bacillus coagulans, as well as many other common mesophilic and thermophilic Bacillus species. The thermoacidophilic Bacillus species B. acidocaldarius, B. acidoterrestris, and B. cycloheptanicus also are unique in that they possess omega-alicylic fatty acid as the major natural membranous lipid component, which is a rare phenotype that has not been found in any other Bacillus species characterized to date. This phenotype, along with the 16S rRNA sequence data, suggests that these thermoacidophiles are biochemically and genetically unique and supports the proposal that they should be reclassified in the new genus Alicyclobacillus.

  3. High and uneven levels of 45S rDNA site-number variation across wild populations of a diploid plant genus (Anacyclus, Asteraceae).

    Science.gov (United States)

    Rosato, Marcela; Álvarez, Inés; Nieto Feliner, Gonzalo; Rosselló, Josep A

    2017-01-01

    The nuclear genome harbours hundreds to several thousand copies of ribosomal DNA. Despite their essential role in cellular ribogenesis few studies have addressed intrapopulation, interpopulation and interspecific levels of rDNA variability in wild plants. Some studies have assessed the extent of rDNA variation at the sequence and copy-number level with large sampling in several species. However, comparable studies on rDNA site number variation in plants, assessed with extensive hierarchical sampling at several levels (individuals, populations, species) are lacking. In exploring the possible causes for ribosomal loci dynamism, we have used the diploid genus Anacyclus (Asteraceae) as a suitable system to examine the evolution of ribosomal loci. To this end, the number and chromosomal position of 45S rDNA sites have been determined in 196 individuals from 47 populations in all Anacyclus species using FISH. The 45S rDNA site-number has been assessed in a significant sample of seed plants, which usually exhibit rather consistent features, except for polyploid plants. In contrast, the level of rDNA site-number variation detected in Anacyclus is outstanding in the context of angiosperms particularly regarding populations of the same species. The number of 45S rDNA sites ranged from four to 11, accounting for 14 karyological ribosomal phenotypes. Our results are not even across species and geographical areas, and show that there is no clear association between the number of 45S rDNA loci and the life cycle in Anacyclus. A single rDNA phenotype was detected in several species, but a more complex pattern that included intra-specific and intra-population polymorphisms was recorded in A. homogamos, A. clavatus and A. valentinus, three weedy species showing large and overlapping distribution ranges. It is likely that part of the cytogenetic changes and inferred dynamism found in these species have been triggered by genomic rearrangements resulting from contemporary

  4. Novel genomes and genome constitutions identified by GISH and 5S rDNA and knotted1 genomic sequences in the genus Setaria.

    Science.gov (United States)

    Zhao, Meicheng; Zhi, Hui; Doust, Andrew N; Li, Wei; Wang, Yongfang; Li, Haiquan; Jia, Guanqing; Wang, Yongqiang; Zhang, Ning; Diao, Xianmin

    2013-04-11

    The Setaria genus is increasingly of interest to researchers, as its two species, S. viridis and S. italica, are being developed as models for understanding C4 photosynthesis and plant functional genomics. The genome constitution of Setaria species has been studied in the diploid species S. viridis, S. adhaerans and S. grisebachii, where three genomes A, B and C were identified respectively. Two allotetraploid species, S. verticillata and S. faberi, were found to have AABB genomes, and one autotetraploid species, S. queenslandica, with an AAAA genome, has also been identified. The genomes and genome constitutions of most other species remain unknown, even though it was thought there are approximately 125 species in the genus distributed world-wide. GISH was performed to detect the genome constitutions of Eurasia species of S. glauca, S. plicata, and S. arenaria, with the known A, B and C genomes as probes. No or very poor hybridization signal was detected indicating that their genomes are different from those already described. GISH was also performed reciprocally between S. glauca, S. plicata, and S. arenaria genomes, but no hybridization signals between each other were found. The two sets of chromosomes of S. lachnea both hybridized strong signals with only the known C genome of S. grisebachii. Chromosomes of Qing 9, an accession formerly considered as S. viridis, hybridized strong signal only to B genome of S. adherans. Phylogenetic trees constructed with 5S rDNA and knotted1 markers, clearly classify the samples in this study into six clusters, matching the GISH results, and suggesting that the F genome of S. arenaria is basal in the genus. Three novel genomes in the Setaria genus were identified and designated as genome D (S. glauca), E (S. plicata) and F (S. arenaria) respectively. The genome constitution of tetraploid S. lachnea is putatively CCC'C'. Qing 9 is a B genome species indigenous to China and is hypothesized to be a newly identified species. The

  5. Intragenomic sequence variation at the ITS1 - ITS2 region and at the 18S and 28S nuclear ribosomal DNA genes of the New Zealand mud snail, Potamopyrgus antipodarum (Hydrobiidae: mollusca)

    Science.gov (United States)

    Hoy, Marshal S.; Rodriguez, Rusty J.

    2013-01-01

    Molecular genetic analysis was conducted on two populations of the invasive non-native New Zealand mud snail (Potamopyrgus antipodarum), one from a freshwater ecosystem in Devil's Lake (Oregon, USA) and the other from an ecosystem of higher salinity in the Columbia River estuary (Hammond Harbor, Oregon, USA). To elucidate potential genetic differences between the two populations, three segments of nuclear ribosomal DNA (rDNA), the ITS1-ITS2 regions and the 18S and 28S rDNA genes were cloned and sequenced. Variant sequences within each individual were found in all three rDNA segments. Folding models were utilized for secondary structure analysis and results indicated that there were many sequences which contained structure-altering polymorphisms, which suggests they could be nonfunctional pseudogenes. In addition, analysis of molecular variance (AMOVA) was used for hierarchical analysis of genetic variance to estimate variation within and among populations and within individuals. AMOVA revealed significant variation in the ITS region between the populations and among clones within individuals, while in the 5.8S rDNA significant variation was revealed among individuals within the two populations. High levels of intragenomic variation were found in the ITS regions, which are known to be highly variable in many organisms. More interestingly, intragenomic variation was also found in the 18S and 28S rDNA, which has rarely been observed in animals and is so far unreported in Mollusca. We postulate that in these P. antipodarum populations the effects of concerted evolution are diminished due to the fact that not all of the rDNA genes in their polyploid genome should be essential for sustaining cellular function. This could lead to a lessening of selection pressures, allowing mutations to accumulate in some copies, changing them into variant sequences.                   

  6. Is ITS-2 rDNA suitable marker for genetic characterization of Sarcoptes mites from different wild animals in different geographic areas?

    Science.gov (United States)

    Alasaad, S; Soglia, D; Spalenza, V; Maione, S; Soriguer, R C; Pérez, J M; Rasero, R; Degiorgis, M P Ryser; Nimmervoll, H; Zhu, X Q; Rossi, L

    2009-02-05

    The present study examined the relationship among individual Sarcoptes scabiei mites from 13 wild mammalian populations belonging to nine species in four European countries using the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) as genetic marker. The ITS-2 plus primer flanking 5.8S and 28S rDNA (ITS-2+) was amplified from individual mites by polymerase chain reaction (PCR) and the amplicons were sequenced directly. A total of 148 ITS-2+ sequences of 404bp in length were obtained and 67 variable sites were identified (16.59%). UPGMA analyses did not show any geographical or host-specific clustering, and a similar outcome was obtained using population pairwise Fst statistics. These results demonstrated that ITS-2 rDNA does not appear to be suitable for examining genetic diversity among mite populations.

  7. Fungal Diversity in Field Mold-Damaged Soybean Fruits and Pathogenicity Identification Based on High-Throughput rDNA Sequencing

    Directory of Open Access Journals (Sweden)

    Jiang Liu

    2017-05-01

    Full Text Available Continuous rain and an abnormally wet climate during harvest can easily lead to soybean plants being damaged by field mold (FM, which can reduce seed yield and quality. However, to date, the underlying pathogen and its resistance mechanism have remained unclear. The objective of the present study was to investigate the fungal diversity of various soybean varieties and to identify and confirm the FM pathogenic fungi. A total of 62,382 fungal ITS1 sequences clustered into 164 operational taxonomic units (OTUs with 97% sequence similarity; 69 taxa were recovered from the samples by internal transcribed spacer (ITS region sequencing. The fungal community compositions differed among the tested soybeans, with 42 OTUs being amplified from all varieties. The quadratic relationships between fungal diversity and organ-specific mildew indexes were analyzed, confirming that mildew on soybean pods can mitigate FM damage to the seeds. In addition, four potentially pathogenic fungi were isolated from FM-damaged soybean fruits; morphological and molecular identification confirmed these fungi as Aspergillus flavus, A. niger, Fusarium moniliforme, and Penicillium chrysogenum. Further re-inoculation experiments demonstrated that F. moniliforme is dominant among these FM pathogenic fungi. These results lay the foundation for future studies on mitigating or preventing FM damage to soybean.

  8. Evaluation of Direct 16S rDNA Sequencing as a Metagenomics-based Approach to Screening Bacteria in Bottled Water

    DEFF Research Database (Denmark)

    Hansen, Trine; Skånseng, Beate; Hoorfar, Jeffrey

    2013-01-01

    Deliberate or accidental contamination of food, feed, and water supplies poses a threat to human health worldwide. A rapid and sensitive detection technique that could replace the current labor-intensive and time-consuming culture-based methods is highly desirable. In addition to species...... 2 B. cereus strains by the principal component plot, despite the close sequence resemblance. A linear correlation between the artificial contamination level and the relative amount of the Bacillus artificial contaminant in the metagenome was observed, and a relative amount value above 0.5 confirmed...

  9. Identification of Giardia species and Giardia duodenalis assemblages by sequence analysis of the 5.8S rDNA gene and internal transcribed spacers.

    Science.gov (United States)

    Cacciò, Simone M; Beck, Relja; Almeida, Andre; Bajer, Anna; Pozio, Edoardo

    2010-05-01

    PCR assays have been developed mainly to assist investigations into the epidemiology of Giardia duodenalis, the only species in the Giardia genus having zoonotic potential. However, a reliable identification of all species is of practical importance, particularly when water samples and samples from wild animals are investigated. The aim of the present work was to genotype Giardia species and G. duodenalis assemblages using as a target the region spanning the 5.8S gene and the 2 flanking internal transcribed spacers (ITS1 and ITS2) of the ribosomal gene. Primers were designed to match strongly conserved regions in the 3' end of the small subunit and in the 5' end of the large subunit ribosomal genes. The corresponding region (about 310 bp) was amplified from 49 isolates of both human and animal origin, representing all G. duodenalis assemblages as well as G. muris and G. microti. Sequence comparison and phylogenetic analysis showed that G. ardeae, G. muris, G. microti as well as the 7 G. duodenalis assemblages can be easily distinguished. Since the major subgroups within the zoonotic assemblages A and B can be identified by sequence analysis, this assay is also informative for molecular epidemiological studies.

  10. Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region

    KAUST Repository

    Arif, Chatchanit; Daniels, Camille; Bayer, Till; Banguera Hinestroza, Eulalia; Barbrook, Adrian; Howe, Christopher J.; LaJeunesse, Todd C.; Voolstra, Christian R.

    2014-01-01

    The persistence of coral reef ecosystems relies on the symbiotic relationship between scleractinian corals and intracellular, photosynthetic dinoflagellates in the genus Symbiodinium. Genetic evidence indicates that these symbionts are biologically diverse and exhibit discrete patterns of environmental and host distribution. This makes the assessment of Symbiodinium diversity critical to understanding the symbiosis ecology of corals. Here, we applied pyrosequencing to the elucidation of Symbiodinium diversity via analysis of the internal transcribed spacer 2 (ITS2) region, a multicopy genetic marker commonly used to analyse Symbiodinium diversity. Replicated data generated from isoclonal Symbiodinium cultures showed that all genomes contained numerous, yet mostly rare, ITS2 sequence variants. Pyrosequencing data were consistent with more traditional denaturing gradient gel electrophoresis (DGGE) approaches to the screening of ITS2 PCR amplifications, where the most common sequences appeared as the most intense bands. Further, we developed an operational taxonomic unit (OTU)-based pipeline for Symbiodinium ITS2 diversity typing to provisionally resolve ecologically discrete entities from intragenomic variation. A genetic distance cut-off of 0.03 collapsed intragenomic ITS2 variants of isoclonal cultures into single OTUs. When applied to the analysis of field-collected coral samples, our analyses confirm that much of the commonly observed Symbiodinium ITS2 diversity can be attributed to intragenomic variation. We conclude that by analysing Symbiodinium populations in an OTU-based framework, we can improve objectivity, comparability and simplicity when assessing ITS2 diversity in field-based studies.

  11. Assessing Symbiodinium diversity in scleractinian corals via next-generation sequencing-based genotyping of the ITS2 rDNA region

    KAUST Repository

    Arif, Chatchanit

    2014-09-01

    The persistence of coral reef ecosystems relies on the symbiotic relationship between scleractinian corals and intracellular, photosynthetic dinoflagellates in the genus Symbiodinium. Genetic evidence indicates that these symbionts are biologically diverse and exhibit discrete patterns of environmental and host distribution. This makes the assessment of Symbiodinium diversity critical to understanding the symbiosis ecology of corals. Here, we applied pyrosequencing to the elucidation of Symbiodinium diversity via analysis of the internal transcribed spacer 2 (ITS2) region, a multicopy genetic marker commonly used to analyse Symbiodinium diversity. Replicated data generated from isoclonal Symbiodinium cultures showed that all genomes contained numerous, yet mostly rare, ITS2 sequence variants. Pyrosequencing data were consistent with more traditional denaturing gradient gel electrophoresis (DGGE) approaches to the screening of ITS2 PCR amplifications, where the most common sequences appeared as the most intense bands. Further, we developed an operational taxonomic unit (OTU)-based pipeline for Symbiodinium ITS2 diversity typing to provisionally resolve ecologically discrete entities from intragenomic variation. A genetic distance cut-off of 0.03 collapsed intragenomic ITS2 variants of isoclonal cultures into single OTUs. When applied to the analysis of field-collected coral samples, our analyses confirm that much of the commonly observed Symbiodinium ITS2 diversity can be attributed to intragenomic variation. We conclude that by analysing Symbiodinium populations in an OTU-based framework, we can improve objectivity, comparability and simplicity when assessing ITS2 diversity in field-based studies.

  12. Sequencing Closterium moniliferum: Future prospects in nuclear ...

    African Journals Online (AJOL)

    Akanksha Pandey

    2012-10-06

    Oct 6, 2012 ... Abstract Genome sequencing can play a vital role in health and several other domains such as in .... ter have imposed some serious questions over the security is- ... strontium and barium from aqueous environment and store.

  13. A two-locus DNA sequence database for typing plant and human pathogens within the Fusarium oxysporum species complex

    DEFF Research Database (Denmark)

    O'Donnell, Kerry; Gueidan, C; Sink, S

    2009-01-01

    We constructed a two-locus database, comprising partial translation elongation factor (EF-1alpha) gene sequences and nearly full-length sequences of the nuclear ribosomal intergenic spacer region (IGS rDNA) for 850 isolates spanning the phylogenetic breadth of the Fusarium oxysporum species compl...... of the IGS rDNA sequences may be non-orthologous. We also evaluated enniatin, fumonisin and moniliformin mycotoxin production in vitro within a phylogenetic framework....

  14. [Sequence of the ITS region of nuclear ribosomal DNA(nrDNA) in Xinjiang wild Dianthus and its phylogenetic relationship].

    Science.gov (United States)

    Zhang, Lu; Cai, You-Ming; Zhuge, Qiang; Zou, Hui-Yu; Huang, Min-Ren

    2002-06-01

    Xinjiang is a center of distribution and differentiation of genus Dianthus in China, and has a great deal of species resources. The sequences of ITS region (including ITS-1, 5.8S rDNA and ITS-2) of nuclear ribosomal DNA from 8 species of genus Dianthus wildly distributed in Xinjiang were determined by direct sequencing of PCR products. The result showed that the size of the ITS of Dianthus is from 617 to 621 bp, and the length variation is only 4 bp. There are very high homogeneous (97.6%-99.8%) sequences between species, and about 80% homogeneous sequences between genus Dianthus and outgroup. The sequences of ITS in genus Dianthus are relatively conservative. In general, there are more conversion than transition in the variation sites among genus Dianthus. The conversion rates are relatively high, and the ratios of conversion/transition are 1.0-3.0. On the basis of phylogenetic analysis of nucleotide sequences the species of Dianthus in China would be divided into three sections. There is a distant relationship between sect. Barbulatum Williams and sect. Dianthus and between sect. Barbulatum Williams and sect. Fimbriatum Williams, and there is a close relationship between sect. Dianthus and sect. Fimbriatum Williams. From the phylogenetic tree of ITS it was found that the origin of sect. Dianthusis is earlier than that of sect. Fimbriatum Williams and sect. Barbulatum Williams.

  15. Identificarion of contaminant bacteria in cachaça yeast by 16s rDNA gene sequencing Identificação de bactérias contaminantes de fermento de cachaça por seqüenciamento do gene 16s rDNA

    Directory of Open Access Journals (Sweden)

    Osmar Vaz de Carvalho-Netto

    2008-01-01

    Full Text Available Cachaça is a typical Brazilian liquor produced from the distillation of fermented sugarcane juice mainly by Saccharomyces cerevisiae. Most of the domestic production is artisanal, and producers usually are not concerned regarding microbiological control of the fermentation. This study aimed to characterize the contaminant bacterial community of the yeast used in the production of cachaça in an artisanal still. Four samples were collected, of which one (NA was used for comparison purposes and was collected one year earlier. The remaining samples were collected at three different periods: at the end of the first day of fermentation (NP, after fifteen days (NS, and thirty days after the same yeast was used (NT. Five hundred and eighty-seven sequences were analyzed from the partial sequencing of the 16S rDNA gene. Sequence analyses revealed the presence of 170 operational taxonomic units (OTUs. Of these, only one was shared among three samples and seventeen were shared between two samples. The remaining 152 OTUs were identified only once in distinct samples indicating that the contaminant bacterial population is highly dynamic along the fermentation process. Statistical analyses revealed differences in bacterial composition among samples. Undescribed species in the literature on yeasts of cachaça were found, such as Weissella cibaria, Leuconostoc citreum, and some species of Lactobacillus, in addition to some unknown bacteria. The community of bacteria in the fermentation process is much more complex than it was previously considered. No previous report is known regarding the use of this technique to determine bacterial contaminants in yeast for the production of cachaça.A cachaça é uma bebida típica brasileira produzida a partir da destilação do caldo de cana-de-açúcar fermentado principalmente por Saccharomyces cerevisiae. Grande parte da produção nacional é artesanal, e não há uma preocupação por parte dos produtores quanto ao

  16. (Brassicaceae) based on nuclear ribosomal ITS DNA sequences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 2. Phylogeny and biogeography of Alyssum (Brassicaceae) based on nuclear ribosomal ITS DNA sequences. Yan Li Yan Kong Zhe Zhang Yanqiang Yin Bin Liu Guanghui Lv Xiyong Wang. Research Article Volume 93 Issue 2 August 2014 pp 313-323 ...

  17. Nuclear RNA sequencing of the mouse erythroid cell transcriptome.

    Directory of Open Access Journals (Sweden)

    Jennifer A Mitchell

    Full Text Available In addition to protein coding genes a substantial proportion of mammalian genomes are transcribed. However, most transcriptome studies investigate steady-state mRNA levels, ignoring a considerable fraction of the transcribed genome. In addition, steady-state mRNA levels are influenced by both transcriptional and posttranscriptional mechanisms, and thus do not provide a clear picture of transcriptional output. Here, using deep sequencing of nuclear RNAs (nucRNA-Seq in parallel with chromatin immunoprecipitation sequencing (ChIP-Seq of active RNA polymerase II, we compared the nuclear transcriptome of mouse anemic spleen erythroid cells with polymerase occupancy on a genome-wide scale. We demonstrate that unspliced transcripts quantified by nucRNA-seq correlate with primary transcript frequencies measured by RNA FISH, but differ from steady-state mRNA levels measured by poly(A-enriched RNA-seq. Highly expressed protein coding genes showed good correlation between RNAPII occupancy and transcriptional output; however, genome-wide we observed a poor correlation between transcriptional output and RNAPII association. This poor correlation is due to intergenic regions associated with RNAPII which correspond with transcription factor bound regulatory regions and a group of stable, nuclear-retained long non-coding transcripts. In conclusion, sequencing the nuclear transcriptome provides an opportunity to investigate the transcriptional landscape in a given cell type through quantification of unspliced primary transcripts and the identification of nuclear-retained long non-coding RNAs.

  18. Accident sequences simulated at the Juragua nuclear power plant

    International Nuclear Information System (INIS)

    Carbajo, J.J.

    1998-01-01

    Different hypothetical accident sequences have been simulated at Unit 1 of the Juragua nuclear power plant in Cuba, a plant with two VVER-440 V213 units under construction. The computer code MELCOR was employed for these simulations. The sequences simulated are: (1) a design-basis accident (DBA) large loss of coolant accident (LOCA) with the emergency core coolant system (ECCS) on, (2) a station blackout (SBO), (3) a small LOCA (SLOCA) concurrent with SBO, (4) a large LOCA (LLOCA) concurrent with SBO, and (5) a LLOCA concurrent with SBO and with the containment breached at time zero. Timings of important events and source term releases have been calculated for the different sequences analyzed. Under certain weather conditions, the fission products released from the severe accident sequences may travel to southern Florida

  19. Fragile sites, dysfunctional telomere and chromosome fusions: What is 5S rDNA role?

    Science.gov (United States)

    Barros, Alain Victor; Wolski, Michele Andressa Vier; Nogaroto, Viviane; Almeida, Mara Cristina; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo

    2017-04-15

    Repetitive DNA regions are known as fragile chromosomal sites which present a high flexibility and low stability. Our focus was characterize fragile sites in 5S rDNA regions. The Ancistrus sp. species shows a diploid number of 50 and an indicative Robertsonian fusion at chromosomal pair 1. Two sequences of 5S rDNA were identified: 5S.1 rDNA and 5S.2 rDNA. The first sequence gathers the necessary structures to gene expression and shows a functional secondary structure prediction. Otherwise, the 5S.2 rDNA sequence does not contain the upstream sequences that are required to expression, furthermore its structure prediction reveals a nonfunctional ribosomal RNA. The chromosomal mapping revealed several 5S.1 and 5S.2 rDNA clusters. In addition, the 5S.2 rDNA clusters were found in acrocentric and metacentric chromosomes proximal regions. The pair 1 5S.2 rDNA cluster is co-located with interstitial telomeric sites (ITS). Our results indicate that its clusters are hotspots to chromosomal breaks. During the meiotic prophase bouquet arrangement, double strand breaks (DSBs) at proximal 5S.2 rDNA of acrocentric chromosomes could lead to homologous and non-homologous repair mechanisms as Robertsonian fusions. Still, ITS sites provides chromosomal instability, resulting in telomeric recombination via TRF2 shelterin protein and a series of breakage-fusion-bridge cycles. Our proposal is that 5S rDNA derived sequences, act as chromosomal fragile sites in association with some chromosomal rearrangements of Loricariidae. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Complex group-I introns in nuclear SSU rDNA of red and green algae: evidence of homing-endonuclease pseudogenes in the Bangiophyceae

    DEFF Research Database (Denmark)

    Haugen, P; Huss, V A; Nielsen, Henrik

    1999-01-01

    on the complementary strand. A comparison between related group-I introns in the Bangiophyceae revealed homing-endonuclease-like pseudogenes due to frame-shifts and deletions in Porphyra and Bangia. The Scenedesmus and Porphyra introns provide new insights into the evolution and possible novel functions of nuclear...

  1. Severe accident sequences simulated at the Grand Gulf Nuclear Station

    International Nuclear Information System (INIS)

    Carbajo, J.J.

    1999-01-01

    Different severe accident sequences employing the MELCOR code, version 1.8.4 QK, have been simulated at the Grand Gulf Nuclear Station (Grand Gulf). The postulated severe accidents simulated are two low-pressure, short-term, station blackouts; two unmitigated small-break (SB) loss-of-coolant accidents (LOCAs) (SBLOCAs); and one unmitigated large LOCA (LLOCA). The purpose of this study was to calculate best-estimate timings of events and source terms for a wide range of severe accidents and to compare the plant response to these accidents

  2. Molecular phylogeny and radiation time of erysiphales inferred from the nuclear ribosomal DNA sequences

    International Nuclear Information System (INIS)

    Mori, Y.; Sato, Y.; Takamatsu, S.

    2000-01-01

    Phylogenetic relationships of Erysiphales within Ascomycota were inferred from the newly determined sequences of the 18S rDNA and partial sequences of the 28S rDNA including the D1 and D2 regions of 10 Erysiphales taxa. Phylogenetic analyses revealed that the Erysiphales form a distinct clade among ascomycetous fungi suggesting that the Erysiphales diverged from a single ancestral taxon. The Myxotrichaceae of the Onygenales was distantly related to the other onygenalean families and was the sister group to the Erysiphales calde, with which it combined to form a clade. The Erysiphales/Myxotrichaceae clade was also closely related to some discomycetous fungi (Leotiales, Cyttariales and Thelebolaceae) including taxa that form cleistothecial ascomata. The present molecular analyses as well as previously reported morphological observations suggest the possible existence of a novel evolutionary pathway from cleistothecial discomycetous fungi to Erysiphales and Myxotrichaceae. However, since most of these fungi, except for the Erysiphales, are saprophytic on dung and/or plant materials, the questions of how and why an obligate biotroph like the Erysiphales radiated from the saprophytic fungi remain to be addressed. We also estimated the radiation time of the Erysiphales using the 18S rDNA sequences and the two molecular clockes that have been previously reported. The calculation showed that the Erysiphales split from the Myxotrichaceae 190–127 myr ago. Since the radiation time of the Erysiphales does not exceed 230 myr ago, even when allowance is made for the uncertainty of the molecular clocks, it is possible to consider that the Erysiphales evolved after the radiation of angiosperms. The results of our calculation also showed that the first radiation within the Erysiphales (138–92 myr ago) coincided with the date of a major diversification of angiosperms (130–90 myr ago). These results may support our early assumption that the radiation of the Erysiphales

  3. The nucleotide sequence and organization of nuclear 5S rRNA genes in yellow lupine

    International Nuclear Information System (INIS)

    Nuc, K.; Nuc, P.; Pawelkiewicz, J.

    1993-01-01

    We have isolated a genomic clone containing 'Lupinus luteus' 5S ribosomal RNA genes by screening with 5S rDNA probe clones that were hybridized previously with the initiator methionine tRNA preparation (contaminated) with traces of rRNA or its degradation products). The clone isolated contains ten repeat units of 342 bp with 119 bp fragment showing 100% homology to the 5S rRNA from yellow lupine. Sequence analysis indicates only point heterogeneities among the flanking regions of the genes. (author). 6 refs, 3 figs

  4. Phylogeny of holoparasitic Orobanche (Orobanchaceae) inferred from nuclear ITS sequences.

    Science.gov (United States)

    Schneeweiss, Gerald M; Colwell, Alison; Park, Jeong-Mi; Jang, Chang-Gee; Stuessy, Tod F

    2004-02-01

    Orobanche is the largest genus among the holoparasitic members of Orobanchaceae. We present the first molecular phylogenetic analysis (using nuclear ITS sequences) that includes members of all sections of Orobanche, Gymnocaulis, Myzorrhiza, Trionychon, and Orobanche. Orobanche is not monophyletic, but falls into two lineages: (1) the Orobanche group comprises Orobanche sect. Orobanche and the small Near Asian genus Diphelypaea and is characterized by a chromosome base number of x=19 and (2) the Phelipanche group contains Orobanche sects. Gymnocaulis, Myzorrhiza, and Trionychon and possesses a chromosome base number of x=12. The relationships between these two groups and to other genera such as Boschniakia or Cistanche remain unresolved. Within the Orobanche group, Orobanche macrolepis and Orobanche anatolica (including Orobanche colorata) constitute two phylogenetically distinct lineages. Intrasectional structurings proposed by some authors for O. sect. Orobanche are not confirmed by the molecular data. In most cases, intraspecific sequence divergence between accessions, if present, is negligible and not correlated with morphological or ecological traits. In a few cases, however, there is evidence for the presence of cryptic taxa.

  5. Phylogeny of holoparasitic Orobanche (Orobanchaceae) inferred from nuclear ITS sequences

    Science.gov (United States)

    Schneeweiss, G.M.; Colwell, A.; Park, J.-M.; Jang, C.-G.; Stuessy, Tod F.

    2004-01-01

    Orobanche is the largest genus among the holoparasitic members of Orobanchaceae. We present the first molecular phylogenetic analysis (using nuclear ITS sequences) that includes members of all sections of Orobanche, Gymnocaulis, Myzorrhiza, Trionychon, and Orobanche. Orobanche is not monophyletic, but falls into two lineages: (1) the Orobanche group comprises Orobanche sect. Orobanche and the small Near Asian genus Diphelypaea and is characterized by a chromosome base number of x = 19 and (2) the Phelipanche group contains Orobanche sects. Gymnocaulis, Myzorrhiza, and Trionychon and possesses a chromosome base number of x = 12. The relationships between these two groups and to other genera such as Boschniakia or Cistanche remain unresolved. Within the Orobanche group, Orobanche macrolepis and Orobanche anatolica (including Orobanche colorata) constitute two phylogenetically distinct lineages. Intrasectional structurings proposed by some authors for O. sect. Orobanche are not confirmed by the molecular data. In most cases, intraspecific sequence divergence between accessions, if present, is negligible and not correlated with morphological or ecological traits. In a few cases, however, there is evidence for the presence of cryptic taxa. ?? 2003 Elsevier Science (USA). All rights reserved.

  6. Molecular characterization of Fasciola spp. from the endemic area of northern Iran based on nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Amor, Nabil; Halajian, Ali; Farjallah, Sarra; Merella, Paolo; Said, Khaled; Ben Slimane, Badreddine

    2011-07-01

    Fasciolosis caused by Fasciola spp. (Platyhelminthes: Trematoda: Digenea) is considered as the most important helminth infection of ruminants in tropical countries, causing considerable socioeconomic problems. In the endemic regions of the North of Iran, Fasciola hepatica and Fasciola gigantica have been previously characterized on the basis of morphometric differences, but the use of molecular markers is necessary to distinguish exactly between species and intermediate forms. Samples from buffaloes and goats from different localities of northern Iran were identified morphologically and then genetically characterized by sequences of the first (ITS-1) and second (ITS-2) Internal Transcribed Spacers (ITS) of nuclear ribosomal DNA (rDNA). Comparison of the ITS of the northern Iranian samples with sequences of Fasciola spp. from GenBank showed that the examined specimens had sequences identical to those of the most frequent haplotypes of F. hepatica (n=25, 48.1%) and F. gigantica (n=20, 38.45%), which differed from each other in different variable nucleotide positions of ITS region sequences, and their intermediate forms (n=7, 13.45%), which had nucleotides overlapped between the two Fasciola species in all the positions. The ITS sequences from populations of Fasciola isolates in buffaloes and goats had experienced introgression/hybridization as previously reported in isolates from other ruminants and humans. Based on ITS-1 and ITS-2 sequences, flukes are scattered in pure F. hepatica, F. gigantica and intermediate Fasciola clades, revealing that multiple genotypes of Fasciola are able to infect goats and buffaloes in North of Iran. Furthermore, the phylogenetic trees based upon the ITS-1 and ITS-2 sequences showed a close relationship of the Iranian samples with isolates of F. hepatica and F. gigantica from different localities of Africa and Asia. In the present study, the intergenic transcribed spacers ITS-1 and ITS-2 showed to be reliable approaches for the genetic

  7. The 5S rDNA in two Abracris grasshoppers (Ommatolampidinae: Acrididae): molecular and chromosomal organization.

    Science.gov (United States)

    Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti

    2016-08-01

    The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.

  8. The linked units of 5S rDNA and U1 snDNA of razor shells (Mollusca: Bivalvia: Pharidae).

    Science.gov (United States)

    Vierna, J; Jensen, K T; Martínez-Lage, A; González-Tizón, A M

    2011-08-01

    The linkage between 5S ribosomal DNA and other multigene families has been detected in many eukaryote lineages, but whether it provides any selective advantage remains unclear. In this work, we report the occurrence of linked units of 5S ribosomal DNA (5S rDNA) and U1 small nuclear DNA (U1 snDNA) in 10 razor shell species (Mollusca: Bivalvia: Pharidae) from four different genera. We obtained several clones containing partial or complete repeats of both multigene families in which both types of genes displayed the same orientation. We provide a comprehensive collection of razor shell 5S rDNA clones, both with linked and nonlinked organisation, and the first bivalve U1 snDNA sequences. We predicted the secondary structures and characterised the upstream and downstream conserved elements, including a region at -25 nucleotides from both 5S rDNA and U1 snDNA transcription start sites. The analysis of 5S rDNA showed that some nontranscribed spacers (NTSs) are more closely related to NTSs from other species (and genera) than to NTSs from the species they were retrieved from, suggesting birth-and-death evolution and ancestral polymorphism. Nucleotide conservation within the functional regions suggests the involvement of purifying selection, unequal crossing-overs and gene conversions. Taking into account this and other studies, we discuss the possible mechanisms by which both multigene families could have become linked in the Pharidae lineage. The reason why 5S rDNA is often found linked to other multigene families seems to be the result of stochastic processes within genomes in which its high copy number is determinant.

  9. Evaluation of MALDI-TOF mass spectrometry and MALDI BioTyper in comparison to 16S rDNA sequencing for the identification of bacteria isolated from Arctic sea water.

    Directory of Open Access Journals (Sweden)

    Anna Maria Timperio

    Full Text Available MALDI-TOF Mass Spectrometry in association with the MALDI BioTyper 3.1 software has been evaluated for the identification and classification of 45 Arctic bacteria isolated from Kandalaksha Bay (White Sea, Russia. The high reliability of this method has been already demonstrated, in clinical microbiology, by a number of studies showing high attribution concordance with other credited analyses. Recently, it has been employed also in other branches of microbiology with controversial performance. The phyloproteomic results reported in this study were validated with those obtained by the "gold standard" 16S rDNA analysis. Concordance between the two methods was 100% at the genus level, while at the species level it was 48%. These percentages appeared to be quite high compared with other studies regarding environmental bacteria. However, the performance of MALDI BioTyper changed in relation to the taxonomical group analyzed, reflecting known identification problems related to certain genera. In our case, attribution concordance for Pseudomonas species was rather low (29%, confirming the problematic taxonomy of this genus, whereas that of strains from other genera was quite high (> 60%. Among the isolates tested in this study, two strains (Exiguobacterium oxidotolerans and Pseudomonas costantinii were misidentified by MALDI BioTyper due to absence of reference spectra in the database. Accordingly, missing spectra were acquired for the database implementation.

  10. Evaluation of MALDI-TOF mass spectrometry and MALDI BioTyper in comparison to 16S rDNA sequencing for the identification of bacteria isolated from Arctic sea water.

    Science.gov (United States)

    Timperio, Anna Maria; Gorrasi, Susanna; Zolla, Lello; Fenice, Massimiliano

    2017-01-01

    MALDI-TOF Mass Spectrometry in association with the MALDI BioTyper 3.1 software has been evaluated for the identification and classification of 45 Arctic bacteria isolated from Kandalaksha Bay (White Sea, Russia). The high reliability of this method has been already demonstrated, in clinical microbiology, by a number of studies showing high attribution concordance with other credited analyses. Recently, it has been employed also in other branches of microbiology with controversial performance. The phyloproteomic results reported in this study were validated with those obtained by the "gold standard" 16S rDNA analysis. Concordance between the two methods was 100% at the genus level, while at the species level it was 48%. These percentages appeared to be quite high compared with other studies regarding environmental bacteria. However, the performance of MALDI BioTyper changed in relation to the taxonomical group analyzed, reflecting known identification problems related to certain genera. In our case, attribution concordance for Pseudomonas species was rather low (29%), confirming the problematic taxonomy of this genus, whereas that of strains from other genera was quite high (> 60%). Among the isolates tested in this study, two strains (Exiguobacterium oxidotolerans and Pseudomonas costantinii) were misidentified by MALDI BioTyper due to absence of reference spectra in the database. Accordingly, missing spectra were acquired for the database implementation.

  11. Identification and evaluation of accident sequences in nuclear power reactors

    International Nuclear Information System (INIS)

    Amendola, A.; Capobianchi, S.; Mancini, G.; Olivi, L.; Volta, G.; Reina, G.

    1981-01-01

    Probabilistic analysis techniques are being more and more used for the evaluation of accident progression in nuclear power plants, especially after the issue of the Reactor Safety Study (Report WASH-1400). This study and subsequent discussions have indicated the necessity of better investigating some major items, namely: adequate data base for the probabilistic evaluations; completeness of the analysis with respect both to accident initiation and behaviour; adequate treatment of uncertainties on the physical and operational parameters governing the accident behaviour. Furthermore, recent occurrences have stressed the importance of the operational aspects of reactor safety, such as plant-specific identification of possible occurrences, their prompt recognition, on-line prediction of subsequent developments and actions to be taken. The paper reviews the contributions in progress at JRC-Ispra to all these aspects, and specifically reports on the following: (1) The set-up of a European Reliability Data System for the acquisition and organisation of operational data of LWRs in the European Community. (2) The development of more complete and realistic models of systems. This work includes multistate static models of components and systems with a view to automatic fault-tree construction and dynamic models for accident sequence identification. The dynamic modelling approach ESCS (Event Sequence and Consequences Spectrum), shown in detail with an example, represents a step forward with respect to event-tree technique and opens new possibilities in dealing with human factors and on-line diagnosis problems. (3) The development of RSM (Response Surface Methodology) for the analysis of uncertainty propagations in consequence and in probability of accident chains. (author)

  12. Uncovering the molecular organization of unusual highly scattered 5S rDNA: The case of Chariesterus armatus (Heteroptera).

    Science.gov (United States)

    Bardella, Vanessa Bellini; Cabral-de-Mello, Diogo Cavalcanti

    2018-03-10

    One cluster of 5S rDNA per haploid genome is the most common pattern among Heteroptera. However, in Chariesterus armatus, highly scattered signals were noticed. We isolated and characterized the entire 5S rDNA unit of C. armatus aiming to a deeper knowledge of molecular organization of the 5S rDNA among Heteroptera and to understand possible causes and consequences of 5S rDNA chromosomal spreading. For a comparative analysis, we performed the same approach in Holymenia histrio with 5S rDNA restricted to one bivalent. Multiple 5S rDNA variants were observed in both species, though they were more variable in C. armatus, with some of variants corresponding to pseudogenes. These pseudogenes suggest birth-and-death mechanism, though homogenization was also observed (concerted evolution), indicating evolution through mixed model. Association between transposable elements and 5S rDNA was not observed, suggesting spreading of 5S rDNA through other mechanisms, like ectopic recombination. Scattered organization is a rare example for 5S rDNA, and such organization in C. armatus genome could have led to the high diversification of sequences favoring their pseudogenization. Copyright © 2017. Published by Elsevier B.V.

  13. Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.

    Science.gov (United States)

    Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří

    2016-11-01

    Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.

  14. Evolution in the block: common elements of 5S rDNA organization and evolutionary patterns in distant fish genera.

    Science.gov (United States)

    Campo, Daniel; García-Vázquez, Eva

    2012-01-01

    The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).

  15. A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).

    Science.gov (United States)

    Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao

    2017-01-01

    In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.

  16. Assessing Fungal Population in Soil Planted with Cry1Ac and CPTI Transgenic Cotton and Its Conventional Parental Line using 18S and ITS rDNA Sequences over Four Seasons

    Directory of Open Access Journals (Sweden)

    Xiemin Qi

    2016-07-01

    Full Text Available Long-term growth of genetically modified plants (GMPs has raised concerns regarding their ecological effects. Here, FLX-pyrosequencing of region I (18S and region II (ITS1, 5.8S and ITS2 rDNA was used to characterize fungal communities in soil samples after 10-year monoculture of one representative transgenic cotton line (TC-10 and 15-year plantation of various transgenic cotton cultivars (TC-15mix over four seasons. Soil fungal communities in the rhizosphere of non-transgenic control (CC were also compared. No notable differences were observed in soil fertility variables among CC, TC-10 and TC-15mix. Within seasons, the different estimations were statistically indistinguishable. There were 411 and 2 067 fungal operational taxonomic units in the two regions, respectively. More than 75% of fungal taxa were stable in both CC and TC except for individual taxa with significantly different abundance between TC and CC. Statistical analysis revealed no significant differences between CC and TC-10, while discrimination of separating TC-15mix from CC and TC-10 with 37.86% explained variance in PCoA and a significant difference of Shannon indexes between TC-10 and TC-15mix were observed in region II. As TC-15mix planted with a mixture of transgenic cottons (Zhongmian-29, 30, and 33B for over 5 years, different genetic modifications may introduce variations in fungal diversity. Further clarification is necessary by detecting the fungal dynamic changes in sites planted in monoculture of various transgenic cottons. Overall, we conclude that monoculture of one representative transgenic cotton cultivar may have no effect on fungal diversity compared with conventional cotton. Furthermore, the choice of amplified region and methodology has potential to affect the outcome of the comparison between GM-crop and its parental line.

  17. Contrasting Patterns of rDNA Homogenization within the Zygosaccharomyces rouxii Species Complex

    Science.gov (United States)

    Chand Dakal, Tikam; Giudici, Paolo; Solieri, Lisa

    2016-01-01

    Arrays of repetitive ribosomal DNA (rDNA) sequences are generally expected to evolve as a coherent family, where repeats within such a family are more similar to each other than to orthologs in related species. The continuous homogenization of repeats within individual genomes is a recombination process termed concerted evolution. Here, we investigated the extent and the direction of concerted evolution in 43 yeast strains of the Zygosaccharomyces rouxii species complex (Z. rouxii, Z. sapae, Z. mellis), by analyzing two portions of the 35S rDNA cistron, namely the D1/D2 domains at the 5’ end of the 26S rRNA gene and the segment including the internal transcribed spacers (ITS) 1 and 2 (ITS regions). We demonstrate that intra-genomic rDNA sequence variation is unusually frequent in this clade and that rDNA arrays in single genomes consist of an intermixing of Z. rouxii, Z. sapae and Z. mellis-like sequences, putatively evolved by reticulate evolutionary events that involved repeated hybridization between lineages. The levels and distribution of sequence polymorphisms vary across rDNA repeats in different individuals, reflecting four patterns of rDNA evolution: I) rDNA repeats that are homogeneous within a genome but are chimeras derived from two parental lineages via recombination: Z. rouxii in the ITS region and Z. sapae in the D1/D2 region; II) intra-genomic rDNA repeats that retain polymorphisms only in ITS regions; III) rDNA repeats that vary only in their D1/D2 domains; IV) heterogeneous rDNA arrays that have both polymorphic ITS and D1/D2 regions. We argue that an ongoing process of homogenization following allodiplodization or incomplete lineage sorting gave rise to divergent evolutionary trajectories in different strains, depending upon temporal, structural and functional constraints. We discuss the consequences of these findings for Zygosaccharomyces species delineation and, more in general, for yeast barcoding. PMID:27501051

  18. Differentiation of Actinobacillus pleuropneumoniae strains by sequence analysis of 16S rDNA and ribosomal intergenic regions, and development of a species specific oligonucleotide for in situ detection

    DEFF Research Database (Denmark)

    Fussing, Vivian; Paster, Bruce J.; Dewhirst, Floyd E.

    1998-01-01

    . The larger RIS's were different between the 3 species tested. The sequence of the 16S ribosomal gene was determined for 8 serotypes of A. pleuropneumoniae. These sequences showed only minor base differences, indicating a close genetic relatedness of these serotypes within the species. An oligonucleotide DNA...... probe designed from the 16S rRNA gene sequence of A. pleuropneumoniae was specific for all strains of the target species and did not cross react with A. lignieresii, the closest known relative of A. pleuropneumoniae. This species-specific DNA probe labeled with fluorescein was used for in situ......The aims of this study were to characterize and determine intraspecies and interspecies relatedness of Actinobacillus pleuropneumoniae to Actinobacillus lignieresii and Actinobacillus suis by sequence analysis of the ribosomal operon and to find a species-specific area for in situ detection of A...

  19. Molecular organization and chromosomal localization of 5S rDNA in Amazonian Engystomops (Anura, Leiuperidae).

    Science.gov (United States)

    Rodrigues, Débora Silva; Rivera, Miryan; Lourenço, Luciana Bolsoni

    2012-03-20

    For anurans, knowledge of 5S rDNA is scarce. For Engystomops species, chromosomal homeologies are difficult to recognize due to the high level of inter- and intraspecific cytogenetic variation. In an attempt to better compare the karyotypes of the Amazonian species Engystomops freibergi and Engystomops petersi, and to extend the knowledge of 5S rDNA organization in anurans, the 5S rDNA sequences of Amazonian Engystomops species were isolated, characterized, and mapped. Two types of 5S rDNA, which were readily differentiated by their NTS (non-transcribed spacer) sizes and compositions, were isolated from specimens of E. freibergi from Brazil and E. petersi from two Ecuadorian localities (Puyo and Yasuní). In the E. freibergi karyotypes, the entire type I 5S rDNA repeating unit hybridized to the pericentromeric region of 3p, whereas the entire type II 5S rDNA repeating unit mapped to the distal region of 6q, suggesting a differential localization of these sequences. The type I NTS probe clearly detected the 3p pericentromeric region in the karyotypes of E. freibergi and E. petersi from Puyo and the 5p pericentromeric region in the karyotype of E. petersi from Yasuní, but no distal or interstitial signals were observed. Interestingly, this probe also detected many centromeric regions in the three karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. The type II NTS probe detected only distal 6q regions in the three karyotypes, corroborating the differential distribution of the two types of 5S rDNA. Because the 5S rDNA types found in Engystomops are related to those of Physalaemus with respect to their nucleotide sequences and chromosomal locations, their origin likely preceded the evolutionary divergence of these genera. In addition, our data indicated homeology between Chromosome 5 in E. petersi from Yasuní and Chromosomes 3 in E. freibergi and E. petersi from Puyo. In addition, the chromosomal location of the type II 5S rDNA

  20. Identification and functional characterization of a novel bipartite nuclear localization sequence in ARID1A

    Energy Technology Data Exchange (ETDEWEB)

    Bateman, Nicholas W. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); The John P. Murtha Cancer Center, Walter Reed National Military Medical Center, 8901 Wisconsin Avenue, Bethesda 20889, MD (United States); Shoji, Yutaka [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids 49503, MI (United States); Conrads, Kelly A.; Stroop, Kevin D. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); Hamilton, Chad A. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); The John P. Murtha Cancer Center, Walter Reed National Military Medical Center, 8901 Wisconsin Avenue, Bethesda 20889, MD (United States); Gynecologic Oncology Service, Department of Obstetrics and Gynecology, Walter Reed National Military Medical Center, 8901 Wisconsin Ave, MD, Bethesda, 20889 (United States); Department of Obstetrics and Gynecology, Uniformed Services University of the Health Sciences, Bethesda 20814, MD (United States); Darcy, Kathleen M. [Women' s Health Integrated Research Center at Inova Health System, Gynecologic Cancer Center of Excellence, Annandale 22003, VA (United States); The John P. Murtha Cancer Center, Walter Reed National Military Medical Center, 8901 Wisconsin Avenue, Bethesda 20889, MD (United States); Maxwell, George L. [Department of Obstetrics and Gynecology, Inova Fairfax Hospital, Falls Church, VA 22042 (United States); Risinger, John I. [Department of Obstetrics, Gynecology and Reproductive Biology, Michigan State University, Grand Rapids 49503, MI (United States); and others

    2016-01-01

    AT-rich interactive domain-containing protein 1A (ARID1A) is a recently identified nuclear tumor suppressor frequently altered in solid tumor malignancies. We have identified a bipartite-like nuclear localization sequence (NLS) that contributes to nuclear import of ARID1A not previously described. We functionally confirm activity using GFP constructs fused with wild-type or mutant NLS sequences. We further show that cyto-nuclear localized, bipartite NLS mutant ARID1A exhibits greater stability than nuclear-localized, wild-type ARID1A. Identification of this undescribed functional NLS within ARID1A contributes vital insights to rationalize the impact of ARID1A missense mutations observed in patient tumors. - Highlights: • We have identified a bipartite nuclear localization sequence (NLS) in ARID1A. • Confirmation of the NLS was performed using GFP constructs. • NLS mutant ARID1A exhibits greater stability than wild-type ARID1A.

  1. Study and realisation of a programmable generator of pulse sequences, for nuclear magnetic resonance

    International Nuclear Information System (INIS)

    Lambert, Daniel

    1974-01-01

    After having recalled the operation of pulse-based nuclear magnetic resonance and the use of pulse sequences in NMR-based measurements, and outlined the need for a pulse sequence generator, the author reports the design and realisation of such a device. He describes its general organisation with its base sequence, base clock, sequence start, duration, displays, data transfers, data processing, and signal distribution. He presents the chosen technology (ECL logics), the sequence base set, time bases, multiplexers, comparison sets, the distribution set, the sequence programming, the sampling and output set. He reports tests and the use of the so-designed generator [fr

  2. Study of event sequence database for a nuclear power domain

    International Nuclear Information System (INIS)

    Kusumi, Yoshiaki

    1998-01-01

    A retrieval engine developed to extract event sequences from an accident information database using a time series retrieval formula expressed with ordered retrieval terms is explored. This engine outputs not only a sequence which completely matches with a time series retrieval formula, but also sequence which approximately matches the formula (fuzzy retrieval). An event sequence database in which records consist of three ordered parameters, namely the causal event, the process and result. Then the database is used to assess the feasibility of this engine and favorable results were obtained. (author)

  3. Navigating the tip of the genomic iceberg: Next-generation sequencing for plant systematics.

    Science.gov (United States)

    Straub, Shannon C K; Parks, Matthew; Weitemier, Kevin; Fishbein, Mark; Cronn, Richard C; Liston, Aaron

    2012-02-01

    Just as Sanger sequencing did more than 20 years ago, next-generation sequencing (NGS) is poised to revolutionize plant systematics. By combining multiplexing approaches with NGS throughput, systematists may no longer need to choose between more taxa or more characters. Here we describe a genome skimming (shallow sequencing) approach for plant systematics. Through simulations, we evaluated optimal sequencing depth and performance of single-end and paired-end short read sequences for assembly of nuclear ribosomal DNA (rDNA) and plastomes and addressed the effect of divergence on reference-guided plastome assembly. We also used simulations to identify potential phylogenetic markers from low-copy nuclear loci at different sequencing depths. We demonstrated the utility of genome skimming through phylogenetic analysis of the Sonoran Desert clade (SDC) of Asclepias (Apocynaceae). Paired-end reads performed better than single-end reads. Minimum sequencing depths for high quality rDNA and plastome assemblies were 40× and 30×, respectively. Divergence from the reference significantly affected plastome assembly, but relatively similar references are available for most seed plants. Deeper rDNA sequencing is necessary to characterize intragenomic polymorphism. The low-copy fraction of the nuclear genome was readily surveyed, even at low sequencing depths. Nearly 160000 bp of sequence from three organelles provided evidence of phylogenetic incongruence in the SDC. Adoption of NGS will facilitate progress in plant systematics, as whole plastome and rDNA cistrons, partial mitochondrial genomes, and low-copy nuclear markers can now be efficiently obtained for molecular phylogenetics studies.

  4. The sequence coding and search system: an approach for constructing and analyzing event sequences at commercial nuclear power plants

    International Nuclear Information System (INIS)

    Mays, G.T.

    1990-01-01

    The U.S. Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedback of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrence of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objectives of SCSS, the information it contains, and the format and approach for constructing SCSS event sequences. Examples are presented demonstrating the use of SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted. Considerable experience has been gained in the areas of evolving and changing data requirements, staffing requirements, and quality control and quality assurance procedures for addressing consistency, software/hardware considerations for developing and maintaining a complex system, documentation requirements, and end-user needs. Two other approaches for constructing and evaluating event sequences are examined including the Accident Precursor Program (ASP) where sequences having the potential for core damage are identified and analyzed, and the Significant Event Compilation Tree

  5. Improving the Analysis of Dinoflagellate Phylogeny based on rDNA

    DEFF Research Database (Denmark)

    Murray, Shauna; Jørgensen, Mårten Flø; Ho, Simon Y.W.

    2005-01-01

    Phylogenetic studies of dinoflagellates are often conducted using rDNA sequences. In analyses to date, the monophyly of some of the major lineages of dinoflagellates remain to be demonstrated. There are several reasons for this uncertainty, one of which may be the use of models of evolution that ...

  6. Complex programmable logic device based alarm sequencer for nuclear power plants

    International Nuclear Information System (INIS)

    Khedkar, Ravindra; Solomon, J. Selva; KrishnaKumar, B.

    2001-01-01

    Complex Programmable Logic Device based Alarm Sequencer is an instrument, which detects alarms, memorizes them and displays the sequences of occurrence of alarms. It caters to sixteen alarm signals and distinguishes the sequence among any two alarms with a time resolution of 1 ms. The system described has been designed for continuous operation in process plants, nuclear power plants etc. The system has been tested and found to be working satisfactorily. (author)

  7. Interactions of rat repetitive sequence MspI8 with nuclear matrix proteins during spermatogenesis

    International Nuclear Information System (INIS)

    Rogolinski, J.; Widlak, P.; Rzeszowska-Wolny, J.

    1996-01-01

    Using the Southwestern blot analysis we have studied the interactions between rat repetitive sequence MspI8 and the nuclear matrix proteins of rats testis cells. Starting from 2 weeks the young to adult animal showed differences in type of testis nuclear matrix proteins recognizing the MspI8 sequence. The same sets of nuclear matrix proteins were detected in some enriched in spermatocytes and spermatids and obtained after fractionation of cells of adult animal by the velocity sedimentation technique. (author). 21 refs, 5 figs

  8. Novel Bacteriocinogenic Lactobacillus plantarum Strains and Their Differentiation by Sequence Analysis of 16S rDNA, 16S-23S and 23S-5S Intergenic Spacer Regions and Randomly Amplified Polymorphic DNA Analysis

    Directory of Open Access Journals (Sweden)

    Morteza Shojaei Moghadam

    2010-01-01

    Full Text Available Six strains of bacteriocinogenic Lactobacillus plantarum (TL1, RG11, RS5, UL4, RG14 and RI11 isolated from Malaysian foods were investigated for their structural bacteriocin genes. A new combination of plantaricin EF and plantaricin W bacteriocin structural genes was successfully amplified from all studied strains, suggesting that they were novel bacteriocin-producing L. plantarum strains. A four-base pair variable region was detected in the short 16S-23S intergenic spacer regions of the studied strains by a comparative analysis with 17 L. plantarum strains deposited in the GenBank, implying they were new genotypes. The studied L. plantarum strains were subsequently differentiated into four groups on the basis of the detected four-base pair variable region of the short 16S-23S intergenic spacer region. Further analysis of the DNA sequence of 23S-5S intergenic spacer region revealed only one type of 23S-5S intergenic spacer region present in the studied strains, indicating it was highly conserved among the studied L. plantarum strains. Three randomly amplified polymorphic DNA experiments using three different combinations of arbitrary primers successfully differentiated the studied L. plantarum strains from each other, confirming they were different strains. In conclusion, the studied L. plantarum strains were shown to be novel bacteriocin producers and high level of strain discrimination could be achieved with a combination of randomly amplified polymorphic DNA analysis and the analysis of the variable region of short 16S-23S intergenic spacer region present in L. plantarum strains.

  9. Molecular organization and phylogenetic analysis of 5S rDNA in crustaceans of the genus Pollicipes reveal birth-and-death evolution and strong purifying selection.

    Science.gov (United States)

    Perina, Alejandra; Seoane, David; González-Tizón, Ana M; Rodríguez-Fariña, Fernanda; Martínez-Lage, Andrés

    2011-10-17

    The 5S ribosomal DNA (5S rDNA) is organized in tandem arrays with repeat units that consist of a transcribing region (5S) and a variable nontranscribed spacer (NTS), in higher eukaryotes. Until recently the 5S rDNA was thought to be subject to concerted evolution, however, in several taxa, sequence divergence levels between the 5S and the NTS were found higher than expected under this model. So, many studies have shown that birth-and-death processes and selection can drive the evolution of 5S rDNA. In analyses of 5S rDNA evolution is found several 5S rDNA types in the genome, with low levels of nucleotide variation in the 5S and a spacer region highly divergent. Molecular organization and nucleotide sequence of the 5S ribosomal DNA multigene family (5S rDNA) were investigated in three Pollicipes species in an evolutionary context. The nucleotide sequence variation revealed that several 5S rDNA variants occur in Pollicipes genomes. They are clustered in up to seven different types based on differences in their nontranscribed spacers (NTS). Five different units of 5S rDNA were characterized in P. pollicipes and two different units in P. elegans and P. polymerus. Analysis of these sequences showed that identical types were shared among species and that two pseudogenes were present. We predicted the secondary structure and characterized the upstream and downstream conserved elements. Phylogenetic analysis showed an among-species clustering pattern of 5S rDNA types. These results suggest that the evolution of Pollicipes 5S rDNA is driven by birth-and-death processes with strong purifying selection.

  10. The sequence coding and search system: An approach for constructing and analyzing event sequences at commercial nuclear power plants

    International Nuclear Information System (INIS)

    Mays, G.T.

    1989-04-01

    The US Nuclear Regulatory Commission (NRC) has recognized the importance of the collection, assessment, and feedstock of operating experience data from commercial nuclear power plants and has centralized these activities in the Office for Analysis and Evaluation of Operational Data (AEOD). Such data is essential for performing safety and reliability analyses, especially analyses of trends and patterns to identify undesirable changes in plant performance at the earliest opportunity to implement corrective measures to preclude the occurrences of a more serious event. One of NRC's principal tools for collecting and evaluating operating experience data is the Sequence Coding and Search System (SCSS). The SCSS consists of a methodology for structuring event sequences and the requisite computer system to store and search the data. The source information for SCSS is the Licensee Event Report (LER), which is a legally required document. This paper describes the objective SCSS, the information it contains, and the format and approach for constructuring SCSS event sequences. Examples are presented demonstrating the use SCSS to support the analysis of LER data. The SCSS contains over 30,000 LERs describing events from 1980 through the present. Insights gained from working with a complex data system from the initial developmental stage to the point of a mature operating system are highlighted

  11. The analysis of energy-time sequences in the nuclear power plants construction

    International Nuclear Information System (INIS)

    Milivojevic, S.; Jovanovic, V.; Riznic, J.

    1983-01-01

    The current nuclear energy development pose many problems; one of them is nuclear power plant construction. They are evaluated energy and time features of the construction and their relative ratios by the analysis of available data. The results point at the reached efficiency of the construction and, in the same time, they are the basis for real estimation of energy-time sequences of the construction in the future. (author)

  12. Expression of 5 S rRNA genes linked to 35 S rDNA in plants, their epigenetic modification and regulatory element divergence

    Directory of Open Access Journals (Sweden)

    Garcia Sònia

    2012-06-01

    Full Text Available Abstract Background In plants, the 5 S rRNA genes usually occur as separate tandems (S-type arrangement or, less commonly, linked to 35 S rDNA units (L-type. The activity of linked genes remains unknown so far. We studied the homogeneity and expression of 5 S genes in several species from family Asteraceae known to contain linked 35 S-5 S units. Additionally, their methylation status was determined using bisulfite sequencing. Fluorescence in situ hybridization was applied to reveal the sub-nuclear positions of rDNA arrays. Results We found that homogenization of L-type units went to completion in most (4/6 but not all species. Two species contained major L-type and minor S-type units (termed Ls-type. The linked genes dominate 5 S rDNA expression while the separate tandems do not seem to be expressed. Members of tribe Anthemideae evolved functional variants of the polymerase III promoter in which a residing C-box element differs from the canonical angiosperm motif by as much as 30%. On this basis, a more relaxed consensus sequence of a plant C-box: (5’-RGSWTGGGTG-3’ is proposed. The 5 S paralogs display heavy DNA methylation similarly as to their unlinked counterparts. FISH revealed the close association of 35 S-5 S arrays with nucleolar periphery indicating that transcription of 5 S genes may occur in this territory. Conclusions We show that the unusual linked arrangement of 5 S genes, occurring in several plant species, is fully compatible with their expression and functionality. This extraordinary 5 S gene dynamics is manifested at different levels, such as variation in intrachromosomal positions, unit structure, epigenetic modification and considerable divergence of regulatory motifs.

  13. Assessing the fidelity of ancient DNA sequences amplified from nuclear genes

    DEFF Research Database (Denmark)

    Binladen, Jonas; Wiuf, Carsten Henrik; Gilbert, M. Thomas P.

    2006-01-01

    To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved...... in phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from...... adenine), respectively. Type 2 transitions are by far the most dominant and increase relative to those of type 1 with damage load. The results suggest that the deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine) is the main cause of miscoding lesions in both ancient mtDNA and nu...

  14. Automatic start-up system of nuclear reactor based on sequence control technology

    International Nuclear Information System (INIS)

    Zhang Yao; Zhang Dafa; Peng Huaqing

    2009-01-01

    A conceptive design of an automatic start-up system based on the sequence control for the nuclear reactors is given in this paper, so as to solve the problems during the start-up process, such as the long operation time, low automatic control level and high accident rate. The start-up process and its requirements are analyzed in detail at first. Then,the principle, the architecture, the key technologies of the automatic start-up system of nuclear reactors are designed and discussed. With the designed system, the automatic start-up of the nuclear reactor can be realized,the work load of the operator can be reduced,and the safety and efficiency of the nuclear power plant during its start-up can be improved. (authors)

  15. Mutation of a Conserved Nuclear Export Sequence in Chikungunya Virus Capsid Protein Disrupts Host Cell Nuclear Import.

    Science.gov (United States)

    Jacobs, Susan C; Taylor, Adam; Herrero, Lara J; Mahalingam, Suresh; Fazakerley, John K

    2017-10-20

    Transmitted by mosquitoes; chikungunya virus (CHIKV) is responsible for frequent outbreaks of arthritic disease in humans. CHIKV is an arthritogenic alphavirus of the Togaviridae family. Capsid protein, a structural protein encoded by the CHIKV RNA genome, is able to translocate to the host cell nucleus. In encephalitic alphaviruses nuclear translocation induces host cell shut off; however, the role of capsid protein nuclear localisation in arthritogenic alphaviruses remains unclear. Using replicon systems, we investigated a nuclear export sequence (NES) in the N-terminal region of capsid protein; analogous to that found in encephalitic alphavirus capsid but uncharacterised in CHIKV. The chromosomal maintenance 1 (CRM1) export adaptor protein mediated CHIKV capsid protein export from the nucleus and a region within the N-terminal part of CHIKV capsid protein was required for active nuclear targeting. In contrast to encephalitic alphaviruses, CHIKV capsid protein did not inhibit host nuclear import; however, mutating the NES of capsid protein (∆NES) blocked host protein access to the nucleus. Interactions between capsid protein and the nucleus warrant further investigation.

  16. Prediction of accident sequence probabilities in a nuclear power plant due to earthquake events

    International Nuclear Information System (INIS)

    Hudson, J.M.; Collins, J.D.

    1980-01-01

    This paper presents a methodology to predict accident probabilities in nuclear power plants subject to earthquakes. The resulting computer program accesses response data to compute component failure probabilities using fragility functions. Using logical failure definitions for systems, and the calculated component failure probabilities, initiating event and safety system failure probabilities are synthesized. The incorporation of accident sequence expressions allows the calculation of terminal event probabilities. Accident sequences, with their occurrence probabilities, are finally coupled to a specific release category. A unique aspect of the methodology is an analytical procedure for calculating top event probabilities based on the correlated failure of primary events

  17. The β-1,3-glucanosyltransferase Gas1 regulates Sir2-mediated rDNA stability in Saccharomyces cerevisiae.

    Science.gov (United States)

    Ha, Cheol Woong; Kim, Kwantae; Chang, Yeon Ji; Kim, Bongkeun; Huh, Won-Ki

    2014-07-01

    In Saccharomyces cerevisiae, the stability of highly repetitive rDNA array is maintained through transcriptional silencing. Recently, a β-1,3-glucanosyltransferase Gas1 has been shown to play a significant role in the regulation of transcriptional silencing in S. cerevisiae. Here, we show that the gas1Δ mutation increases rDNA silencing in a Sir2-dependent manner. Remarkably, the gas1Δ mutation induces nuclear localization of Msn2/4 and stimulates the expression of PNC1, a gene encoding a nicotinamidase that functions as a Sir2 activator. The lack of enzymatic activity of Gas1 or treatment with a cell wall-damaging agent, Congo red, exhibits effects similar to those of the gas1Δ mutation. Furthermore, the loss of Gas1 or Congo red treatment lowers the cAMP-dependent protein kinase (PKA) activity in a cell wall integrity MAP kinase Slt2-dependent manner. Collectively, our results suggest that the dysfunction of Gas1 plays a positive role in the maintenance of rDNA integrity by decreasing PKA activity and inducing the accumulation of Msn2/4 in the nucleus. It seems that nuclear-localized Msn2/4 stimulate the expression of Pnc1, thereby enhancing the association of Sir2 with rDNA and promoting rDNA stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Human factors review for nuclear power plant severe accident sequence analysis

    International Nuclear Information System (INIS)

    Krois, P.A.; Haas, P.M.

    1985-01-01

    The paper discusses work conducted to: (1) support the severe accident sequence analysis of a nuclear power plant transient based on an assessment of operator actions, and (2) develop a descriptive model of operator severe accident management. Operator actions during the transient are assessed using qualitative and quantitative methods. A function-oriented accident management model provides a structure for developing technical operator guidance on mitigating core damage preventing radiological release

  19. Internal event analysis for Laguna Verde Unit 1 Nuclear Power Plant. Accident sequence quantification and results

    International Nuclear Information System (INIS)

    Huerta B, A.; Aguilar T, O.; Nunez C, A.; Lopez M, R.

    1994-01-01

    The Level 1 results of Laguna Verde Nuclear Power Plant PRA are presented in the I nternal Event Analysis for Laguna Verde Unit 1 Nuclear Power Plant, CNSNS-TR 004, in five volumes. The reports are organized as follows: CNSNS-TR 004 Volume 1: Introduction and Methodology. CNSNS-TR4 Volume 2: Initiating Event and Accident Sequences. CNSNS-TR 004 Volume 3: System Analysis. CNSNS-TR 004 Volume 4: Accident Sequence Quantification and Results. CNSNS-TR 005 Volume 5: Appendices A, B and C. This volume presents the development of the dependent failure analysis, the treatment of the support system dependencies, the identification of the shared-components dependencies, and the treatment of the common cause failure. It is also presented the identification of the main human actions considered along with the possible recovery actions included. The development of the data base and the assumptions and limitations in the data base are also described in this volume. The accident sequences quantification process and the resolution of the core vulnerable sequences are presented. In this volume, the source and treatment of uncertainties associated with failure rates, component unavailabilities, initiating event frequencies, and human error probabilities are also presented. Finally, the main results and conclusions for the Internal Event Analysis for Laguna Verde Nuclear Power Plant are presented. The total core damage frequency calculated is 9.03x 10-5 per year for internal events. The most dominant accident sequences found are the transients involving the loss of offsite power, the station blackout accidents, and the anticipated transients without SCRAM (ATWS). (Author)

  20. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica.

    Directory of Open Access Journals (Sweden)

    Shui-Lian He

    Full Text Available Foxtail millet (Setaria italica (L. Beauv is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1 in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  1. Nucleotide Sequence Diversity and Linkage Disequilibrium of Four Nuclear Loci in Foxtail Millet (Setaria italica).

    Science.gov (United States)

    He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang

    2015-01-01

    Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.

  2. Organization and variation analysis of 5S rDNA in different ploidy-level hybrids of red crucian carp × topmouth culter.

    Science.gov (United States)

    He, Weiguo; Qin, Qinbo; Liu, Shaojun; Li, Tangluo; Wang, Jing; Xiao, Jun; Xie, Lihua; Zhang, Chun; Liu, Yun

    2012-01-01

    Through distant crossing, diploid, triploid and tetraploid hybrids of red crucian carp (Carassius auratus red var., RCC♀, Cyprininae, 2n = 100) × topmouth culter (Erythroculter ilishaeformis Bleeker, TC♂, Cultrinae, 2n = 48) were successfully produced. Diploid hybrids possessed 74 chromosomes with one set from RCC and one set from TC; triploid hybrids harbored 124 chromosomes with two sets from RCC and one set from TC; tetraploid hybrids had 148 chromosomes with two sets from RCC and two sets from TC. The 5S rDNA of the three different ploidy-level hybrids and their parents were sequenced and analyzed. There were three monomeric 5S rDNA classes (designated class I: 203 bp; class II: 340 bp; and class III: 477 bp) in RCC and two monomeric 5S rDNA classes (designated class IV: 188 bp, and class V: 286 bp) in TC. In the hybrid offspring, diploid hybrids inherited three 5S rDNA classes from their female parent (RCC) and only class IV from their male parent (TC). Triploid hybrids inherited class II and class III from their female parent (RCC) and class IV from their male parent (TC). Tetraploid hybrids gained class II and class III from their female parent (RCC), and generated a new 5S rDNA sequence (designated class I-N). The specific paternal 5S rDNA sequence of class V was not found in the hybrid offspring. Sequence analysis of 5S rDNA revealed the influence of hybridization and polyploidization on the organization and variation of 5S rDNA in fish. This is the first report on the coexistence in vertebrates of viable diploid, triploid and tetraploid hybrids produced by crossing parents with different chromosome numbers, and these new hybrids are novel specimens for studying the genomic variation in the first generation of interspecific hybrids, which has significance for evolution and fish genetics.

  3. Evolutionary insight on localization of 18S, 28S rDNA genes on homologous chromosomes in Primates genomes

    Science.gov (United States)

    Mazzoleni, Sofia; Rovatsos, Michail; Schillaci, Odessa; Dumas, Francesca

    2018-01-01

    Abstract We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH) in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876) (Scandentia), in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates. PMID:29416829

  4. Evolutionary insight on localization of 18S, 28S rDNA genes on homologous chromosomes in Primates genomes

    Directory of Open Access Journals (Sweden)

    Sofia Mazzoleni

    2018-01-01

    Full Text Available We explored the topology of 18S and 28S rDNA units by fluorescence in situ hybridization (FISH in the karyotypes of thirteen species representatives from major groups of Primates and Tupaia minor (Günther, 1876 (Scandentia, in order to expand our knowledge of Primate genome reshuffling and to identify the possible dispersion mechanisms of rDNA sequences. We documented that rDNA probe signals were identified on one to six pairs of chromosomes, both acrocentric and metacentric ones. In addition, we examined the potential homology of chromosomes bearing rDNA genes across different species and in a wide phylogenetic perspective, based on the DAPI-inverted pattern and their synteny to human. Our analysis revealed an extensive variability in the topology of the rDNA signals across studied species. In some cases, closely related species show signals on homologous chromosomes, thus representing synapomorphies, while in other cases, signal was detected on distinct chromosomes, leading to species specific patterns. These results led us to support the hypothesis that different mechanisms are responsible for the distribution of the ribosomal DNA cluster in Primates.

  5. The next nuclear power station generation: Beyond-design accident concepts, methods, and action sequence

    International Nuclear Information System (INIS)

    Asmolov, V.G.; Khakh, O.Ya.; Shashkov, M.G.

    1993-01-01

    The problem of beyond-design accidents at nuclear stations will not be solved unless a safety culture becomes a basic characteristic of all lines of activity. Only then can the danger of accidents as an objective feature of nuclear stations be eliminated by purposive skilled and responsible activities of those implementing safety. Nuclear-station safety is provided by the following interacting and complementary lines of activity: (1) the design and construction of nuclear stations by properly qualified design and building organizations; (2) monitoring and supervision of safety by special state bodies; (3) control of the station by the exploiting organization; and (4) scientific examination of safety within the above framework and by independent organizations. The distribution of the responsibilities, powers, and right in these lines should be defined by a law on atomic energy, but there is not such law in Russian. The beyond-design accident problem is a key one in nuclear station safety, as it clear from the serious experience with accidents and numerous probabilistic studies. There are four features of the state of this topic in Russia that are of major significance for managing accidents: the lack of an atomic energy law, the inadequacy of the technical standards, the lack of a verified program package for nuclear-station designs in order to calculate the beyond-design accidents and analyze risks, and a lack of approach by designers to such accidents on the basis of international recommendations. This paper gives a brief description of three-forming points in the scientific activity: the general concept of nuclear-station safety, methods of analyzing and providing accident management, and the sequence of actions developed by specialists at this institute in recent years

  6. Evolutionary conservation of nuclear and nucleolar targeting sequences in yeast ribosomal protein S6A

    International Nuclear Information System (INIS)

    Lipsius, Edgar; Walter, Korden; Leicher, Torsten; Phlippen, Wolfgang; Bisotti, Marc-Angelo; Kruppa, Joachim

    2005-01-01

    Over 1 billion years ago, the animal kingdom diverged from the fungi. Nevertheless, a high sequence homology of 62% exists between human ribosomal protein S6 and S6A of Saccharomyces cerevisiae. To investigate whether this similarity in primary structure is mirrored in corresponding functional protein domains, the nuclear and nucleolar targeting signals were delineated in yeast S6A and compared to the known human S6 signals. The complete sequence of S6A and cDNA fragments was fused to the 5'-end of the LacZ gene, the constructs were transiently expressed in COS cells, and the subcellular localization of the fusion proteins was detected by indirect immunofluorescence. One bipartite and two monopartite nuclear localization signals as well as two nucleolar binding domains were identified in yeast S6A, which are located at homologous regions in human S6 protein. Remarkably, the number, nature, and position of these targeting signals have been conserved, albeit their amino acid sequences have presumably undergone a process of co-evolution with their corresponding rRNAs

  7. An N-terminal nuclear localization sequence but not the calmodulin-binding domain mediates nuclear localization of nucleomorphin, a protein that regulates nuclear number in Dictyostelium

    International Nuclear Information System (INIS)

    Myre, Michael A.; O'Day, Danton H.

    2005-01-01

    Nucleomorphin is a novel nuclear calmodulin (CaM)-binding protein (CaMBP) containing an extensive DEED (glu/asp repeat) domain that regulates nuclear number. GFP-constructs of the 38 kDa NumA1 isoform localize as intranuclear patches adjacent to the inner nuclear membrane. The translocation of CaMBPs into nuclei has previously been shown by others to be mediated by both classic nuclear localization sequences (NLSs) and CaM-binding domains (CaMBDs). Here we show that NumA1 possesses a CaMBD ( 171 EDVSRFIKGKLLQKQQKIYKDLERF 195 ) containing both calcium-dependent-binding motifs and an IQ-like motif for calcium-independent binding. GFP-constructs containing only NumA1 residues 1-129, lacking the DEED and CaMBDs, still localized as patches at the internal periphery of nuclei thus ruling out a direct role for the CaMBD in nuclear import. These constructs contained the amino acid residues 48 KKSYQDPEIIAHSRPRK 64 that include both a putative bipartite and classical NLS. GFP-bipartite NLS constructs localized uniformly within nuclei but not as patches. As with previous work, removal of the DEED domain resulted in highly multinucleate cells. However as shown here, multinuclearity only occurred when the NLS was present allowing the protein to enter nuclei. Site-directed mutation analysis in which the NLS was changed to 48 EF 49 abolished the stability of the GFP fusion at the protein but not RNA level preventing subcellular analyses. Cells transfected with the 48 EF 49 construct exhibited slowed growth when compared to parental AX3 cells and other GFP-NumA1 deletion mutants. In addition to identifying an NLS that is sufficient for nuclear translocation of nucleomorphin and ruling out CaM-binding in this event, this work shows that the nuclear localization of NumA1 is crucial to its ability to regulate nuclear number in Dictyostelium

  8. Examination of species boundaries in the Acropora cervicornis group (Scleractinia, cnidaria) using nuclear DNA sequence analyses.

    Science.gov (United States)

    Oppen, M J; Willis, B L; Vugt, H W; Miller, D J

    2000-09-01

    Although Acropora is the most species-rich genus of the scleractinian (stony) corals, only three species occur in the Caribbean: A. cervicornis, A. palmata and A. prolifera. Based on overall coral morphology, abundance and distribution patterns, it has been suggested that A. prolifera may be a hybrid between A. cervicornis and A. palmata. The species boundaries among these three morphospecies were examined using DNA sequence analyses of the nuclear Pax-C 46/47 intron and the ribosomal DNA Internal Transcribed Spacer (ITS1 and ITS2) and 5.8S regions. Moderate levels of sequence variability were observed in the ITS and 5.8S sequences (up to 5.2% overall sequence difference), but variability within species was as large as between species and all three species carried similar sequences. Since this is unlikely to represent a shared ancestral polymorphism, the data suggest that introgressive hybridization occurs among the three species. For the Pax-C intron, A. cervicornis and A. palmata had very distinct allele frequencies and A. cervicornis carried a unique allele at a frequency of 0.769 (although sequence differences between alleles were small). All A. prolifera colonies examined were heterozygous for the Pax-C intron, whereas heterozygosity was only 0.286 and 0.333 for A. cervicornis and A. palmata, respectively. These data support the hypothesis that A. prolifera is the product of hybridization between two species that have a different allelic composition for the Pax-C intron, i.e. A. cervicornis and A. palmata. We therefore suggest that A. prolifera is a hybrid between A. cervicornis and A. palmata, which backcrosses with the parental species at low frequency.

  9. Molecular systematics of Indian Alysicarpus (Fabaceae) based on analyses of nuclear ribosomal DNA sequences.

    Science.gov (United States)

    Gholami, Akram; Subramaniam, Shweta; Geeta, R; Pandey, Arun K

    2017-06-01

    Alysicarpus Necker ex Desvaux (Fabaceae, Desmodieae) consists of ~30 species that are distributed in tropical and subtropical regions of theworld. In India, the genus is represented by ca. 18 species, ofwhich seven are endemic. Sequences of the nuclear Internal transcribed spacer from38 accessions representing 16 Indian specieswere subjected to phylogenetic analyses. The ITS sequence data strongly support the monophyly of the genus Alysicarpus. Analyses revealed four major well-supported clades within Alysicarpus. Ancestral state reconstructions were done for two morphological characters, namely calyx length in relation to pod (macrocalyx and microcalyx) and pod surface ornamentation (transversely rugose and nonrugose). The present study is the first report on molecular systematics of Indian Alysicarpus.

  10. Accurate quantification of mouse mitochondrial DNA without co-amplification of nuclear mitochondrial insertion sequences.

    Science.gov (United States)

    Malik, Afshan N; Czajka, Anna; Cunningham, Phil

    2016-07-01

    Mitochondria contain an extra-nuclear genome in the form of mitochondrial DNA (MtDNA), damage to which can lead to inflammation and bioenergetic deficit. Changes in MtDNA levels are increasingly used as a biomarker of mitochondrial dysfunction. We previously reported that in humans, fragments in the nuclear genome known as nuclear mitochondrial insertion sequences (NumtS) affect accurate quantification of MtDNA. In the current paper our aim was to determine whether mouse NumtS affect the quantification of MtDNA and to establish a method designed to avoid this. The existence of NumtS in the mouse genome was confirmed using blast N, unique MtDNA regions were identified using FASTA, and MtDNA primers which do not co-amplify NumtS were designed and tested. MtDNA copy numbers were determined in a range of mouse tissues as the ratio of the mitochondrial and nuclear genome using real time qPCR and absolute quantification. Approximately 95% of mouse MtDNA was duplicated in the nuclear genome as NumtS which were located in 15 out of 21 chromosomes. A unique region was identified and primers flanking this region were used. MtDNA levels differed significantly in mouse tissues being the highest in the heart, with levels in descending order (highest to lowest) in kidney, liver, blood, brain, islets and lung. The presence of NumtS in the nuclear genome of mouse could lead to erroneous data when studying MtDNA content or mutation. The unique primers described here will allow accurate quantification of MtDNA content in mouse models without co-amplification of NumtS. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  11. Mitochondrial and nuclear sequence polymorphisms reveal geographic structuring in Amazonian populations of Echinococcus vogeli (Cestoda: Taeniidae).

    Science.gov (United States)

    Santos, Guilherme B; Soares, Manoel do C P; de F Brito, Elisabete M; Rodrigues, André L; Siqueira, Nilton G; Gomes-Gouvêa, Michele S; Alves, Max M; Carneiro, Liliane A; Malheiros, Andreza P; Póvoa, Marinete M; Zaha, Arnaldo; Haag, Karen L

    2012-12-01

    To date, nothing is known about the genetic diversity of the Echinococcus neotropical species, Echinococcus vogeli and Echinococcus oligarthrus. Here we used mitochondrial and nuclear DNA sequence polymorphisms to uncover the genetic structure, transmission and history of E. vogeli in the Brazilian Amazon, based on a sample of 38 isolates obtained from human and wild animal hosts. We confirm that the parasite is partially synanthropic and show that its populations are diverse. Furthermore, significant geographical structuring is found, with western and eastern populations being genetically divergent. Copyright © 2012 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

  12. The proteins of intra-nuclear bodies: a data-driven analysis of sequence, interaction and expression

    Directory of Open Access Journals (Sweden)

    Bodén Mikael

    2010-04-01

    Full Text Available Abstract Background Cajal bodies, nucleoli, PML nuclear bodies, and nuclear speckles are morpohologically distinct intra-nuclear structures that dynamically respond to cellular cues. Such nuclear bodies are hypothesized to play important regulatory roles, e.g. by sequestering and releasing transcription factors in a timely manner. While the nucleolus and nuclear speckles have received more attention experimentally, the PML nuclear body and the Cajal body are still incompletely characterized in terms of their roles and protein complement. Results By collating recent experimentally verified data, we find that almost 1000 proteins in the mouse nuclear proteome are known to associate with one or more of the nuclear bodies. Their gene ontology terms highlight their regulatory roles: splicing is confirmed to be a core activity of speckles and PML nuclear bodies house a range of proteins involved in DNA repair. We train support-vector machines to show that nuclear proteins contain discriminative sequence features that can be used to identify their intra-nuclear body associations. Prediction accuracy is highest for nucleoli and nuclear speckles. The trained models are also used to estimate the full protein complement of each nuclear body. Protein interactions are found primarily to link proteins in the nuclear speckles with proteins from other compartments. Cell cycle expression data provide support for increased activity in nucleoli, nuclear speckles and PML nuclear bodies especially during S and G2 phases. Conclusions The large-scale analysis of the mouse nuclear proteome sheds light on the functional organization of physically embodied intra-nuclear compartments. We observe partial support for the hypothesis that the physical organization of the nucleus mirrors functional modularity. However, we are unable to unambiguously identify proteins' intra-nuclear destination, suggesting that critical drivers behind of intra-nuclear translocation are yet to

  13. Cytogenetic Analysis of Populus trichocarpa - Ribosomal DNA, Telomere Repeat Sequence, and Marker-selected BACs

    Science.gov (United States)

    M.N. lslam-Faridi; C.D. Nelson; S.P. DiFazio; L.E. Gunter; G.A. Tuskan

    2009-01-01

    The 185-285 rDNA and 55 rDNA loci in Populus trichocarpa were localized using fluorescent in situ hybridization (FISH). Two 185-285 rDNA sites and one 55 rDNA site were identified and located at the ends of 3 different chromosomes. FISH signals from the Arabidopsis-type telomere repeat sequence were observed at the distal ends of each chromosome. Six BAC clones...

  14. Molecular organization of the 5S rDNA gene type II in elasmobranchs.

    Science.gov (United States)

    Castro, Sergio I; Hleap, Jose S; Cárdenas, Heiber; Blouin, Christian

    2016-01-01

    The 5S rDNA gene is a non-coding RNA that can be found in 2 copies (type I and type II) in bony and cartilaginous fish. Previous studies have pointed out that type II gene is a paralog derived from type I. We analyzed the molecular organization of 5S rDNA type II in elasmobranchs. Although the structure of the 5S rDNA is supposed to be highly conserved, our results show that the secondary structure in this group possesses some variability and is different than the consensus secondary structure. One of these differences in Selachii is an internal loop at nucleotides 7 and 112. These mutations observed in the transcribed region suggest an independent origin of the gene among Batoids and Selachii. All promoters were highly conserved with the exception of BoxA, possibly due to its affinity to polymerase III. This latter enzyme recognizes a dT4 sequence as stop signal, however in Rajiformes this signal was doubled in length to dT8. This could be an adaptation toward a higher efficiency in the termination process. Our results suggest that there is no TATA box in elasmobranchs in the NTS region. We also provide some evidence suggesting that the complexity of the microsatellites present in the NTS region play an important role in the 5S rRNA gene since it is significantly correlated with the length of the NTS.

  15. Evidence that two types of 18S rDNA coexist in the genome of Dugesia (Schmidtea) mediterranea (Platyhelminthes, Turbellaria, Tricladida).

    Science.gov (United States)

    Carranza, S; Giribet, G; Ribera, C; Baguñà; Riutort, M

    1996-07-01

    Sequences of 18S ribosomal DNA (rDNA) are increasingly being used to infer phylogenetic relationships among living taxa. Although the 18S rDNA belongs to a multigene family, all its copies are kept homogeneous by concerted evolution (Dover 1982; Hillis and Dixon 1991). To date, there is only one well-characterized exception to this rule, the protozoan Plasmodium (Gunderson et al. 1987; Waters, Syin, and McCutchan 1989; Qari et al. 1994). Here we report the 1st case of 18S rDNA polymorphism within a metazoan species. Two types (I and II) of 18S rDNA have been found and sequenced in the platyhelminth Dugesia (Schmidtea) mediterranea (Turbellaria, Seriata, Tricladida). Southern blot analysis suggested that both types of rDNA are present in the genome of this flatworm. This was confirmed through sequence comparisons and phylogenetic analysis using the neighbor-joining method and bootstrap test. Although secondary structure analysis suggests that both types are functional, only type I seems to be transcribed to RNA, as demonstrated by Northern blot analysis. The finding of different types of 18S rDNAs in a single genome stresses the need for analyzing a large number of clones whenever 18S sequences obtained by PCR amplification and cloning are being used in phylogenetic reconstruction.

  16. Plastid, nuclear and reverse transcriptase sequences in the mitochondrial genome of Oenothera: is genetic information transferred between organelles via RNA?

    Science.gov (United States)

    Schuster, W; Brennicke, A

    1987-01-01

    We describe an open reading frame (ORF) with high homology to reverse transcriptase in the mitochondrial genome of Oenothera. This ORF displays all the characteristics of an active plant mitochondrial gene with a possible ribosome binding site and 39% T in the third codon position. It is located between a sequence fragment from the plastid genome and one of nuclear origin downstream from the gene encoding subunit 5 of the NADH dehydrogenase. The nuclear derived sequence consists of 528 nucleotides from the small ribosomal RNA and contains an expansion segment unique to nuclear rRNAs. The plastid sequence contains part of the ribosomal protein S4 and the complete tRNA(Ser). The observation that only transcribed sequences have been found i more than one subcellular compartment in higher plants suggests that interorganellar transfer of genetic information may occur via RNA and subsequent local reverse transcription and genomic integration. PMID:14650433

  17. Estimation of physiological parameters using knowledge-based factor analysis of dynamic nuclear medicine image sequences

    International Nuclear Information System (INIS)

    Yap, J.T.; Chen, C.T.; Cooper, M.

    1995-01-01

    The authors have previously developed a knowledge-based method of factor analysis to analyze dynamic nuclear medicine image sequences. In this paper, the authors analyze dynamic PET cerebral glucose metabolism and neuroreceptor binding studies. These methods have shown the ability to reduce the dimensionality of the data, enhance the image quality of the sequence, and generate meaningful functional images and their corresponding physiological time functions. The new information produced by the factor analysis has now been used to improve the estimation of various physiological parameters. A principal component analysis (PCA) is first performed to identify statistically significant temporal variations and remove the uncorrelated variations (noise) due to Poisson counting statistics. The statistically significant principal components are then used to reconstruct a noise-reduced image sequence as well as provide an initial solution for the factor analysis. Prior knowledge such as the compartmental models or the requirement of positivity and simple structure can be used to constrain the analysis. These constraints are used to rotate the factors to the most physically and physiologically realistic solution. The final result is a small number of time functions (factors) representing the underlying physiological processes and their associated weighting images representing the spatial localization of these functions. Estimation of physiological parameters can then be performed using the noise-reduced image sequence generated from the statistically significant PCs and/or the final factor images and time functions. These results are compared to the parameter estimation using standard methods and the original raw image sequences. Graphical analysis was performed at the pixel level to generate comparable parametric images of the slope and intercept (influx constant and distribution volume)

  18. Genetic polymorphisms of Echinococcus tapeworms in China as determined by mitochondrial and nuclear DNA sequences

    Science.gov (United States)

    Nakao, Minoru; Li, Tiaoying; Han, Xiumin; Ma, Xiumin; Xiao, Ning; Qiu, Jiamin; Wang, Hu; Yanagida, Tetsuya; Mamuti, Wulamu; Wen, Hao; Moro, Pedro L.; Giraudoux, Patrick; Craig, Philip S.; Ito, Akira

    2009-01-01

    The genetic polymorphisms of Echinococcus spp. in the eastern Tibetan Plateau and the Xinjiang Uyghur Autonomous Region were evaluated by DNA sequencing analyses of genes for mitochondrial cytochrome c oxidase subunit 1 (cox1) and nuclear elongation factor-1 alpha (ef1a). We collected 68 isolates of Echinococcus granulosus sensu stricto (s.s.) from Xinjiang and 113 isolates of E. granulosus s. s., 49 isolates of Echinococcus multilocularis and 34 isolates of Echinococcus shiquicus from the Tibetan Plateau. The results of molecular identification by mitochondrial and nuclear markers were identical, suggesting the infrequency of introgressive hybridization. A considerable intraspecific variation was detected in mitochondrial cox1 sequences. The parsimonious network of cox1 haplotypes showed star-like features in E. granulosus s. s. and E. multilocularis, but a divergent feature in E. shiquicus. The cox1 neutrality indexes computed by Tajima's D and Fu's Fs tests showed high negative values in E. granulosus s. s. and E. multilocularis, indicating significant deviations from neutrality. In contrast, the low positive values of both tests were obtained in E. shiquicus. These results suggest the following hypotheses: (i) recent founder effects arose in E. granulosus and E. multilocularis after introducing particular individuals into the endemic areas by anthropogenic movement or natural migration of host mammals, and (ii) the ancestor of E. shiquicus was segregated into the Tibetan Plateau by colonizing alpine mammals and its mitochondrial locus has evolved without bottleneck effects. PMID:19800346

  19. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  20. Development of technique for estimating primary cooling system break diameter in predicting nuclear emergency event sequence

    International Nuclear Information System (INIS)

    Tatebe, Yasumasa; Yoshida, Yoshitaka

    2012-01-01

    If an emergency event occurs in a nuclear power plant, appropriate action is selected and taken in accordance with the plant status, which changes from time to time, in order to prevent escalation and mitigate the event consequences. It is thus important to predict the event sequence and identify the plant behavior resulting from the action taken. In predicting the event sequence during a loss-of-coolant accident (LOCA), it is necessary to estimate break diameter. The conventional method for this estimation is time-consuming, since it involves multiple sensitivity analyses to determine the break diameter that is consistent with the plant behavior. To speed up the process of predicting the nuclear emergency event sequence, a new break diameter estimation technique that is applicable to pressurized water reactors was developed in this study. This technique enables the estimation of break diameter using the plant data sent from the safety parameter display system (SPDS), with focus on the depressurization rate in the reactor cooling system (RCS) during LOCA. The results of LOCA analysis, performed by varying the break diameter using the MAAP4 and RELAP5/MOD3.2 codes, confirmed that the RCS depressurization rate could be expressed by the log linear function of break diameter, except in the case of a small leak, in which RCS depressurization is affected by the coolant charging system and the high-pressure injection system. A correlation equation for break diameter estimation was developed from this function and tested for accuracy. Testing verified that the correlation equation could estimate break diameter accurately within an error of approximately 16%, even if the leak increases gradually, changing the plant status. (author)

  1. Accidental sequences associated with the containment of the pressurized water nuclear installation - INAP

    International Nuclear Information System (INIS)

    Natacci, Faustina Beatriz; Correa, Francisco

    2002-01-01

    The analysis of accidental sequences associated with the Containment is one of the most important tasks during the development of the Probabilistic Safety Assessment (PSA) of nuclear plants mainly because of its importance on the mitigation of consequences of severe postulated accident initiating events. This paper presents a first approach of the Containment analysis of the INAP identifying failures and events that can compromise its performance, and outlining accidental sequences and Containment end states. The initial plant damage states, which are the input for this study, are based on the event trees developed in the PSA level 1 for the INAP. It should be emphasized that since this PSA is still in a preliminary stage it is subjected to further completion. Consequently, the Containment analysis shall also be revised in order to incorporate, in an extension as complete as possible, all initial plant damage states, the corresponding event trees, and the related Containment end states. Finally, it can be concluded that the evaluation of the qualitative analysis presented herein allows a concise and broad knowledge of the qualitative analysis presented herein allows a concise and broad knowledge of the development of accidental sequences related to the Containment of the INAP. (author)

  2. Complete nuclear ribosomal DNA sequence amplification and molecular analyses of Bangia (Bangiales, Rhodophyta) from China

    Science.gov (United States)

    Xu, Jiajie; Jiang, Bo; Chai, Sanming; He, Yuan; Zhu, Jianyi; Shen, Zonggen; Shen, Songdong

    2016-09-01

    Filamentous Bangia, which are distributed extensively throughout the world, have simple and similar morphological characteristics. Scientists can classify these organisms using molecular markers in combination with morphology. We successfully sequenced the complete nuclear ribosomal DNA, approximately 13 kb in length, from a marine Bangia population. We further analyzed the small subunit ribosomal DNA gene (nrSSU) and the internal transcribed spacer (ITS) sequence regions along with nine other marine, and two freshwater Bangia samples from China. Pairwise distances of the nrSSU and 5.8S ribosomal DNA gene sequences show the marine samples grouping together with low divergences (00.003; 0-0.006, respectively) from each other, but high divergences (0.123-0.126; 0.198, respectively) from freshwater samples. An exception is the marine sample collected from Weihai, which shows high divergence from both other marine samples (0.063-0.065; 0.129, respectively) and the freshwater samples (0.097; 0.120, respectively). A maximum likelihood phylogenetic tree based on a combined SSU-ITS dataset with maximum likelihood method shows the samples divided into three clades, with the two marine sample clades containing Bangia spp. from North America, Europe, Asia, and Australia; and one freshwater clade, containing Bangia atropurpurea from North America and China.

  3. Cdc25A localisation and shuttling: characterisation of sequences mediating nuclear export and import

    International Nuclear Information System (INIS)

    Kaellstroem, Helena; Lindqvist, Arne; Pospisil, Vitek; Lundgren, Andreas; Karlsson Rosenthal, Christina

    2005-01-01

    The Cdc25 phosphatases play crucial roles in cell cycle progression by removing inhibitory phosphates from tyrosine and threonine residues of cyclin-dependent kinases. Cdc25A is an important regulator of the G1/S transition but functions also in the mitotic phase of the human cell cycle. In this paper, we investigate the sub-cellular localisation of exogenously expressed Cdc25A. We show that YFP-Cdc25A is localised both in the nucleus and the cytoplasm of HeLa cells and untransformed fibroblasts. Cell fusion assays and fluorescence loss in photobleaching (FLIP) assays reveal that the localisation is dynamic and the protein shuttles between the nucleus and the cytoplasm. We demonstrate that nuclear export of Cdc25A is partly mediated by an N-terminal nuclear export sequence (NES), in a manner not sensitive to the Exportin 1-inhibitor leptomycin B. A nuclear localisation signal (NLS) is also characterised, mutation of which leads to cytoplasmic localisation of Cdc25A. Our results imply that the Cdc25A phosphatase may interact with substrates and regulators both in the nucleus and the cytoplasm

  4. Description of a New Planktonic Mixotrophic Dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp from the Coastal Waters off Western Korea: Morphology, Pigments, and Ribosomal DNA Gene Sequence

    DEFF Research Database (Denmark)

    Kang, Nam Seon; Jeong, Hae Jin; Moestrup, Øjvind

    2010-01-01

    The mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. is described from living cells and from cells prepared by light, scanning electron, and transmission electron microscopy. In addition, sequences of the small subunit (SSU) and large subunit (LSU) rDNA and photosynthetic...... extension-like furrow. The cingulum is as wide as 0.2-0.3 x cell length and displaced by 0.2-0.3 x cell length. Cell length and width of live cells fed Amphidinium carterae were 8.4-19.3 and 6.1-16.0 mu m, respectively. Paragymnodinium shiwhaense does not have a nuclear envelope chamber nor a nuclear...... fibrous connective (NFC). Cells contain chloroplasts, nematocysts, trichocysts, and peduncle, though eyespots, pyrenoids, and pusules are absent. The main accessory pigment is peridinin. The sequence of the SSU rDNA of this dinoflagellate (GenBank AM408889) is 4% different from that of Gymnodinium...

  5. Heterochromatin diversity and its co-localization with 5S and 45S rDNA sites in chromosomes of four Maxillaria species (Orchidaceae

    Directory of Open Access Journals (Sweden)

    Juliano S. Cabral

    2006-01-01

    Full Text Available We investigated four orchids of the genus Maxillaria (M. discolor, M. acicularis, M. notylioglossa and M. desvauxiana in regard to the position of heterochromatin blocks as revealed using chromomycin A3 (CMA and 4'-6-diamidino-2-phenylindole (DAPI fluorochrome staining and 5S and 45S rDNA sites using fluorescence in situ hybridization (FISH. The species showed differences in chromosome number and a diversified pattern of CMA+ and DAPI+ bands, including heteromorphism for CMA+ bands. The 5S and 45S rDNA sites also varied in number and most of them were co-localized with CMA+ bands. The relationship between 5S rDNA sites and CMA+ bands was more evident in M. notylioglossa, in which the brighter CMA+ bands were associated with large 5S rDNA sites. However, not all 5S and 45S rDNA sites were co-localized with CMA+ bands, probably due to technical constraints. We compare these results to banding data from other species and suggest that not all blocks of tandemly repetitive sequences, such as 5S rDNA sites, can be observed as heterochromatin blocks.

  6. Explorability and predictability of the paleozoic sedimentary sequence beneath the Bruce nuclear site

    International Nuclear Information System (INIS)

    Parmenter, A.; Jensen, M.; Crowe, R.; Raven, K.

    2011-01-01

    Ontario Power Generation (OPG) is proposing to develop a Deep Geologic Repository (DGR) for the long-term management of its Low and Intermediate Level Waste (L&ILW) at the Bruce nuclear site located in the Municipality of Kincardine, Ontario. A 4-year program of geoscientific studies to assess the suitability of the 850 m thick Palaeozoic age sedimentary sequence beneath the site to host the DGR was completed in 2010. The studies provide evidence of a geologic setting in which the DGR concept would be safely implemented at a nominal depth of 680 m within the argillaceous limestone of the Cobourg Formation. This paper describes the geologic framework of the Bruce nuclear site with a focus on illustrating the high degree of stratigraphic continuity and traceability at site-specific and regional scales within the Ordovician sediments proposed to host and enclose the DGR. As part of the site-specific studies, a program of deep drilling/coring (6 boreholes) and in-situ testing through the sedimentary sequence was completed from 4 drill sites situated beyond the DGR footprint, approximately 1 km apart. Core logging reveals that the stratigraphic sequence comprises 34 distinct bedrock formations/members/units consistent with the known regional stratigraphic framework. These layered sedimentary formations dip 0.6 o (~10 m/km) to the southwest with highly uniform thicknesses both at the site- and regional-scale, particularly, the Ordovician sediments, which vary on the order of metres. The occurrence of steeply-dipping faults within the sedimentary sequence is not revealed through surface outcrop fracture mapping, micro-seismic (M ≥ 1) monitoring, inclined borehole coring or intersection of hydrothermal type dolomitized reservoir systems. Potential fault structures, interpreted from a 2-D seismic survey, were targeted by angled boreholes which found no evidence for their existence. Formation specific continuity is also evidence by the lateral traceability of physical rock

  7. Apparatus for measuring the nuclear radiation of a sequence of radioactive samples

    International Nuclear Information System (INIS)

    Lohr, W.; Berthold, F.; Allington, R.W.

    1977-01-01

    To measure the nuclear radiation of a sequence of radioactive samples, magazines that hold sample containers are removably positioned in shuttles, some of which are driven step-by-step by a toothed belt that engates racks on the sides of the shuttles from one compartment to another through a measuring station, with the shuttles that are being driven by the belt driving other shuttles not in engagement with the belt at that time. In the measuring station, the sample containers are released from the magazines one at a time through openings in their bottoms and lowered by a reciprocable support to a position adjacent to a radiation detector for the measurement, after which they are raised by the support to the magazine and the shuttle is driven one more step to the next position. 8 figures

  8. Image sequence analysis in nuclear medicine: (1) Parametric imaging using statistical modelling

    International Nuclear Information System (INIS)

    Liehn, J.C.; Hannequin, P.; Valeyre, J.

    1989-01-01

    This is a review of parametric imaging methods on Nuclear Medicine. A Parametric Image is an image in which each pixel value is a function of the value of the same pixel of an image sequence. The Local Model Method is the fitting of each pixel time activity curve by a model which parameter values form the Parametric Images. The Global Model Method is the modelling of the changes between two images. It is applied to image comparison. For both methods, the different models, the identification criterion, the optimization methods and the statistical properties of the images are discussed. The analysis of one or more Parametric Images is performed using 1D or 2D histograms. The statistically significant Parametric Images, (Images of significant Variances, Amplitudes and Differences) are also proposed [fr

  9. When molecules support morphology: Phylogenetic reconstruction of the family Onuphidae (Eunicida, Annelida) based on 16S rDNA and 18S rDNA.

    Science.gov (United States)

    Budaeva, Nataliya; Schepetov, Dmitry; Zanol, Joana; Neretina, Tatiana; Willassen, Endre

    2016-01-01

    Onuphid polychaetes are tubicolous marine worms commonly reported worldwide from intertidal areas to hadal depths. They often dominate in benthic communities and have economic importance in aquaculture and recreational fishing. Here we report the phylogeny of the family Onuphidae based on the combined analyses of nuclear (18S rDNA) and mitochondrial (16S rDNA) genes. Results of Bayesian and Maximum Likelihood analyses supported the monophyly of Onuphidae and its traditional subdivision into two monophyletic subfamilies: Onuphinae and Hyalinoeciinae. Ten of 22 recognized genera were monophyletic with strong node support; four more genera included in this study were either monotypic or represented by a single species. None of the genera appeared para- or polyphyletic and this indicates a strong congruence between the traditional morphology-based systematics of the family and the newly obtained molecular-based phylogenetic reconstructions. Intergeneric relationships within Hyalinoeciinae were not resolved. Two strongly supported monophyletic groups of genera were recovered within Onuphinae: ((Onuphis, Aponuphis), Diopatra, Paradiopatra) and (Hirsutonuphis, (Paxtonia, (Kinbergonuphis, Mooreonuphis))). A previously accepted hypothesis on the subdivision of Onuphinae into the Onuphis group of genera and the Diopatra group of genera was largely rejected. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  10. High-resolution whole-genome sequencing reveals that specific chromatin domains from most human chromosomes associate with nucleoli.

    Science.gov (United States)

    van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I

    2010-11-01

    The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.

  11. Isolation and analysis of high quality nuclear DNA with reduced organellar DNA for plant genome sequencing and resequencing

    Directory of Open Access Journals (Sweden)

    Zdepski Anna

    2011-05-01

    Full Text Available Abstract Background High throughput sequencing (HTS technologies have revolutionized the field of genomics by drastically reducing the cost of sequencing, making it feasible for individual labs to sequence or resequence plant genomes. Obtaining high quality, high molecular weight DNA from plants poses significant challenges due to the high copy number of chloroplast and mitochondrial DNA, as well as high levels of phenolic compounds and polysaccharides. Multiple methods have been used to isolate DNA from plants; the CTAB method is commonly used to isolate total cellular DNA from plants that contain nuclear DNA, as well as chloroplast and mitochondrial DNA. Alternatively, DNA can be isolated from nuclei to minimize chloroplast and mitochondrial DNA contamination. Results We describe optimized protocols for isolation of nuclear DNA from eight different plant species encompassing both monocot and eudicot species. These protocols use nuclei isolation to minimize chloroplast and mitochondrial DNA contamination. We also developed a protocol to determine the number of chloroplast and mitochondrial DNA copies relative to the nuclear DNA using quantitative real time PCR (qPCR. We compared DNA isolated from nuclei to total cellular DNA isolated with the CTAB method. As expected, DNA isolated from nuclei consistently yielded nuclear DNA with fewer chloroplast and mitochondrial DNA copies, as compared to the total cellular DNA prepared with the CTAB method. This protocol will allow for analysis of the quality and quantity of nuclear DNA before starting a plant whole genome sequencing or resequencing experiment. Conclusions Extracting high quality, high molecular weight nuclear DNA in plants has the potential to be a bottleneck in the era of whole genome sequencing and resequencing. The methods that are described here provide a framework for researchers to extract and quantify nuclear DNA in multiple types of plants.

  12. CORE: a phylogenetically-curated 16S rDNA database of the core oral microbiome.

    Directory of Open Access Journals (Sweden)

    Ann L Griffen

    2011-04-01

    Full Text Available Comparing bacterial 16S rDNA sequences to GenBank and other large public databases via BLAST often provides results of little use for identification and taxonomic assignment of the organisms of interest. The human microbiome, and in particular the oral microbiome, includes many taxa, and accurate identification of sequence data is essential for studies of these communities. For this purpose, a phylogenetically curated 16S rDNA database of the core oral microbiome, CORE, was developed. The goal was to include a comprehensive and minimally redundant representation of the bacteria that regularly reside in the human oral cavity with computationally robust classification at the level of species and genus. Clades of cultivated and uncultivated taxa were formed based on sequence analyses using multiple criteria, including maximum-likelihood-based topology and bootstrap support, genetic distance, and previous naming. A number of classification inconsistencies for previously named species, especially at the level of genus, were resolved. The performance of the CORE database for identifying clinical sequences was compared to that of three publicly available databases, GenBank nr/nt, RDP and HOMD, using a set of sequencing reads that had not been used in creation of the database. CORE offered improved performance compared to other public databases for identification of human oral bacterial 16S sequences by a number of criteria. In addition, the CORE database and phylogenetic tree provide a framework for measures of community divergence, and the focused size of the database offers advantages of efficiency for BLAST searching of large datasets. The CORE database is available as a searchable interface and for download at http://microbiome.osu.edu.

  13. Fine organization of genomic regions tagged to the 5S rDNA locus of the bread wheat 5B chromosome.

    Science.gov (United States)

    Sergeeva, Ekaterina M; Shcherban, Andrey B; Adonina, Irina G; Nesterov, Michail A; Beletsky, Alexey V; Rakitin, Andrey L; Mardanov, Andrey V; Ravin, Nikolai V; Salina, Elena A

    2017-11-14

    The multigene family encoding the 5S rRNA, one of the most important structurally-functional part of the large ribosomal subunit, is an obligate component of all eukaryotic genomes. 5S rDNA has long been a favored target for cytological and phylogenetic studies due to the inherent peculiarities of its structural organization, such as the tandem arrays of repetitive units and their high interspecific divergence. The complex polyploid nature of the genome of bread wheat, Triticum aestivum, and the technically difficult task of sequencing clusters of tandem repeats mean that the detailed organization of extended genomic regions containing 5S rRNA genes remains unclear. This is despite the recent progress made in wheat genomic sequencing. Using pyrosequencing of BAC clones, in this work we studied the organization of two distinct 5S rDNA-tagged regions of the 5BS chromosome of bread wheat. Three BAC-clones containing 5S rDNA were identified in the 5BS chromosome-specific BAC-library of Triticum aestivum. Using the results of pyrosequencing and assembling, we obtained six 5S rDNA- containing contigs with a total length of 140,417 bp, and two sets (pools) of individual 5S rDNA sequences belonging to separate, but closely located genomic regions on the 5BS chromosome. Both regions are characterized by the presence of approximately 70-80 copies of 5S rDNA, however, they are completely different in their structural organization. The first region contained highly diverged short-type 5S rDNA units that were disrupted by multiple insertions of transposable elements. The second region contained the more conserved long-type 5S rDNA, organized as a single tandem array. FISH using probes specific to both 5S rDNA unit types showed differences in the distribution and intensity of signals on the chromosomes of polyploid wheat species and their diploid progenitors. A detailed structural organization of two closely located 5S rDNA-tagged genomic regions on the 5BS chromosome of bread

  14. Neurospora ribosomal DNA sequences are indistinguishable within cell types but distinguishable among heterothallic species

    International Nuclear Information System (INIS)

    Chambers, C.; Dutta, S.K.

    1983-01-01

    High molecular nuclear DNAs were isolated from three developmental cell types of N. crassa: conidia, mycelia and germinated conidia, and from mycelial cells of two other heterothallic species, N. intermedia and N. sitophila. These nuclear DNAs were treated with several restriction enzymes: EcoR1, Bam H1, Hind III, Hinc II, Bgl II, Sma I and Pst 1. All seven restriction enzymes were tested on 0.7% agarose gels. EcoR1, Hind III, Pst 1, and Hinc II showed band differences among the species, but not among the cell types. Southern blot transfers of restricted DNA gels were then hybridized with 32 P-labelled pMF2 rDNAs (probe). This later DNA was prepared from N. crassa rDNA cloned into pBR322 plasmid, obtained from Dr. Robert Metzenberg of the University of Wisconsin. Autoradiograms of these hybrids between southern blots and probe DNA revealed similar rDNA band patterns confirming the observations on restriction gels. In the case of EcoR1 restriction analysis there were differences in fragments on 0.7% agarose gel, but after hybridization of southern blots no differences in band patterns were seen in autoradiograms. This raises the question whether the background bands were all of rDNA sequences. These studies are being continued using ITS (internal transcribed spacer) sequences of N. crassa rDNAs cloned in pBR322 plasmid

  15. Phylogeny, character evolution, and biogeography of Cuscuta (dodders; Convolvulaceae) inferred from coding plastid and nuclear sequences.

    Science.gov (United States)

    García, Miguel A; Costea, Mihai; Kuzmina, Maria; Stefanović, Saša

    2014-04-01

    The parasitic genus Cuscuta, containing some 200 species circumscribed traditionally in three subgenera, is nearly cosmopolitan, occurring in a wide range of habitats and hosts. Previous molecular studies, on subgenera Grammica and Cuscuta, delimited major clades within these groups. However, the sequences used were unalignable among subgenera, preventing the phylogenetic comparison across the genus. We conducted a broad phylogenetic study using rbcL and nrLSU sequences covering the morphological, physiological, and geographical diversity of Cuscuta. We used parsimony methods to reconstruct ancestral states for taxonomically important characters. Biogeographical inferences were obtained using statistical and Bayesian approaches. Four well-supported major clades are resolved. Two of them correspond to subgenera Monogynella and Grammica. Subgenus Cuscuta is paraphyletic, with section Pachystigma sister to subgenus Grammica. Previously described cases of strongly supported discordance between plastid and nuclear phylogenies, interpreted as reticulation events, are confirmed here and three new cases are detected. Dehiscent fruits and globose stigmas are inferred as ancestral character states, whereas the ancestral style number is ambiguous. Biogeographical reconstructions suggest an Old World origin for the genus and subsequent spread to the Americas as a consequence of one long-distance dispersal. Hybridization may play an important yet underestimated role in the evolution of Cuscuta. Our results disagree with scenarios of evolution (polarity) previously proposed for several taxonomically important morphological characters, and with their usage and significance. While several cases of long-distance dispersal are inferred, vicariance or dispersal to adjacent areas emerges as the dominant biogeographical pattern.

  16. Phylogenetic Relationships of Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Gobioninae Inferred from Multiple Nuclear Gene Sequences

    Directory of Open Access Journals (Sweden)

    Keun-Yong Kim

    2013-01-01

    Full Text Available Gobionine species belonging to the genera Pseudorasbora, Pseudopungtungia, and Pungtungia (Teleostei; Cypriniformes; Cyprinidae have been heavily studied because of problems on taxonomy, threats of extinction, invasion, and human health. Nucleotide sequences of three nuclear genes, that is, recombination activating protein gene 1 (rag1, recombination activating gene 2 (rag2, and early growth response 1 gene (egr1, from Pseudorasbora, Pseudopungtungia, and Pungtungia species residing in China, Japan, and Korea, were analyzed to elucidate their intergeneric and interspecific phylogenetic relationships. In the phylogenetic tree inferred from their multiple gene sequences, Pseudorasbora, Pseudopungtungia and Pungtungia species ramified into three phylogenetically distinct clades; the “tenuicorpa” clade composed of Pseudopungtungia tenuicorpa, the “parva” clade composed of all Pseudorasbora species/subspecies, and the “herzi” clade composed of Pseudopungtungia nigra, and Pungtungia herzi. The genus Pseudorasbora was recovered as monophyletic, while the genus Pseudopungtungia was recovered as polyphyletic. Our phylogenetic result implies the unstable taxonomic status of the genus Pseudopungtungia.

  17. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences

    OpenAIRE

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-01

    Background The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Results Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consi...

  18. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    Science.gov (United States)

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Specific nuclear localizing sequence directs two myosin isoforms to the cell nucleus in calmodulin-sensitive manner.

    Science.gov (United States)

    Dzijak, Rastislav; Yildirim, Sukriye; Kahle, Michal; Novák, Petr; Hnilicová, Jarmila; Venit, Tomáš; Hozák, Pavel

    2012-01-01

    Nuclear myosin I (NM1) was the first molecular motor identified in the cell nucleus. Together with nuclear actin, they participate in crucial nuclear events such as transcription, chromatin movements, and chromatin remodeling. NM1 is an isoform of myosin 1c (Myo1c) that was identified earlier and is known to act in the cytoplasm. NM1 differs from the "cytoplasmic" myosin 1c only by additional 16 amino acids at the N-terminus of the molecule. This amino acid stretch was therefore suggested to direct NM1 into the nucleus. We investigated the mechanism of nuclear import of NM1 in detail. Using over-expressed GFP chimeras encoding for truncated NM1 mutants, we identified a specific sequence that is necessary for its import to the nucleus. This novel nuclear localization sequence is placed within calmodulin-binding motif of NM1, thus it is present also in the Myo1c. We confirmed the presence of both isoforms in the nucleus by transfection of tagged NM1 and Myo1c constructs into cultured cells, and also by showing the presence of the endogenous Myo1c in purified nuclei of cells derived from knock-out mice lacking NM1. Using pull-down and co-immunoprecipitation assays we identified importin beta, importin 5 and importin 7 as nuclear transport receptors that bind NM1. Since the NLS sequence of NM1 lies within the region that also binds calmodulin we tested the influence of calmodulin on the localization of NM1. The presence of elevated levels of calmodulin interfered with nuclear localization of tagged NM1. We have shown that the novel specific NLS brings to the cell nucleus not only the "nuclear" isoform of myosin I (NM1 protein) but also its "cytoplasmic" isoform (Myo1c protein). This opens a new field for exploring functions of this molecular motor in nuclear processes, and for exploring the signals between cytoplasm and the nucleus.

  20. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides AT+CG in the mitogenome of Kamimuria wangi.

    Science.gov (United States)

    Seligmann, Hervé

    2016-07-01

    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

  1. Comparative genomics and repetitive sequence divergence in the species of diploid Nicotiana section Alatae.

    Science.gov (United States)

    Lim, K Yoong; Kovarik, Ales; Matyasek, Roman; Chase, Mark W; Knapp, Sandra; McCarthy, Elizabeth; Clarkson, James J; Leitch, Andrew R

    2006-12-01

    Combining phylogenetic reconstructions of species relationships with comparative genomic approaches is a powerful way to decipher evolutionary events associated with genome divergence. Here, we reconstruct the history of karyotype and tandem repeat evolution in species of diploid Nicotiana section Alatae. By analysis of plastid DNA, we resolved two clades with high bootstrap support, one containing N. alata, N. langsdorffii, N. forgetiana and N. bonariensis (called the n = 9 group) and another containing N. plumbaginifolia and N. longiflora (called the n = 10 group). Despite little plastid DNA sequence divergence, we observed, via fluorescent in situ hybridization, substantial chromosomal repatterning, including altered chromosome numbers, structure and distribution of repeats. Effort was focussed on 35S and 5S nuclear ribosomal DNA (rDNA) and the HRS60 satellite family of tandem repeats comprising the elements HRS60, NP3R and NP4R. We compared divergence of these repeats in diploids and polyploids of Nicotiana. There are dramatic shifts in the distribution of the satellite repeats and complete replacement of intergenic spacers (IGSs) of 35S rDNA associated with divergence of the species in section Alatae. We suggest that sequence homogenization has replaced HRS60 family repeats at sub-telomeric regions, but that this process may not occur, or occurs more slowly, when the repeats are found at intercalary locations. Sequence homogenization acts more rapidly (at least two orders of magnitude) on 35S rDNA than 5S rDNA and sub-telomeric satellite sequences. This rapid rate of divergence is analogous to that found in polyploid species, and is therefore, in plants, not only associated with polyploidy.

  2. Diversification in insular plants: Inferring the phylogenetic relationship in Aeonium (Crassulaceae) using ITS sequences of nuclear ribosomal DNA

    DEFF Research Database (Denmark)

    Jorgensen, T.H.; Frydenberg, J.

    1999-01-01

    The ITS regions of nuclear ribosomal DNA were sequenced in 37 species of the genus Aeonium. A phylogeny obtained through the use of parsimony agrees to some extent with the sectional division of the genus and confirms the position of two newly described species. It also suggests the potential imp...

  3. Population structure of the African savannah elephant inferred from mitochondrial control region sequences and nuclear microsatellite loci

    DEFF Research Database (Denmark)

    Nyakaana, S; Arctander, P; Siegismund, H R

    2002-01-01

    Two hundred and thirty-six mitochondrial DNA nucleotide sequences were used in combination with polymorphism at four nuclear microsatellite loci to assess the amount and distribution of genetic variation within and between African savannah elephants. They were sampled from 11 localities in easter...

  4. Trichostrongylus colubriformis rDNA polymorphism associated with arrested development

    Czech Academy of Sciences Publication Activity Database

    Langrová, I.; Zouhar, M.; Vadlejch, J.; Borovský, M.; Jankovská, I.; Lytvynets, Andrej

    2008-01-01

    Roč. 103, č. 2 (2008), s. 401-403 ISSN 0932-0113 Institutional research plan: CEZ:AV0Z50110509 Keywords : arrested development * polymorphism * rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.473, year: 2008

  5. A dated molecular phylogeny of manta and devil rays (Mobulidae) based on mitogenome and nuclear sequences.

    Science.gov (United States)

    Poortvliet, Marloes; Olsen, Jeanine L; Croll, Donald A; Bernardi, Giacomo; Newton, Kelly; Kollias, Spyros; O'Sullivan, John; Fernando, Daniel; Stevens, Guy; Galván Magaña, Felipe; Seret, Bernard; Wintner, Sabine; Hoarau, Galice

    2015-02-01

    Manta and devil rays are an iconic group of globally distributed pelagic filter feeders, yet their evolutionary history remains enigmatic. We employed next generation sequencing of mitogenomes for nine of the 11 recognized species and two outgroups; as well as additional Sanger sequencing of two mitochondrial and two nuclear genes in an extended taxon sampling set. Analysis of the mitogenome coding regions in a Maximum Likelihood and Bayesian framework provided a well-resolved phylogeny. The deepest divergences distinguished three clades with high support, one containing Manta birostris, Manta alfredi, Mobula tarapacana, Mobula japanica and Mobula mobular; one containing Mobula kuhlii, Mobula eregoodootenkee and Mobula thurstoni; and one containing Mobula munkiana, Mobula hypostoma and Mobula rochebrunei. Mobula remains paraphyletic with the inclusion of Manta, a result that is in agreement with previous studies based on molecular and morphological data. A fossil-calibrated Bayesian random local clock analysis suggests that mobulids diverged from Rhinoptera around 30 Mya. Subsequent divergences are characterized by long internodes followed by short bursts of speciation extending from an initial episode of divergence in the Early and Middle Miocene (19-17 Mya) to a second episode during the Pliocene and Pleistocene (3.6 Mya - recent). Estimates of divergence dates overlap significantly with periods of global warming, during which upwelling intensity - and related high primary productivity in upwelling regions - decreased markedly. These periods are hypothesized to have led to fragmentation and isolation of feeding regions leading to possible regional extinctions, as well as the promotion of allopatric speciation. The closely shared evolutionary history of mobulids in combination with ongoing threats from fisheries and climate change effects on upwelling and food supply, reinforces the case for greater protection of this charismatic family of pelagic filter feeders

  6. Contrasting patterns of evolution of 45S and 5S rDNA families uncover new aspects in the genome constitution of the agronomically important grass Thinopyrum intermedium (Triticeae).

    Science.gov (United States)

    Mahelka, Václav; Kopecky, David; Baum, Bernard R

    2013-09-01

    We employed sequencing of clones and in situ hybridization (genomic and fluorescent in situ hybridization [GISH and rDNA-FISH]) to characterize both the sequence variation and genomic organization of 45S (herein ITS1-5.8S-ITS2 region) and 5S (5S gene + nontranscribed spacer) ribosomal DNA (rDNA) families in the allohexaploid grass Thinopyrum intermedium. Both rDNA families are organized within several rDNA loci within all three subgenomes of the allohexaploid species. Both families have undergone different patterns of evolution. The 45S rDNA family has evolved in a concerted manner: internal transcribed spacer (ITS) sequences residing within the arrays of two subgenomes out of three got homogenized toward one major ribotype, whereas the third subgenome contained a minor proportion of distinct unhomogenized copies. Homogenization mechanisms such as unequal crossover and/or gene conversion were coupled with the loss of certain 45S rDNA loci. Unlike in the 45S family, the data suggest that neither interlocus homogenization among homeologous chromosomes nor locus loss occurred in 5S rDNA. Consistently with other Triticeae, the 5S rDNA family in intermediate wheatgrass comprised two distinct array types-the long- and short-spacer unit classes. Within the long and short units, we distinguished five and three different types, respectively, likely representing homeologous unit classes donated by putative parental species. Although the major ITS ribotype corresponds in our phylogenetic analysis to the E-genome species, the minor ribotype corresponds to Dasypyrum. 5S sequences suggested the contributions from Pseudoroegneria, Dasypyrum, and Aegilops. The contribution from Aegilops to the intermediate wheatgrass' genome is a new finding with implications in wheat improvement. We discuss rDNA evolution and potential origin of intermediate wheatgrass.

  7. Comparing the potential for identification of lactobacillus spp. of 16s rDNA variable regions

    International Nuclear Information System (INIS)

    Riano Pachon, Diego Mauricio; Vanegas Lopez, Maria Consuelo; Gonzalez Garcia, Laura Natalia

    2013-01-01

    16s rDNA is used for bacterial identification because its variation rate between species allows differentiation. The gene for this ribosomal subunit has 9 variable regions and some of them give more information than others. We were interested in evaluating the potential for species identification of each region and their combinations. We extracted the V1 to V8 regions of 16s rDNA from different strains and species of Lactobacillus and analyzed them using STAP (ss-RNA Taxonomy Assigning Pipeline) and RDP (Ribosomal Database Project) multiclassifier packages. Phylogenetic trees obtained by maximum likelihood analyses were compared. Classification results show that many regions give the correct genus classification using RDP and STAP; however they are not enough to classify up to the level of species. V5V6 region presents the highest quantity of informative fragments but also present the highest rate of false negatives. V1V3 region presents the highest rate of true positives (species) using STAP and the region V5V8 in RDP (genus).The phylogenetic result shows that the reference topology could be obtained using different combination of regions as V1V3 and V1V8.The experimental validation was done using commercial strains from a probiotic tampon. Sequencing analysis show that the V1V3 region gives the same information and result as the complete 16s rDNA; the three isolated strains correspond to the strains indicated in the product. We conclude that the V1V3 region is the minimum required region to classify Lactobacillus spp. in the correct way and this region is useful in metagenomics to analyze probiotics samples.

  8. A Portrait of Ribosomal DNA Contacts with Hi-C Reveals 5S and 45S rDNA Anchoring Points in the Folded Human Genome.

    Science.gov (United States)

    Yu, Shoukai; Lemos, Bernardo

    2016-12-31

    Ribosomal RNAs (rRNAs) account for >60% of all RNAs in eukaryotic cells and are encoded in the ribosomal DNA (rDNA) arrays. The rRNAs are produced from two sets of loci: the 5S rDNA array resides exclusively on human chromosome 1, whereas the 45S rDNA array resides on the short arm of five human acrocentric chromosomes. The 45S rDNA gives origin to the nucleolus, the nuclear organelle that is the site of ribosome biogenesis. Intriguingly, 5S and 45S rDNA arrays exhibit correlated copy number variation in lymphoblastoid cells (LCLs). Here we examined the genomic architecture and repeat content of the 5S and 45S rDNA arrays in multiple human genome assemblies (including PacBio MHAP assembly) and ascertained contacts between the rDNA arrays and the rest of the genome using Hi-C datasets from two human cell lines (erythroleukemia K562 and lymphoblastoid cells). Our analyses revealed that 5S and 45S arrays each have thousands of contacts in the folded genome, with rDNA-associated regions and genes dispersed across all chromosomes. The rDNA contact map displayed conserved and disparate features between two cell lines, and pointed to specific chromosomes, genomic regions, and genes with evidence of spatial proximity to the rDNA arrays; the data also showed a lack of direct physical interaction between the 5S and 45S rDNA arrays. Finally, the analysis identified an intriguing organization in the 5S array with Alu and 5S elements adjacent to one another and organized in opposite orientation along the array. Portraits of genome folding centered on the ribosomal DNA array could help understand the emergence of concerted variation, the control of 5S and 45S expression, as well as provide insights into an organelle that contributes to the spatial localization of human chromosomes during interphase. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  9. Evolution of rDNA in Nicotiana allopolyploids: A potential link between rDNa homogenization and epigenetics

    Czech Academy of Sciences Publication Activity Database

    Kovařík, Aleš; Nešpor Dadejová, Martina; Lim, Y.K.; Chase, M.W.; Clarkson, J.J.; Knapp, S.; Leitch, A.R.

    2008-01-01

    Roč. 101, č. 6 (2008), s. 815-823 ISSN 0305-7364 R&D Projects: GA ČR(CZ) GA521/07/0116 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : rDNA * allopolyploidy * evolution-Nicotiana Subject RIV: BO - Biophysics Impact factor: 2.755, year: 2008

  10. Hedysarum L. (Fabaceae: Hedysareae) Is Not Monophyletic - Evidence from Phylogenetic Analyses Based on Five Nuclear and Five Plastid Sequences.

    Science.gov (United States)

    Liu, Pei-Liang; Wen, Jun; Duan, Lei; Arslan, Emine; Ertuğrul, Kuddisi; Chang, Zhao-Yang

    2017-01-01

    The legume family (Fabaceae) exhibits a high level of species diversity and evolutionary success worldwide. Previous phylogenetic studies of the genus Hedysarum L. (Fabaceae: Hedysareae) showed that the nuclear and the plastid topologies might be incongruent, and the systematic position of the Hedysarum sect. Stracheya clade was uncertain. In this study, phylogenetic relationships of Hedysarum were investigated based on the nuclear ITS, ETS, PGDH, SQD1, TRPT and the plastid psbA-trnH, trnC-petN, trnL-trnF, trnS-trnG, petN-psbM sequences. Both nuclear and plastid data support two major lineages in Hedysarum: the Hedysarum s.s. clade and the Sartoria clade. In the nuclear tree, Hedysarum is biphyletic with the Hedysarum s.s. clade sister to the Corethrodendron + Eversmannia + Greuteria + Onobrychis clade (the CEGO clade), whereas the Sartoria clade is sister to the genus Taverniera DC. In the plastid tree, Hedysarum is monophyletic and sister to Taverniera. The incongruent position of the Hedysarum s.s. clade between the nuclear and plastid trees may be best explained by a chloroplast capture hypothesis via introgression. The Hedysarum sect. Stracheya clade is resolved as sister to the H. sect. Hedysarum clade in both nuclear and plastid trees, and our analyses support merging Stracheya into Hedysarum. Based on our new evidence from multiple sequences, Hedysarum is not monophyletic, and its generic delimitation needs to be reconsidered.

  11. Hedysarum L. (Fabaceae: Hedysareae) Is Not Monophyletic – Evidence from Phylogenetic Analyses Based on Five Nuclear and Five Plastid Sequences

    Science.gov (United States)

    Liu, Pei-Liang; Wen, Jun; Duan, Lei; Arslan, Emine; Ertuğrul, Kuddisi; Chang, Zhao-Yang

    2017-01-01

    The legume family (Fabaceae) exhibits a high level of species diversity and evolutionary success worldwide. Previous phylogenetic studies of the genus Hedysarum L. (Fabaceae: Hedysareae) showed that the nuclear and the plastid topologies might be incongruent, and the systematic position of the Hedysarum sect. Stracheya clade was uncertain. In this study, phylogenetic relationships of Hedysarum were investigated based on the nuclear ITS, ETS, PGDH, SQD1, TRPT and the plastid psbA-trnH, trnC-petN, trnL-trnF, trnS-trnG, petN-psbM sequences. Both nuclear and plastid data support two major lineages in Hedysarum: the Hedysarum s.s. clade and the Sartoria clade. In the nuclear tree, Hedysarum is biphyletic with the Hedysarum s.s. clade sister to the Corethrodendron + Eversmannia + Greuteria + Onobrychis clade (the CEGO clade), whereas the Sartoria clade is sister to the genus Taverniera DC. In the plastid tree, Hedysarum is monophyletic and sister to Taverniera. The incongruent position of the Hedysarum s.s. clade between the nuclear and plastid trees may be best explained by a chloroplast capture hypothesis via introgression. The Hedysarum sect. Stracheya clade is resolved as sister to the H. sect. Hedysarum clade in both nuclear and plastid trees, and our analyses support merging Stracheya into Hedysarum. Based on our new evidence from multiple sequences, Hedysarum is not monophyletic, and its generic delimitation needs to be reconsidered. PMID:28122062

  12. Nuclear Trafficking of the Rabies Virus Interferon Antagonist P-Protein Is Regulated by an Importin-Binding Nuclear Localization Sequence in the C-Terminal Domain.

    Directory of Open Access Journals (Sweden)

    Caitlin L Rowe

    Full Text Available Rabies virus P-protein is expressed as five isoforms (P1-P5 which undergo nucleocytoplasmic trafficking important to roles in immune evasion. Although nuclear import of P3 is known to be mediated by an importin (IMP-recognised nuclear localization sequence in the N-terminal region (N-NLS, the mechanisms underlying nuclear import of other P isoforms in which the N-NLS is inactive or has been deleted have remained unresolved. Based on the previous observation that mutation of basic residues K214/R260 of the P-protein C-terminal domain (P-CTD can result in nuclear exclusion of P3, we used live cell imaging, protein interaction analysis and in vitro nuclear transport assays to examine in detail the nuclear trafficking properties of this domain. We find that the effect of mutation of K214/R260 on P3 is largely dependent on nuclear export, suggesting that nuclear exclusion of mutated P3 involves the P-CTD-localized nuclear export sequence (C-NES. However, assays using cells in which nuclear export is pharmacologically inhibited indicate that these mutations significantly inhibit P3 nuclear accumulation and, importantly, prevent nuclear accumulation of P1, suggestive of effects on NLS-mediated import activity in these isoforms. Consistent with this, molecular binding and transport assays indicate that the P-CTD mediates IMPα2/IMPβ1-dependent nuclear import by conferring direct binding to the IMPα2/IMPβ1 heterodimer, as well as to a truncated form of IMPα2 lacking the IMPβ-binding autoinhibitory domain (ΔIBB-IMPα2, and IMPβ1 alone. These properties are all dependent on K214 and R260. This provides the first evidence that P-CTD contains a genuine IMP-binding NLS, and establishes the mechanism by which P-protein isoforms other than P3 can be imported to the nucleus. These data underpin a refined model for P-protein trafficking that involves the concerted action of multiple NESs and IMP-binding NLSs, and highlight the intricate regulation of P

  13. Nuclear DNA sequences from the Middle Pleistocene Sima de los Huesos hominins.

    Science.gov (United States)

    Meyer, Matthias; Arsuaga, Juan-Luis; de Filippo, Cesare; Nagel, Sarah; Aximu-Petri, Ayinuer; Nickel, Birgit; Martínez, Ignacio; Gracia, Ana; Bermúdez de Castro, José María; Carbonell, Eudald; Viola, Bence; Kelso, Janet; Prüfer, Kay; Pääbo, Svante

    2016-03-24

    A unique assemblage of 28 hominin individuals, found in Sima de los Huesos in the Sierra de Atapuerca in Spain, has recently been dated to approximately 430,000 years ago. An interesting question is how these Middle Pleistocene hominins were related to those who lived in the Late Pleistocene epoch, in particular to Neanderthals in western Eurasia and to Denisovans, a sister group of Neanderthals so far known only from southern Siberia. While the Sima de los Huesos hominins share some derived morphological features with Neanderthals, the mitochondrial genome retrieved from one individual from Sima de los Huesos is more closely related to the mitochondrial DNA of Denisovans than to that of Neanderthals. However, since the mitochondrial DNA does not reveal the full picture of relationships among populations, we have investigated DNA preservation in several individuals found at Sima de los Huesos. Here we recover nuclear DNA sequences from two specimens, which show that the Sima de los Huesos hominins were related to Neanderthals rather than to Denisovans, indicating that the population divergence between Neanderthals and Denisovans predates 430,000 years ago. A mitochondrial DNA recovered from one of the specimens shares the previously described relationship to Denisovan mitochondrial DNAs, suggesting, among other possibilities, that the mitochondrial DNA gene pool of Neanderthals turned over later in their history.

  14. A new hypothesis of squamate evolutionary relationships from nuclear and mitochondrial DNA sequence data

    Energy Technology Data Exchange (ETDEWEB)

    Townsend, Ted M.; Larson, Allan; Louis, Edward; Macey, J. Robert

    2004-05-19

    Squamate reptiles serve as model systems for evolutionary studies of a variety of morphological and behavioral traits, and phylogeny is crucial to many generalizations derived from such studies. Specifically, the traditional dichotomy between Iguania and Scleroglossa has been correlated with major evolutionary shifts within Squamata. We present a molecular phylogenetic study of squamates using DNA sequence data from the nuclear genes RAG-1 and c-mos and the mitochondrial ND2 region, sampling all major clades and most major subclades. Monophyly of Iguania, Anguimorpha, and almost all currently recognized squamate families is strongly supported. However, monophyly is rejected for Scleroglossa, Varanoidea, and several other higher taxa, and Iguania is highly nested within Squamata. Limblessness evolved independently in snakes, dibamids, and amphisbaenians, suggesting widespread morphological convergence or parallelism in limbless, burrowing forms. Amphisbaenians are the sister group of lacertids, and snakes are grouped with iguanians and anguimorphs. Dibamids diverged early in squamate evolutionary history. Xantusiidae is the sister taxon of Cordylidae. Studies of functional tongue morphology and feeding mode have found significant differences between Scleroglossa and Iguania, and our finding of a nonmonophyletic Scleroglossa and a highly nested Iguania suggest that similar states evolved separately in Sphenodon and Iguania, and that jaw prehension is the ancestral feeding mode in squamates.

  15. Phylogeographic structure of cotton pest Adelphocoris suturalis (Hemiptera: Miridae): strong subdivision in China inferred from mtDNA and rDNA ITS markers

    OpenAIRE

    Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H.; Cai, Wanzhi

    2015-01-01

    Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populatio...

  16. Chromosomal Locations of 5S and 45S rDNA in Gossypium Genus and Its Phylogenetic Implications Revealed by FISH.

    Science.gov (United States)

    Gan, Yimei; Liu, Fang; Chen, Dan; Wu, Qiong; Qin, Qin; Wang, Chunying; Li, Shaohui; Zhang, Xiangdi; Wang, Yuhong; Wang, Kunbo

    2013-01-01

    We investigated the locations of 5S and 45S rDNA in Gossypium diploid A, B, D, E, F, G genomes and tetraploid genome (AD) using multi-probe fluorescent in situ hybridization (FISH) for evolution analysis in Gossypium genus. The rDNA numbers and sizes, and synteny relationships between 5S and 45S were revealed using 5S and 45S as double-probe for all species, and the rDNA-bearing chromosomes were identified for A, D and AD genomes with one more probe that is single-chromosome-specific BAC clone from G. hirsutum (A1D1). Two to four 45S and one 5S loci were found in diploid-species except two 5S loci in G. incanum (E4), the same as that in tetraploid species. The 45S on the 7th and 9th chromosomes and the 5S on the 9th chromosomes seemed to be conserved in A, D and AD genomes. In the species of B, E, F and G genomes, the rDNA numbers, sizes, and synteny relationships were first reported in this paper. The rDNA pattern agrees with previously reported phylogenetic history with some disagreements. Combined with the whole-genome sequencing data from G. raimondii (D5) and the conserved cotton karyotype, it is suggested that the expansion, decrease and transposition of rDNA other than chromosome rearrangements might occur during the Gossypium evolution.

  17. A Nuclear Ribosomal DNA Phylogeny of Acer Inferred with Maximum Likelihood, Splits Graphs, and Motif Analysis of 606 Sequences

    Science.gov (United States)

    Grimm, Guido W.; Renner, Susanne S.; Stamatakis, Alexandros; Hemleben, Vera

    2007-01-01

    The multi-copy internal transcribed spacer (ITS) region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML) and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation) instead of the full (partly redundant) original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994) 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly. PMID:19455198

  18. A Nuclear Ribosomal DNA Phylogeny of Acer Inferred with Maximum Likelihood, Splits Graphs, and Motif Analysis of 606 Sequences

    Directory of Open Access Journals (Sweden)

    Guido W. Grimm

    2006-01-01

    Full Text Available The multi-copy internal transcribed spacer (ITS region of nuclear ribosomal DNA is widely used to infer phylogenetic relationships among closely related taxa. Here we use maximum likelihood (ML and splits graph analyses to extract phylogenetic information from ~ 600 mostly cloned ITS sequences, representing 81 species and subspecies of Acer, and both species of its sister Dipteronia. Additional analyses compared sequence motifs in Acer and several hundred Anacardiaceae, Burseraceae, Meliaceae, Rutaceae, and Sapindaceae ITS sequences in GenBank. We also assessed the effects of using smaller data sets of consensus sequences with ambiguity coding (accounting for within-species variation instead of the full (partly redundant original sequences. Neighbor-nets and bipartition networks were used to visualize conflict among character state patterns. Species clusters observed in the trees and networks largely agree with morphology-based classifications; of de Jong’s (1994 16 sections, nine are supported in neighbor-net and bipartition networks, and ten by sequence motifs and the ML tree; of his 19 series, 14 are supported in networks, motifs, and the ML tree. Most nodes had higher bootstrap support with matrices of 105 or 40 consensus sequences than with the original matrix. Within-taxon ITS divergence did not differ between diploid and polyploid Acer, and there was little evidence of differentiated parental ITS haplotypes, suggesting that concerted evolution in Acer acts rapidly.

  19. Bacterial diversity in a soil sample from Uranium mining waste pile as estimated via a culture-independent 16S rDNA approach

    International Nuclear Information System (INIS)

    Satchanska, G.; Golovinsky, E.; Selenska-Pobell, S.

    2004-01-01

    Bacterial diversity was studied in a soil sample collected from a uranium mining waste pile situated near the town of Johanngeorgenstadt, Germany. As estimated by ICP-MS analysis the studied sample was highly contaminated with Fe, Al, Mn, Zn, As, Pb and U. The 16S rDNA retrieval, applied in this study, demonstrated that more than the half of the clones of the constructed 16S rDNA library were represented by individual RFLP profiles. This indicates that the composition of the bacterial community in the sample was very complex. However, several 16S rDNA RFLP groups were found to be predominant and they were subjected to a sequence analysis. The most predominant group, which represented about 13% of the clones of the 16S rDNA library, was affiliated with the Holophaga/Acidobacterium phylum. Significant was also the number of the proteobacterial sequences which were distributed in one predominant α-proteobacterial cluster representing 11% of the total number of clones and in two equal-sized β- and γ-proteobacterial clusters representing each 6% of the clones. Two smaller groups representing both 2% of the clones were affiliated with Nitrospira and with the novel division WS3. Three of the analysed sequences were evaluated as a novel, not yet described lineage and one as a putative chimera. (authors)

  20. Evolutionary Dynamics of 5S rDNA and Recurrent Association of Transposable Elements in Electric Fish of the Family Gymnotidae (Gymnotiformes): The Case of Gymnotus mamiraua.

    Science.gov (United States)

    da Silva, Maelin; Barbosa, Patricia; Artoni, Roberto F; Feldberg, Eliana

    2016-01-01

    Gymnotidae is a family of electric fish endemic to the Neotropics consisting of 2 genera: Electrophorus and Gymnotus. The genus Gymnotus is widely distributed and is found in all of the major Brazilian river systems. Physical and molecular mapping data for the ribosomal DNA (rDNA) in this genus are still scarce, with its chromosomal location known in only 11 species. As other species of Gymnotus with 2n = 54 chromosomes from the Paraná-Paraguay basin, G. mamiraua was found to have a large number of 5S rDNA sites. Isolation and cloning of the 5S rDNA sequences from G. mamiraua identified a fragment of a transposable element similar to the Tc1/mariner transposon associated with a non-transcribed spacer. Double fluorescence in situ hybridization analysis of this element and the 5S rDNA showed that they were colocalized on several chromosomes, in addition to acting as nonsyntenic markers on others. Our data show the association between these sequences and suggest that the Tc1 retrotransposon may be the agent that drives the spread of these 5S rDNA-like sequences in the G. mamiraua genome. © 2016 S. Karger AG, Basel.

  1. Effect of preemptive weld overlay sequence on residual stress distribution for dissimilar metal weld of Kori nuclear power plant pressurizer

    Energy Technology Data Exchange (ETDEWEB)

    Bae, Hong Yeol; Song, Tae Kwang; Chun, Yun Bae; Oh, Chang Young; Kim, Yun Jae [Korea Univ., Seoul (Korea, Republic of); Lee, Kyoung Soo; Park, Chi Yong [Korea Electric Power Research Institute, Daejeon (Korea, Republic of)

    2008-07-01

    Weld overlay is one of the residual stress mitigation method which arrest crack. An overlay weld sued in this manner is termed a Preemptive Weld OverLay(PWOL). PWOL was good for distribution of residual stress of Dissimilar Metal Weld(DMW) by previous research. Because range of overlay welding is wide relatively, residual stress distribution on PWR is affected by welding sequence. In order to examine the effect of welding sequence, PWOL was applied to a specific DMW of KORI nuclear power plant by finite element analysis method. As a result, the welding direction that from nozzle to pipe is better good for residual stress distribution on PWR.

  2. Effect of preemptive weld overlay sequence on residual stress distribution for dissimilar metal weld of Kori nuclear power plant pressurizer

    International Nuclear Information System (INIS)

    Bae, Hong Yeol; Song, Tae Kwang; Chun, Yun Bae; Oh, Chang Young; Kim, Yun Jae; Lee, Kyoung Soo; Park, Chi Yong

    2008-01-01

    Weld overlay is one of the residual stress mitigation method which arrest crack. An overlay weld sued in this manner is termed a Preemptive Weld OverLay(PWOL). PWOL was good for distribution of residual stress of Dissimilar Metal Weld(DMW) by previous research. Because range of overlay welding is wide relatively, residual stress distribution on PWR is affected by welding sequence. In order to examine the effect of welding sequence, PWOL was applied to a specific DMW of KORI nuclear power plant by finite element analysis method. As a result, the welding direction that from nozzle to pipe is better good for residual stress distribution on PWR

  3. Taxonomic confirmation of mud crab species (genus Scylla) in Bangladesh by nuclear and mitochondrial DNA markers.

    Science.gov (United States)

    Sarower, Mohammed Golam; Shahriar, Sheik Istiak Md; Nakamura, Hiromasa; Rouf, Muhammad Abdur; Okada, Shigeru

    2017-11-01

    Taxonomy of mud crabs genus Scylla has been misidentified for several years due to their high morphological plasticity. Several reports concerning mud crab have been published with misleading identification in Bangladesh. In this study, partial fragments of nuclear and mitochondrial DNA of Scylla species obtained from four locations along the Bangladesh coast were used to resolve taxonomical ambiguity of mud crab species. A single PCR product from the nuclear first internal transcribed spacer (ITS-1) marker and phylogenetic trees constructed based on 16S rDNA sequences indicated that all Scylla species obtained in this study were S. olivacea. Both molecular data and morphological characters revealed that S. olivacea is the only major species in Bangladesh coastal waters. Further, the 16S rDNA haplotypes significantly differed with known S. serrata by 33%. From this study it is clear that 'S. serrata' commonly reported from Bangladesh should be S. olivacea.

  4. Short Interspersed Nuclear Element (SINE Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293.

    Directory of Open Access Journals (Sweden)

    Lakkhana Kanhayuwa

    Full Text Available Novel families of short interspersed nuclear element (SINE sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.

  5. Short Interspersed Nuclear Element (SINE) Sequences in the Genome of the Human Pathogenic Fungus Aspergillus fumigatus Af293.

    Science.gov (United States)

    Kanhayuwa, Lakkhana; Coutts, Robert H A

    2016-01-01

    Novel families of short interspersed nuclear element (SINE) sequences in the human pathogenic fungus Aspergillus fumigatus, clinical isolate Af293, were identified and categorised into tRNA-related and 5S rRNA-related SINEs. Eight predicted tRNA-related SINE families originating from different tRNAs, and nominated as AfuSINE2 sequences, contained target site duplications of short direct repeat sequences (4-14 bp) flanking the elements, an extended tRNA-unrelated region and typical features of RNA polymerase III promoter sequences. The elements ranged in size from 140-493 bp and were present in low copy number in the genome and five out of eight were actively transcribed. One putative tRNAArg-derived sequence, AfuSINE2-1a possessed a unique feature of repeated trinucleotide ACT residues at its 3'-terminus. This element was similar in sequence to the I-4_AO element found in A. oryzae and an I-1_AF long nuclear interspersed element-like sequence identified in A. fumigatus Af293. Families of 5S rRNA-related SINE sequences, nominated as AfuSINE3, were also identified and their 5'-5S rRNA-related regions show 50-65% and 60-75% similarity to respectively A. fumigatus 5S rRNAs and SINE3-1_AO found in A. oryzae. A. fumigatus Af293 contains five copies of AfuSINE3 sequences ranging in size from 259-343 bp and two out of five AfuSINE3 sequences were actively transcribed. Investigations on AfuSINE distribution in the fungal genome revealed that the elements are enriched in pericentromeric and subtelomeric regions and inserted within gene-rich regions. We also demonstrated that some, but not all, AfuSINE sequences are targeted by host RNA silencing mechanisms. Finally, we demonstrated that infection of the fungus with mycoviruses had no apparent effects on SINE activity.

  6. Phylogenetic relationships and timing of diversification in gonorynchiform fishes inferred using nuclear gene DNA sequences (Teleostei: Ostariophysi).

    Science.gov (United States)

    Near, Thomas J; Dornburg, Alex; Friedman, Matt

    2014-11-01

    The Gonorynchiformes are the sister lineage of the species-rich Otophysi and provide important insights into the diversification of ostariophysan fishes. Phylogenies of gonorynchiforms inferred using morphological characters and mtDNA gene sequences provide differing resolutions with regard to the sister lineage of all other gonorynchiforms (Chanos vs. Gonorynchus) and support for monophyly of the two miniaturized lineages Cromeria and Grasseichthys. In this study the phylogeny and divergence times of gonorynchiforms are investigated with DNA sequences sampled from nine nuclear genes and a published morphological character matrix. Bayesian phylogenetic analyses reveal substantial congruence among individual gene trees with inferences from eight genes placing Gonorynchus as the sister lineage to all other gonorynchiforms. Seven gene trees resolve Cromeria and Grasseichthys as a clade, supporting previous inferences using morphological characters. Phylogenies resulting from either concatenating the nuclear genes, performing a multispecies coalescent species tree analysis, or combining the morphological and nuclear gene DNA sequences resolve Gonorynchus as the living sister lineage of all other gonorynchiforms, strongly support the monophyly of Cromeria and Grasseichthys, and resolve a clade containing Parakneria, Cromeria, and Grasseichthys. The morphological dataset, which includes 13 gonorynchiform fossil taxa that range in age from Early Cretaceous to Eocene, was analyzed in combination with DNA sequences from the nine nuclear genes and a relaxed molecular clock to estimate times of evolutionary divergence. This "tip dating" strategy accommodates uncertainty in the phylogenetic resolution of fossil taxa that provide calibration information in the relaxed molecular clock analysis. The estimated age of the most recent common ancestor (MRCA) of living gonorynchiforms is slightly older than estimates from previous node dating efforts, but the molecular tip dating

  7. Insulin-induced translocation of IR to the nucleus in insulin responsive cells requires a nuclear translocation sequence.

    Science.gov (United States)

    Kesten, Dov; Horovitz-Fried, Miriam; Brutman-Barazani, Tamar; Sampson, Sanford R

    2018-04-01

    Insulin binding to its cell surface receptor (IR) activates a cascade of events leading to its biological effects. The Insulin-IR complex is rapidly internalized and then is either recycled back to the plasma membrane or sent to lysosomes for degradation. Although most of the receptor is recycled or degraded, a small amount may escape this pathway and migrate to the nucleus of the cell where it might be important in promulgation of receptor signals. In this study we explored the mechanism by which insulin induces IR translocation to the cell nucleus. Experiments were performed cultured L6 myoblasts, AML liver cells and 3T3-L1 adipocytes. Insulin treatment induced a rapid increase in nuclear IR protein levels within 2 to 5 min. Treatment with WGA, an inhibitor of nuclear import, reduced insulin-induced increases nuclear IR protein; IR was, however, translocated to a perinuclear location. Bioinformatics tools predicted a potential nuclear localization sequence (NLS) on IR. Immunofluorescence staining showed that a point mutation on the predicted NLS blocked insulin-induced IR nuclear translocation. In addition, blockade of nuclear IR activation in isolated nuclei by an IR blocking antibody abrogated insulin-induced increases in IR tyrosine phosphorylation and nuclear PKCδ levels. Furthermore, over expression of mutated IR reduced insulin-induced glucose uptake and PKB phosphorylation. When added to isolated nuclei, insulin induced IR phosphorylation but had no effect on nuclear IR protein levels. These results raise questions regarding the possible role of nuclear IR in IR signaling and insulin resistance. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    Directory of Open Access Journals (Sweden)

    Daniël O. Warmerdam

    2016-03-01

    Full Text Available rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5 as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability.

  9. Phylogenetic inferences of Nepenthes species in Peninsular Malaysia revealed by chloroplast (trnL intron) and nuclear (ITS) DNA sequences.

    Science.gov (United States)

    Bunawan, Hamidun; Yen, Choong Chee; Yaakop, Salmah; Noor, Normah Mohd

    2017-01-26

    The chloroplastic trnL intron and the nuclear internal transcribed spacer (ITS) region were sequenced for 11 Nepenthes species recorded in Peninsular Malaysia to examine their phylogenetic relationship and to evaluate the usage of trnL intron and ITS sequences for phylogenetic reconstruction of this genus. Phylogeny reconstruction was carried out using neighbor-joining, maximum parsimony and Bayesian analyses. All the trees revealed two major clusters, a lowland group consisting of N. ampullaria, N. mirabilis, N. gracilis and N. rafflesiana, and another containing both intermediately distributed species (N. albomarginata and N. benstonei) and four highland species (N. sanguinea, N. macfarlanei, N. ramispina and N. alba). The trnL intron and ITS sequences proved to provide phylogenetic informative characters for deriving a phylogeny of Nepenthes species in Peninsular Malaysia. To our knowledge, this is the first molecular phylogenetic study of Nepenthes species occurring along an altitudinal gradient in Peninsular Malaysia.

  10. Authentication of ruta graveolens and its adulterant using internal transcribed spacer (its) sequences of nuclear ribosomal DNA

    International Nuclear Information System (INIS)

    Qurainy, F.A.; Khan, S.; Ali, M.A.; Hemaid, M.A.; Ashraf, M.

    2011-01-01

    Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)

  11. Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.

    Science.gov (United States)

    Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo

    2004-06-15

    The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples.

  12. The directionality of the nuclear transport of the influenza A genome is driven by selective exposure of nuclear localization sequences on nucleoprotein

    Directory of Open Access Journals (Sweden)

    Panté Nelly

    2009-06-01

    Full Text Available Abstract Background Early in infection, the genome of the influenza A virus, consisting of eight complexes of RNA and proteins (termed viral ribonucleoproteins; vRNPs, enters the nucleus of infected cells for replication. Incoming vRNPs are imported into the nucleus of infected cells using at least two nuclear localization sequences on nucleoprotein (NP; NLS1 at the N terminus, and NLS2 in the middle of the protein. Progeny vRNP assembly occurs in the nucleus, and later in infection, these are exported from the nucleus to the cytoplasm. Nuclear-exported vRNPs are different from incoming vRNPs in that they are prevented from re-entering the nucleus. Why nuclear-exported vRNPs do not re-enter the nucleus is unknown. Results To test our hypothesis that the exposure of NLSs on the vRNP regulates the directionality of the nuclear transport of the influenza vRNPs, we immunolabeled the two NLSs of NP (NLS1 and NLS2 and analyzed their surface accessibility in cells infected with the influenza A virus. We found that the NLS1 epitope on NP was exposed throughout the infected cells, but the NLS2 epitope on NP was only exposed in the nucleus of the infected cells. Addition of the nuclear export inhibitor leptomycin B further revealed that NLS1 is no longer exposed in cytoplasmic NP and vRNPs that have already undergone nuclear export. Similar immunolabeling studies in the presence of leptomycin B and with cells transfected with the cDNA of NP revealed that the NLS1 on NP is hidden in nuclear exported-NP. Conclusion NLS1 mediates the nuclear import of newly-synthesized NP and incoming vRNPs. This NLS becomes hidden on nuclear-exported NP and nuclear-exported vRNPs. Thus the selective exposure of the NLS1 constitutes a critical mechanism to regulate the directionality of the nuclear transport of vRNPs during the influenza A viral life cycle.

  13. A study for the sequence of events (SOE) system on the nuclear power plant

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Byung Chae; Jeon, Jong Sun; Lee, Sun Sung; Lee, Kyung Ho; Lee, Byung Ju; Sohn, Kwang Young [Korea Atomic Energy Research Institute, Taejon (Korea, Republic of)

    1996-06-01

    It is important to identify where and why an event or a trip is occurred in the Nuclear Power Plant(NPP) and to provide proper resolution against above situation. In order to analyze the prime cause or conspicuous reason of trouble occurred after events or trips occur, the Sequence of Events(SOE) system has been adopted in Korean NPP to acquire the sequential information along where and when an event or a trip take place. The SOE system of UCN 3 and 4 plant which is included in the Plant Data Acquisition System (PDAS), shares the 3205 computer and system software with PDAS. Sharing of the computer H/w and S/W, however, requires more complicated process to provide the events or trip signals due to the inherent characteristics of the shared system. Moreover there are high potentiality of collision between synchronization signals and data transmitted to the Plant Computer System (PCS), when the synchronization signals are sent from PCS to the three SOE processors. When this collision happens the SOE system will break down, thus it is not possible to analyze the trend of events or trips. An independent SOE system composed with single processor is proposed in this paper. To begin with, the analyses on the hardware and software of SOE and PDAS system of UCN 3 and 4 were performed to justify the problems and the resolution if it exists. In order to test the new SOE system, VMEbus, VM30 CPU, change of status I/O card and OS-9 for the operating system were adopted and the analysis for this test system was done as follows; the verification should be achieved through the simulation; the simulated signals for events are given the test system as inputs and the outputs are monitored to verify whether the sequential events logging function works well or not on PC. In conclusion, this report is expected to provide the technical background for the improvement and changing of the NPP PDAS and SOE system in the future. 18 tabs., 33 figs., 26 refs. (Author) .new.

  14. A study for the sequence of events (SOE) system on the nuclear power plant

    International Nuclear Information System (INIS)

    Lee, Byung Chae; Jeon, Jong Sun; Lee, Sun Sung; Lee, Kyung Ho; Lee, Byung Ju; Sohn, Kwang Young

    1996-06-01

    It is important to identify where and why an event or a trip is occurred in the Nuclear Power Plant(NPP) and to provide proper resolution against above situation. In order to analyze the prime cause or conspicuous reason of trouble occurred after events or trips occur, the Sequence of Events(SOE) system has been adopted in Korean NPP to acquire the sequential information along where and when an event or a trip take place. The SOE system of UCN 3 and 4 plant which is included in the Plant Data Acquisition System (PDAS), shares the 3205 computer and system software with PDAS. Sharing of the computer H/w and S/W, however, requires more complicated process to provide the events or trip signals due to the inherent characteristics of the shared system. Moreover there are high potentiality of collision between synchronization signals and data transmitted to the Plant Computer System (PCS), when the synchronization signals are sent from PCS to the three SOE processors. When this collision happens the SOE system will break down, thus it is not possible to analyze the trend of events or trips. An independent SOE system composed with single processor is proposed in this paper. To begin with, the analyses on the hardware and software of SOE and PDAS system of UCN 3 and 4 were performed to justify the problems and the resolution if it exists. In order to test the new SOE system, VMEbus, VM30 CPU, change of status I/O card and OS-9 for the operating system were adopted and the analysis for this test system was done as follows; the verification should be achieved through the simulation; the simulated signals for events are given the test system as inputs and the outputs are monitored to verify whether the sequential events logging function works well or not on PC. In conclusion, this report is expected to provide the technical background for the improvement and changing of the NPP PDAS and SOE system in the future. 18 tabs., 33 figs., 26 refs. (Author) .new

  15. Yeast Tdh3 (glyceraldehyde 3-phosphate dehydrogenase is a Sir2-interacting factor that regulates transcriptional silencing and rDNA recombination.

    Directory of Open Access Journals (Sweden)

    Alison E Ringel

    Full Text Available Sir2 is an NAD(+-dependent histone deacetylase required to mediate transcriptional silencing and suppress rDNA recombination in budding yeast. We previously identified Tdh3, a glyceraldehyde 3-phosphate dehydrogenase (GAPDH, as a high expression suppressor of the lethality caused by Sir2 overexpression in yeast cells. Here we show that Tdh3 interacts with Sir2, localizes to silent chromatin in a Sir2-dependent manner, and promotes normal silencing at the telomere and rDNA. Characterization of specific TDH3 alleles suggests that Tdh3's influence on silencing requires nuclear localization but does not correlate with its catalytic activity. Interestingly, a genetic assay suggests that Tdh3, an NAD(+-binding protein, influences nuclear NAD(+ levels; we speculate that Tdh3 links nuclear Sir2 with NAD(+ from the cytoplasm.

  16. Stalled RNAP-II molecules bound to non-coding rDNA spacers are required for normal nucleolus architecture.

    Science.gov (United States)

    Freire-Picos, M A; Landeira-Ameijeiras, V; Mayán, María D

    2013-07-01

    The correct distribution of nuclear domains is critical for the maintenance of normal cellular processes such as transcription and replication, which are regulated depending on their location and surroundings. The most well-characterized nuclear domain, the nucleolus, is essential for cell survival and metabolism. Alterations in nucleolar structure affect nuclear dynamics; however, how the nucleolus and the rest of the nuclear domains are interconnected is largely unknown. In this report, we demonstrate that RNAP-II is vital for the maintenance of the typical crescent-shaped structure of the nucleolar rDNA repeats and rRNA transcription. When stalled RNAP-II molecules are not bound to the chromatin, the nucleolus loses its typical crescent-shaped structure. However, the RNAP-II interaction with Seh1p, or cryptic transcription by RNAP-II, is not critical for morphological changes. Copyright © 2013 John Wiley & Sons, Ltd.

  17. Phylogeny and revision of Erpobdelliformes (Annelida, Arhynchobdellida from Mexico based on nuclear and mithochondrial gene sequences. Filogenia y revisión de los Erpobdelliformes (Annelida, Arhynchobdellida de México, con base en secuencias de ADN nuclear y mitocondrial

    Directory of Open Access Journals (Sweden)

    Alejandro Oceguera-Figueroa

    2005-12-01

    Full Text Available The phylogenetic relationships of the suborder Erpobdelliformes, a group of non-sanguivorous leeches, were investigated with the use of mitochondrial cytochrome c oxidase subunit I, mitochondrial 12S rDNA and nuclear 18S rDNA. The resulting hypothesis indicates that Erpobdellidae and Salifidae are monophyletic and each other closest relatives. We detect, for first time in leeches, intra-specific variation of similar amount than inter-specific variation. We formally resurrect the name Erpobdella mexicana, proposed by Dugès for Mexican specimens, and recommend the use of the name Erpobdella ochoterenai rather than Erpobdella microstoma for Mexican specimens. We record an invasive species of the family Salifidae: Barbronia arcana in Mexico, representing the first record of the species outside Australia, first record of the family in Mexico and third in the New World.Se estudian las relaciones filogenéticas del suborden Erpobdelliformes, un grupo de sanguijuelas no hematófagas de vertebrados, con base en secuencias de la subunidad I del citocromo c oxidasa del ADN mitocondrial, 12S ADNr del ADN mitocondrial y 18S ADNr del ADN nuclear. La hipótesis resultante señala que las familias Salifidae y Erpobdellidae son monofiléticas y hermanas entre sí. Se detecta por primera vez en sanguijuelas variación interespecífica de magnitud similar a la variación interespecífica. Formalmente se reslece el nombre empleado por Dugès: Erpobdella mexicana para las formas mexicanas, así como se argumenta sobre el uso del nombre Erpobdella ochoterenai en lugar de Erpobdella microstoma para las formas mexicanas. Se registra a una especie invasora de la familia Salifidae en México: Barbronia arcana, el cual constituye el primer registro de la especie fuera de Australia, primer registro de la familia en México y tercero en el continente americano.

  18. A nuclear ribosomal DNA pseudogene in triatomines opens a new research field of fundamental and applied implications in Chagas disease

    Directory of Open Access Journals (Sweden)

    María Angeles Zuriaga

    2015-05-01

    Full Text Available A pseudogene, designated as "ps(5.8S+ITS-2", paralogous to the 5.8S gene and internal transcribed spacer (ITS-2 of the nuclear ribosomal DNA (rDNA, has been recently found in many triatomine species distributed throughout North America, Central America and northern South America. Among characteristics used as criteria for pseudogene verification, secondary structures and free energy are highlighted, showing a lower fit between minimum free energy, partition function and centroid structures, although in given cases the fit only appeared to be slightly lower. The unique characteristics of "ps(5.8S+ITS-2" as a processed or retrotransposed pseudogenic unit of the ghost type are reviewed, with emphasis on its potential functionality compared to the functionality of genes and spacers of the normal rDNA operon. Besides the technical problem of the risk for erroneous sequence results, the usefulness of "ps(5.8S+ITS-2" for specimen classification, phylogenetic analyses and systematic/taxonomic studies should be highlighted, based on consistence and retention index values, which in pseudogenic sequence trees were higher than in functional sequence trees. Additionally, intraindividual, interpopulational and interspecific differences in pseudogene amount and the fact that it is a pseudogene in the nuclear rDNA suggests a potential relationships with fitness, behaviour and adaptability of triatomine vectors and consequently its potential utility in Chagas disease epidemiology and control.

  19. A dated molecular phylogeny of manta and devil rays (Mobulidae) based on mitogenome and nuclear sequences

    NARCIS (Netherlands)

    Poortvliet, Marloes; Olsen, Jeanine; Croll, Donald A.; Bernardi, Giacomo; Newton, Kelly; Kollias, Spyros; O'Sullivan, John; Fernando, Daniel; Stevens, Guy; Galván Magaña, Felipe; Seret, Bernard; Wintner, Sabine; Hoarau, Galice

    Manta and devil rays are an iconic group of globally distributed pelagic filter feeders, yet their evolutionary history remains enigmatic. We employed next generation sequencing of mitogenomes for nine of the 11 recognized species and two outgroups; as well as additional Sanger sequencing of two

  20. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  1. Comment on "Nuclear genomic sequences reveal that polar bears are an old and distinct bear lineage".

    Science.gov (United States)

    Nakagome, Shigeki; Mano, Shuhei; Hasegawa, Masami

    2013-03-29

    Based on nuclear and mitochondrial DNA, Hailer et al. (Reports, 20 April 2012, p. 344) suggested early divergence of polar bears from a common ancestor with brown bears and subsequent introgression. Our population genetic analysis that traces each of the genealogies in the independent nuclear loci does not support the evolutionary model proposed by the authors.

  2. Crystal structure of importin-{alpha} complexed with a classic nuclear localization sequence obtained by oriented peptide library screening

    Energy Technology Data Exchange (ETDEWEB)

    Takeda, A.A.S.; Fontes, M.R.M. [UNESP, Universidade Estadual Paulista, Botucatu, SP (Brazil); Yang, S.N.Y. [University of Melbourne, Melbourne (Australia); Harris, J.M. [Queensland University of Technology, Brisbane (Australia); Jans, D.A. [Monash University, Clayton (Australia); Kobe, B. [University of Queensland, Brisbane, QU (Australia)

    2012-07-01

    Full text: Importin-{alpha} (Imp{alpha}) plays a role in the classical nuclear import pathway, binding to cargo proteins with activities in the nucleus. Different Imp{alpha} paralogs responsible for specific cargos can be found in a single organism. The cargos contain nuclear localization sequences (NLSs), which are characterized by one or two clusters of basic amino acids (monopartite and bipartite NLSs, respectively). In this work we present the crystal structure of Imp{alpha} from M. musculus (residues 70-529, lacking the auto inhibitory domain) bound to a NLS peptide (pepTM). The peptide corresponds to the optimal sequence obtained by an oriented peptide library experiment designed to probe the specificity of the major NLS binding site. The peptide library used five degenerate positions and identified the sequence KKKRR as the optimal sequence for binding to this site for mouse Imp{alpha} (70-529). The protein was obtained using an E. coli expression system and purified by affinity chromatography followed by an ion exchange chromatography. A single crystal of Imp{alpha} -pepTM complex was grown by the hanging drop method. The data were collected using the Synchrotron Radiation Source LNLS, Brazil and processed to 2.3. Molecular replacement techniques were used to determine the crystal structure. Electron density corresponding to the peptide was present in both major and minor binding sites The peptide is bound to Imp{alpha} similar as the simian virus 40 (SV40) large tumour (T)-antigen NLS. Binding assays confirmed that the peptide bound to Imp{alpha} with low nM affinities. This is the first time that structural information has been linked to an oriented peptide library screening approach for importin-{alpha}; the results will contribute to understanding of the sequence determinants of classical NLSs, and may help identify as yet unidentified classical NLSs in novel proteins. (author)

  3. Armillaria phylogeny based on tef-1α sequences suggests ongoing divergent speciation within the boreal floristic kingdom

    Science.gov (United States)

    Ned B. Klopfenstein; John W. Hanna; Amy L. Ross-Davis; Jane E. Stewart; Yuko Ota; Rosario Medel-Ortiz; Miguel Armando Lopez-Ramirez; Ruben Damian Elias-Roman; Dionicio Alvarado-Rosales; Mee-Sook Kim

    2013-01-01

    Armillaria plays diverse ecological roles in forests worldwide, which has inspired interest in understanding phylogenetic relationships within and among species of this genus. Previous rDNA sequence-based phylogenetic analyses of Armillaria have shown general relationships among widely divergent taxa, but rDNA sequences were not reliable for separating closely related...

  4. Complete mitochondrial genome sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting domestic turkeys.

    Science.gov (United States)

    Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Barta, John R

    2014-07-17

    Clinical and subclinical coccidiosis is cosmopolitan and inflicts significant losses to the poultry industry globally. Seven named Eimeria species are responsible for coccidiosis in turkeys: Eimeria dispersa; Eimeria meleagrimitis; Eimeria gallopavonis; Eimeria meleagridis; Eimeria adenoeides; Eimeria innocua; and, Eimeria subrotunda. Although attempts have been made to characterize these parasites molecularly at the nuclear 18S rDNA and ITS loci, the maternally-derived and mitotically replicating mitochondrial genome may be more suited for species level molecular work; however, only limited sequence data are available for Eimeria spp. infecting turkeys. The purpose of this study was to sequence and annotate the complete mitochondrial genomes from 5 Eimeria species that commonly infect the domestic turkey (Meleagris gallopavo). Six single-oocyst derived cultures of five Eimeria species infecting turkeys were PCR-amplified and sequenced completely prior to detailed annotation. Resulting sequences were aligned and used in phylogenetic analyses (BI, ML, and MP) that included complete mitochondrial genomes from 16 Eimeria species or concatenated CDS sequences from each genome. Complete mitochondrial genome sequences were obtained for Eimeria adenoeides Guelph, 6211 bp; Eimeria dispersa Briston, 6238 bp; Eimeria meleagridis USAR97-01, 6212 bp; Eimeria meleagrimitis USMN08-01, 6165 bp; Eimeria gallopavonis Weybridge, 6215 bp; and Eimeria gallopavonis USKS06-01, 6215 bp). The order, orientation and CDS lengths of the three protein coding genes (COI, COIII and CytB) as well as rDNA fragments encoding ribosomal large and small subunit rRNA were conserved among all sequences. Pairwise sequence identities between species ranged from 88.1% to 98.2%; sequence variability was concentrated within CDS or between rDNA fragments (where indels were common). No phylogenetic reconstruction supported monophyly of Eimeria species infecting turkeys; Eimeria dispersa may have arisen

  5. An apparent Acanthamoeba genotype is the product of a chimeric 18S rDNA artifact.

    Science.gov (United States)

    Corsaro, Daniele; Venditti, Danielle

    2018-02-01

    Free-living amoebae of the genus Acanthamoeba are potentially pathogenic protozoa widespread in the environment. The detection/diagnosis as well as environmental survey strategies is mainly based on the identification of the 18S rDNA sequences of the strains that allow the recovery of various distinct genotypes/subgenotypes. The accurate recording of such data is important to better know the environmental distribution of distinct genotypes and how they may be preferentially associated with disease. Recently, a putative new acanthamoebal genotype T99 was introduced, which comprises only environmental clones apparently with some anomalous features. Here, we analyze these sequences through partial treeing and BLAST analyses and find that they are actually chimeras. Our results show that the putative T99 genotype is very likely formed by chimeric sequences including a middle fragment from acanthamoebae of genotype T13, while the 5'- and 3'-end fragments came from a nematode and a cercozoan, respectively. Molecular phylogenies of Acanthamoeba including T99 are consequently erroneous as genotype T99 does not exist in nature. Careful identification of Acanthamoeba genotypes is therefore critical for both phylogenetic and diagnostic applications.

  6. Morphology and rDNA phylogeny of a Mediterranean Coolia monotis (Dinophyceae strain from Greece

    Directory of Open Access Journals (Sweden)

    Nicolas P. Dolapsakis

    2006-03-01

    Full Text Available Sequences of LSU and SSU ribosomal RNA genes and phylogeny have not been widely investigated for the dinoflagellate Coolia monotis Meunier, and no information is available on the small and large rDNA subunits of Mediterranean strains. A strain isolated from the Thermaikos Gulf in northern Greece was identified as C. monotis—a new record for the Greek algal flora—using thecal morphology by light, epifluorescence and scanning electron microscopy. The small subunit and partial (D1/D2 large subunit sequences were analyzed and compared to other strains of C. monotis and dinoflagellates from various regions. Thecal architecture showed that the Greek strain of C. monotis was phenotypically similar, but not identical, to other strains reported in literature. The partial LSU sequence (700 bp was found to vary by 113 bp positions (16% from the C. monotis strain from New Zealand, whereas the SSU (1757 bp had 15 bp differences (0.85% from the strain from Norway. Phylogenetic tree construction showed that the Greek strain fell within the Coolia clade and had a close relationship with the families Ostreopsidaceae and Goniodomaceae of the order Gonyaulacales. Preliminary findings suggest the existence of different genotype strains of C. monotis with large intraspecific genetic variability and minimal morphological differentiation (similar phenotypes. Certain ecological and evolutionary implications of these findings are discussed.

  7. Taxonomy and phylogeny of the genus citrus based on the nuclear ribosomal dna its region sequence

    International Nuclear Information System (INIS)

    Sun, Y.L.

    2015-01-01

    The genus Citrus (Aurantioideae, Rutaceae) is the sole source of the citrus fruits of commerce showing high economic values. In this study, the taxonomy and phylogeny of Citrus species is evaluated using sequence analysis of the ITS region of nrDNA. This study is based on 26 plants materials belonging to 22 Citrus species having wild, domesticated, and cultivated species. Through DNA alignment of the ITS sequence, ITS1 and ITS2 regions showed relatively high variations of sequence length and nucleotide among these Citrus species. According to previous six-tribe discrimination theory by Swingle and Reece, the grouping in our ITS phylogenetic tree reconstructed by ITS sequences was not related to tribe discrimination but species discrimination. However, the molecular analysis could provide more information on citrus taxonomy. Combined with ITS sequences of other subgenera in then true citrus fruit tree group, the ITS phylogenetic tree indicated subgenera Citrus was monophyletic and nearer to Fortunella, Poncirus, and Clymenia compared to Microcitrus and Eremocitrus. Abundant sequence variations of the ITS region shown in this study would help species identification and tribe differentiation of the genus Citrus. (author)

  8. A decision theoretic approach to an accident sequence: when feedwater and auxiliary feedwater fail in a nuclear power plant

    International Nuclear Information System (INIS)

    Svenson, Ola

    1998-01-01

    This study applies a decision theoretic perspective on a severe accident management sequence in a processing industry. The sequence contains loss of feedwater and auxiliary feedwater in a boiling water nuclear reactor (BWR), which necessitates manual depressurization of the reactor pressure vessel to enable low pressure cooling of the core. The sequence is fast and is a major contributor to core damage in probabilistic risk analyses (PRAs) of this kind of plant. The management of the sequence also includes important, difficult and fast human decision making. The decision theoretic perspective, which is applied to a Swedish ABB-type reactor, stresses the roles played by uncertainties about plant state, consequences of different actions and goals during the management of a severe accident sequence. Based on a theoretical analysis and empirical simulator data the human error probabilities in the PRA for the plant are considered to be too small. Recommendations for how to improve safety are given and they include full automation of the sequence, improved operator training, and/or actions to assist the operators' decision making through reduction of uncertainties, for example, concerning water/steam level for sufficient cooling, time remaining before insufficient cooling level in the tank is reached and organizational cost-benefit evaluations of the events following a false alarm depressurization as well as the events following a successful depressurization at different points in time. Finally, it is pointed out that the approach exemplified in this study is applicable to any accident scenario which includes difficult human decision making with conflicting goals, uncertain information and with very serious consequences

  9. The 5S rDNA family evolves through concerted and birth-and-death evolution in fish genomes: an example from freshwater stingrays

    Science.gov (United States)

    2011-01-01

    Background Ribosomal 5S genes are well known for the critical role they play in ribosome folding and functionality. These genes are thought to evolve in a concerted fashion, with high rates of homogenization of gene copies. However, the majority of previous analyses regarding the evolutionary process of rDNA repeats were conducted in invertebrates and plants. Studies have also been conducted on vertebrates, but these analyses were usually restricted to the 18S, 5.8S and 28S rRNA genes. The recent identification of divergent 5S rRNA gene paralogs in the genomes of elasmobranches and teleost fishes indicate that the eukaryotic 5S rRNA gene family has a more complex genomic organization than previously thought. The availability of new sequence data from lower vertebrates such as teleosts and elasmobranches enables an enhanced evolutionary characterization of 5S rDNA among vertebrates. Results We identified two variant classes of 5S rDNA sequences in the genomes of Potamotrygonidae stingrays, similar to the genomes of other vertebrates. One class of 5S rRNA genes was shared only by elasmobranches. A broad comparative survey among 100 vertebrate species suggests that the 5S rRNA gene variants in fishes originated from rounds of genome duplication. These variants were then maintained or eliminated by birth-and-death mechanisms, under intense purifying selection. Clustered multiple copies of 5S rDNA variants could have arisen due to unequal crossing over mechanisms. Simultaneously, the distinct genome clusters were independently homogenized, resulting in the maintenance of clusters of highly similar repeats through concerted evolution. Conclusions We believe that 5S rDNA molecular evolution in fish genomes is driven by a mixed mechanism that integrates birth-and-death and concerted evolution. PMID:21627815

  10. Severe Accident Sequence Analysis Program: Anticipated transient without scram simulations for Browns Ferry Nuclear Plant Unit 1

    International Nuclear Information System (INIS)

    Dallman, R.J.; Gottula, R.C.; Holcomb, E.E.; Jouse, W.C.; Wagoner, S.R.; Wheatley, P.D.

    1987-05-01

    An analysis of five anticipated transients without scram (ATWS) was conducted at the Idaho National Engineering Laboratory (INEL). The five detailed deterministic simulations of postulated ATWS sequences were initiated from a main steamline isolation valve (MSIV) closure. The subject of the analysis was the Browns Ferry Nuclear Plant Unit 1, a boiling water reactor (BWR) of the BWR/4 product line with a Mark I containment. The simulations yielded insights to the possible consequences resulting from a MSIV closure ATWS. An evaluation of the effects of plant safety systems and operator actions on accident progression and mitigation is presented

  11. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    OpenAIRE

    Warmerdam, Daniël O.; van den Berg, Jeroen; Medema, René H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of b...

  12. Sequence dependent structure and thermodynamics of DNA oligonucleotides and polynucleotides: uv melting and NMR (nuclear magnetic resonance) studies

    Energy Technology Data Exchange (ETDEWEB)

    Aboul-ela, F.M.

    1987-12-01

    Thermodynamic parameters for double strand formation have been measured for the twenty-five DNA double helices made by mixing deoxyoligonucleotides of the sequence dCA/sub 3/XA/sub 3/G with the complement dCT/sub 3/YT/sub 3/G. Each of the bases A, C, G, T, and I (I = hypoxanthine) have been substituted at the positions labeled X and Y. The results are analyzed in terms of nearest neighbors. At higher temperatures the sequences containing a G)centerreverse arrowdot)C base pair become more stable than those containing only A)centerreverse arrowdot)T. All molecules containing mismatcher are destabilized with respect to those with only Watson-Crick pairing, but there is a wide range of destabilization. Large neighboring base effects upon stability were observed. For example, when (X, Y) = (I, A), the duplex is eightfold more stable than when (X, Y) = (A, I). Independent of sequence effects the order of stabilities is: I)centerreverse arrowdot)C )succ) I)centerreverse arrowdot) A)succ) I)centerreverse arrowdot)T approx. I)centerreverse arrowdot)G. All of these results are discussed within the context of models for sequence dependent DNA secondary structure, replication fidelity and mechanisms of mismatch repair, and implications for probe design. The duplex deoxyoligonucleotide d(GGATGGGAG))centerreverse arrowdot)d(CTCCCATCC) is a portion of the gene recognition sequence of the protein transcription factor IIIA. The crystal structure of this oligonucleotide was shown to be A-form The present study employs Nuclear Magnetic Resonance, optical, chemical and enzymatic techniques to investigate the solution structure of this DNA 9-mer. (157 refs., 19 figs., 10 tabs.

  13. Sequence dependent structure and thermodynamics of DNA oligonucleotides and polynucleotides: uv melting and NMR (nuclear magnetic resonance) studies

    International Nuclear Information System (INIS)

    Aboul-ela, F.M.

    1987-12-01

    Thermodynamic parameters for double strand formation have been measured for the twenty-five DNA double helices made by mixing deoxyoligonucleotides of the sequence dCA 3 XA 3 G with the complement dCT 3 YT 3 G. Each of the bases A, C, G, T, and I (I = hypoxanthine) have been substituted at the positions labeled X and Y. The results are analyzed in terms of nearest neighbors. At higher temperatures the sequences containing a G/center dot/C base pair become more stable than those containing only A/center dot/T. All molecules containing mismatcher are destabilized with respect to those with only Watson-Crick pairing, but there is a wide range of destabilization. Large neighboring base effects upon stability were observed. For example, when (X, Y) = (I, A), the duplex is eightfold more stable than when (X, Y) = (A, I). Independent of sequence effects the order of stabilities is: I/center dot/C /succ/ I/center dot/ A/succ/ I/center dot/T ∼ I/center dot/G. All of these results are discussed within the context of models for sequence dependent DNA secondary structure, replication fidelity and mechanisms of mismatch repair, and implications for probe design. The duplex deoxyoligonucleotide d(GGATGGGAG)/center dot/d(CTCCCATCC) is a portion of the gene recognition sequence of the protein transcription factor IIIA. The crystal structure of this oligonucleotide was shown to be A-form The present study employs Nuclear Magnetic Resonance, optical, chemical and enzymatic techniques to investigate the solution structure of this DNA 9-mer. (157 refs., 19 figs., 10 tabs.)

  14. Structure-Related Roles for the Conservation of the HIV-1 Fusion Peptide Sequence Revealed by Nuclear Magnetic Resonance.

    Science.gov (United States)

    Serrano, Soraya; Huarte, Nerea; Rujas, Edurne; Andreu, David; Nieva, José L; Jiménez, María Angeles

    2017-10-17

    Despite extensive characterization of the human immunodeficiency virus type 1 (HIV-1) hydrophobic fusion peptide (FP), the structure-function relationships underlying its extraordinary degree of conservation remain poorly understood. Specifically, the fact that the tandem repeat of the FLGFLG tripeptide is absolutely conserved suggests that high hydrophobicity may not suffice to unleash FP function. Here, we have compared the nuclear magnetic resonance (NMR) structures adopted in nonpolar media by two FP surrogates, wtFP-tag and scrFP-tag, which had equal hydrophobicity but contained wild-type and scrambled core sequences LFLGFLG and FGLLGFL, respectively. In addition, these peptides were tagged at their C-termini with an epitope sequence that folded independently, thereby allowing Western blot detection without interfering with FP structure. We observed similar α-helical FP conformations for both specimens dissolved in the low-polarity medium 25% (v/v) 1,1,1,3,3,3-hexafluoro-2-propanol (HFIP), but important differences in contact with micelles of the membrane mimetic dodecylphosphocholine (DPC). Thus, whereas wtFP-tag preserved a helix displaying a Gly-rich ridge, the scrambled sequence lost in great part the helical structure upon being solubilized in DPC. Western blot analyses further revealed the capacity of wtFP-tag to assemble trimers in membranes, whereas membrane oligomers were not observed in the case of the scrFP-tag sequence. We conclude that, beyond hydrophobicity, preserving sequence order is an important feature for defining the secondary structures and oligomeric states adopted by the HIV FP in membranes.

  15. Phylogenetic Analysis of Phytophthora Species Based on Mitochondrial and Nuclear DNA Sequences

    NARCIS (Netherlands)

    Kroon, L.P.N.M.; Bakker, F.T.; Bosch, van den G.B.M.; Bonants, P.J.M.; Flier, W.G.

    2004-01-01

    A molecular phylogenetic analysis of the genus Phytophthora was performed, 113 isolates from 48 Phytophthora species were included in this analysis. Phylogenetic analyses were performed on regions of mitochondrial (cytochrome c oxidase subunit 1; NADH dehydrogenase subunit 1) and nuclear gene

  16. Rapid identification and classification of bacteria by 16S rDNA restriction fragment melting curve analyses (RFMCA).

    Science.gov (United States)

    Rudi, Knut; Kleiberg, Gro H; Heiberg, Ragnhild; Rosnes, Jan T

    2007-08-01

    The aim of this work was to evaluate restriction fragment melting curve analyses (RFMCA) as a novel approach for rapid classification of bacteria during food production. RFMCA was evaluated for bacteria isolated from sous vide food products, and raw materials used for sous vide production. We identified four major bacterial groups in the material analysed (cluster I-Streptococcus, cluster II-Carnobacterium/Bacillus, cluster III-Staphylococcus and cluster IV-Actinomycetales). The accuracy of RFMCA was evaluated by comparison with 16S rDNA sequencing. The strains satisfying the RFMCA quality filtering criteria (73%, n=57), with both 16S rDNA sequence information and RFMCA data (n=45) gave identical group assignments with the two methods. RFMCA enabled rapid and accurate classification of bacteria that is database compatible. Potential application of RFMCA in the food or pharmaceutical industry will include development of classification models for the bacteria expected in a given product, and then to build an RFMCA database as a part of the product quality control.

  17. Morphology and 18S rDNA of Henneguya gurlei (Myxosporea) from Ameiurus nebulosus (Siluriformes) in North Carolina.

    Science.gov (United States)

    Iwanowicz, Luke R; Iwanowicz, Deborah D; Pote, Linda M; Blazer, Vicki S; Schill, William B

    2008-02-01

    Henneguya gurlei was isolated from Ameiurus nebulosus captured in North Carolina and redescribed using critical morphological features and 18S small-subunit ribosomal RNA (SSU rDNA) gene sequence. Plasmodia are white, spherical, or subspherical, occur in clusters, measure up to 1.8 mm in length, and are located on the dorsal, pectoral, and anal fins. Histologically, plasmodia are located in the dermis and subdermally, and the larger cysts disrupt the melanocyte pigment layer. The spore body is lanceolate, 18.2 +/- 0.3 microm (range 15.7-20.3) in length, and 5.4 +/- 0.1 microm (range 3.8-6.1) in width in valvular view. The caudal appendages are 41.1 +/- 1.1 microm (range 34.0-49.7) in length. Polar capsules are pyriform and of unequal size. The longer polar capsule measures 6.2 +/- 0.1 microm (range 5.48-7.06), while the shorter is 5.7 +/- 0.1 microm (range 4.8-6.4) in length. Polar capsule width is 1.2 +/- 0.03 microm (range 1.0-1.54). The total length of the spore is 60.9 +/- 1.2 microm (range 48.7-68.5). Morphologically, this species is similar to other species of Henneguya that are known to infect ictalurids. Based on SSU rDNA sequences, this species is most closely related to H. exilis and H. ictaluri, which infect Ictalurus punctatus.

  18. Building a model: developing genomic resources for common milkweed (Asclepias syriaca with low coverage genome sequencing

    Directory of Open Access Journals (Sweden)

    Weitemier Kevin

    2011-05-01

    Full Text Available Abstract Background Milkweeds (Asclepias L. have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L. could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. Results A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp and 5S rDNA (120 bp sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp, with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae unigenes (median coverage of 0.29× and 66% of single copy orthologs (COSII in asterids (median coverage of 0.14×. From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites and phylogenetics (low-copy nuclear genes studies were developed. Conclusions The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species

  19. Building a model: developing genomic resources for common milkweed (Asclepias syriaca) with low coverage genome sequencing.

    Science.gov (United States)

    Straub, Shannon C K; Fishbein, Mark; Livshultz, Tatyana; Foster, Zachary; Parks, Matthew; Weitemier, Kevin; Cronn, Richard C; Liston, Aaron

    2011-05-04

    Milkweeds (Asclepias L.) have been extensively investigated in diverse areas of evolutionary biology and ecology; however, there are few genetic resources available to facilitate and compliment these studies. This study explored how low coverage genome sequencing of the common milkweed (Asclepias syriaca L.) could be useful in characterizing the genome of a plant without prior genomic information and for development of genomic resources as a step toward further developing A. syriaca as a model in ecology and evolution. A 0.5× genome of A. syriaca was produced using Illumina sequencing. A virtually complete chloroplast genome of 158,598 bp was assembled, revealing few repeats and loss of three genes: accD, clpP, and ycf1. A nearly complete rDNA cistron (18S-5.8S-26S; 7,541 bp) and 5S rDNA (120 bp) sequence were obtained. Assessment of polymorphism revealed that the rDNA cistron and 5S rDNA had 0.3% and 26.7% polymorphic sites, respectively. A partial mitochondrial genome sequence (130,764 bp), with identical gene content to tobacco, was also assembled. An initial characterization of repeat content indicated that Ty1/copia-like retroelements are the most common repeat type in the milkweed genome. At least one A. syriaca microread hit 88% of Catharanthus roseus (Apocynaceae) unigenes (median coverage of 0.29×) and 66% of single copy orthologs (COSII) in asterids (median coverage of 0.14×). From this partial characterization of the A. syriaca genome, markers for population genetics (microsatellites) and phylogenetics (low-copy nuclear genes) studies were developed. The results highlight the promise of next generation sequencing for development of genomic resources for any organism. Low coverage genome sequencing allows characterization of the high copy fraction of the genome and exploration of the low copy fraction of the genome, which facilitate the development of molecular tools for further study of a target species and its relatives. This study represents a first

  20. Genetic diversity and molecular evolution of Naga King Chili inferred from internal transcribed spacer sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Kehie, Mechuselie; Kumaria, Suman; Devi, Khumuckcham Sangeeta; Tandon, Pramod

    2016-02-01

    Sequences of the Internal Transcribed Spacer (ITS1-5.8S-ITS2) of nuclear ribosomal DNAs were explored to study the genetic diversity and molecular evolution of Naga King Chili. Our study indicated the occurrence of nucleotide polymorphism and haplotypic diversity in the ITS regions. The present study demonstrated that the variability of ITS1 with respect to nucleotide diversity and sequence polymorphism exceeded that of ITS2. Sequence analysis of 5.8S gene revealed a much conserved region in all the accessions of Naga King Chili. However, strong phylogenetic information of this species is the distinct 13 bp deletion in the 5.8S gene which discriminated Naga King Chili from the rest of the Capsicum sp. Neutrality test results implied a neutral variation, and population seems to be evolving at drift-mutation equilibrium and free from directed selection pressure. Furthermore, mismatch analysis showed multimodal curve indicating a demographic equilibrium. Phylogenetic relationships revealed by Median Joining Network (MJN) analysis denoted a clear discrimination of Naga King Chili from its closest sister species (Capsicum chinense and Capsicum frutescens). The absence of star-like network of haplotypes suggested an ancient population expansion of this chili.

  1. Phylogeny of Eleusine (Poaceae: Chloridoideae) based on nuclear ITS and plastid trnT-trnF sequences.

    Science.gov (United States)

    Neves, Susana S; Swire-Clark, Ginger; Hilu, Khidir W; Baird, Wm Vance

    2005-05-01

    Phylogenetic relationships in the genus Eleusine (Poaceae: Chloridoideae) were investigated using nuclear ITS and plastid trnT-trnF sequences. Separate and combined data sets were analyzed using parsimony, distance, and likelihood based methods, including Bayesian. Data congruence was examined using character and topological measures. Significant data heterogeneity was detected, but there was little conflict in the topological substructure measures for triplets and quartets, and resolution and clade support increased in the combined analysis. Data incongruence may be a result of noise and insufficient information in the slower evolving trnT-trnF. Monophyly of Eleusine is strongly supported in all analyses, but basal relationships in the genus remain uncertain. There is good support for a CAIK clade (E. coracana subsp. coracana and africana, E. indica, and E. kigeziensis), with E. tristachya as its sister group. Two putative ITS homeologues (A and B loci) were identified in the allotetraploid E. coracana; the 'B' locus sequence type was not found in the remaining species. Eleusine coracana and its putative 'A' genome donor, the diploid E. indica, are confirmed close allies, but sequence data contradicts the hypothesis that E. floccifolia is its second genome donor. The 'B' genome donor remains unidentified and may be extinct.

  2. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    NARCIS (Netherlands)

    Warmerdam, Daniel O.; van den Berg, Jeroen; Medema, Rene H.

    2016-01-01

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded

  3. Molecular cloning and restriction analysis of EcoRI-fragments of Vicia faba rDNA

    International Nuclear Information System (INIS)

    Yakura, Kimitaka; Tanifuji, Shigeyuki.

    1983-01-01

    EcoRI-fragments of Vicia faba rDNA were cloned in plasmid pBR325. Southern blot hybridization of BamHI-digests of these cloned plasmids and Vicia genomic DNA led to the determination of relative positions of BamHI sites in the rDNA and the physical map that had been tentatively made is corrected. (author)

  4. Rapid diagnosis of virulent Pasteurella multocida isolated from farm animals with clinical manifestation of pneumonia respiratory infection using 16S rDNA and KMT1 gene

    Directory of Open Access Journals (Sweden)

    Gamal Mohamedin Hassan

    2016-01-01

    Full Text Available Objective: To characterize intra-isolates variation between clinical isolates of Pasteurella multocida (P. multocida isolated from sheep, cattle and buffalo at molecular level to check the distribution of pneumonia and hemorrhagic septicemia in some regions of Fayoum, Egypt. Methods: These isolates were obtained from various locations in the Fayoum Governorate, Egypt and they were identified by amplifying 16S rDNA and KMT1 genes using their DNA as a template in PCR reaction. Results: The results demonstrated that the five selective isolates of P. multocida had similar size of PCR products that generated one band of 16S rDNA having 1 471 bp and KMT1 gene having 460 bp. The phylogenetic tree and similarity of the five selective isolates of P. multocida which were collected from GenBank database were calculated and analyzed for the nucleotide sequence of 16S rDNA and KMT1 genes. The sequencing result of 16S rRNA gene product (1 471 bp for the five selective isolates of P. multocida showed that the isolates of sheep (FUP2 shared 94.08%, 88.10% homology with the buffalo isolate (FUP8 and cattle isolate (FUP9 respectively, whereas, the buffalo isolate (FUP5 shared 98.18% and 94.40% homology with the cattle isolates (FUP12 and FUP9. Conclusions: The results indicated the relationships of P. multocida isolated from buffalo and cattle rather than the close relationships between P. multocida isolated from cattle and sheep. Diagnosis of P. multocida by 16S rDNA and KMT1 gene sequences was important to determine the antigen that is responsible for protective cover within the same group of animals and to help for the production of new vaccines for the control of microbial infection for domestic animals.

  5. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants

    Directory of Open Access Journals (Sweden)

    Elizabeth X. Kwan

    2016-09-01

    Full Text Available The Saccharomyces cerevisiae ribosomal DNA (rDNA locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae.

  6. rDNA Copy Number Variants Are Frequent Passenger Mutations in Saccharomyces cerevisiae Deletion Collections and de Novo Transformants.

    Science.gov (United States)

    Kwan, Elizabeth X; Wang, Xiaobin S; Amemiya, Haley M; Brewer, Bonita J; Raghuraman, M K

    2016-09-08

    The Saccharomyces cerevisiae ribosomal DNA (rDNA) locus is known to exhibit greater instability relative to the rest of the genome. However, wild-type cells preferentially maintain a stable number of rDNA copies, suggesting underlying genetic control of the size of this locus. We performed a screen of a subset of the Yeast Knock-Out (YKO) single gene deletion collection to identify genetic regulators of this locus and to determine if rDNA copy number correlates with yeast replicative lifespan. While we found no correlation between replicative lifespan and rDNA size, we identified 64 candidate strains with significant rDNA copy number differences. However, in the process of validating candidate rDNA variants, we observed that independent isolates of our de novo gene deletion strains had unsolicited but significant changes in rDNA copy number. Moreover, we were not able to recapitulate rDNA phenotypes from the YKO yeast deletion collection. Instead, we found that the standard lithium acetate transformation protocol is a significant source of rDNA copy number variation, with lithium acetate exposure being the treatment causing variable rDNA copy number events after transformation. As the effects of variable rDNA copy number are being increasingly reported, our finding that rDNA is affected by lithium acetate exposure suggested that rDNA copy number variants may be influential passenger mutations in standard strain construction in S. cerevisiae. Copyright © 2016 Kwan et al.

  7. Reconsidering the generation time hypothesis based on nuclear ribosomal ITS sequence comparisons in annual and perennial angiosperms

    Directory of Open Access Journals (Sweden)

    Fiz-Palacios Omar

    2008-12-01

    Full Text Available Abstract Background Differences in plant annual/perennial habit are hypothesized to cause a generation time effect on divergence rates. Previous studies that compared rates of divergence for internal transcribed spacer (ITS1 and ITS2 sequences of nuclear ribosomal DNA (nrDNA in angiosperms have reached contradictory conclusions about whether differences in generation times (or other life history features are associated with divergence rate heterogeneity. We compared annual/perennial ITS divergence rates using published sequence data, employing sampling criteria to control for possible artifacts that might obscure any actual rate variation caused by annual/perennial differences. Results Relative rate tests employing ITS sequences from 16 phylogenetically-independent annual/perennial species pairs rejected rate homogeneity in only a few comparisons, with annuals more frequently exhibiting faster substitution rates. Treating branch length differences categorically (annual faster or perennial faster regardless of magnitude with a sign test often indicated an excess of annuals with faster substitution rates. Annuals showed an approximately 1.6-fold rate acceleration in nucleotide substitution models for ITS. Relative rates of three nuclear loci and two chloroplast regions for the annual Arabidopsis thaliana compared with two closely related Arabidopsis perennials indicated that divergence was faster for the annual. In contrast, A. thaliana ITS divergence rates were sometimes faster and sometimes slower than the perennial. In simulations, divergence rate differences of at least 3.5-fold were required to reject rate constancy in > 80 % of replicates using a nucleotide substitution model observed for the combination of ITS1 and ITS2. Simulations also showed that categorical treatment of branch length differences detected rate heterogeneity > 80% of the time with a 1.5-fold or greater rate difference. Conclusion Although rate homogeneity was not rejected

  8. Analysis of risk-dominant sequences by MAAP3.0 for Kuosheng Nuclear Power Plant

    International Nuclear Information System (INIS)

    Lin, J.D.; Chieng, C.C.; Wang, T.K.; Hsiue, R.K.

    1987-01-01

    Kuosheng Nuclear Power Plant is the first operating model-6/Mark III boiling water reactor (BWR6/Mark III) in the world, and a probabilistic risk assessment (PRA) has been performed to determine the likely frequencies of core melt accidents and the magnitude, composition, and fraction of fission products released in these accidents. The final report of this PRA indicates that categories 8 and 15 are ranked No. 1 by risk index (the product of release frequency and release fraction) and release frequency, respectively. The dominant contributors of these two categories are frequent earthquakes and typhoons

  9. Cytogenetic analysis and chromosomal characteristics of the polymorphic 18S rDNA of Haliotis discus hannai from Fujian, China.

    Directory of Open Access Journals (Sweden)

    Haishan Wang

    Full Text Available We report on novel chromosomal characteristics of Haliotis discus hannai from a breeding population at Fujian, China. The karyotypes of H. discus hannai we obtained from an abalone farm include a common type 2n = 36 = 10M + 8SM (82% and two rare types 2n = 36 = 11M + 7SM (14% and 2n = 36 = 10M + 7SM + 1ST (4%. The results of silver staining showed that the NORs of H. discus hannai were usually located terminally on the long arms of chromosome pairs 14 and 17, NORs were also sometimes located terminally on the short arms of other chromosomes, either metacentric or submetacentric pairs. The number of Ag-nucleoli ranged from 2 to 8, and the mean number was 3.61 ± 0.93. Among the scored interphase cells, 41% had 3 detectable nucleoli and 37% had 4 nucleoli. The 18S rDNA FISH result is the first report of the location of 18S rDNA genes in H. discus hannai. The 18S rDNA locations were highly polymorphic in this species. Copies of the gene were observed in the terminal of long or/and short arms of submetacentric or/and metacentric chromosomes. Using FISH with probe for vertebrate-like telomeric sequences (CCCTAA3 displayed positive green FITC signals at telomere regions of all analyzed chromosome types. We found about 7% of chromosomes had breaks in prophase. A special form of nucleolus not previously described from H. discus hannai was observed in some interphase cells. It consists of many small silver-stained nucleoli gathered together to form a larger nucleolus and may correspond to prenucleolar bodies.

  10. Genetic analysis of Fasciola isolates from cattle in Korea based on second internal transcribed spacer (ITS-2) sequence of nuclear ribosomal DNA.

    Science.gov (United States)

    Choe, Se-Eun; Nguyen, Thuy Thi-Dieu; Kang, Tae-Gyu; Kweon, Chang-Hee; Kang, Seung-Won

    2011-09-01

    Nuclear ribosomal DNA sequence of the second internal transcribed spacer (ITS-2) has been used efficiently to identify the liver fluke species collected from different hosts and various geographic regions. ITS-2 sequences of 19 Fasciola samples collected from Korean native cattle were determined and compared. Sequence comparison including ITS-2 sequences of isolates from this study and reference sequences from Fasciola hepatica and Fasciola gigantica and intermediate Fasciola in Genbank revealed seven identical variable sites of investigated isolates. Among 19 samples, 12 individuals had ITS-2 sequences completely identical to that of pure F. hepatica, five possessed the sequences identical to F. gigantica type, whereas two shared the sequence of both F. hepatica and F. gigantica. No variations in length and nucleotide composition of ITS-2 sequence were observed within isolates that belonged to F. hepatica or F. gigantica. At the position of 218, five Fasciola containing a single-base substitution (C>T) formed a distinct branch inside the F. gigantica-type group which was similar to those of Asian-origin isolates. The phylogenetic tree of the Fasciola spp. based on complete ITS-2 sequences from this study and other representative isolates in different locations clearly showed that pure F. hepatica, F. gigantica type and intermediate Fasciola were observed. The result also provided additional genetic evidence for the existence of three forms of Fasciola isolated from native cattle in Korea by genetic approach using ITS-2 sequence.

  11. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    Science.gov (United States)

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  12. CNE (central nuclear en Embalse): probabilistic safety study. Loss-of-coolant accidents. Analysis through events sequence

    International Nuclear Information System (INIS)

    Layral, S.I.

    1987-01-01

    The aim of this study was to perform for the Embalse nuclear power plant, a probabilistic evaluation of loss-of-coolant accidents (LOCA) to identify the risks associated with them and to determine their acceptability in accordance with norms. This study includes all ruptures in the primary system that produce the automatic activation of 'emergency core cooling system'. Three starting events were selected for the probabilistic evaluation: 100% rupture of an input collector; 5% rupture of an input collector; 1.2% rupture of an input collector. At this stage the evaluation is focussed on the identification and quantization of the main failure sequences that follow a LOCA and lead to an uncontrolled reactor state or 'core meltdown'. The most important contribution to the core meltdown due to LOCA is the failure of supplies that are required for the emergency core cooling system. (Author)

  13. Molecular systematic of three species of Oithona (Copepoda, Cyclopoida from the Atlantic Ocean: comparative analysis using 28S rDNA.

    Directory of Open Access Journals (Sweden)

    Georgina D Cepeda

    Full Text Available Species of Oithona (Copepoda, Cyclopoida are highly abundant, ecologically important, and widely distributed throughout the world oceans. Although there are valid and detailed descriptions of the species, routine species identifications remain challenging due to their small size, subtle morphological diagnostic traits, and the description of geographic forms or varieties. This study examined three species of Oithona (O. similis, O. atlantica and O. nana occurring in the Argentine sector of the South Atlantic Ocean based on DNA sequence variation of a 575 base-pair region of 28S rDNA, with comparative analysis of these species from other North and South Atlantic regions. DNA sequence variation clearly resolved and discriminated the species, and revealed low levels of intraspecific variation among North and South Atlantic populations of each species. The 28S rDNA region was thus shown to provide an accurate and reliable means of identifying the species throughout the sampled domain. Analysis of 28S rDNA variation for additional species collected throughout the global ocean will be useful to accurately characterize biogeographical distributions of the species and to examine phylogenetic relationships among them.

  14. Organization and variation analysis of 5S rDNA in gynogenetic offspring of Carassius auratus red var. (♀) × Megalobrama amblycephala (♂).

    Science.gov (United States)

    Qin, QinBo; Wang, Juan; Wang, YuDe; Liu, Yun; Liu, ShaoJun

    2015-03-13

    The offspring with 100 chromosomes (abbreviated as GRCC) have been obtained in the first generation of Carassius auratus red var. (abbreviated as RCC, 2n = 100) (♀) × Megalobrama amblycephala (abbreviated as BSB, 2n = 48) (♂), in which the females and unexpected males both are found. Chromosomal and karyotypic analysis has been reported in GRCC which gynogenesis origin has been suggested, but lack genetic evidence. Fluorescence in situ hybridization with species-specific centromere probes directly proves that GRCC possess two sets of RCC-derived chromosomes. Sequence analysis of the coding region (5S) and adjacent nontranscribed spacer (abbreviated as NTS) reveals that three types of 5S rDNA class (class I; class II and class III) in GRCC are completely inherited from their female parent (RCC), and show obvious base variations and insertions-deletions. Fluorescence in situ hybridization with the entire 5S rDNA probe reveals obvious chromosomal loci (class I and class II) variation in GRCC. This paper provides directly genetic evidence that GRCC is gynogenesis origin. In addition, our result is also reveals that distant hybridization inducing gynogenesis can lead to sequence and partial chromosomal loci of 5S rDNA gene obvious variation.

  15. Method for improving accident sequence recognition in nuclear power plant control rooms

    International Nuclear Information System (INIS)

    Heising, C.D.; Dinsmore, S.C.

    1983-01-01

    This work adapts fault trees from plant-specific probabilistic risk analyses (PRAs) to construct and quantitatively evaluate an alarm analysis system for the engineered safety features (ESFs). The purpose is to help improve reactor operator recognition and identification of potential accident sequences. The PRA system fault trees provide system failure mode information which can be used to construct alarm trees. These alarm trees provide a framework for assessing the plant indicators so that the plant conditions are made more readily apparent to plant personnel. In the alarm tree, possible states of each instrumented alarem are identified as true or false. In addition, a warning status is defined and integrated into an alarm analysis routine. The impact of this additional status conditioned on the Boolean laws used to evaluate the alarm trees is examined. An application is described for BWR high pressure coolant injection system (HPCI) that would be utilized during many severe reactor accidents

  16. CNE (Embalse nuclear power plant): probabilistic safety study. Electric power supply. Events sequence

    International Nuclear Information System (INIS)

    Figueroa, N.

    1987-01-01

    The plant response to the occurrence of the starting event 'total loss of electric power supply to class IV and class III' is analyzed. This involves the study of automatical actions of safety and process systems as well as the operator actions. The probabilistic evaluation of starting event frequency is performed through fault-tree techniques. The frequency of occurrence 'loss of electric power supply to class IV (λIV = 0.56/year) and the probability of failure to demand of 'reserve' generating groups (Pd III 6.79 x 10 -3 ) contribute to the mentioned frequency. As soon as the starting event occurs, the reactor power must be reduced to 0%, the fuel must be cooled through the thermo siphon and decay heat has to be removed. The events sequence analysis leads to the conclusion that the non shutting down of the reactor with any of the shutdown systems is 'incredible' (10 -6 /year). In all cases the fuel is cooled by building the thermo siphon except when a substantial inventory loss exist due to a closure failure of some valve of pressure and inventory control system. The order of magnitude of the failure of decay heat removal through the steam generators is 4 x 10 -4 . This removal would be assured by the emergency water system. Therefore, the frequency of the sequence of possible core meltdown, when the reactor does not shut down is: λ = 5 x 10 -9 /year and for the failure of heat removal: λ = 2 x 10 -6 /year. (Author)

  17. Nuclear genomic sequences reveal that polar bears are an old and distinct bear lineage.

    Science.gov (United States)

    Hailer, Frank; Kutschera, Verena E; Hallström, Björn M; Klassert, Denise; Fain, Steven R; Leonard, Jennifer A; Arnason, Ulfur; Janke, Axel

    2012-04-20

    Recent studies have shown that the polar bear matriline (mitochondrial DNA) evolved from a brown bear lineage since the late Pleistocene, potentially indicating rapid speciation and adaption to arctic conditions. Here, we present a high-resolution data set from multiple independent loci across the nuclear genomes of a broad sample of polar, brown, and black bears. Bayesian coalescent analyses place polar bears outside the brown bear clade and date the divergence much earlier, in the middle Pleistocene, about 600 (338 to 934) thousand years ago. This provides more time for polar bear evolution and confirms previous suggestions that polar bears carry introgressed brown bear mitochondrial DNA due to past hybridization. Our results highlight that multilocus genomic analyses are crucial for an accurate understanding of evolutionary history.

  18. Identification of a nuclear matrix attachment region like sequence in the last intron of PI3Kγ

    International Nuclear Information System (INIS)

    Dai Bingbing; Ying Lei; Cai Rong; Li Ying; Zhang Xingqian; Lu Jian; Qian Guanxiang

    2006-01-01

    MARs are not only the structure bases of chromatin higher order structure but also have much biological significance. In this study, the whole sequence of about 100 kb in length from BAC clone of GS1-223D4 (GI: 5931478), in which human PI3Kγ gene is localized, was analyzed by two online-based computer programs, MARFinder and SMARTest. A strong potential MAR was predicted in the last and largest intron of PI3Kγ. The predicted 2 kb MAR, we refer to PIMAR, was further analyzed through biochemical methods in vitro and in vivo. The results showed that the PIMAR could be associated with nuclear matrices from HeLa cells both in vitro and in vivo. Further reporter gene analysis showed that in the transient transfection the expression of reporter gene linked with reversed PIMAR was repressed slightly, while in stably integrated state, the luciferase reporter both linked with reversed and orientated PIMAR was enhanced greatly in NIH-3T3 and K-562. These results suggest that the PIMAR maybe has the capacity of shielding integrated heterogeneous gene from chromatin position effect. Through combination of computer program analysis with confirmation by biochemical methods, we identified, for First time, a 2 kb matrix attachment region like sequence in the last intron of human PI3Kγ

  19. Proton nuclear magnetic resonance studies on bulge-containing DNA oligonucleotides from a mutational hot-spot sequence

    International Nuclear Information System (INIS)

    Woodson, S.A.; Crothers, D.M.

    1987-01-01

    A series of bulge-containing and normal double-helical synthetic oligodeoxyribonucleotides, of sequence corresponding to a frame-shift mutational hot spot in the λ C/sub I/ gene, are compared by proton magnetic resonance spectroscopy at 500 MHz. The imino proton resonances are assigned by one-dimensional nuclear Overhauser effect spectroscopy. Nonselective T 1 inversion-recovery experiments are used to determine exchangeable proton lifetimes and to compare helix stability and dynamics of the three duplexes. An extra adenosine flanking the internal G-C base pairs has a strongly localized effect on helix stability, but the destabilizing effect of an extra cytidine in a C tract is delocalized over the entire G-C run. These data lead to the conclusion that the position of the bulge migrates along the run in the fast-exchange limit on the NMR time scale. Rapid migration of the bulge defect in homopolymeric sequences may help rationalize both frame-shift mutagenesis and translational frame shifting. The authors estimate that the unfavorable free energy of a localized bulge defect is 2.9-3.2 kcal/mol, in good agreement with earlier estimates for RNA helices

  20. The predictable nature of the Paleozoic sedimentary sequence beneath the Bruce nuclear site in Southern Ontario, Canada

    International Nuclear Information System (INIS)

    Parmenter, Andrew; Jensen, Mark; Crowe, Richard

    2012-01-01

    Document available in extended abstract form only. A key aspect of a Deep Geologic Repository (DGR) safety case is the ability to develop and communicate an understanding of the geologic stability and resilience to change at time frames relevant to demonstrating repository performance. As part of an on-going Environmental Assessment, Ontario Power Generation (OPG) recently completed site-specific investigations within an 850 m thick Paleozoic sedimentary sequence beneath the Bruce nuclear site for the proposed development of a DGR for Low and Intermediate Level Waste (L and ILW). As envisioned, the shaft-accessed DGR would be excavated at a nominal depth of 680 m within the low permeability Ordovician argillaceous limestone of the Cobourg Formation, which is overlain by more than 200 m of low permeability Ordovician shale. The geo-scientific investigations revealed a relatively undeformed and laterally continuous architecture within the sedimentary sequence at the repository scale (1.5 km 2 ) and beyond. This paper explores the predictable nature of the sedimentary sequence that has contributed to increasing confidence in an understanding of the spatial distribution of groundwater system properties, deep groundwater system evolution and natural barrier performance. Multi-disciplinary geo-scientific investigations of the Bruce nuclear site were completed in 3 phases between 2006 and 2010. The sub-surface investigations included a deep drilling, coring and in-situ testing program and, the completion of a 19.7 km (9 lines) 2-D seismic reflection survey. The drilling program involved 6 (150 mm dia.) deep boreholes (4-vertical; 2 inclined) that were extended through the sedimentary sequence from 4 drill sites, arranged around the 0.3 km 2 footprint of the proposed repository. The more than 3.8 km of rock core (77 mm dia.) retrieved have provided, in part, a strong basis to understand bedrock lithology and mineralogy, facies assemblages, structure, and oil and gas

  1. CNE (Embalse nuclear power plant): probabilistic safety study. Loss of service water. Probabilistic evaluation and analysis through events sequence

    International Nuclear Information System (INIS)

    Couto, A.J.; Perez, S.S.

    1987-01-01

    This work is part of a study on the service water systems of the Embalse nuclear power plant from a safety point of view. The faults of service water systems of high and low pressure that can lead to situations threatening the plant safety were analyzed in a previous report. The event 'total loss of low pressure service water' causes the largest number of such conditions. Such event is an operational incident that can lead to an accident situation due to faults in the required process systems or by omission of a procedure. The annual frequency of the event 'total loss of low pressure service water' is calculated. The main contribution comes from pump failure. The evaluation of the accident sequences shows that the most direct way to the liberation of fission products is the loss of steam generators as heat sink. The contributions to small and large LOCA and electric supply loss are analyzed. The sequence that leads to tritium release through boiling of moderator is also evaluated. (Author)

  2. Nuclear and cpDNA sequences combined provide strong inference of higher phylogenetic relationships in the phlox family (Polemoniaceae).

    Science.gov (United States)

    Johnson, Leigh A; Chan, Lauren M; Weese, Terri L; Busby, Lisa D; McMurry, Samuel

    2008-09-01

    Members of the phlox family (Polemoniaceae) serve as useful models for studying various evolutionary and biological processes. Despite its biological importance, no family-wide phylogenetic estimate based on multiple DNA regions with complete generic sampling is available. Here, we analyze one nuclear and five chloroplast DNA sequence regions (nuclear ITS, chloroplast matK, trnL intron plus trnL-trnF intergeneric spacer, and the trnS-trnG, trnD-trnT, and psbM-trnD intergenic spacers) using parsimony and Bayesian methods, as well as assessments of congruence and long branch attraction, to explore phylogenetic relationships among 84 ingroup species representing all currently recognized Polemoniaceae genera. Relationships inferred from the ITS and concatenated chloroplast regions are similar overall. A combined analysis provides strong support for the monophyly of Polemoniaceae and subfamilies Acanthogilioideae, Cobaeoideae, and Polemonioideae. Relationships among subfamilies, and thus for the precise root of Polemoniaceae, remain poorly supported. Within the largest subfamily, Polemonioideae, four clades corresponding to tribes Polemonieae, Phlocideae, Gilieae, and Loeselieae receive strong support. The monogeneric Polemonieae appears sister to Phlocideae. Relationships within Polemonieae, Phlocideae, and Gilieae are mostly consistent between analyses and data permutations. Many relationships within Loeselieae remain uncertain. Overall, inferred phylogenetic relationships support a higher-level classification for Polemoniaceae proposed in 2000.

  3. Evidence for 5S rDNA horizontal transfer in the toadfish Halobatrachus didactylus (Schneider, 1801) based on the analysis of three multigene families.

    Science.gov (United States)

    Merlo, Manuel A; Cross, Ismael; Palazón, José L; Ubeda-Manzanaro, María; Sarasquete, Carmen; Rebordinos, Laureana

    2012-10-07

    The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH). Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS) sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not in the Pleuronectiformes and Clupeiformes orders. Two

  4. Evidence for 5S rDNA Horizontal Transfer in the toadfish Halobatrachus didactylus (Schneider, 1801 based on the analysis of three multigene families

    Directory of Open Access Journals (Sweden)

    Merlo Manuel A

    2012-10-01

    Full Text Available Abstract Background The Batrachoididae family is a group of marine teleosts that includes several species with more complicated physiological characteristics, such as their excretory, reproductive, cardiovascular and respiratory systems. Previous studies of the 5S rDNA gene family carried out in four species from the Western Atlantic showed two types of this gene in two species but only one in the other two, under processes of concerted evolution and birth-and-death evolution with purifying selection. Here we present results of the 5S rDNA and another two gene families in Halobatrachus didactylus, an Eastern Atlantic species, and draw evolutionary inferences regarding the gene families. In addition we have also mapped the genes on the chromosomes by two-colour fluorescence in situ hybridization (FISH. Results Two types of 5S rDNA were observed, named type α and type β. Molecular analysis of the 5S rDNA indicates that H. didactylus does not share the non-transcribed spacer (NTS sequences with four other species of the family; therefore, it must have evolved in isolation. Amplification with the type β specific primers amplified a specific band in 9 specimens of H. didactylus and two of Sparus aurata. Both types showed regulatory regions and a secondary structure which mark them as functional genes. However, the U2 snRNA gene and the ITS-1 sequence showed one electrophoretic band and with one type of sequence. The U2 snRNA sequence was the most variable of the three multigene families studied. Results from two-colour FISH showed no co-localization of the gene coding from three multigene families and provided the first map of the chromosomes of the species. Conclusions A highly significant finding was observed in the analysis of the 5S rDNA, since two such distant species as H. didactylus and Sparus aurata share a 5S rDNA type. This 5S rDNA type has been detected in other species belonging to the Batrachoidiformes and Perciformes orders, but not

  5. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats.

    Science.gov (United States)

    Warmerdam, Daniël O; van den Berg, Jeroen; Medema, René H

    2016-03-22

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5) as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  6. Mapping of rDNA on the chromosomes of Eleusine species by fluorescence in situ hybridization.

    Science.gov (United States)

    Bisht, M S; Mukai, Y

    2000-12-01

    Mapping of rDNA sites on the chromosomes of four diploid and two tetraploid species of Eleusine has provided valuable information on genome relationship between the species. Presence of 18S-5.8S-26S rDNA on the largest pair of the chromosomes, location of 5S rDNA at four sites on two pairs of chromosomes and presence of 18S-5.8S-26S and 5S rDNA at same location on one pair of chromosomes have clearly differentiated E. multiflora from rest of the species of Eleusine. The two tetraploid species, E. coracana and E. africana have the same number of 18S-5.8S-26S and 5S rDNA sites and located at similar position on the chromosomes. Diploid species, E. indica, E. floccifolia and E. tristachya have the same 18S-5.8S-26S sites and location on the chromosomes which also resembled with the two pairs of 18S-5.8S-26S rDNA locations in tetraploid species, E. coracana and E. africana. The 5S rDNA sites on chromosomes of E. indica and E. floccifolia were also comparable to the 5S rDNA sites of E. africana and E. coracana. The similarity of the rDNA sites and their location on chromosomes in the three diploid and two polyploid species also supports the view that genome donors to tetraploid species may be from these diploid species.

  7. 18S rDNA phylogeny of lamproderma and allied genera (Stemonitales, Myxomycetes, Amoebozoa.

    Directory of Open Access Journals (Sweden)

    Anna Maria Fiore-Donno

    Full Text Available The phylogenetic position of the slime-mould genus Lamproderma (Myxomycetes, Amoebozoa challenges traditional taxonomy: although it displays the typical characters of the order Stemonitales, it appears to be sister to Physarales. This study provides a small subunit (18S or SSU ribosomal RNA gene-based phylogeny of Lamproderma and its allies, with new sequences from 49 specimens in 12 genera. We found that the order Stemonitales and Lamproderma were both ancestral to Physarales and that Lamproderma constitutes several clades intermingled with species of Diacheopsis, Colloderma and Elaeomyxa. We suggest that these genera may have evolved from Lamproderma by multiple losses of fruiting body stalks and that many taxonomic revisions are needed. We found such high genetic diversity within three Lamproderma species that they probably consist of clusters of sibling species. We discuss the contrasts between genetic and morphological divergence and implications for the morphospecies concept, highlighting the phylogenetically most reliable morphological characters and pointing to others that have been overestimated. In addition, we showed that the first part (~600 bases of the SSU rDNA gene is a valuable tool for phylogeny in Myxomycetes, since it displayed sufficient variability to distinguish closely related taxa and never failed to cluster together specimens considered of the same species.

  8. CONTRIBUTION TO THE PHYLOGENY OF THE PANGASIIDAE BASED ON MITOCHONDRIAL 12S RDNA

    Directory of Open Access Journals (Sweden)

    L. Pouyaud

    2016-10-01

    Full Text Available Catfishes are generally one of the economically important groups of fresh and brackish water fishes in the world. In many countries, they form a significant part of inland fisheries, and several species have been  introduced in fish culture. Judging from literature, the main constraint to cultivate wild species and to optimise the production of pangasiid catfishes is due to the poorly documented systematics of this family. In the present contribution, the phylogenetic relationships within Pangasiidae are studied to contribute to a better insight in their taxonomy and evolution. The genetic relatedness is inferred using mitochondrial 12S rDNA gene sequences. To resolve the phylogenetic position of Laides in this group of catfish, five genera of Asian and African Schilbeidae are also considered. The results showed that a species group (complex could be clearly seen in the genetic tree. Pangasius is more derive than the other genera. By using approximate molecular clock/evolutionary calibration from  mitochondrial gene, a new episode of  speciation for the family marked explosive radiation about 5- 8 million years ago (mya. This adaptive radiation extended until the Late Pleistocene. Regarding the relationships between the Pangasiidae and Schilbeidae, two families show an allopatric distribution with slight overlap. The Pangasiidae occur mainly in Southeast Asia, while the Schilbeidae are seen mainly on the Indian subcontinent (including Myanmar and Africa. It confirms the separation between  Schilbeidae and Pangasiidae occurred in the Early Miocene.

  9. A preliminary molecular phylogeny of planthoppers (Hemiptera: Fulgoroidea based on nuclear and mitochondrial DNA sequences.

    Directory of Open Access Journals (Sweden)

    Nan Song

    Full Text Available The planthopper superfamily Fulgoroidea (Insecta: Hemiptera is one of the most dominant groups of phytophagous insects. It comprises about 20 families, containing a total of 9000 species worldwide. Despite several recent studies, the phylogeny of Fulgoroidea is not yet satisfactorily resolved and the phylogenetic positions of several key families, especially Cixiidae, Delphacidae, Tettigometridae, Nogodinidae, Acanaloniidae and Issidae, are contentious. Here, we expand upon recent phylogenetic work using additional nuclear (18S and 28S and novel mitochondrial (16S and cytb markers. Maximum likelihood and Bayesian analyses yielded robust phylogenetic trees. In these topologies, a group containing Cixiidae and Delphacidae is recovered as the sister group to the remaining taxa. Tettigometridae is placed in a more nested position and is grouped with Caliscelidae. Sister relationships are found between Flatidae and Ricaniidae, and between Dictyopharidae and Fulgoridae. Nogodinidae and Issidae are confirmed to be non-monophyletic families. For major nodes of interest, divergence date estimates are generally older than those from the fossil record.

  10. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    International Nuclear Information System (INIS)

    Grierson, Patrick M.; Acharya, Samir; Groden, Joanna

    2013-01-01

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription

  11. Collaborating functions of BLM and DNA topoisomerase I in regulating human rDNA transcription

    Energy Technology Data Exchange (ETDEWEB)

    Grierson, Patrick M. [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Acharya, Samir, E-mail: samir.acharya@osumc.edu [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States); Groden, Joanna [Department of Microbiology, Immunology and Medical Genetics, The Ohio State University College of Medicine, Columbus, OH 43210 (United States)

    2013-03-15

    Bloom's syndrome (BS) is an inherited disorder caused by loss of function of the recQ-like BLM helicase. It is characterized clinically by severe growth retardation and cancer predisposition. BLM localizes to PML nuclear bodies and to the nucleolus; its deficiency results in increased intra- and inter-chromosomal recombination, including hyper-recombination of rDNA repeats. Our previous work has shown that BLM facilitates RNA polymerase I-mediated rRNA transcription in the nucleolus (Grierson et al., 2012 [18]). This study uses protein co-immunoprecipitation and in vitro transcription/translation (IVTT) to identify a direct interaction of DNA topoisomerase I with the C-terminus of BLM in the nucleolus. In vitro helicase assays demonstrate that DNA topoisomerase I stimulates BLM helicase activity on a nucleolar-relevant RNA:DNA hybrid, but has an insignificant effect on BLM helicase activity on a control DNA:DNA duplex substrate. Reciprocally, BLM enhances the DNA relaxation activity of DNA topoisomerase I on supercoiled DNA substrates. Our study suggests that BLM and DNA topoisomerase I function coordinately to modulate RNA:DNA hybrid formation as well as relaxation of DNA supercoils in the context of nucleolar transcription.

  12. [18S-25S rDNA variation in tissue culture of some Gentiana L. species].

    Science.gov (United States)

    Mel'nyk, V M; Andrieiev, I O; Spiridonova, K V; Strashniuk, N M; Kunakh, V A

    2007-01-01

    18S-25S rDNA of intact plants and tissue cultures of G. acaulis, G. punctata and G. lutea have been investigated by using blot-hybridization. The decrease of rDNA amount was found in the callus cultures as compared with the plants. In contrast to other species, G. lutea showed intragenome heterogeneity of rRNA genes as well as qualitative rDNA changes in tissue culture, in particular appearance of altered repeats. The relationship between the peculiarities of rRNA gene structure and their rearrangements in in vitro culture was suggested.

  13. Applications of inter simple sequence repeat (ISSR) rDNA in ...

    African Journals Online (AJOL)

    bika

    2015-04-22

    Apr 22, 2015 ... for studying genetic variations of L. natalensis snails in Egypt. L. natalensis snails ... Molecular techniques such as random amplified polymorphic ... during collection, water temperature, conductivity and pH were recorded and ...

  14. How well do ITS rDNA sequences differentiate species of true morels (Morchella)?

    Science.gov (United States)

    Arguably more mycophiles hunt true morels (Morchella) during their brief fruiting season each spring in the Northern Hemisphere than any other wild edible fungus. Concerns about overharvesting by individual collectors and commercial enterprises make it essential that science-based management practic...

  15. Applications of inter simple sequence repeat (ISSR) rDNA in ...

    African Journals Online (AJOL)

    bika

    2015-04-22

    Apr 22, 2015 ... respectively. These markers were used to estimate genetic similarity among the varieties using ... the degree of species preference plants for snails' life. (Kader ..... countries 80% of all human illness is associated with polluted ...

  16. Higher-order organisation of extremely amplified, potentially functional and massively methylated 5S rDNA in European pikes (Esox sp.).

    Science.gov (United States)

    Symonová, Radka; Ocalewicz, Konrad; Kirtiklis, Lech; Delmastro, Giovanni Battista; Pelikánová, Šárka; Garcia, Sonia; Kovařík, Aleš

    2017-05-18

    Pikes represent an important genus (Esox) harbouring a pre-duplication karyotype (2n = 2x = 50) of economically important salmonid pseudopolyploids. Here, we have characterized the 5S ribosomal RNA genes (rDNA) in Esox lucius and its closely related E. cisalpinus using cytogenetic, molecular and genomic approaches. Intragenomic homogeneity and copy number estimation was carried out using Illumina reads. The higher-order structure of rDNA arrays was investigated by the analysis of long PacBio reads. Position of loci on chromosomes was determined by FISH. DNA methylation was analysed by methylation-sensitive restriction enzymes. The 5S rDNA loci occupy exclusively (peri)centromeric regions on 30-38 acrocentric chromosomes in both E. lucius and E. cisalpinus. The large number of loci is accompanied by extreme amplification of genes (>20,000 copies), which is to the best of our knowledge one of the highest copy number of rRNA genes in animals ever reported. Conserved secondary structures of predicted 5S rRNAs indicate that most of the amplified genes are potentially functional. Only few SNPs were found in genic regions indicating their high homogeneity while intergenic spacers were more heterogeneous and several families were identified. Analysis of 10-30 kb-long molecules sequenced by the PacBio technology (containing about 40% of total 5S rDNA) revealed that the vast majority (96%) of genes are organised in large several kilobase-long blocks. Dispersed genes or short tandems were less common (4%). The adjacent 5S blocks were directly linked, separated by intervening DNA and even inverted. The 5S units differing in the intergenic spacers formed both homogeneous and heterogeneous (mixed) blocks indicating variable degree of homogenisation between the loci. Both E. lucius and E. cisalpinus 5S rDNA was heavily methylated at CG dinucleotides. Extreme amplification of 5S rRNA genes in the Esox genome occurred in the absence of significant pseudogenisation

  17. Assessment of phylogenetic relationship of rare plant species collected from Saudi Arabia using internal transcribed spacer sequences of nuclear ribosomal DNA.

    Science.gov (United States)

    Al-Qurainy, F; Khan, S; Nadeem, M; Tarroum, M; Alaklabi, A

    2013-03-11

    The rare and endangered plants of any country are important genetic resources that often require urgent conservation measures. Assessment of phylogenetic relationships and evaluation of genetic diversity is very important prior to implementation of conservation strategies for saving rare and endangered plant species. We used internal transcribed spacer sequences of nuclear ribosomal DNA for the evaluation of sequence identity from the available taxa in the GenBank database by using the Basic Local Alignment Search Tool (BLAST). Two rare plant species viz, Heliotropium strigosum claded with H. pilosum (98% branch support) and Pancratium tortuosum claded with P. tenuifolium (61% branch support) clearly. However, some species, viz Scadoxus multiflorus, Commiphora myrrha and Senecio hadiensis showed close relationships with more than one species. We conclude that nuclear ribosomal internal transcribed spacer sequences are useful markers for phylogenetic study of these rare plant species in Saudi Arabia.

  18. Rapid allopolyploid radiation of moonwort ferns (Botrychium; Ophioglossaceae) revealed by PacBio sequencing of homologous and homeologous nuclear regions.

    Science.gov (United States)

    Dauphin, Benjamin; Grant, Jason R; Farrar, Donald R; Rothfels, Carl J

    2018-03-01

    Polyploidy is a major speciation process in vascular plants, and is postulated to be particularly important in shaping the diversity of extant ferns. However, limitations in the availability of bi-parental markers for ferns have greatly limited phylogenetic investigation of polyploidy in this group. With a large number of allopolyploid species, the genus Botrychium is a classic example in ferns where recurrent polyploidy is postulated to have driven frequent speciation events. Here, we use PacBio sequencing and the PURC bioinformatics pipeline to capture all homeologous or allelic copies of four long (∼1 kb) low-copy nuclear regions from a sample of 45 specimens (25 diploids and 20 polyploids) representing 37 Botrychium taxa, and three outgroups. This sample includes most currently recognized Botrychium species in Europe and North America, and the majority of our specimens were genotyped with co-dominant nuclear allozymes to ensure species identification. We analyzed the sequence data using maximum likelihood (ML) and Bayesian inference (BI) concatenated-data ("gene tree") approaches to explore the relationships among Botrychium species. Finally, we estimated divergence times among Botrychium lineages and inferred the multi-labeled polyploid species tree showing the origins of the polyploid taxa, and their relationships to each other and to their diploid progenitors. We found strong support for the monophyly of the major lineages within Botrychium and identified most of the parental donors of the polyploids; these results largely corroborate earlier morphological and allozyme-based investigations. Each polyploid had at least two distinct homeologs, indicating that all sampled polyploids are likely allopolyploids (rather than autopolyploids). Our divergence-time analyses revealed that these allopolyploid lineages originated recently-within the last two million years-and thus that the genus has undergone a recent radiation, correlated with multiple independent

  19. Mitochondrial and nuclear DNA sequences support a Cretaceous origin of Columbiformes and a dispersal-driven radiation in the Paleocene .

    Science.gov (United States)

    Pereira, Sergio L; Johnson, Kevin P; Clayton, Dale H; Baker, Allan J

    2007-08-01

    Phylogenetic relationships among genera of pigeons and doves (Aves, Columbiformes) have not been fully resolved because of limited sampling of taxa and characters in previous studies. We therefore sequenced multiple nuclear and mitochondrial DNA genes totaling over 9000 bp from 33 of 41 genera plus 8 outgroup taxa, and, together with sequences from 5 other pigeon genera retrieved from GenBank, recovered a strong phylogenetic hypothesis for the Columbiformes. Three major clades were recovered with the combined data set, comprising the basally branching New World pigeons and allies (clade A) that are sister to Neotropical ground doves (clade B), and the Afro-Eurasian and Australasian taxa (clade C). None of these clades supports the monophyly of current families and subfamilies. The extinct, flightless dodo and solitaires (Raphidae) were embedded within pigeons and doves (Columbidae) in clade C, and monophyly of the subfamily Columbinae was refuted because the remaining subfamilies were nested within it. Divergence times estimated using a Bayesian framework suggest that Columbiformes diverged from outgroups such as Apodiformes and Caprimulgiformes in the Cretaceous before the mass extinction that marks the end of this period. Bayesian and maximum likelihood inferences of ancestral areas, accounting for phylogenetic uncertainty and divergence times, respectively, favor an ancient origin of Columbiformes in the Neotropical portion of what was then Gondwana. The radiation of modern genera of Columbiformes started in the Early Eocene to the Middle Miocene, as previously estimated for other avian groups such as ratites, tinamous, galliform birds, penguins, shorebirds, parrots, passerine birds, and toucans. Multiple dispersals of more derived Columbiformes between Australasian and Afro-Eurasian regions are required to explain current distributions.

  20. Description of a new planktonic mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. from the coastal waters off Western Korea: morphology, pigments, and ribosomal DNA gene sequence.

    Science.gov (United States)

    Kang, Nam Seon; Jeong, Hae Jin; Moestrup, Øjvind; Shin, Woongghi; Nam, Seung Won; Park, Jae Yeon; De Salas, Miguel F; Kim, Ki Woo; Noh, Jae Hoon

    2010-01-01

    The mixotrophic dinoflagellate Paragymnodinium shiwhaense n. gen., n. sp. is described from living cells and from cells prepared by light, scanning electron, and transmission electron microscopy. In addition, sequences of the small subunit (SSU) and large subunit (LSU) rDNA and photosynthetic pigments are reported. The episome is conical, while the hyposome is hemispherical. Cells are covered with polygonal amphiesmal vesicles arranged in 16 rows and containing a very thin plate-like component. There is neither an apical groove nor apical line of narrow plates. Instead, there is a sulcal extension-like furrow. The cingulum is as wide as 0.2-0.3 x cell length and displaced by 0.2-0.3 x cell length. Cell length and width of live cells fed Amphidinium carterae were 8.4-19.3 and 6.1-16.0 microm, respectively. Paragymnodinium shiwhaense does not have a nuclear envelope chamber nor a nuclear fibrous connective (NFC). Cells contain chloroplasts, nematocysts, trichocysts, and peduncle, though eyespots, pyrenoids, and pusules are absent. The main accessory pigment is peridinin. The sequence of the SSU rDNA of this dinoflagellate (GenBank AM408889) is 4% different from that of Gymnodinium aureolum, Lepidodinium viride, and Gymnodinium catenatum, the three closest species, while the LSU rDNA was 17-18% different from that of G. catenatum, Lepidodinium chlorophorum, and Gymnodinium nolleri. The phylogenetic trees show that this dinoflagellate belongs within the Gymnodinium sensu stricto clade. However, in contrast to Gymnodinium spp., cells lack nuclear envelope chambers, NFC, and an apical groove. Unlike Polykrikos spp., which have a taeniocyst-nematocyst complex, P. shiwhaense has nematocysts without taeniocysts. In addition, P. shiwhaense does not have ocelloids in contrast to Warnowia spp. and Nematodinium spp. Therefore, based on morphological and molecular analyses, we suggest that this taxon is a new species, also within a new genus.

  1. Inferring Invasion History of Red Swamp Crayfish (Procambarus clarkii) in China from Mitochondrial Control Region and Nuclear Intron Sequences

    Science.gov (United States)

    Li, Yanhe; Guo, Xianwu; Chen, Liping; Bai, Xiaohui; Wei, Xinlan; Zhou, Xiaoyun; Huang, Songqian; Wang, Weimin

    2015-01-01

    Identifying the dispersal pathways of an invasive species is useful for adopting the appropriate strategies to prevent and control its spread. However, these processes are exceedingly complex. So, it is necessary to apply new technology and collect representative samples for analysis. This study used Approximate Bayesian Computation (ABC) in combination with traditional genetic tools to examine extensive sample data and historical records to infer the invasion history of the red swamp crayfish, Procambarus clarkii, in China. The sequences of the mitochondrial control region and the proPOx intron in the nuclear genome of samples from 37 sites (35 in China and one each in Japan and the USA) were analyzed. The results of combined scenarios testing and historical records revealed a much more complex invasion history in China than previously believed. P. clarkii was most likely originally introduced into China from Japan from an unsampled source, and the species then expanded its range primarily into the middle and lower reaches and, to a lesser extent, into the upper reaches of the Changjiang River in China. No transfer was observed from the upper reaches to the middle and lower reaches of the Changjiang River. Human-mediated jump dispersal was an important dispersal pathway for P. clarkii. The results provide a better understanding of the evolutionary scenarios involved in the rapid invasion of P. clarkii in China. PMID:26132567

  2. Inferring Invasion History of Red Swamp Crayfish (Procambarus clarkii in China from Mitochondrial Control Region and Nuclear Intron Sequences

    Directory of Open Access Journals (Sweden)

    Yanhe Li

    2015-06-01

    Full Text Available Identifying the dispersal pathways of an invasive species is useful for adopting the appropriate strategies to prevent and control its spread. However, these processes are exceedingly complex. So, it is necessary to apply new technology and collect representative samples for analysis. This study used Approximate Bayesian Computation (ABC in combination with traditional genetic tools to examine extensive sample data and historical records to infer the invasion history of the red swamp crayfish, Procambarus clarkii, in China. The sequences of the mitochondrial control region and the proPOx intron in the nuclear genome of samples from 37 sites (35 in China and one each in Japan and the USA were analyzed. The results of combined scenarios testing and historical records revealed a much more complex invasion history in China than previously believed. P. clarkii was most likely originally introduced into China from Japan from an unsampled source, and the species then expanded its range primarily into the middle and lower reaches and, to a lesser extent, into the upper reaches of the Changjiang River in China. No transfer was observed from the upper reaches to the middle and lower reaches of the Changjiang River. Human-mediated jump dispersal was an important dispersal pathway for P. clarkii. The results provide a better understanding of the evolutionary scenarios involved in the rapid invasion of P. clarkii in China.

  3. Reproductive biology and variation of nuclear ribosomal ITS and ETS sequences in the Calligonum mongolicum complex (Polygonaceae

    Directory of Open Access Journals (Sweden)

    Wei Shi

    2017-01-01

    Full Text Available To explore the biosystematics of the Calligonum mongolicum complex (Polygonaceae, the flowering phenological period, breeding and pollination characters and seed set of the complex (C. Mongolicum Turze, C. chinense A. Los., C. gobicum A. Los., C. pumilum A. Los. and C. zaidamense A. Los. were documented in the Turpan Eremophyte Botanical Garden, China. The sequences of the nuclear ribosomal ITS and ETS region were employed to differentiate the C. mongolicum complex and other species in sect. Medusae. The results showed species of the C. mongolicum complex occupied overlapping flowering periods and had consistent pollination agents. Their breeding systems are all self-compatible, tend to be out-crossing and they interbreed amongst each other (out-crossing index, OCI = 4.The crosses within and amongst species had high seed sets (44 - 65%. Phylogenetic analyses of Calligonum sect. Medusae and the network analysis of nrDNA (ITS and ETS in the complex suggest interbreeding amongst “species” within the complex and provide evidence for taxonomically merging the five species in the complex. The detected hybridisation, occurring within the complex, suggests the need to improve traditional methods of ex situ plant conservation in botanical gardens for maintaining genetic diversity of Calligonum within and amongst species from different geographic areas.

  4. A phylogenetic hypothesis for passerine birds: taxonomic and biogeographic implications of an analysis of nuclear DNA sequence data.

    Science.gov (United States)

    Barker, F Keith; Barrowclough, George F; Groth, Jeff G

    2002-02-07

    Passerine birds comprise over half of avian diversity, but have proved difficult to classify. Despite a long history of work on this group, no comprehensive hypothesis of passerine family-level relationships was available until recent analyses of DNA-DNA hybridization data. Unfortunately, given the value of such a hypothesis in comparative studies of passerine ecology and behaviour, the DNA-hybridization results have not been well tested using independent data and analytical approaches. Therefore, we analysed nucleotide sequence variation at the nuclear RAG-1 and c-mos genes from 69 passerine taxa, including representatives of most currently recognized families. In contradiction to previous DNA-hybridization studies, our analyses suggest paraphyly of suboscine passerines because the suboscine New Zealand wren Acanthisitta was found to be sister to all other passerines. Additionally, we reconstructed the parvorder Corvida as a basal paraphyletic grade within the oscine passerines. Finally, we found strong evidence that several family-level taxa are misplaced in the hybridization results, including the Alaudidae, Irenidae, and Melanocharitidae. The hypothesis of relationships we present here suggests that the oscine passerines arose on the Australian continental plate while it was isolated by oceanic barriers and that a major northern radiation of oscines (i.e. the parvorder Passerida) originated subsequent to dispersal from the south.

  5. Limits of transforming competence of SV40 nuclear and cytoplasmic large T mutants with altered Rb binding sequences.

    Science.gov (United States)

    Tedesco, D; Fischer-Fantuzzi, L; Vesco, C

    1993-03-01

    Multiple amino acid substitutions were introduced into the SV40 large T region that harbors the retinoblastoma protein (Rb) binding site and the nuclear transport signal, changing either one or both of these determinants. Mutant activities were examined in a set of assays allowing different levels of transforming potential to be distinguished; phenotypic changes in established and pre-crisis rat embryo fibroblasts (REFs) were detected under isogenic cell conditions, and comparisons made with other established rodent cells. The limit of the transforming ability of mutants with important substitutions in the Rb binding site fell between two transformation levels of the same established rat cells. Such cells could be induced to form dense foci but not agar colonies (their parental pre-crises REFs, as expected, were untransformed either way). Nonetheless, agar colony induction was possible in other cell lines, such as mouse NIH3T3 and (for one of the mutants) rat F2408. All these mutants efficiently immortalized pre-crisis REFs. The transforming ability of cytoplasmic mutants appeared to depend on the integrity of the Rb-binding sequence to approximately the same extent as that of the wild-type large T, although evidence of in vivo Rb-cytoplasmic large T complexes was not found. The presence or absence of small t was critical when the transforming task of mutants was near the limit of their abilities.

  6. Multiple group I introns in the small-subunit rDNA of Botryosphaeria dothidea: implication for intraspecific genetic diversity.

    Directory of Open Access Journals (Sweden)

    Chao Xu

    Full Text Available Botryosphaeria dothidea is a widespread and economically important pathogen on various fruit trees, and it often causes die-back and canker on limbs and fruit rot. In characterizing intraspecies genetic variation within this fungus, group I introns, rich in rDNA of fungi, may provide a productive region for exploration. In this research, we analysed complete small subunit (SSU ribosomal DNA (rDNA sequences of 37 B. dothidea strains, and found four insertions, designated Bdo.S943, Bdo.S1199-A, Bdo.S1199-B and Bdo.S1506, at three positions. Sequence analysis and structure prediction revealed that both Bdo.S943 and Bdo.S1506 belonged to subgroup IC1 of group I introns, whereas Bdo.S1199-A and Bdo.S1199-B corresponded to group IE introns. Moreover, Bdo.S1199-A was found to host an open reading frame (ORF for encoding the homing endonuclease (HE, whereas Bdo.S1199-B, an evolutionary descendant of Bdo.S1199-A, included a degenerate HE. The above four introns were novel, and were the first group I introns observed and characterized in this species. Differential distribution of these introns revealed that all strains could be separated into four genotypes. Genotype III (no intron and genotype IV (Bdo.S1199-B were each found in only one strain, whereas genotype I (Bdo.S1199-A and genotype II (Bdo.S943 and Bdo.S1506 occurred in 95% of the strains. There is a correlation between B. dothidea genotypes and hosts or geographic locations. Thus, these newly discovered group I introns can help to advance understanding of genetic differentiation within B. dothidea.

  7. Complete genome sequence and integrated protein localization and interaction map for alfalfa dwarf virus, which combines properties of both cytoplasmic and nuclear plant rhabdoviruses

    Energy Technology Data Exchange (ETDEWEB)

    Bejerman, Nicolás, E-mail: n.bejerman@uq.edu.au [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia); Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio [Instituto de Patología Vegetal (IPAVE), Centro de Investigaciones Agropecuarias (CIAP), Instituto Nacional de Tecnología Agropecuaria INTA, Camino a 60 Cuadras k 5,5, Córdoba X5020ICA (Argentina); Dietzgen, Ralf G. [Queensland Alliance for Agriculture and Food Innovation, The University of Queensland, St Lucia, QLD 4072 (Australia)

    2015-09-15

    Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses.

  8. Complete genome sequence and integrated protein localization and interaction map for alfalfa dwarf virus, which combines properties of both cytoplasmic and nuclear plant rhabdoviruses

    International Nuclear Information System (INIS)

    Bejerman, Nicolás; Giolitti, Fabián; Breuil, Soledad de; Trucco, Verónica; Nome, Claudia; Lenardon, Sergio; Dietzgen, Ralf G.

    2015-01-01

    Summary: We have determined the full-length 14,491-nucleotide genome sequence of a new plant rhabdovirus, alfalfa dwarf virus (ADV). Seven open reading frames (ORFs) were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, in the order 3′-N-P-P3-M-G-P6-L-5′. The ORFs are separated by conserved intergenic regions and the genome coding region is flanked by complementary 3′ leader and 5′ trailer sequences. Phylogenetic analysis of the nucleoprotein amino acid sequence indicated that this alfalfa-infecting rhabdovirus is related to viruses in the genus Cytorhabdovirus. When transiently expressed as GFP fusions in Nicotiana benthamiana leaves, most ADV proteins accumulated in the cell periphery, but unexpectedly P protein was localized exclusively in the nucleus. ADV P protein was shown to have a homotypic, and heterotypic nuclear interactions with N, P3 and M proteins by bimolecular fluorescence complementation. ADV appears unique in that it combines properties of both cytoplasmic and nuclear plant rhabdoviruses. - Highlights: • The complete genome of alfalfa dwarf virus is obtained. • An integrated localization and interaction map for ADV is determined. • ADV has a genome sequence similarity and evolutionary links with cytorhabdoviruses. • ADV protein localization and interaction data show an association with the nucleus. • ADV combines properties of both cytoplasmic and nuclear plant rhabdoviruses

  9. Copy number of the transposon, Pokey, in rDNA is positively correlated with rDNA copy number in Daphnia obtuse [corrected].

    Directory of Open Access Journals (Sweden)

    Kaitlynn LeRiche

    Full Text Available Pokey is a class II DNA transposon that inserts into 28S ribosomal RNA (rRNA genes and other genomic regions of species in the subgenus, Daphnia. Two divergent lineages, PokeyA and PokeyB have been identified. Recombination between misaligned rRNA genes changes their number and the number of Pokey elements. We used quantitative PCR (qPCR to estimate rRNA gene and Pokey number in isolates from natural populations of Daphnia obtusa, and in clonally-propagated mutation accumulation lines (MAL initiated from a single D. obtusa female. The change in direction and magnitude of Pokey and rRNA gene number did not show a consistent pattern across ∼ 87 generations in the MAL; however, Pokey and rRNA gene number changed in concert. PokeyA and 28S gene number were positively correlated in the isolates from both natural populations and the MAL. PokeyB number was much lower than PokeyA in both MAL and natural population isolates, and showed no correlation with 28S gene number. Preliminary analysis did not detect PokeyB outside rDNA in any isolates and detected only 0 to 4 copies of PokeyA outside rDNA indicating that Pokey may be primarily an rDNA element in D. obtusa. The recombination rate in this species is high and the average size of the rDNA locus is about twice as large as that in other Daphnia species such as D. pulicaria and D. pulex, which may have facilitated expansion of PokeyA to much higher numbers in D. obtusa rDNA than these other species.

  10. Non-Random Distribution of 5S rDNA Sites and Its Association with 45S rDNA in Plant Chromosomes.

    Science.gov (United States)

    Roa, Fernando; Guerra, Marcelo

    2015-01-01

    5S and 45S rDNA sites are the best mapped chromosome regions in eukaryotic chromosomes. In this work, a database was built gathering information about the position and number of 5S rDNA sites in 784 plant species, aiming to identify patterns of distribution along the chromosomes and its correlation with the position of 45S rDNA sites. Data revealed that in most karyotypes (54.5%, including polyploids) two 5S rDNA sites (a single pair) are present, with 58.7% of all sites occurring in the short arm, mainly in the proximal region. In karyotypes of angiosperms with only 1 pair of sites (single sites) they are mostly found in the proximal region (52.0%), whereas in karyotypes with multiple sites the location varies according to the average chromosome size. Karyotypes with multiple sites and small chromosomes (6 µm) more commonly show terminal or interstitial sites. In species with holokinetic chromosomes, the modal value of sites per karyotype was also 2, but they were found mainly in a terminal position. Adjacent 5S and 45S rDNA sites were often found in the short arm, reflecting the preferential distribution of both sites in this arm. The high frequency of genera with at least 1 species with adjacent 5S and 45S sites reveals that this association appeared several times during angiosperm evolution, but it has been maintained only rarely as the dominant array in plant genera. © 2015 S. Karger AG, Basel.

  11. Biofouling on austenitic stainless steels in spent nuclear fuel pools

    Energy Technology Data Exchange (ETDEWEB)

    Sarro, M I; Moreno, D A; Chicote, E; Lorenzo, P I; Garcia, A M [Universidad Politecnica de Madrid, Departamento de Ingenieria y Ciencia de los Materiales, Escuela Tecnica Superior de Ingenieros Industriales, Jose Gutierrez Abascal, 2, E-28006 Madrid (Spain); Montero, F [Iberdrola Generacion, S.A., y C.M.D.S., Centro de Tecnologia de Materiales, Paseo de la Virgen del Puerto, 53, E-28005 Madrid (Spain)

    2003-07-01

    The objective of this study was to investigate the biofilm formation on three different types of austenitic stainless steel (UNS S30400, S30466 and S31600) submerged in a spent nuclear fuel pool. The presence of microorganisms in coupons was characterised using standard culture microbiological methods, microscopic techniques (epifluorescence microscopy and scanning electron microscopy), and molecular biology techniques (denaturing gradient gel electrophoresis and sequencing fragments of 16S rDNA). The microscopy techniques showed signs of colonisation of stainless steels in spite of these extreme conditions. Based on sequencing of cultured microorganisms, different bacteria belonging to {alpha}, {beta}, {gamma}-Proteobacteria, Bacilli, and Actinobacteria classes have been identified. The biofilm radioactivity was measured using gamma-ray spectrometry and, according to the data gathered, the radionuclides present in the water pool were entrapped in the biofilm increasing the amount of radiation at the surface of the different materials. (Abstract Copyright [2003], Wiley Periodicals, Inc.)

  12. Biofouling on austenitic stainless steels in spent nuclear fuel pools

    International Nuclear Information System (INIS)

    Sarro, M.I.; Moreno, D.A.; Chicote, E.; Lorenzo, P.I.; Garcia, A.M.; Montero, F.

    2003-01-01

    The objective of this study was to investigate the biofilm formation on three different types of austenitic stainless steel (UNS S30400, S30466 and S31600) submerged in a spent nuclear fuel pool. The presence of microorganisms in coupons was characterised using standard culture microbiological methods, microscopic techniques (epifluorescence microscopy and scanning electron microscopy), and molecular biology techniques (denaturing gradient gel electrophoresis and sequencing fragments of 16S rDNA). The microscopy techniques showed signs of colonisation of stainless steels in spite of these extreme conditions. Based on sequencing of cultured microorganisms, different bacteria belonging to α, β, γ-Proteobacteria, Bacilli, and Actinobacteria classes have been identified. The biofilm radioactivity was measured using gamma-ray spectrometry and, according to the data gathered, the radionuclides present in the water pool were entrapped in the biofilm increasing the amount of radiation at the surface of the different materials. (Abstract Copyright [2003], Wiley Periodicals, Inc.)

  13. Evolutionary history of Phakopsora pachyrhizi (the Asian soybean rust in Brazil based on nucleotide sequences of the internal transcribed spacer region of the nuclear ribosomal DNA

    Directory of Open Access Journals (Sweden)

    Maíra C. M. Freire

    2008-01-01

    Full Text Available Phakopsora pachyrhizi has dispersed globally and brought severe economic losses to soybean growers. The fungus has been established in Brazil since 2002 and is found nationwide. To gather information on the temporal and spatial patterns of genetic variation in P. pachyrhizi , we sequenced the nuclear internal transcribed spacer regions (ITS1 and ITS2. Total genomic DNA was extracted using either lyophilized urediniospores or lesions removed from infected leaves sampled from 26 soybean fields in Brazil and one field in South Africa. Cloning prior to sequencing was necessary because direct sequencing of PCR amplicons gave partially unreadable electrophoretograms with peak displacements suggestive of multiple sequences with length polymorphism. Sequences were determined from four clones per field. ITS sequences from African or Asian isolates available from the GenBank were included in the analyses. Independent sequence alignments of the ITS1 and ITS2 datasets identified 27 and 19 ribotypes, respectively. Molecular phylogeographic analyses revealed that ribotypes of widespread distribution in Brazil displayed characteristics of ancestrality and were shared with Africa and Asia, while ribotypes of rare occurrence in Brazil were indigenous. The results suggest P. pachyrhizi found in Brazil as originating from multiple, independent long-distance dispersal events.

  14. Cell-cycle-specific interaction of nuclear DNA-binding proteins with a CCAAT sequence from the human thymidine kinase gene

    International Nuclear Information System (INIS)

    Knight, G.B.; Gudas, J.M.; Pardee, A.B.

    1987-01-01

    Induction of thymidine kinase parallels the onset of DNA synthesis. To investigate the transcriptional regulation of the thymidine kinase gene, the authors have examined whether specific nuclear factors interact in a cell-cycle-dependent manner with sequences upstream of this gene. Two inverted CCAAT boxes near the transcriptional initiation sites were observed to form complexes with nuclear DNA-binding proteins. The nature of the complexes changes dramatically as the cells approach DNA synthesis and correlates well with the previously reported transcriptional increase of the thymidine kinase gene

  15. Comparative analysis of seven viral nuclear export signals (NESs reveals the crucial role of nuclear export mediated by the third NES consensus sequence of nucleoprotein (NP in influenza A virus replication.

    Directory of Open Access Journals (Sweden)

    Nopporn Chutiwitoonchai

    Full Text Available The assembly of influenza virus progeny virions requires machinery that exports viral genomic ribonucleoproteins from the cell nucleus. Currently, seven nuclear export signal (NES consensus sequences have been identified in different viral proteins, including NS1, NS2, M1, and NP. The present study examined the roles of viral NES consensus sequences and their significance in terms of viral replication and nuclear export. Mutation of the NP-NES3 consensus sequence resulted in a failure to rescue viruses using a reverse genetics approach, whereas mutation of the NS2-NES1 and NS2-NES2 sequences led to a strong reduction in viral replication kinetics compared with the wild-type sequence. While the viral replication kinetics for other NES mutant viruses were also lower than those of the wild-type, the difference was not so marked. Immunofluorescence analysis after transient expression of NP-NES3, NS2-NES1, or NS2-NES2 proteins in host cells showed that they accumulated in the cell nucleus. These results suggest that the NP-NES3 consensus sequence is mostly required for viral replication. Therefore, each of the hydrophobic (Φ residues within this NES consensus sequence (Φ1, Φ2, Φ3, or Φ4 was mutated, and its viral replication and nuclear export function were analyzed. No viruses harboring NP-NES3 Φ2 or Φ3 mutants could be rescued. Consistent with this, the NP-NES3 Φ2 and Φ3 mutants showed reduced binding affinity with CRM1 in a pull-down assay, and both accumulated in the cell nucleus. Indeed, a nuclear export assay revealed that these mutant proteins showed lower nuclear export activity than the wild-type protein. Moreover, the Φ2 and Φ3 residues (along with other Φ residues within the NP-NES3 consensus were highly conserved among different influenza A viruses, including human, avian, and swine. Taken together, these results suggest that the Φ2 and Φ3 residues within the NP-NES3 protein are important for its nuclear export function

  16. Investigating bacterial populations in styrene-degrading biofilters by 16S rDNA tag pyrosequencing.

    Science.gov (United States)

    Portune, Kevin J; Pérez, M Carmen; Álvarez-Hornos, F Javier; Gabaldón, Carmen

    2015-01-01

    Microbial biofilms are essential components in the elimination of pollutants within biofilters, yet still little is known regarding the complex relationships between microbial community structure and biodegradation function within these engineered ecosystems. To further explore this relationship, 16S rDNA tag pyrosequencing was applied to samples taken at four time points from a styrene-degrading biofilter undergoing variable operating conditions. Changes in microbial structure were observed between different stages of biofilter operation, and the level of styrene concentration was revealed to be a critical factor affecting these changes. Bacterial genera Azoarcus and Pseudomonas were among the dominant classified genera in the biofilter. Canonical correspondence analysis (CCA) and correlation analysis revealed that the genera Brevundimonas, Hydrogenophaga, and Achromobacter may play important roles in styrene degradation under increasing styrene concentrations. No significant correlations (P > 0.05) could be detected between biofilter operational/functional parameters and biodiversity measurements, although biological heterogeneity within biofilms and/or technical variability within pyrosequencing may have considerably affected these results. Percentages of selected bacterial taxonomic groups detected by fluorescence in situ hybridization (FISH) were compared to results from pyrosequencing in order to assess the effectiveness and limitations of each method for identifying each microbial taxon. Comparison of results revealed discrepancies between the two methods in the detected percentages of numerous taxonomic groups. Biases and technical limitations of both FISH and pyrosequencing, such as the binding of FISH probes to non-target microbial groups and lack of classification of sequences for defined taxonomic groups from pyrosequencing, may partially explain some differences between the two methods.

  17. Using mitochondrial and nuclear sequence data for disentangling population structure in complex pest species: a case study with Dermanyssus gallinae.

    Directory of Open Access Journals (Sweden)

    Lise Roy

    Full Text Available Among global changes induced by human activities, association of breakdown of geographical barriers and impoverishered biodiversity of agroecosystems may have a strong evolutionary impact on pest species. As a consequence of trade networks' expansion, secondary contacts between incipient species, if hybrid incompatibility is not yet reached, may result in hybrid swarms, even more when empty niches are available as usual in crop fields and farms. By providing important sources of genetic novelty for organisms to adapt in changing environments, hybridization may be strongly involved in the emergence of invasive populations. Because national and international trade networks offered multiple hybridization opportunities during the previous and current centuries, population structure of many pest species is expected to be the most intricate and its inference often blurred when using fast-evolving markers. Here we show that mito-nuclear sequence datasets may be the most helpful in disentangling successive layers of admixture in the composition of pest populations. As a model we used D. gallinae s. l., a mesostigmatid mite complex of two species primarily parasitizing birds, namely D. gallinae L1 and D. gallinae s. str. The latter is a pest species, considered invading layer farms in Brazil. The structure of the pest as represented by isolates from both wild and domestic birds, from European (with a focus on France, Australian and Brazilian farms, revealed past hybridization events and very recent contact between deeply divergent lineages. The role of wild birds in the dissemination of mites appears to be null in European and Australian farms, but not in Brazilian ones. In French farms, some recent secondary contact is obviously consecutive to trade flows. Scenarios of populations' history were established, showing five different combinations of more or less dramatic bottlenecks and founder events, nearly interspecific hybridizations and recent

  18. Identification of Angiostrongylus cantonensis and other nematodes using the SSU rDNA in Achatina fulica populations of Metro Manila.

    Science.gov (United States)

    Constantino-Santos, M A; Basiao, Z U; Wade, C M; Santos, B S; Fontanilla I, K C

    2014-06-01

    Angiostrongylus cantonensis is a parasitic nematode that causes eosinophilic meningitis in humans. Accidental infection occurs by consumption of contaminated intermediates, such as the giant African land snail, Achatina fulica. This study surveyed the presence of A. cantonensis juveniles in A. fulica populations from 12 sites in Metropolitan Manila, Philippines using the SSU rDNA. Fourteen distinct sequences from 226 nematodes were obtained; of these, two matched A. cantonensis and Ancylostoma caninum, respectively, with 100% identity. Exact identities of the remaining twelve sequences could not be determined due to low percent similarities. Of the sequenced nematodes, A. cantonensis occurred with the highest frequency (139 out of 226). Most of these (131 out of 139) were collected in just one area in Quezon City. Nematode infection of A. fulica in this area and two others from Makati and another area in Quezon City, respectively, were highest, combining for 95% of the total infection. Ancylostoma caninum, on the other hand, was detected in four different sites. A. caninum is a canine parasite, and this is the first report of the nematode in A. fulica. These results cause public health concerns as both A. cantonensis and A. caninum are zoonotic to humans.

  19. Cryptic variation in an ecological indicator organism: mitochondrial and nuclear DNA sequence data confirm distinct lineages of Baetis harrisoni Barnard (Ephemeroptera: Baetidae in southern Africa

    Directory of Open Access Journals (Sweden)

    Pereira-da-Conceicoa Lyndall L

    2012-02-01

    Full Text Available Abstract Background Baetis harrisoni Barnard is a mayfly frequently encountered in river studies across Africa, but the external morphological features used for identifying nymphs have been observed to vary subtly between different geographic locations. It has been associated with a wide range of ecological conditions, including pH extremes of pH 2.9–10.0 in polluted waters. We present a molecular study of the genetic variation within B. harrisoni across 21 rivers in its distribution range in southern Africa. Results Four gene regions were examined, two mitochondrial (cytochrome c oxidase subunit I [COI] and small subunit ribosomal 16S rDNA [16S] and two nuclear (elongation factor 1 alpha [EF1α] and phosphoenolpyruvate carboxykinase [PEPCK]. Bayesian and parsimony approaches to phylogeny reconstruction resulted in five well-supported major lineages, which were confirmed using a general mixed Yule-coalescent (GMYC model. Results from the EF1α gene were significantly incongruent with both mitochondrial and nuclear (PEPCK results, possibly due to incomplete lineage sorting of the EF1α gene. Mean between-clade distance estimated using the COI and PEPCK data was found to be an order of magnitude greater than the within-clade distance and comparable to that previously reported for other recognised Baetis species. Analysis of the Isolation by Distance (IBD between all samples showed a small but significant effect of IBD. Within each lineage the contribution of IBD was minimal. Tentative dating analyses using an uncorrelated log-normal relaxed clock and two published estimates of COI mutation rates suggest that diversification within the group occurred throughout the Pliocene and mid-Miocene (~2.4–11.5 mya. Conclusions The distinct lineages of B. harrisoni correspond to categorical environmental variation, with two lineages comprising samples from streams that flow through acidic Table Mountain Sandstone and three lineages with samples from

  20. The occurrence of Toxocara malaysiensis in cats in China, confirmed by sequence-based analyses of ribosomal DNA.

    Science.gov (United States)

    Li, Ming-Wei; Zhu, Xing-Quan; Gasser, Robin B; Lin, Rui-Qing; Sani, Rehana A; Lun, Zhao-Rong; Jacobs, Dennis E

    2006-10-01

    Non-isotopic polymerase chain reaction (PCR)-based single-strand conformation polymorphism and sequence analyses of the second internal transcribed spacer (ITS-2) of nuclear ribosomal DNA (rDNA) were utilized to genetically characterise ascaridoids from dogs and cats from China by comparison with those from other countries. The study showed that Toxocara canis, Toxocara cati, and Toxascaris leonina from China were genetically the same as those from other geographical origins. Specimens from cats from Guangzhou, China, which were morphologically consistent with Toxocara malaysiensis, were the same genetically as those from Malaysia, with the exception of a polymorphism in the ITS-2 but no unequivocal sequence difference. This is the first report of T. malaysiensis in cats outside of Malaysia (from where it was originally described), supporting the proposal that this species has a broader geographical distribution. The molecular approach employed provides a powerful tool for elucidating the biology, epidemiology, and zoonotic significance of T. malaysiensis.

  1. The tsunami probabilistic risk assessment (PRA). Example of accident sequence analysis of tsunami PRA according to the standard for procedure of tsunami PRA for nuclear power plants

    International Nuclear Information System (INIS)

    Ohara, Norihiro; Hasegawa, Keiko; Kuroiwa, Katsuya

    2013-01-01

    After the Fukushima Daiichi nuclear power plant (NPP) accident, standard for procedure of tsunami PRA for NPP had been established by the Standardization Committee of AESJ. Industry group had been conducting analysis of Tsunami PRA for PWR based on the standard under the cooperation with electric utilities. This article introduced overview of the standard and examples of accident sequence analysis of Tsunami PRA studied by the industry group according to the standard. The standard consisted of (1) investigation of NPP's composition, characteristics and site information, (2) selection of relevant components for Tsunami PRA and initiating events and identification of accident sequence, (3) evaluation of Tsunami hazards, (4) fragility evaluation of building and components and (5) evaluation of accident sequence. Based on the evaluation, countermeasures for further improvement of safety against Tsunami could be identified by the sensitivity analysis. (T. Tanaka)

  2. Repeated reunions and splits feature the highly dynamic evolution of 5S and 35S ribosomal RNA genes (rDNA) in the Asteraceae family.

    Science.gov (United States)

    Garcia, Sònia; Panero, José L; Siroky, Jiri; Kovarik, Ales

    2010-08-16

    In flowering plants and animals the most common ribosomal RNA genes (rDNA) organisation is that in which 35S (encoding 18S-5.8S-26S rRNA) and 5S genes are physically separated occupying different chromosomal loci. However, recent observations established that both genes have been unified to a single 35S-5S unit in the genus Artemisia (Asteraceae), a genomic arrangement typical of primitive eukaryotes such as yeast, among others. Here we aim to reveal the origin, distribution and mechanisms leading to the linked organisation of rDNA in the Asteraceae by analysing unit structure (PCR, Southern blot, sequencing), gene copy number (quantitative PCR) and chromosomal position (FISH) of 5S and 35S rRNA genes in approximately 200 species representing the family diversity and other closely related groups. Dominant linked rDNA genotype was found within three large groups in subfamily Asteroideae: tribe Anthemideae (93% of the studied cases), tribe Gnaphalieae (100%) and in the "Heliantheae alliance" (23%). The remaining five tribes of the Asteroideae displayed canonical non linked arrangement of rDNA, as did the other groups in the Asteraceae. Nevertheless, low copy linked genes were identified among several species that amplified unlinked units. The conserved position of functional 5S insertions downstream from the 26S gene suggests a unique, perhaps retrotransposon-mediated integration event at the base of subfamily Asteroideae. Further evolution likely involved divergence of 26S-5S intergenic spacers, amplification and homogenisation of units across the chromosomes and concomitant elimination of unlinked arrays. However, the opposite trend, from linked towards unlinked arrangement was also surmised in few species indicating possible reversibility of these processes. Our results indicate that nearly 25% of Asteraceae species may have evolved unusual linked arrangement of rRNA genes. Thus, in plants, fundamental changes in intrinsic structure of rDNA units, their copy

  3. Dancing together and separate again: gymnosperms exhibit frequent changes of fundamental 5S and 35S rRNA gene (rDNA) organisation.

    Science.gov (United States)

    Garcia, S; Kovařík, A

    2013-07-01

    In higher eukaryotes, the 5S rRNA genes occur in tandem units and are arranged either separately (S-type arrangement) or linked to other repeated genes, in most cases to rDNA locus encoding 18S-5.8S-26S genes (L-type arrangement). Here we used Southern blot hybridisation, PCR and sequencing approaches to analyse genomic organisation of rRNA genes in all large gymnosperm groups, including Coniferales, Ginkgoales, Gnetales and Cycadales. The data are provided for 27 species (21 genera). The 5S units linked to the 35S rDNA units occur in some but not all Gnetales, Coniferales and in Ginkgo (∼30% of the species analysed), while the remaining exhibit separate organisation. The linked 5S rRNA genes may occur as single-copy insertions or as short tandems embedded in the 26S-18S rDNA intergenic spacer (IGS). The 5S transcript may be encoded by the same (Ginkgo, Ephedra) or opposite (Podocarpus) DNA strand as the 18S-5.8S-26S genes. In addition, pseudogenised 5S copies were also found in some IGS types. Both L- and S-type units have been largely homogenised across the genomes. Phylogenetic relationships based on the comparison of 5S coding sequences suggest that the 5S genes independently inserted IGS at least three times in the course of gymnosperm evolution. Frequent transpositions and rearrangements of basic units indicate relatively relaxed selection pressures imposed on genomic organisation of 5S genes in plants.

  4. Detection of mucormycetes and other pathogenic fungi in formalin fixed paraffin embedded and fresh tissues using the extended region of 28S rDNA.

    Science.gov (United States)

    Gade, Lalitha; Hurst, Steven; Balajee, S Arunmozhi; Lockhart, Shawn R; Litvintseva, Anastasia P

    2017-06-01

    Molecular methods of detection based on DNA-sequencing of the internal transcribed spacer 1 and 2 (ITS1 and ITS2) or 5΄ end region of 28S (D1-D2 region) of ribosomal RNA gene (rDNA) have been used extensively for molecular identification and detection of fungal infections. However, these regions are not always informative for identification of mucormycetes and other rare fungal pathogens as they often contain large introns, heterogenic regions, and/or cannot be PCR-amplified using broad range fungal PCR primers. In addition, because of the difficulties of recovering intact fungal DNA from human specimens, smaller regions of DNA are more useful for the direct detection of fungal DNA in tissues and fluids. In this study, we investigated the utility of 12F/13R PCR primers targeting a 200-230 bp region of the extended 28S region of rDNA for molecular identification of fungal DNA in formalin fixed paraffin embedded tissues and other clinical specimens. We demonstrated that this region can be successfully used for identification of all genera and some species of clinically relevant mucormycetes, as well as other medically important fungi, such as Aspergillus, Fusarium, Coccidioides, and Cryptococcus. We also demonstrated that PCR amplification and direct sequencing of the extended 28S region of rDNA was more sensitive compared to targeting the ITS2 region, as we were able to detect and identify mucormycetes and other fungal pathogens in tissues from patients with histopathological and/or culture evidence of fungal infections that were negative with PCR using ITS-specific primers. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  5. Selective enrichment and sequencing of whole mitochondrial genomes in the presence of nuclear encoded mitochondrial pseudogenes (numts.

    Directory of Open Access Journals (Sweden)

    Jonci N Wolff

    Full Text Available Numts are an integral component of many eukaryote genomes offering a snapshot of the evolutionary process that led from the incorporation of an α-proteobacterium into a larger eukaryotic cell some 1.8 billion years ago. Although numt sequence can be harnessed as molecular marker, these sequences often remain unidentified and are mistaken for genuine mtDNA leading to erroneous interpretation of mtDNA data sets. It is therefore indispensable that during the process of amplifying and sequencing mitochondrial genes, preventive measures are taken to ensure the exclusion of numts to guarantee the recovery of genuine mtDNA. This applies to mtDNA analyses in general but especially to studies where mtDNAs are sequenced de novo as the launch pad for subsequent mtDNA-based research. By using a combination of dilution series and nested rolling circle amplification (RCA, we present a novel strategy to selectively amplify mtDNA and exclude the amplification of numt sequence. We have successfully applied this strategy to de novo sequence the mtDNA of the Black Field Cricket Teleogryllus commodus, a species known to contain numts. Aligning our assembled sequence to the reference genome of Teleogryllus emma (GenBank EU557269.1 led to the identification of a numt sequence in the reference sequence. This unexpected result further highlights the need of a reliable and accessible strategy to eliminate this source of error.

  6. rKnowledge: The Spatial Diffusion of rDNA Methods

    OpenAIRE

    Maryann Feldman; Dieter Kogler; David Rigby

    2013-01-01

    The 1980 patent granted to Stanley Cohen and Herbert Boyer for their development of rDNA technology played a critical role in the establishment of the modern biotechnology industry. From the birth of this general purpose technology in the San Francisco Bay area, rDNA-related knowledge diffused across sectors and regions of the U.S. economy. The local absorption and application of rDNA technology is tracked across metropolitan areas with USPTO patent data. The influence of cognitive, geographi...

  7. Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

    Energy Technology Data Exchange (ETDEWEB)

    Waller, Zoë A.E., E-mail: z.waller@uea.ac.uk; Howell, Lesley A.; MacDonald, Colin J.; O’Connell, Maria A.; Searcey, Mark, E-mail: m.searcey@uea.ac.uk

    2014-04-25

    Highlights: • Discovery of a G-quadruplex forming sequence in the promoter sequence of Nrf2. • Characterisation of the G-quadruplex by UV, CD and NMR. • Conformational switching of G-quadruplex induced by 9-aminoacridine. - Abstract: The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5’-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3’ using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K{sup +} ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

  8. Simulation with the MELCOR code of two severe accident sequences, Station Blackout and Small Break LOCA, for the Atucha I nuclear power plant

    International Nuclear Information System (INIS)

    Valle Cepero, Reinaldo

    2004-01-01

    The results of the PSA-I applied to the Atucha I nuclear power plant (CNA I) determine the accidental sequences with the most influence related to the probability of the core reactor damage. Among those sequences are include, the Station Blackout and lost of primary coolant, combine with the failure of the emergency injection systems by pipe breaks of diameters between DN100 - DN25 or equivalent areas, Small LOCA. This paper has the objective to model and analyze the behavior of the primary circuit and the pressure vessel during the evolution of those two accidental sequences. It presented a detailed analysis of the main phenomena that occur from the initial moment of the accident to the failure moment of the pressure vessel and the melt material fall to the reactor cavity. Two sequences were taken into account, considering the main phenomena (core uncover, heating, fuel element oxidation, hydrogen generation, degradation and relocation of the melt material, failure of the support structures, etc.) and the time of occurrence, of those events will be different, if it is considered that both sequences will be developed in different scenarios. One case is an accident with the primary circuit to a high pressure (Station Blackout scenario) and the other with a early primary circuit depressurization due to the lost of primary coolant. For this work the MELCOR 1.8.5 code was used and it allows within a unified framework to modeling an extensive spectrum of phenomenology associated with the severe accidents. (author)

  9. Identification of a novel nuclear localization signal and speckle-targeting sequence of tuftelin-interacting protein 11, a splicing factor involved in spliceosome disassembly

    Energy Technology Data Exchange (ETDEWEB)

    Tannukit, Sissada [Center for Craniofacial Molecular Biology, University of Southern California, 2250 Alcazar Street, CSA Rm103, Los Angeles, CA 90033-1004 (United States); Crabb, Tara L.; Hertel, Klemens J. [Department of Microbiology and Molecular Genetics, University of California Irvine, Irvine, CA 92697-4025 (United States); Wen, Xin [Center for Craniofacial Molecular Biology, University of Southern California, 2250 Alcazar Street, CSA Rm103, Los Angeles, CA 90033-1004 (United States); Jans, David A. [Department of Biochemistry and Molecular Biology, Nuclear Signalling Laboratory, Monash University, Clayton, Victoria 3800 (Australia); Paine, Michael L., E-mail: paine@usc.edu [Center for Craniofacial Molecular Biology, University of Southern California, 2250 Alcazar Street, CSA Rm103, Los Angeles, CA 90033-1004 (United States)

    2009-12-18

    Tuftelin-interacting protein 11 (TFIP11) is a protein component of the spliceosome complex that promotes the release of the lariat-intron during late-stage splicing through a direct recruitment and interaction with DHX15/PRP43. Expression of TFIP11 is essential for cell and organismal survival. TFIP11 contains a G-patch domain, a signature motif of RNA-processing proteins that is responsible for TFIP11-DHX15 interactions. No other functional domains within TFIP11 have been described. TFIP11 is localized to distinct speckled regions within the cell nucleus, although excluded from the nucleolus. In this study sequential C-terminal deletions and mutational analyses have identified two novel protein elements in mouse TFIP11. The first domain covers amino acids 701-706 (VKDKFN) and is an atypical nuclear localization signal (NLS). The second domain is contained within amino acids 711-735 and defines TFIP11's distinct speckled nuclear localization. The identification of a novel TFIP11 nuclear speckle-targeting sequence (TFIP11-STS) suggests that this domain directly interacts with additional spliceosomal components. These data help define the mechanism of nuclear/nuclear speckle localization of the splicing factor TFIP11, with implications for it's function.

  10. The formation of diploid and triploid hybrids of female grass carp × male blunt snout bream and their 5S rDNA analysis.

    Science.gov (United States)

    He, Weiguo; Xie, Lihua; Li, Tangluo; Liu, Shaojun; Xiao, Jun; Hu, Jie; Wang, Jing; Qin, Qinbo; Liu, Yun

    2013-11-23

    Hybridization is a useful strategy to alter the genotypes and phenotypes of the offspring. It could transfer the genome of one species to another through combing the different genome of parents in the hybrid offspring. And the offspring may exhibit advantages in growth rate, disease resistance, survival rate and appearance, which resulting from the combination of the beneficial traits from both parents. Diploid and triploid hybrids of female grass carp (Ctenopharyngodon idellus, GC, Cyprininae, 2n = 48) × male blunt snout bream (Megalobrama amblycephala, BSB, Cultrinae, 2n = 48) were successfully obtained by distant hybridization. Diploid hybrids had 48 chromosomes, with one set from GC and one set from BSB. Triploid hybrids possessed 72 chromosomes, with two sets from GC and one set from BSB.The morphological traits, growth rates, and feeding ecology of the parents and hybrid offspring were compared and analyzed. The two kinds of hybrid offspring exhibited significantly phenotypic divergence from GC and BSB. 2nGB hybrids showed similar growth rate compared to that of GC, and 3nGB hybrids significantly higher results. Furthermore, the feeding ecology of hybrid progeny was omnivorous.The 5S rDNA of GC, BSB and their hybrid offspring were also cloned and sequenced. There was only one type of 5S rDNA (designated type I: 180 bp) in GC and one type of 5S rDNA (designated type II: 188 bp) in BSB. However, in the hybrid progeny, diploid and triploid hybrids both inherited type I and type II from their parents, respectively. In addition, a chimera of type I and type II was observed in the genome of diploid and triploid hybrids, excepting a 10 bp of polyA insertion in type II sequence of the chimera of the diploid hybrids. This is the first report of diploid and triploid hybrids being produced by crossing GC and BSB, which have the same chromosome number. The obtainment of two new hybrid offspring has significance in fish genetic breeding. The results illustrate the effect

  11. Cytogenetic features of rRNA genes across land plants: analysis of the Plant rDNA database

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Kovařík, Aleš; Leitch, A. R.; Garnatje, T.

    2017-01-01

    Roč. 89, č. 5 (2017), s. 1020-1030 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GC16-02149J Institutional support: RVO:68081707 Keywords : in-situ hybridization * 5s rdna * 45s rdna * concerted evolution Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 5.901, year: 2016

  12. Modulation of immune response to rDNA hepatitis B vaccination by psychological stress

    NARCIS (Netherlands)

    L. Jabaaij (Lea); J. van Hattum (Jan); A.J.J.M. Vingerhoets (Ad); F.G. Oostveen (Frank); H.J. Duivenvoorden (Hugo); R.E. Ballieux (Rudy)

    1996-01-01

    textabstractIn a previous study it was shown that antibody formation after vaccination with a low-dose recombinant DNA (rDNA) hepatitis B vaccine was negatively influenced by psychological stress. The present study was designed to assess whether the same inverse relation between HBs-antibody levels

  13. Effect of nickel chloride on Arabidopsis genomic DNA and methylation of 18S rDNA

    Directory of Open Access Journals (Sweden)

    Zhongai Li

    2015-01-01

    Conclusions: NiCl2 application caused variation of DNA methylation of the Arabidopsis genomic and offspring's. NiCl2 also resulted in nucleolar injury and deformity of root tip cells. The methylation rate of 18S rDNA also changed by adding NiCl2.

  14. Heterochromatin and rDNA sites distribution in the holocentric chromosomes of Cuscuta approximata Bab. (Convolvulaceae).

    Science.gov (United States)

    Guerra, Marcelo; García, Miguel A

    2004-02-01

    Cuscuta is a widely distributed genus of holoparasitic plants. Holocentric chromosomes have been reported only in species of one of its subgenera (Cuscuta subg. Cuscuta). In this work, a representative of this subgenus, Cuscuta approximata, was investigated looking for its mitotic and meiotic chromosome behaviour and the heterochromatin distribution. The mitotic chromosomes showed neither primary constriction nor Rabl orientation whereas the meiotic ones exhibited the typical quadripartite structure characteristic of holocentrics, supporting the assumption of holocentric chromosomes as a synapomorphy of Cuscuta subg. Cuscuta. Chromosomes and interphase nuclei displayed many heterochromatic blocks that stained deeply with hematoxylin, 4',6-diamidino-2-phenylindole (DAPI), or after C banding. The banded karyotype showed terminal or subterminal bands in all chromosomes and central bands in some of them. The single pair of 45S rDNA sites was observed at the end of the largest chromosome pair, close to a DAPI band and a 5S rDNA site. Two other 5S rDNA site pairs were found, both closely associated with DAPI bands. The noteworthy giant nuclei of glandular cells of petals and ovary wall exhibited large chromocentres typical of polytenic nuclei. The chromosomal location of heterochromatin and rDNA sites and the structure of the endoreplicated nuclei of C. approximata seemed to be similar to those known in monocentric nuclei, suggesting that centromeric organization has little or no effect on chromatin organization.

  15. Updating rDNA restriction enzyme maps of Tetrahymena reveals four new intron-containing species

    DEFF Research Database (Denmark)

    Nielsen, Henrik; Simon, E M; Engberg, J

    1985-01-01

    an intron in the 26s rRNA coding region. The evolutionary relationship among the species of the T. pyriformis complex was examined on the basis of the rDNA maps with emphasis on similarities between two of the new species and the widely studied T. thermophila and T. pigmentosa. Examination of a large number...

  16. Clinorotation influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; González-Camacho, F.; Rodríguez-Vilariño, V.; Kordyum, E. L.; Medina, F. J.

    The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts. The plant nucleolin homologue NopA100 is involved in the regulation of r-chromatin condensation/expansion and rDNA transcription as well as in rRNA processing. We have investigated with immunogold electron microscopy the location of nucleolar DNA and NopA100 in cress root meristematic cells grown under slow horizontal clinorotation, reproducing an important feature of microgravity, namely the absence of an orienting action of a gravity vector, compared to control conditions. We demonstrate redistribution of both rDNA and NopA100 in nucleolar subcomponents induced by clinorotation. Ribosomal DNA concentrated predominantly in fibrillar centers in the form of condensed r-chromatin inclusions and internal non condensed fibrils, redistributing from the dense fibrillar component and the transition zone between fibrillar centers and the dense fibrillar component, recognized as the loci of rDNA transcription. The content of NopA100 was much higher in the inner space of fibrillar centers and reduced in the dense fibrillar component as compared to the control. Based on these data, an effect of slow horizontal clinorotation in lowering the level of rDNA transcription as well as rRNA processing is suggested.

  17. The chromosomal constitution of fish hybrid lineage revealed by 5S rDNA FISH.

    Science.gov (United States)

    Zhang, Chun; Ye, Lihai; Chen, Yiyi; Xiao, Jun; Wu, Yanhong; Tao, Min; Xiao, Yamei; Liu, Shaojun

    2015-12-03

    The establishment of the bisexual fertile fish hybrid lineage including the allodiploid and allotetraploid hybrids, from interspecific hybridization of red crucian carp (Carassius auratus red var. 2n = 100, 2n = AA) (♀) × common carp (Cyprinus carpio L. 2n = 100, 2n = BB) (♂), provided a good platform to investigate genetic relationship between the parents and their hybrid progenies. The chromosomal inheritance of diploid and allotetraploid hybrid progenies in successive generations, was studied by applying 5S rDNA fluorescence in situ hybridization. Signals of 5S rDNA distinguished the chromosomal constitution of common carp (B-genome) from red crucian carp (A-genome), in which two strong signals were observed on the first submetacentric chromosome, while no major signal was found in common carp. After fish hybridization, one strong signal of 5S rDNA was detected in the same locus on the chromosome of diploid hybrids. As expected, two strong signals were observed in 4nF3 tetraploid hybrids offspring and it is worth mentioning that two strong signals were detected in a separating bivalent of a primary spermatocyte in 4nF3. Furthermore, the mitosis of heterozygous chromosomes was shown normal and stable with blastular tissue histological studies. We revealed that 5S rDNA signal can be applied to discern A-genome from B-genome, and that 5S rDNA bearing chromosomes can be stably passed down in successive generations. Our work provided a significant method in fish breeding and this is important for studies in fish evolutionary biology.

  18. Paenibacillus larvae 16S-23S rDNA intergenic transcribed spacer (ITS) regions: DNA fingerprinting and characterization.

    Science.gov (United States)

    Dingman, Douglas W

    2012-07-01

    Paenibacillus larvae is the causative agent of American foulbrood in honey bee (Apis mellifera) larvae. PCR amplification of the 16S-23S ribosomal DNA (rDNA) intergenic transcribed spacer (ITS) regions, and agarose gel electrophoresis of the amplified DNA, was performed using genomic DNA collected from 134 P. larvae strains isolated in Connecticut, six Northern Regional Research Laboratory stock strains, four strains isolated in Argentina, and one strain isolated in Chile. Following electrophoresis of amplified DNA, all isolates exhibited a common migratory profile (i.e., ITS-PCR fingerprint pattern) of six DNA bands. This profile represented a unique ITS-PCR DNA fingerprint that was useful as a fast, simple, and accurate procedure for identification of P. larvae. Digestion of ITS-PCR amplified DNA, using mung bean nuclease prior to electrophoresis, characterized only three of the six electrophoresis bands as homoduplex DNA and indicating three true ITS regions. These three ITS regions, DNA migratory band sizes of 915, 1010, and 1474 bp, signify a minimum of three types of rrn operons within P. larvae. DNA sequence analysis of ITS region DNA, using P. larvae NRRL B-3553, identified the 3' terminal nucleotides of the 16S rRNA gene, 5' terminal nucleotides of the 23S rRNA gene, and the complete DNA sequences of the 5S rRNA, tRNA(ala), and tRNA(ile) genes. Gene organization within the three rrn operon types was 16S-23S, 16S-tRNA(ala)-23S, and l6S-5S-tRNA(ile)-tRNA(ala)-23S and these operons were named rrnA, rrnF, and rrnG, respectively. The 23S rRNA gene was shown by I-CeuI digestion and pulsed-field gel electrophoresis of genomic DNA to be present as seven copies. This was suggestive of seven rrn operon copies within the P. larvae genome. Investigation of the 16S-23S rDNA regions of this bacterium has aided the development of a diagnostic procedure and has helped genomic mapping investigations via characterization of the ITS regions. Copyright © 2012 Elsevier Inc

  19. Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

    1996-02-15

    Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).

  20. Progenitor-derivative relationships of Hordeum polyploids (Poaceae, Triticeae inferred from sequences of TOPO6, a nuclear low-copy gene region.

    Directory of Open Access Journals (Sweden)

    Jonathan Brassac

    Full Text Available Polyploidization is a major mechanism of speciation in plants. Within the barley genus Hordeum, approximately half of the taxa are polyploids. While for diploid species a good hypothesis of phylogenetic relationships exists, there is little information available for the polyploids (4×, 6× of Hordeum. Relationships among all 33 diploid and polyploid Hordeum species were analyzed with the low-copy nuclear marker region TOPO6 for 341 Hordeum individuals and eight outgroup species. PCR products were either directly sequenced or cloned and on average 12 clones per individual were included in phylogenetic analyses. In most diploid Hordeum species TOPO6 is probably a single-copy locus. Most sequences found in polyploid individuals phylogenetically cluster together with sequences derived from diploid species and thus allow the identification of parental taxa of polyploids. Four groups of sequences occurring only in polyploid taxa are interpreted as footprints of extinct diploid taxa, which contributed to allopolyploid evolution. Our analysis identifies three key species involved in the evolution of the American polyploids of the genus. (i All but one of the American tetraploids have a TOPO6 copy originating from the Central Asian diploid H. roshevitzii, the second copy clustering with different American diploid species. (ii All hexaploid species from the New World have a copy of an extinct close relative of H. californicum and (iii possess the TOPO6 sequence pattern of tetraploid H. jubatum, each with an additional copy derived from different American diploids. Tetraploid H. bulbosum is an autopolyploid, while the assumed autopolyploid H. brevisubulatum (4×, 6× was identified as allopolyploid throughout most of its distribution area. The use of a proof-reading DNA polymerase in PCR reduced the proportion of chimerical sequences in polyploids in comparison to Taq polymerase.

  1. Analysis of a cDNA clone expressing a human autoimmune antigen: full-length sequence of the U2 small nuclear RNA-associated B antigen

    International Nuclear Information System (INIS)

    Habets, W.J.; Sillekens, P.T.G.; Hoet, M.H.; Schalken, J.A.; Roebroek, A.J.M.; Leunissen, J.A.M.; Van de Ven, W.J.M.; Van Venrooij, W.J.

    1987-01-01

    A U2 small nuclear RNA-associated protein, designated B'', was recently identified as the target antigen for autoimmune sera from certain patients with systemic lupus erythematosus and other rheumatic diseases. Such antibodies enabled them to isolate cDNA clone λHB''-1 from a phage λgt11 expression library. This clone appeared to code for the B'' protein as established by in vitro translation of hybrid-selected mRNA. The identity of clone λHB''-1 was further confirmed by partial peptide mapping and analysis of the reactivity of the recombinant antigen with monospecific and monoclonal antibodies. Analysis of the nucleotide sequence of the 1015-base-pair cDNA insert of clone λHB''-1 revealed a large open reading frame of 800 nucleotides containing the coding sequence for a polypeptide of 25,457 daltons. In vitro transcription of the λHB''-1 cDNA insert and subsequent translation resulted in a protein product with the molecular size of the B'' protein. These data demonstrate that clone λHB''-1 contains the complete coding sequence of this antigen. The deduced polypeptide sequence contains three very hydrophilic regions that might constitute RNA binding sites and/or antigenic determinants. These findings might have implications both for the understanding of the pathogenesis of rheumatic diseases as well as for the elucidation of the biological function of autoimmune antigens

  2. Nuclear

    International Nuclear Information System (INIS)

    2014-01-01

    This document proposes a presentation and discussion of the main notions, issues, principles, or characteristics related to nuclear energy: radioactivity (presence in the environment, explanation, measurement, periods and activities, low doses, applications), fuel cycle (front end, mining and ore concentration, refining and conversion, fuel fabrication, in the reactor, back end with reprocessing and recycling, transport), the future of the thorium-based fuel cycle (motivations, benefits and drawbacks), nuclear reactors (principles of fission reactors, reactor types, PWR reactors, BWR, heavy-water reactor, high temperature reactor of HTR, future reactors), nuclear wastes (classification, packaging and storage, legal aspects, vitrification, choice of a deep storage option, quantities and costs, foreign practices), radioactive releases of nuclear installations (main released radio-elements, radioactive releases by nuclear reactors and by La Hague plant, gaseous and liquid effluents, impact of releases, regulation), the OSPAR Convention, management and safety of nuclear activities (from control to quality insurance, to quality management and to sustainable development), national safety bodies (mission, means, organisation and activities of ASN, IRSN, HCTISN), international bodies, nuclear and medicine (applications of radioactivity, medical imagery, radiotherapy, doses in nuclear medicine, implementation, the accident in Epinal), nuclear and R and D (past R and D programmes and expenses, main actors in France and present funding, main R and D axis, international cooperation)

  3. The RTR Complex Partner RMI2 and the DNA Helicase RTEL1 Are Both Independently Involved in Preserving the Stability of 45S rDNA Repeats in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Sarah Röhrig

    2016-10-01

    Full Text Available The stability of repetitive sequences in complex eukaryotic genomes is safeguarded by factors suppressing homologues recombination. Prominent in this is the role of the RTR complex. In plants, it consists of the RecQ helicase RECQ4A, the topoisomerase TOP3α and RMI1. Like mammals, but not yeast, plants harbor an additional complex partner, RMI2. Here, we demonstrate that, in Arabidopsis thaliana, RMI2 is involved in the repair of aberrant replication intermediates in root meristems as well as in intrastrand crosslink repair. In both instances, RMI2 is involved independently of the DNA helicase RTEL1. Surprisingly, simultaneous loss of RMI2 and RTEL1 leads to loss of male fertility. As both the RTR complex and RTEL1 are involved in suppression of homologous recombination (HR, we tested the efficiency of HR in the double mutant rmi2-2 rtel1-1 and found a synergistic enhancement (80-fold. Searching for natural target sequences we found that RTEL1 is required for stabilizing 45S rDNA repeats. In the double mutant with rmi2-2 the number of 45S rDNA repeats is further decreased sustaining independent roles of both factors in this process. Thus, loss of suppression of HR does not only lead to a destabilization of rDNA repeats but might be especially deleterious for tissues undergoing multiple cell divisions such as the male germline.

  4. The RTR Complex Partner RMI2 and the DNA Helicase RTEL1 Are Both Independently Involved in Preserving the Stability of 45S rDNA Repeats in Arabidopsis thaliana.

    Science.gov (United States)

    Röhrig, Sarah; Schröpfer, Susan; Knoll, Alexander; Puchta, Holger

    2016-10-01

    The stability of repetitive sequences in complex eukaryotic genomes is safeguarded by factors suppressing homologues recombination. Prominent in this is the role of the RTR complex. In plants, it consists of the RecQ helicase RECQ4A, the topoisomerase TOP3α and RMI1. Like mammals, but not yeast, plants harbor an additional complex partner, RMI2. Here, we demonstrate that, in Arabidopsis thaliana, RMI2 is involved in the repair of aberrant replication intermediates in root meristems as well as in intrastrand crosslink repair. In both instances, RMI2 is involved independently of the DNA helicase RTEL1. Surprisingly, simultaneous loss of RMI2 and RTEL1 leads to loss of male fertility. As both the RTR complex and RTEL1 are involved in suppression of homologous recombination (HR), we tested the efficiency of HR in the double mutant rmi2-2 rtel1-1 and found a synergistic enhancement (80-fold). Searching for natural target sequences we found that RTEL1 is required for stabilizing 45S rDNA repeats. In the double mutant with rmi2-2 the number of 45S rDNA repeats is further decreased sustaining independent roles of both factors in this process. Thus, loss of suppression of HR does not only lead to a destabilization of rDNA repeats but might be especially deleterious for tissues undergoing multiple cell divisions such as the male germline.

  5. Ribosomal DNA intergenic spacer sequence in foxtail millet, Setaria italica (L.) P. Beauv. and its characterization and application to typing of foxtail millet landraces.

    Science.gov (United States)

    Fukunaga, Kenji; Ichitani, Katsuyuki; Taura, Satoru; Sato, Muneharu; Kawase, Makoto

    2005-02-01

    We determined the sequence of ribosomal DNA (rDNA) intergenic spacer (IGS) of foxtail millet isolated in our previous study, and identified subrepeats in the polymorphic region. We also developed a PCR-based method for identifying rDNA types based on sequence information and assessed 153 accessions of foxtail millet. Results were congruent with our previous works. This study provides new findings regarding the geographical distribution of rDNA variants. This new method facilitates analyses of numerous foxtail millet accessions. It is helpful for typing of foxtail millet germplasms and elucidating the evolution of this millet.

  6. Close sequence identity between ribosomal DNA episomes of the ...

    Indian Academy of Sciences (India)

    Unknown

    The restriction map of the E. dispar rDNA circle showed close simi- larity to EhR1 .... for 30 cycles in a DNA Thermal cycler (MJ Research,. USA). 3. .... by asterisk. The gaps show the variation between E. dispar and E. histolytica sequences.

  7. Insertion of a nuclear factor kappa B DNA nuclear-targeting sequence potentiates suicide gene therapy efficacy in lung cancer cell lines

    DEFF Research Database (Denmark)

    Cramer, F; Christensen, C L; Poulsen, T T

    2012-01-01

    Lung cancer currently causes the majority of cancer-related deaths worldwide and new treatments are in high demand. Gene therapy could be a promising treatment but currently lacks sufficient efficiency for clinical use, primarily due to limited cellular and nuclear DNA delivery. In the present...

  8. rDNA genetic imbalance and nucleolar chromatin restructuring is induced by distant hybridization between Raphanus sativus and Brassica alboglabra.

    Directory of Open Access Journals (Sweden)

    Hong Long

    Full Text Available The expression of rDNA in hybrids inherited from only one progenitor refers to nucleolar dominance. The molecular basis for choosing which genes to silence remains unclear. We report genetic imbalance induced by distant hybridization correlates with formation of rDNA genes (NORs in the hybrids between Raphanus sativus L. and Brassica alboglabra Bailey. Moreover, increased CCGG methylation of rDNA in F1 hybrids is concomitant with Raphanus-derived rDNA gene silencing and rDNA transcriptional inactivity revealed by nucleolar configuration restriction. Newly formed rDNA gene locus occurred through chromosomal in F1 hybrids via chromosomal imbalance. NORs are gained de novo, lost, and/or transposed in the new genome. Inhibition of methyltransferases leads to changes in nucleolar architecture, implicating a key role of methylation in control of nucleolar dominance and vital nucleolar configuration transition. Our findings suggest that gene imbalance and methylation-related chromatin restructuring is important for rDNA gene silencing that may be crucial for synthesis of specific proteins.

  9. Genetic variation among the Mapuche Indians from the Patagonian region of Argentina: mitochondrial DNA sequence variation and allele frequencies of several nuclear genes.

    Science.gov (United States)

    Ginther, C; Corach, D; Penacino, G A; Rey, J A; Carnese, F R; Hutz, M H; Anderson, A; Just, J; Salzano, F M; King, M C

    1993-01-01

    DNA samples from 60 Mapuche Indians, representing 39 maternal lineages, were genetically characterized for (1) nucleotide sequences of the mtDNA control region; (2) presence or absence of a nine base duplication in mtDNA region V; (3) HLA loci DRB1 and DQA1; (4) variation at three nuclear genes with short tandem repeats; and (5) variation at the polymorphic marker D2S44. The genetic profile of the Mapuche population was compared to other Amerinds and to worldwide populations. Two highly polymorphic portions of the mtDNA control region, comprising 650 nucleotides, were amplified by the polymerase chain reaction (PCR) and directly sequenced. The 39 maternal lineages were defined by two or three generation families identified by the Mapuches. These 39 lineages included 19 different mtDNA sequences that could be grouped into four classes. The same classes of sequences appear in other Amerinds from North, Central, and South American populations separated by thousands of miles, suggesting that the origin of the mtDNA patterns predates the migration to the Americas. The mtDNA sequence similarity between Amerind populations suggests that the migration throughout the Americas occurred rapidly relative to the mtDNA mutation rate. HLA DRB1 alleles 1602 and 1402 were frequent among the Mapuches. These alleles also occur at high frequency among other Amerinds in North and South America, but not among Spanish, Chinese or African-American populations. The high frequency of these alleles throughout the Americas, and their specificity to the Americas, supports the hypothesis that Mapuches and other Amerind groups are closely related.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Species-Level Phylogeny and Polyploid Relationships in Hordeum (Poaceae) Inferred by Next-Generation Sequencing and In Silico Cloning of Multiple Nuclear Loci.

    Science.gov (United States)

    Brassac, Jonathan; Blattner, Frank R

    2015-09-01

    Polyploidization is an important speciation mechanism in the barley genus Hordeum. To analyze evolutionary changes after allopolyploidization, knowledge of parental relationships is essential. One chloroplast and 12 nuclear single-copy loci were amplified by polymerase chain reaction (PCR) in all Hordeum plus six out-group species. Amplicons from each of 96 individuals were pooled, sheared, labeled with individual-specific barcodes and sequenced in a single run on a 454 platform. Reference sequences were obtained by cloning and Sanger sequencing of all loci for nine supplementary individuals. The 454 reads were assembled into contigs representing the 13 loci and, for polyploids, also homoeologues. Phylogenetic analyses were conducted for all loci separately and for a concatenated data matrix of all loci. For diploid taxa, a Bayesian concordance analysis and a coalescent-based dated species tree was inferred from all gene trees. Chloroplast matK was used to determine the maternal parent in allopolyploid taxa. The relative performance of different multilocus analyses in the presence of incomplete lineage sorting and hybridization was also assessed. The resulting multilocus phylogeny reveals for the first time species phylogeny and progenitor-derivative relationships of all di- and polyploid Hordeum taxa within a single analysis. Our study proves that it is possible to obtain a multilocus species-level phylogeny for di- and polyploid taxa by combining PCR with next-generation sequencing, without cloning and without creating a heavy load of sequence data. © The Author(s) 2015. Published by Oxford University Press, on behalf of the Society of Systematic Biologists.

  11. Molecular phylogeny of bladderworts: A wide approach of Utricularia (Lentibulariaceae) species relationships based on six plastidial and nuclear DNA sequences.

    Czech Academy of Sciences Publication Activity Database

    Silva, S. R.; Gibson, R.; Adamec, Lubomír; Domínguez, Y.; Miranda, V.F.O.

    2018-01-01

    Roč. 118, Jan2018 (2018), s. 244-264 ISSN 1055-7903 Institutional support: RVO:67985939 Keywords : bladderworts * DNA sequencing * carnivorous plants Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 4.419, year: 2016

  12. Formal Revision of the Alexandrium tamarense Species Complex (Dinophyceae) Taxonomy: The Introduction of Five Species with Emphasis on Molecular-based (rDNA) Classification

    Science.gov (United States)

    John, Uwe; Litaker, R. Wayne; Montresor, Marina; Murray, Shauna; Brosnahan, Michael L.; Anderson, Donald M.

    2015-01-01

    The Alexandrium tamarense species complex is one of the most studied marine dinoflagellate groups due to its ecological, toxicological and economic importance. Several members of this complex produce saxitoxin and its congeners – potent neurotoxins that cause paralytic shellfish poisoning. Isolates from this complex are assigned to A. tamarense, A. fundyense, or A. catenella based on two main morphological characters: the ability to form chains and the presence/absence of a ventral pore between Plates 1′ and 4′. However, studies have shown that these characters are not consistent and/or distinctive. Further, phylogenies based on multiple regions in the rDNA operon indicate that the sequences from morphologically indistinguishable isolates partition into five clades. These clades were initially named based on their presumed geographic distribution, but recently were renamed as Groups I–V following the discovery of sympatry among some groups. In this study we present data on morphology, ITS/5.8S genetic distances, ITS2 compensatory base changes, mating incompatibilities, toxicity, the sxtA toxin synthesis gene, and rDNA phylogenies. All results were consistent with each group representing a distinct cryptic species. Accordingly, the groups were assigned species names as follows: Group I, A. fundyense; Group II, A. mediterraneum; Group III, A. tamarense; Group IV, A. pacificum; Group V, A. australiense. PMID:25460230

  13. A robust and well-resolved phylogeny of Bactridinae (Arecaceae) based on plastid and nuclear DNA sequences

    DEFF Research Database (Denmark)

    Eiserhardt, Wolf L.; Pintaud, Jean-Christophe; Asmussen-Lange, Conny

    as well as most of the currently accepted infrageneric taxa and recently proposed informal groups. Analyses are based on five plastid DNA regions (matK, trnQ-rps16, rps16 intron, trnD-trnT, trnL-trnF) and three nuclear markers (PRK, RPB2, ITS). A combined dataset was analysed with likelihood and parsimony...

  14. A multilocus assessment of nuclear and mitochondrial sequence data elucidates phylogenetic relationships among European spirlins (Alburnoides, Cyprinidae)

    Czech Academy of Sciences Publication Activity Database

    Stierandová, Soňa; Vukic, J.; Vasil'eva, E. D.; Zogaris, S.; Shumka, S.; Halačka, Karel; Vetešník, Lukáš; Švátora, M.; Nowak, M.; Stefanov, T.; Koščo, J.; Mendel, Jan

    2016-01-01

    Roč. 94, January (2016), s. 479-491 ISSN 1055-7903 Grant - others:GA AV ČR(CZ) M200930901 Institutional support: RVO:68081766 Keywords : Alburnoides * Taxonomy * Phylogeography * Mitochondrial and nuclear markers Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.419, year: 2016

  15. iNR-PhysChem: a sequence-based predictor for identifying nuclear receptors and their subfamilies via physical-chemical property matrix.

    Directory of Open Access Journals (Sweden)

    Xuan Xiao

    Full Text Available Nuclear receptors (NRs form a family of ligand-activated transcription factors that regulate a wide variety of biological processes, such as homeostasis, reproduction, development, and metabolism. Human genome contains 48 genes encoding NRs. These receptors have become one of the most important targets for therapeutic drug development. According to their different action mechanisms or functions, NRs have been classified into seven subfamilies. With the avalanche of protein sequences generated in the postgenomic age, we are facing the following challenging problems. Given an uncharacterized protein sequence, how can we identify whether it is a nuclear receptor? If it is, what subfamily it belongs to? To address these problems, we developed a predictor called iNR-PhysChem in which the protein samples were expressed by a novel mode of pseudo amino acid composition (PseAAC whose components were derived from a physical-chemical matrix via a series of auto-covariance and cross-covariance transformations. It was observed that the overall success rate achieved by iNR-PhysChem was over 98% in identifying NRs or non-NRs, and over 92% in identifying NRs among the following seven subfamilies: NR1--thyroid hormone like, NR2--HNF4-like, NR3--estrogen like, NR4--nerve growth factor IB-like, NR5--fushi tarazu-F1 like, NR6--germ cell nuclear factor like, and NR0--knirps like. These rates were derived by the jackknife tests on a stringent benchmark dataset in which none of protein sequences included has ≥60% pairwise sequence identity to any other in a same subset. As a user-friendly web-server, iNR-PhysChem is freely accessible to the public at either http://www.jci-bioinfo.cn/iNR-PhysChem or http://icpr.jci.edu.cn/bioinfo/iNR-PhysChem. Also a step-by-step guide is provided on how to use the web-server to get the desired results without the need to follow the complicated mathematics involved in developing the predictor. It is anticipated that iNR-PhysChem may

  16. Phylogeographic structure of cotton pest Adelphocoris suturalis (Hemiptera: Miridae): strong subdivision in China inferred from mtDNA and rDNA ITS markers.

    Science.gov (United States)

    Zhang, Lijuan; Li, Hu; Li, Shujuan; Zhang, Aibing; Kou, Fei; Xun, Huaizhu; Wang, Pei; Wang, Ying; Song, Fan; Cui, Jianxin; Cui, Jinjie; Gouge, Dawn H; Cai, Wanzhi

    2015-09-21

    Phylogeographic patterns of some extant plant and vertebrate species have been well studied; however, they are poorly understood in the majority of insects. The study documents analysis of mitochondrial (COI, CYTB and ND5) and nuclear (5.8S rDNA, ITS2 and 28S rDNA) data from 419 individuals of Adelphocoris suturalis, which is one of the main cotton pests found in the 31 locations in China and Japan involved in the study. Results show that the species is highly differentiated between populations from central China and peripheral China regions. Analysis of molecular variance showed a high level of geographical differentiation at different hierarchical levels. Isolation-by-distance test showed no significant correlation between genetic distance and geographical distance among A. suturalis populations, which suggested gene flow is not restricted by distance. In seven peripheral populations, the high levels of genetic differentiation and the small Nem values implied that geographic barriers were more likely restrict gene flow. Neutrality tests and the Bayesian skyline plot suggested population expansion likely happened during the cooling transition between Last Interglacial and Last Glacial Maximum. All lines of evidence suggest that physical barriers, Pleistocene climatic oscillations and geographical heterogeneity have affected the population structure and distribution of this insect in China.

  17. 16S rDNA analysis of the effect of fecal microbiota transplantation on pulmonary and intestinal flora.

    Science.gov (United States)

    Liu, Tianhao; Yang, Zhongshan; Zhang, Xiaomei; Han, Niping; Yuan, Jiali; Cheng, Yu

    2017-12-01

    This study aims to explore the effect of FMT on regulations of dysbacteriosis of pulmonary and intestinal flora in rats with 16S rDNA sequencing technology. A total of 27 SPF rats (3-4 weeks old) were randomly divided into three groups: normal control group (K), model control group (MX), and fecal microbiota transplantation group (FMT); each group contained nine rats. The OTU values of the pulmonary and intestinal flora of the MX group decreased significantly compared with the normal control group. After FMT, the OTU value of pulmonary flora increased, while the value of OTU in intestinal flora declined. At the phylum level, FMT down-regulated Proteobacteria , Firmicutes , and Bacteroidetes in the pulmonary flora. At the genus level, FMT down-regulated Pseudomonas , Sphingobium , Lactobacillus , Rhizobium , and Acinetobacter , thus maintaining the balance of the pulmonary flora. Moreover, FMT could change the structure and diversity of the pulmonary and intestinal flora by positively regulating the pulmonary flora and negatively regulating intestinal flora. This study may provide a scientific basis for FMT treatment of respiratory diseases.

  18. Localization of Daucus carota NMCP1 to the nuclear periphery: the role of the N-terminal region and an NLS-linked sequence motif, RYNLRR, in the tail domain

    Directory of Open Access Journals (Sweden)

    Yuta eKimura

    2014-02-01

    Full Text Available Recent ultrastructural studies revealed that a structure similar to the vertebrate nuclear lamina exists in the nuclei of higher plants. However, plant genomes lack genes for lamins and intermediate-type filament proteins, and this suggests that plant-specific nuclear coiled-coil proteins make up the lamina-like structure in plants. NMCP1 is a protein, first identified in Daucus carota cells, that localizes exclusively to the nuclear periphery in interphase cells. It has a tripartite structure comprised of head, rod, and tail domains, and includes putative nuclear localization signal (NLS motifs. We identified the functional NLS of DcNMCP1 (carrot NMCP1 and determined the protein regions required for localizing to the nuclear periphery using EGFP-fused constructs transiently expressed in Apium graveolens epidermal cells. Transcription was driven under a CaMV35S promoter, and the genes were introduced into the epidermal cells by a DNA-coated microprojectile delivery system. Of the NLS motifs, KRRRK and RRHK in the tail domain were highly functional for nuclear localization. Addition of the N-terminal 141 amino acids from DcNMCP1 shifted the localization of a region including these NLSs from the entire nucleus to the nuclear periphery. Using this same construct, the replacement of amino acids in RRHK or its preceding sequence, YNL, with alanine residues abolished localization to the nuclear periphery, while replacement of KRRRK did not affect localization. The sequence R/Q/HYNLRR/H, including YNL and the first part of the sequence of RRHK, is evolutionarily conserved in a subclass of NMCP1 sequences from many plant species. These results show that NMCP1 localizes to the nuclear periphery by a combined action of a sequence composed of R/Q/HYNLRR/H, NLS, and the N-terminal region including the head and a portion of the rod domain, suggesting that more than one binding site is implicated in localization of NMCP1.

  19. Autoantibodies from patients with systemic lupus erythematosus bind a shared sequence of SmD and Epstein-Barr virus-encoded nuclear antigen EBNA I.

    Science.gov (United States)

    Sabbatini, A; Bombardieri, S; Migliorini, P

    1993-05-01

    SmD is one of the small nuclear ribonucleoproteins frequently targeted by autoantibodies in systemic lupus erythematosus. We isolated and characterized the antibodies present in lupus sera that are specific for the C-terminal region of SmD (sequence 95-119). This region is highly homologous to sequence 35-58 of the EBNA I antigen, one of the nuclear antigens induced by infection with Epstein-Barr virus. Antibodies affinity purified over a peptide 95-119 column were able to recognize this sequence in the context of the whole SmD molecule, as they reacted with blotted recombinant SmD. Anti-SmD 95-119 antibodies bound also the EBNA I 35-58 peptide and detected the EBNA I molecule in a total cell extract from Epstein-Barr virus-infected lines. A population of anti-SmD antibodies is, therefore, able to bind an epitope shared by the autoantigen and the viral antigen EBNA I. To investigate the involvement of this shared epitope in the generation of anti-SmD antibodies, we immunized mice with the EBNA I 35-58 peptide. Sera from immunized animals displayed the same pattern of reactivity of spontaneously produced anti-SmD antibodies. They reacted in fact with the EBNA peptide as well as with SmD 95-119 and recombinant SmD. These data suggest that molecular mimicry may play a role in the induction of anti-SmD autoantibodies.

  20. Dinoflagellate phylogeny as inferred from heat shock protein 90 and ribosomal gene sequences.

    Directory of Open Access Journals (Sweden)

    Mona Hoppenrath

    2010-10-01

    Full Text Available Interrelationships among dinoflagellates in molecular phylogenies are largely unresolved, especially in the deepest branches. Ribosomal DNA (rDNA sequences provide phylogenetic signals only at the tips of the dinoflagellate tree. Two reasons for the poor resolution of deep dinoflagellate relationships using rDNA sequences are (1 most sites are relatively conserved and (2 there are different evolutionary rates among sites in different lineages. Therefore, alternative molecular markers are required to address the deeper phylogenetic relationships among dinoflagellates. Preliminary evidence indicates that the heat shock protein 90 gene (Hsp90 will provide an informative marker, mainly because this gene is relatively long and appears to have relatively uniform rates of evolution in different lineages.We more than doubled the previous dataset of Hsp90 sequences from dinoflagellates by generating additional sequences from 17 different species, representing seven different orders. In order to concatenate the Hsp90 data with rDNA sequences, we supplemented the Hsp90 sequences with three new SSU rDNA sequences and five new LSU rDNA sequences. The new Hsp90 sequences were generated, in part, from four additional heterotrophic dinoflagellates and the type species for six different genera. Molecular phylogenetic analyses resulted in a paraphyletic assemblage near the base of the dinoflagellate tree consisting of only athecate species. However, Noctiluca was never part of this assemblage and branched in a position that was nested within other lineages of dinokaryotes. The phylogenetic trees inferred from Hsp90 sequences were consistent with trees inferred from rDNA sequences in that the backbone of the dinoflagellate clade was largely unresolved.The sequence conservation in both Hsp90 and rDNA sequences and the poor resolution of the deepest nodes suggests that dinoflagellates reflect an explosive radiation in morphological diversity in their recent

  1. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae) based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments.

    Science.gov (United States)

    Wang, Zhaoshan; Du, Shuhui; Dayanandan, Selvadurai; Wang, Dongsheng; Zeng, Yanfei; Zhang, Jianguo

    2014-01-01

    Populus (Salicaceae) is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1) the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2) three advanced sections (Populus, Aigeiros and Tacamahaca) are of hybrid origin; (3) species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4) many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  2. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments.

    Directory of Open Access Journals (Sweden)

    Zhaoshan Wang

    Full Text Available Populus (Salicaceae is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1 the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2 three advanced sections (Populus, Aigeiros and Tacamahaca are of hybrid origin; (3 species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4 many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  3. Plant rDNA database: ribosomal DNA loci information goes online

    Czech Academy of Sciences Publication Activity Database

    Garcia, S.; Garnatje, T.; Kovařík, Aleš

    2012-01-01

    Roč. 121, č. 4 (2012), s. 389-394 ISSN 0009-5915 R&D Projects: GA ČR(CZ) GAP501/10/0208; GA ČR GBP501/12/G090 Institutional research plan: CEZ:AV0Z50040702 Keywords : rDNA loci * FISH * database Subject RIV: BO - Biophysics Impact factor: 3.340, year: 2012

  4. Cloning, sequencing and expression of a novel xylanase cDNA from ...

    African Journals Online (AJOL)

    A strain SH 2016, capable of producing xylanase, was isolated and identified as Aspergillus awamori, based on its physiological and biochemical characteristics as well as its ITS rDNA gene sequence analysis. A xylanase gene of 591 bp was cloned from this newly isolated A. awamori and the ORF sequence predicted a ...

  5. Comparative d2/d3 LSU–rDNA sequence study of some Iranian ...

    African Journals Online (AJOL)

    SERVER

    2007-11-05

    Nov 5, 2007 ... segments yielded one fragment at over all sequenced isolates as 787 bp in size. The DNA sequences were aligned .... expansion segments of the 28S rDNA subunit (D2/D3. LSU-rDNA) are the ... isolated from different geographical location from tea shrubs infested roots of Guilan province, Iran (Table 1).

  6. Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.

    Science.gov (United States)

    Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal

    2014-05-01

    Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.

  7. Phylogenetic Analysis of a ?Jewel Orchid? Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions

    OpenAIRE

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal th...

  8. Concurrent speciation in the eastern woodland salamanders (Genus Plethodon):DNA sequences of the complete albumin nuclear and partialmitochondrial 12s genes

    Science.gov (United States)

    Highton, Richard; Hastings, Amy Picard; Palmer, Catherine; Watts, Richard; Hass, Carla A.; Culver, Melanie; Arnold, Stevan

    2012-01-01

    Salamanders of the North American plethodontid genus Plethodon are important model organisms in a variety of studies that depend on a phylogenetic framework (e.g., chemical communication, ecological competition, life histories, hybridization, and speciation), and consequently their systematics has been intensively investigated over several decades. Nevertheless, we lack a synthesis of relationships among the species. In the analyses reported here we use new DNA sequence data from the complete nuclear albumin gene (1818 bp) and the 12s mitochondrial gene (355 bp), as well as published data for four other genes (Wiens et al., 2006), up to a total of 6989 bp, to infer relationships. We relate these results to past systematic work based on morphology, allozymes, and DNA sequences. Although basal relationships show a strong consensus across studies, many terminal relationships remain in flux despite substantial sequencing and other molecular and morphological studies. This systematic instability appears to be a consequence of contemporaneous bursts of speciation in the late Miocene and Pliocene, yielding many closely related extant species in each of the four eastern species groups. Therefore we conclude that many relationships are likely to remain poorly resolved in the face of additional sequencing efforts. On the other hand, the current classification of the 45 eastern species into four species groups is supported. The Plethodon cinereus group (10 species) is the sister group to the clade comprising the other three groups, but these latter groups (Plethodon glutinosus [28 species], Plethodon welleri [5 species], and Plethodon wehrlei [2 species]) probably diverged from each other at approximately the same time.

  9. Improved Method for Direct Detection of Environmental Microorganisms Using an Amplification of 16S rDNA Region

    Science.gov (United States)

    Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.

    2004-12-01

    The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection

  10. A populational survey of 45S rDNA polymorphism in the Jefferson salamander Ambystoma jeffersonianum revealed by fluorescence in situ hybridization (FISH

    Directory of Open Access Journals (Sweden)

    Jinzhong FU

    2009-04-01

    Full Text Available The chromosomal localization of 45S ribosomal RNA genes in Ambystoma jeffersonianum was determined by fluorescence in situ hybridization with 18S rDNA fragment as a probe (FISH-rDNA. Our results revealed the presence of rDNA polymorphism among A.jeffersonianum populations in terms of number, location and FISH signal intensity on the chromosomes. Nine rDNA cytotypes were found in ten geographically isolated populations and most of them contained derivative rDNA sites. Our preliminary study provides strong indication of karyotypic diversification of A.jeffersonianum that is demonstrated by intraspecific variation of 45S rDNA cytotypes. rDNA cytotype polymorphism has been described in many other caudate amphibians. We predict that habitat isolation, low dispersal ability and decline of effective population size could facilitate the fixation and accumulation of variable rDNA cytotypes during their chromosome evolution.

  11. Similar patterns of rDNA evolution in synthetic and recently formed natural populations of Tragopogon (Asteraceae allotetraploids

    Directory of Open Access Journals (Sweden)

    Soltis Pamela S

    2010-09-01

    Full Text Available Abstract Background Tragopogon mirus and T. miscellus are allotetraploids (2n = 24 that formed repeatedly during the past 80 years in eastern Washington and adjacent Idaho (USA following the introduction of the diploids T. dubius, T. porrifolius, and T. pratensis (2n = 12 from Europe. In most natural populations of T. mirus and T. miscellus, there are far fewer 35S rRNA genes (rDNA of T. dubius than there are of the other diploid parent (T. porrifolius or T. pratensis. We studied the inheritance of parental rDNA loci in allotetraploids resynthesized from diploid accessions. We investigate the dynamics and directionality of these rDNA losses, as well as the contribution of gene copy number variation in the parental diploids to rDNA variation in the derived tetraploids. Results Using Southern blot hybridization and fluorescent in situ hybridization (FISH, we analyzed copy numbers and distribution of these highly reiterated genes in seven lines of synthetic T. mirus (110 individuals and four lines of synthetic T. miscellus (71 individuals. Variation among diploid parents accounted for most of the observed gene imbalances detected in F1 hybrids but cannot explain frequent deviations from repeat additivity seen in the allotetraploid lines. Polyploid lineages involving the same diploid parents differed in rDNA genotype, indicating that conditions immediately following genome doubling are crucial for rDNA changes. About 19% of the resynthesized allotetraploid individuals had equal rDNA contributions from the diploid parents, 74% were skewed towards either T. porrifolius or T. pratensis-type units, and only 7% had more rDNA copies of T. dubius-origin compared to the other two parents. Similar genotype frequencies were observed among natural populations. Despite directional reduction of units, the additivity of 35S rDNA locus number is maintained in 82% of the synthetic lines and in all natural allotetraploids. Conclusions Uniparental reductions of

  12. Species delimitation and phylogenetic reconstruction of the sinipercids (Perciformes: Sinipercidae) based on target enrichment of thousands of nuclear coding sequences.

    Science.gov (United States)

    Song, Shuli; Zhao, Jinliang; Li, Chenhong

    2017-06-01

    The sinipercids are freshwater fishes endemic to East Asia, mainly in China. Phylogenetic studies on the sinipercids have made great progress in the last decades, but interspecific relationships and evolutionary history of the sinipercids remain unresolved. Lack of distinctive morphological characters leads to problems in validating of some species, such as Siniperca loona. Moreover, genetic data are needed to delimitate species pairs with explicit hypothesis testing, such as in S. chuatsi vs. S. kneri and Coreoperca whiteheadi vs. C. liui. Here we reconstructed phylogeny of the sinipercids with an unprecedented scale of data, 16,943 loci of single-copy coding sequence data from nine sinipercid species, eight putative sister taxa and two outgroups. Targeted sequences were collected using gene enrichment and Illumina sequencing, yielding thousands of protein coding sequences and single nucleotide polymorphisms (SNPs) data. Maximum likelihood and coalescent species tree analyses resulted in identical and highly supported trees. We confirmed that the centrarchids are sister to the sinipercids. A monophyletic Sinipercidae with two genera, Siniperca and Coreoperca was also supported. Different from most previous studies, S. scherzeri was found as the most basal taxon to other species of Siniperca, which consists of two clades: a clade having S. roulei sister to S. chuatsi and S. kneri, and a clade consisting S. loona sister to S. obscura and S. undulata. We found that both S. loona and C. liui are valid species using Bayes factor delimitation (BFD ∗ ) based on SNPs data. Species delimitation also provided decisive support for S. chuatsi and S. kneri being two distinct species. We calibrated a chronogram of the sinipercids based on 100 loci and three fossil calibration points using BEAST, and reconstructed ancestral ranges of the sinipercids using Lagrange Analysis (DEC model) and Statistical Dispersal-Vicariance Analysis (S-DIVA) implemented in RASP. Divergence time

  13. Sequencing of whole plastid genomes and nuclear ribosomal DNA of Diospyros species (Ebenaceae) endemic to New Caledonia: many species, little divergence.

    Science.gov (United States)

    Turner, Barbara; Paun, Ovidiu; Munzinger, Jérôme; Chase, Mark W; Samuel, Rosabelle

    2016-06-01

    Some plant groups, especially on islands, have been shaped by strong ancestral bottlenecks and rapid, recent radiation of phenotypic characters. Single molecular markers are often not informative enough for phylogenetic reconstruction in such plant groups. Whole plastid genomes and nuclear ribosomal DNA (nrDNA) are viewed by many researchers as sources of information for phylogenetic reconstruction of groups in which expected levels of divergence in standard markers are low. Here we evaluate the usefulness of these data types to resolve phylogenetic relationships among closely related Diospyros species. Twenty-two closely related Diospyros species from New Caledonia were investigated using whole plastid genomes and nrDNA data from low-coverage next-generation sequencing (NGS). Phylogenetic trees were inferred using maximum parsimony, maximum likelihood and Bayesian inference on separate plastid and nrDNA and combined matrices. The plastid and nrDNA sequences were, singly and together, unable to provide well supported phylogenetic relationships among the closely related New Caledonian Diospyros species. In the nrDNA, a 6-fold greater percentage of parsimony-informative characters compared with plastid DNA was found, but the total number of informative sites was greater for the much larger plastid DNA genomes. Combining the plastid and nuclear data improved resolution. Plastid results showed a trend towards geographical clustering of accessions rather than following taxonomic species. In plant groups in which multiple plastid markers are not sufficiently informative, an investigation at the level of the entire plastid genome may also not be sufficient for detailed phylogenetic reconstruction. Sequencing of complete plastid genomes and nrDNA repeats seems to clarify some relationships among the New Caledonian Diospyros species, but the higher percentage of parsimony-informative characters in nrDNA compared with plastid DNA did not help to resolve the phylogenetic tree

  14. Detection of Ribosomal DNA Sequence Polymorphisms in the Protist Plasmodiophora brassicae for the Identification of Geographical Isolates

    Directory of Open Access Journals (Sweden)

    Rawnak Laila

    2017-01-01

    Full Text Available Clubroot is a soil-borne disease caused by the protist Plasmodiophora brassicae (P. brassicae. It is one of the most economically important diseases of Brassica rapa and other cruciferous crops as it can cause remarkable yield reductions. Understanding P. brassicae genetics, and developing efficient molecular markers, is essential for effective detection of harmful races of this pathogen. Samples from 11 Korean field populations of P. brassicae (geographic isolates, collected from nine different locations in South Korea, were used in this study. Genomic DNA was extracted from the clubroot-infected samples to sequence the ribosomal DNA. Primers and probes for P. brassicae were designed using a ribosomal DNA gene sequence from a Japanese strain available in GenBank (accession number AB526843; isolate NGY. The nuclear ribosomal DNA (rDNA sequence of P. brassicae, comprising 6932 base pairs (bp, was cloned and sequenced and found to include the small subunits (SSUs and a large subunit (LSU, internal transcribed spacers (ITS1 and ITS2, and a 5.8s. Sequence variation was observed in both the SSU and LSU. Four markers showed useful differences in high-resolution melting analysis to identify nucleotide polymorphisms including single- nucleotide polymorphisms (SNPs, oligonucleotide polymorphisms, and insertions/deletions (InDels. A combination of three markers was able to distinguish the geographical isolates into two groups.

  15. Efficient Subcellular Targeting to the Cell Nucleus of Quantum Dots Densely Decorated with a Nuclear Localization Sequence Peptide.

    Science.gov (United States)

    Maity, Amit Ranjan; Stepensky, David

    2016-01-27

    Organelle-targeted drug delivery can enhance the efficiency of the intracellularly acting drugs and reduce their toxicity. We generated core-shell type CdSe-ZnS quantum dots (QDs) densely decorated with NLS peptidic targeting residues using a 3-stage decoration approach and investigated their endocytosis and nuclear targeting efficiencies. The diameter of the generated QDs increased following the individual decoration stages (16.3, 18.9, and 21.9 nm), the ζ-potential became less negative (-33.2, -17.5, and -11.9 mV), and characteristic changes appeared in the FTIR spectra following decoration with the linker and NLS peptides. Quantitative analysis of the last decoration stage revealed that 37.9% and 33.2% of the alkyne-modified NLS groups that were added to the reaction mix became covalently attached or adsorbed to the QDs surface, respectively. These numbers correspond to 63.6 and 55.7 peptides conjugated or adsorbed to a single QD (the surface density of 42 and 37 conjugated and adsorbed peptides per 1000 nm(2) of the QDs surface), which is higher than in the majority of previous studies that reported decoration efficiencies of formulations intended for nuclear-targeted drug delivery. QDs decorated with NLS peptides undergo more efficient endocytosis, as compared to other investigated QDs formulations, and accumulated to a higher extent in the cell nucleus or in close vicinity to it (11.9%, 14.6%, and 56.1% of the QDs endocytosed by an average cell for the QD-COOH, QD-azide, and QD-NLS formulations, respectively). We conclude that dense decoration of QDs with NLS residues increased their endocytosis and led to their nuclear targeting (preferential accumulation in the cells nuclei or in close vicinity to them). The experimental system and research tools that were used in this study allow quantitative investigation of the mechanisms that govern the QDs nuclear targeting and their dependence on the formulation properties. These findings will contribute to the

  16. Specific nuclear localizing sequence directs two myosin isoforms to the cell nucleus in calmodulin-sensitive manner

    Czech Academy of Sciences Publication Activity Database

    Dzijak, Rastislav; Yildirim, Sukriye; Kahle, Michal; Novák, Petr; Hnilicová, Jarmila; Venit, Tomáš; Hozák, Pavel

    2012-01-01

    Roč. 7, č. 1 (2012), e30529 E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA204/07/1592; GA ČR(CZ) GD204/09/H084; GA ČR GAP305/11/2232; GA MŠk LC545; GA MŠk(CZ) LC06063 Institutional research plan: CEZ:AV0Z50520514 Institutional support: RVO:68378050 ; RVO:61388971 Keywords : NM1 * nuclear import * NLS * calmodulin Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.730, year: 2012

  17. Genotypic diversity of oscillatoriacean strains belonging to the genera Geitlerinema and Spirulina determined by 16S rDNA restriction analysis.

    Science.gov (United States)

    Margheri, Maria C; Piccardi, Raffaella; Ventura, Stefano; Viti, Carlo; Giovannetti, Luciana

    2003-05-01

    Genotypic diversity of several cyanobacterial strains mostly isolated from marine or brackish waters, belonging to the genera Geitlerinema and Spirulina, was investigated by amplified 16S ribosomal DNA restriction analysis and compared with morphological features and response to salinity. Cluster analysis was performed on amplified 16S rDNA restriction profiles of these strains along with profiles obtained from sequence data of five Spirulina-like strains, including three representatives of the new genus Halospirulina. Our strains with tightly coiled trichomes from hypersaline waters could be assigned to the Halospirulina genus. Among the uncoiled strains, the two strains of hypersaline origin clustered together and were found to be distant from their counterparts of marine and freshwater habitat. Moreover, another cluster, formed by alkali-tolerant strains with tightly coiled trichomes, was well delineated.

  18. Phylogeography of Thlaspi arvense (Brassicaceae in China Inferred from Chloroplast and Nuclear DNA Sequences and Ecological Niche Modeling

    Directory of Open Access Journals (Sweden)

    Miao An

    2015-06-01

    Full Text Available Thlaspi arvense is a well-known annual farmland weed with worldwide distribution, which can be found from sea level to above 4000 m high on the Qinghai-Tibetan Plateau (QTP. In this paper, a phylogeographic history of T. arvense including 19 populations from China was inferred by using three chloroplast (cp DNA segments (trnL-trnF, rpl32-trnL and rps16 and one nuclear (n DNA segment (Fe-regulated transporter-like protein, ZIP. A total of 11 chloroplast haplotypes and six nuclear alleles were identified, and haplotypes unique to the QTP were recognized (C4, C5, C7 and N4. On the basis of molecular dating, haplotypes C4, C5 and C7 have separated from others around 1.58 Ma for cpDNA, which corresponds to the QTP uplift. In addition, this article suggests that the T. arvense populations in China are a mixture of diverged subpopulations as inferred by hT/vT test (hT ≤ vT, cpDNA and positive Tajima’s D values (1.87, 0.05 < p < 0.10 for cpDNA and 3.37, p < 0.01 for nDNA. Multimodality mismatch distribution curves and a relatively large shared area of suitable environmental conditions between the Last Glacial Maximum (LGM as well as the present time recognized by MaxEnt software reject the sudden expansion population model.

  19. Isolation and Optimization of Inter-Simple Sequence Repeat (ISSR) Technique For Pleurotus Sajor Caju Towards Environmental Study in Support of the Country's Nuclear Power Programme

    International Nuclear Information System (INIS)

    Rosnani Abdul Rashid; Azhar Mohamad; Mat Rasol Awang; Hassan Hamdani Mutaat; Shaiful Azuar Mohamad; Affrida Abu Hasan; Mohd Meswan Maskom; Siti Khadijah Mohd Nahar

    2013-01-01

    Mushroom can be used as a biological indicator in assessing radiological impact on the environment. Radiological effect would be reflected through morphological changes as well as those changes at molecular level. For this purpose, a preliminary work was conducted, which included DNA isolation, optimization of PCR parameters for Inter-Simple Sequence Repeat (ISSR) and primers screening on Pleurotus sajor caju mushroom strains from Nuclear Malaysia's Sterifeed Mushrooms Collection Centre. In this work, DNA isolation technique from cap and stalk of fruit body were optimized and quantified. It was found that stalk produced highest amount of genomic DNA at 304.01 ng/ μl and cap at 149.00 ng/ μl. A total of 100 ISSR primers were tested and 51 primers were successfully amplified. These primers will be used further for dose response evaluation and molecular profiling in mushroom species. (author)

  20. Molecular Phylogeny of Triticum and Aegilops Genera Based on ITS and MATK Sequence Data

    International Nuclear Information System (INIS)

    Dizkirici, A.; Kansu, C.; Onde, S.

    2016-01-01

    Understanding the phylogenetic relationship between Triticum and Aegilops species, which form a vast gene pool of wheat, is very important for breeding new cultivated wheat varieties. In the present study, phylogenetic relationships between Triticum (12 samples from 4 species) and Aegilops (24 samples from 8 species) were investigated using sequences of the nuclear ITS rDNA gene and partial sequences of the matK gene of chloroplast genome. The phylogenetic relationships among species were reconstructed using Maximum Likelihood method. The constructed tree based on the sequences of the nuclear component (ITS) displayed a close relationship between polyploid wheats and Aegilops speltoides species which provided new evidence for the source of the enigmatic B genome donor as Ae. speltoides. Concurrent clustering of Ae. cylindrica and Ae. tauschii and their close positioning to polyploid wheats pointed the source of the D genome as one of these species. As reported before, diploid Triticum species (i.e. T. urartu) were identified as the A genome donors and the positioning of these diploid wheats on the constructed tree are meaningful. The constructed tree based on the chloroplastic matK sequences displayed same relationship between polyploid wheats and Ae. speltoides species providing evidence for the later species being the chloroplast donors for polyploid wheats. Therefore, our results supported the idea of coinheritance of nuclear and chloroplast genomes where Ae. speltoides was the maternal donor. For both trees the remaining Aegilops species produced a distinct cluster whereas with the exception of T. urartu, diploid Triticum species displayed a monophyletic structure. (author)

  1. The phylogeny of the family Lacertidae (Reptilia) based on nuclear DNA sequences: convergent adaptations to arid habitats within the subfamily Eremiainae.

    Science.gov (United States)

    Mayer, Werner; Pavlicev, Mihaela

    2007-09-01

    The family Lacertidae encompasses more than 250 species distributed in the Palearctis, Ethiopis and Orientalis. Lacertids have been subjected in the past to several morphological and molecular studies to establish their phylogeny. However, the problems of convergent adaptation in morphology and of excessively variable molecular markers have hampered the establishment of well supported deeper phylogenetic relationships. Particularly the adaptations to xeric environments have often been used to establish a scenario for the origin and radiation of major lineages within lacertids. Here we present a molecular phylogenetic study based on two nuclear marker genes and representatives of 37 lacertid genera and distinct species groups (as in the case of the collective genus Lacerta). Roughly 1600 bp of the nuclear rag1 and c-mos genes were sequenced and analyzed. While the results provide good support to the hitherto suggested main subfamilies of Gallotiinae (Gallotia and Psammodromus), Eremiainae and Lacertinae [Harris, D.J., Arnold, E.N., Thomas, R.H., 1998. Relationships of lacertid lizards (Reptilia: Lacertidae) estimated from mitochondrial DNA sequences and morphology. Proc. R. Soc. Lond. B 265, 1939-1948], they also suggest unexpected relationships. In particular, the oriental genus Takydromus, previously considered the sister-group to the three subfamilies, is nested within Lacertinae. Moreover, the genera within the Eremiainae are further divided into two groups, roughly corresponding to their respective geographical distributions in the Ethiopian and the Saharo-Eurasian ranges. The results support an independent origin of adaptations to xeric conditions in different subfamilies. The relationships within the subfamily Lacertinae could not be resolved with the markers used. The species groups of the collective genus Lacerta show a bush-like topology in the inferred Bayesian tree, suggesting rapid radiation. The composition of the subfamilies Eremiainae and Lacertinae

  2. The phylogenetic position of Lygodactylus angularis and the utility of using the 16S rDNA gene for delimiting species in Lygodactylus (Squamata, Gekkonidae

    Directory of Open Access Journals (Sweden)

    Riccardo Castiglia

    2011-06-01

    Full Text Available The African genus Lygodactylus Gray, is composed of roughly 60 species of diurnal geckos that inhabit tropical and temperate Africa, Madagascar, and South America. In this study, we assessed the phylogenetic position of L. angularis, for which molecular data were so far lacking, by means of sequence analysis of the mitochondrial 16S rDNA gene. We also compared intraspecific vs. interspecific genetic divergences using an extended data set (34 species, 153 sequences, to determine whether a fragment of this gene can be useful for species identification and to reveal the possible existence of new cryptic species in the genus. The analysis placed L. angularis in a monophyletic group together with members of “fischeri” and “picturatus” groups. Nevertheless, the independence of the “angularis” lineage is supported by the high genetic divergence. Comparison of intraspecific vs. interspecific genetic distances highlights that, assuming an equal molecular rate of evolution among the studied species for the used gene, the threshold value useful for recognising a candidate new species can be tentatively placed at 7%. We identified four species that showed an intraspecific divergence higher than, or close to, the 7% threshold: L. capensis (8.7%, L. gutturalis (9.3%, L. madagascariensis (6.5% and L. picturatus (8.1%. Moreover, two species, L. mombasicus and L. verticillatus, are paraphyletic in terms of gene genealogy. Thus, the study shows that a short fragment of the 16S rDNA gene can be an informative tool for species-level taxonomy in the genus Lygodactylus.

  3. Nuclear Species-Diagnostic SNP Markers Mined from 454 Amplicon Sequencing Reveal Admixture Genomic Structure of Modern Citrus Varieties

    Science.gov (United States)

    Curk, Franck; Ancillo, Gema; Ollitrault, Frédérique; Perrier, Xavier; Jacquemoud-Collet, Jean-Pierre; Garcia-Lor, Andres; Navarro, Luis; Ollitrault, Patrick

    2015-01-01

    Most cultivated Citrus species originated from interspecific hybridisation between four ancestral taxa (C. reticulata, C. maxima, C. medica, and C. micrantha) with limited further interspecific recombination due to vegetative propagation. This evolution resulted in admixture genomes with frequent interspecific heterozygosity. Moreover, a major part of the phenotypic diversity of edible citrus results from the initial differentiation between these taxa. Deciphering the phylogenomic structure of citrus germplasm is therefore essential for an efficient utilization of citrus biodiversity in breeding schemes. The objective of this work was to develop a set of species-diagnostic single nucleotide polymorphism (SNP) markers for the four Citrus ancestral taxa covering the nine chromosomes, and to use these markers to infer the phylogenomic structure of secondary species and modern cultivars. Species-diagnostic SNPs were mined from 454 amplicon sequencing of 57 gene fragments from 26 genotypes of the four basic taxa. Of the 1,053 SNPs mined from 28,507 kb sequence, 273 were found to be highly diagnostic for a single basic taxon. Species-diagnostic SNP markers (105) were used to analyse the admixture structure of varieties and rootstocks. This revealed C. maxima introgressions in most of the old and in all recent selections of mandarins, and suggested that C. reticulata × C. maxima reticulation and introgression processes were important in edible mandarin domestication. The large range of phylogenomic constitutions between C. reticulata and C. maxima revealed in mandarins, tangelos, tangors, sweet oranges, sour oranges, grapefruits, and orangelos is favourable for genetic association studies based on phylogenomic structures of the germplasm. Inferred admixture structures were in agreement with previous hypotheses regarding the origin of several secondary species and also revealed the probable origin of several acid citrus varieties. The developed species-diagnostic SNP

  4. Veronica: Chemical characters for the support of phylogenetic relationships based on nuclear ribosomal and plastid DNA sequence data

    DEFF Research Database (Denmark)

    Albach, Dirk C.; Jensen, Søren Rosendal; Özgökce, Fevzi

    2005-01-01

    Molecular phylogenetic analyses have revealed many relationships in Veronica (Plantaginaceae) never anticipated before. However, phytochemical characters show good congruence with DNA-based analyses. We have analysed a combined data set of 49 species and subspecies derived from the nuclear...... are monophyletic sister groups with the annual species consecutive sisters to them. All species of Veronica that contain cornoside are found in this subgenus, although some species seem to have secondarily lost the ability to produce this compound. Subgenera Pocilla and Pentasepalae are well supported sister...... species in the genus analysed to date to contain melittoside and globularifolin. Subgenus Pentasepalae appears to be a clade of diverse lineages from southwestern Asia and a single European clade. Species shown to have 6-hydroxyflavones do not form a monophyletic group. Subgenus Pseudolysimachium seems...

  5. Phylogenetic Analysis of a 'Jewel Orchid' Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions.

    Science.gov (United States)

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1) Goodyera is not monophyletic; 2) Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3) sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection.

  6. Phylogenetic Analysis of a 'Jewel Orchid' Genus Goodyera (Orchidaceae Based on DNA Sequence Data from Nuclear and Plastid Regions.

    Directory of Open Access Journals (Sweden)

    Chao Hu

    Full Text Available A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae based on the nuclear ribosomal internal transcribed spacer (ITS region and two chloroplast loci (matK and trnL-F was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1 Goodyera is not monophyletic; 2 Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3 sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection.

  7. Species tree phylogeny and character evolution in the genus Centipeda (Asteraceae): evidence from DNA sequences from coding and non-coding loci from the plastid and nuclear genomes.

    Science.gov (United States)

    Nylinder, Stephan; Cronholm, Bodil; de Lange, Peter J; Walsh, Neville; Anderberg, Arne A

    2013-08-01

    A species tree phylogeny of the Australian/New Zealand genus Centipeda (Asteraceae) is estimated based on nucleotide sequence data. We analysed sequences of nuclear ribosomal DNA (ETS, ITS) and three plasmid loci (ndhF, psbA-trnH, and trnL-F) using the multi-species coalescent module in BEAST. A total of 129 individuals from all 10 recognised species of Centipeda were sampled throughout the species distribution ranges, including two subspecies. We conclude that the inferred species tree topology largely conform previous assumptions on species relationships. Centipeda racemosa (Snuffweed) is the sister to remaining species, which is also the only consistently perennial representative in the genus. Centipeda pleiocephala (Tall Sneezeweed) and C. nidiformis (Cotton Sneezeweed) constitute a species pair, as does C. borealis and C. minima (Spreading Sneezeweed), all sharing the symplesiomorphic characters of spherical capitulum and convex receptacle with C. racemosa. Another species group comprising C. thespidioides (Desert Sneezeweed), C. cunninghamii (Old man weed, or Common sneeze-weed), C. crateriformis is well-supported but then include the morphologically aberrant C. aotearoana, all sharing the character of having capitula that mature more slowly relative the subtending shoot. Centipeda elatinoides takes on a weakly supported intermediate position between the two mentioned groups, and is difficult to relate to any of the former groups based on morphological characters. Copyright © 2013 Elsevier Inc. All rights reserved.

  8. Nuclear

    International Nuclear Information System (INIS)

    Anon.

    2000-01-01

    The first text deals with a new circular concerning the collect of the medicine radioactive wastes, containing radium. This campaign wants to incite people to let go their radioactive wastes (needles, tubes) in order to suppress any danger. The second text presents a decree of the 31 december 1999, relative to the limitations of noise and external risks resulting from the nuclear facilities exploitation: noise, atmospheric pollution, water pollution, wastes management and fire prevention. (A.L.B.)

  9. Discrimination of Shark species by simple PCR of 5S rDNA repeats

    OpenAIRE

    Pinhal, Danillo [UNESP; Gadig, Otto Bismarck Fazzano [UNESP; Wasko, Adriane Pinto [UNESP; Oliveira, Claudio [UNESP; Ron, Ernesto; Foresti, Fausto [UNESP; Martins, Cesar [UNESP

    2008-01-01

    Sharks are suffering from intensive exploitation by worldwide fisheries leading to a severe decline in several populations in the last decades. The lack of biological data on a species-specific basis, associated with a k-strategist life history make it difficult to correctly manage and conserve these animals. The aim of the present study was to develop a DNA-based procedure to discriminate shark species by means of a rapid, low cost and easily applicable PCR analysis based on 5S rDNA repeat u...

  10. Data partitions, Bayesian analysis and phylogeny of the zygomycetous fungal family Mortierellaceae, inferred from nuclear ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Tamás Petkovits

    Full Text Available Although the fungal order Mortierellales constitutes one of the largest classical groups of Zygomycota, its phylogeny is poorly understood and no modern taxonomic revision is currently available. In the present study, 90 type and reference strains were used to infer a comprehensive phylogeny of Mortierellales from the sequence data of the complete ITS region and the LSU and SSU genes with a special attention to the monophyly of the genus Mortierella. Out of 15 alternative partitioning strategies compared on the basis of Bayes factors, the one with the highest number of partitions was found optimal (with mixture models yielding the best likelihood and tree length values, implying a higher complexity of evolutionary patterns in the ribosomal genes than generally recognized. Modeling the ITS1, 5.8S, and ITS2, loci separately improved model fit significantly as compared to treating all as one and the same partition. Further, within-partition mixture models suggests that not only the SSU, LSU and ITS regions evolve under qualitatively and/or quantitatively different constraints, but that significant heterogeneity can be found within these loci also. The phylogenetic analysis indicated that the genus Mortierella is paraphyletic with respect to the genera Dissophora, Gamsiella and Lobosporangium and the resulting phylogeny contradict previous, morphology-based sectional classification of Mortierella. Based on tree structure and phenotypic traits, we recognize 12 major clades, for which we attempt to summarize phenotypic similarities. M. longicollis is closely related to the outgroup taxon Rhizopus oryzae, suggesting that it belongs to the Mucorales. Our results demonstrate that traits used in previous classifications of the Mortierellales are highly homoplastic and that the Mortierellales is in a need of a reclassification, where new, phylogenetically informative phenotypic traits should be identified, with molecular phylogenies playing a decisive role.

  11. Ribosomal DNA sequence divergence and group I introns within the Leucostoma species L. cinctum, L. persoonii, and L. parapersoonii sp. nov., ascomycetes that cause Cytospora canker of fruit trees.

    Science.gov (United States)

    Adams, Gerard C; Surve-Iyer, Rupa S; Iezzoni, Amy F

    2002-01-01

    Leucostoma species that are the causal agents of Cytospora canker of stone and pome fruit trees were studied in detail. DNA sequence of the internal transcribed spacer regions and the 5.8S of the nuclear ribosomal DNA operon (ITS rDNA) supplied sufficient characters to assess the phylogenetic relationships among species of Leucostoma, Valsa, Valsella, and related anamorphs in Cytospora. Parsimony analysis of the aligned sequence divided Cytospora isolates from fruit trees into clades that generally agreed with the morphological species concepts, and with some of the phenetic groupings (PG 1-6) identified previously by isozyme analysis and cultural characteristics. Phylogenetic analysis inferred that isolates of L. persoonii formed two well-resolved clades distinct from isolates of L. cinctum. Phylogenetic analysis of the ITS rDNA, isozyme analysis, and cultural characteristics supported the inference that L. persoonii groups PG 2 and PG 3 were populations of a new species apparently more genetically different from L. persoonii PG 1 than from isolates representative of L. massariana, L. niveum, L. translucens, and Valsella melastoma. The new species, L. parapersoonii, was described. A diverse collection of isolates of L. cinctum, L. persoonii, and L. parapersoonii were examined for genetic variation using restriction fragment length polymorphism (RFLP) analysis of the ITS rDNA and the five prime end of the large subunit of the rDNA (LSU rDNA). HinfI and HpaII endonucleases were each useful in dividing the Leucostoma isolates into RFLP profiles corresponding to the isozyme phenetic groups, PG 1-6. RFLP analysis was more effective than isozyme analysis in uncovering variation among isolates of L. persoonii PG 1, but less effective within L. cinctum populations. Isolates representative of seven of the L. persoonii formae speciales proposed by G. Défago in 1935 were found to be genetically diverse isolates of PG 1. Two large insertions, 415 and 309 nucleotides long, in

  12. A reassessment of phylogenetic relationships within the phaeophyceae based on RUBISCO large subunit and ribosomal DNA sequences

    NARCIS (Netherlands)

    Draisma, S.G A; Prud'homme van Reine, W.F; Stam, W.T.; Olsen, J.L.

    To better assess the current state of phaeophycean phylogeny, we compiled all currently available rbcL, 18S, and 26S rDNA sequences from the EMBL/GenBank database and added 21 new rbcL sequences of our own. We then developed three new alignments designed to maximize taxon sampling while minimizing

  13. Pnc1p-mediated nicotinamide clearance modifies the epigenetic properties of rDNA silencing in Saccharomyces cerevisiae.

    Science.gov (United States)

    McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S

    2008-10-01

    The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.

  14. Molecular technique reveals high variability of 18S rDNA distribution in harvestmen (Opiliones, Phalangiidae) from South Africa.

    Science.gov (United States)

    Šťáhlavský, František; Opatova, Vera; Just, Pavel; Lotz, Leon N; Haddad, Charles R

    2018-01-01

    The knowledge of cytogenetics in the harvestmen family Phalangiidae has been based on taxa from the Northern Hemisphere. We performed cytogenetic analysis on Guruia africana (Karsch, 1878) (2n=24) and four species of the genus Rhampsinitus Simon, 1879 (2n=24, 26, 34) from South Africa. Fluorescence in situ hybridization with an 18S rDNA probe was used to analyze the number and the distribution of this cluster in the family Phalangiidae for the first time. The results support the cytogenetic characteristics typical for the majority of harvestmen taxa, i.e. the predominance of small biarmed chromosomes and the absence of morphologically well-differentiated sex chromosomes as an ancestral state. We identified the number of 18S rDNA sites ranging from two in R. qachasneki Kauri, 1962 to seven in one population of R. leighi Pocock, 1903. Moreover, we found differences in the number and localization of 18S rDNA sites in R. leighi between populations from two localities and between sexes of R. capensis (Loman, 1898). The heterozygous states of the 18S rDNA sites in these species may indicate the presence of XX/XY and ZZ/ZW sex chromosomes, and the possible existence of these systems in harvestmen is discussed. The variability of the 18S rDNA sites indicates intensive chromosomal changes during the differentiation of the karyotypes, which is in contrast to the usual uniformity in chromosomal morphology known from harvestmen so far.

  15. Different patterns of rDNA distribution in Pisum sativum nucleoli correlate with different levels of nucleolar activity

    International Nuclear Information System (INIS)

    Highett, M.I.; Rawlins, D.J.; Shaw, P.J.

    1993-01-01

    We have used in situ hybridization with probes to rDNA, labelled either with digoxygenin or directly with fluorescein, to determine the arrangement of these genes within the nucleoli of Pisum sativum L. root cells. Confocal laser scanning microscopy was used to image the three-dimensional structures revealed, but we have also compared this technique with deconvolution of conventional (wide-field) fluorescence images measured with a cooled CCD camera, and have shown that the results are remarkably similar. When the deconvolution technique was applied to the confocal data it gave clearer images than could be achieved by confocal microscopy alone. We have analysed the distribution of rDNA in the different cell types observable in root tips: the quiescent centre; active meristematic cells; and relatively differentiated root cap, epidermal and cortical cells. In addition to four perinucleolar knobs of condensed, inactive rDNA genes, corresponding to the four nucleolar organizers in P. sativum, which were the most brightly labelled structures, several characteristic patterns of intranucleolar labelling were apparent, including bright foci, large central chromatin masses, and fine, decondensed interconnecting fibres. The larger and more active the nucleolus, the smaller the proportion of condensed perinucleolar rDNA. In some large and active meristematic nucleoli, all the internal rDNA is decondensed, showing that transcription cannot be restricted to the bright foci, and is most likely to occur on the decondensed fibres. (author)

  16. Ultrastructural and autoradiographic studies of nucleolar development and rDNA transcription in preimplantation mouse embryos

    Energy Technology Data Exchange (ETDEWEB)

    Geuskens, M.; Alexandre, H. (Universite Libre de Bruxelles (Belgium). Dep. de Biologie Moleculaire)

    1984-06-01

    The development of the nucleoli and the sites of rDNA transcription have been studies by high-resolution autoradiography during the cleavage stages of mouse embryos. The appearance of fibrillar centres at the periphery of the fibrillar primary nucleoli has been observed at the 4-cell stage. Several fibrillar centres interconnected by electron-dense fibrillar strands, form a reticulated region around the fibrillar mass at the 6- to 8-cell stage. After a 10 min pulse with (/sup 3/H)uridine, only this peripheral network is labelled. At the late morula and at the blastocyst stage, the fibrillar component (nucleolonema) of the reticulated nucleoli is labelled after 10 min (/sup 3/H)uridine incorporation. When the embryos are reincubated for 2 h in cold medium, the label is localized mainly in the granular component. Fibrillar centres are not labelled. Autoradiograms of in vitro developed embryos pulsed for 2 h with (/sup 3/H)uridine confirm that the central fibrillar core of the nucleoli of 6- to 8-cell embryos is never labelled. Thus, the fibrillar constituent of this core is not homologous to the fibrillar component of the nucleoli of later stage embryos, which is the site of active rDNA transcription. An interpretation of nucleologenesis during early mouse embryogenesis is proposed.

  17. Ultrastructural and autoradiographic studies of nucleolar development and rDNA transcription in preimplantation mouse embryos

    International Nuclear Information System (INIS)

    Geuskens, M.; Alexandre, H.

    1984-01-01

    The development of the nucleoli and the sites of rDNA transcription have been studies by high-resolution autoradiography during the cleavage stages of mouse embryos. The appearance of fibrillar centres at the periphery of the fibrillar primary nucleoli has been observed at the 4-cell stage. Several fibrillar centres interconnected by electron-dense fibrillar strands, form a reticulated region around the fibrillar mass at the 6- to 8-cell stage. After a 10 min pulse with ( 3 H)uridine, only this peripheral network is labelled. At the late morula and at the blastocyst stage, the fibrillar component (nucleolonema) of the reticulated nucleoli is labelled after 10 min ( 3 H)uridine incorporation. When the embryos are reincubated for 2 h in cold medium, the label is localized mainly in the granular component. Fibrillar centres are not labelled. Autoradiograms of in vitro developed embryos pulsed for 2 h with ( 3 H)uridine confirm that the central fibrillar core of the nucleoli of 6- to 8-cell embryos is never labelled. Thus, the fibrillar constituent of this core is not homologous to the fibrillar component of the nucleoli of later stage embryos, which is the site of active rDNA transcription. An interpretation of nucleologenesis during early mouse embryogenesis is proposed. (author)

  18. Nonviral Gene Targeting at rDNA Locus of Human Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Youjin Hu

    2013-01-01

    Full Text Available Background. Genetic modification, such as the addition of exogenous genes to the MSC genome, is crucial to their use as cellular vehicles. Due to the risks associated with viral vectors such as insertional mutagenesis, the safer nonviral vectors have drawn a great deal of attention. Methods. VEGF, bFGF, vitamin C, and insulin-transferrin-selenium-X were supplemented in the MSC culture medium. The cells’ proliferation and survival capacity was measured by MTT, determination of the cumulative number of cells, and a colony-forming efficiency assay. The plasmid pHr2-NL was constructed and nucleofected into MSCs. The recombinants were selected using G418 and characterized using PCR and Southern blotting. Results. BFGF is critical to MSC growth and it acted synergistically with vitamin C, VEGF, and ITS-X, causing the cells to expand significantly. The neomycin gene was targeted to the rDNA locus of human MSCs using a nonviral human ribosomal targeting vector. The recombinant MSCs retained multipotential differentiation capacity, typical levels of hMSC surface marker expression, and a normal karyotype, and none were tumorigenic in nude mice. Conclusions. Exogenous genes can be targeted to the rDNA locus of human MSCs while maintaining the characteristics of MSCs. This is the first nonviral gene targeting of hMSCs.

  19. Optimisation of 16S rDNA amplicon sequencing protocols for microbial community profiling of anaerobic digesters

    DEFF Research Database (Denmark)

    Kirkegaard, Rasmus Hansen; McIlroy, Simon Jon; Larsen, Poul

    A reliable and reproducible method for identification and quantification of the microorganisms involved in biogas production is important for the study and understanding of the microbial communities responsible for the function of anaerobic digester systems. DNA based identification using 16S rRN...

  20. Phylogenetic analysis of the kenaf fiber microbial retting community by semiconductor sequencing of 16S rDNA amplicons

    Science.gov (United States)

    Kenaf, hemp, and jute have been used for cordage and fiber production since prehistory. To obtain the fibers, harvested plants are soaked in ponds where indigenous microflora digests pectins and other heteropolysaccharides, releasing fibers in a process called retting. Renewed interest in “green” ...

  1. Phylogeny of Neoparamoeba strains isolated from marine fish and invertebrates as inferred from SSU rDNA sequences

    Czech Academy of Sciences Publication Activity Database

    Dyková, Iva; Nowak, B.; Pecková, Hana; Fiala, Ivan; Crosbie, P.; Dvořáková, Helena

    2007-01-01

    Roč. 74, č. 1 (2007), s. 57-65 ISSN 0177-5103 R&D Projects: GA ČR GA206/05/2384; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : Neoparamoeba strains * Paramoeba eilhardi * phylogeny * invertebrate infections Subject RIV: EA - Cell Biology Impact factor: 1.598, year: 2007

  2. Altered gravity influences rDNA and NopA100 localization in nucleoli

    Science.gov (United States)

    Sobol, M. A.; Kordyum, E. L.

    Fundamental discovery of gravisensitivity of cells no specified to gravity perception focused increasing attention on an elucidation of the mechanisms involved in altered gravity effects at the cellular and subcellular levels. The nucleolus is the transcription site of rRNA genes as well as the site of processing and initial packaging of their transcripts with ribosomal and nonribosomal proteins. The mechanisms inducing the changes in the subcomponents of the nucleolus that is morphologically defined yet highly dynamic structure are still unknown in detail. To understand the functional organization of the nucleolus as in the control as under altered gravity conditions it is essential to determine both the precise location of rDNA and the proteins playing the key role in rRNA processing. Lepidium sativum seeds were germinated in 1% agar medium on the slow horizontal clinostat (2 rpm) and in the stationary conditions. We investigated the root meristematic cells dissected from the seedlings grown in darkness for two days. The investigations were carried out with anti-DNA and anti-NopA100 antibodies labeling as well as with TdT procedure, and immunogold electron microscopy. In the stationary growth conditions, the anti-DNA antibody as well TdT procedure were capable of detecting fibrillar centers (FCs) and the dense fibrillar component (DFC) in the nucleolus. In FCs, gold particles were revealed on the condensed chromatin inclusions, internal fibrils of decondensed rDNA and the transition zone FC-DFC. Quantitatively, FCs appeared 1,5 times more densely labeled than DFC. NopA100 was localized in FCs and in DFC. In FCs, the most of protein was revealed in the transition zone FC-DFC. After a quantitative study, FCs and the transition zone FC-DFC appeared to contain NopA100 1,7 times more than DFC. Under the conditions of altered gravity, quantitative data clearly showed a redistribution of nucleolar DNA and NopA100 between FCs and DFC in comparison with the control. In

  3. Distribution of 45S rDNA in Modern Rose Cultivars (Rosa hybrida), Rosa rugosa, and Their Interspecific Hybrids Revealed by Fluorescence in situ Hybridization.

    Science.gov (United States)

    Ding, Xiao-Liu; Xu, Ting-Liang; Wang, Jing; Luo, Le; Yu, Chao; Dong, Gui-Min; Pan, Hui-Tang; Zhang, Qi-Xiang

    2016-01-01

    To elucidate the evolutionary dynamics of the location and number of rDNA loci in the process of polyploidization in the genus Rosa, we examined 45S rDNA sites in the chromosomes of 6 modern rose cultivars (R. hybrida), 5 R. rugosa cultivars, and 20 hybrid progenies by fluorescence in situ hybridization. Variation in the number of rDNA sites in parents and their interspecific hybrids was detected. As expected, 4 rDNA sites were observed in the genomes of 4 modern rose cultivars, while 3 hybridization sites were observed in the 2 others. Two expected rDNA sites were found in 2 R. rugosa cultivars, while in the other 3 R. rugosa cultivars 4 sites were present. Among the 20 R. hybrida × R. rugosa offspring, 13 carried the expected number of rDNA sites, and 1 had 6 hybridization sites, which exceeded the expected number by far. The other 6 offspring had either 2 or 3 hybridization sites, which was less than expected. Differences in the number of rDNA loci were observed in interspecific offspring, indicating that rDNA loci exhibit instability after distant hybridization events. Abnormal chromosome pairing may be the main factor explaining the variation in rDNA sites during polyploidization. © 2016 S. Karger AG, Basel.

  4. Early-life nutrition modulates the epigenetic state of specific rDNA genetic variants in mice.

    Science.gov (United States)

    Holland, Michelle L; Lowe, Robert; Caton, Paul W; Gemma, Carolina; Carbajosa, Guillermo; Danson, Amy F; Carpenter, Asha A M; Loche, Elena; Ozanne, Susan E; Rakyan, Vardhman K

    2016-07-29

    A suboptimal early-life environment, due to poor nutrition or stress during pregnancy, can influence lifelong phenotypes in the progeny. Epigenetic factors are thought to be key mediators of these effects. We show that protein restriction in mice from conception until weaning induces a linear correlation between growth restriction and DNA methylation at ribosomal DNA (rDNA). This epigenetic response remains into adulthood and is restricted to rDNA copies associated with a specific genetic variant within the promoter. Related effects are also found in models of maternal high-fat or obesogenic diets. Our work identifies environmentally induced epigenetic dynamics that are dependent on underlying genetic variation and establishes rDNA as a genomic target of nutritional insults. Copyright © 2016, American Association for the Advancement of Science.

  5. The efficacy of 16S ribosomal DNA sequencing in the diagnosis of bacteria from blood, bone and synovial fluid samples of children with musculoskeletal infections.

    Science.gov (United States)

    Hashavya, S; Gross, I; Michael-Gayego, A; Simanovsky, N; Lamdan, R

    2018-04-01

    Musculoskeletal infections are among the most common bacterial infections in children leading to hospitalization, invasive procedures and prolonged antibiotic administration. Blood, synovial and sometimes tissue cultures are essential for the diagnosis and treatment of musculoskeletal infections; 16S ribosomal DNA (rDNA) sequencing is a novel diagnostic tool for the detection of bacteria.While the yield of 16S rDNA sequencing in synovial fluid was previously assessed, data regarding the efficacy of this method from blood samples or partially treated children with suspected musculoskeletal infections is lacking.In this study we assessed the yield of 16S rDNA sequencing in blood, bone and synovial samples of children with musculoskeletal infections. Blood, synovial and bone samples were collected from children with suspected musculoskeletal infections and analyzed for the presence of 16S rDNA, the results were then compared with the benchmark microbial cultures. During the study period, 41 children (18 boys and 23 girls) with suspected acute musculoskeletal infection were enrolled. A positive blood culture was found in 6/31 cases (19.4%) with methicillin-susceptible Staphylococcus aureus being the most commonly isolated bacterium. No significant 16S rDNA detection in blood samples was recorded.Synovial fluid culture was positive in 6/28 samples (21%), Kingella kingae being the most common pathogen. When using the 16S rDNA sequencing method, the rate of positive results in synovial fluid was higher with bacterial detection in 12/23 (52%) samples. The 16S rDNA sequencing method was also able to identify pathogens in samples taken from partially treated children where cultures were negative with 16S rDNA detection in 5/5 samples. Although 16S rDNA sequencing may increase the yield of bacterial detection in synovial samples of patients with musculoskeletal infections, there is no benefit from applying this method on blood samples. The 16S rDNA sequencing method may be

  6. Electron microscopic in situ hybridization and autoradiography: Localization and transcription of rDNA in human lymphocyte nucleoli

    International Nuclear Information System (INIS)

    Wachtler, F.; Mosgoeller, W.S.; Schwarzacher, H.G.

    1990-01-01

    The distribution of ribosomal DNA (rDNA) in the nucleoli of human lymphocytes was revealed by in situ hybridization with a nonautoradiographic procedure at the electron microscopic level. rDNA is located in the dense fibrillar component of the nucleolus but not in the fibrillar centers. In the same cells the incorporation of tritiated uridine takes place in the dense fibrillar component of the nucleolus as seen by autoradiography followed by gold latensification. From these findings it can be concluded that the transcription of ribosomal DNA takes place in the dense fibrillar component of the nucleolus

  7. Do we treat our patients or rather periodontal microbes with adjunctive antibiotics in periodontal therapy? A 16S rDNA microbial community analysis.

    Science.gov (United States)

    Hagenfeld, Daniel; Koch, Raphael; Jünemann, Sebastian; Prior, Karola; Harks, Inga; Eickholz, Peter; Hoffmann, Thomas; Kim, Ti-Sun; Kocher, Thomas; Meyle, Jörg; Kaner, Doğan; Schlagenhauf, Ulrich; Ehmke, Benjamin; Harmsen, Dag

    2018-01-01

    Empiric antibiotics are often used in combination with mechanical debridement to treat patients suffering from periodontitis and to eliminate disease-associated pathogens. Until now, only a few next generation sequencing 16S rDNA amplicon based publications with rather small sample sizes studied the effect of those interventions on the subgingival microbiome. Therefore, we studied subgingival samples of 89 patients with chronic periodontitis (solely non-smokers) before and two months after therapy. Forty-seven patients received mechanical periodontal therapy only, whereas 42 patients additionally received oral administered amoxicillin plus metronidazole (500 and 400 mg, respectively; 3x/day for 7 days). Samples were sequenced with Illumina MiSeq 300 base pairs paired end technology (V3 and V4 hypervariable regions of the 16S rDNA). Inter-group differences before and after therapy of clinical variables (percentage of sites with pocket depth ≥ 5mm, percentage of sites with bleeding on probing) and microbiome variables (diversity, richness, evenness, and dissimilarity) were calculated, a principal coordinate analysis (PCoA) was conducted, and differential abundance of agglomerated ribosomal sequence variants (aRSVs) classified on genus level was calculated using a negative binomial regression model. We found statistically noticeable decreased richness, and increased dissimilarity in the antibiotic, but not in the placebo group after therapy. The PCoA revealed a clear compositional separation of microbiomes after therapy in the antibiotic group, which could not be seen in the group receiving mechanical therapy only. This difference was even more pronounced on aRSV level. Here, adjunctive antibiotics were able to induce a microbiome shift by statistically noticeably reducing aRSVs belonging to genera containing disease-associated species, e.g., Porphyromonas, Tannerella, Treponema, and Aggregatibacter, and by noticeably increasing genera containing health

  8. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    Science.gov (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.

  9. How conserved are the bacterial communities associated with aphids? A detailed assessment of the Brevicoryne brassicae (Hemiptera: Aphididae) using 16S rDNA.

    Science.gov (United States)

    Clark, E L; Daniell, T J; Wishart, J; Hubbard, S F; Karley, A J

    2012-12-01

    Aphids harbor a community of bacteria that include obligate and facultative endosymbionts belonging to the Enterobacteriaceae along with opportunistic, commensal, or pathogenic bacteria. This study represents the first detailed analysis of the identity and diversity of the bacterial community associated with the cabbage aphid, Brevicoryne brassicae (L.). 16S rDNA sequence analysis revealed that the community of bacteria associated with B. brassicae was diverse, with at least four different bacterial community types detected among aphid lines, collected from widely dispersed sites in Northern Britain. The bacterial sequence types isolated from B. brassicae showed little similarity to any bacterial endosymbionts characterized in insects; instead, they were closely related to free-living extracellular bacterial species that have been isolated from the aphid gut or that are known to be present in the environment, suggesting that they are opportunistic bacteria transmitted between the aphid gut and the environment. To quantify variation in bacterial community between aphid lines, which was driven largely by differences in the proportions of two dominant bacterial orders, the Pseudomonales and the Enterobacteriales, we developed a novel real-time (Taqman) qPCR assay. By improving our knowledge of aphid microbial ecology, and providing novel molecular tools to examine the presence and function of the microbial community, this study forms the basis of further research to explore the influence of the extracellular bacterial community on aphid fitness, pest status, and susceptibility to control by natural enemies.

  10. Can abundance of protists be inferred from sequence data: a case study of foraminifera.

    Directory of Open Access Journals (Sweden)

    Alexandra A-T Weber

    Full Text Available Protists are key players in microbial communities, yet our understanding of their role in ecosystem functioning is seriously impeded by difficulties in identification of protistan species and their quantification. Current microscopy-based methods used for determining the abundance of protists are tedious and often show a low taxonomic resolution. Recent development of next-generation sequencing technologies offered a very powerful tool for studying the richness of protistan communities. Still, the relationship between abundance of species and number of sequences remains subjected to various technical and biological biases. Here, we test the impact of some of these biological biases on sequence abundance of SSU rRNA gene in foraminifera. First, we quantified the rDNA copy number and rRNA expression level of three species of foraminifera by qPCR. Then, we prepared five mock communities with these species, two in equal proportions and three with one species ten times more abundant. The libraries of rDNA and cDNA of the mock communities were constructed, Sanger sequenced and the sequence abundance was calculated. The initial species proportions were compared to the raw sequence proportions as well as to the sequence abundance normalized by rDNA copy number and rRNA expression level per species. Our results showed that without normalization, all sequence data differed significantly from the initial proportions. After normalization, the congruence between the number of sequences and number of specimens was much better. We conclude that without normalization, species abundance determination based on sequence data was not possible because of the effect of biological biases. Nevertheless, by taking into account the variation of rDNA copy number and rRNA expression level we were able to infer species abundance, suggesting that our approach can be successful in controlled conditions.

  11. Gyrodiniellum shiwhaense n. gen., n. sp., a new planktonic heterotrophic dinoflagellate from the coastal waters of western Korea: morphology and ribosomal DNA gene sequence.

    Science.gov (United States)

    Kang, Nam Seon; Jeong, Hae Jin; Moestrup, Ojvind; Park, Tae Gyu

    2011-01-01

    The heterotrophic dinoflagellate Gyrodiniellum shiwhaense n. gen., n. sp. is described from live cells and from cells prepared for light, scanning electron, and transmission electron microscopy. Also, sequences of the small subunit (SSU) and large subunit (LSU) of rDNA have been analyzed. The episome is conical, while the hyposome is ellipsoid. Cells are covered with polygonal amphiesmal vesicles arranged in 16 horizontal rows. Unlike other Gyrodinium-like dinoflagellates, the apical end of the cell shows a loop-shaped row of five elongate amphiesmal vesicles. The cingulum is displaced by 0.3-0.5 × cell length. Cells that were feeding on the dinoflagellate Amphidinium carterae Hulburt were 9.1-21.6 μm long and 6.6-15.7 μm wide. Cells of G. shiwhaense contain nematocysts, trichocysts, a peduncle, and pusule systems, but they lack chloroplasts. The SSU rDNA sequence is >3% different from that of the six most closely related species: Warnowia sp. (FJ947040), Lepidodinium viride Watanabe, Suda, Inouye, Sawaguchi & Chihara, Gymnodinium aureolum (Hulburt) Hansen, Gymnodinium catenatum Graham, Nematodinium sp. (FJ947039), and Gymnodinium sp. MUCC284 (AF022196), while the LSU rDNA is 11-12% different from that of Warnowia sp., G. aureolum, and Nematodinium sp. (FJ947041). The phylogenetic trees show that the species belongs in the Gymnodinium sensu stricto clade. However, in contrast to Gymnodinium spp., cells lack nuclear envelope chambers and a nuclear fibrous connective. Unlike Polykrikos spp., cells of which possess a taeniocyst-nematocyst complex, G. shiwhaense has nematocysts but lacks taeniocysts. It differs from Paragymnodinium shiwhaense Kang, Jeong, Moestrup & Shin by possessing nematocysts with stylets and filaments. Gyrodiniellum shiwhaense n. gen., n. sp. furthermore lacks ocelloids, in contrast to Warnowia spp., Nematodinium spp., and Proterythropsis spp. Based on morphological and molecular data, we suggest that the taxon represents a new species within a

  12. Employing 454 amplicon pyrosequencing to reveal intragenomic divergence in the internal transcribed spacer rDNA region in fungi

    Science.gov (United States)

    Daniel L. Lindner; Tor Carlsen; Henrik Nilsson; Marie Davey; Trond Schumacher; Havard. Kauserud

    2013-01-01

    The rDNA internal transcribed spacer (ITS) region has been accepted as a DNA barcoding marker for fungi and is widely used in phylogenetic studies; however, intragenomic ITS variability has been observed in a broad range of taxa, including prokaryotes, plants, animals, and fungi, and this variability has the potential to inflate species richness estimates in molecular...

  13. Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

    Czech Academy of Sciences Publication Activity Database

    Muchová, V.; Amiard, S.; Mozgová, I.; Dvořáčková, Martina; Gallego, M.E.; White, C.; Fajkus, Jiří

    2015-01-01

    Roč. 81, č. 2 (2015), s. 198-209 ISSN 0960-7412 R&D Projects: GA ČR(CZ) GP13-11563P Institutional support: RVO:68081707 Keywords : DNA repair * genome instability * 45S rDNA Subject RIV: BO - Biophysics Impact factor: 5.468, year: 2015

  14. The nucleolus: a raft adrift in the nuclear sea or the keystone in nuclear structure?

    Science.gov (United States)

    O'Sullivan, Justin M; Pai, Dave A; Cridge, Andrew G; Engelke, David R; Ganley, Austen R D

    2013-06-01

    The nucleolus is a prominent nuclear structure that is the site of ribosomal RNA (rRNA) transcription, and hence ribosome biogenesis. Cellular demand for ribosomes, and hence rRNA, is tightly linked to cell growth and the rRNA makes up the majority of all the RNA within a cell. To fulfill the cellular demand for rRNA, the ribosomal RNA (rDNA) genes are amplified to high copy number and transcribed at very high rates. As such, understanding the rDNA has profound consequences for our comprehension of genome and transcriptional organization in cells. In this review, we address the question of whether the nucleolus is a raft adrift the sea of nuclear DNA, or actively contributes to genome organization. We present evidence supporting the idea that the nucleolus, and the rDNA contained therein, play more roles in the biology of the cell than simply ribosome biogenesis. We propose that the nucleolus and the rDNA are central factors in the spatial organization of the genome, and that rapid alterations in nucleolar structure in response to changing conditions manifest themselves in altered genomic structures that have functional consequences. Finally, we discuss some predictions that result from the nucleolus having a central role in nuclear organization.

  15. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    International Nuclear Information System (INIS)

    Tao Weitao; Budd, Martin; Campbell, Judith L.

    2003-01-01

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1Δ double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1Δ alone. However, surprisingly, the dna2-2 sgs1Δ lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1Δ lethality is only partially suppressed by deletion of rad51Δ. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones

  16. Evidence that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA stability

    Energy Technology Data Exchange (ETDEWEB)

    Tao Weitao; Budd, Martin; Campbell, Judith L

    2003-11-27

    We and others have proposed that faulty processing of arrested replication forks leads to increases in recombination and chromosome instability in Saccharomyces cerevisiae. Now we use the ribosomal DNA locus, which is a good model for all stages of DNA replication, to test this hypothesis. We showed previously that DNA replication pausing at the ribosomal DNA replication fork barrier (RFB) is accompanied by the occurrence of double-strand breaks near the RFB. Both pausing and breakage are elevated in the hypomorphic dna2-2 helicase mutant. Deletion of FOB1 suppresses the elevated pausing and DSB formation. Our current work shows that mutation inactivating Sgs1, the yeast RecQ helicase ortholog, also causes accumulation of stalled replication forks and DSBs at the rDNA RFB. Either deletion of FOB1, which suppresses fork blocking and certain types of rDNA recombination, or an increase in SIR2 gene dosage, which suppresses rDNA recombination, reduces the number of forks persisting at the RFB. Although dna2-2 sgs1{delta} double mutants are conditionally lethal, they do not show enhanced rDNA defects compared to sgs1{delta} alone. However, surprisingly, the dna2-2 sgs1{delta} lethality is suppressed by deletion of FOB1. On the other hand, the dna2-2 sgs1{delta} lethality is only partially suppressed by deletion of rad51{delta}. We propose that the replication-associated defects that we document in the rDNA are characteristic of similar events occurring either stochastically throughout the genome or at other regions where replication forks move slowly or stall, such as telomeres, centromeres, or replication slow zones.

  17. Internal event analysis for Laguna Verde Unit 1 Nuclear Power Plant. Accident sequence quantification and results; Analisis de eventos internos para la Unidad 1 de la Central Nucleoelectrica de Laguna Verde. Cuantificacion de secuencias de accidente y resultados

    Energy Technology Data Exchange (ETDEWEB)

    Huerta B, A; Aguilar T, O; Nunez C, A; Lopez M, R [Comision Nacional de Seguridad Nuclear y Salvaguardias, 03000 Mexico D.F. (Mexico)

    1994-07-01

    The Level 1 results of Laguna Verde Nuclear Power Plant PRA are presented in the {sup I}nternal Event Analysis for Laguna Verde Unit 1 Nuclear Power Plant, CNSNS-TR 004, in five volumes. The reports are organized as follows: CNSNS-TR 004 Volume 1: Introduction and Methodology. CNSNS-TR4 Volume 2: Initiating Event and Accident Sequences. CNSNS-TR 004 Volume 3: System Analysis. CNSNS-TR 004 Volume 4: Accident Sequence Quantification and Results. CNSNS-TR 005 Volume 5: Appendices A, B and C. This volume presents the development of the dependent failure analysis, the treatment of the support system dependencies, the identification of the shared-components dependencies, and the treatment of the common cause failure. It is also presented the identification of the main human actions considered along with the possible recovery actions included. The development of the data base and the assumptions and limitations in the data base are also described in this volume. The accident sequences quantification process and the resolution of the core vulnerable sequences are presented. In this volume, the source and treatment of uncertainties associated with failure rates, component unavailabilities, initiating event frequencies, and human error probabilities are also presented. Finally, the main results and conclusions for the Internal Event Analysis for Laguna Verde Nuclear Power Plant are presented. The total core damage frequency calculated is 9.03x 10-5 per year for internal events. The most dominant accident sequences found are the transients involving the loss of offsite power, the station blackout accidents, and the anticipated transients without SCRAM (ATWS). (Author)

  18. Ribosomal DNA sequence heterogeneity reflects intraspecies phylogenies and predicts genome structure in two contrasting yeast species.

    Science.gov (United States)

    West, Claire; James, Stephen A; Davey, Robert P; Dicks, Jo; Roberts, Ian N

    2014-07-01

    The ribosomal RNA encapsulates a wealth of evolutionary information, including genetic variation that can be used to discriminate between organisms at a wide range of taxonomic levels. For example, the prokaryotic 16S rDNA sequence is very widely used both in phylogenetic studies and as a marker in metagenomic surveys and the internal transcribed spacer region, frequently used in plant phylogenetics, is now recognized as a fungal DNA barcode. However, this widespread use does not escape criticism, principally due to issues such as difficulties in classification of paralogous versus orthologous rDNA units and intragenomic variation, both of which may be significant barriers to accurate phylogenetic inference. We recently analyzed data sets from the Saccharomyces Genome Resequencing Project, characterizing rDNA sequence variation within multiple strains of the baker's yeast Saccharomyces cerevisiae and its nearest wild relative Saccharomyces paradoxus in unprecedented detail. Notably, both species possess single locus rDNA systems. Here, we use these new variation datasets to assess whether a more detailed characterization of the rDNA locus can alleviate the second of these phylogenetic issues, sequence heterogeneity, while controlling for the first. We demonstrate that a strong phylogenetic signal exists within both datasets and illustrate how they can be used, with existing methodology, to estimate intraspecies phylogenies of yeast strains consistent with those derived from whole-genome approaches. We also describe the use of partial Single Nucleotide Polymorphisms, a type of sequence variation found only in repetitive genomic regions, in identifying key evolutionary features such as genome hybridization events and show their consistency with whole-genome Structure analyses. We conclude that our approach can transform rDNA sequence heterogeneity from a problem to a useful source of evolutionary information, enabling the estimation of highly accurate phylogenies of

  19. Tissue-selective effects of nucleolar stress and rDNA damage in developmental disorders.

    Science.gov (United States)

    Calo, Eliezer; Gu, Bo; Bowen, Margot E; Aryan, Fardin; Zalc, Antoine; Liang, Jialiang; Flynn, Ryan A; Swigut, Tomek; Chang, Howard Y; Attardi, Laura D; Wysocka, Joanna

    2018-02-01

    Many craniofacial disorders are caused by heterozygous mutations in general regulators of housekeeping cellular functions such as transcription or ribosome biogenesis. Although it is understood that many of these malformations are a consequence of defects in cranial neural crest cells, a cell type that gives rise to most of the facial structures during embryogenesis, the mechanism underlying cell-type selectivity of these defects remains largely unknown. By exploring molecular functions of DDX21, a DEAD-box RNA helicase involved in control of both RNA polymerase (Pol) I- and II-dependent transcriptional arms of ribosome biogenesis, we uncovered a previously unappreciated mechanism linking nucleolar dysfunction, ribosomal DNA (rDNA) damage, and craniofacial malformations. Here we demonstrate that genetic perturbations associated with Treacher Collins syndrome, a craniofacial disorder caused by heterozygous mutations in components of the Pol I transcriptional machinery or its cofactor TCOF1 (ref. 1), lead to relocalization of DDX21 from the nucleolus to the nucleoplasm, its loss from the chromatin targets, as well as inhibition of rRNA processing and downregulation of ribosomal protein gene transcription. These effects are cell-type-selective, cell-autonomous, and involve activation of p53 tumour-suppressor protein. We further show that cranial neural crest cells are sensitized to p53-mediated apoptosis, but blocking DDX21 loss from the nucleolus and chromatin rescues both the susceptibility to apoptosis and the craniofacial phenotypes associated with Treacher Collins syndrome. This mechanism is not restricted to cranial neural crest cells, as blood formation is also hypersensitive to loss of DDX21 functions. Accordingly, ribosomal gene perturbations associated with Diamond-Blackfan anaemia disrupt DDX21 localization. At the molecular level, we demonstrate that impaired rRNA synthesis elicits a DNA damage response, and that rDNA damage results in tissue-selective and

  20. Karyotypes, heterochromatin, and physical mapping of 18S-26S rDNA in Cactaceae.

    Science.gov (United States)

    Las Peñas, M L; Urdampilleta, J D; Bernardello, G; Forni-Martins, E R

    2009-01-01

    Karyotype analyses in members of the four Cactaceae subfamilies were performed. Numbers and karyotype formula obtained were: Pereskioideae = Pereskiaaculeata(2n = 22; 10 m + 1 sm), Maihuenioideae = Maihuenia patagonica (2n = 22, 9 m + 2 sm; 2n = 44, 18 m + 4 sm), Opuntioideae = Cumulopuntia recurvata(2n = 44; 20 m + 2 sm), Cactoideae = Acanthocalycium spiniflorum (2n = 22; 10 m + 1 sm),Echinopsis tubiflora (2n = 22; 10 m + 1 sm), Trichocereus candicans (2n = 22, 22 m). Chromosomes were small, the average chromosome length was 2.3 mum. Diploid species and the tetraploid C. recurvata had one terminal satellite, whereas the remaining tetraploid species showed four satellited chromosomes. Karyotypes were symmetrical. No CMA(-)/DAPI(+) bands were detected, but CMA(+)/DAPI(-) bands associated with NOR were always found. Pericentromeric heterochromatin was found in C. recurvata, A. spiniflorum, and the tetraploid cytotype of M. patagonica. The locations of the 18S-26S rDNA sites in all species coincided with CMA(+)/DAPI(-) bands; the same occurred with the sizes and numbers of signals for each species. This technique was applied for the first time in metaphase chromosomes in cacti. NOR-bearing pair no.1 may be homeologous in all species examined. In Cactaceae, the 18S-26S loci seem to be highly conserved. Copyright 2009 S. Karger AG, Basel.

  1. Conserved Organisation of 45S rDNA Sites and rDNA Gene Copy Number among Major Clades of Early Land Plants

    Czech Academy of Sciences Publication Activity Database

    Rosato, M.; Kovařík, Aleš; Garilleti, R.; Rosselló, J. A.

    2016-01-01

    Roč. 11, č. 9 (2016), č. článku e0162544. E-ISSN 1932-6203 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:68081707 Keywords : molecular cytogenetic analyses * nuclear ribosomal dna Subject RIV: BO - Biophysics Impact factor: 2.806, year: 2016

  2. Ichthyophonus parasite phylogeny based on ITS rDNA structure prediction and alignment identifies six clades, with a single dominant marine type

    Science.gov (United States)

    Gregg, Jacob; Thompson, Rachel L.; Purcell, Maureen; Friedman, Carolyn S.; Hershberger, Paul

    2016-01-01

    Despite their widespread, global impact in both wild and cultured fishes, little is known of the diversity, transmission patterns, and phylogeography of parasites generally identified as Ichthyophonus. This study constructed a phylogeny based on the structural alignment of internal transcribed spacer (ITS) rDNA sequences to compare Ichthyophonus isolates from fish hosts in the Atlantic and Pacific oceans, and several rivers and aquaculture sites in North America, Europe, and Japan. Structure of the Ichthyophonus ITS1–5.8S–ITS2 transcript exhibited several homologies with other eukaryotes, and 6 distinct clades were identified within Ichthyophonus. A single clade contained a majority (71 of 98) of parasite isolations. This ubiquitous Ichthyophonus type occurred in 13 marine and anadromous hosts and was associated with epizootics in Atlantic herring, Chinook salmon, and American shad. A second clade contained all isolates from aquaculture, despite great geographic separation of the freshwater hosts. Each of the 4 remaining clades contained isolates from single host species. This study is the first to evaluate the genetic relationships among Ichthyophonus species across a significant portion of their host and geographic range. Additionally, parasite infection prevalence is reported in 16 fish species.

  3. Ichthyophonus parasite phylogeny based on ITS rDNA structure prediction and alignment identifies six clades, with a single dominant marine type.

    Science.gov (United States)

    Gregg, Jacob L; Powers, Rachel L; Purcell, Maureen K; Friedman, Carolyn S; Hershberger, Paul K

    2016-07-07

    Despite their widespread, global impact in both wild and cultured fishes, little is known of the diversity, transmission patterns, and phylogeography of parasites generally identified as Ichthyophonus. This study constructed a phylogeny based on the structural alignment of internal transcribed spacer (ITS) rDNA sequences to compare Ichthyophonus isolates from fish hosts in the Atlantic and Pacific oceans, and several rivers and aquaculture sites in North America, Europe, and Japan. Structure of the Ichthyophonus ITS1-5.8S-ITS2 transcript exhibited several homologies with other eukaryotes, and 6 distinct clades were identified within Ichthyophonus. A single clade contained a majority (71 of 98) of parasite isolations. This ubiquitous Ichthyophonus type occurred in 13 marine and anadromous hosts and was associated with epizootics in Atlantic herring, Chinook salmon, and American shad. A second clade contained all isolates from aquaculture, despite great geographic separation of the freshwater hosts. Each of the 4 remaining clades contained isolates from single host species. This study is the first to evaluate the genetic relationships among Ichthyophonus species across a significant portion of their host and geographic range. Additionally, parasite infection prevalence is reported in 16 fish species.

  4. Biodiversity and molecular ecology of Russula and Lactarius in Alaska based on soil and sporocarp DNA sequences

    Science.gov (United States)

    Geml J.; D.L. Taylor

    2013-01-01

    Although critical for the functioning of ecosystems, fungi are poorly known in highlatitude regions. This paper summarizes the results of the first genetic diversity assessments of Russula and Lactarius, two of the most diverse and abundant fungal genera in Alaska. SU rDNA sequences from both curated sporocarp collections and soil PCR clone libraries sampled in...

  5. Unexpected Diagnosis of Cerebral Toxoplasmosis by 16S and D2 Large-Subunit Ribosomal DNA PCR and Sequencing

    DEFF Research Database (Denmark)

    Kruse, Alexandra Yasmin Collin; Kvich, Lasse Andersson; Eickhardt-Dalbøge, Steffen Robert

    2015-01-01

    The protozoan parasite Toxoplasma gondii causes severe opportunistic infections. Here, we report an unexpected diagnosis of cerebral toxoplasmosis. T. gondii was diagnosed by 16S and D2 large-subunit (LSU) ribosomal DNA (rDNA) sequencing of a cerebral biopsy specimen and confirmed by T. gondii...

  6. Whole genome sequencing and assembly of Eukaryotic microbes isolated from ISS environmental surface Kirovograd region soil Chernobyl Nuclear Power Plant and Chernobyl Exclusion Zone

    Data.gov (United States)

    National Aeronautics and Space Administration — The whole-genome sequences of eight fungal strains that were selected for exposure to microgravity at the International Space Station are presented here. These...

  7. Variation in the number of nucleoli and incomplete homogenization of 18S ribosomal DNA sequences in leaf cells of the cultivated Oriental ginseng (Panax ginseng Meyer).

    Science.gov (United States)

    Chelomina, Galina N; Rozhkovan, Konstantin V; Voronova, Anastasia N; Burundukova, Olga L; Muzarok, Tamara I; Zhuravlev, Yuri N

    2016-04-01

    Wild ginseng, Panax ginseng Meyer, is an endangered species of medicinal plants. In the present study, we analyzed variations within the ribosomal DNA (rDNA) cluster to gain insight into the genetic diversity of the Oriental ginseng, P. ginseng, at artificial plant cultivation. The roots of wild P. ginseng plants were sampled from a nonprotected natural population of the Russian Far East. The slides were prepared from leaf tissues using the squash technique for cytogenetic analysis. The 18S rDNA sequences were cloned and sequenced. The distribution of nucleotide diversity, recombination events, and interspecific phylogenies for the total 18S rDNA sequence data set was also examined. In mesophyll cells, mononucleolar nuclei were estimated to be dominant (75.7%), while the remaining nuclei contained two to four nucleoli. Among the analyzed 18S rDNA clones, 20% were identical to the 18S rDNA sequence of P. ginseng from Japan, and other clones differed in one to six substitutions. The nucleotide polymorphism was more expressed at the positions 440-640 bp, and distributed in variable regions, expansion segments, and conservative elements of core structure. The phylogenetic analysis confirmed conspecificity of ginseng plants cultivated in different regions, with two fixed mutations between P. ginseng and other species. This study identified the evidences of the intragenomic nucleotide polymorphism in the 18S rDNA sequences of P. ginseng. These data suggest that, in cultivated plants, the observed genome instability may influence the synthesis of biologically active compounds, which are widely used in traditional medicine.

  8. (reprocessed)HeliscopeCAGE sequencing, Delve mapping and CAGE TSS aggregation - FANTOM5 | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available switchLanguage; BLAST Search Image Search Home About Archive Update History Data List Contact us FANTOM...ntified by CAGE tag analysis (BED format) *.rdna.fa.gz: rDNA sequences (FASTA format) Data file File name: fantom...5_rp_exp_details.zip File URL: ftp://ftp.biosciencedbc.jp/archive/fantom5/20161221/fantom5_rp_exp_detai...tp://ftp.biosciencedbc.jp/archive/fantom5/datafiles/reprocessed/hg38_latest/basic/ File size: 1.4 TB File na...me: (reprocessed)basic (Mus musculus) File URL: ftp://ftp.biosciencedbc.jp/archive/fantom5/datafiles/reproce

  9. Probabilistic studies of accident sequences

    International Nuclear Information System (INIS)

    Villemeur, A.; Berger, J.P.

    1986-01-01

    For several years, Electricite de France has carried out probabilistic assessment of accident sequences for nuclear power plants. In the framework of this program many methods were developed. As the interest in these studies was increasing and as adapted methods were developed, Electricite de France has undertaken a probabilistic safety assessment of a nuclear power plant [fr

  10. Concatenated SSU and LSU rDNA data confirm the main evolutionary trends within myxosporeans (Myxozoa: Myxosporea) and provide effective tool for their molecular phylogenetics

    Czech Academy of Sciences Publication Activity Database

    Bartošová, Pavla; Fiala, Ivan; Hypša, Václav

    2009-01-01

    Roč. 53, č. 1 (2009), s. 81-93 ISSN 1055-7903 R&D Projects: GA AV ČR KJB600960701; GA MŠk LC522 Institutional research plan: CEZ:AV0Z60220518 Keywords : myxosporea * phylogeny * LBA * LSU rDNA * 28S * SSU rDNA * 18S * D domains Subject RIV: EG - Zoology Impact factor: 3.556, year: 2009

  11. Acute Smc5/6 depletion reveals its primary role in rDNA replication by restraining recombination at fork pausing sites.

    Directory of Open Access Journals (Sweden)

    Xiao P Peng

    2018-01-01

    Full Text Available Smc5/6, a member of the conserved SMC family of complexes, is essential for growth in most organisms. Its exact functions in a mitotic cell cycle are controversial, as chronic Smc5/6 loss-of-function alleles produce varying phenotypes. To circumvent this issue, we acutely depleted Smc5/6 in budding yeast and determined the first cell cycle consequences of Smc5/6 removal. We found a striking primary defect in replication of the ribosomal DNA (rDNA array. Each rDNA repeat contains a programmed replication fork barrier (RFB established by the Fob1 protein. Fob1 removal improves rDNA replication in Smc5/6 depleted cells, implicating Smc5/6 in the management of programmed fork pausing. A similar improvement is achieved by removing the DNA helicase Mph1 whose recombinogenic activity can be inhibited by Smc5/6 under DNA damage conditions. DNA 2D gel analyses further show that Smc5/6 loss increases recombination structures at RFB regions; moreover, mph1∆ and fob1∆ similarly reduce this accumulation. These findings point to an important mitotic role for Smc5/6 in restraining recombination events when protein barriers in rDNA stall replication forks. As rDNA maintenance influences multiple essential cellular processes, Smc5/6 likely links rDNA stability to overall mitotic growth.

  12. Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

    Science.gov (United States)

    Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

    2016-01-01

    Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

  13. Sequence assembly

    DEFF Research Database (Denmark)

    Scheibye-Alsing, Karsten; Hoffmann, S.; Frankel, Annett Maria

    2009-01-01

    Despite the rapidly increasing number of sequenced and re-sequenced genomes, many issues regarding the computational assembly of large-scale sequencing data have remain unresolved. Computational assembly is crucial in large genome projects as well for the evolving high-throughput technologies and...... in genomic DNA, highly expressed genes and alternative transcripts in EST sequences. We summarize existing comparisons of different assemblers and provide a detailed descriptions and directions for download of assembly programs at: http://genome.ku.dk/resources/assembly/methods.html....

  14. Genome Sequencing

    DEFF Research Database (Denmark)

    Sato, Shusei; Andersen, Stig Uggerhøj

    2014-01-01

    The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based on transcr......The current Lotus japonicus reference genome sequence is based on a hybrid assembly of Sanger TAC/BAC, Sanger shotgun and Illumina shotgun sequencing data generated from the Miyakojima-MG20 accession. It covers nearly all expressed L. japonicus genes and has been annotated mainly based...

  15. Chromosome mapping of repetitive sequences in four Serrasalmidae species (Characiformes

    Directory of Open Access Journals (Sweden)

    Leila Braga Ribeiro

    2014-01-01

    Full Text Available The Serrasalmidae family is composed of a number of commercially interesting species, mainly in the Amazon region where most of these fishes occur. In the present study, we investigated the genomic organization of the 18S and 5S rDNA and telomeric sequences in mitotic chromosomes of four species from the basal clade of the Serrasalmidae family: Colossoma macropomum, Mylossoma aureum, M. duriventre, and Piaractus mesopotamicus, in order to understand the chromosomal evolution in the family. All the species studied had diploid numbers 2n = 54 and exclusively biarmed chromosomes, but variations of the karyotypic formulas were observed. C-banding resulted in similar patterns among the analyzed species, with heterochromatic blocks mainly present in centromeric regions. The 18S rDNA mapping of C. macropomum and P. mesopotamicus revealed multiple sites of this gene; 5S rDNA sites were detected in two chromosome pairs in all species, although not all of them were homeologs. Hybridization with a telomeric probe revealed signals in the terminal portions of chromosomes in all the species and an interstitial signal was observed in one pair of C. macropomum.

  16. Male meiosis, heterochromatin characterization and chromosomal location of rDNA in Microtomus lunifer (Berg, 1900 (Hemiptera: Reduviidae: Hammacerinae

    Directory of Open Access Journals (Sweden)

    María Poggio

    2011-05-01

    Full Text Available In the present work, we analysed the male meiosis, the content and distribution of heterochromatin and the number and location of nucleolus organizing regions in Microtomus lunifer (Berg, 1900 by means of standard technique, C- and fluorescent bandings, and fluorescent in situ hybridization with an 18S rDNA probe. This species is the second one cytogenetically analysed within the Hammacerinae. Its male diploid chromosome number is 31 (2n=28+X1X2Y, including a minute pair of m-chromosomes. The diploid autosomal number and the presence of m-chromosomes are similar to those reported in M. conspicillaris (Drury, 1782 (2n=28+XY. However, M. lunifer has a multiple sex chromosome system X1X2Y (male that could have originated by fragmentation of the ancestral X chromosome. Taking into account that M. conspicillaris and M. lunifer are the only two species within Reduviidae that possess m-chromosomes, the presence of this pair could be a synapomorphy for the species of this genus. C- and fluorescent bandings showed that the amount of heterochromatin in M. lunifer was small, and only a small CMA3 bright band was observed in the largest autosomal pair at one terminal region. FISH with the 18S rDNA probe demonstrated that ribosomal genes were terminally placed on the largest autosomal pair. Our present results led us to propose that the location of rDNA genes could be associated with variants  of the sex chromosome systems in relation with a kind of the sex chromosome systems within this family. Furthermore, the terminal location of NOR in the largest autosomal pair allowed us to use it as a chromosome marker and, thus, to infer that the kinetic activity of both ends is not a random process, and there is an inversion of this activity.

  17. Molecular Characterization of Fasciola Samples Using Sequences of Second Internal Transcribed Spacer-rDNA in Different Geographical Localities of Sistan and Balouchestan Province, Iran

    Directory of Open Access Journals (Sweden)

    Mahsa Shahbakhsh

    2016-02-01

    Full Text Available Background: The Fasciola trematodes are the most common liver flukes, living in a range of animals with global distribution and resulting in profound economic loss and public health challenges. Previous studies have indicated that the sequences of the second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA provide reliable genetic markers for molecular systemic studies of Fasciola. Objectives: The objective of the present study was to characterize Fasciola samples from different geographical regions of Sistan and Balouchestan province using sequences of second internal transcribed spacer (ITS-2 of ribosomal DNA (rDNA. Materials and Methods: Twenty adult trematodes were collected from the livers of slaughtered infected cattle. Total genomic DNA was extracted and ITS-2 rDNA targets were amplified by polymerase chain reaction (PCR. All samples were sequenced and investigated using the ClustalW2 sequence alignment tool and MEGA software. The sequences of some Iranian and non-Iranian isolates were used for comparison, in order to evaluate the variation in sequence homology between geographically different trematode populations. Results: The results of comparing the ITS-2 sequences with the BLAST GenBank database showed one type of sequence for F. hepatica and three different types of sequences for F. gigantica in the specimens. Conclusions: The present study demonstrated that Fasciola samples from cattle in two geographical locations in Sistan and Balouchestan province represented no genetic diversity in F. hepatica and high genetic variation in F. gigantica.

  18. Determination of Molecular Genotyping of Ureaplasma SPP in Women with Genital Infections by 16S–23S rDNA PCR-RFLP Method

    Directory of Open Access Journals (Sweden)

    R. Mirnejad

    2011-04-01

    Full Text Available Introduction & Objective: So far, despite the wide range of methods such as analytic methods used for differentiation of Mycoplasma, the diagnosis of Mycoplasma species is still difficult. Generally the low-level discriminatory power of serological methods because of the rapid changes in size and phase of the dominant antigens in the immune cell surface of Mycoplasmas greatly limits their applicability to the typing of Mycoplasmas. On the contrary,molecular methods do not suffer from these drawbacks and can be used for typing of Mycoplasmas. The aim of this investigation was molecular identification and genotyping of ureaplasma SPP in women with genital infections by 16S–23S rDNA PCR-RFLP.Materials & Methods: Genital swabs were taken from 210 patients who referred to gynecology clinic of Rasool hospital in Tehran, Iran during December 2007 until June 2008. The swabs suspended in PBS, were immediately transferred to laboratory .Following DNA extraction, PCR assay was performed using a genus specific primer pair. These primer sets amplified a 559 bp fragment for Ureaplasma Spp. Samples containing bands of the expected size for Ureaplasma strains were subjected to digestion with different restriction endonuclease enzymes (AluI, Taq I, CacI8, BbsI, EcoRI. Results: Of the 210 samples, Ureaplasma Spp was isolated from 93 patients (44.3% by PCR and 69 samples by culture. In the present study only Biovar 1 (Ureaplasma parvum was isolated from clinical specimens and the results were confirmed using a cutting enzyme TaqI (enzyme specific species of ureaplasma SPP. The results of this analysis using PCR-RFLP and sequencing showed that all had the same genotype and shared identical sequence with the genome sequence of serovar 3 Ureaplasma parvum.Conclusion: Ureaplasma parvum is generally isolated from the genital samples. In this study all isolates were identical and no difference was found among the enzyme patterns of the bacteria after PCR-RFLP .So

  19. MALDI-TOF MS performance compared to direct examination, culture, and 16S rDNA PCR for the rapid diagnosis of bone and joint infections.

    Science.gov (United States)

    Lallemand, E; Coiffier, G; Arvieux, C; Brillet, E; Guggenbuhl, P; Jolivet-Gougeon, A

    2016-05-01

    The rapid identification of bacterial species involved in bone and joint infections (BJI) is an important element to optimize the diagnosis and care of patients. The aim of this study was to evaluate the usefulness of matrix-assisted laser desorption ionization mass spectrometry (MALDI-TOF MS) for the rapid diagnosis of bone infections, directly on synovial fluid (SF) or on crushed osteoarticular samples (CS). From January to October 2013, we prospectively analyzed 111 osteoarticular samples (bone and joint samples, BJS) from 78 patients in care at the University Hospital of Rennes, France. The diagnosis procedure leading to the sample collection was linked to a suspicion of infection, inflammatory disease, arthritis, or for any bone or joint abnormalities. Standard bacteriological diagnosis and molecular biology analysis [16S rRNA polymerase chain reaction (PCR) and sequencing] were conducted. In addition, analysis by MALDI-TOF MS was performed directly on the osteoarticular samples, as soon as the amount allowed. Culture, which remains the gold standard for the diagnosis of BJI, has the highest sensitivity (85.9 %) and remains necessary to test antimicrobial susceptibility. The 16S rDNA PCR results were positive in the group with positive BJI (28.6 %) and negative in the group without infection. Direct examination remains insensitive (31.7 %) but more effective than MALDI-TOF MS directly on the sample (6.3 %). The specificity was 100 % in all cases, except for culture (74.5 %). Bacterial culture remains the gold standard, especially enrichment in blood bottles. Direct analysis of bone samples with MALDI-TOF MS is not useful, possibly due to the low inoculum of BJS.

  20. Variabilidade genética na região its do rDNA de isolados de trichoderma spp. (Biocontrolador e Fusarium oxysporum f. sp. Chrysanthemi Genetic variability in rDNA ITS region of Trichoderma spp. (biocontrole agent and Fusarium oxysporum f. sp. chrysanthemi isolates

    Directory of Open Access Journals (Sweden)

    Josiane Pacheco Menezes

    2010-02-01

    Full Text Available A análise de características morfológicas e culturais podem não ser suficientes para uma caracterização precisa das espécies de Trichoderma e Fusarium. Objetivou-se, neste trabalho, caracterizar a região do Espaço Interno Transcrito (ITS do rDNA dos isolados UFSMT15.1, UFSMT16 e UFSMT17 de Trichoderma spp. utilizados no biocontrole de Fusarium oxysporum f. sp. chrysanthemi (isolado UFSMF6. A extração de DNA de cada isolado foi realizada a partir de micélio produzido em meio líquido Batata-Dextrose. As amostras de DNA genômico foram submetidas à Reação em Cadeia da Polimerase (PCR com os oligonucleotídeos iniciadores universais ITS1 e ITS4 e o produto gerado foi sequenciado. Os fragmentos gerados pela amplificação da PCR foram tratados com as enzimas de restrição HaeIII, HinfI e MboI. As regiões ITS1, ITS2 e 5.8S do rDNA desses isolados fúngicos foram amplificadas com sucesso. A região ITS dos isolados UFSMT15.1, UFSMT16 e UFSMT17 de Trichoderma e o isolado UFSMF6 de Fusarium apresentaram uma banda simples com um fragmento de aproximadamente 600 pares de base (pb. As enzimas de restrição HaeIII, HinfI e MboI geraram polimorfismo de bandas entre os isolados. Com base nas análises da sequência de DNA, os isolados UFSMT15.1, UFSMT16, UFSMT17 e UFSMF6 apresentaram maior similaridade com as espécies Trichoderma koningiopsis, Hypocrea virens, Hypocrea lixii e Fusarium oxysporum, respectivamente.The analysis of morphological and cultural characteristics may not enough for the characterization of the species of Trichoderma and Fusarium. The aim of this work was to characterize the Internal Transcribed Spacer (ITS region of the rDNA of UFSMT15.1, UFSMT16 and UFSMT17 isolates of Trichoderma spp. used in the biocontrol of Fusarium oxysporum f. sp. chrysanthemi UFSMF6. DNA extraction of each isolate was accomplished starting from hyphae produced in liquid medium Potato-Dextrose-Agar. The samples of genomic DNA were submitted to

  1. Paralogues of nuclear ribosomal genes conceal phylogenetic signals within the invasive Asian fish tapeworm lineage: evidence from next generation sequencing data

    Czech Academy of Sciences Publication Activity Database

    Brabec, Jan; Kuchta, Roman; Scholz, Tomáš; Littlewood, D. T. J.

    2016-01-01

    Roč. 46, č. 9 (2016), s. 555-562 ISSN 0020-7519 R&D Projects: GA MŠk(CZ) EE2.3.30.0032; GA ČR GA15-14198S Grant - others:GA MŠk(CZ) LM2010005 Institutional support: RVO:60077344 Keywords : Schyzocotyle acheilognathi * Asian fish tapeworm * Bothriocephalus acheilognathi * invasive parasite * mitochondrial genome * ribosomal RNA * illumina sequencing * phylogeny Subject RIV: EG - Zoology Impact factor: 3.730, year: 2016

  2. Deletion of the nuclear localization sequences and C-terminus of PTHrP impairs embryonic mammary development but also inhibits PTHrP production.

    Directory of Open Access Journals (Sweden)

    Kata Boras-Granic

    Full Text Available Parathyroid hormone-related protein (PTHrP can be secreted from cells and interact with its receptor, the Type 1 PTH/PTHrP Receptor (PTHR1 in an autocrine, paracrine or endocrine fashion. PTHrP can also remain inside cells and be transported into the nucleus, where its functions are unclear, although recent experiments suggest that it may broadly regulate cell survival and senescence. Disruption of either the PTHrP or PTHR1 gene results in many abnormalities including a failure of embryonic mammary gland development in mice and in humans. In order to examine the potential functions of nuclear PTHrP in the breast, we examined mammary gland development in PTHrP (1-84 knock-in mice, which express a mutant form of PTHrP that lacks the C-terminus and nuclear localization signals and which can be secreted but cannot enter the nucleus. Interestingly, we found that PTHrP (1-84 knock-in mice had defects in mammary mesenchyme differentiation and mammary duct outgrowth that were nearly identical to those previously described in PTHrP-/- and PTHR1-/- mice. However, the mammary buds in PTHrP (1-84 knock-in mice had severe reductions in mutant PTHrP mRNA levels, suggesting that the developmental defects were due to insufficient production of PTHrP by mammary epithelial cells and not loss of PTHrP nuclear function. Examination of the effects of nuclear PTHrP in the mammary gland in vivo will require the development of alternative animal models.

  3. Phylogenetic and ecological analyses of soil and sporocarp DNA sequences reveal high diversity and strong habitat partitioning in the boreal ectomycorrhizal genus Russula (Russulales; Basidiomycota)

    Science.gov (United States)

    József Geml; Gary A. Laursen; Ian C. Herriott; Jack M. McFarland; Michael G. Booth; Niall Lennon; H. Chad Nusbaum; D. Lee Taylor

    2010-01-01

    Although critical for the functioning of ecosystems, fungi are poorly known in high-latitude regions. Here, we provide the first genetic diversity assessment of one of the most diverse and abundant ectomycorrhizal genera in Alaska: Russula. We analyzed internal transcribed spacer rDNA sequences from sporocarps and soil samples using phylogenetic...

  4. rDNA mapping, heterochromatin characterization and AT/GC content of Agapanthus africanus (L. Hoffmanns (Agapanthaceae

    Directory of Open Access Journals (Sweden)

    ARYANE C. REIS

    2016-01-01

    Full Text Available ABSTRACT Agapanthus (Agapanthaceae has 10 species described. However, most taxonomists differ respect to this number because the great phenotypic plasticity of the species. The cytogenetic has been an important tool to aid the plant taxon identification, and to date, all taxa of Agapanthus L'Héritier studied cytologically, presented 2n = 30. Although the species possess large chromosomes, the group is karyologically little explored. This work aimed to increase the cytogenetic knowledge of Agapanthus africanus (L. Hoffmanns by utilization of chromosome banding techniques with DAPI / CMA3 and Fluorescent in situ Hybridization (FISH. In addition, flow cytometry was used for determination of DNA content and the percentage of AT / GC nitrogenous bases. Plants studied showed 2n = 30 chromosomes, ranging from 4.34 - 8.55 µm, with the karyotype formulae (KF = 10m + 5sm. Through FISH, one 45S rDNA signal was observed proximally to centromere of the chromosome 7, while for 5S rDNA sites we observed one signal proximally to centromere of chromosome 9. The 2C DNA content estimated for the species was 2C = 24.4 with 59% of AT and 41% of GC. Our data allowed important upgrade for biology and cytotaxonomy of Agapanthus africanus (L. Hoffmanns.

  5. Molecular characterization of the rDNA-ITS sequence and a PCR diagnostic technique for Pileolaria terebinthi, the cause of pistachio rust

    Directory of Open Access Journals (Sweden)

    Hossein ALAEI

    2013-01-01

    Full Text Available Eleven samples of the most important pistachio rust (caused by Pileolaria terebinthi (DC. Cast.,, which causes disease on Beneh (Pistacia atlantica Desf. subsp. mutica (Fisch. & Mey. Rech. F and Kasoor (Pistacia khinjuk Stocks., were collected from herbarium specimens and pistachio fields at the Pistachio Research Institute in Rafsanjan, Iran. The complete sequences of ribosomal DNA internal transcribed spacers ITS1 and ITS2 (rDNA ITS from the samples were determined and analysed. In general, very little rDNA ITS sequence variation was observed between rDNA ITS sequences of P. terebinthi samples. The length of the PCR fragments was 621 bp (for ITS1F-ITS4 and 1177 bp (for ITS1F-rust1, and consisted of 67 bp at the 3 ́ end of 18S rDNA, 93 bp of ITS1 region, 154 bp of 5.8S rDNA, 246 bp of the ITS2 region, 57 bp (for ITS1F-ITS4 and 613 bp (for ITS1F-rust1 at the 5 ́ end of the 28S rDNA. Restriction fragment length polymorphisms (RFLPs of the rDNA-ITS region were used to identify Pileolaria terebinthi. Three strong bands of 105, 134 and 381 bp and five bands of 105, 134, 200, 301 and 437 bp are observed for the fragment of “ITS1F-ITS4” and “ITS1F-rust1”, respectively. A PCR-RFLP diagnostic technique provided effective identification of the species by a unique pattern with the specific restriction enzyme XapI (ApoI.

  6. The ITS1-5.8S rRNA gene -ITS2 sequence variability during the divergence of sweet-grass species (gen us Glyceria R. Br.

    Directory of Open Access Journals (Sweden)

    Alexander V Rodionov

    2011-12-01

    Full Text Available Comparative analysis of the sequence ITS1-5.8S rRNA gene-ITS2 of the nuclear genome of 13 species of genus Glyceria, 4 species of Melica and a species of monotypic genus Pleuropogon showed that the species of the genus Glyceria have 3 haplotypes: 1 Haplotype A was found only in species of the subgenus Glyceria section Glyceria (G. septentrionalis, G. fluitans, G. declinata, G. occidentalis, G. notata, G. borealis, G. leptostachya and in Pleuropogon sabinii; 2 Haplotype C is characteristic of the subgenus Hydropoa, section Hydropoa (G. grandis, G. х amurensis, G. triflora, G. maxima and sect. Lithuanicae (G. leptolepis; 3 Haplotype B is found in the species of the subgenus Hydropoa sections Striatae (G. elata, G. striata, G. neogaea, G. canadensis, Scolochloiformes (G. alnasteretum, G. spiculosa and G. lithuanica of sect. Lithuanicae. Species carring haplotype B are located at the base of the phylogenetic tree of the genus Glyceria and/or clustered with low bootstrap indices. On the phylogenetic trees inferred by the analysis of the sequences ITS and 5.8S rDNA both sect. Glyceria and sect. Hydropoa represented two sister monophyly branches. The species Pleuropogon sabinii belong to the branch of subgenus Glyceria as a sister monotypic branch to the branch of the sect. Glyceria.

  7. Pattern of phylogenetic diversification of the Cychrini ground beetles in the world as deduced mainly from sequence comparisons of the mitochondrial genes.

    Science.gov (United States)

    Su, Zhi-Hui; Imura, Yûki; Okamoto, Munehiro; Osawa, Syozo

    2004-02-04

    The phylogenetic position of the tribe Cychrini within the subfamily Carabinae (the family Carabidae) was estimated by comparing the nucleotide sequences of the mitochondrial NADH dehydrogenase subunit 5 (ND5) gene and the nuclear 28S ribosomal DNA (rDNA). The phylogenetic trees suggest that the Cychrini would most probably be the oldest line within the Carabinae. Phylogenetic trees were constructed by comparing the mitochondrial cytochrome C oxidase subunit I (COI) gene sequences from 33 species of the Cychrini from various localities that include the whole distribution ranges of the representative species within all the known genera in the world. The trees suggest that the Cychrini members radiated into a number of phylogenetic lineages within a short period, starting about 44 million years ago (MYA). Most of the phylogenetic lineages or sublineages are geographically linked, each consisting of a single or only a few species without scarce morphological differentiation in spite of their long evolutionary histories (silent or near-silent evolution [see Adv. Biophys. 36 (1999) 65; J. Mol. Evol. 53 (2001) 517]). The fact suggests that the geographic isolation per se did not bring about conspicuous morphological differentiation. The phylogenetic lineages of the Cychrini well correspond to the taxonomically defined genera and the subgenera.

  8. Molecular dating of caprines using ancient DNA sequences of Myotragus balearicus, an extinct endemic Balearic mammal

    Directory of Open Access Journals (Sweden)

    Alcover Josep Antoni

    2005-12-01

    Full Text Available Abstract Background Myotragus balearicus was an endemic bovid from the Balearic Islands (Western Mediterranean that became extinct around 6,000-4,000 years ago. The Myotragus evolutionary lineage became isolated in the islands most probably at the end of the Messinian crisis, when the desiccation of the Mediterranean ended, in a geological date established at 5.35 Mya. Thus, the sequences of Myotragus could be very valuable for calibrating the mammalian mitochondrial DNA clock and, in particular, the tree of the Caprinae subfamily, to which Myotragus belongs. Results We have retrieved the complete mitochondrial cytochrome b gene (1,143 base pairs, plus fragments of the mitochondrial 12S gene and the nuclear 28S rDNA multi-copy gene from a well preserved Myotragus subfossil bone. The best resolved phylogenetic trees, obtained with the cytochrome b gene, placed Myotragus in a position basal to the Ovis group. Using the calibration provided by the isolation of Balearic Islands, we calculated that the initial radiation of caprines can be dated at 6.2 ± 0.4 Mya. In addition, alpine and southern chamois, considered until recently the same species, split around 1.6 ± 0.3 Mya, indicating that the two chamois species have been separated much longer than previously thought. Conclusion Since there are almost no extant endemic mammals in Mediterranean islands, the sequence of the extinct Balearic endemic Myotragus has been crucial for allowing us to use the Messinian crisis calibration point for dating the caprines phylogenetic tree.

  9. Complete mitochondrial genome sequences from five Eimeria species (Apicomplexa; Coccidia; Eimeriidae) infecting domestic turkeys

    OpenAIRE

    Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Barta, John R

    2014-01-01

    Background Clinical and subclinical coccidiosis is cosmopolitan and inflicts significant losses to the poultry industry globally. Seven named Eimeria species are responsible for coccidiosis in turkeys: Eimeria dispersa; Eimeria meleagrimitis; Eimeria gallopavonis; Eimeria meleagridis; Eimeria adenoeides; Eimeria innocua; and, Eimeria subrotunda. Although attempts have been made to characterize these parasites molecularly at the nuclear 18S rDNA and ITS loci, the maternally-derived and mitotic...

  10. Taxonomic characterization of honey bee (Apis mellifera) pollen foraging based on non-overlapping paired-end sequencing of nuclear ribosomal loci

    Science.gov (United States)

    Cornman, Robert S.; Otto, Clint R.; Iwanowicz, Deborah; Pettis, Jeffery S

    2015-01-01

    Identifying plant taxa that honey bees (Apis mellifera) forage upon is of great apicultural interest, but traditional methods are labor intensive and may lack resolution. Here we evaluate a high-throughput genetic barcoding approach to characterize trap-collected pollen from multiple North Dakota apiaries across multiple years. We used the Illumina MiSeq platform to generate sequence scaffolds from non-overlapping 300-bp paired-end sequencing reads of the ribosomal internal transcribed spacers (ITS). Full-length sequence scaffolds represented ~530 bp of ITS sequence after adapter trimming, drawn from the 5’ of ITS1 and the 3’ of ITS2, while skipping the uninformative 5.8S region. Operational taxonomic units (OTUs) were picked from scaffolds clustered at 97% identity, searched by BLAST against the nt database, and given taxonomic assignments using the paired-read lowest common ancestor approach. Taxonomic assignments and quantitative patterns were consistent with known plant distributions, phenology, and observational reports of pollen foraging, but revealed an unexpected contribution from non-crop graminoids and wetland plants. The mean number of plant species assignments per sample was 23.0 (+/- 5.5) and the mean species diversity (effective number of equally abundant species) was 3.3 (+/- 1.2). Bray-Curtis similarities showed good agreement among samples from the same apiary and sampling date. Rarefaction plots indicated that fewer than 50,000 reads are typically needed to characterize pollen samples of this complexity. Our results show that a pre-compiled, curated reference database is not essential for genus-level assignments, but species-level assignments are hindered by database gaps, reference length variation, and probable errors in the taxonomic assignment, requiring post-hoc evaluation. Although the effective per-sample yield achieved using custom MiSeq amplicon primers was less than the machine maximum, primarily due to lower “read2” quality

  11. Taxonomic Characterization of Honey Bee (Apis mellifera Pollen Foraging Based on Non-Overlapping Paired-End Sequencing of Nuclear Ribosomal Loci.

    Directory of Open Access Journals (Sweden)

    R Scott Cornman

    Full Text Available Identifying plant taxa that honey bees (Apis mellifera forage upon is of great apicultural interest, but traditional methods are labor intensive and may lack resolution. Here we evaluate a high-throughput genetic barcoding approach to characterize trap-collected pollen from multiple North Dakota apiaries across multiple years. We used the Illumina MiSeq platform to generate sequence scaffolds from non-overlapping 300-bp paired-end sequencing reads of the ribosomal internal transcribed spacers (ITS. Full-length sequence scaffolds represented ~530 bp of ITS sequence after adapter trimming, drawn from the 5' of ITS1 and the 3' of ITS2, while skipping the uninformative 5.8S region. Operational taxonomic units (OTUs were picked from scaffolds clustered at 97% identity, searched by BLAST against the nt database, and given taxonomic assignments using the paired-read lowest common ancestor approach. Taxonomic assignments and quantitative patterns were consistent with known plant distributions, phenology, and observational reports of pollen foraging, but revealed an unexpected contribution from non-crop graminoids and wetland plants. The mean number of plant species assignments per sample was 23.0 (+/- 5.5 and the mean species diversity (effective number of equally abundant species was 3.3 (+/- 1.2. Bray-Curtis similarities showed good agreement among samples from the same apiary and sampling date. Rarefaction plots indicated that fewer than 50,000 reads are typically needed to characterize pollen samples of this complexity. Our results show that a pre-compiled, curated reference database is not essential for genus-level assignments, but species-level assignments are hindered by database gaps, reference length variation, and probable errors in the taxonomic assignment, requiring post-hoc evaluation. Although the effective per-sample yield achieved using custom MiSeq amplicon primers was less than the machine maximum, primarily due to lower "read2

  12. Taxonomic Characterization of Honey Bee (Apis mellifera) Pollen Foraging Based on Non-Overlapping Paired-End Sequencing of Nuclear Ribosomal Loci.

    Science.gov (United States)

    Cornman, R Scott; Otto, Clint R V; Iwanowicz, Deborah; Pettis, Jeffery S

    2015-01-01

    Identifying plant taxa that honey bees (Apis mellifera) forage upon is of great apicultural interest, but traditional methods are labor intensive and may lack resolution. Here we evaluate a high-throughput genetic barcoding approach to characterize trap-collected pollen from multiple North Dakota apiaries across multiple years. We used the Illumina MiSeq platform to generate sequence scaffolds from non-overlapping 300-bp paired-end sequencing reads of the ribosomal internal transcribed spacers (ITS). Full-length sequence scaffolds represented ~530 bp of ITS sequence after adapter trimming, drawn from the 5' of ITS1 and the 3' of ITS2, while skipping the uninformative 5.8S region. Operational taxonomic units (OTUs) were picked from scaffolds clustered at 97% identity, searched by BLAST against the nt database, and given taxonomic assignments using the paired-read lowest common ancestor approach. Taxonomic assignments and quantitative patterns were consistent with known plant distributions, phenology, and observational reports of pollen foraging, but revealed an unexpected contribution from non-crop graminoids and wetland plants. The mean number of plant species assignments per sample was 23.0 (+/- 5.5) and the mean species diversity (effective number of equally abundant species) was 3.3 (+/- 1.2). Bray-Curtis similarities showed good agreement among samples from the same apiary and sampling date. Rarefaction plots indicated that fewer than 50,000 reads are typically needed to characterize pollen samples of this complexity. Our results show that a pre-compiled, curated reference database is not essential for genus-level assignments, but species-level assignments are hindered by database gaps, reference length variation, and probable errors in the taxonomic assignment, requiring post-hoc evaluation. Although the effective per-sample yield achieved using custom MiSeq amplicon primers was less than the machine maximum, primarily due to lower "read2" quality, further

  13. Physical mapping of the 5S and 18S rDNA in ten species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae): evolutionary tendencies in the genus.

    Science.gov (United States)

    Bueno, Vanessa; Venere, Paulo César; Thums Konerat, Jocicléia; Zawadzki, Cláudio Henrique; Vicari, Marcelo Ricardo; Margarido, Vladimir Pavan

    2014-01-01

    Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH) with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  14. Physical Mapping of the 5S and 18S rDNA in Ten Species of Hypostomus Lacépède 1803 (Siluriformes: Loricariidae: Evolutionary Tendencies in the Genus

    Directory of Open Access Journals (Sweden)

    Vanessa Bueno

    2014-01-01

    Full Text Available Hypostomus is a diverse group with unclear aspects regarding its biology, including the mechanisms that led to chromosome diversification within the group. Fluorescence in situ hybridization (FISH with 5S and 18S rDNA probes was performed on ten Hypostomini species. Hypostomus faveolus, H. cochliodon, H. albopunctatus, H. aff. paulinus, and H. topavae had only one chromosome pair with 18S rDNA sites, while H. ancistroides, H. commersoni, H. hermanni, H. regani, and H. strigaticeps had multiple 18S rDNA sites. Regarding the 5S rDNA genes, H. ancistroides, H. regani, H. albopunctatus, H. aff. paulinus, and H. topavae had 5S rDNA sites on only one chromosome pair and H. faveolus, H. cochliodon, H. commersoni, H. hermanni, and H. strigaticeps had multiple 5S rDNA sites. Most species had 18S rDNA sites in the telomeric region of the chromosomes. All species but H. cochliodon had 5S rDNA in the centromeric/pericentromeric region of one metacentric pair. Obtained results are discussed based on existent phylogenies for the genus, with comments on possible dispersion mechanisms to justify the variability of the rDNA sites in Hypostomus.

  15. The use of 16s rDNA methods in soil microbial ecology Uso de métodos 16S rDNA em ecologia microbiana do solo

    Directory of Open Access Journals (Sweden)

    Andrew Macrae

    2000-06-01

    Full Text Available New and exciting molecular methods, many using the 16S small sub-unit ribosomal nucleic acid molecule, are opening the microbial "black box" in soil. These studies have added much to our knowledge of microbial diversity in soils, and are beginning to advance our understanding of the relationship between this diversity and its function in soil processes. Over the next few years, the knowledge gained from molecular studies will, we hope, lead to improvements in sustainable land management and sustainable exploitation of soil genetic resources. As we enter the third millenium, it is appropriate to review the application of 16S rDNA methods to soil microbiology. This review examines 16S ribosomal DNA (rDNA methods and their application to soil. It mentions their limits and suggests how they may be applied in the future.Novas e excitantes técnicas moleculares muitas usando a fração 16S da subunidade menor da molécula de ácido nucleico ribossomal, estão abrindo a "caixa-preta" da microbiologia do solo. Esses estudos têm acrescentado muito ao nosso conhecimento acerca da diversidade microbiana no solo, e começam a avançar nosso entendimento sobre a relação entre essa diversidade a sua função nos processos no solo. Ao longo dos próximos anos, o conhecimento obtido a partir de técnicas moleculares irão, esperamos, levar a melhoramentos do manejo de áreas sustentáveis da exploração dos recursos genéticos do solo. Com a chegada do terceiro milênio, é apropriado revermos a aplicação das técnicas da fração 16S do rDNA em microbiologia de solo. Esta revisão examina aplicações das técnicas da fração 16S do DNA (RNA no solo, menciona seus limites e sugere como elas poderão ser usadas no futuro.

  16. Developmentally Regulated Ribosomal rDNA Genes in Plasmodium vivax: Biological Implications and Practical Applications

    Science.gov (United States)

    1994-08-10

    technological advances, especially DNA polymerase chain reaction (peR), molecular cloning and rapid nuc1eotide sequencing. These advances have allowed...containing 0.15% saponin and set on ice for 2· minutes. After washing and centrifugation twice, as described above, the pellets were dissolved in...incubated at 370C for 60 minutes. DNA was further processed by standard procedures [Maniatis et al., 1982]. Briefly, the lysed sample was extracted

  17. Multilocus Sequence Analysis of Cercospora spp. from Different Host Plant Families

    Directory of Open Access Journals (Sweden)

    Floreta Fiska Yuliarni

    2014-06-01

    Full Text Available Identification of the genus Cercospora is still complicated due to the host preferences often being used as the main criteria to propose a new name. We determined the relationship between host plants and multilocus sequence variations (ITS rDNA including 5.8S rDNA, elongation factor 1-α, and calmodulin in Cercospora spp. to investigate the host specificity. We used 53 strains of Cercospora spp. infecting 12 plant families for phylogenetic analysis. The sequences of 23 strains of Cercospora spp. infecting the plant families of Asteraceae, Cucurbitaceae, and Solanaceae were determined in this study. The sequences of 30 strains of Cercospora spp. infecting the plant families of Fabaceae, Amaranthaceae, Apiaceae, Plumbaginaceae, Malvaceae, Cistaceae, Plantaginaceae, Lamiaceae, and Poaceae were obtained from GenBank. The molecular phylogenetic analysis revealed that the majority of Cercospora species lack host specificity, and only C. zinniicola, C. zeina, C. zeae-maydis, C. cocciniae, and C. mikaniicola were found to be host-specific. Closely related species of Cercospora could not be distinguished using molecular analyses of ITS, EF, and CAL gene regions. The topology of the phylogenetic tree based on the CAL gene showed a better topology and Cercospora species separation than the trees developed based on the ITS rDNA region or the EF gene.

  18. Chromosomal localization of two novel repetitive sequences isolated from the Chenopodium quinoa Willd. genome.

    Science.gov (United States)

    Kolano, B; Gardunia, B W; Michalska, M; Bonifacio, A; Fairbanks, D; Maughan, P J; Coleman, C E; Stevens, M R; Jellen, E N; Maluszynska, J

    2011-09-01

    The chromosomal organization of two novel repetitive DNA sequences isolated from the Chenopodium quinoa Willd. genome was analyzed across the genomes of selected Chenopodium species. Fluorescence in situ hybridization (FISH) analysis with the repetitive DNA clone 18-24J in the closely related allotetraploids C. quinoa and Chenopodium berlandieri Moq. (2n = 4x = 36) evidenced hybridization signals that were mainly present on 18 chromosomes; however, in the allohexaploid Chenopodium album L. (2n = 6x = 54), cross-hybridization was observed on all of the chromosomes. In situ hybridization with rRNA gene probes indicated that during the evolution of polyploidy, the chenopods lost some of their rDNA loci. Reprobing with rDNA indicated that in the subgenome labeled with 18-24J, one 35S rRNA locus and at least half of the 5S rDNA loci were present. A second analyzed sequence, 12-13P, localized exclusively in pericentromeric regions of each chromosome of C. quinoa and related species. The intensity of the FISH signals differed considerably among chromosomes. The pattern observed on C. quinoa chromosomes after FISH with 12-13P was very similar to GISH results, suggesting that the 12-13P sequence constitutes a major part of the repetitive DNA of C. quinoa.

  19. Introducing W.A.T.E.R.S.: a workflow for the alignment, taxonomy, and ecology of ribosomal sequences.

    Science.gov (United States)

    Hartman, Amber L; Riddle, Sean; McPhillips, Timothy; Ludäscher, Bertram; Eisen, Jonathan A

    2010-06-12

    For more than two decades microbiologists have used a highly conserved microbial gene as a phylogenetic marker for bacteria and archaea. The small-subunit ribosomal RNA gene, also known as 16 S rRNA, is encoded by ribosomal DNA, 16 S rDNA, and has provided a powerful comparative tool to microbial ecologists. Over time, the microbial ecology field has matured from small-scale studies in a select number of environments to massive collections of sequence data that are paired with dozens of corresponding collection variables. As the complexity of data and tool sets have grown, the need for flexible automation and maintenance of the core processes of 16 S rDNA sequence analysis has increased correspondingly. We present WATERS, an integrated approach for 16 S rDNA analysis that bundles a suite of publicly available 16 S rDNA analysis software tools into a single software package. The "toolkit" includes sequence alignment, chimera removal, OTU determination, taxonomy assignment, phylogentic tree construction as well as a host of ecological analysis and visualization tools. WATERS employs a flexible, collection-oriented 'workflow' approach using the open-source Kepler system as a platform. By packaging available software tools into a single automated workflow, WATERS simplifies 16 S rDNA analyses, especially for those without specialized bioinformatics, programming expertise. In addition, WATERS, like some of the newer comprehensive rRNA analysis tools, allows researchers to minimize the time dedicated to carrying out tedious informatics steps and to focus their attention instead on the biological interpretation of the results. One advantage of WATERS over other comprehensive tools is that the use of the Kepler workflow system facilitates result interpretation and reproducibility via a data provenance sub-system. Furthermore, new "actors" can be added to the workflow as desired and we see WATERS as an initial seed for a sizeable and growing repository of interoperable

  20. Testing mitochondrial sequences and anonymous nuclear markers for phylogeny reconstruction in a rapidly radiating group: molecular systematics of the Delphininae (Cetacea: Odontoceti: Delphinidae

    Directory of Open Access Journals (Sweden)

    Kingston Sarah E

    2009-10-01

    Full Text Available Abstract Background Many molecular phylogenetic analyses rely on DNA sequence data obtained from single or multiple loci, particularly mitochondrial DNA loci. However, phylogenies for taxa that have undergone recent, rapid radiation events often remain unresolved. Alternative methodologies for discerning evolutionary relationships under these conditions are desirable. The dolphin subfamily Delphininae is a group that has likely resulted from a recent and rapid radiation. Despite several efforts, the evolutionary relationships among the species in the subfamily remain unclear. Results Here, we compare a phylogeny estimated using mitochondrial DNA (mtDNA control region sequences to a multi-locus phylogeny inferred from 418 polymorphic genomic markers obtained from amplified fragment length polymorphism (AFLP analysis. The two sets of phylogenies are largely incongruent, primarily because the mtDNA tree provides very poor resolving power; very few species' nodes in the tree are supported by bootstrap resampling. The AFLP phylogeny is considerably better resolved and more congruent with relationships inferred from morphological data. Both phylogenies support paraphyly for the genera Stenella and Tursiops. The AFLP data indicate a close relationship between the two spotted dolphin species and recent ancestry between Stenella clymene and S. longirostris. The placement of the Lagenodelphis hosei lineage is ambiguous: phenetic analysis of the AFLP data is consistent with morphological expectations but the phylogenetic analysis is not. Conclusion For closely related, recently diverged taxa, a multi-locus genome-wide survey is likely the most comprehensive approach currently available for phylogenetic inference.

  1. Single-strand conformation polymorphism (SSCP)-based mutation scanning approaches to fingerprint sequence variation in ribosomal DNA of ascaridoid nematodes.

    Science.gov (United States)

    Zhu, X Q; Gasser, R B

    1998-06-01

    In this study, we assessed single-strand conformation polymorphism (SSCP)-based approaches for their capacity to fingerprint sequence variation in ribosomal DNA (rDNA) of ascaridoid nematodes of veterinary and/or human health significance. The second internal transcribed spacer region (ITS-2) of rDNA was utilised as the target region because it is known to provide species-specific markers for this group of parasites. ITS-2 was amplified by PCR from genomic DNA derived from individual parasites and subjected to analysis. Direct SSCP analysis of amplicons from seven taxa (Toxocara vitulorum, Toxocara cati, Toxocara canis, Toxascaris leonina, Baylisascaris procyonis, Ascaris suum and Parascaris equorum) showed that the single-strand (ss) ITS-2 patterns produced allowed their unequivocal identification to species. While no variation in SSCP patterns was detected in the ITS-2 within four species for which multiple samples were available, the method allowed the direct display of four distinct sequence types of ITS-2 among individual worms of T. cati. Comparison of SSCP/sequencing with the methods of dideoxy fingerprinting (ddF) and restriction endonuclease fingerprinting (REF) revealed that also ddF allowed the definition of the four sequence types, whereas REF displayed three of four. The findings indicate the usefulness of the SSCP-based approaches for the identification of ascaridoid nematodes to species, the direct display of sequence variation in rDNA and the detection of population variation. The ability to fingerprint microheterogeneity in ITS-2 rDNA using such approaches also has implications for studying fundamental aspects relating to mutational change in rDNA.

  2. Comparative physical mapping of 18S rDNA in the karyotypes of six leafcutter ant species of the genera Atta and Acromyrmex (Formicidae: Myrmicinae).

    Science.gov (United States)

    Teixeira, Gisele Amaro; Barros, Luísa Antônia Campos; de Aguiar, Hilton Jeferson Alves Cardoso; das Graças Pompolo, Silvia

    2017-10-01

    Leafcutter ants of the Atta and Acromyrmex genera are important plagues in different cultures. Cytogenetic data on chromosome number, morphology, and chromosomal banding pattern are only available for 17 species of leafcutter ants. Molecular cytogenetic data for the detection of ribosomal genes by the FISH technique are scarce, and only 15 Neotropical ant species have been studied. This study aimed to physically map the 18S ribosomal RNA genes (rDNA) of six leafcutter ants belonging to the genera Atta and Acromyrmex using FISH. The results were compared with data on the fluorochrome CMA 3 currently available for these species. All analyzed species presented the 18S rDNA on one pair of chromosomes. In Acromyrmex subterraneus molestans and Ac. aspersus, FISH signals were observed in the terminal region of the short arm of the largest subtelocentric pair, while in Atta bisphaerica, A. laevigata, and A. sexdens, FISH signals were observed in the interstitial region of the long arm of the fourth metacentric pair. In Acromyrmex striatus, 18S rDNA was located in the interstitial region of the second metacentric pair. The karyotypic formula for Ac. aspersus was 2n = 38 (8m + 10sm + 16st + 4a), representing the first report in this species. The observed 18S rDNA regions in A. laevigata, A. sexdens, A. bisphaerica, Ac. aspersus, and Ac. subterraneus molestans corresponded to the CMA 3 + bands, while in Ac. striatus, several GC-rich bands and one pair of 18S rDNA bands were observed. No differential bands were visible using the DAPI fluorochrome. Karyotype uniformity with previously studied Atta spp. was also observed at the level of molecular cytogenetics using 18S rDNA FISH. A difference in the size of the chromosomal pair carrying the 18S rDNA gene was observed in Ac. striatus (2n = 22) and Atta spp. (2n = 22) highlighting the dissimilarity between these species. The results from the present study contribute to the description of 18S rDNA clusters

  3. A continental-wide perspective: the genepool of nuclear encoded ribosomal DNA and single-copy gene sequences in North American Boechera (Brassicaceae.

    Directory of Open Access Journals (Sweden)

    Christiane Kiefer

    Full Text Available 74 of the currently accepted 111 taxa of the North American genus Boechera (Brassicaceae were subject to pyhlogenetic reconstruction and network analysis. The dataset comprised 911 accessions for which ITS sequences were analyzed. Phylogenetic analyses yielded largely unresolved trees. Together with the network analysis confirming this result this can be interpreted as an indication for multiple, independent, and rapid diversification events. Network analyses were superimposed with datasets describing i geographical distribution, ii taxonomy, iii reproductive mode, and iv distribution history based on phylogeographic evidence. Our results provide first direct evidence for enormous reticulate evolution in the entire genus and give further insights into the evolutionary history of this complex genus on a continental scale. In addition two novel single-copy gene markers, orthologues of the Arabidopsis thaliana genes At2g25920 and At3g18900, were analyzed for subsets of taxa and confirmed the findings obtained through the ITS data.

  4. Phylogenetic Analysis of a ‘Jewel Orchid’ Genus Goodyera (Orchidaceae) Based on DNA Sequence Data from Nuclear and Plastid Regions

    Science.gov (United States)

    Hu, Chao; Tian, Huaizhen; Li, Hongqing; Hu, Aiqun; Xing, Fuwu; Bhattacharjee, Avishek; Hsu, Tianchuan; Kumar, Pankaj; Chung, Shihwen

    2016-01-01

    A molecular phylogeny of Asiatic species of Goodyera (Orchidaceae, Cranichideae, Goodyerinae) based on the nuclear ribosomal internal transcribed spacer (ITS) region and two chloroplast loci (matK and trnL-F) was presented. Thirty-five species represented by 132 samples of Goodyera were analyzed, along with other 27 genera/48 species, using Pterostylis longifolia and Chloraea gaudichaudii as outgroups. Bayesian inference, maximum parsimony and maximum likelihood methods were used to reveal the intrageneric relationships of Goodyera and its intergeneric relationships to related genera. The results indicate that: 1) Goodyera is not monophyletic; 2) Goodyera could be divided into four sections, viz., Goodyera, Otosepalum, Reticulum and a new section; 3) sect. Reticulum can be further divided into two subsections, viz., Reticulum and Foliosum, whereas sect. Goodyera can in turn be divided into subsections Goodyera and a new subsection. PMID:26927946

  5. A molecular phylogenetic and fruit evolutionary analysis of the major groups of the paleotropical woody bamboos (Gramineae: Bambusoideae) based on nuclear ITS, GBSSI gene and plastid trnL-F DNA sequences.

    Science.gov (United States)

    Yang, Han-Qi; Yang, Jun-Bo; Peng, Zhen-Hua; Gao, Jian; Yang, Yu-Ming; Peng, Sheng; Li, De-Zhu

    2008-09-01

    This study presented the first molecular phylogenetic analysis of the major clades of woody bamboos of the Old World tropics based on nuclear and chloroplast sequences (ITS, GBSSI and trnL-F). Sequence data from 53 species, representing 17 paleotropical woody bamboo genera, were analyzed using the maximum parsimony and Bayesian inference methods. All examined ingroup taxa were clustered into two clades, i.e., the Bambusinae+Dinochloa clade and the Melocanninae clade. The former clade included Bambusa, Bonia, Dendrocalamus, Dendrocalamopsis, Dinochloa, Gigantochloa, Molecalamus, Neomicrocalamus, Neosinocalamus, Oxytenanthera s. str. (sensu stricto), Racemobambos and Thyrsostachys. The Melocanninae clade consisted of Cephalostachyum, Leptocanna (better treated as part of Cephalostachyum), Melocanna, Pseudostachyum and Schizostachyum s. str. The subtribe Racemobambosinae and tribes Dendrocalameae and Oxytenanthereae were not supported and may be better placed in subtribe Bambusinae. The ovary characters seemed to be good criteria to distinguish these two clades. The reconstruction of ancestral fruit characters indicated that the bacoid caryopsis, namely, fleshy or berry-like fruits, was found to be scattered in three lineages of the examined paleotropical woody bamboos. Fruit characters are thus not reliable indicators of phylogeny and bacoid caryopsis likely represents a specialization for particular ecological conditions.

  6. Raptor, a positive regulatory subunit of mTOR complex 1, is a novel phosphoprotein of the rDNA transcription machinery in nucleoli and chromosomal nucleolus organizer regions (NORs).